A novel methylation-detection panel for HPV associated high-grade squamous intraepithelial lesion and cervical cancer screening

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher
Full text 103,504 characters · extracted from preprint-html · click to expand
A novel methylation-detection panel for HPV associated high-grade squamous intraepithelial lesion and cervical cancer screening | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article A novel methylation-detection panel for HPV associated high-grade squamous intraepithelial lesion and cervical cancer screening Xiaobo Cheng, Ranran Chai, Teng Zhang, Yanjie Chen, Fangqin Fan, and 13 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4664647/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 26 Oct, 2024 Read the published version in Scientific Reports → Version 1 posted 12 You are reading this latest preprint version Abstract Objective Cervical cancer (CC) was considered to be the most common gynaecological cancer, with an estimated 342,000 deaths worldwide each year, as the majority of patients were diagnosed at an advanced stage of the disease. The purpose of this study was to evaluate the predictive value of multi-locus methylation assay for the early detection of CC. Methods The cervical exfoliated cell samples from 492 HPV-positive females with cervical lesions were collected and subjected to methylation detection of gene FAM19A4, EPB41L3 and PAX1 after bisulfite conversion. The levels of gene methylation in patients with different severity of cervical lesions were evaluated and compared. The receiver-operating characteristic (ROC) curve was established and efficacy indexes such as sensitivity, specificity and area under the curve (AUC) were calculated to assess the diagnostic value of DNA methylation detection at multiple gene loci for CC. Results The methylation levels of FAM19A4, EPB41L3 and PAX1 were significantly increased with the grade of cervical squamous intraepithelial lesions. The sensitivities of FAM19A4, EPB41L3 and PAX1 alone for high-grade squamous intraepithelial lesion (HSIL) and CC diagnosis were 84.6%, 86.3% and 88.0%, respectively; when three markers were combined by a logistic regression model, the sensitivity was 88.0%, with a high specificity of 97.7% and AUC of 0.957 (95% CI: 0.937–0.977). Conclusion Methylation status of FAM19A4, EPB41L3 and PAX1 were highly specific and effective for monitoring the progression of cervical lesions and the tri-gene methylation assay provided an alternatively non-invasive choice for CC early screening. DNA methylation detection early screening cervical squamous intraepithelial lesion cervical cancer Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Over the past few decades, cervical cancer (CC), with the increasing morbidity, has been seriously harming human health and becomes a leading cause of female death worldwide in modern society [ 1 ]. The persistent infection of high-risk human papillomavirus (hrHPV) is an important factor in the development and progression of CC, and almost all patients with CC are HPV-positive [ 2 ]. Currently, cervical liquid-based cytology examination and hrHPV testing have been proposed as the main CC screening methods. However, the sensitivity and specificity of these methods are limited, leading to an increase in colposcopy referrals, thereby increasing the physical and mental burden on women [ 3 , 4 ]. Therefore, a cost-benefical screening strategy with high accuracy and feasibility is urgently needed to predict the occurrence of CC in high-risk patients. Recent studies have shown that genomic and epigenetic abnormalities are present in the early stages of tumorigenesis. DNA methylation is an epigenetic mechanism that results in heritable silence of genes without changes to their coding sequences [ 5 ]. The occurrence of a variety of tumors is associated with methylation changes in genomic DNA, and these tumor-specific changes are often detected at an early stage. It has been proved that hypermethylation modification of the promoter regions of the tumor suppressor genes is positively correlated with the degree of cervical lesions, making DNA methylation detection a promising tool for CC diagnosis [ 6 , 7 ]. The methylation status of cytosine (C) in CpG dinucleotides in the promoter regions of human genes such as FAM19A4, EPB41L3 or PAX1 has been found to be significantly different in cancerous cervical exfoliated cells, compared to normal cervical exfoliated cells [ 8 – 10 ]. However, previous studies usually had small sample sizes and mostly focused on a single gene, resulting in low sensitivity and specificity for diagnosing CC. This exploratory study aimed to develop a methylation-detection panel containing three genes (FAM19A4, EPB41L3 and PAX1) and investigate the predictive value of polygenic methylation assay in CC screening, so as to provide more references for early diagnosis and treatment. The gene methylation assay, as previously described [ 11 ], firstly used bisulfite to treat CpG dinucleotides on genomic DNA, and bisulfite treatment would produce different transformation effects on CpG dinucleotides in different methylation states: if the cytosine (C) in CpG dinucleotide was methylated, it would remain unchanged after treatment; If the cytosine (C) in the CpG dinucleotide was