Enhancement of BMP-2-Induced Osteogenic Differentiation of MC3T3-E1 Cells by Dexamethasone through the Smad Signaling Pathway

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher
AI-generated deep summary by claude@2026-06, 2026-06-24 · read from full text

This preprint studied whether low-concentration dexamethasone (DEX; 10−8 M) can synergize with recombinant BMP-2 (100 ng/mL) to enhance osteogenic differentiation in mouse MC3T3-E1 osteoblast precursor cells, using morphology and viability assays plus alkaline phosphatase activity, alizarin red mineralization, and osteogenic gene expression (ALP, RUNX2, OCN, Col-1). The combined treatment did not significantly alter cell morphology or activity relative to controls but increased alkaline phosphatase activity, calcium deposition, and osteogenic markers compared with either agent alone. Mechanistically, Western blotting showed the combination significantly increased Smad1/3/5 expression, while p38 expression was not significantly elevated, implicating BMP–Smad signaling over p38-MAPK. A key caveat is that the work is limited to an in vitro cell model and does not include in vivo or clinical outcome data. The paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via a keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Abstract Tissue-engineered bone is a promising approach for repairing defects in the jawbone caused by tumors, infections, trauma, and congenital malformations, with BMP-2 playing a key role. Clinically, to achieve favorable therapeutic outcomes, the doses of BMP-2 used far exceed the physiological levels found in natural bone, leading to various side effects.To investigate the effectiveness and molecular mechanisms of the synergistic osteogenic action of dexamethasone (DEX) and BMP-2, and to explore effective methods to reduce the dosage of BMP-2 used. The effects of low concentration DEX (10− 8 M) and/or BMP-2 (100 ng/mL) on the morphology and activity of MC3T3-E1 cells were examined in various combinations. The efficacy of their combined use was verified through the detection of alkaline phosphatase, alizarin red staining, and the expression of osteogenesis-related genes. The molecular mechanism of their synergistic action was explored by detecting the expression of proteins in the Smad and p38 signaling pathways. The combined use of low concentration DEX and BMP-2 had no significant impact on the morphology and activity of MC3T3-E1 cells. Compared to the use of DEX or BMP-2 alone, their combined use enhanced the expression of alkaline phosphatase, increased calcium deposition, and significantly elevated the expression of osteogenesis-related genes such as ALP, RUNX2, OCN, and Col-1. Western blot analysis showed that the combined use of DEX and BMP-2 significantly increased the expression of Smad1/3/5, while p38 expression did not show a significant increase. The combined use of low concentration DEX and BMP-2 has a synergistic effect on osteogenic differentiation in MC3T3-E1 cells, acting through the BMPs-Smads signaling pathway rather than the p38-MAPK pathway. The results of this study are expected to reduce the dosage and dosage-related side effects of BMP-2 in jawbone repair, offering new strategies for the use of dosage and mode of growth factors in tissue-engineered bone.
Full text 110,129 characters · extracted from preprint-html · click to expand
Enhancement of BMP-2-Induced Osteogenic Differentiation of MC3T3-E1 Cells by Dexamethasone through the Smad Signaling Pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Enhancement of BMP-2-Induced Osteogenic Differentiation of MC3T3-E1 Cells by Dexamethasone through the Smad Signaling Pathway Yaoxiang Xu, Yali Li, Yanshan Liu, Liqiang Chen, Ming Sun, Li Li, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4303918/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Tissue-engineered bone is a promising approach for repairing defects in the jawbone caused by tumors, infections, trauma, and congenital malformations, with BMP-2 playing a key role. Clinically, to achieve favorable therapeutic outcomes, the doses of BMP-2 used far exceed the physiological levels found in natural bone, leading to various side effects.To investigate the effectiveness and molecular mechanisms of the synergistic osteogenic action of dexamethasone (DEX) and BMP-2, and to explore effective methods to reduce the dosage of BMP-2 used. The effects of low concentration DEX (10 − 8 M) and/or BMP-2 (100 ng/mL) on the morphology and activity of MC3T3-E1 cells were examined in various combinations. The efficacy of their combined use was verified through the detection of alkaline phosphatase, alizarin red staining, and the expression of osteogenesis-related genes. The molecular mechanism of their synergistic action was explored by detecting the expression of proteins in the Smad and p38 signaling pathways. The combined use of low concentration DEX and BMP-2 had no significant impact on the morphology and activity of MC3T3-E1 cells. Compared to the use of DEX or BMP-2 alone, their combined use enhanced the expression of alkaline phosphatase, increased calcium deposition, and significantly elevated the expression of osteogenesis-related genes such as ALP, RUNX2, OCN, and Col-1. Western blot analysis showed that the combined use of DEX and BMP-2 significantly increased the expression of Smad1/3/5, while p38 expression did not show a significant increase. The combined use of low concentration DEX and BMP-2 has a synergistic effect on osteogenic differentiation in MC3T3-E1 cells, acting through the BMPs-Smads signaling pathway rather than the p38-MAPK pathway. The results of this study are expected to reduce the dosage and dosage-related side effects of BMP-2 in jawbone repair, offering new strategies for the use of dosage and mode of growth factors in tissue-engineered bone. Dexamethasone BMP-2 Smad Signaling pathway Osteogenesis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 1. Introduction Jawbone defects caused by tumors, infections, trauma, and congenital malformations are common diseases in the oral and maxillofacial region, severely affecting the appearance, oral function, and psychological state of patients [ 1 , 2 ]. Bone tissue engineering, utilizing tissue engineering technology to form bone in vivo or in vitro, is a promising method for repairing jawbone defects. Three factors are essential in bone tissue engineering, i.e., tissue engineering scaffolds, growth factors, and seed cells. Among numerous osteogenic growth factors, Bone Morphogenetic Protein-2 (BMP-2) reigns as the foremost in both widespread usage and effectiveness [ 3 – 5 ]. BMP-2, a member of the Transforming Growth Factor-β (TGF-β) superfamily, plays a crucial role in recruiting, proliferating, and differentiating osteoprogenitor cells during bone regeneration [ 6 ]. Approved by the FDA for clinical use between 2002 and 2007, BMP-2 found applications in treating conditions like spinal fusion, open tibial fractures, maxillary sinus lifting, and alveolar ridge augmentation [ 5 ]. Despite its efficacy, clinical dosages of BMP-2 often surpass physiological levels [ 7 ], potentially leading to adverse effects including tissue swelling, inflammation, ectopic bone formation, and tumor induction [ 8 , 9 ]. Consequently, efforts by scholars have focused on exploring adjunctive drugs to enhance BMP-2's osteogenic effect and minimize dosage requirements. Research has demonstrated that small molecule drugs such as DEX, simvastatin, hydroxycholesterol, and estrogen can induce osteogenic differentiation in various cells and enhance the osteogenic effect of BMP-2 [ 10 – 13 ]. DEX, a synthetic glucocorticoid (GC) widely employed in clinical practice for its potent anti-inflammatory and immunosuppressive effects, has attracted considerable interest. Its pharmacological concentrations significantly affect bone metabolism [ 14 ]. Previous research has delineated DEX's dual role in bone formation. At low concentrations, it enhances osteoblast growth and differentiation via the classical Wnt signaling pathway [ 15 ], while also boosting osteoblast vitality through autophagy induction by increasing intracellular reactive oxygen species [ 16 ]. However, elevated DEX concentrations inhibit osteoblast differentiation and mineralization. Specifically, at a concentration of 10 mM, DEX disrupts mitochondrial dynamics, promotes adipogenesis, and impedes the osteogenic differentiation of stem cells [ 17 ]. While research has confirmed the synergistic effect of BMP-2 and DEX, the precise mechanism of their action remains incompletely understood. BMP-2, a member of the TGF-β superfamily, engages in signal transduction by binding to type I and type II transmembrane serine/threonine kinase receptors (BMPR-1, BMPR-2). The classical BMPs-Receptor-Smad signaling pathway, crucial in transmitting signals from the cell membrane to the cell interior, is central to this process [ 18 , 19 ]. Additionally, BMP-2 can activate non-Smad pathways like MAPK (mitogen-activated protein kinase), Notch, and Wnt, termed non-classical signaling pathways. Among these, P38, a pivotal member of the MAPK family, facilitates the expression of osteogenic markers such as ALP and Osteocalcin (OCN) by phosphorylating transcription factors Cbfal and Osteri [ 20 ]. Runx2 (Runt-related transcription factor 2), a specific transcription factor for osteogenic differentiation, serves as a convergence point for both the BMPs-Smad pathway and the P38 MAPK pathway. It functions as a target gene of BMPs, enhancing cellular responsiveness to BMPs. Runx2 expression is essential for mesenchymal cell differentiation into the osteoblast lineage, with its absence completely inhibiting osteoblast differentiation and subsequent bone formation [ 21 – 25 ]. Within this theoretical framework, this work investigates the molecular mechanisms of BMP-2 and DEX by detecting the expression of proteins associated with both classical and non-classical signaling pathways. This study utilized mouse embryonic osteoblast precursor cells (MC3T3-E1) to investigate two prominent BMP signaling pathways: BMPs-Smad and p38-MAPK. We evaluated the synergistic effects of BMP-2 and DEX by assessing alkaline phosphatase activity, calcium deposition, and the expression of osteogenic genes. Furthermore, by examining the expression of key components such as Smads and p38 within the BMPs osteogenic signaling pathway, we elucidated the molecular mechanisms underlying the synergistic action of BMP-2 and DEX. These findings may offer valuable insights into optimizing BMP-2 dosage and administration methods in bone tissue engineering. 2. Materials and Methods 2.1. Materials Cyclosporin A, 4',6-diamidino-2-phenylindole (DAPI), fluorescein isothiocyanate (FITC), DEX, alkaline phosphatase (ALP) test kit, alizarin red staining solution, Smad 1/3/5 antibodies, p38 antibodies, and other reagents were purchased from Sigma-Aldrich, USA. Recombinant human Bone Morphogenetic Protein-2 (rhBMP-2) was obtained from Abmole Bioscience, USA. Mouse embryonic osteoblast precursor cells (MC3T3-E1) were provided by Cyagen Biosciences Inc., Shanghai, China. 2.2. Cell Culture DMEM (high glucose) supplemented with 10% FBS and 1% antibiotics (penicillin/streptomycin) served as the basic culture medium. Osteogenic induction medium was prepared by adding 10 mM sodium β-glycerophosphate, 50 µg/mL ascorbic acid, and 0.1 µM DEX to the basic culture medium. The cells were divided into different groups for treatment: a negative control group (Control) using the basic culture medium, and a positive control group (Osteoinductive) using the osteogenic induction medium. Experimental groups were established by adding DEX (10 − 8 M), BMP-2 (100 ng/mL), either individually or in combination to the basic culture medium: BMP-2(-)DEX(+), BMP-2(+)DEX(-), and BMP-2(+)DEX(+). MC3T3-E1 cells, according to these groupings, were cultured in a 37°C incubator with 5% CO₂and 95% humidity. 2.3. Observation of Cell Morphology MC3T3-E1 cells were cultured in media containing DEX and/or BMP-2 for 24 hours, after which the cell morphology and growth were observed under an inverted biological microscope. The culture medium was removed, and the cells were fixed with 3.7% formaldehyde solution for 20 minutes, followed by washing with PBS and preservation with a mounting medium. The cytoplasm and nuclei were stained with FITC-labeled cyclosporin A and DAPI solution, respectively. A fluorescence microscope (TE2000-U, Nikon, Japan) was used to observe the spread and distribution of the cells, as well as the effects of the addition of DEX and BMP-2 on cell morphology. 