Response of UBR-box E3 ubiquitin ligases and protein quality control pathways to perturbations in protein synthesis and skeletal muscle size

17 The N-degron pathway contributes to proteolysis by targeting N-terminal residues of 18 destabilized proteins via E3 ligases that contain a UBR-box domain. Emerging evidence 19 suggests the UBR-box family of E3 ubiquitin ligases (UBR1-7) are involved in the 20 positive regulation of skeletal muscle mass. The purpose of this study was to explore 21 the role of UBR-box E3 ubiquitin ligases under enhanced protein synthesis and skeletal 22 muscle growth conditions. Cohorts of adult male mice were electroporated with 23 constitutively active Akt (Akt-CA) or UBR5 RNAi constructs with a rapamycin diet 24 intervention for 7 and 30 days, respectively. In addition, the UBR-box family was 25 studied during the regrowth phase post nerve crush induced inactivity. Skeletal muscle 26 growth with Akt-CA or regrowth following inactivity increased protein abundance of 27 UBR1, UBR2, UBR4, UBR5 and UBR7. This occurred with corresponding increases in 28 Akt-mTORC1/S6K and MAPK/p90RSK signaling and protein synthesis. The increases 29 in UBR-box E3s, ubiquitination, and proteasomal activity occurred independently of 30 mTORC1 activity and were associated with increases in markers related to autophagy, 31 ER-stress, and protein quality control pathways. Finally, while UBR5 knockdown (KD) 32 evokes atrophy, it occurs together with hyperactivation of mTORC1 and protein 33 synthesis. In UBR5 KD muscles, we identified an increase in protein abundance for 34 UBR2, UBR4 and UBR7, which may highlight a compensatory response to maintain 35 proteome integrity. Future studies will seek to understand the role of UBR-box E3s 36 towards protein quality control in skeletal muscle plasticity. 37 38 Key Words: hypertrophy, UBR5, proteasome system, N-degron pathway 39 Running head: UBR-box E3 ligases and skeletal muscle size 40 New and Noteworthy : Novel UBR-box E3 ubiquitin ligases are responsive to 41 heightened protein synthesis and alterations in skeletal muscle mass and fiber size, in 42 order to maintain proteome integrity. 43 .CC-BY-NC-ND 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted July 27, 2025. ; https://doi.org/10.1101/2025.07.23.666188doi: bioRxiv preprint 3

44 Skeletal muscle is a highly adaptable tissue that can respond to various stimuli (e.g., 45 inactivity, disease, and exercise) and has the ability to increase (i.e. hypertrophy) or 46 decrease (i.e. atrophy) in size when required (1-3). The regulation of skeletal muscle 47 mass is orchestrated by the activity of key signaling pathways that control protein 48 breakdown and synthesis within myofibers (2). Early seminal work highlighted the 49 critical role for the Akt-mTORC1-p70S6K1 signaling pathway in skeletal muscle mass 50 regulation (4, 5). Since this discovery, our understanding of growth signals in skeletal 51 muscle has evolved towards mTORC1-dependent and mTORC1-independent 52 mechanisms, along with other processes that may contribute to hypertrophy, such as 53 ribosome biogenesis (6-13). Genetic models, such as transgenic constitutively active 54 Akt (Akt-CA) and TSC1 knockout mice, have expanded our knowledge of the mTORC1 55 signaling pathway and the regulation of muscle mass (14-19). Indeed, the transgenic 56 Akt mice display a phenotype of increased skeletal muscle fiber size and protein 57 synthesis, while electroporation-mediated transfection of an Akt-CA construct elicits 58 similar effects on skeletal muscle growth (4, 19, 20). Previously published evidence 59 from the TSC1 knockout mouse has observed mTORC1 to be an inhibitor of autophagy 60 and regulate the ubiquitin proteasome system (UPS) (19, 21). The regulation of the 61 UPS by mTORC1 directly remains to be determined as the UPS may be active in 62 response to mTORC1-mediated activation of translation, where the UPS is needed to 63 maintaining proteome integrity. However, given that the characterization of the UPS has 64 predominantly centered on atrophy models, and only a handful of E3 ubiquitin ligases 65 have been studied to date (e.g. MuRF1, MAFbx, and MUSA1) (22-24), very little is 66 known about the UPS in skeletal muscle remodeling and growth. Thus, our 67 understanding of the UPS, and other protein quality control systems (e.g. unfolded 68 protein response, autophagy), could be expanded by characterizing new targets or 69 exploring different contexts and scenarios where these systems are influential in tissue 70 health, such as skeletal muscle growth and remodeling. 71 The UBR-box family of E3 ubiquitin ligases, which consists of HECT, RING and 72 F-box E3 ubiquitin ligases named UBR1 through UBR7, encompasses part of the 73 ubiquitin proteasome system, and their action on protein substrate recognition forms the 74 .CC-BY-NC-ND 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted July 27, 2025. ; https://doi.org/10.1101/2025.07.23.666188doi: bioRxiv preprint 4 N-degron pathway (25, 26). The N-degron pathway (also known as the N-end rule 75 pathway) identifies degradation signals on destabilized proteins through the presence of 76 ubiquitin and acetyl motifs (25, 27). As part of the N-degron pathway, the UBR-box 77 family of E3 ubiquitin ligases identify unacetylated protein substrates for ubiquitination 78 via the UBR-box domain.(25, 27-29). Studies have highlighted that UBR-box E3s play 79 diverse roles in a range of cellular processes, with protein quality control and protein 80 clearance typically being referenced (30-33). However, very little is known about this 81 family of E3 ubiquitin ligases in skeletal muscle. In an early study from the Goldberg lab 82 (34), various inhibitors targeting E3 α (also known as UBR1) showed an ~60% 83 contribution of this proteolytic pathway to the turnover of endogenous proteins in 84 mammalian skeletal muscle. More recently, studies have identified UBR4, UBR5 and 85 UBR7 to be responsive to exercise stimuli (35-38) and UBR2 for being important in the 86 development of cancer cachexia (39, 40). Our previous studies have identified a 87 potential role for UBR5 in skeletal muscle growth and recovery following disuse (41). 88 Further, UBR5 knockdown in mouse skeletal muscle perturbed Akt-mTORC1-p70S6K1 89 and MAPK/p90RSK signaling pathways, that coincided with a loss of skeletal muscle 90 mass and fiber cross-sectional area (CSA) (42). Thus, it has been observed that UBR-91 box E3 ubiquitin ligases may be important for skeletal muscle health and the regulation 92 of skeletal muscle mass (30, 36, 37, 41-43). 93 Therefore, we sought to investigate if UBR-box E3 ubiquitin ligases and protein 94 quality control systems are responsive to genetic manipulation of Akt-mTORC1 95 signaling and the associated increase in protein synthesis and skeletal muscle size. In 96 addition, we wanted to ascertain if these effects were dependent on mTORC1 activity. 97 Lastly, given our previous observations of UBR5 in models of skeletal muscle regrowth 98 following a period of atrophy (41), we hypothesized that UBR1, UBR2, UBR4 and UBR7 99 might display a similar temporal profile to UBR5 during the regrowth phase of the nerve 100 crush injury model. 101 102

103 Study approval for animal experiments 104 .CC-BY-NC-ND 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted July 27, 2025. ; https://doi.org/10.1101/2025.07.23.666188doi: bioRxiv preprint 5 The mice used in these studies were males from the C57BL/6 strain obtained from 105 Charles River laboratories at 5-6 months of age and used for experiments within 2 106 weeks of their arrival. Animals were housed in ventilated cages maintained in a room at 107 21 °C with 12-h light/ dark cycles and had ad libitum access to standard chow (LabDiet 108 PicoLab® 5053) and water throughout the study. All animal procedures were approved 109 by the Institutional Animal Care and Use Committee at the Oklahoma Medical Research 110 Foundation. 111 Rapamycin Diet Intervention 112 Male C57BL/6 mice received either a control diet (PicoLab® 5053 (LabDiet®) containing 113 Eudragit) or a diet containing 42 /i2 mg/kg chow active encapsulated rapamycin (Rapa; 114 Rapamycin Holdings, Inc., San Antonio, TX) which was provided ad libitum. The 115 Eudragit in the chow serves as a true experimental control, given that the rapamycin is 116 encapsulated by this material in order to provide effective release of the drug. For the 117 Akt overexpression experiments, age-matched cohorts of mice were randomized into 118 control or rapamycin diet interventions for 7 days prior to the electroporation procedure 119 and remained on the respective diet until completion (total time equaled 14 days). For 120 the UBR5 knockdown experiments, age-matched cohorts of mice were electroporated 121 and randomized into control or rapamycin diet interventions and remained on the diets 122 for a total of 30 days. The rapamycin dose implemented has been reported to inhibit 123 mTORC1 activity (44-46) and we confirmed mTORC1 inhibition by assessing p70S6K1 124 and rpS6 phosphorylation as downstream markers for mTORC1 activity. Body weight 125 was assessed throughout the dietary interventions, and no difference was observed 126 between control and rapamycin-treated mice over the 14 to 30 days intervention (data 127 not shown). 128 Akt and UBR5 Plasmid Constructs 129 For the Akt experiments, the open reading frame of mouse Akt1 (Akt-WT) was cloned 130 and ligated into the pCMV5 expression plasmid and fused with a hemagglutinin (HA) tag 131 at the carboxyl-terminus . To create the constitutively active (Akt-CA) construct, a 132 consensus myristylation sequence (MGSSKSKPKSR) was fused to the amino terminus 133 of HA-tagged, wild-type mouse Akt1 in the pCMV5 expression plasmid. For RNAi 134 .CC-BY-NC-ND 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted July 27, 2025. ; https://doi.org/10.1101/2025.07.23.666188doi: bioRxiv preprint 6 experiments, the negative control RNAi plasmid was described previously (41, 47) and 135 encodes emerald green fluorescent protein (EmGFP) and a non ‐ targeting pre ‐ miRNA 136 under bicistronic control of the cytomegalovirus (CMV) promoter in the 137 pcDNA6.2GW/EmGFP‐ miR plasmid (Invitrogen, Carlsbad, CA). The UBR5 RNAi 138 plasmid encodes EmGFP and an artificial pre ‐ miRNA targeting the full-length gene of 139 mouse UBR5 under bicistronic control of the CMV promoter; it was generated by 140 ligating the Mmi571982 oligonucleotide duplex (Invitrogen, Carlsbad, CA) into the 141 pcDNA6.2GW/EmGFP‐ miR plasmid. The successful knockdown of UBR5 mRNA 142 expression and protein levels in mouse skeletal muscle was previously screened and 143 confirmed at approximately 50-60% (41, 42). 