not methylated, it would be converted to uracil (U) after treatment. Subsequently, the methylation status was qualitatively analyzed using the fluorescent probes that specifically identified untransformed CpG dinucleotides. Materials and methods Study participants and samples The cervical exfoliated cell samples from participants used in the experiment were all from Obstetrics and Gynecology Hospital Affiliated to Fudan University, Shanghai, China from March 2023 to May 2023, with a total of 492 consecutive cases. According to the WHO 2020 pathological classification criteria for CC and corresponding cervical histopathological test reports, the clinical samples used in the trial were divided into control group (151 cases), low-grade squamous intraepithelial lesion (LSIL) group (107 cases), high-grade squamous intraepithelial lesion (HSIL) group (121 cases), and CC group (113 cases). The histopathological report was verified by two professional pathologists with associate senior titles and above. Specimens are collected by a stationary physician and baseline clinical characteristics were obtained from all participants at the time of admission. This study complied with the Declaration of Helsinki and was approved by the Institutional Ethics Committee of Obstetrics and Gynecology Hospital Affiliated to Fudan University. All participants provided written informed consent. Inclusion criteria for all subjects were as follows: a) Patients with HPV infection who were not pregnant and had not received vaginal medication or vaginal irrigation within 7 days prior to visit; b) Patients with cervical inflammation or intraepithelial neoplasia or CC; c) Patients and their families agreed to participate in the study and signed an informed consent. Exclusion criteria for all subjects were as follows: a) Patients with a history of pelvic chemoradiotherapy; b) Patients with a history of cervical and uterine surgery; c) Patients treated with antibiotics in the last 1 week; d) Patients who were menstruating at the time of enrollment; e) Patients with HPV infection and vaginal lesions but no cervical inflammation. DNA extraction and bisulfite transformation Samples were collected using a disposable cervical sampling swab and stored in cell preservation solution (PreservCyt Solution, Hologic, National Machinery: 20140197) at -80℃. Genomic DNA extraction was performed from cervical exfoliated cells using UE Genomic DNA Miniprep Kit (Suzhou Youyi Landi Biotechnology, catalog number: UE-MN-MS-GDNA-250 ). 40 ~ 1000 ng of genomic DNA was taken and transformed into bisulfite-converted DNA (bisDNA) according to the instructions of the recommended bisulfite conversion kit EZ DNA Methylation-Gold (ZYMO RESEARCH, catalog number: D5006), and finally bisDNA was eluted with 20 µl of ultrapure water and stored at − 20℃ until analysis. In general, cytosine (C), which was not methylated on DNA, became uracil (U) due to deamination, while methylated cytosine (C) was not converted by bisulfite and remained unchanged. Methylation-specific PCR (MSP) analysis The bisDNA from the previous step was used as a template for methylation-specific PCR (MSP) amplification using Hongshi PCR Analysis System (SLAN-96S), and the specific primers could only amplify the methylated genes, so as to detect the methylation status of the three genes FAM19A4, EPB41L3 and PAX1. ACTB was set as the internal reference gene to monitor the extraction effect of each sample and the amplification of the PCR reaction, in order to effectively avoid false negatives. When the Ct value of the ACTB gene was ≤ 32.0, the sample test result was valid. The Ct value was defined as 45.0 when the gene was not amplified. Calculated the ΔCt value for each target gene, where the target gene ΔCt = Ct (FAM19A4/EPB41L3/PAX1)-Ct (ACTB). MSP program setting were as follows: 94℃ for 30 seconds in stage 1, 94℃ for 5 seconds and 60℃ for 30 seconds in stage 2 (stage 2 for 45 cycles). A blank control and a positive control were included in each assay. The primers and probes were both synthesized by Shanghai Sangon Bioengineering and these specific sequences were summarized in Table 1 . All primers were lyophilized powder and dissolved in TE buffer at PH8.0. PAGE electrophoresis did not contain miscellaneous bands. Determined with a visible-ultraviolet spectrophotometer, the OD260nm/OD280nm was between 1.6-2.0. All probes were lyophilized powder and stored in brown tubes,with a purity of HPLC grade. The probes were also dissolved with TE buffer at PH8.0. Visible-ultraviolet spectrophotometer determined that OD260nm/OD280nm was between 1.6-2.0. The probes had a specific absorption peak at the fluorescein excitation wavelength of 494nm (FAM fluorophore) or 576nm (ROX fluorophore). We selected PerfectStart™ II Probe qPCR SuperMix (TransGen Biotech, catalog number: AQ711) with the best amplification efficiency and reaction stability as the raw material for the MSP reaction. Table 1 Specific sequences of probes and primers (5’-3’) Gene FAM19A4 EPB41L3 PAX1 ACTB Forward primer GGGTCGGTTTTTTTTTCGTT TTTTTTGTTGTAGGAGATATCGAGG GTAGTGACGGGAATTAATGAGTTG TGGTGATGGAGGAGGTTTAGTAAGT Reverse primer GAACCCTAAATCCGTCTTCCTT CCCTACGCCAAAACGAAAA CAAACCCAAAATAAACTTCATCC AACCAATAAAACCTACTCCTCCCTTAA probe TAGGCGTTTTTTTCGAGCGTTTCG CGGGGGTTTACGTTTAGAGAT ATTGTCGAGATTGACGTGGAGGATACG