2.4. Cell Viability Assay Cell viability in the experimental and control groups was assessed using the Cell Counting Kit-8 (CCK-8) method. Frozen MC3T3-E1 cells were revived, cultured, and passaged. Cells in good growth condition from the fourth generation were used for the experiments, prepared as a cell suspension with a concentration of 2.5×10 4 cells/mL. 100 µL of the cell suspension (2500 cells per well) was seeded into each well of a 96-well plate and incubated at 37°C with 5% CO2 for 24 hours. After this incubation period, the original culture medium was discarded, and 100 µL of the various group solutions mentioned previously was added to each well of the experimental groups. At different time points (days 1, 3, and 5), 10 µL of CCK-8 was added to each well, followed by a further 2 hours of incubation. The optical density (OD) at 450 nm wavelength of each well was measured using a microplate reader. The formula for calculating cell survival rate is as follows: \(\text{c}\text{e}\text{l}\text{l} \text{s}\text{u}\text{r}\text{v}\text{i}\text{v}\text{a}\text{l} \text{r}\text{a}\text{t}\text{e}(100\text{%})= \frac{{\text{A}}_{\text{T}\text{e}\text{s}\text{t}}}{{\text{A}}_{\text{C}\text{o}\text{n}\text{t}\text{r}\text{o}\text{l}}} \times 100\text{%}\) (Eq. 1) where A Test and A Control represent the OD values measured at 450 nm for the experimental and control group cells. 2.5. Alkaline Phosphatase (ALP) Activity Assay MC3T3-E1 cells were seeded in a 24-well culture plate at a density of 4×10 5 /cm², with six replicates per group, according to the experimental grouping. On days 7 and 14 of culture induction, the cells were washed three times with PBS, fixed with 4% paraformaldehyde for 30 minutes, and then washed three times with PBS. Subsequently, BCIP/NBT staining working solution (BCIP/NBT Alkaline Phosphatase Color Development Kit, Beyotime) was added to fully cover the cells for 30 minutes of staining. The BCIP/NBT staining solution was then removed, and the cells were rinsed three times with distilled water. The rinse water was discarded, and the cells were observed under a microscope. Cells were lysed using 1% Triton X-100, and the lysed cells were scraped off and transferred to an EP tube for centrifugation (4°C, 12000 rpm) for 30 minutes. The supernatant was transferred to a new, labeled EP tube. The optical density (OD) at 520 nm was measured using a microplate assay (Alkaline Phosphatase ALP Test Kit, Sigma-Aldrich, USA), with the experiment repeated three times. 2.6. Alizarin Red Staining and Quantitative Analysis Following the experimental groupings from section 2.2, MC3T3-E1 cells were seeded at a density of 4×105/cm² in a 24-well culture plate, with six replicates per group. After 14 and 21 days of culture and induction at 37°C in a cell incubator, the cells were washed three times with PBS and fixed with 4% paraformaldehyde solution for 30 minutes. Following three washes with deionized water, the cells were fully covered with 2% Alizarin Red S solution for 30 minutes to stain. The cells were then washed three times with deionized water to remove excess Alizarin Red staining solution and observed under a microscope. 100 nmol/L cetylpyridinium chloride was added to dissolve the Alizarin Red stain chelated with calcium, and the solution was decolorized at room temperature for 1 hour. The optical density (OD) at 562 nm was measured, with the experiment repeated three times. 2.7. Real-Time Quantitative PCR (RT-PCR) Analysis Table 1 RT-PCR Primer Sequences for Osteogenesis-Related Genes Gene Forward primer sequence (5’–3’) Reverse primer sequence (5’–3’) ALP GTTGCCAAGCTGGGAAGAACAC CCCACCCCGCTATTCAAAC RUNX2 TTCTCCAACCCACGAATGCAC CAGGTACGTGTGGTAGTGAGT OCN GAACAGACTCCGGCGCTA AGGGAGGATCAAGTCCCG Col-1 AACATGACCAAAAACCAAAAGTG CATTGTTTCCTGTGTCTTCTGG MC3T3-E1 cells were seeded at a density of 4×10 5 /cm² in 12-well culture plates according to the experimental groupings. The cells were cultured in a 37°C incubator for 7 and 14 days, after which the expression of osteogenesis-related genes such as ALP, RUNX2, OCN, and Col-1 was detected through RT-PCR. Total RNA was extracted from the cells using Trizol reagent. First-strand cDNA was synthesized according to the kit instructions (Takara, Japan). Subsequently, the cDNA was diluted 10-fold with sterile distilled water, and 4 µL of the diluted cDNA was added to the RT-PCR reaction mixture using the SYBR Premix Ex TaqTM kit (Takara, Japan). The RT-PCR reaction mixture was prepared as follows: the 10 µL solution contained 4 µL of diluted cDNA, 1×SYBR Premix Ex Taq (5 µL), 0.4 µL of each primer (0.2 µM), and 0.2 µL of ROX reference dye (50×). The RT-PCR protocol was as follows: initial denaturation at 95°C for 30 s, followed by 40 cycles of 95°C for 5 s and 60°C for 34 s. The sequences of primers used for RT-PCR amplification are shown in Table 1. 2.8. Western Blot Analysis MC3T3-E1 cells were seeded at a density of 4×10 5 cells/cm² in a 24-well culture plate and cultured for 7 days. The cells were lysed using RIPA lysis buffer. A 10 µL sample of the protein was taken, separated on an SDS-PAGE gel, and then transferred to a PVDF membrane, which was subsequently blocked. Primary antibodies (including Smad1/5/8, p38, and anti-actin antibodies) were diluted 500 times and added to the membrane for overnight incubation at 4°C. After washing the membrane, it was incubated with secondary antibodies for 1 hour, and the protein bands were visualized using imaging technology. 2.9. Statistical Analysis Statistical analysis of the measured results was conducted using SPSS software version 26.0. Data are presented as means ± standard deviation (SD). Comparisons between groups were made using one-way analysis of variance (ANOVA). P<0.05 was considered to indicate a statistically significant difference. 3. Results 3.1. Observation of Cell Morphology After 24 hours of cell culture, observation with an inverted microscope showed that the morphology of MC3T3-E1 cells in both the experimental and control groups was consistent, predominantly fusiform or polygonal, with cells closely arranged. The BMP-2(+)DEX(+) group displayed a denser cell arrangement than other groups, with more pronounced polygonal shapes and more significant cytoplasmic projections (Fig. 1). Fluorescence microscopy revealed clear cell contours, polygonal shapes, and good spreading. Cell nuclei were stained blue, and the cell skeleton was clearly displayed without any abnormalities observed (Fig. 2). 3.2. Cell Viability Assay The cell survival rates of the experimental and control groups were assessed on days 1, 3, and 5. The results (shown in Fig. 3), indicate that at the specified concentrations of DEX and BMP-2, cells exhibited sustained high viability over a 5-day period, with survival rates consistently exceeding 90% across all groups, in comparison to the negative control group. Statistical analysis indicated no significant differences between the groups (P > 0.05). 3.3. Alkaline Phosphatase (ALP) Activity Assay On days 7 and 14 of MC3T3-E1 cell culture, ALP staining was observed under a microscope (Fig. 4). The Control group exhibited the lightest staining, while the BMP-2(+)DEX(+) group showed the darkest staining, followed by the BMP-2(+)DEX(-) group, Osteoinductive group, and BMP-2(-)DEX(+) group. Quantitative analysis of ALP further validated the osteogenic effects among the groups, as shown in Fig. 5. With time, the ALP activity in the Osteoinductive, BMP-2(+)DEX(-), and BMP-2(+)DEX(+) groups increased, showing a time-dependent pattern. The Control group and BMP-2(-)DEX(+) group exhibited only a slight increase in ALP activity over time, with no significant difference between them (P > 0.05). At all tested time points, the BMP-2(+)DEX(+) group displayed the highest alkaline phosphatase activity, significantly higher than that of the groups using BMP-2 alone (P < 0.01) or DEX alone (P < 0.001). 3.4. In Vitro Mineralization Analysis As seen in the Alizarin Red staining in Fig. 6, after 14 days of culture of MC3T3-E1 cells, the Control group and the BMP-2(-)DEX(+) group exhibited minimal staining, with no discernible calcium deposition evident. The BMP-2(+)DEX(+) group exhibited the deepest staining, followed by the BMP-2(+)DEX(-) group and the Osteoinductive group. Quantitative analysis of Alizarin Red staining (Fig. 7) revealed that over time, the Control group and the BMP-2(-)DEX(+) group exhibited only minor mineralization, while calcium deposition gradually increased in the Osteoinductive group, BMP-2(+)DEX(-) group, and BMP-2(+) DEX(+) group. At the selected time points for analysis, the BMP-2(+)DEX(+) group had the highest amount of calcium deposition, significantly more than the BMP-2(+)DEX(-) group (P < 0.05), the BMP-2(-)DEX(+) group (P < 0.01), and the Osteoinductive group (P 0.05). 3.5. Expression of Osteogenesis-Related Genes The expression of osteogenesis-related genes such as ALP, RUNX2, Col-1, and OCN was detected using RT-PCR (Fig. 8). As observed, on day 7 of MC3T3-E1 cell culture, the highest expression levels of all four osteogenesis-related genes were observed in the BMP-2(+)DEX(+) group, followed by the BMP-2(+)DEX(-) group and the Osteoinductive group. The lowest expressions were noted in the Control group and the BMP-2(-)DEX(+) group. The expression of osteogenic genes in both the Control group and the BMP-2(-)DEX(+) group was relatively low, with no significant difference between them (P > 0.05). The BMP-2(+)DEX(+) group exhibited higher expression levels compared to the groups using BMP-2 alone (P < 0.01) or DEX alone (P < 0.001). 3.6. Detection of Signaling Pathway-Related Proteins On day 7 of MC3T3-E1 cell culture, the expression of smad1/5/8 and p38 proteins in the BMP-2 osteogenic signaling pathway was detected using western blot. The western blot bands (Fig. 9A) indicated that, compared to the Control group, both the BMP-2(+)DEX(+) and BMP-2(+)DEX(-) groups exhibited higher expression of phosphorylated smad1/5/8, with the BMP-2(+)DEX(+) group showing stronger expression than the BMP-2(+)DEX(-) group, followed by the Osteoinductive group. The expression of smad1/5/8 in the BMP-2(-)DEX(+) group was lower, suggesting that the addition of DEX enhanced the expression of smad1/5/8 in the BMP-2 osteogenic signaling pathway. The expression of p38 was most pronounced in the BMP-2(+)DEX(+) and BMP-2(+)DEX(-) groups, followed by the Osteoinductive group, with the BMP-2(-)DEX(+) and Control groups showing lower expression. Quantitative analysis of the protein bands (Figs. 9B and 9C) showed that the expression of phosphorylated smad1/5/8 was strongest in the BMP-2(+)DEX(+) group, with significant differences compared to the BMP-2(+)DEX(-) and BMP-2(-)DEX(+) groups (P 0.05), indicating that the addition of DEX did not enhance the expression of p38 in the BMP-2 osteogenic signaling pathway. 4. Discussion BMP-2 plays a powerful regulatory role in bone and cartilage formation and repair, making it a pivotal component in bone tissue engineering. Physiologically, BMP-2 levels in human natural bone are low, approximately 1–2 ng per gram of cortical bone, markedly contrasting with the initial therapeutic doses for long bone defects (10–12 mg) [ 26 ]and the currently recommended concentration (1.5 µg/kg) [ 27 ]. To date, there exists no standardized dosage for BMP-2, and in clinical practice, achieving optimal osteogenic effects often requires dosages and concentrations significantly exceeding normal physiological levels. However, studies have revealed that the osteogenic efficacy of BMP-2 is not strongly correlated with dosage; instead, maintaining a specific concentration for sustained release proves more crucial [ 5 , 28 ]. Conversely, the administration of BMP-2 in large doses and high concentrations can lead to adverse reactions, including local inflammation, hematoma formation, ectopic bone formation, and potentially tumorigenesis [ 29 , 33 ]. To attenuate the dosage of BMP-2 while ensuring consistent and sustained drug concentrations, current strategies emphasize investigating drug synergies and controlled-release technologies. Howard et al. [ 34 ] utilized self-assembling layer-by-layer film deposition to incorporate a modest BMP-2 dosage (0.5 µg) into films for rat cranial defect repair. Their findings demonstrated that BMP-2 sustained release over 30 days yielded superior osteogenic effects compared to shorter release durations (2, 4, and 14 days) at the same dosage, validating the impact of BMP-2 release kinetics on therapeutic outcomes. Despite various approaches employed to reduce BMP-2 dosage, it still exceeds physiological levels in native bone. Studies have validated the osteogenic enhancement of BMP-2 by growth factors such as Vascular Endothelial Growth Factor (VEGF), basic Fibroblast Growth Factor (FGF), and Platelet-Rich Plasma (PRP), which exhibit synergistic effects when combined with BMP-2 [ 35 – 38 ]. Compared to growth factors, small molecule drugs like DEX, simvastatin, hydroxycholesterol, and estrogen can also enhance the osteogenic action of BMP-2 [ 10 , 11 , 39 – 42 ], and they are more readily available and less expensive. Studies indicate that the effect of DEX on bone may be related to the concentration used, with low concentrations ( 10 − 6 M) having an inhibitory effect [ 14 , 17 ]. For different species, cell lines, and culturing methods, the concentrations of BMP-2 