144 145 In vivo electroporation 146 Transfection of mouse skeletal muscle with plasmid DNA was performed in mice under 147 isoflurane (2-4% inhalation) anesthesia as previously described (48-50). Briefly, after a 148 2h pre-treatment with 0.4 units/µl of bovine placental hyaluronidase (Sigma) 149 resuspended in sterile 0.9% saline, 20µg of plasmid DNA was injected into the tibialis 150 anterior (TA) muscle. The hind limbs were placed between two-paddle electrodes and 151 subjected to 10 pulses (20 msec) of 175 V/cm using an ECM-830 electroporator (BTX 152 Harvard Apparatus, Holliston, MA). For Akt overexpression studies, an additional 2 µg 153 of emerald-GFP plasmid was electroporated for identification of GFP positive fibers. 154 Following transfection, mice were returned to their cages to resume normal activities 155 until tissue collection. 156 Nerve Crush Injury Model 157 Gastrocnemius complex (GSTC) muscle samples from our previously published study 158 (41) were reanalyzed for protein abundance of UBR-box E3 ubiquitin ligases (UBR1, 159 UBR2, UBR4, UBR5 and UBR7) via immunoblotting. Targeted nerve crush in the lower 160 limb muscles of the right leg was accomplished via acute 10 s crushing of the sciatic 161 nerve in the midthigh region of mice using forceps. The procedure was performed under 162 isoflurane anesthesia (3% inhalation) using aseptic surgical techniques. Male mice 163 (C57BL/6; 12 weeks old) purchased from Charles River Laboratories (Wilmington, MA) 164 .CC-BY-NC-ND 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted July 27, 2025. ; https://doi.org/10.1101/2025.07.23.666188doi: bioRxiv preprint 7 were given an analgesic (buprenorphine, 0.1 mg kg –1) immediately, as well as for 48 h 165 following surgery, and returned to their cage following recovery. Following completion of 166 the appropriate time point (n=6/group), mice were anesthetized with 3% isoflurane, and 167 the gastrocnemius complex (GSTC) muscles were excised, weighed, frozen in liquid 168 nitrogen and stored at −80°C for later analysis. Prior to tissue collection, a sciatic nerve 169 test was applied via a single electrical pulse to the sciatic nerve through electrodes to 170 observe a twitch response in the hindlimb muscles. Between 21 and 60 days, all 171 animals displayed a twitch, suggesting that neural activity to the hindlimb muscles had 172 returned at these time points. A separate untreated cohort of animals (n = 4/group) was 173 used as the relevant control. We assessed UBR-box E3 ubiquitin ligase protein 174 abundance at time points 21-, 28-, 45-, and 60-days post nerve crush injury which 175 coincided with reinnervation and reflective of skeletal muscle regrowth following a 176 period of inactivity. 177 Tissue Collection 178 Following completion of the appropriate time period following the electroporation 179 procedure (i.e. 7 or 30 days), mice were anesthetized with isoflurane, the TA muscles 180 were excised, weighed, frozen in liquid nitrogen, and stored at −80°C for later analysis. 181 A subset of muscles was collected for histology and processed as described below. On 182 completion of tissue removal, mice were euthanized by exsanguination. 183 Histology 184 Harvested muscles were immediately fixed in 4% (w/v) paraformaldehyde for 16h at 185 4°C. Following a sucrose gradient incubation period (10%, 20%, and 30% for 2-3 hours 186 each), the TA muscles were embedded in Tissue Freezing Medium (Triangle 187 Biomedical Sciences), and a Thermo HM525 cryostat was used to prepare 10-μ m serial 188 sections from the muscle midbelly. All sections were examined and photographed using 189 a Nikon Eclipse Ti automated inverted microscope equipped with NIS-Elements BR 190 digital imaging software at 10x and 20x magnification for laminin and Hematoxylin & 191 Eosin Stain respectively. 192 Laminin Stain: TA muscle sections were permeabilized in PBS with 1% triton for 10 min 193 at room temperature. After washing with PBS, sections were blocked with 5% goat 194 .CC-BY-NC-ND 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted July 27, 2025. ; https://doi.org/10.1101/2025.07.23.666188doi: bioRxiv preprint 8 serum for 15 min at room temperature. Sections were incubated with Anti-Laminin 195 (1:500, Sigma Aldrich, Cat no. L9393) in 5% goat serum for 2 h at room temperature, 196 followed by two 5-min washes with PBS. Goat-anti-rabbit AlexaFluor® 555 secondary 197 (1:333, Invitrogen Cat no. A28180) in 5% goat serum was then added for 1 h at room 198 temperature. Slides were cover slipped using ProLong Gold Antifade reagent (Life 199 Technologies). Image analysis was performed using Myovision software (51, 52). 200 Skeletal muscle fiber size was analyzed by measuring ≥ 400 transfected muscle fibers 201 per muscle (GFP-positive), per animal (10x magnification). In some muscles the 202 transfection frequency was so high that there were few GFP-negative fibers within the 203 same region as the GFP-positive fibers, as has been observed previously (42, 48, 49). 204 Therefore, for Akt-CA overexpression and UBR5 knockdown (RNAi) studies, fiber size 205 comparisons were made between the GFP-positive fibers in the EV controls and Akt-CA 206 or UBR5 RNAi transected muscles with and without the rapamycin diet. 207 Hematoxylin & Eosin Stain : A standard H&E protocol was performed (adapted from 208 Parlee et al. (53)). Briefly, TA muscle sections at room temperature were incubated in 209 deionized H2O for 2 min on a rocker at 30 rpm (Labnet International Inc). Next, slides 210 were incubated with Mayer’s hematoxylin solution (EMS SKU: 26043-05) for 10 min to 211 stain the nuclei, rinsed in running H 2O until clear, dipped 3 times in blue solution, and 212 rinsed under running H2O for 2 min. This was followed by incubation in 80% ethanol for 213 2 min. TA sections were stained with 0.1% Eosin (Sigma E4382-25G) solution for 10 s, 214 followed by sequential immersion in graded ethanol concentrations for 2 min each (1 x 215 80%, 2 x 95%, 2 x 100%). Slides were then incubated in xylene solution (three times, 3 216 min each). A coverslip was applied using Permount™ media (Thermo Fisher Scientific, 217 Waltham, MA). Slides were placed horizontally at room temperature to air dry for at 218 least 24 hours before imaging. The percentage of aberrant myofibers was calculated by 219 dividing the number of fibers displaying aberrant/vacuole structures by the total number 220 of fibers (19, 54, 55). An average of 1500-1800 myofibers were counted per animal (n = 221 4-5/group), and quantification was performed using ImageJ software (National Institutes 222 of Health, Bethesda, MD, USA). 223 224 Muscle Protein Synthesis (Puromycin Incorporation) 225 .CC-BY-NC-ND 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted July 27, 2025. ; https://doi.org/10.1101/2025.07.23.666188doi: bioRxiv preprint 9 Changes in muscle protein synthesis (MPS) were assessed in TA muscles transfected 226 for 7 and 30 days by measuring the incorporation of exogenous puromycin into nascent 227 peptides as described previously (6, 56). Puro mycin (EMD Millipore, Billerica, MA; Cat. 228 No. 540222) was dissolved in sterile saline and delivered (0.02 μ mol/g body wt by ip 229 injection) 30 min before muscle collection. Protein synthesis was measured under fed 230 conditions and studied in the light cycle. 231 232 Immunoblotting 233 Frozen TA muscles were homogenized in sucrose lysis buffer (50 mM Tris pH 7.5, 250 234 mM sucrose, 1 mM EDTA, 1 mM EGTA, 1% Triton X 100, 50 mM NaF). The 235 supernatant was collected following centrifugation at 8,000 g for 10 min and protein 236 concentrations were determined using the 660 protein assay (Thermo Fisher Scientific, 237 Waltham, MA). Twenty micrograms of protein were subjected to SDS-PAGE on 4-20% 238 Criterion TGX stain-free gels (Bio-Rad, Hercules, CA) and transferred to polyvinylidene 239 diflouride membranes (PVDF, Millipore, Burlington, MA). Membranes were blocked in 240 3% nonfat milk in Tris-buffered saline with 0.1% Tween-20 added for one hour and then 241 probed with primary antibody overnight at 4°C. Membranes were washed and incubated 242 with HRP-conjugated secondary antibodies at 1:10,000 for one hour at room 243 temperature (Cell Signaling technology Cat no. 7076 and Cat no. 7074 ). Immobilon 244 Western Chemiluminescent HRP substrate was then applied to the membranes prior to 245 image acquisition. Image acquisition and band quantification were performed using the 246 ChemiDoc MP System and Image Laboratory 6.1 software (Bio-Rad), respectively. 247 Total protein loading of the membranes captured from images using stain ‐ free gel 248 technology was used as the normalization control for all blots . The following antibodies 249 were used at 1:1000 concentration unless otherwise stated: Total Ubiquitin FK2 250 (RRID:AB_2931782), UBR1 (ProteinTech, Cat no. 260069), UBR2 (Abcam, Cat no. 251 217069), UBR4 (Abcam, Cat no. 86738), UBR5 (Protein Tech, Cet no. 66937), UBR7 252 (Novus Biologicals, Cat no. NBP1-88409), VCP (Protein Tech, RRID:AB_2214635), p62 253 (Sigma, RRID:AB_1841064), LC3B (Sigma, Cat no. L7543), eIF2A (Protein Tech, 254 RRID:AB_2096489), NDRG1 (Protein Tech, RRID:AB_2880676). Cell Signaling 255 Technologies (Danvers, MA) – K48 Ub-linkage (RRID:AB_10859893), phospho-p44/42 256 .CC-BY-NC-ND 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted July 27, 2025. ; https://doi.org/10.1101/2025.07.23.666188doi: bioRxiv preprint 10 MAPKThr202/Tyr204 (RRID:AB_2315112), phospho-p90RSK Ser380 (RRID:AB_2687613), 257 p90RSK (RRID:AB_659900), phospho-Akt Ser473 (RRID:AB_2315049), phospho-AktThr308 258 (RRID:AB_2629447), Akt (RRID:AB_329827), phospho-NDRG1 Thr346 259 (RRID:AB_10693451), Raptor (RRID:AB_561245), phospho-p70S6K 260 Thr389 (RRID:AB_330944), p70S6K (RRID:AB_331676), phospho-261 rpS6Ser240/244 (RRID:AB_10694233), rpS6 (RRID:AB_331355), phospho-262 4EBP1 Thr37/46 (RRID: AB_560835) , 4EBP1 (RRID: AB_2097841), eIF4E 263 (RRID:AB_823488), eIF4G (RRID:AB_2096025), BiP (RRID:AB_2119845), PDI 264 (RRID:AB_2156433), CHOP (RRID:AB _2089254). EMD Millipore–puromycin 265 (RRID:AB_2566826). Anti-rabbit IgG, HRP-linked (1:10 /i2 000, Cell Signaling, Cat no. 266 7074) and anti-mouse IgG, HRP-linked (1:10 /i2 000, Cell Signaling, Cat no. 7076) were 267 used as secondary antibodies. 