ACCACCACCCAACACACAATAACA Statistic analysis All acquired data were analyzed and visualized using SPSS 17.0 and GraphPad Prism 8 software. For continuous variables, normal distribution data presented as means ± standard deviation were compared using t-test between two groups or one-way analysis of variance (ANOVA) among multiple groups. Skewed distribution data expressed as median value (interquartile interval) were analyzed using the Mann-Whitney U test between two groups or Kruskal-Wallis H test among multiple groups. Categorical variables were expressed as percentage and evaluated using Fisher's exact test. Receiver-operating characteristic (ROC) curves were established and logistic regression analysis was performed to assess the clinical predictive value of polygenic methylation assay for HSIL and CC. A two-tailed p value < 0.05 was considered to be statistically significant. The ΔCt data of each target gene were analyzed separately using SPSS 17.0, and the software automatically generated a ROC curve. According to the coordinate point data from SPSS 17.0, excel was used to calculate "sensitivity + specificity", and the point with the largest value was the optimal cut-off value. The website for drawning the heatmap was https://www.bioinformatics.com.cn/ [ 12 ]. Results Characteristics of study participants According to the inclusion criteria, a total of 505 subjects were selected, and according to the exclusion criteria, 492 subjects were finally recruited. They were divided into four groups according to the results of pathological tests from the hospital: control group (151 cases), LSIL group (107 cases), HSIL group (121 cases) and CC group (113 cases) (Fig. 1 ). The age distribution of the four groups was normal and there were no significant differences in these groups (P > 0.05, Table 2 ). The age range for the control group was 20–62 years old (38.00 ± 15.36). For the LSIL group, the age range was 31–64 years old (40.25 ± 12.28). The HSIL group ranged in age from 26 to 74 years old (41.88 ± 11.64), while the CC group ranged in age from 28 to 78 years old (40.50 ± 12.47). It could be concluded that the incidence of cervical intraepithelial neoplasia and CC is tending towards a younger age group, with the majority of each group being under 35 years old. Obviously, both the HSIL and CC groups had a higher proportion of hrHPV16/18 infection compared to the control and LSIL groups (p 35 vs. ≤35 hrHPV 16/18 infection Other types of HPV infection Control group 151 56 (37%) vs. 95 (63%) 71 (47%) 80 (53%) LSIL group 107 45 (42%) vs. 62 (58%) 56 (52%) 51 (48%) HSIL group 121 40 (33%) vs. 81 (67%) 76 (63%) * 45 (37%) CC group 113 53 (47%) vs. 60 (58%) 93 (82%) * 20 (18%) Data are expressed as case (percentage), * p < 0.05 vs. Control Relationship between gene methylation and cervical lesions The methylation degree of FAM19A4 (Fig. 2 A), EPB41L3 (Fig. 2 B) or PAX1 (Fig. 2 C) was further compared in the four groups. According to the principle of MSP, a smaller ΔCt value usually indicated a higher methylation level of the target gene. As shown in Fig. 2 , the methylation levels of all three genes were significantly higher in the HSIL and CC groups than in the control and LSIL groups (p < 0.05), and the CC group had higher gene methylation degree compared to the HSIL group (p 0.05). The clustering heatmap in Fig. 3 illustrated the same findings. It could be seen that the higher the methylation level of the target gene, the greater the risk of cervical malignancy, especially HSIL and CC, indicating a positive correlation between the degree of gene methylation and the severity of cervical lesions. Diagnostic potential of target gene methylation for HSIL and CC ROC analysis was conducted to evaluate the predictive value of gene methylation levels including FAM19A4, EPB41L3 and PAX1 to diagnose HSIL and CC patients. To differentiate the HSIL + CC cases from the control + LSIL cases (Fig. 4 B), cut-off value of ΔCt was 10.445 (sensitivity, 84.6%; specificity, 96.1%) for FAM19A4, 9.08 (sensitivity, 86.3%; specificity, 95.3%) for EPB41L3, and 10.015 (sensitivity, 88.0%; specificity, 97.7%) for PAX1. To differentiate the CC cases from the HSIL cases (Fig. 4 C), cut-off value of ΔCt was 5.375 (sensitivity, 68.1%; specificity, 66.9%) for FAM19A4, 2.665 (sensitivity, 54.9%; specificity, 81.8%) for EPB41L3, and 4.955 (sensitivity, 81.4%; specificity, 58.7%) for PAX1. Consistent with the previous result that there was no significant difference in gene methylation degree between control group and LSIL group, it was also of low value in the diagnosis of LSIL (Fig. 4 A, p > 0.05). Meanwhile, it could be seen that the methylation levels of the three genes had higher diagnostic value for HSIL + CC (Fig. 4 B), but their specificity and sensitivity in differentiating HSIL from CC were relatively low (Fig. 4 C). All area under the curve (AUC) and p values were shown in Fig. 4 D. We further performed logistic regression analysis to determine the scoring weights of the three target genes in the model, and established a combined scoring formula based on the ΔCt values of the three target genes. Then, the optimal scoring threshold were determined based on the principle of the largest Youden index. After analysis, the scoring formula for value at risk (VAR) of the logistic regression