and DEX used also vary, usually lower in in vitro experiments. Based on previous related studies [ 13 , 15 , 16 , 44 ], this experiment used low concentrations of BMP-2 (100 ng/mL) combined with low concentrations of DEX (10 − 8 M) to study their osteogenic effects on MC3T3-E1 cells in vitro. MC3T3-E1 cells are a cell line widely used in osteogenesis research. Under osteogenic induction conditions, they can differentiate into osteoblasts and express osteogenesis-related specific genes such as Alkaline Phosphatase (ALP), OCN, and Bone Morphogenetic Proteins (BMP). Moreover, MC3T3-E1 cells have strong proliferative capabilities and can be passaged indefinitely, overcoming the limitations of primary cells, such as poor proliferative ability, long culture periods, and weak transfection capability. As precursors to osteoblasts, they can simulate the entire process of osteogenesis and are commonly used in studies on bone biomaterials and bone regeneration [ 45 ]. In this experiment, MC3T3-E1 cells, which were subjected to predetermined concentrations of BMP-2 and DEX induction, exhibited no notable decrease in cell count after 24 hours of culture compared to the control group, as observed under an inverted and fluorescence microscope. Notably, cells maintained distinct contours and exhibited robust spreading, indicative of heightened cell viability. The preservation of cellular morphology, including intact cytoskeletal structures, further suggested optimal cellular function. Additionally, the experimental group displayed healthy cytoskeletal integrity, signifying cellular robustness, alongside notable cytoplasmic protrusions, indicative of MC3T3-E1 cell differentiation towards osteoblasts. The cell survival rate assessed by the CCK-8 assay showed that after 5 days of culture, the survival rate in all groups was above 90% compared to the control group, indicating that the selected concentrations of BMP-2 and DEX have no significant cytotoxic effects. This experiment focuses on achieving effective osteogenesis while mitigating the dosage and adverse reactions associated with BMP-2, accomplished through its synergistic action with DEX. Jiang F et al., [ 46 ] found that low doses of BMP-2 did not promote new bone formation but triggered M1 macrophages to release IL-1β. The addition of DEX promoted osteogenesis by inhibiting M1 polarization and enhancing BMP-2 induced differentiation of Mesenchymal Stem Cells (MSCs). Similarly, Li L and colleagues [ 47 ] developed a nano-particle-embedded electrospun fiber scaffold for dual delivery of BMP-2 and DEX, showing strong induction of osteoblast differentiation due to the synergistic action of BMP-2 and DEX, with dual-drug-loaded nano-fiber scaffolds demonstrating the best repair effects. In line with these findings, our experiments validated the enhanced osteogenic effect of low-concentration DEX on low-concentration BMP-2 through various assays including ALP activity, in vitro mineralization, and PCR of osteogenesis-related genes. Alkaline Phosphatase (ALP) is one of the marker enzymes for osteoblast maturation and an early marker of cellular osteogenesis, reflecting the activity and function of osteoblasts. Studies have shown ALP expression within 3 days of osteoblast culture, peaking at 14 days [ 48 ]. Our experiment observed ALP expression at days 7 and 14, with the Control and BMP-2(-)DEX(+) groups showing weaker expression and only slight increases over time, indicating weak osteogenic differentiation in basic medium and DEX alone. The BMP-2(+)DEX(+), BMP-2(+)DEX(-), and Osteoinductive groups showed increased ALP activity over time, with the BMP-2(+)DEX(+) group displaying the strongest activity at all tested times, indicating a synergistic effect of combined BMP-2 and DEX use. Alizarin Red Staining (ARS) detected the formation of calcium nodules after osteogenic differentiation. By day 14, calcium nodule formation commenced, reaching its peak between days 21 and 28, serving as a critical late-stage marker of osteogenesis. Through ARS and quantitative analysis at days 14 and 21, the Control and BMP-2(-)DEX(+) groups exhibited only a mild increase in staining over time, with limited calcium deposition. Conversely, the BMP-2(+)DEX(+), BMP-2(+)DEX(-), and Osteoinductive groups displayed progressively deeper staining and increased calcium nodules, with the BMP-2(+)DEX(+) group exhibiting the most pronounced calcium deposition, thereby further confirming the enhancing effect of DEX on BMP-2's osteogenic action. The expression of genes such as ALP, Runx2, Col-1, and OCN served as crucial markers of osteoblastic bone function. ALP, Runx2, and Col-1 were expressed within the first three days post-osteogenic induction, while OCN expression became detectable after 3 days, increasing over time [ 14 ]. On day 7 of osteogenic induction in MC3T3-E1 cells, the expression of osteogenesis-related genes ALP, Runx2, Col-1, and OCN was evident, with minimal expression observed in the Control and BMP-2(-)DEX(+) groups, and the most robust expression observed in the BMP-2(+)DEX(+) group, surpassing that of BMP-2 or DEX used alone. This genetic evidence confirms that the combined use of BMP-2 and DEX can promote heightened expression of osteogenic genes, demonstrating a synergistic effect. The BMPs-Smad pathway is the classical signaling pathway for BMP-2-induced osteogenic differentiation. BMP-2 first binds to type I and II transmembrane receptors to form a heterodimer, activating the Smad complex to form phosphorylated Smad1/5/8, which then regulates the expression of downstream Runx2 to promote osteogenic differentiation [ 22 , 24 ]. The p38-MAPK pathway is one of the non-classical signaling pathways for BMP-2-induced osteogenic differentiation, where phosphorylated p38 can also regulate osteogenic differentiation through RUNX2 [ 25 , 49 ]. Studies have shown that DEX is hydrophobic and mainly enters cells by binding to cell membrane receptors, forming an endocytic vesicle for cellular entry, and then releasing in the cytoplasm 15. Lu MF et al., [ 50 ] studied the expression of Smad3 in the osteogenic process of MC3T3-E1 cells under the concentration of 10 − 7 M DEX, showing that this concentration of DEX significantly inhibited Smad-stimulated ALP activity, thereby inhibiting osteogenesis. Gan Qi et al., [ 51 ] prepared a gelatin sponge scaffold loaded with BMP-2 and DEX to study the osteogenic activity of the dual drugs, finding that 100 nM DEX could significantly enhance BMP-2 induced ALP activity and ALP mRNA expression in C2C12 cells through a RUNX2-dependent pathway compared to the use of BMP-2 or DEX alone. Thus, DEX can inhibit or enhance osteogenesis through the BMPs-Smad pathway, potentially related to its concentration. Western blot analysis of Smad protein expression within the BMP-2 signaling pathway revealed that DEX alone did not augment Smad1/5/8 levels, whereas BMP-2 alone promoted their elevation. Furthermore, the addition of DEX further enhanced Smad1/5/8 expression, suggesting potential synergy via the BMPs-Smad pathway in the MC3T3-E1 cell line. Conversely, analysis of p38 expression indicated that DEX alone did not significantly impact p38 levels, while BMP-2 alone elevated them. Interestingly, the combined use of BMP-2 and DEX did not further increase p38 expression, implying that their synergistic action may not involve the p38-MAPK signaling pathway. Therefore, the inferred mechanism of synergistic action between BMP-2 and DEX (as depicted in Fig. 10 ) suggests that BMP-2 binds to transmembrane receptors, forming a heterodimer and activating the BMPs-Smads signaling pathway, while DEX enhances BMP-2's osteogenic effect through this pathway. 5. Conclusions The combined use of low concentrations of BMP-2 and DEX has a synergistic effect on osteogenic differentiation in MC3T3-E1 cells, likely acting through the BMPs-Smads signaling pathway rather than the p38-MAPK pathway. The results of this study hold the potential to reduce the dosage of BMP-2 used in jawbone repair, thereby minimizing the incidence of dose-related side effects. This lays a theoretical foundation for the use and dosage of growth factors in tissue-engineered bone and offers new insights into treatments for jawbone defects. Declarations The authors declare that they have no competing interests as defined by BMC, or other interests that might be perceived to influence the results and/or discussion reported in this paper. The results/data/figures in this manuscript have not been published elsewhere, nor are they under consideration (from you or one of your Contributing Authors) by another publisher. Funding This research was funded by the Shandong Province Medical and Health Technology Development Plan Project (grant number:202308020875 and 202208020979), the Qingdao Medical and Health Research Program (grant number: 2023-2-005-YY and 2021-WJZD193), the Qingdao University Affiliated Hospital Clinical Medicine + X Scientific Research Project (grant number: QDFY + X 2023207 and 202101041), and Qingdao Key Health Discipline Development Fund and Oral Medicine Climbing Discipline Project in Qingdao. Author Contribution Conceptualization, Y.X. and Y.L.; methodology, Y.L.; software, M.S.; validation, Y.L., and L.C.; formal analysis, M.S.; resources, J.S.; data curation, X.G.; writing—original draft preparation, Y.X.; writing—review and editing, Z.X.; visualization, L.L.; supervision, J.S.; project administration, Z.X. and J.S; funding acquisition, Z.X. and J.S. References Dalfino S, Savadori P, Piazzoni M, et al. Regeneration of Critical-Sized Mandibular Defects Using 3D-Printed Composite Scaffolds: A Quantitative Evaluation of New Bone Formation in In Vivo Studies. Adv Healthc Mater. 2023;12(21):e2300128. Zhang Q, Wu W, Qian C, et al. Advanced biomaterials for repairing and reconstruction of mandibular defects. Mater Sci Eng C Mater Biol Appl. 2019;103:109858. Wu Z, Bao C, Zhou S, et al. The synergetic effect of bioactive molecule-loaded electrospun core-shell fibres for reconstruction of critical-sized calvarial bone defect-The effect of synergetic release on bone Formation. Cell Prolif. 2020;53(4):e12796. Paulini M, Camal Ruggieri IN, Ramallo M, et al. Recombinant Proteins-Based Strategies in Bone Tissue Engineering. Biomolecules. 2021;12(1). Schmidt-Bleek K, Willie BM, Schwabe P, Seemann P, Duda GN. BMPs in bone regeneration: Less is more effective, a paradigm-shift. Cytokine Growth Factor Rev. 2016;27:141-148. Salazar VS, Gamer LW, Rosen V. BMP signalling in skeletal development, disease and repair. Nat Rev Endocrinol. 2016;12(4):203-221. Ma D, An G, Liang M, Liu Y, Zhang B, Wang Y. A composited PEG-silk hydrogel combining with polymeric particles delivering rhBMP-2 for bone regeneration. Mater Sci Eng C Mater Biol Appl. 2016;65:221-231. Gelebart P, Cuenot S, Sinquin C, et al. Microgels based on Infernan, a glycosaminoglycan-mimetic bacterial exopolysaccharide, as BMP-2 delivery systems. Carbohydr Polym. 2022;284:119191. Oliver-Cervello L, Martin-Gomez H, Mandakhbayar N, et al. Mimicking Bone Extracellular Matrix: From BMP-2-Derived Sequences to Osteogenic-Multifunctional Coatings. Adv Healthc Mater. 2022;11(20):e2201339. Chen PY, Sun JS, Tsuang YH, Chen MH, Weng PW, Lin FH. Simvastatin promotes osteoblast viability and differentiation via Ras/Smad/Erk/BMP-2 signaling pathway. Nutr Res. 2010;30(3):191-199. Huang Y, Lin Y, Rong M, Liu W, He J, Zhou L. 20(S)-hydroxycholesterol and simvastatin synergistically enhance osteogenic differentiation of marrow stromal cells and bone regeneration by initiation of Raf/MEK/ERK signaling. J Mater Sci Mater Med. 2019;30(8):87. Aghaloo TL, Amantea CM, Cowan CM, et al. Oxysterols enhance osteoblast differentiation in vitro and bone healing in vivo. J Orthop Res. 2007;25(11):1488-1497. Mikami Y, Asano M, Honda MJ, Takagi M. Bone morphogenetic protein 2 and DEX synergistically increase alkaline phosphatase levels through JAK/STAT signaling in C3H10T1/2 cells. J Cell Physiol. 2010;223(1):123-133. Luppen CA, Smith E, Spevak L, Boskey AL, Frenkel B. Bone BMP-2 restores mineralization in glucocorticoid-inhibited MC3T3-E1 osteoblast cultures. J Bone Miner Res. 2003;18(7):1186-1197. Han L, Wang B, Wang R, Gong S, Chen G, Xu W. The shift in the balance between osteoblastogenesis and adipogenesis of mesenchymal stem cells mediated by glucocorticoid receptor. Stem Cell Res Ther. 2019;10(1):377. Zhang S, Liu Y, Liang Q. Low-dose DEX affects osteoblast viability by inducing autophagy via intracellular ROS. Mol Med Rep. 2018;17(3):4307-4316. Hong D, Chen HX, Yu HQ, et al. Quantitative proteomic analysis of DEX-induced effects on osteoblast differentiation, proliferation, and apoptosis in MC3T3-E1 cells using SILAC. Osteoporos Int. 2011;22(7):2175-2186. Manzari-Tavakoli A, Babajani A, Farjoo MH, Hajinasrollah M, Bahrami S, Niknejad H. The Cross-Talks Among Bone Morphogenetic Protein (BMP) Signaling and Other Prominent Pathways Involved in Neural Differentiation. Front Mol Neurosci. 