268 Proteasome Activity Assays 269 20S and 26S proteasome activities were performed as previously described (57, 58). 270 The 26S ATP-dependent assays were performed in homogenization buffer (50 /i2 mM 271 Tris, 150 /i2 mM NaCl, 1 /i2 mM EDTA, 5 /i2 mM MgCl 2 [pH 7.5] and 0.5mM dithiothreitol 272 (DTT)) with the addition of 100 μ M ATP. The 20S ATP-independent assays were carried 273 out in assay buffer containing 25 mM HEPES, 0.5 mM EDTA, and 0.001% SDS (pH 274 7.5). Proteasome activities were determined by adding substrates at 100 µM: Z-Leu-275 Leu-Glu-MCA (Peptide Institute, catalog no. 3179-v), Boc-Leu-Ser-Thr-Arg-AMC 276 (Bachem, catalog no. I-1940), or succinyl-Leu-Leu-Val-Tyr-7-AMC (Bachem, catalog no. 277 I-1395), for β 1- (caspase-like), β 2- (trypsin-like), and β 5-subunits (chymotrypsin-like), 278 respectively. Each assay was conducted in the absence and presence of the 279 proteasome inhibitor bortezomib (Cell Signaling, catalog no. 2204) at a final 280 concentration of 2 mM ( β 5) or 10 mM ( β 1 and β 2). All proteasome assays were 281 conducted using 10 µg of protein/well on a 96-well plate (Greiner Bio-One, catalog no. 282 655076), and each sample was loaded in triplicate on the plate. The activity of the 20S 283 and 26S proteasome was measured by calculating the difference between fluorescence 284 units recorded with or without the inhibitor in the reaction medium. Fluorescence was 285 measured using a Spectra Max M2 Fluorescent Microplate reader (Molecular Devices, 286 .CC-BY-NC-ND 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted July 27, 2025. ; https://doi.org/10.1101/2025.07.23.666188doi: bioRxiv preprint 11 Sunnyvale, CA; excitation wavelength, 360 nm; emission wavelength, 460 nm) at 15-287 min intervals for 2 h. 288 Gene expression by Quantitative RT‐ PCR in skeletal muscle 289 Frozen muscle powder was homogenized using RNAzol RT reagent (Sigma ‐ Aldrich, St 290 Louis, MO) in accordance with the manufacturer's instructions. cDNA was synthesized 291 using a reverse transcription kit (High-Capacity cDNA synthesis kit; Applied Biosystems, 292 Waltham, MA) from 1 µg of total RNA. PCR reactions (10 µL) were set up as: 2 µL of 293 cDNA, 0.5 µL (10 µ M stock) forward and reverse primer, 5 µL of Power SYBR Green 294 master mix (Thermo Fisher Scientific, Waltham, MA) and 2 µL of RNA/DNA free water. 295 Gene expression analysis was then performed by quantitative PCR on a Quantstudio 6 296 Flex Real ‐ time PCR System (Applied Biosystems, Waltham, MA) using the mouse 297 primers shown in Table 1. PCR cycling comprised: hold at 50°C for 2 min, 10 min hold 298 at 95°C, before 40 PCR cycles of 95°C for 15 s followed by annealing temp (see Table 299 1) for 30 s, and extension at 72°C for 30 s). Melt curve analysis at the end of the PCR 300 cycling protocol yielded a single peak. As a result of reference gene instability, gene 301 expression was normalized to tissue weight and subsequently reported as the fold 302 change relative to empty vector control muscles, as described previously (59). This type 303 of analysis has previously been used extensively by our group (60-62). 304 Statistical Analysis 305

are presented as mean ± standard error of measure (SEM) for all experiments. 306 Statistical differences for in vivo overexpression studies were determined using a paired 307 students’ t-test on muscle mass and fiber CSA data sets. For data sets with the Akt-Wt 308 and Akt-CA construct comparisons, a one-way analysis of variance (ANOVA) was 309 performed followed by Dunnett’s test for multiple comparisons. For data sets generated 310 with diet (control and rapa) and construct experiments, a two-way ANOVA was 311 performed. When applicable, a Šídák’s post hoc test was conducted for multiple 312 comparisons across groups. Potential outliers within data sets were identified and 313 excluded using a Grubbs test. All statistical analyses were performed using GraphPad 314 Prism ( GraphPad Software, Inc., La Jolla, CA). Results were considered significant 315 when P ≤ 0.05. 316 .CC-BY-NC-ND 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted July 27, 2025. ; https://doi.org/10.1101/2025.07.23.666188doi: bioRxiv preprint 12 317

318 Effect of differing levels of Akt activation on mTORC1 signaling and skeletal muscle 319 mass and fiber cross-sectional area 320 To explore the role of protein quality control systems in response to skeletal muscle 321 growth, we utilized an Akt overexpression model where either a wild-type (WT) or 322 constitutively active (CA) Akt construct was electroporated into male TA skeletal 323 muscles for 7 d (Figure 1a). We observed a significant increase in TA muscle mass with 324 the Akt-WT (+4%) and Akt-CA (+12%) constructs when compared to the respective 325 empty vector (EV) control (Figure 1b; P ≤ 0.05). Skeletal muscle fiber CSA was 326 assessed in EV control and Akt-CA transfected TA muscles with GFP-positive fibers 327 being analyzed (Figure 1c). We observed a shift in GFP-positive fiber CSA distribution 328 towards both smaller and larger fiber sizes with the Akt-CA construct verses the EV 329 control (Figure 1d). Lastly, overexpression of Akt-WT and Akt-CA increased Akt 330 phosphorylation and phosphorylation of downstream mTORC1 substrates, rpS6 and 331 p70S6K1, compared to the EV control (Figure 1f). In addition, we saw a significant 332 increase in protein abundance for eIF4E, eIF4G and puromycin labeling, indicating 333 elevated protein synthesis with Akt-CA overexpression (Figure 1f). 334 335 Changes in UBR-box E3 ubiquitin ligase protein abundance and mRNA expression in 336 Akt-transfected skeletal muscles 337 Given the proposed role for UBR-box E3 ubiquitin ligases in protein quality control and 338 previous literature observing UBR5 to be elevated in models of skeletal muscle growth 339 (35, 41), we assessed UBR-box E3 ubiquitin ligase expression in experimental models 340 where protein synthesis and skeletal muscle mass are increased. In our Akt-WT and 341 Akt-CA overexpression models, we observed increases in the abundance of UBR1, 342 UBR2, UBR4, UBR5 and UBR7 proteins (Figure 2a and 2b). In addition, we observed 343 increased levels of protein ubiquitination only in the Akt-CA transfected muscles 344 compared to the EV control (Figure 2b). At the mRNA level, we found increased 345 expression of UBR2, UBR4 and UBR7 in Akt-CA transfected muscles (Figure 2c). We 346 .CC-BY-NC-ND 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted July 27, 2025. ; https://doi.org/10.1101/2025.07.23.666188doi: bioRxiv preprint 13 observed no changes in UBR1, UBR5, MuRF1 or MAFbx mRNA expression with either 347 Akt-WT or Akt-CA compared to the EV control (Figure 2c). 348 349 UBR-box E3 ubiquitin ligases are elevated during a period of skeletal muscle regrowth 350 following neural inactivity 351 To extend our observations, we analyzed UBR-box E3 ubiquitin ligase protein 352 abundance in gastrocnemius muscle from a previously published nerve crush injury 353 model (41). Between 21 and 60 days post nerve crush injury, skeletal muscle regrowth 354 occurs following a period of neural inactivity (41). All the UBR-box E3 ubiquitin ligases 355 displayed increased protein abundance between 21 and 45 days post-surgery (Figure 356 2d and 2e). Only UBR1 and UBR7 protein remained elevated above control tissue 357 levels at the 60 day time point (Figure 2e). The changes in protein abundance for 358 UBR1, UBR2, UBR4 and UBR7 correspond with our previously published observations 359 for increased UBR5 protein abundance in the nerve crush injury model (41) during a 360 reinnervation period when skeletal muscle mass and the protein synthetic machinery 361 are remodeling. 362 363 Effect of rapamycin on Akt-induced skeletal muscle growth, rapamycin-sensitive and 364 insensitive signaling 365 Next, we investigated whether changes in the content of these ubiquitin ligases were 366 dependent on mTORC1 activity. We first confirmed blunting of mTORC1 activity with 367 Akt overexpression through the implementation of a rapamycin diet (Figure 3a). In the 368 control diet, there was a significant increase in TA muscle mass with Akt-CA 369 overexpression, whereas the rapamycin diet blunted Akt-CA induced growth (Figure 370 3b). At the fiber CSA level, GFP-positive fibers were distributed towards larger and 371 smaller size compared to the EV transfected muscles under the control diet with Akt 372 overexpression (Figure 3c and 3d). However, the GFP-positive fibers in the rapamycin 373 diet condition displayed only smaller fiber size in the Akt-CA transfected muscles, with a 374 reduction in the percentage of larger fibers being observed (Figure 3c and 3d). 375 In terms of Akt-mTORC1 signaling, we observed increased phosphorylation of 376 Akt, S6K and rpS6 under control diet conditions with Akt-CA overexpression (Figure 3e 377 .CC-BY-NC-ND 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted July 27, 2025. ; https://doi.org/10.1101/2025.07.23.666188doi: bioRxiv preprint 14 and 3f). Conversely, these downstream targets of mTORC1 were either non-detectable 378 or blunted in the rapamycin diet condition (Figure 3e). However, rapamycin did not 379 impact 4E-BP1 phosphorylation, suggesting that mTORC1 signals might not have been 380 fully blocked. Further, we report increased protein abundance for raptor and eIF4E 381 under control and rapamycin diet conditions with Akt-CA overexpression. Given that Akt 382 is upstream of mTORC1 activation and can initiate signaling of other independent 383 pathways, we assessed mTORC2 and p44/ 42 MAPK activity. P hosphorylation of 384 NDRG1 (mTORC2 substrate), p44/42 MAPK and p90RSK were all significantly elevated 385 irrespective of the diet conditions in transfected TA muscles with Akt-CA (Figure 3f). 386 Lastly, puromycin-labeling for nascent peptides was increased in Akt-CA 387 overexpression muscles irrespective of mTORC1 activity, highlighting the contribution of 388 rapamycin-insensitive mechanisms to increases in the protein synthetic machinery 389 (Figure 3e and 3f). It should be noted that the magnitude of increase for the puromycin-390 labelling was greater in the control group verses the rapamycin treated groups. 