model differentiating the HSIL + CC cases from the control + LSIL cases was: VAR = 6.498 − 0.107*ΔCt (FAM19A4)-0.167*ΔCt (EPB41L3)-0.305*ΔCt (PAX1). As shown in Fig. 5 A, VAR cut-off value was 0.599 with 88% sensitivity and 97.7% specificity (AUC, 0.957; 95%CI, 0.937–0.977; p < 0.0001). However, the scoring formula differentiating the CC cases from the HSIL cases was: VAR = 1.475 − 0.105*ΔCt (EPB41L3) -0.157*ΔCt (PAX1). As shown in Fig. 5 B, VAR cut-off value was 0.257 with 78.8% sensitivity and 62% specificity (AUC, 0.752; 95%CI, 0.691–0.814; p < 0.0001). Apparently, compared with the single target gene prediction model, the combined tri-gene methylation assay had higher sensitivity, specificity and AUC for predicting HSIL + CC cases (Fig. 5 A). It was worth noting that in the logistic regression model that differentiated HSIL from CC, the sensitivity, specificity, and AUC were relatively low, and the role of gene FAM19A4 even did not reach a statistically significant level (p > 0.05, Fig. 5 B). Discussion For the first time, we described methylation alterations in genes FAM19A4, EPB41L3 and PAX1 in HPV-positive patients with cervical lesions and explored their relationship with disease progression. The major new findings of this study were: (i) methylation levels of these three genes were markedly elevated in HSIL and CC patients and could be considered as new biomarkers accurately distinguishing between HSIL + CC cases and control + LSIL cases; (ii) The methylation degree of all three genes had high sensitivity and specificity for the diagnosis and prediction of HSIL + CC, especially the diagnostic performance of the tri-gene methylation assay was more prominent; (iii) methylation levels of the three genes were positively correlated with the severity of cervical lesions, and they had significant differences in group HSIL and CC. Although slightly inferior, methylation assay of the three genes still had considerable sensitivity and specificity for distinguishing between HSIL and CC, which could act as novel indicators to monitor disease progression; (iv) Although all of the included subjects were HPV-positive, patients in groups HSIL and CC seemed to have a higher proportion of hrHPV16/18 infection. CC is one of the most common malignant tumors in wome with extremely high morbidity and mortality rate [ 13 ]. Although the incidence rate of CC in China has been dramatically increasing in recent years, the screening rate in China is markedly lower than those in developed countries [ 14 ]. HPV has emerged as a primary cause of CC worldwide. To date, 228 genotypes of HPV have been identified. Persistent infection of hrHPV (mainly with HPV16 and HPV18) usually results in the development of malignancy of cervix [ 15 ]. Scientific screening, rational triage of risk groups and active interventions are critical to effectively prevent disease progression, improve prognosis and reduce fatality. Cervical liquid-based cytology examination is mainly used to stain the exfoliated cells from the cervix to observe morphological changes and then determine whether the cells are cancerous. The specificity of cytology examination is high, but the sensitivity is low, which is easy to lead to missed diagnosis and treatment. The judgment of cytology results needs to be interpreted by professional pathologists under the microscope, and as a result, results are susceptible to subjective decisions [ 3 ]. HPV testing is an etiological examination to detect whether the cervix is infected with HPV virus through nucleic acid testing for pathogens [ 4 ]. The sensitivity of HPV testing is high, but the specificity is poor. The false-positive rate is relatively high, and it is impossible to distinguish between transient infection and pathogenic infection. Transient HPV infection will not develop into cervical precancerous lesions or CC, which is easy to increase the rate of colposcopy referral and cervical tissue biopsy, causing unnecessary suffering to women [ 16 ]. Aberrant genomic DNA methylation of cervical exfoliated cells is a common epigenetic alteration in the process of CC. HPV can induce hypermethylation of the promoter of certain tumor suppressor genes in the host, thereby causing gene silencing and participating in the occurrence of CC [ 17 ]. The quantitative detection of DNA methylation of related genes can act as a new means for CC screening, which has important clinical value for monitoring high-risk populations [ 18 – 23 ]. FAM19A4 gene is a member of the TAFA family, which is low in most normal tissues and slightly higher in brain tissues, and is generally considered to be involved in immune response as immunomodulators, with the function of preventing pathogen invasion [ 24 , 25 ]. It was found that the promoter of FAM19A4 gene had a high degree of abnormal methylation in cervical precancerous lesions and CC, and the methylation detection of FAM19A4 gene promoter had a higher specificity than cytology examination and HPV testing in CC screening [ 26 ]. Luttmer et al. [ 27 ] found that the sensitivity of FAM19A4 methylation assay, cytology examination and HPV16/18-genotyping testing for the detection of cervical lesion (grade ≥ CIN 3) was 75.6%, 85.6% and 72.2%, respectively, and the specificity was 71.1%, 49.8% and 57.4%, respectively. According to another study, patients