2022;15:827275. Beederman M, Lamplot JD, Nan G, et al. BMP signaling in mesenchymal stem cell differentiation and bone formation. J Biomed Sci Eng. 2013;6(8A):32-52. Liu M, Goldman G, MacDougall M, Chen S. BMP Signaling Pathway in Dentin Development and Diseases. Cells. 2022;11(14). Liu DD, Zhang CY, Liu Y, Li J, Wang YX, Zheng SG. RUNX2 Regulates Osteoblast Differentiation via the BMP4 Signaling Pathway. J Dent Res. 2022;101(10):1227-1237. Qin X, Jiang Q, Komori H, et al. Runt-related transcription factor-2 (Runx2) is required for bone matrix protein gene expression in committed osteoblasts in mice. J Bone Miner Res. 2021;36(10):2081-2095. Dai Q, Xu Z, Ma X, et al. mTOR/Raptor signaling is critical for skeletogenesis in mice through the regulation of Runx2 expression. Cell Death Differ. 2017;24(11):1886-1899. Phimphilai M, Zhao Z, Boules H, Roca H, Franceschi RT. BMP signaling is required for RUNX2-dependent induction of the osteoblast phenotype. J Bone Miner Res. 2006;21(4):637-646. Wu M, Chen G, Li YP. TGF-beta and BMP signaling in osteoblast, skeletal development, and bone formation, homeostasis and disease. Bone Res. 2016;4:16009. Jones AL, Bucholz RW, Bosse MJ, et al. Recombinant human BMP-2 and allograft compared with autogenous bone graft for reconstruction of diaphyseal tibial fractures with cortical defects. A randomized, controlled trial. J Bone Joint Surg Am. 2006;88(7):1431-1441. Wozney JM, Rosen V, Celeste AJ, et al. Novel regulators of bone formation: molecular clones and activities. Science. 1988;242(4885):1528-1534. Lytle EJ, Lawless MH, Paik G, Tong D, Soo TM. The minimally effective dose of bone morphogenetic protein in posterior lumbar interbody fusion: a systematic review and meta-analysis. Spine J. 2020;20(8):1286-1304. James AW, LaChaud G, Shen J, et al. A Review of the Clinical Side Effects of Bone BMP-2. Tissue Eng Part B Rev. 2016;22(4):284-297. Seo BB, Choi H, Koh JT, Song SC. Sustained BMP-2 delivery and injectable bone regeneration using thermosensitive polymeric nanoparticle hydrogel bearing dual interactions with BMP-2. J Control Release. 2015;209:67-76. Lu HT, Lin C, Wang YJ, et al. Sequential deacetylation/self-gelling chitin hydrogels and scaffolds functionalized with fucoidan for enhanced BMP-2 loading and sustained release. Carbohydr Polym. 2023;315:121002. Bouyer M, Guillot R, Lavaud J, et al. Surface delivery of tunable doses of BMP-2 from an adaptable polymeric scaffold induces volumetric bone regeneration. Biomaterials. 2016;104:168-181. Skovrlj B, Koehler SM, Anderson PA, et al. Association Between BMP-2 and Carcinogenicity. Spine. 2015;40(23):1862-1871. Howard MT, Wang S, Berger AG, et al. Sustained release of BMP-2 using self-assembled layer-by-layer film-coated implants enhances bone regeneration over burst release. Biomaterials. 2022;288:121721. Stamnitz S, Krawczenko A, Szalaj U, et al. Osteogenic Potential of Sheep Mesenchymal Stem Cells Preconditioned with BMP-2 and FGF-2 and Seeded on an nHAP-Coated PCL/HAP/beta-TCP Scaffold. Cells. 2022;11(21). Nedorubova IA, Bukharova TB, Mokrousova VO, et al. Comparative Efficiency of Gene-Activated Matrices Based on Chitosan Hydrogel and PRP Impregnated with BMP2 Polyplexes for Bone Regeneration. Int J Mol Sci. 2022;23(23). Liu K, Meng CX, Lv ZY, et al. Enhancement of BMP-2 and VEGF carried by mineralized collagen for mandibular bone regeneration. Regen Biomater. 2020;7(4):435-440. Geng Y, Duan H, Xu L, et al. BMP-2 and VEGF-A modRNAs in collagen scaffold synergistically drive bone repair through osteogenic and angiogenic pathways. Commun Biol. 2021;4(1):82. Bakshi R, Hokugo A, Zhou S, et al. Application of Hydroxycholesterols for Alveolar Cleft Osteoplasty in a Rodent Model. Plast Reconstr Surg. 2019;143(5):1385-1395. Park JB. Combination of simvastatin and bone BMP-2 enhances the differentiation of osteoblasts by regulating the expression of phospho-Smad1/5/8. Exp Ther Med. 2012;4(2):303-306. Wei A, Leong A, Williams L, et al. BMP-7 in combination with estrogen enhances bone formation in a fracture callus explant culture. Tohoku J Exp Med. 2010;221(1):61-68. Pauly S, Luttosch F, Morawski M, Haas NP, Schmidmaier G, Wildemann B. Simvastatin locally applied from a biodegradable coating of osteosynthetic implants improves fracture healing comparable to BMP-2 application. Bone. 2009;45(3):505-511. Chen Y, Kawazoe N, Chen G. Preparation of DEX-loaded biphasic calcium phosphate nanoparticles/collagen porous composite scaffolds for bone tissue engineering. Acta Biomater. 2018;67:341-353. Mikami Y, Lee M, Irie S, Honda MJ. DEX modulates osteogenesis and adipogenesis with regulation of osterix expression in rat calvaria-derived cells. J Cell Physiol. 2011;226(3):739-748. Czekanska EM, Stoddart MJ, Richards RG, Hayes JS. In search of an osteoblast cell model for in vitro research. Eur Cell Mater. 2012;24:1-17. Jiang F, Qi X, Wu X, et al. Regulating macrophage-MSC interaction to optimize BMP-2-induced osteogenesis in the local microenvironment. Bioact Mater. 2023;25:307-318. Li L, Zhou G, Wang Y, Yang G, Ding S, Zhou S. Controlled dual delivery of BMP-2 and DEX by nanoparticle-embedded electrospun nanofibers for the efficient repair of critical-sized rat calvarial defect. Biomaterials. 2015;37:218-229. Vimalraj S. Alkaline phosphatase: Structure, expression and its function in bone mineralization. Gene. 2020;754:144855. Chen G, Deng C, Li YP. TGF-beta and BMP signaling in osteoblast differentiation and bone formation. Int J Biol Sci. 2012;8(2):272-288. Iu MF, Kaji H, Sowa H, Naito J, Sugimoto T, Chihara K. DEX suppresses Smad3 pathway in osteoblastic cells. J Endocrinol. 2005;185(1):131-138. Gan Q, Pan H, Zhang W, Yuan Y, Qian J, Liu C. Fabrication and evaluation of a BMP-2/DEX co-loaded gelatin sponge scaffold for rapid bone regeneration. Regen Biomater. 2022;9:rbac008. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4303918","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":297445539,"identity":"500a984c-418c-43ba-955f-b124c969e390","order_by":0,"name":"Yaoxiang Xu","email":"","orcid":"","institution":"The Affiliated Hospital of Qingdao University, Qingdao University","correspondingAuthor":false,"prefix":"","firstName":"Yaoxiang","middleName":"","lastName":"Xu","suffix":""},{"id":297445541,"identity":"ea6b1557-db45-4f33-8fa6-aa2f780d16a3","order_by":1,"name":"Yali Li","email":"","orcid":"","institution":"The Affiliated Hospital of Qingdao University, Qingdao University","correspondingAuthor":false,"prefix":"","firstName":"Yali","middleName":"","lastName":"Li","suffix":""},{"id":297445543,"identity":"3713d1fd-4196-47a7-ac18-e3470b6c40f8","order_by":2,"name":"Yanshan Liu","email":"","orcid":"","institution":"The Affiliated Hospital of Qingdao University, Qingdao University","correspondingAuthor":false,"prefix":"","firstName":"Yanshan","middleName":"","lastName":"Liu","suffix":""},{"id":297445545,"identity":"4b77fa45-ee42-4d8e-833a-1b133c9014c1","order_by":3,"name":"Liqiang Chen","email":"","orcid":"","institution":"The Affiliated Hospital of Qingdao University, Qingdao University","correspondingAuthor":false,"prefix":"","firstName":"Liqiang","middleName":"","lastName":"Chen","suffix":""},{"id":297445546,"identity":"0ce002d9-9228-43e5-b9c5-f0c426cc55ed","order_by":4,"name":"Ming Sun","email":"","orcid":"","institution":"The Affiliated Hospital of Qingdao University, Qingdao University","correspondingAuthor":false,"prefix":"","firstName":"Ming","middleName":"","lastName":"Sun","suffix":""},{"id":297445548,"identity":"0d4199b3-899c-4653-9a9e-1392d391896b","order_by":5,"name":"Li Li","email":"","orcid":"","institution":"The Affiliated Hospital of Qingdao University, Qingdao University","correspondingAuthor":false,"prefix":"","firstName":"Li","middleName":"","lastName":"Li","suffix":""},{"id":297445551,"identity":"9a236789-226e-49e2-8f9f-83ab404dad96","order_by":6,"name":"Xiaohan Gao","email":"","orcid":"","institution":"The Affiliated Hospital of Qingdao University, Qingdao University","correspondingAuthor":false,"prefix":"","firstName":"Xiaohan","middleName":"","lastName":"Gao","suffix":""},{"id":297445554,"identity":"449988e3-a1d3-4f2f-b377-7286d4ae1be6","order_by":7,"name":"Zexian Xu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAArUlEQVRIiWNgGAWjYBACCQhlw8PP30CaljQZyRkHSNNy2MagIYFILZLtOWaSP9vO8xgwHGD88DGHCC3SPM/SJCTO3OYxZ25glpy5jQgtchLJxyQMKm7zWDYcYGPmJU5LYptEgsE5HoMDCURqkQbZcqDiAAlaJHueJVs2nEnmkZxxsJk4v0gczzG8+bPNzp6fv/ngh4/EaGFgSIAxGBuIUo+sZRSMglEwCkYBDgAATYUyAyWi7VAAAAAASUVORK5CYII=","orcid":"","institution":"The Affiliated Hospital of Qingdao University, Qingdao University","correspondingAuthor":true,"prefix":"","firstName":"Zexian","middleName":"","lastName":"Xu","suffix":""},{"id":297445557,"identity":"f419f306-d405-4e7b-a9c2-741448e7a23c","order_by":8,"name":"Jian Sun","email":"","orcid":"","institution":"The Affiliated Hospital of Qingdao University, Qingdao University","correspondingAuthor":false,"prefix":"","firstName":"Jian","middleName":"","lastName":"Sun","suffix":""}],"badges":[],"createdAt":"2024-04-22 07:29:32","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4303918/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4303918/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":55947453,"identity":"29184207-b173-44b7-adf8-44be2d08ab72","added_by":"auto","created_at":"2024-05-06 16:58:03","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2240274,"visible":true,"origin":"","legend":"\u003cp\u003eObservation of MC3T3-E1 cell morphology using an inverted microscope 24 hours after culture.\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4303918/v1/713d895b635b795b0a6bf045.jpg"},{"id":55947456,"identity":"b589dd7d-9a8b-4bce-9919-1355a4e9097c","added_by":"auto","created_at":"2024-05-06 16:58:03","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1651766,"visible":true,"origin":"","legend":"\u003cp\u003eObservation of MC3T3-E1 cell morphology using fluorescence microscopy 24 hours after culture.\u003c/p\u003e","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4303918/v1/b358a509238c25365d44b6b5.jpg"},{"id":55947766,"identity":"9c0596ad-6d55-490f-a192-10229591b1f1","added_by":"auto","created_at":"2024-05-06 17:06:03","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":735168,"visible":true,"origin":"","legend":"\u003cp\u003eCell viability assay of MC3T3-E1 cells after 1, 3, and 5 days of culture.\u003c/p\u003e","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4303918/v1/2ffefceb2effc7e3e81ec85e.jpg"},{"id":55947454,"identity":"336c45fb-f67e-424c-847a-ece72971aef0","added_by":"auto","created_at":"2024-05-06 16:58:03","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":10179169,"visible":true,"origin":"","legend":"\u003cp\u003eALP staining of MC3T3-E1 cells after 7 days of culture.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-4303918/v1/7beaee0c877809651b8df78a.png"},{"id":55947458,"identity":"9d0938c5-97cb-467c-b698-a6c02ebbd668","added_by":"auto","created_at":"2024-05-06 16:58:03","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":684739,"visible":true,"origin":"","legend":"\u003cp\u003eQuantitative analysis of alkaline phosphatase (ALP) activity in MC3T3-E1 cells after 7 and 14 days of culture; *P\u0026lt;0.05, **P\u0026lt;0.01, ***P\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Figure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4303918/v1/3f5ec51fa96ec6c5d7c5f106.jpg"},{"id":55947461,"identity":"ebc5309e-caa8-4742-8fc7-d38e3906b171","added_by":"auto","created_at":"2024-05-06 16:58:03","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":6831479,"visible":true,"origin":"","legend":"\u003cp\u003eAlizarin Red staining of MC3T3-E1 cells after 14 and 21 days of culture.\u003c/p\u003e","description":"","filename":"Figure6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4303918/v1/00f339a7f9f9cc81b055a903.jpg"},{"id":55947457,"identity":"75abf3e2-16d6-487d-a2d4-3f952ac069f6","added_by":"auto","created_at":"2024-05-06 16:58:03","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":638126,"visible":true,"origin":"","legend":"\u003cp\u003eQuantitative analysis of Alizarin Red staining in MC3T3-E1 cells after 14 and 21 days of culture; *P\u0026lt;0.05, **P\u0026lt;0.01.\u003c/p\u003e","description":"","filename":"Figure7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4303918/v1/5472bc1a8b2a63d043f83ad0.jpg"},{"id":55947767,"identity":"fb7d4194-5fc5-4d42-9a42-2901f969cbf0","added_by":"auto","created_at":"2024-05-06 17:06:03","extension":"jpg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":632421,"visible":true,"origin":"","legend":"\u003cp\u003emRNA expression of osteogenesis-related genes in MC3T3-E1 cells after 7 days of culture: A, ALP mRNA expression; B, Runx2 mRNA expression; C, Col-1 mRNA expression; D, OCN mRNA expression; *P\u0026lt;0.05, **P\u0026lt;0.01, ***P\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Figure8.