391 392 Changes in UBR-box E3 ubiquitin ligases, ubiquitination and proteasomal activity are 393 independent of mTORC1 activity 394 In control and rapamycin diet conditions, we assessed UBR-box E3 ubiquitin ligase 395 protein levels to ascertain if changes occurred in a rapamycin-sensitive or insensitive 396 manner. Protein levels for UBR2, UBR4, UBR5 and UBR7 significantly increased in the 397 Akt-CA overexpression muscles independent of the diet condition (Figure 4a and 4b). 398 Interestingly, UBR1 increased in the Akt-CA overexpression muscles, but also appeared 399 to be responsive to rapamycin treatment as we observed elevated levels of UBR1 in the 400 EV control plus rapamycin condition (Figure 4b). To further assess the UPS, we 401 measured total ubiquitinated proteins, K48-specific linkage levels and proteasome 402 activity for 20S and 26S subunits (Figure 4a, 4c and 4d). Independent of diet condition, 403 we observed significantly increased levels of total ubiquitinated proteins and K48-404 specific linkage in Akt-CA overexpression muscles compared to the EV control (Figure 405 4c). For the 20S subunit proteasomal activity, we observed little change in activity with 406 Akt-CA overexpression, except for 20S β 1 activity under the rapamycin diet background 407 (Figure 4d). In comparison, 26S proteasomal activity displayed significant elevations in 408 .CC-BY-NC-ND 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted July 27, 2025. ; https://doi.org/10.1101/2025.07.23.666188doi: bioRxiv preprint 15 β 1 and β 2 subunit activity in Akt-CA overexpression muscles independent of the diet 409 condition (Figure 4d). For the 26S β 5 subunit, we observed a near significant increase 410 in activity with the Akt-CA plus rapamycin condition compared to the control diet 411

(Figure 4d; P = 0.051). Altogether, these data highlight changes in UBR-412 box E3 ubiquitin ligases, ubiquitination, and proteasomal activity that occur in a 413 condition of low mTORC1 activity. 414 415 Markers for autophagy and ER-stress are elevated in Akt transfected muscles with 416 suppressed mTORC1 activity 417 Given the reported association between the UBR-box E3 ubiquitin ligases and their 418 involvement in protein quality control (27, 30, 31), we sought to assess changes in 419 markers related to autophagy and ER-stress pathways in Akt-CA overexpression TA 420 muscles. For VCP, LC3B I and LC3B II, we observed significant increased protein levels 421 in Akt-CA overexpression muscles that were independent of diet background (Figure 5a 422 and 5b). Interestingly for p62 protein abundance we observed significant increases in 423 the control diet condition only with Akt-CA overexpression (Figure 5b). However, similar 424 to UBR1, we observed a rapamycin-induced increase in basal p62 protein levels in the 425 EV control muscles (Figure 5b). For markers related to the ER stress response, there 426 was no change in protein levels for BiP (Figure 5c and 5d). However, for PDI, CHOP 427 and eIF2α protein levels, there was a significant increase in Akt-CA transfected muscles 428 that was present independent of the diet conditions (Figure 5d). Lastly, similar to Akt 429 transgenic and TSC1/2 knockout rodent models (19), we observed the presence of 430 ‘aberrant’ muscle fibers containing multiple vacuole-like structures in the Akt-CA 431 overexpression muscles, which were also present in the rapamycin diet condition 432 (Figure 5e and 5f). Overall, these data highlight the response of protein quality control 433 pathways to Akt induction, and that these pathways may be responding to protein 434 clearance and removal of damaged/misfolded proteins that are driven by hyperactive 435 protein synthesis, leading to potential increased errors of translation. 436 437 UBR5 knockdown results in loss of muscle mass and fiber size under control and 438 rapamycin conditions 439 .CC-BY-NC-ND 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted July 27, 2025. ; https://doi.org/10.1101/2025.07.23.666188doi: bioRxiv preprint 16 We have previously observed UBR5 knockdown to result in loss of muscle mass and 440 fiber size which was accompanied by mTORC1 hyperactivation, as measured by 441 phosphorylation of downstream substrates p70S6K and rpS6 at multiple time points 442 (42). However, it remained to be determined if the response of mTORC1 activity was 443 adaptive or maladaptive and could be contributing to the development of skeletal 444 muscle atrophy with UBR5 knockdown. Therefore, we sought to utilize the rapamycin 445 diet in conjunction with UBR5 knockdown for 30 days post electroporation (Fig 6a). In 446 the control diet group, we observed significant loss of skeletal muscle mass and fiber 447 size, as measured by a reduction in muscle weight and a shift toward smaller CSA size 448 for GFP-positive fibers for the UBR5 RNAi construct compared to the contralateral EV 449 muscle (Fig 6b and 6d). These observations confirmed our previous findings for the 450 effect of UBR5 knockdown on skeletal muscle mass size (42). Interestingly, we also 451 observed significant reductions in muscle mass and fiber CSA size in UBR5 RNAi 452 transfected muscles compared to the contralateral EV in the presence of rapamycin 453 (Fig 6b and 6d). 454 At the biochemical level, similar to our previously published data (42), we 455 observed increased phosphorylation of Akt, p70S6K1, rpS6 and p90RSK in UBR5 RNAi 456 transfected muscles in the control diet condition compared to the EV muscles (Fig. 6e 457 and 6f). The phosphorylation of p70S6K at Thr389 was suppressed in the EV and UBR5 458 RNAi transfected muscles confirming the inhibitory effect of the rapamycin diet on 459 mTORC1 activity (Fig. 6e and 6f). Interestingly, rapamycin did not inhibit the UBR5 460 RNAi-induced phosphorylation of Akt, rpS6 and p90RSK sites compared to the EV 461 transfected muscle (Fig. 6e and 6f). The dissociation between p70S6K1 and rpS6 462 phosphorylation is interesting and might suggest the potential involvement of either 463 another rpS6 kinase (e.g. PKA) or the inhibition of a rpS6 phosphatase (63-65). This 464 observation warrants further investigation in the UBR5 knockdown model. Lastly, we 465 wanted to observe how the protein abundance for UBR1, UBR2, UBR4, and UBR7 466 might change with UBR5 Knockdown. In the control diet, we observed significant 467 increases in UBR2, UBR4, and UBR7 when UBR5 protein was suppressed 50-60% 468 (Fig. 6g and 6h) In the rapamycin diet condition, basal UBR1 and UBR7 proteins were 469 significantly increased in EV transfected muscles compared to control diet EV 470 .CC-BY-NC-ND 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted July 27, 2025. ; https://doi.org/10.1101/2025.07.23.666188doi: bioRxiv preprint 17 transfected muscles, while only UBR2 remained significantly elevated in the UBR5 471 RNAi tissues compared to the EV transfected muscle (Fig. 6g and 6h). 472 473

474 Skeletal muscle can regulate its size in response to internal and external cues 475 throughout the life span (2, 3, 66). Homeostasis of skeletal muscle size occurs through 476 a balance between protein synthesis and breakdown (2). In the present study, we 477 sought to further our understanding of skeletal muscle proteostasis under growth and 478 remodeling conditions by using a short term Akt overexpression model, in conjunction 479 with a rapamycin diet intervention. Our results highlight a novel group of E3 ubiquitin 480 ligases (UBR1, UBR2, UBR4, UBR5, and UBR7) that appear to be responsive under 481 conditions of heightened protein synthesis and when other protein quality control 482 pathways are active. In addition, the change in protein abundance for UBR-box E3 483 ubiquitin ligases was still evident with r apamycin treatment, suggesting that the UBR-484 box E3 ubiquitin ligases might act in a rapamycin-insensitive manner and maybe 485 dependent on upstream Akt signals and mTORC1-independent control. Indeed, we 486 observed the activation of p44/p42 M APK, p90RSK and mTORC2 signaling that can 487 contribute to protein synthesis and skeletal muscle growth (67-71). Future studies are 488 required to ascertain a physiological role of UBR-box E3 ubiquitin ligases with Akt-489 mediated protein synthesis and turnover in the context of skeletal muscle growth and 490 remodeling. 491 As the UBR-box E3 ubiquitin ligases are part of the N-degron pathway, they contain a 492 UBR-domain which can recognize destabilized proteins and protein fragments for 493 protein degradation (25, 27). The N-degron pathway serves as an important protein 494 quality control mechanism (25, 31) and limited studies have been performed in skeletal 495 muscle exploring this pathway. However, recent observations from us and other 496 laboratories have implicated UBR4, UBR5, and UBR7 in the regulation of the skeletal 497 muscle proteome under growth and exercise stimuli (35-38). For instance, UBR5 and 498 UBR4 have each been observed to be exercise responsive E3 ubiquitin ligases in 499 human and mouse skeletal muscle under resistance and aerobic exercise models (35, 500 36, 38), with a change in phosphorylation status for UBR5 noted in multiple different 501 .CC-BY-NC-ND 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted July 27, 2025. ; https://doi.org/10.1101/2025.07.23.666188doi: bioRxiv preprint 18 exercise modalities (38). Further, UBR5 has been observed to increase in other models 502 of mechanical loading (41) and UBR5 activity may be rapamycin insensitive (72) which 503 compliments data collected in the current study in our Akt overexpression and UBR5 504 knockdown models. In other cell types, UBR5 has been reported to interact with 505 p90RSK signaling via p90RSK phosphorylation sites on UBR5 (73), and we saw 506 p90RSK activation with UBR5 suppression or increased UBR5 protein abundance in the 507 presence of p90RSK phosphorylation, highlighting the potential responsiveness of 508 UBR5 and UBR-box E3 ubiquitin ligases to changes in the protein synthetic machinery. 509 These observations extend our understanding of E3 ubiquitin ligases in protein quality 510 control and the regulation of skeletal muscle size. 511 Although very little is known about the substrates for the UBR-box E3 ubiquitin ligases, 512 we observed an increase in K48-linked ubiquitinated proteins, total ubiquitinated protein 513 levels and 26S proteasome activity under control and rapamycin diet conditions in the 514 Akt overexpression model. Recent evidence by Kaiser and colleagues (19) has alluded 515 to the proteasome system being controlled by mTORC1 via feedback inhibition of 516 PKB/Akt. The authors utilized transgenic Akt-CA mice and TSC1 knockout models to 517 manipulate mTORC1 activation and observed changes in proteasome biogenesis and 518 activity as well as atrophy-related gene expression for specific E3 ubiquitin ligases in 519 these models. It could be postulated that the increase in mTORC1-mediated translation 520