with a positive FAM19A4 methylation test could be directly referred for colposcopy, while a negative test could predict a transient HPV infection and a low risk of CC [ 28 ]. In our study, methylation levels of FAM19A4 gene promoter had a higher sensitivity and specificity for the diagnosis of HSIL + CC, at 84.6% and 96.1%, respectively. The sensitivity and specificity of further differentiating HSIL from CC were 68.1% and 66.9%, respectively. EPB41L3 (erythrocyte membrane protein band 4.1 like 3), also known as 4.1B or DAI-1, is an important membrane skeleton protein belonging to the protein 4.1 family. As a candidate tumor suppressor gene, EPB41L3 inhibits cell overgrowth by inducing cell apoptosis and arresting the cell cycle [ 29 ]. It was found that the expression of EPB41L3 in various malignant tumors such as CC was significantly down-regulated compared with that in normal tissues, and the aberrant methylation of its promoter played an important role in the regulation of the expression of EPB41L3 genes [ 30 ]. Boers et al. [ 31 ] showed that the sensitivity and specificity of EPB41L3 promoter methylation for the screening of CIN3 cervical precancerous lesions reached 79% and 88%, respectively, with good shunt guidance significance for HPV-positive patients. In our study, methylation levels of EPB41L3 gene promoter had a higher sensitivity and specificity for the prediction of HSIL + CC, at 86.3% and 95.3%, respectively. The sensitivity and specificity of further differentiating HSIL from CC were 54.9% and 81.8%, respectively. PAX1 has been revealed to be a key tumor suppressor gene that regulates cell differentiation and maturation. In cervical cells, once the PAX1 gene promoter is methylated, it will cause the gene to be silenced or inactivated, thus losing the function of inhibiting tumor growth and resulting in CC, which has been widely recognized and studied internationally [ 32 ]. In 2010, Lai's research team [ 33 ] found that PAX1 methylation assay has a sensitivity of 78% and a specificity of 91% for CIN3 + cervical precancer. In 2014, Kan's study [ 34 ] confirmed that methylation detection of PAX1 has an 86% sensitivity and 85% specificity for CIN3 + cervical precancer. In another study, Yang L et al. [ 35 ] found that in non-HPV16/18 hrHPV-positive populations, PAX1 methylation detection had a sensitivity and specificity of 86.2% and 75.5%, respectively, for CIN2 cervical precancerous lesions, while CIN3 cervical precancerous lesions had a sensitivity and specificity of 90% and 69.3%, respectively, which were significantly better than cytology detection. According to the latest research, hypermethylation of PAX1 was positively associated with high HPV viral load, especially HPV16/18, and PAX1 methylation had a specificity of 86.6% for detecting CIN2+ [ 36 ]. From our experimental data, the methylation detection of gene PAX1 also had high sensitivity and specificity for the diagnosis of HSIL + CC, which is 88.0% and 97.7%, respectively. The sensitivity and specificity of further differentiating HSIL from CC were 81.4% and 58.7%, respectively. Meanwhile, there were also some limitations in this study. First, due to the fact that there was no difference in methylation degree of the three genes in the control cases and the LSIL cases, other screening indicators need to be further explored and confirmed for cervical lesions below HSIL. Second, on the basis that both HSIL and CC cases had high methylation levels of FAM19A4, EPB41L3 and PAX1 and high rates of hrHPV16/18 infection, further studies are needed to investigate the relationship between methylation alterations and hrHPV16/18 viral load. Last but not least, further basic researches are needed to explore the mechanism of these tumor suppressor genes with abnormal methylation status in the pathogenesis of CC, so as to provide more effective and precise therapies and interventions. Conclusion In all, this exploratory study aimd to explore the possible role of methylation detection in CC screening. We firstly provided evidence that the methylation levels of FAM19A4, EPB41L3 and PAX1 increased as cervical lesions worsened, thus promising to be new biomarkers for monitoring disease progression. In particular, if possible, the combinationed performance of tri-gene methylation assay and logistic regression model will have the greatest predictive value. Our experimental results revealed that methylation detection of these three genes has extremely high sensitivity and specificity for HSIL and above, including CC. however, if further differentiation between HSIL and CC is required, additional ancillary evidence may be necessary to ensure that the diagnosis is not flawed. Abbreviations LSIL: low-grade squamous intraepithelial lesion HSIL: high-grade squamous intraepithelial lesion CC: cervical cancer hrHPV: high-risk human papillomavirus HPV: human papillomavirus ROC: the receiver-operating characteristic curve AUC: area under the curve CI: confidence interval MSP: methylation-specific PCR ANOVA: one-way analysis of variance VAR: value at risk Declarations Supplementary Information Not applicable. Acknowledgements We would like to thank all the participants and their families who agreed on taking part into the study. We also thank all the researchers and clinical staff that helped collecting