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4303918/v1/5056aed1e4cc3d58065ddd37.jpg"},{"id":55947768,"identity":"510ae5fe-ad67-43e0-b275-8cd69aca93b5","added_by":"auto","created_at":"2024-05-06 17:06:03","extension":"jpg","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":602883,"visible":true,"origin":"","legend":"\u003cp\u003eExpression of signaling pathway-related proteins: A, Western blot analysis of phosphorylated Smad1/3/5 (p-pSmad1/5/8) and phosphorylated p38 (p-p38); B, Relative expression of phosphorylated Smad1/3/5 protein; C, Relative expression of phosphorylated p38 protein; *P\u0026lt;0.05, **P\u0026lt;0.01, ns = no significant difference.\u003c/p\u003e","description":"","filename":"Figure9.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4303918/v1/f1efdde433033390b04a1d96.jpg"},{"id":55947463,"identity":"d707942e-e9c0-4a0c-9c96-9c74f55a1846","added_by":"auto","created_at":"2024-05-06 16:58:03","extension":"jpg","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":645085,"visible":true,"origin":"","legend":"\u003cp\u003eCell model of the synergistic mechanism of action between BMP-2 and DEX.\u003c/p\u003e","description":"","filename":"Figure10.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4303918/v1/2ba51ca19d1f3124e096cafb.jpg"},{"id":60037619,"identity":"791beceb-68df-434d-82fb-5f53d8d4ac46","added_by":"auto","created_at":"2024-07-11 01:23:04","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":31935644,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4303918/v1/34eb2f56-f8e9-43ef-9f7d-ecc30df77e56.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Enhancement of BMP-2-Induced Osteogenic Differentiation of MC3T3-E1 Cells by Dexamethasone through the Smad Signaling Pathway","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eJawbone defects caused by tumors, infections, trauma, and congenital malformations are common diseases in the oral and maxillofacial region, severely affecting the appearance, oral function, and psychological state of patients [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Bone tissue engineering, utilizing tissue engineering technology to form bone in vivo or in vitro, is a promising method for repairing jawbone defects. Three factors are essential in bone tissue engineering, i.e., tissue engineering scaffolds, growth factors, and seed cells. Among numerous osteogenic growth factors, Bone Morphogenetic Protein-2 (BMP-2) reigns as the foremost in both widespread usage and effectiveness [\u003cspan additionalcitationids=\"CR4\" citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. BMP-2, a member of the Transforming Growth Factor-β (TGF-β) superfamily, plays a crucial role in recruiting, proliferating, and differentiating osteoprogenitor cells during bone regeneration [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Approved by the FDA for clinical use between 2002 and 2007, BMP-2 found applications in treating conditions like spinal fusion, open tibial fractures, maxillary sinus lifting, and alveolar ridge augmentation [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Despite its efficacy, clinical dosages of BMP-2 often surpass physiological levels [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e], potentially leading to adverse effects including tissue swelling, inflammation, ectopic bone formation, and tumor induction [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Consequently, efforts by scholars have focused on exploring adjunctive drugs to enhance BMP-2's osteogenic effect and minimize dosage requirements.\u003c/p\u003e \u003cp\u003eResearch has demonstrated that small molecule drugs such as DEX, simvastatin, hydroxycholesterol, and estrogen can induce osteogenic differentiation in various cells and enhance the osteogenic effect of BMP-2 [\u003cspan additionalcitationids=\"CR11 CR12\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. DEX, a synthetic glucocorticoid (GC) widely employed in clinical practice for its potent anti-inflammatory and immunosuppressive effects, has attracted considerable interest. Its pharmacological concentrations significantly affect bone metabolism [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Previous research has delineated DEX's dual role in bone formation. At low concentrations, it enhances osteoblast growth and differentiation via the classical Wnt signaling pathway [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], while also boosting osteoblast vitality through autophagy induction by increasing intracellular reactive oxygen species [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. However, elevated DEX concentrations inhibit osteoblast differentiation and mineralization. Specifically, at a concentration of 10 mM, DEX disrupts mitochondrial dynamics, promotes adipogenesis, and impedes the osteogenic differentiation of stem cells [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eWhile research has confirmed the synergistic effect of BMP-2 and DEX, the precise mechanism of their action remains incompletely understood. BMP-2, a member of the TGF-β superfamily, engages in signal transduction by binding to type I and type II transmembrane serine/threonine kinase receptors (BMPR-1, BMPR-2). The classical BMPs-Receptor-Smad signaling pathway, crucial in transmitting signals from the cell membrane to the cell interior, is central to this process [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Additionally, BMP-2 can activate non-Smad pathways like MAPK (mitogen-activated protein kinase), Notch, and Wnt, termed non-classical signaling pathways. Among these, P38, a pivotal member of the MAPK family, facilitates the expression of osteogenic markers such as ALP and Osteocalcin (OCN) by phosphorylating transcription factors Cbfal and Osteri [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Runx2 (Runt-related transcription factor 2), a specific transcription factor for osteogenic differentiation, serves as a convergence point for both the BMPs-Smad pathway and the P38 MAPK pathway. It functions as a target gene of BMPs, enhancing cellular responsiveness to BMPs. Runx2 expression is essential for mesenchymal cell differentiation into the osteoblast lineage, with its absence completely inhibiting osteoblast differentiation and subsequent bone formation [\u003cspan additionalcitationids=\"CR22 CR23 CR24\" citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Within this theoretical framework, this work investigates the molecular mechanisms of BMP-2 and DEX by detecting the expression of proteins associated with both classical and non-classical signaling pathways.\u003c/p\u003e \u003cp\u003eThis study utilized mouse embryonic osteoblast precursor cells (MC3T3-E1) to investigate two prominent BMP signaling pathways: BMPs-Smad and p38-MAPK. We evaluated the synergistic effects of BMP-2 and DEX by assessing alkaline phosphatase activity, calcium deposition, and the expression of osteogenic genes. Furthermore, by examining the expression of key components such as Smads and p38 within the BMPs osteogenic signaling pathway, we elucidated the molecular mechanisms underlying the synergistic action of BMP-2 and DEX. These findings may offer valuable insights into optimizing BMP-2 dosage and administration methods in bone tissue engineering.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cdiv id=\"Sec3\"\u003e\n \u003ch2\u003e2.1. Materials\u003c/h2\u003e\n \u003cdiv\u003e\n \u003cp\u003eCyclosporin A, 4\u0026apos;,6-diamidino-2-phenylindole (DAPI), fluorescein isothiocyanate (FITC), DEX, alkaline phosphatase (ALP) test kit, alizarin red staining solution, Smad 1/3/5 antibodies, p38 antibodies, and other reagents were purchased from Sigma-Aldrich, USA. Recombinant human Bone Morphogenetic Protein-2 (rhBMP-2) was obtained from Abmole Bioscience, USA. Mouse embryonic osteoblast precursor cells (MC3T3-E1) were provided by Cyagen Biosciences Inc., Shanghai, China.\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec4\"\u003e\n \u003ch2\u003e2.2. Cell Culture\u003c/h2\u003e\n \u003cp\u003eDMEM (high glucose) supplemented with 10% FBS and 1% antibiotics (penicillin/streptomycin) served as the basic culture medium. Osteogenic induction medium was prepared by adding 10 mM sodium \u0026beta;-glycerophosphate, 50 \u0026micro;g/mL ascorbic acid, and 0.1 \u0026micro;M DEX to the basic culture medium. The cells were divided into different groups for treatment: a negative control group (Control) using the basic culture medium, and a positive control group (Osteoinductive) using the osteogenic induction medium. Experimental groups were established by adding DEX (10\u003csup\u003e\u0026minus;\u0026thinsp;8\u003c/sup\u003e M), BMP-2 (100 ng/mL), either individually or in combination to the basic culture medium: BMP-2(-)DEX(+), BMP-2(+)DEX(-), and BMP-2(+)DEX(+). MC3T3-E1 cells, according to these groupings, were cultured in a 37\u0026deg;C incubator with 5% CO₂and 95% humidity.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec5\"\u003e\n \u003ch2\u003e2.3. Observation of Cell Morphology\u003c/h2\u003e\n \u003cdiv\u003e\n \u003cp\u003eMC3T3-E1 cells were cultured in media containing DEX and/or BMP-2 for 24 hours, after which the cell morphology and growth were observed under an inverted biological microscope. The culture medium was removed, and the cells were fixed with 3.7% formaldehyde solution for 20 minutes, followed by washing with PBS and preservation with a mounting medium. The cytoplasm and nuclei were stained with FITC-labeled cyclosporin A and DAPI solution, respectively. A fluorescence microscope (TE2000-U, Nikon, Japan) was used to observe the spread and distribution of the cells, as well as the effects of the addition of DEX and BMP-2 on cell morphology.\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec6\"\u003e\n \u003ch2\u003e2.4. Cell Viability Assay\u003c/h2\u003e\n \u003cdiv\u003e\n \u003cp\u003eCell viability in the experimental and control groups was assessed using the Cell Counting Kit-8 (CCK-8) method. Frozen MC3T3-E1 cells were revived, cultured, and passaged. Cells in good growth condition from the fourth generation were used for the experiments, prepared as a cell suspension with a concentration of 2.5\u0026times;10\u003csup\u003e4\u003c/sup\u003e cells/mL. 100 \u0026micro;L of the cell suspension (2500 cells per well) was seeded into each well of a 96-well plate and incubated at 37\u0026deg;C with 5% CO2 for 24 hours. After this incubation period, the original culture medium was discarded, and 100 \u0026micro;L of the various group solutions mentioned previously was added to each well of the experimental groups. At different time points (days 1, 3, and 5), 10 \u0026micro;L of CCK-8 was added to each well, followed by a further 2 hours of incubation. The optical density (OD) at 450 nm wavelength of each well was measured using a microplate reader. The formula for calculating cell survival rate is as follows:\u003c/p\u003e\n \u003cp\u003e\\(\\text{c}\\text{e}\\text{l}\\text{l} \\text{s}\\text{u}\\text{r}\\text{v}\\text{i}\\text{v}\\text{a}\\text{l} \\text{r}\\text{a}\\text{t}\\text{e}(100\\text{%})= \\frac{{\\text{A}}_{\\text{T}\\text{e}\\text{s}\\text{t}}}{{\\text{A}}_{\\text{C}\\text{o}\\text{n}\\text{t}\\text{r}\\text{o}\\text{l}}} \\times 100\\text{%}\\) (Eq. 1)\u003c/p\u003e\n \u003cp\u003ewhere A\u003csub\u003eTest\u003c/sub\u003e and A\u003csub\u003eControl\u003c/sub\u003e represent the OD values measured at 450 nm for the experimental and control group cells.\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec7\"\u003e\n \u003ch2\u003e2.5. Alkaline Phosphatase (ALP) Activity Assay\u003c/h2\u003e\n \u003cdiv\u003e\n \u003cp\u003eMC3T3-E1 cells were seeded in a 24-well culture plate at a density of 4\u0026times;10\u003csup\u003e5\u003c/sup\u003e/cm\u0026sup2;, with six replicates per group, according to the experimental grouping. On days 7 and 14 of culture induction, the cells were washed three times with PBS, fixed with 4% paraformaldehyde for 30 minutes, and then washed three times with PBS. Subsequently, BCIP/NBT staining working solution (BCIP/NBT Alkaline Phosphatase Color Development Kit, Beyotime) was added to fully cover the cells for 30 minutes of staining. The BCIP/NBT staining solution was then removed, and the cells were rinsed three times with distilled water. The rinse water was discarded, and the cells were observed under a microscope.\u003c/p\u003e\n \u003cp\u003eCells were lysed using 1% Triton X-100, and the lysed cells were scraped off and transferred to an EP tube for centrifugation (4\u0026deg;C, 12000 rpm) for 30 minutes. The supernatant was transferred to a new, labeled EP tube. The optical density (OD) at 520 nm was measured using a microplate assay (Alkaline Phosphatase ALP Test Kit, Sigma-Aldrich, USA), with the experiment repeated three times.