in a buildup of error containing peptides and misfolded proteins, which 521 inadvertently increases the demand on the UPS for targeted protein degradation. These 522 ideas warrant further investigation, and are highlighted in the literature drawing on 523 observations reported using other cell and tissue models (74). In our current study, Akt 524 overexpression and subsequent mTORC1 activation was induced for a shorter period 525 of time compared to previous studies (15, 19, 20), and notably, we observed UPS-526 induction and markers of other protein quality control pathways (e.g. ER stress and 527 autophagy) to be elevated under conditions where mTORC1 activity is low (e.g. 528 rapamycin diet). Given, that it has previously been proposed that mTORC1 may control 529 the UPS system and proteasome activity in skeletal muscle (19), the current study’s 530 findings extend our observations for the UPS and protein quality control system being 531 controlled under rapamycin-sensitive and insensitive signals. We observed increased 532 .CC-BY-NC-ND 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted July 27, 2025. ; https://doi.org/10.1101/2025.07.23.666188doi: bioRxiv preprint 19 phosphorylation of p90RSK and NDRG1 (mTORC2 substrate) with Akt overexpression 533 and thus the activation of alternative protein synthetic pathways may require a response 534 from a variety of protein quality control mechanisms such as the N-degron pathway in 535 order to maintain proteome integrity. 536 Recent studies have alluded to the importance of the N-degron pathway being critical 537 for protein quality control via its ability to recognize destabilized proteins that display a 538 degron signal (31-33). Interestingly, with UBR5 knockdown, we observed an increase in 539 protein abundance for UBR2, UBR4 and UBR7 which may highlight a compensatory 540 response in order to maintain proteostasis due to increased protein synthesis in UBR5 541 KD transfected muscles. These observations are interesting because UBR-box E3 542 ligases all share the UBR-domain, but the mechanisms for ubiquitin transfer differs 543 between RING, F-box and Hect E3 ubiquitin ligases which are all comprised in the UBR 544 class of E3 ligases (24, 29, 75). The substrates for the UBR-box E3 ligases remain to 545 be identified in vivo. Previous literature has suggested that different UBRs may elicit 546 their function for ubiquitination under different cellular compartments (27, 31, 76). For 547 instance, UBR1 and UBR2 are reported to target misfolded proteins for degradation in 548 the cytosolic compartment (31) whereas the action of UBR5 might be dominant in the 549 nucleus and regulating nuclear receptors and transcription factors (33, 77-79). However, 550 these previously published observations remain to be confirmed in vivo and in the 551 context of skeletal muscle plasticity. 552

553 The data reported within the current study is not without limitations. The use of in vivo 554 electroporation allows for a targeted skeletal muscle approach to understand the 555 molecular mechanisms of hypertrophy and atrophy (48). However, transfection 556 efficiency can play a role in observations made at the biochemical level, as a “dilution” 557 effect can occur whereby changes in gene/protein expression are diluted by a large 558 proportion of non-transfected fibers, leading to an underestimation of the effect of the 559 gene of interest (48). Our electroporation protocol has been optimized to maximize 560 transfection efficiency whilst also limiting the level of potential muscle damage that 561 might be observed (48, 49). Our current observations for the UBR-box E3 ligases in 562 .CC-BY-NC-ND 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted July 27, 2025. ; https://doi.org/10.1101/2025.07.23.666188doi: bioRxiv preprint 20 skeletal muscle remodeling are limited to only the tibialis anterior muscle, although we 563 have performed similar electroporation experiments in the gastrocnemius muscle with 564 the UBR5 RNAi construct and observed similar levels of muscle mass and fiber CSA 565 decreases with UBR5 suppression (data not shown). In the current study, we observed 566 changes in UBR-box E3 ligase protein abundance during the recovery of muscle mass 567 following atrophy in the gastrocnemius complex muscles (Fig. 2), which might imply that 568 their role is similar in all hindlimb skeletal muscles, but future studies are warranted. 569 Lastly, protein turnover and quality control are dynamic processes for maintaining 570 proteostasis (74, 80, 81) and thus caution must be applied given that a single snapshot 571 in time was measured for changes in protein quality control mechanisms when protein 572 synthesis was genetically enhanced to induce skeletal muscle growth. 573

574 The present study highlights a novel group of E3 ubiquitin ligases that respond to 575 heightened protein synthesis under skeletal muscle growth or atrophy conditions via 576 genetic manipulation or recovery following nerve crush injury. Little is known about the 577 N-degron pathway in tissue health and our initial observations provide important steps 578 towards understanding this pathway. Future studies are warranted to identify protein 579 substrates for these E3 ubiquitin ligases and explore their potential role in other tissues 580 (e.g. heart, brain) given that they are ubiquitous E3 ligases. Overall, the UBR-box E3 581 ubiquitin ligases could be critical in the adaptive response to cellular stress where 582 perturbations in proteostasis and tissue remodeling might occur in the context of aging, 583 disease, and exercise. 584 585 .CC-BY-NC-ND 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted July 27, 2025. ; https://doi.org/10.1101/2025.07.23.666188doi: bioRxiv preprint 21 Data Availability 586 The data that support the findings of this study are available from the corresponding 587 author upon reasonable request. 588 Author Contributions 589 Conception and design of the experiments: SCB and DCH. Collection, analysis and 590 interpretation of data: LMB, LGO, CAG, APS, DSW, SCB and DCH. Drafting the article 591 or revising it critically for important intellectual content: LMB, LGO, CAG, APS, DSW, 592 SCB and DCH. All authors read and approved the final version of the manuscript, and 593 all authors listed qualify for authorship. 594 Conflict of Interest 595 SCB is on the scientific advisory board for Emmyon Inc. All other authors declare that 596 they do not have a conflict of interest. 597 Funding 598 D.C. Hughes was supported by the National Institute of Arthritis and Musculoskeletal 599 and Skin Diseases of the National Institutes of Health under Award Numbers 600 K01AR077684 and R03AR083980. Additional support was provided by a pilot project 601 award to D.C. Hughes from the CoBRE Center for Cellular Metabolism Research 602 (NIGMS P20GM139763). 603 604 .CC-BY-NC-ND 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted July 27, 2025. ; https://doi.org/10.1101/2025.07.23.666188doi: bioRxiv preprint 22 Figure Legends 605 Figure 1. Differing degrees of Akt activity result in skeletal muscle growth and activation 606 of mTORC1 signaling and translation. Schematic diagram (A) of experimental design using in 607 vivo electroporation delivery of wild type (Akt-WT) and constitutively active (Akt-CA) Akt 608 constructs into male mouse TA muscle. Muscle mass ( B) measurements (milligrams) for 609 muscles transfected with either the empty vector (EV) or Akt-WT, and Akt-CA plasmids after 7 610 days (n=5-10/group). Representative microscope images ( C) for green fluorescent protein 611 (GFP) and laminin (red) in TA muscles transfected with EV or Akt-CA constructs (x10 612 magnification; scale bar = 100µm), highlighting transfection efficiency and muscle morphology 613 after 7 days. Muscle cross-sectional area (CSA) distribution for EV and Akt-CA transfected 614 muscles ( D). GFP-positive fibers were measured for CSA, with ≥ 450 transfected fibers 615 analyzed per animal, per muscle (n=5/group). Total number of fibers analyzed per group are 616 reported in parentheses. For CSA data, fibers presented as percentage of fibers between 0 and 617 4800 µm plus size. Representative immunoblot images ( E) for Akt/mTORC1 signaling and 618 puromycin. Quantification of Akt/mTORC1 signaling and puromycin-labelling ( F) in EV, Akt-WT, 619 and Akt-CA transfected muscles (n=5/group). Total protein loading was used as the 620 normalization control for all blots. Data presented as means ± SEM. *P<0.05; **P<0.01. 621 Figure 2. Response of UBR-box E3 ligases to increased Akt activity in transfected TA 622 muscles and upon skeletal muscle regrowth following a period of neural inactivity. 623 Representative immunoblot images ( A) for UBR-box E3 ubiquitin ligases and total ubiquitin. 624 Quantification of UBR-box E3 ubiquitin ligases (UBR1, UBR2, UBR4, UBR5, and UBR7) and 625 total ubiquitin (B) in empty vector (EV), Akt-WT, and Akt-CA transfected muscles (n=4-5/group). 626 *P<0.05; **P<0.01 vs EV. Total protein loading was used as the normalization control for all 627 blots. In EV, Akt-WT, and Akt-CA transfected muscles, mRNA expression ( C) was determined 628 via quantitative PCR for UBR1, UBR2, UBR4 , UBR5, UBR7, MuRF1 (Trim63), and MAFbx 629 (FBXO32). N=4-5/group. *P<0.05; **P<0.01 vs EV. Representative immunoblot images ( D) for 630 UBR-box E3 ubiquitin ligases across 21 to 60 days post nerve crush injury in gastrocnemius 631 complex (GSTC) skeletal muscle. We have previously published the UBR5 protein response in 632 the GSTC muscle following nerve crush injury (NCI) and the 21 to 60-day time period 633 corresponds to the recovery (regrowth) of skeletal muscle mass following a period of disuse. ( E) 634 Quantification of UBR-box E3 ubiquitin ligases (UBR1, UBR2, UBR4, UBR5, and UBR7) in 635 GSTC muscle from control and time points (21, 28 ,45, and 60 days post NCI) corresponding to 636 skeletal muscle regrowth (n=4-5/group). Data presented as means ± SEM. *P<0.05 vs control. 