the data used in this research. In particular, we acknowledge Dr. Wu Kang for giving professional advice on this article. Author Contributions YK, WFL and TZ made substantial contributions in conception and design; XBC, RRC, YJC, FQF, YFY, GQJ, TTL, HW, JWD, MZ, YHH, QZT and ZQS made contributions to acquisition of clinical data and samples; WWS and TZ performed experiments and data analysis; YQJ and TZ wrote the original draft of the manuscript under the supervision of YK and WFL; XBC took part in reviewing the article or revising it critically for important intellectual content. All authors read and approved the final manuscript, and agreed to submit to the current journal and to be accountable for all aspects of the work. Funding Not applicable. Availability of data and materials Data are available from the corresponding author on request. Ethics approval and consent to participate All study protocols comply with the Declaration of Helsinki. All participants provided written and informed consent before being included in the research. The protocol for the study has been approved by the Institutional Ethics Committee of Obstetrics and Gynecology Hospital Affiliated to Fudan University. Consent for publication Not applicable. Competing interests The authors declare that they have no competing interests. Author details 1 Clinical Research Center, Obstetrics & Gynecology Hospital of Fudan University, Shanghai 200090, P.R. China. 2 Shanghai Ruisai Biotechnology Co., Ltd., No. 3399 Kangxin Highway, Pudong New Area, Shanghai, China. References Singh D, Vignat J, Lorenzoni V, et al. Global estimates of incidence and mortality of cervical cancer in 2020: a baseline analysis of the WHO Global Cervical Cancer Elimination Initiative.Lancet Glob Health. 2023;11:E197-E206. Sankaranarayanan R, Prabhu PR, Pawlita M. Immunogenicity and HPV infection after one, two, and three doses of quadrivalent HPV vaccine in girls in India: a multicentre prospective cohort study. Lancet Oncol. 2016;17(1):67-77. MacLaughlin KL, Jacobson RM, Radecki Breitkopf C, et al. Trends over time in pap and Pap-HPV cotesting for cervical cancer screening. J Womens Health. 2019;28(2):244-249. Nkwabong E, Laure Bessi Badjan I, Sando Z, et al. Pap smear accuracy for the diagnosis of cervical precancerous lesions. Trop Doct. 2019;49(1):34-39. Lechner M, Boshoff C, Beck S, et al. cancer epigenome. Adv Genet. 2010;70:247-276. Kristensen LS, Hansen LL. PCR-based methods for detecting single-locus DNA methylation biomarkers in cancer diagnostics, prognostics, and response to treatment. Clin Chem. 2009;55(8):1471-1483. Wentzensen N, Sherman ME, Schiffman M, et al. Utility of methylation markers in cervical cancer early detection: appraisal of the state-of-thescience. Gynecol Oncol. 2009;112(2):293-299. Yu-Ligh, Liou., Tao-Lan, et al. Combined clinical and genetic testing algorithm for cervical cancer diagnosis. Clin Epigenetics. 2016; 8(0), 0. Qiaowen, Bu., Sanfeng, et al. The clinical significance of FAM19A4 methylation in high-risk HPV-positive cervical samples for the detection of cervical (pre)cancer in Chinese women. BMC Cancer. 2018;18(1), 0. Ying, Sha., Yunyun, et al. Exploring the Diagnostic Potential of EPB41L3 Methylation in Cervical Cancer and Precancerous Lesions: A Systematic Review and Meta-Analysis. Gynecol Obstet Invest. 2023;89(1), 0. Xiang, Li., Lu, et al. BRIF-Seq: Bisulfite-Converted Randomly Integrated Fragments Sequencing at the Single-Cell Level. Mol Plant. 2019;12(3), 0. The bioinformatics cluster heatmap. https://www.bioinformatics.com.cn/. Accessed 21 May 2024. Bray F, Ferlay J, Soerjomataram I, et al. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA: Cancer J Clin. 2018;68(6):394-424. Bao H, Zhang L, Wang L, et al. Significant variations in the cervical cancer screening rate in China by individual-level and geographical measures of socioeconomic status: a multilevel model analysis of a nationally representative survey dataset. Cancer Med;2018,7(5):2089-2100. Jee B, Yadav R, Pankaj S, et al. Immunology of HPV-mediated cervical cancer: current understanding. Int Rev Immunol. 2021;40:359-378. Koliopoulos G, Nyaga VN, Santesso N, et al. Cytology versus HPV testing for cervical cancer screening in the general population. Cochrane Database Syst Rev. 2017;8(8):CD008587. Bowden SJ, Lathouras K, Kyrgiou M, et al. Can DNA methylation tests improve the accuracy of cervical screening?. BJOG. 2021;128(3):515. de Waard J, Bhattacharya A, de Boer MT, et al. Identification of a methylation panel as an alternative triage to detect CIN3+ in hrHPV-positive self-samples from the population-based cervical cancer screening programme. Clin Epigenetics. 2023;15(1):103. Reuter C, Preece M, Banwait R, et al. Consistency of the S5 DNA methylation classifier in formalin-fixed biopsies versus corresponding exfoliated cells for the detection of pre-cancerous cervical lesions. Cancer Med. 2021;10(8):2668-2679. Zhang J, Yang C, Wu C, et al. DNA methyltransferases in cancer: biology, paradox, aberrations, and targeted therapy. Cancers (Basel). 2020;12(8):2123. Feng C, Dong J, Chang W, et al. The progress of methylation regulation in gene expression of cervical cancer. Int J Genomics. 2018;2018:8260652. Hernandez-Lopez R, Lorincz AT, Torres-Ibarra L, et al. Methylation estimates the risk of precancer in HPV-infected women with discrepant results between cytology and HPV16/18 genotyping. Clin Epigenetics. 