\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec8\"\u003e\n \u003ch2\u003e2.6. Alizarin Red Staining and Quantitative Analysis\u003c/h2\u003e\n \u003cdiv\u003e\n \u003cp\u003eFollowing the experimental groupings from section 2.2, MC3T3-E1 cells were seeded at a density of 4\u0026times;105/cm\u0026sup2; in a 24-well culture plate, with six replicates per group. After 14 and 21 days of culture and induction at 37\u0026deg;C in a cell incubator, the cells were washed three times with PBS and fixed with 4% paraformaldehyde solution for 30 minutes. Following three washes with deionized water, the cells were fully covered with 2% Alizarin Red S solution for 30 minutes to stain. The cells were then washed three times with deionized water to remove excess Alizarin Red staining solution and observed under a microscope.\u003c/p\u003e\n \u003cp\u003e100 nmol/L cetylpyridinium chloride was added to dissolve the Alizarin Red stain chelated with calcium, and the solution was decolorized at room temperature for 1 hour. The optical density (OD) at 562 nm was measured, with the experiment repeated three times.\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec9\"\u003e\n \u003ch2\u003e2.7. Real-Time Quantitative PCR (RT-PCR) Analysis\u003c/h2\u003e\n \u003cdiv\u003e\n \u003ctable id=\"Tab1\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv\u003eTable 1\u003c/div\u003e\n \u003cdiv\u003e\n \u003cp\u003eRT-PCR Primer Sequences for Osteogenesis-Related Genes\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eGene\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eForward primer sequence (5\u0026rsquo;\u0026ndash;3\u0026rsquo;)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eReverse primer sequence (5\u0026rsquo;\u0026ndash;3\u0026rsquo;)\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eALP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGTTGCCAAGCTGGGAAGAACAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCCCACCCCGCTATTCAAAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eRUNX2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTTCTCCAACCCACGAATGCAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCAGGTACGTGTGGTAGTGAGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eOCN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGAACAGACTCCGGCGCTA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAGGGAGGATCAAGTCCCG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCol-1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAACATGACCAAAAACCAAAAGTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCATTGTTTCCTGTGTCTTCTGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n \u003cdiv\u003e\n \u003cp\u003eMC3T3-E1 cells were seeded at a density of 4\u0026times;10\u003csup\u003e5\u003c/sup\u003e/cm\u0026sup2; in 12-well culture plates according to the experimental groupings. The cells were cultured in a 37\u0026deg;C incubator for 7 and 14 days, after which the expression of osteogenesis-related genes such as ALP, RUNX2, OCN, and Col-1 was detected through RT-PCR. Total RNA was extracted from the cells using Trizol reagent. First-strand cDNA was synthesized according to the kit instructions (Takara, Japan). Subsequently, the cDNA was diluted 10-fold with sterile distilled water, and 4 \u0026micro;L of the diluted cDNA was added to the RT-PCR reaction mixture using the SYBR Premix Ex TaqTM kit (Takara, Japan). The RT-PCR reaction mixture was prepared as follows: the 10 \u0026micro;L solution contained 4 \u0026micro;L of diluted cDNA, 1\u0026times;SYBR Premix Ex Taq (5 \u0026micro;L), 0.4 \u0026micro;L of each primer (0.2 \u0026micro;M), and 0.2 \u0026micro;L of ROX reference dye (50\u0026times;). The RT-PCR protocol was as follows: initial denaturation at 95\u0026deg;C for 30 s, followed by 40 cycles of 95\u0026deg;C for 5 s and 60\u0026deg;C for 34 s. The sequences of primers used for RT-PCR amplification are shown in Table\u0026nbsp;1.\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec10\"\u003e\n \u003ch2\u003e2.8. Western Blot Analysis\u003c/h2\u003e\n \u003cdiv\u003e\n \u003cp\u003eMC3T3-E1 cells were seeded at a density of 4\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells/cm\u0026sup2; in a 24-well culture plate and cultured for 7 days. The cells were lysed using RIPA lysis buffer. A 10 \u0026micro;L sample of the protein was taken, separated on an SDS-PAGE gel, and then transferred to a PVDF membrane, which was subsequently blocked. Primary antibodies (including Smad1/5/8, p38, and anti-actin antibodies) were diluted 500 times and added to the membrane for overnight incubation at 4\u0026deg;C. After washing the membrane, it was incubated with secondary antibodies for 1 hour, and the protein bands were visualized using imaging technology.\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec11\"\u003e\n \u003ch2\u003e2.9. Statistical Analysis\u003c/h2\u003e\n \u003cdiv\u003e\n \u003cp\u003eStatistical analysis of the measured results was conducted using SPSS software version 26.0. Data are presented as means\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD). Comparisons between groups were made using one-way analysis of variance (ANOVA). P\u0026lt;0.05 was considered to indicate a statistically significant difference.\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec13\"\u003e\n \u003ch2\u003e3.1. Observation of Cell Morphology\u003c/h2\u003e\n \u003cdiv\u003e\n \u003cp\u003eAfter 24 hours of cell culture, observation with an inverted microscope showed that the morphology of MC3T3-E1 cells in both the experimental and control groups was consistent, predominantly fusiform or polygonal, with cells closely arranged. The BMP-2(+)DEX(+) group displayed a denser cell arrangement than other groups, with more pronounced polygonal shapes and more significant cytoplasmic projections (Fig.\u0026nbsp;1). Fluorescence microscopy revealed clear cell contours, polygonal shapes, and good spreading. Cell nuclei were stained blue, and the cell skeleton was clearly displayed without any abnormalities observed (Fig.\u0026nbsp;2).\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec14\"\u003e\n \u003ch2\u003e3.2. Cell Viability Assay\u003c/h2\u003e\n \u003cdiv\u003e\n \u003cp\u003eThe cell survival rates of the experimental and control groups were assessed on days 1, 3, and 5. The results (shown in Fig.\u0026nbsp;3), indicate that at the specified concentrations of DEX and BMP-2, cells exhibited sustained high viability over a 5-day period, with survival rates consistently exceeding 90% across all groups, in comparison to the negative control group. Statistical analysis indicated no significant differences between the groups (P \u0026gt; 0.05).\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec15\"\u003e\n \u003ch2\u003e3.3. Alkaline Phosphatase (ALP) Activity Assay\u003c/h2\u003e\n \u003cdiv\u003e\n \u003cp\u003eOn days 7 and 14 of MC3T3-E1 cell culture, ALP staining was observed under a microscope (Fig.\u0026nbsp;4). The Control group exhibited the lightest staining, while the BMP-2(+)DEX(+) group showed the darkest staining, followed by the BMP-2(+)DEX(-) group, Osteoinductive group, and BMP-2(-)DEX(+) group. Quantitative analysis of ALP further validated the osteogenic effects among the groups, as shown in Fig.\u0026nbsp;5. With time, the ALP activity in the Osteoinductive, BMP-2(+)DEX(-), and BMP-2(+)DEX(+) groups increased, showing a time-dependent pattern. The Control group and BMP-2(-)DEX(+) group exhibited only a slight increase in ALP activity over time, with no significant difference between them (P \u0026gt; 0.05). At all tested time points, the BMP-2(+)DEX(+) group displayed the highest alkaline phosphatase activity, significantly higher than that of the groups using BMP-2 alone (P \u0026lt; 0.01) or DEX alone (P \u0026lt; 0.001).\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec16\"\u003e\n \u003ch2\u003e3.4. In Vitro Mineralization Analysis\u003c/h2\u003e\n \u003cdiv\u003e\n \u003cp\u003eAs seen in the Alizarin Red staining in Fig.\u0026nbsp;6, after 14 days of culture of MC3T3-E1 cells, the Control group and the BMP-2(-)DEX(+) group exhibited minimal staining, with no discernible calcium deposition evident. The BMP-2(+)DEX(+) group exhibited the deepest staining, followed by the BMP-2(+)DEX(-) group and the Osteoinductive group. Quantitative analysis of Alizarin Red staining (Fig.\u0026nbsp;7) revealed that over time, the Control group and the BMP-2(-)DEX(+) group exhibited only minor mineralization, while calcium deposition gradually increased in the Osteoinductive group, BMP-2(+)DEX(-) group, and BMP-2(+) DEX(+) group. At the selected time points for analysis, the BMP-2(+)DEX(+) group had the highest amount of calcium deposition, significantly more than the BMP-2(+)DEX(-) group (P \u0026lt; 0.05), the BMP-2(-)DEX(+) group (P \u0026lt; 0.01), and the Osteoinductive group (P \u0026lt; 0.05). There was no significant difference between the Control group and the BMP-2(-)DEX(+) group (P \u0026gt; 0.05).\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec17\"\u003e\n \u003ch2\u003e3.5. Expression of Osteogenesis-Related Genes\u003c/h2\u003e\n \u003cdiv\u003e\n \u003cp\u003eThe expression of osteogenesis-related genes such as ALP, RUNX2, Col-1, and OCN was detected using RT-PCR (Fig.\u0026nbsp;8). As observed, on day 7 of MC3T3-E1 cell culture, the highest expression levels of all four osteogenesis-related genes were observed in the BMP-2(+)DEX(+) group, followed by the BMP-2(+)DEX(-) group and the Osteoinductive group. The lowest expressions were noted in the Control group and the BMP-2(-)DEX(+) group. The expression of osteogenic genes in both the Control group and the BMP-2(-)DEX(+) group was relatively low, with no significant difference between them (P \u0026gt; 0.05). The BMP-2(+)DEX(+) group exhibited higher expression levels compared to the groups using BMP-2 alone (P \u0026lt; 0.01) or DEX alone (P \u0026lt; 0.001).\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec18\"\u003e\n \u003ch2\u003e3.6. Detection of Signaling Pathway-Related Proteins\u003c/h2\u003e\n \u003cdiv\u003e\n \u003cp\u003eOn day 7 of MC3T3-E1 cell culture, the expression of smad1/5/8 and p38 proteins in the BMP-2 osteogenic signaling pathway was detected using western blot. The western blot bands (Fig.\u0026nbsp;9A) indicated that, compared to the Control group, both the BMP-2(+)DEX(+) and BMP-2(+)DEX(-) groups exhibited higher expression of phosphorylated smad1/5/8, with the BMP-2(+)DEX(+) group showing stronger expression than the BMP-2(+)DEX(-) group, followed by the Osteoinductive group. The expression of smad1/5/8 in the BMP-2(-)DEX(+) group was lower, suggesting that the addition of DEX enhanced the expression of smad1/5/8 in the BMP-2 osteogenic signaling pathway. The expression of p38 was most pronounced in the BMP-2(+)DEX(+) and BMP-2(+)DEX(-) groups, followed by the Osteoinductive group, with the BMP-2(-)DEX(+) and Control groups showing lower expression. Quantitative analysis of the protein bands (Figs.\u0026nbsp;9B and 9C) showed that the expression of phosphorylated smad1/5/8 was strongest in the BMP-2(+)DEX(+) group, with significant differences compared to the BMP-2(+)DEX(-) and BMP-2(-)DEX(+) groups (P \u0026lt; 0.05). Both the BMP-2(+)DEX(+) and BMP-2(+)DEX(-) groups had strong p38 expression, higher than the BMP-2(-)DEX(+) group, but there was no significant difference between them (P \u0026gt; 0.05), indicating that the addition of DEX did not enhance the expression of p38 in the BMP-2 osteogenic signaling pathway.