637 .CC-BY-NC-ND 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted July 27, 2025. ; https://doi.org/10.1101/2025.07.23.666188doi: bioRxiv preprint 23 Figure 3. Effect of rapamycin on Akt-induced skeletal muscle growth, mTORC1 638 dependent and independent signaling. Schematic diagram ( A) of experimental design using 639 in vivo electroporation delivery of wild type (Akt-WT) and constitutively active (Akt-CA) Akt 640 constructs into male mouse TA muscle. Male mice were provided either a control or rapamycin 641 diet seven days prior to the electroporation procedure and kept on the respective diet for the 642 remainder of the experiment. Muscle mass ( B) measurements (milligrams) for muscles 643 transfected with either the empty vector (EV) and Akt-CA plasmids for the control and 644 rapamycin interventions after 7 days (n=10/group; left panel). The percentage difference in 645 muscle mass compared to the EV transfected muscle for the control and rapamycin diets (right 646 panel). Representative microscope images ( C) for green fluorescent protein (GFP) and Laminin 647 (red) in TA muscles transfected with EV or Akt-CA plasmid on the control or rapamycin diet (x10 648 magnification; scale bar = 100µm), highlighting transfection efficiency and muscle morphology 649 after 7 days. Muscle cross-sectional area (CSA) distribution for EV and Akt-CA transfected 650 muscles ( D). GFP-positive fibers were measured for CSA, with ≥ 450 transfected fibers 651 analyzed per animal, per muscle (n=5/group). Total number of fibers analyzed per group are 652 reported in parentheses. For CSA data, fibers presented as percentage of fibers between 0 and 653 4800 µm plus size. Representative immunoblot images ( E) for Akt/mTORC1 signaling and 654 puromycin from EV and Akt-CA plasmids with control or rapamycin diet (n=5/group). 655 Quantification of puromycin and phosphorylation status of rpS6, NDRG1 and p90RSK in control 656 and rapamycin conditions with Akt overexpression ( F). Data presented as means ± SEM. 657 *P<0.05; **P<0.01. 658 Figure 4. Increase in UBR-box E3 ligase abundance and proteasome activity in Akt 659 transfected skeletal muscles under suppressed mTORC1 activity. Representative 660 immunoblot images ( A) for UBR-box E3 ubiquitin ligases, total ubiquitin, and K48-specific 661 ubiquitin linkage. Quantification of UBR-box E3 ubiquitin ligases (UBR1, UBR2, UBR4, UBR5, 662 and UBR7) ( B), total ubiquitin, and K48 specific ubiquitin ( C) in empty vector (EV) and Akt-CA 663 transfected muscles under control or rapamycin diet conditions (n=5/group). Total protein 664 loading was used as the normalization control for all blots. Proteasome activity assays were 665 performed for 20S and 26S subunits ( β 1, β 2, and β 5) in transfected muscles (n=4/group; D ). 666 Data presented as means ± SEM. *P<0.05; **P<0.01. 667 Figure 5. Changes in autophagy-related an d ER stress-related proteins with Akt 668 transfected skeletal muscle independent of mTORC1 activity. Representative immunoblot 669 images (A) for autophagy-related markers, VCP, p62, and LC3B. Quantification of autophagy-670 .CC-BY-NC-ND 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted July 27, 2025. ; https://doi.org/10.1101/2025.07.23.666188doi: bioRxiv preprint 24 related markers ( B) in empty vector (EV) and Akt-CA transfected muscles under control or 671 rapamycin diet conditions (n=5/group). Representative immunoblot images ( C) for ER stress-672 related markers, BiP, PDI, CHOP, and eIF2 α . Quantification of ER stress-related markers ( D) in 673 EV and Akt-CA transfected muscles under control or rapamycin diet conditions (n=5/group). 674 Total protein loading was used as the normalization control for all blots. Representative 675 microscope images for hematoxylin-eosin (H&E) in TA mouse muscles transfected with EV and 676 Akt-CA plasmids under control and rapamycin diet conditions (×20 magnification; scale 677 bar/i4 =/i4 50 µm) highlighting muscle morphology after 7 days post electroporation ( E). Examples 678 of aberrant skeletal muscle fibers are identified on H&E images with yellow arrows and were 679 quantified in EV and Akt-CA transfected muscles under control and rapamycin conditions 680 (n=5/group) (F). Data presented as means ± SEM. *P<0.05; **P<0.01. 681 Figure 6. Loss of skeletal muscle mass and fiber size with UBR5 knockdown occurs 682 independent of mTORC1 activity. Schematic diagram (A) of experimental design using in vivo 683 electroporation delivery of empty vector (EV) or UBR5 RNAi constructs into male mouse tibialis 684 anterior (TA) muscle. Male mice were provided either a control or rapamycin (Rapa) diet for 30 685 days post electroporation. TA muscle mass ( Bi) measurements (milligrams) for muscles 686 transfected with either the EV or UBR5 RNAi plasmids for the control and rapamycin 687 interventions after 30 days (n=9-10/group). Mean GFP-positive fiber size ( Bii) was quantified for 688 TA muscles transfected with EV or UBR5 RNAi under control or rapamycin diets (n=3-4/group). 689 Representative microscope images (C) for green fluorescent protein (GFP) and Laminin (red) in 690 TA muscles transfected with EV or UBR5 RNAi plasmid on the control or rapamycin diet (x10 691 magnification; scale bar = 100µm), highlighting transfection efficiency and muscle morphology 692 after 30 days. Muscle fiber CSA distribution for EV and UBR5 RNAi transfected muscles ( D). 693 GFP-positive fibers were measured for CSA, with ≥ 450 transfected fibers analyzed per animal, 694 per muscle (n=4/group). Total number of fibers analyzed per group are reported in parentheses 695 and represent Fiber CSA data for TA transfected muscles. For CSA data, fibers presented as 696 percentage of fibers between 0 and 4800 µm. Representative immunoblot images ( E) for 697 Akt/mTORC1 signaling and puromycin from EV and UBR5 RNAi plasmids with control or 698 rapamycin diet (n=5-6/group). Quantification of puromycin and phosphorylation status of Akt, 699 p70S6K1, rpS6, and p90RSK in control and rapamycin conditions with UBR5 knockdown ( F). 700 Representative immunoblot images ( G) for UBR-box E3 ubiquitin ligases. Quantification of 701 UBR-box E3 ubiquitin ligases (UBR1, UBR2, UBR4, UBR5, and UBR7) ( H) in EV and UBR5 702 RNAi transfected muscles (n=5-6/group) under control and rapamycin diet conditions. *P<0.05 703 .CC-BY-NC-ND 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted July 27, 2025. ; https://doi.org/10.1101/2025.07.23.666188doi: bioRxiv preprint 25 vs. EV. Total protein loading was used as the normalization control for all blots. Data presented 704 as means ± SEM. *P<0.05; **P<0.01. 705 706 .CC-BY-NC-ND 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted July 27, 2025. ; https://doi.org/10.1101/2025.07.23.666188doi: bioRxiv preprint 26

707 1. Hughes DC, Ellefsen S, and Baar K . Adap tatio ns to endu rance a nd str ength t raini ng. Cold Spring 708 Harbor perspectives in medicine a029769 , 2017. 709 2. Baehr LM, Hughes DC, Waddell DS, and Bodine SC . SnapShot: Skelet al muscle atr ophy. Cell 185: 710 1618-1618. e1611, 2022. 711 3. Sharples AP, Hughes DC, Deane CS, Saini A, Selman C, and Stewart CE . Longevity and skelet al 712 muscle mass: the rol e of IGF signalling, t he sirtuins, di eta ry rest riction an d prot ei n intake. Aging cell 14: 713 511-523, 2015. 714 4. Bodine SC, Stitt TN, Gonzalez M, Kline WO, Stover GL, Baue rlein R, Zlotc henko E, Scri mgeou r 715 A, Lawrence JC, an d Glass DJ . Akt/mTOR pathway is a crucial regula tor of skele tal muscle hypertro phy 716 and can preven t muscle atr ophy in vivo. Nature cell biology 3: 1014-1019, 2001. 717 5. Baar K, and Esser K. Phosphorylation of p70S6kcorrela tes with incr eased skel etal muscle mass 718 following resistance e xercis e. American Journal of Physiology-Cell Physiology 276: C120-C12 7, 1999. 719 6. West DW, Baehr LM, Marcotte GR, Chason CM, Tolento L, G omes AV, Bodin e SC, and Baar K . 720 Acute r esistanc e ex ercise act ivates r apa mycin-sensitive and-insensitive mechanis ms that cont rol 721 transla tional activity and capacity in skel etal muscle. The Journal of physiology 594: 453-468, 2016. 722 7. Lee Hamilton D, Philp A, MacKenzie MG , Patton A, Towler MC, Gallagher IJ, Bod ine SC, and 723 Baar K. Mol ecular br akes regula ting mTO RC1 activation in skele tal muscle following synergist ablation . 724 American Journal of Physiology-Endocrinology and Metabolism 307: E365-E373, 2014. 725 8. You J-S, Doole y MS, Kim C-R, Kim E-J, Xu W, Goodman CA, an d Hornbe rger TA . A DGKζ-FoxO-726 ubiquitin pro te olytic axis cont rols fiber si ze during skele tal muscle remod eling. Science signaling 11: 727 2018. 728 9. Frey JW, Jacobs BL, Goo dman CA, an d Hornberg er TA . A role for Rapt or phospho rylation in th e 729 mechanical activati on of mTOR signaling. Cellular Signalling 26: 313-322, 2014. 730 10. Goodman CA . Role of mTORC1 in mechanically induced increases in transla tion a nd skeletal 731 muscle mass. Journal of applied physiology 127: 581-590, 2019. 732 11. Kim H-G, Guo B, and Nader GA . Regulation of ribosome biogen esis during skelet a l muscle 733 hypertr ophy. Exercise and sport sciences reviews 47: 91-97, 2019. 734 12. Figueiredo VC, a nd McCarthy JJ . Regulati on of ribosome biogen esis in skeletal mu scle 735 hypertr ophy. Physiology 34: 30-42, 2019. 736 13. Wallace MA, Hughes DC, and Baar K . mTORC1 in the Contr ol of Myogenesis and A dult Skele tal 737 Muscle Mass. In : Molecules to Medicine with mTOR Elsevier, 2016, p . 37-56. 738 14. Castets P, Rion N, Théodore M, Falcetta D, Lin S, Reischl M, Wild F , Gué rard L, Ei ckhorst C, 739 Brockhoff M, Guridi M, Ibe bunj o C, Cruz J, Sinnrei ch M, Rudolf R, Glass DJ, and Rüegg MA . mTORC1 740 and PKB/Akt control th e muscle respo nse to den ervati on by regulati ng autoph agy and HDAC4. Nat 741 Commun 10: 3187, 2019. 742 15. Marabita M, Baraldo M, Solagna F, Ceel en Judith Johanna M, Sartori R, Nolte H, Nemazanyy I, 743 Pyronnet S, Krug er M, Pende M, and Bla auw B . S6K1 Is Requi red for Incr easing Skelet al Muscle Forc e 744 during Hypert rophy. Cell Reports 17: 501 -513, 2016. 