2019;11(1):140. Kelly H, Benavente Y, Pavon MA, et al. Performance of DNA methylation assays for detection of high-grade cervical intraepithelial neoplasia (CIN2+): a systematic review and Meta-analysis. Br J Cancer. 2019;121(11):954-965. Tom TY, Emtage P, Funk WD, et al. TAFA: a novel secreted family with conserved cysteine residues and restricted expression in the brain. Genomics. 2004;83(4):727-734. Wang W, Li T, Wang X, et al. FAM19A4 is a novel cytokine ligand of formyl peptide receptor 1 (FPR1) and is able to promote the migration and phagocytosis of macrophages. Cell Mol Immunol. 2015;12(5):615-624. De Strooper LMA, Meijer CJ, Berkhof J, et al. Methylation analysis of the FAM19A4 gene in cervical scrapes is highly efficient in detecting cervical carcinomas and advanced CIN2/3 lesions. Cancer Prev Res (Phila). 2014;7(12):1251-1257. Luttmer R, De Strooper LM, Berkhof J, et al. Comparing the performance of FAM19A4 methylation analysis, cytology and HPV16/18 genotyping for the detection of cervical (pre)cancer in high-risk HPV-positive women of a gynecologic outpatient population (COMETH study). Int J Cancer. 2016;138(4):992-1002. Bu Q, Wang S, Ma J, et al. The clinical significance of FAM19A4 methylation in high-risk HPV-positive cervical samples for the detection of cervical (pre)cancer in Chinese women. BMC Cancer. 2018;18(1):1182. Xiaofeng, Yuan., Lianhua, et al. Pivotal roles of protein 4.1B/DAL-1, a FERM‑domain containing protein, in tumor progression (Review). Int J Oncol. 2019;55(5),0. Kelly HA, Chikandiwa A, Warman R, et al. Associations of human gene EPB41L3 DNA methylation and cervical intraepithelial neoplasia in women living with HIV-1 in Africa. AIDS. 2018;32(15):2227-2236. BoersA, Bosgraaf RP, van Leeuwen RW, et al. DNA methylation analysis in self-sampled brush material as a triage test in hrHPV-positive women. Br J Cancer. 2014;111(6):1095-101. Li X, Liu H, Zhou X, et al. PAX1 hypomethylation as a prognostic biomarker for radioresistance of cervical cancer. Clin Epigenetics. 2023;15(1):123. Lai H.C., Lin Y.W., Huang R.L., et al. Quantitative DNA methylation analysis detects cervical intraepithelial neoplasms type 3 and worse. Cancer. 2010;116,4266-4274. Kan Y.Y., Liou Y.L., Wang H.J., et al. PAX1 methylation as a potential biomarker for cervical cancer screening. Int. J. Gynecol Cancer. 2014;24,928-934. Yang L, Tao H, Lin B, et al. Utilization of PAX1 methylation test for cervical cancer screening of non-HPV16/18 high-risk HPV infection in women. Future Oncol. 2023;19: 1917-1927. Li M, Zhao C, Zhao Y, et al. Association and Effectiveness of PAX1 Methylation and HPV Viral Load for the Detection of Cervical High-Grade Squamous Intraepithelial Lesion. Pathogens. 2022;12(1):63. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 26 Oct, 2024 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 30 Jul, 2024 Reviews received at journal 30 Jul, 2024 Reviews received at journal 26 Jul, 2024 Reviews received at journal 25 Jul, 2024 Reviewers agreed at journal 16 Jul, 2024 Reviewers agreed at journal 15 Jul, 2024 Reviewers agreed at journal 15 Jul, 2024 Reviewers invited by journal 05 Jul, 2024 Editor assigned by journal 05 Jul, 2024 Editor invited by journal 05 Jul, 2024 Submission checks completed at journal 05 Jul, 2024 First submitted to journal 30 Jun, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4664647","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":332397599,"identity":"a3266bf1-366a-4755-9e2b-e1d175f65b68","order_by":0,"name":"Xiaobo Cheng","email":"","orcid":"","institution":"Obstetrics \u0026 Gynecology Hospital of Fudan University","correspondingAuthor":false,"prefix":"","firstName":"Xiaobo","middleName":"","lastName":"Cheng","suffix":""},{"id":332397600,"identity":"bd026ec1-cde8-42f1-a256-61a56d072de7","order_by":1,"name":"Ranran Chai","email":"","orcid":"","institution":"Obstetrics \u0026 Gynecology Hospital of Fudan University","correspondingAuthor":false,"prefix":"","firstName":"Ranran","middleName":"","lastName":"Chai","suffix":""},{"id":332397601,"identity":"48e278ad-7117-48e4-8489-e6ee65e46b77","order_by":2,"name":"Teng Zhang","email":"","orcid":"","institution":"Shanghai Ruisai Biotechnology Co., Ltd","correspondingAuthor":false,"prefix":"","firstName":"Teng","middleName":"","lastName":"Zhang","suffix":""},{"id":332397602,"identity":"5bdc1ea1-7a0e-4914-9601-61b582ee5e4e","order_by":3,"name":"Yanjie Chen","email":"","orcid":"","institution":"Obstetrics \u0026 Gynecology Hospital of Fudan University","correspondingAuthor":false,"prefix":"","firstName":"Yanjie","middleName":"","lastName":"Chen","suffix":""},{"id":332397603,"identity":"078897e3-1422-4f02-a29e-1c1023589974","order_by":4,"name":"Fangqin Fan","email":"","orcid":"","institution":"Obstetrics \u0026 Gynecology Hospital of Fudan University","correspondingAuthor":false,"prefix":"","firstName":"Fangqin","middleName":"","lastName":"Fan","suffix":""},{"id":332397604,"identity":"c65a2753-b4a2-4d9c-a489-3fdfed0f93f3","order_by":5,"name":"Yingfei Ye","email":"","orcid":"","institution":"Obstetrics \u0026 Gynecology Hospital of Fudan University","correspondingAuthor":false,"prefix":"","firstName":"Yingfei","middleName":"","lastName":"Ye","suffix":""},{"id":332397605,"identity":"74d9fa14-eec3-4ad6-ba03-0401229f5ba0","order_by":6,"name":"Guanqin