\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eBMP-2 plays a powerful regulatory role in bone and cartilage formation and repair, making it a pivotal component in bone tissue engineering. Physiologically, BMP-2 levels in human natural bone are low, approximately 1\u0026ndash;2 ng per gram of cortical bone, markedly contrasting with the initial therapeutic doses for long bone defects (10\u0026ndash;12 mg) [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]and the currently recommended concentration (1.5 \u0026micro;g/kg) [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. To date, there exists no standardized dosage for BMP-2, and in clinical practice, achieving optimal osteogenic effects often requires dosages and concentrations significantly exceeding normal physiological levels. However, studies have revealed that the osteogenic efficacy of BMP-2 is not strongly correlated with dosage; instead, maintaining a specific concentration for sustained release proves more crucial [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Conversely, the administration of BMP-2 in large doses and high concentrations can lead to adverse reactions, including local inflammation, hematoma formation, ectopic bone formation, and potentially tumorigenesis [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. To attenuate the dosage of BMP-2 while ensuring consistent and sustained drug concentrations, current strategies emphasize investigating drug synergies and controlled-release technologies. Howard et al. [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e] utilized self-assembling layer-by-layer film deposition to incorporate a modest BMP-2 dosage (0.5 \u0026micro;g) into films for rat cranial defect repair. Their findings demonstrated that BMP-2 sustained release over 30 days yielded superior osteogenic effects compared to shorter release durations (2, 4, and 14 days) at the same dosage, validating the impact of BMP-2 release kinetics on therapeutic outcomes. Despite various approaches employed to reduce BMP-2 dosage, it still exceeds physiological levels in native bone. Studies have validated the osteogenic enhancement of BMP-2 by growth factors such as Vascular Endothelial Growth Factor (VEGF), basic Fibroblast Growth Factor (FGF), and Platelet-Rich Plasma (PRP), which exhibit synergistic effects when combined with BMP-2 [\u003cspan additionalcitationids=\"CR36 CR37\" citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Compared to growth factors, small molecule drugs like DEX, simvastatin, hydroxycholesterol, and estrogen can also enhance the osteogenic action of BMP-2 [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan additionalcitationids=\"CR40 CR41\" citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e], and they are more readily available and less expensive. Studies indicate that the effect of DEX on bone may be related to the concentration used, with low concentrations (\u0026lt;\u0026thinsp;10\u003csup\u003e\u0026minus;\u0026thinsp;8\u003c/sup\u003e M) having an osteogenic effect [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]and high concentrations (\u0026gt;\u0026thinsp;10\u003csup\u003e\u0026minus;\u0026thinsp;6\u003c/sup\u003e M) having an inhibitory effect [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. For different species, cell lines, and culturing methods, the concentrations of BMP-2 and DEX used also vary, usually lower in in vitro experiments. Based on previous related studies [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e], this experiment used low concentrations of BMP-2 (100 ng/mL) combined with low concentrations of DEX (10\u003csup\u003e\u0026minus;\u0026thinsp;8\u003c/sup\u003e M) to study their osteogenic effects on MC3T3-E1 cells in vitro.\u003c/p\u003e \u003cp\u003eMC3T3-E1 cells are a cell line widely used in osteogenesis research. Under osteogenic induction conditions, they can differentiate into osteoblasts and express osteogenesis-related specific genes such as Alkaline Phosphatase (ALP), OCN, and Bone Morphogenetic Proteins (BMP). Moreover, MC3T3-E1 cells have strong proliferative capabilities and can be passaged indefinitely, overcoming the limitations of primary cells, such as poor proliferative ability, long culture periods, and weak transfection capability. As precursors to osteoblasts, they can simulate the entire process of osteogenesis and are commonly used in studies on bone biomaterials and bone regeneration [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. In this experiment, MC3T3-E1 cells, which were subjected to predetermined concentrations of BMP-2 and DEX induction, exhibited no notable decrease in cell count after 24 hours of culture compared to the control group, as observed under an inverted and fluorescence microscope. Notably, cells maintained distinct contours and exhibited robust spreading, indicative of heightened cell viability. The preservation of cellular morphology, including intact cytoskeletal structures, further suggested optimal cellular function. Additionally, the experimental group displayed healthy cytoskeletal integrity, signifying cellular robustness, alongside notable cytoplasmic protrusions, indicative of MC3T3-E1 cell differentiation towards osteoblasts. The cell survival rate assessed by the CCK-8 assay showed that after 5 days of culture, the survival rate in all groups was above 90% compared to the control group, indicating that the selected concentrations of BMP-2 and DEX have no significant cytotoxic effects.\u003c/p\u003e \u003cp\u003eThis experiment focuses on achieving effective osteogenesis while mitigating the dosage and adverse reactions associated with BMP-2, accomplished through its synergistic action with DEX. Jiang F et al., [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e] found that low doses of BMP-2 did not promote new bone formation but triggered M1 macrophages to release IL-1β. The addition of DEX promoted osteogenesis by inhibiting M1 polarization and enhancing BMP-2 induced differentiation of Mesenchymal Stem Cells (MSCs). Similarly, Li L and colleagues [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e] developed a nano-particle-embedded electrospun fiber scaffold for dual delivery of BMP-2 and DEX, showing strong induction of osteoblast differentiation due to the synergistic action of BMP-2 and DEX, with dual-drug-loaded nano-fiber scaffolds demonstrating the best repair effects. In line with these findings, our experiments validated the enhanced osteogenic effect of low-concentration DEX on low-concentration BMP-2 through various assays including ALP activity, in vitro mineralization, and PCR of osteogenesis-related genes. Alkaline Phosphatase (ALP) is one of the marker enzymes for osteoblast maturation and an early marker of cellular osteogenesis, reflecting the activity and function of osteoblasts. Studies have shown ALP expression within 3 days of osteoblast culture, peaking at 14 days [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. Our experiment observed ALP expression at days 7 and 14, with the Control and BMP-2(-)DEX(+) groups showing weaker expression and only slight increases over time, indicating weak osteogenic differentiation in basic medium and DEX alone. The BMP-2(+)DEX(+), BMP-2(+)DEX(-), and Osteoinductive groups showed increased ALP activity over time, with the BMP-2(+)DEX(+) group displaying the strongest activity at all tested times, indicating a synergistic effect of combined BMP-2 and DEX use.\u003c/p\u003e \u003cp\u003eAlizarin Red Staining (ARS) detected the formation of calcium nodules after osteogenic differentiation. By day 14, calcium nodule formation commenced, reaching its peak between days 21 and 28, serving as a critical late-stage marker of osteogenesis. Through ARS and quantitative analysis at days 14 and 21, the Control and BMP-2(-)DEX(+) groups exhibited only a mild increase in staining over time, with limited calcium deposition. Conversely, the BMP-2(+)DEX(+), BMP-2(+)DEX(-), and Osteoinductive groups displayed progressively deeper staining and increased calcium nodules, with the BMP-2(+)DEX(+) group exhibiting the most pronounced calcium deposition, thereby further confirming the enhancing effect of DEX on BMP-2's osteogenic action. The expression of genes such as ALP, Runx2, Col-1, and OCN served as crucial markers of osteoblastic bone function. ALP, Runx2, and Col-1 were expressed within the first three days post-osteogenic induction, while OCN expression became detectable after 3 days, increasing over time [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. On day 7 of osteogenic induction in MC3T3-E1 cells, the expression of osteogenesis-related genes ALP, Runx2, Col-1, and OCN was evident, with minimal expression observed in the Control and BMP-2(-)DEX(+) groups, and the most robust expression observed in the BMP-2(+)DEX(+) group, surpassing that of BMP-2 or DEX used alone. This genetic evidence confirms that the combined use of BMP-2 and DEX can promote heightened expression of osteogenic genes, demonstrating a synergistic effect.\u003c/p\u003e \u003cp\u003eThe BMPs-Smad pathway is the classical signaling pathway for BMP-2-induced osteogenic differentiation. BMP-2 first binds to type I and II transmembrane receptors to form a heterodimer, activating the Smad complex to form phosphorylated Smad1/5/8, which then regulates the expression of downstream Runx2 to promote osteogenic differentiation [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. The p38-MAPK pathway is one of the non-classical signaling pathways for BMP-2-induced osteogenic differentiation, where phosphorylated p38 can also regulate osteogenic differentiation through RUNX2 [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. Studies have shown that DEX is hydrophobic and mainly enters cells by binding to cell membrane receptors, forming an endocytic vesicle for cellular entry, and then releasing in the cytoplasm 15. Lu MF et al., [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e] studied the expression of Smad3 in the osteogenic process of MC3T3-E1 cells under the concentration of 10\u0026thinsp;\u0026minus;\u0026thinsp;7 M DEX, showing that this concentration of DEX significantly inhibited Smad-stimulated ALP activity, thereby inhibiting osteogenesis. Gan Qi et al., [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e] prepared a gelatin sponge scaffold loaded with BMP-2 and DEX to study the osteogenic activity of the dual drugs, finding that 100 nM DEX could significantly enhance BMP-2 induced ALP activity and ALP mRNA expression in C2C12 cells through a RUNX2-dependent pathway compared to the use of BMP-2 or DEX alone. Thus, DEX can inhibit or enhance osteogenesis through the BMPs-Smad pathway, potentially related to its concentration.\u003c/p\u003e \u003cp\u003eWestern blot analysis of Smad protein expression within the BMP-2 signaling pathway revealed that DEX alone did not augment Smad1/5/8 levels, whereas BMP-2 alone promoted their elevation. Furthermore, the addition of DEX further enhanced Smad1/5/8 expression, suggesting potential synergy via the BMPs-Smad pathway in the MC3T3-E1 cell line. Conversely, analysis of p38 expression indicated that DEX alone did not significantly impact p38 levels, while BMP-2 alone elevated them. Interestingly, the combined use of BMP-2 and DEX did not further increase p38 expression, implying that their synergistic action may not involve the p38-MAPK signaling pathway. Therefore, the inferred mechanism of synergistic action between BMP-2 and DEX (as depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003e) suggests that BMP-2 binds to transmembrane receptors, forming a heterodimer and activating the BMPs-Smads signaling pathway, while DEX enhances BMP-2's osteogenic effect through this pathway.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"5. Conclusions","content":"\u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eThe combined use of low concentrations of BMP-2 and DEX has a synergistic effect on osteogenic differentiation in MC3T3-E1 cells, likely acting through the BMPs-Smads signaling pathway rather than the p38-MAPK pathway. The results of this study hold the potential to reduce the dosage of BMP-2 used in jawbone repair, thereby minimizing the incidence of dose-related side effects. This lays a theoretical foundation for the use and dosage of growth factors in tissue-engineered bone and offers new insights into treatments for jawbone defects.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003eThe authors declare that they have no competing interests as defined by BMC, or other interests that might be perceived to influence the results and/or discussion reported in this paper. The results/data/figures in this manuscript have not been published elsewhere, nor are they under consideration (from you or one of your Contributing Authors) by another publisher.\u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis research was funded by the Shandong Province Medical and Health Technology Development Plan Project (grant number:202308020875 and 202208020979), the Qingdao Medical and Health Research Program (grant number: 2023-2-005-YY and 2021-WJZD193), the Qingdao University Affiliated Hospital Clinical Medicine\u0026thinsp;+\u0026thinsp;X Scientific Research Project (grant number: QDFY\u0026thinsp;+\u0026thinsp;X 2023207 and 202101041), and Qingdao Key Health Discipline Development Fund and Oral Medicine Climbing Discipline Project in Qingdao.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eConceptualization, Y.X. and Y.L.; methodology, Y.L.; software, M.S.; validation, Y.L., and L.C.; formal analysis, M.S.; resources, J.S.; data curation, X.G.; writing\u0026mdash;original draft preparation, Y.X.; writing\u0026mdash;review and editing, Z.X.; visualization, L.L.; supervision, J.S.; project administration, Z.X. and J.S; funding acquisition, Z.X. and J.S.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eDalfino S, Savadori P, Piazzoni M, et al. Regeneration of Critical-Sized Mandibular Defects Using 3D-Printed Composite Scaffolds: A Quantitative Evaluation of New Bone Formation in In Vivo Studies. Adv Healthc Mater. 2023;12(21):e2300128.\u003c/li\u003e\n\u003cli\u003eZhang Q, Wu W, Qian C, et al. Advanced biomaterials for repairing and reconstruction of mandibular defects. Mater Sci Eng C Mater Biol Appl. 2019;103:109858.\u003c/li\u003e\n\u003cli\u003eWu Z, Bao C, Zhou S, et al. The synergetic effect of bioactive molecule-loaded electrospun core-shell fibres for reconstruction of critical-sized calvarial bone defect-The effect of synergetic release on bone Formation. Cell Prolif. 2020;53(4):e12796.\u003c/li\u003e\n\u003cli\u003ePaulini M, Camal Ruggieri IN, Ramallo M, et al. Recombinant Proteins-Based Strategies in Bone Tissue Engineering. Biomolecules. 2021;12(1).