745 16. Bentzinger CF, Lin S , Romanino K, Castets P, Guridi M, Sum mermatter S, Handsc hin C, 746 Tintignac LA, Hall MN, and Rüegg MA . D ifferential r esponse of skele tal muscles t o mTORC1 signaling 747 during atro phy and hypert rophy. Skeletal muscle 3: 1-16, 2013. 748 17. Tang H, Inoki K, Brooks SV, Okaza wa H, Lee M, Wang J, Kim M, Kenn edy CL, Mac pherson PC, 749 and Ji X. mTORC1 underlies age-rela ted muscle fiber damage and loss by inducin g oxidative st ress and 750 catabolism. Aging cell 18: e12943, 2019. 751 .CC-BY-NC-ND 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted July 27, 2025. ; https://doi.org/10.1101/2025.07.23.666188doi: bioRxiv preprint 27 18. Lai K-MV, Gonzalez M, Poueymirou WT, Kline WO, Na E, Zlotchenko E , Stitt TN, E conomid es 752 AN, Yancopo ulos GD, and Glass DJ . Con ditional ac tivation of akt in ad ult skele tal muscle induces rapid 753 hypertr ophy. Molecular and cellular biology 24: 9295-9304, 2004. 754 19. Kaiser MS, Milan G, Ham DJ, Lin S, Olive ri F, Chojn owska K, Tintignac LA, Mittal N, Zimmerli CE, 755 and Glass DJ . Dual r oles of mTORC1-dependen t activati on of the ubiqui tin-pro tea some system in muscle 756 prote ostasis . Communications biology 5: 1141, 2022. 757 20. Blaauw B, Canato M, Agatea L, Toniolo L, Mammucari C, Masiero E, Abra ham R, Sandri M, 758 Schiaffino S, and Reggiani C . Inducible ac tivation of Akt incr eases skel etal muscle mass and force 759 without sa tellit e cell activa tion. The FASEB journal 23: 3896-3905, 2009. 760 21. Castets P, and Rüegg MA . MTORC1 det e rmines auto phagy through ULK1 regula ti on in skeletal 761 muscle. Autophagy 9: 1435-1437, 2013. 762 22. Bodine SC, Latres E , Baumhuet er S, Lai V K-M, Nunez L, Clarke BA, Poueymi rou W T, Panaro FJ, 763 Na E, and Dharmarajan K . Iden tification of ubiquitin ligases req uired for skel etal muscle atrophy. 764 Science 294: 1704-1708, 2001. 765 23. Milan G, Romanello V, Pescatore F, Ar m ani A, Paik J-H, Frasson L, Seydel A , Zhao J, Abraham R, 766 and Goldbe rg AL . Regulation of autop ha gy and the ubiquitin –pro te asome system by the FoxO 767 transcrip tional n etwork dur ing muscle at rophy. Nature communications 6: 6670, 2015. 768 24. Hughes DC, Goodman CA, Baehr LM, G r egorevic P, and Bodin e SC . A critical discussion on the 769 relati onship be tween E3 ubiqui tin ligases , prot ein degrad atio n, and skele tal muscl e wasting: it’s no t tha t 770 simple. American Journal of Physiology-Cell Physiology 325: C1567-C1582, 2023. 771 25. Varshavsky A . N-d egron and C-degron p athways of protein d egrada tion . Proceedings of the 772 National Academy of Sciences 116: 358-366, 2019. 773 26. Varshavsky A . The N-end rule p athway a nd regulati on by prot eolysis. Protein science 20: 1298-774 1345, 2011. 775 27. Sherpa D, Chrustowicz J, and Schul man BA . How the e nds signal the e nd: Regul at ion by E3 776 ubiquitin ligases r ecognizing pro tein t er mini. Molecular Cell 82: 1424-1438, 2022. 777 28. Choi WS, Jeong B-C, Joo YJ, Lee M-R, Kim J, Eck MJ, and Song HK . Structu ral basi s for the 778 recognition of N- end rule subs tra tes by t he UBR bo x of ubiquitin ligases . Nature structural & molecular 779 biology 17: 1175-1181, 2010. 780 29. Tasaki T, Mulder LC, Iwamatsu A, Lee MJ, Davydov IV, Varshavsky A, Muesing M, and Kwon 781 YT. A family of mammalian E3 ubiquitin ligases that con tain t he UBR b ox motif an d recognize N-d egrons. 782 Molecular and cellular biology 2005. 783 30. Hunt LC, Schadeb erg B, Sto ver J, Haugen B, Pagala V, Wang Y-D, Puglise J, Barton ER, Peng J, 784 and Demontis F . Antagonist ic control of myofiber size and muscle pro tein quali ty control by th e 785 ubiquitin ligase UB R4 during aging. Nature Communications 12: 1418, 2021. 786 31. Nillegoda NB, Theodoraki MA, Mandal AK, Mayo KJ, Ren HY, Sultana R, Wu K, Johnson J, Cyr 787 DM, and Caplan AJ . Ubr1 and U br2 funct ion in a quality cont rol pat hway for degr adation of unfold ed 788 cytosolic prote ins. Molecular biology of the cell 21: 2102-2116, 2010. 789 32. Shimshon A, Dahan K, Israel-Gu eta M, Olmayev-Yaakobov D, Timms RT, Bekturo va A, Makaros 790 Y, Elledg e SJ, and Koren I . Dipeptidyl peptidases and E3 ligases of N-degro n pathw ays cooperat e to 791 regulat e pro tein st ability. Journal of Cell Biology 223: e202311035, 2024. 792 33. Tsai JM, Aguirre JD, Li Y-D, Brown J, Fo c ht V, Kater L, Kempf G , Sandoval B, Sch mitt S, and 793 Rutter JC. UBR5 forms ligand-dep enden t complexes on chr omatin to regula te nucl ear hormo ne rec epto r 794 stability. Molecular cell 83: 2753-2767. e 2710, 2023. 795 34. Solomon V, Lecke r SH, and Gol dberg AL . The N-end rule pa thway catalyz es a major fraction of 796 the pro tein d egrada tion in skele tal muscl e. Journal of Biological Chemistry 273: 25 216-25222, 1998. 797 .CC-BY-NC-ND 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted July 27, 2025. ; https://doi.org/10.1101/2025.07.23.666188doi: bioRxiv preprint 28 35. Seaborne RA, Strauss J, Cocks M, Sheph erd S, O'Brien TD, van Some ren KA, Bell PG, 798 Murgatroyd C, Morton JP, Stewart CE, a nd Sharpl es AP . Human Skele tal Muscle Possesses an 799 Epigenetic Memo ry of Hypertro phy. Sci Rep 8: 1898, 2018. 800 36. Chambers TL, Dimet-Wiley A, Keeble AR , Haghani A, Lo WJ, Kang G, Bro oke R, Horvath S, Fry 801 CS, and Watowich SJ . Methylome –pro te ome integr ation af ter la te-life volunt ary exe rcise tr aining 802 reveals regul ation a nd ta rget informa tio n for improved skelet al muscle healt h. The Journal of Physiology 803 603: 211-237, 2025. 804 37. Roberts MD, Ruple BA, Godwin JS, McIn tosh MC, Chen S-Y, Kontos NJ, Agyin -Biri korang A, 805 Michel M, Plotkin DL, and Mattingly ML . A novel deep pr ote omic approach in hu man skeletal muscle 806 unveils distinct molecula r signatur es affected by aging and resista nce tr aining. Aging (Albany NY) 16: 807 6631, 2024. 808 38. Blazev R, Carl CS, Ng Y-K, Molendijk J, V oldstedlund CT, Zhao Y , Xiao D, Kueh AJ, Miotto PM, 809 and Haynes VR . Phosphopr ote omics of three e xe rcise modaliti es iden tifies canon ical signaling and 810 C18ORF25 as an AMPK substrat e regula ti ng skeletal muscle function . Cell Metabolism 34: 1561-1577. 811 e1569, 2022. 812 39. Gao S, Zhang G, Zhang Z, Zhu JZ, Li L, Zh ou Y, Rodn ey GG, J r., Abo-Zahrah RS, An derson L, 813 Garcia JM, Kwon YT, and Li YP . UBR2 ta r gets myosin heavy chain IIb and I Ix for de gradatio n: Mol ecular 814 mechanism essenti al for cancer-induced muscle wasting. Proc Natl Acad Sci U S A 119: e2200215119, 815 2022. 816 40. Kwak KS, Zhou X, Sol omon V , Baracos V E, Davis J, Bannon AW, Boyle WJ, Lac ey DL, and Han 817 HQ. Regula tion of pro tein ca tabolism by muscle-specific and cytokine-inducible ubiquitin ligase E3alph a-818 II during cance r cachexi a. Cancer Res 64: 8193-8198, 2004. 819 41. Seaborne RA, Hugh es DC, Turner DC, Owens DJ, Baehr LM, Gorski P, Semenova EA, Borisov 820 OV, Larin AK, Popov DV, Gene rozov EV, Sutherland H, Ah metov II, Jarvis JC, Bodi ne SC, and S harples 821 AP. UBR5 is a novel E3 ubiqui tin ligase in volved in skeletal muscle hyper trophy an d recovery from 822 atrophy . The Journal of Physiology 597: 3 727-3749, 2019. 823 42. Hughes DC, Turner DC, Baehr LM, Seab o rne RA, Viggars M, Jarvis JC, Gorski PP, Stewart CE, 824 Owens DJ, Bodine SC, and Sharples AP . Knockdown of the E3 Ubiquitin ligase UB R5 and its role in 825 skeletal muscle an abolism. American Journal of Physiology-Cell Physiology 320: C 45-C56, 2021. 826 43. Hunt LC, Stover J, Haugen B, Shaw TI, Li Y, Pagala VR, Finkelstein D, Barton ER, Fan Y, and 827 Labelle M. A key role for the ubiq uitin lig ase UBR4 in myofiber hyper trophy in Dro sophila and mice. Cell 828 reports 28: 1268-1281. e1266, 2019. 829 44. Ham DJ, Börsch A, Chojnowska K, Lin S, Leuchtman AB, Ham AS, Thü rkauf M, Delezie J, Furr er 830 R, Burri D, Sinnr eich M, Handschin C, Tin tignac LA, Zavolan M, Mittal N, and Rüe gg MA . Distinct and 831 additive effects of calori e res trictio n and rapamycin in aging skeletal muscle. Nature Communications 832 13: 2025, 2022. 833 45. Ham DJ, Börsch A, Lin S, Thürkauf M, Weihrauch M, Reinhard JR, Delezie J, Battilana F, Wang 834 X, and Kaiser MS . The neuromuscular ju nction is a focal point of mTORC1 signaling in sarcopenia. Nature 835 Communications 11: 1-21, 2020. 836 46. Chiao YA, Kolwicz SC, Basisty N, Gagnidze A, Zhang J, G u H, Djukovic D, Beye r RP, Raftery D, 837 and MacCoss M . R apamycin transi ently i nduces mitochondri al remod eling to r epr ogram energy 838 metabolism in old he arts . Aging (Albany NY) 8: 314, 2016. 839 47. Ebert SM, Dyle MC, Kunkel SD, Bullard S A, Bongers KS, Fox DK, Dierdorff JM, Foster ED, and 840 Adams CM . St ress-induced skel etal musc le Gadd45a exp ression r eprogr ams myonuclei and causes 841 muscle atrophy. J Biol Chem 287: 27290-27301, 2012. 842 48. Hughes DC, Hardee JP, Waddell DS, and Goodman CA . CORP: Gene delive ry into murine skele tal 843 muscle using in vivo electropora tion . Journal of Applied Physiology 133: 41-59, 2022. 844 .CC-BY-NC-ND 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted July 27, 2025. ; https://doi.org/10.1101/2025.07.23.666188doi: bioRxiv preprint 29 49. Hughes DC, Baehr LM, Driscoll JR, Lynch SA, Waddell DS, and Bodi ne SC . Identification and 845 characte riza tion of Fbxl22, a n ovel skelet al muscle atrophy-promo ting E3 ubiquiti n ligase. Am J Physiol 846 Cell Physiol 319: C700-c719, 2020. 847 50. Baehr LM, Hughes DC, Lynch SA, Van Haver D, Maia TM, Marshall AG, Radoshevich L, Im pens 848 F, Waddell DS, and Bodin e SC . Identifica tion of the Mu RF1 skelet al muscle ubiqui tylome thro ugh 849 quanti tative p rot eomics. Function 2: zq a b029, 2021. 850 51. Wen Y, Murac h KA, Vech etti IJ, Jr., Fry C S, Vickery C, Peterson CA, McCarthy JJ, a nd Campbell 851 KS . MyoVision: softwar e for autom ate d high-content an alysis of skeletal muscle i mmunohistochemist ry. 852 J Appl Physiol (1985) 124: 40-51, 2018. 853 52. Viggars MR, Wen Y, Peterson CA, and Ja rvis JC . Au tomat ed cross-section al analys is of trained, 854 severely at rophied , and r ecovering ra t skelet al muscles using MyoVision 2.0. J Appl Physiol (1985) 132: 855 593-610, 2022. 856 53. Parlee SD, Lentz SI, Mori H, and MacDou gald OA . Quantifying size and numbe r of adipocytes in 857 adipose tissu e. Methods Enzymol 537: 93 -122, 2014. 858 54. Castets P, Lin S, Rion N, Di Fulvio S, Rom anino K, Guridi M, Frank S, Tintigna c LA, Sinnrei ch M, 859 and Rüegg MA . Sustained ac tivation of mTORC1 in skeletal muscle inhibits cons t itutive and s tarvati on-860 induced aut ophagy and causes a sever e, late-onse t myopathy. Cell Metab 17: 731 -744, 2013. 861 55. Ching JK, Elizabeth SV, Ju JS, Lusk C, Pitt man SK, and Weihl CC . mTOR dysfunction contribu tes 862 to vacuolar pa thology and weakness in v alosin-containing pr otei n associat ed incl usion body myopathy. 863 Hum Mol Genet 22: 1167-1179, 2013. 864 56. Goodman CA, and Hornberg er TA . Measuring prot ein synthesis with SUnSET: a va lid alter native 865 to tr adition al techn iques? Exerc Sport Sci Rev 41: 107-115, 2013. 866 57. Baehr LM, Tunzi M, and Bodi ne SC . Muscle hypertr ophy is associated wit h increa ses in 867 prote asome activi ty that is ind epend ent of MuRF1 and MAFb x exp ression . Front Physiol 5: 69, 2014. 868 58. Gomes AV, Waddell DS, Si u R, Stein M, Dewey S, Furlow JD, and Bodine SC . Upregulation of 869 prote asome activi ty in muscle RING finge r 1-null mice following denervation . The FASEB Journal 26: 870 2986-2999, 2012. 871 59. Heinemeier KM, Olesen JL, Haddad F, Sc hjerling P, Baldwin KM, and Kjaer M . Eff ect of 872 unloading followed by reloa ding on exp r ession of collagen and rel at ed growth fac tors in ra t ten don and 873 muscle. Journal of applied physiology 10 6: 178-186, 2009. 874 60. Baehr LM, West DWD, Marcotte G, Marshall AG, De Sousa LG, Baar K, and Bodi ne SC . Age-875 relat ed deficits in skele tal muscle r ecove ry following disuse are associat ed with n euromuscular juncti on 876 instability and ER st ress, no t impaire d pr otein synth esis. Aging 8: 127-146, 2016. 877 61. Baehr LM, West DWD, Marshall AG, Ma rcotte GR, Baar K, and Bodi ne SC . Muscl e-specific and 878 age-rela ted changes in pr ot ein synthesis and prot ein degr adati on in respo nse to h indlimb unloading in 879 rats. J Appl Physiol (1985) 122: 1336-135 0, 2017. 880 62. Hughes DC, Marcotte GR, Baehr LM, We st DW, Marshall AG, Ebert SM, Davidyan A, Adams 881 CM, Bodine SC, and Baar K . Altera tions i n the muscle force t ransfer app ara tus in aged rats du ring 882 unloading and r eloading: impac t of microRNA-31. The Journal of physiology 596: 2 883-2900, 2018. 883 63. Biever A, Puighe rmanal E, Nishi A, David A, Panciatici C, Long ueville S, Xi rodimas D, 884 Gangarossa G, Meyuhas O, Hervé D, Gir ault J-A, and Valje nt E . PKA- Dependen t Phosphorylati on of 885 Ribosomal Prot ein S6 Does Not Cor rela te with Translation Efficiency in Stria tonigr al and Stri atop allidal 886 Medium-Sized Spiny N eurons . The Journal of Neuroscience 35: 4113-4130, 2015. 887 64. Bonito-Oliva A, Pallottino S, Bertran- Go nzalez J, Girault J-A, Valje nt E, and Fison e G . 888 Haloperi dol promo tes mTORC1-depend e nt phosphoryla tion of ribosom al prot ein S6 via dopamine- and 889 cAMP-regulate d phosphopr ot ein of 32 kDa and inhibition of pro tein phosp hat ase -1. 890 Neuropharmacology 72: 197-203, 2013. 891 .CC-BY-NC-ND 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted July 27, 2025. ; https://doi.org/10.1101/2025.07.23.666188doi: bioRxiv preprint 30 65. Roux PP, Shahbazian D, Vu H, Holz MK, Cohen MS, Taunton J, Sonen berg N, a nd Blenis J . 892 RAS/ERK signaling promotes sit e-specific ribosomal pro tein S6 phosph orylati on via RSK and stimulates 893 cap-depend ent t ransla tion. J Biol Chem 2 82: 14056-14064, 2007. 894 66. Sartori R, Romanello V, and Sand ri M . Mechanisms of muscle atrophy and hype rt rophy: 895 Implications in he alth an d disease . Nature Communications 12: 1-12, 2021. 896 67. Ogasa wara R, and Suginohara T . Rapamycin-insensitive mechanistic ta rget of rap amycin 897 regulat es basal and r esistanc e ex ercise-i nduced muscle prot ein synthesis . The FASEB Journal 32: 5824-898 5834, 2018. 899 68. Ogasa wara R, Knudsen JR, Li J, Ato S, an d Jensen TE . Rapamycin and mTORC2 inhibition 900 synergistically reduce con trac tion-stimul ated muscle pr otei n synthesis. The Journal of physiology 598: 901 5453-5466, 2020. 902 69. You J-S, McNally RM, Jacobs BL, Priv ett RE, Gunder mann DM, Lin K-H, Stein ert ND, Goodman 903 CA, and Hornberg er TA . The role of rapt or in the mecha nical load-induce d regula tion of mTOR signaling, 904 prote in synthesis, and skel etal muscle hy pert rophy. The FASEB Journal 33: 4021, 2 018. 905 70. Burd NA, Holwerda AM, Selby KC, West DW, Staples AW, Cain NE, Cashaback JG, Potvin JR, 906 Baker SK, and Phillips SM . Resista nce ex ercise volume affects myofibrillar pro tein synthesis and anabolic 907 signalling molecule phosphoryla tion in y oung men. The Journal of physiology 588 : 3119-3130, 2010. 908 71. Williamson D, Gallagher P, Harber M, Hollon C, and Trap pe S . Mitogen-activate d protein kinas e 909 (MAPK) pathway activation: effects of age and acut e ex ercise on human skel eta l muscle. The Journal of 910 physiology 547 : 977-987, 2003. 911 72. Steinert ND, Potts GK, Wilson GM, Klam en AM, Lin KH, Hermanson JB, McNally RM, Coon JJ, 912 and Hornberg er TA . Mapping of the cont raction-induce d phosphop rot eome ide nt ifies TRIM28 as a 913 significant regulat or of skelet al muscle size and function . Cell Rep 34: 108796, 202 1. 914 73. Cho JH, Kim SA, Seo Y -S, Park SG, Park B C, Kim J-H, and Kim S . The p90 ribosomal S6 kinase–915 UBR5 pathway cont rols Toll-like recep tor signaling via miRNA-induced transl ation al inhibition of tumo r 916 necrosis factor r ecep tor –associat ed fact or 3. Journal of Biological Chemistry 292: 11804-11814, 2017. 917 74. Pla-Prats C, and Thomä NH . Quality cont rol of prot ein complex ass embly by the ubiquitin–918 prote asome system. Trends in cell biology 32: 696-706, 2022. 919 75. Komander D, and Rape M . The Ubiquitin Code. Annual Review of Biochemistry 81 : 203-229, 920 2012. 921 76. Hogan AK, Sathyan KM, Willis AB, Khura na S, Srivastava S, Zasadzińska E, Lee AS , Bailey AO, 922 Gaynes MN, and Huang J . UBR7 acts as a histone chap eron e for post-nucleos omal histone H3. The 923 EMBO journal 40: e108307, 2021. 924 77. Taherbhoy AM, and Daniels DL . Harn essing UBR5 for targe ted pr ot ein degrad atio n of key 925 transcrip tional regula tors. Trends in Pharmacological Sciences 2023. 926 78. Duan C-y, Li Y, Zhi H-y, Tian Y, Huang Z -y , Chen S-P, Zhang Y, Li u Q, Zho u L, an d Ji ang X-g . E3 927 ubiquitin ligase UB R5 modulat es circadia n rhythm by facilitating the ubi quitin atio n and degrada tion of 928 the key clock transcrip tion facto r BMAL1. Acta Pharmacologica Sinica 45: 1793-1808, 2024. 929 79. Mark KG, Kolla S, Aguirre JD, Garshott DM, Schmitt S, Haakonsen DL, X u C, Kater L, Kempf G, 930 and Martínez-González B . Orphan qu alit y control shapes ne twork dynamics and gene exp ression . Cell 931 186: 3460-3475. e3423, 2023. 932 80. O'Reilly CL, Bodine SC, and Miller BF . Cu rren t limitati ons and futur e oppo rtuni tie s of tracer 933 studies of muscle ageing. The Journal of Physiology 603: 7, 2023. 934 81. Brandman O, Stewart-Ornstein J, Wong D, Larson A, Williams CC, Li G-W, Zhou S , King D, Shen 935 PS, and Weibezahn J . A ribosome-bound quality control compl ex t riggers degra da tion of nascent 936 peptid es and signals tra nslatio n stress . Cell 151: 1042-1054, 2012. 937 938 .CC-BY-NC-ND 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted July 27, 2025. ; https://doi.org/10.1101/2025.07.23.666188doi: bioRxiv preprint Table 1. Primers used in this study Gene Name Primers Annealing Temp (oC) UBR1 Fwd: TGCTCTGTATGGACTGCTTCC Rev: GGCTCGTGATCCACACAAAAAG 60 UBR2 Fwd: TATTCTCCTCCTTACCTTG Rev: CGAAACCGCTCTTGGCATA 56 UBR4 Fwd: GGGACGCCACCTTCTAACAG Rev: TTCAGAGTGTTCGTCTCCAGC 59 UBR5 Fwd: GTCTGCTGGAGCTCGTGATT Rev: TGCTGGAATAACTGGCTGGG 59 UBR7 Fwd: CGACTCGGAGAAGTGCTCCTA Rev: ACTGCAAGCTAGACAAATCCC 60 Trim63 (MuRF1) Fwd: GCTGGTGGAAAACATCATTGACAT Rev: CATCGGGTGGCTGCCTTT 59 Fbxo32 (MAFbx/Atrogin-1) Fwd: CTTTCAACAGACTGGACTTCTCGA Rev: CAGCTCCAACAGCCTTACTACGT 59 .CC-BY-NC-ND 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted July 27, 2025. ; https://doi.org/10.1101/2025.07.23.666188doi: bioRxiv preprint Empty Vector Akt-CA Laminin/GFP A) B) C) D) F) EV Akt-WT Akt-CA Akt Ser473 rpS6 Ser240/244 S6K1 Thr389 eIF4E eIF4G Puromycin E) rpS6 S6K1 Akt Kda 30 30 75 75 75 75 30 150 250 100 37 .CC-BY-NC-ND 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted July 27, 2025. ; https://doi.org/10.1101/2025.07.23.666188doi: bioRxiv preprint Total Ubiquitin (FK2) UBR5 EV Akt-WT Akt-CA UBR7 UBR4 UBR2 UBR1 A) B) C) UBR7 UBR4 UBR2 UBR1 Control 21d 28d 45d 60d Nerve Crush Injury ModelD) E) UBR5 Kda 150 150 300 250 35 250 100 37 Kda 150 150 300 250 35 .CC-BY-NC-ND 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted July 27, 2025. ; https://doi.org/10.1101/2025.07.23.666188doi: bioRxiv preprint Laminin/GFP Empty Vector Akt-CA Rapa Control A) B) C) D) F) E) Control Rapa EV Akt-CA EV Akt-CA p70S6KThr389 rpS6Ser240/244 4E-BP1Thr37/46 Aktser473 eIF4E Raptor AktThr308 NDRG1Thr346 p90RSKser380 p44/42 MAPKthr202/Tyr204 Puromycin NDRG1 Akt p70S6K rpS6 Kda 250 100 37 75 100 30 30 75 75 75 75 25 25 4E-BP1 30 50 50 35 75 .CC-BY-NC-ND 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted July 27, 2025. ; https://doi.org/10.1101/2025.07.23.666188doi: bioRxiv preprint Total Ubiquitin (FK2) K48-specific Ubiquitin Control diet Rapamycin diet EV Akt-CA EV Akt-CA UBR4 UBR5 UBR7 UBR2 UBR1 A) B) D) C) 250 100 37 Kda 150 150 300 250 35 250 100 37 .CC-BY-NC-ND 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted July 27, 2025. ; https://doi.org/10.1101/2025.07.23.666188doi: bioRxiv preprint Empty Vector Akt-CA Rapa Control EV Akt-CA EV Akt-CA Control diet Rapamycin diet p62 LC3B I/II VCP Autophagy-related proteins ER Stress-related proteins Control diet Rapamycin diet EV Akt-CA EV Akt-CA PDI CHOP eIF2α BiP A) B) C) D) E) F) Kda 25 50 100 25 20 50 75 Kda .CC-BY-NC-ND 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted July 27, 2025. ; https://doi.org/10.1101/2025.07.23.666188doi: bioRxiv preprint A) Bi) C) D) E) F) G) H) Bii) UBR4 UBR5 UBR2 UBR7 UBR1 EV EVUBR5 RNAi UBR5 RNAi Control Rapamycin Kda 150 150 300 250 35 p70S6KThr389 rpS6Ser240/244 Aktser473 p90RSKser380 Puromycin EV EVUBR5 RNAi UBR5 RNAi Control Rapamycin Akt p70S6K rpS6 p90RSK Kda 250 100 37 75 75 30 30 75 75 75 75 ControlRapa UBR5 RNAiEmpty Vector Laminin/GFP .CC-BY-NC-ND 4.0 International licenseavailable under a was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprint (whichthis version posted July 27, 2025. ; https://doi.org/10.1101/2025.07.23.666188doi: bioRxiv preprint