\u003c/li\u003e\n\u003cli\u003eSchmidt-Bleek K, Willie BM, Schwabe P, Seemann P, Duda GN. BMPs in bone regeneration: Less is more effective, a paradigm-shift. Cytokine Growth Factor Rev. 2016;27:141-148.\u003c/li\u003e\n\u003cli\u003eSalazar VS, Gamer LW, Rosen V. BMP signalling in skeletal development, disease and repair. Nat Rev Endocrinol. 2016;12(4):203-221.\u003c/li\u003e\n\u003cli\u003eMa D, An G, Liang M, Liu Y, Zhang B, Wang Y. A composited PEG-silk hydrogel combining with polymeric particles delivering rhBMP-2 for bone regeneration. Mater Sci Eng C Mater Biol Appl. 2016;65:221-231.\u003c/li\u003e\n\u003cli\u003eGelebart P, Cuenot S, Sinquin C, et al. Microgels based on Infernan, a glycosaminoglycan-mimetic bacterial exopolysaccharide, as BMP-2 delivery systems. Carbohydr Polym. 2022;284:119191.\u003c/li\u003e\n\u003cli\u003eOliver-Cervello L, Martin-Gomez H, Mandakhbayar N, et al. Mimicking Bone Extracellular Matrix: From BMP-2-Derived Sequences to Osteogenic-Multifunctional Coatings. Adv Healthc Mater. 2022;11(20):e2201339.\u003c/li\u003e\n\u003cli\u003eChen PY, Sun JS, Tsuang YH, Chen MH, Weng PW, Lin FH. Simvastatin promotes osteoblast viability and differentiation via Ras/Smad/Erk/BMP-2 signaling pathway. Nutr Res. 2010;30(3):191-199.\u003c/li\u003e\n\u003cli\u003eHuang Y, Lin Y, Rong M, Liu W, He J, Zhou L. 20(S)-hydroxycholesterol and simvastatin synergistically enhance osteogenic differentiation of marrow stromal cells and bone regeneration by initiation of Raf/MEK/ERK signaling. J Mater Sci Mater Med. 2019;30(8):87.\u003c/li\u003e\n\u003cli\u003eAghaloo TL, Amantea CM, Cowan CM, et al. Oxysterols enhance osteoblast differentiation in vitro and bone healing in vivo. J Orthop Res. 2007;25(11):1488-1497.\u003c/li\u003e\n\u003cli\u003eMikami Y, Asano M, Honda MJ, Takagi M. Bone morphogenetic protein 2 and DEX synergistically increase alkaline phosphatase levels through JAK/STAT signaling in C3H10T1/2 cells. J Cell Physiol. 2010;223(1):123-133.\u003c/li\u003e\n\u003cli\u003eLuppen CA, Smith E, Spevak L, Boskey AL, Frenkel B. Bone BMP-2 restores mineralization in glucocorticoid-inhibited MC3T3-E1 osteoblast cultures. J Bone Miner Res. 2003;18(7):1186-1197.\u003c/li\u003e\n\u003cli\u003eHan L, Wang B, Wang R, Gong S, Chen G, Xu W. The shift in the balance between osteoblastogenesis and adipogenesis of mesenchymal stem cells mediated by glucocorticoid receptor. Stem Cell Res Ther. 2019;10(1):377.\u003c/li\u003e\n\u003cli\u003eZhang S, Liu Y, Liang Q. Low-dose DEX affects osteoblast viability by inducing autophagy via intracellular ROS. Mol Med Rep. 2018;17(3):4307-4316.\u003c/li\u003e\n\u003cli\u003eHong D, Chen HX, Yu HQ, et al. Quantitative proteomic analysis of DEX-induced effects on osteoblast differentiation, proliferation, and apoptosis in MC3T3-E1 cells using SILAC. Osteoporos Int. 2011;22(7):2175-2186.\u003c/li\u003e\n\u003cli\u003eManzari-Tavakoli A, Babajani A, Farjoo MH, Hajinasrollah M, Bahrami S, Niknejad H. The Cross-Talks Among Bone Morphogenetic Protein (BMP) Signaling and Other Prominent Pathways Involved in Neural Differentiation. Front Mol Neurosci. 2022;15:827275.\u003c/li\u003e\n\u003cli\u003eBeederman M, Lamplot JD, Nan G, et al. BMP signaling in mesenchymal stem cell differentiation and bone formation. J Biomed Sci Eng. 2013;6(8A):32-52.\u003c/li\u003e\n\u003cli\u003eLiu M, Goldman G, MacDougall M, Chen S. BMP Signaling Pathway in Dentin Development and Diseases. Cells. 2022;11(14).\u003c/li\u003e\n\u003cli\u003eLiu DD, Zhang CY, Liu Y, Li J, Wang YX, Zheng SG. RUNX2 Regulates Osteoblast Differentiation via the BMP4 Signaling Pathway. J Dent Res. 2022;101(10):1227-1237.\u003c/li\u003e\n\u003cli\u003eQin X, Jiang Q, Komori H, et al. Runt-related transcription factor-2 (Runx2) is required for bone matrix protein gene expression in committed osteoblasts in mice. J Bone Miner Res. 2021;36(10):2081-2095.\u003c/li\u003e\n\u003cli\u003eDai Q, Xu Z, Ma X, et al. mTOR/Raptor signaling is critical for skeletogenesis in mice through the regulation of Runx2 expression. Cell Death Differ. 2017;24(11):1886-1899.\u003c/li\u003e\n\u003cli\u003ePhimphilai M, Zhao Z, Boules H, Roca H, Franceschi RT. BMP signaling is required for RUNX2-dependent induction of the osteoblast phenotype. J Bone Miner Res. 2006;21(4):637-646.\u003c/li\u003e\n\u003cli\u003eWu M, Chen G, Li YP. TGF-beta and BMP signaling in osteoblast, skeletal development, and bone formation, homeostasis and disease. Bone Res. 2016;4:16009.\u003c/li\u003e\n\u003cli\u003eJones AL, Bucholz RW, Bosse MJ, et al. Recombinant human BMP-2 and allograft compared with autogenous bone graft for reconstruction of diaphyseal tibial fractures with cortical defects. A randomized, controlled trial. J Bone Joint Surg Am. 2006;88(7):1431-1441.\u003c/li\u003e\n\u003cli\u003eWozney JM, Rosen V, Celeste AJ, et al. Novel regulators of bone formation: molecular clones and activities. Science. 1988;242(4885):1528-1534.\u003c/li\u003e\n\u003cli\u003eLytle EJ, Lawless MH, Paik G, Tong D, Soo TM. The minimally effective dose of bone morphogenetic protein in posterior lumbar interbody fusion: a systematic review and meta-analysis. Spine J. 2020;20(8):1286-1304.\u003c/li\u003e\n\u003cli\u003eJames AW, LaChaud G, Shen J, et al. A Review of the Clinical Side Effects of Bone BMP-2. Tissue Eng Part B Rev. 2016;22(4):284-297.\u003c/li\u003e\n\u003cli\u003eSeo BB, Choi H, Koh JT, Song SC. Sustained BMP-2 delivery and injectable bone regeneration using thermosensitive polymeric nanoparticle hydrogel bearing dual interactions with BMP-2. J Control Release. 2015;209:67-76.\u003c/li\u003e\n\u003cli\u003eLu HT, Lin C, Wang YJ, et al. Sequential deacetylation/self-gelling chitin hydrogels and scaffolds functionalized with fucoidan for enhanced BMP-2 loading and sustained release. Carbohydr Polym. 2023;315:121002.\u003c/li\u003e\n\u003cli\u003eBouyer M, Guillot R, Lavaud J, et al. Surface delivery of tunable doses of BMP-2 from an adaptable polymeric scaffold induces volumetric bone regeneration. Biomaterials. 2016;104:168-181.\u003c/li\u003e\n\u003cli\u003eSkovrlj B, Koehler SM, Anderson PA, et al. Association Between BMP-2 and Carcinogenicity. Spine. 2015;40(23):1862-1871.\u003c/li\u003e\n\u003cli\u003eHoward MT, Wang S, Berger AG, et al. Sustained release of BMP-2 using self-assembled layer-by-layer film-coated implants enhances bone regeneration over burst release. Biomaterials. 2022;288:121721.\u003c/li\u003e\n\u003cli\u003eStamnitz S, Krawczenko A, Szalaj U, et al. Osteogenic Potential of Sheep Mesenchymal Stem Cells Preconditioned with BMP-2 and FGF-2 and Seeded on an nHAP-Coated PCL/HAP/beta-TCP Scaffold. Cells. 2022;11(21).\u003c/li\u003e\n\u003cli\u003eNedorubova IA, Bukharova TB, Mokrousova VO, et al. Comparative Efficiency of Gene-Activated Matrices Based on Chitosan Hydrogel and PRP Impregnated with BMP2 Polyplexes for Bone Regeneration. Int J Mol Sci. 2022;23(23).\u003c/li\u003e\n\u003cli\u003eLiu K, Meng CX, Lv ZY, et al. Enhancement of BMP-2 and VEGF carried by mineralized collagen for mandibular bone regeneration. Regen Biomater. 2020;7(4):435-440.\u003c/li\u003e\n\u003cli\u003eGeng Y, Duan H, Xu L, et al. BMP-2 and VEGF-A modRNAs in collagen scaffold synergistically drive bone repair through osteogenic and angiogenic pathways. Commun Biol. 2021;4(1):82.\u003c/li\u003e\n\u003cli\u003eBakshi R, Hokugo A, Zhou S, et al. Application of Hydroxycholesterols for Alveolar Cleft Osteoplasty in a Rodent Model. Plast Reconstr Surg. 2019;143(5):1385-1395.\u003c/li\u003e\n\u003cli\u003ePark JB. Combination of simvastatin and bone BMP-2 enhances the differentiation of osteoblasts by regulating the expression of phospho-Smad1/5/8. Exp Ther Med. 2012;4(2):303-306.\u003c/li\u003e\n\u003cli\u003eWei A, Leong A, Williams L, et al. BMP-7 in combination with estrogen enhances bone formation in a fracture callus explant culture. Tohoku J Exp Med. 2010;221(1):61-68.\u003c/li\u003e\n\u003cli\u003ePauly S, Luttosch F, Morawski M, Haas NP, Schmidmaier G, Wildemann B. Simvastatin locally applied from a biodegradable coating of osteosynthetic implants improves fracture healing comparable to BMP-2 application. Bone. 2009;45(3):505-511.\u003c/li\u003e\n\u003cli\u003eChen Y, Kawazoe N, Chen G. Preparation of DEX-loaded biphasic calcium phosphate nanoparticles/collagen porous composite scaffolds for bone tissue engineering. Acta Biomater. 2018;67:341-353.\u003c/li\u003e\n\u003cli\u003eMikami Y, Lee M, Irie S, Honda MJ. DEX modulates osteogenesis and adipogenesis with regulation of osterix expression in rat calvaria-derived cells. J Cell Physiol. 2011;226(3):739-748.\u003c/li\u003e\n\u003cli\u003eCzekanska EM, Stoddart MJ, Richards RG, Hayes JS. In search of an osteoblast cell model for in vitro research. Eur Cell Mater. 2012;24:1-17.\u003c/li\u003e\n\u003cli\u003eJiang F, Qi X, Wu X, et al. Regulating macrophage-MSC interaction to optimize BMP-2-induced osteogenesis in the local microenvironment. Bioact Mater. 2023;25:307-318.\u003c/li\u003e\n\u003cli\u003eLi L, Zhou G, Wang Y, Yang G, Ding S, Zhou S. Controlled dual delivery of BMP-2 and DEX by nanoparticle-embedded electrospun nanofibers for the efficient repair of critical-sized rat calvarial defect. Biomaterials. 2015;37:218-229.\u003c/li\u003e\n\u003cli\u003eVimalraj S. Alkaline phosphatase: Structure, expression and its function in bone mineralization. Gene. 2020;754:144855.\u003c/li\u003e\n\u003cli\u003eChen G, Deng C, Li YP. TGF-beta and BMP signaling in osteoblast differentiation and bone formation. Int J Biol Sci. 2012;8(2):272-288.\u003c/li\u003e\n\u003cli\u003eIu MF, Kaji H, Sowa H, Naito J, Sugimoto T, Chihara K. DEX suppresses Smad3 pathway in osteoblastic cells. J Endocrinol. 2005;185(1):131-138.\u003c/li\u003e\n\u003cli\u003eGan Q, Pan H, Zhang W, Yuan Y, Qian J, Liu C. Fabrication and evaluation of a BMP-2/DEX co-loaded gelatin sponge scaffold for rapid bone regeneration. Regen Biomater. 2022;9:rbac008.\u003cstrong\u003e\u003c/strong\u003e\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Dexamethasone, BMP-2, Smad, Signaling pathway, Osteogenesis","lastPublishedDoi":"10.21203/rs.3.rs-4303918/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4303918/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eTissue-engineered bone is a promising approach for repairing defects in the jawbone caused by tumors, infections, trauma, and congenital malformations, with BMP-2 playing a key role. Clinically, to achieve favorable therapeutic outcomes, the doses of BMP-2 used far exceed the physiological levels found in natural bone, leading to various side effects.To investigate the effectiveness and molecular mechanisms of the synergistic osteogenic action of dexamethasone (DEX) and BMP-2, and to explore effective methods to reduce the dosage of BMP-2 used. The effects of low concentration DEX (10\u003csup\u003e\u0026minus;\u0026thinsp;8\u003c/sup\u003e M) and/or BMP-2 (100 ng/mL) on the morphology and activity of MC3T3-E1 cells were examined in various combinations. The efficacy of their combined use was verified through the detection of alkaline phosphatase, alizarin red staining, and the expression of osteogenesis-related genes. The molecular mechanism of their synergistic action was explored by detecting the expression of proteins in the Smad and p38 signaling pathways. The combined use of low concentration DEX and BMP-2 had no significant impact on the morphology and activity of MC3T3-E1 cells. Compared to the use of DEX or BMP-2 alone, their combined use enhanced the expression of alkaline phosphatase, increased calcium deposition, and significantly elevated the expression of osteogenesis-related genes such as ALP, RUNX2, OCN, and Col-1. Western blot analysis showed that the combined use of DEX and BMP-2 significantly increased the expression of Smad1/3/5, while p38 expression did not show a significant increase. The combined use of low concentration DEX and BMP-2 has a synergistic effect on osteogenic differentiation in MC3T3-E1 cells, acting through the BMPs-Smads signaling pathway rather than the p38-MAPK pathway. The results of this study are expected to reduce the dosage and dosage-related side effects of BMP-2 in jawbone repair, offering new strategies for the use of dosage and mode of growth factors in tissue-engineered bone.\u003c/p\u003e","manuscriptTitle":"Enhancement of BMP-2-Induced Osteogenic Differentiation of MC3T3-E1 Cells by Dexamethasone through the Smad Signaling Pathway","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-05-06 16:57:58","doi":"10.21203/rs.3.rs-4303918/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"c70d1aff-f0ae-4e53-820d-4db9e054c328","owner":[],"postedDate":"May 6th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-07-11T01:14:45+00:00","versionOfRecord":[],"versionCreatedAt":"2024-05-06 16:57:58","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4303918","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4303918","identity":"rs-4303918","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-23T02:00:01.238055+00:00
License: CC-BY-4.0