Jin","email":"","orcid":"","institution":"Obstetrics \u0026 Gynecology Hospital of Fudan University","correspondingAuthor":false,"prefix":"","firstName":"Guanqin","middleName":"","lastName":"Jin","suffix":""},{"id":332397606,"identity":"60bfba02-672a-4d49-8c50-fde70fe79c3f","order_by":7,"name":"Tingting Li","email":"","orcid":"","institution":"Obstetrics \u0026 Gynecology Hospital of Fudan University","correspondingAuthor":false,"prefix":"","firstName":"Tingting","middleName":"","lastName":"Li","suffix":""},{"id":332397607,"identity":"a1ccc9d0-3e83-4d48-975e-1d24b540b78b","order_by":8,"name":"Hui Wang","email":"","orcid":"","institution":"Obstetrics \u0026 Gynecology Hospital of Fudan University","correspondingAuthor":false,"prefix":"","firstName":"Hui","middleName":"","lastName":"Wang","suffix":""},{"id":332397608,"identity":"892aeb39-cc6a-40de-80ac-80d0ae5b54b1","order_by":9,"name":"Jingwen Ding","email":"","orcid":"","institution":"Obstetrics \u0026 Gynecology Hospital of Fudan University","correspondingAuthor":false,"prefix":"","firstName":"Jingwen","middleName":"","lastName":"Ding","suffix":""},{"id":332397609,"identity":"59aac21d-ea0a-463c-b1c9-73138aa08a23","order_by":10,"name":"Min Zheng","email":"","orcid":"","institution":"Obstetrics \u0026 Gynecology Hospital of Fudan University","correspondingAuthor":false,"prefix":"","firstName":"Min","middleName":"","lastName":"Zheng","suffix":""},{"id":332397610,"identity":"69ee174f-5079-4131-bd82-8587f6cb3c3e","order_by":11,"name":"Yanhua Han","email":"","orcid":"","institution":"Obstetrics \u0026 Gynecology Hospital of Fudan University","correspondingAuthor":false,"prefix":"","firstName":"Yanhua","middleName":"","lastName":"Han","suffix":""},{"id":332397611,"identity":"3f9f69c6-edf7-4755-bc6b-c3db5a287d61","order_by":12,"name":"Qinzhu Tang","email":"","orcid":"","institution":"Obstetrics \u0026 Gynecology Hospital of Fudan University","correspondingAuthor":false,"prefix":"","firstName":"Qinzhu","middleName":"","lastName":"Tang","suffix":""},{"id":332397612,"identity":"d8035f81-a49a-460a-8b4c-49a0cfa2df6a","order_by":13,"name":"Zhiqing Song","email":"","orcid":"","institution":"Obstetrics \u0026 Gynecology Hospital of Fudan University","correspondingAuthor":false,"prefix":"","firstName":"Zhiqing","middleName":"","lastName":"Song","suffix":""},{"id":332397613,"identity":"6cbb7f16-a891-45fd-98d1-b0dcc4796c61","order_by":14,"name":"Yiqun Ji","email":"","orcid":"","institution":"Shanghai Ruisai Biotechnology Co., Ltd","correspondingAuthor":false,"prefix":"","firstName":"Yiqun","middleName":"","lastName":"Ji","suffix":""},{"id":332397614,"identity":"ee91d397-4294-4175-ab8f-866eba694ac9","order_by":15,"name":"Wengweng Song","email":"","orcid":"","institution":"Shanghai Ruisai Biotechnology Co., Ltd","correspondingAuthor":false,"prefix":"","firstName":"Wengweng","middleName":"","lastName":"Song","suffix":""},{"id":332397615,"identity":"e508906b-c637-454d-aae6-3892b67ed8fe","order_by":16,"name":"Weifeng Luo","email":"","orcid":"","institution":"Shanghai Ruisai Biotechnology Co., Ltd","correspondingAuthor":false,"prefix":"","firstName":"Weifeng","middleName":"","lastName":"Luo","suffix":""},{"id":332397616,"identity":"03312637-4c25-4dd4-a4b3-e6c863112c0a","order_by":17,"name":"Yu Kang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA1klEQVRIiWNgGAWjYFACNhBhw8/AkABiMBOtJU2ygVQth0nQYnAjLfFzwa/zEgbHk589YKiwTmxgP3uAkJbD0jP7bksYnHlmbsBwJj2xgScvgYCW9AZp3p7bdQY3EswkGNsOJzZI8BgQ0tL8m7fnnASQ8U2C8R9RWtKOSfP8OADUkgO0pYEILZJnnqVZ8zYkS0ieeVMmkXAs3biNJwe/Fr7jaca3ef7YSfAdT98m8aHGWraf/Qx+LQoHgARjG5SXwACNJ3xAvgFE/iGkbBSMglEwCkY0AADzXkiBKmZAVwAAAABJRU5ErkJggg==","orcid":"","institution":"Obstetrics \u0026 Gynecology Hospital of Fudan University","correspondingAuthor":true,"prefix":"","firstName":"Yu","middleName":"","lastName":"Kang","suffix":""}],"badges":[],"createdAt":"2024-07-01 01:30:49","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4664647/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4664647/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-024-75047-3","type":"published","date":"2024-10-26T15:57:05+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":62130998,"identity":"fa4a4811-4123-4b81-99ea-76342deda592","added_by":"auto","created_at":"2024-08-09 15:39:08","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":297334,"visible":true,"origin":"","legend":"\u003cp\u003eFlow chart of inclusion and exclusion to the current analysis\u003c/p\u003e","description":"","filename":"figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4664647/v1/44f2e42a9112b15188f3ee65.jpg"},{"id":62130995,"identity":"d5c0688d-0b52-4d42-8ee7-4e4a5459ea44","added_by":"auto","created_at":"2024-08-09 15:39:08","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":177142,"visible":true,"origin":"","legend":"\u003cp\u003eΔCt value of FAM19A4 (A), EPB41L3 (B) and PAX1 (C) in different groups. A smaller ΔCt value indicates a higher degree of methylation of the target gene. \u003cstrong\u003e*\u003c/strong\u003ep \u0026lt; 0.05 vs. control or LSIL group, \u003csup\u003e\u0026amp;\u003c/sup\u003ep \u0026lt; 0.05 vs. HSIL group\u0026nbsp;\u003c/p\u003e","description":"","filename":"figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4664647/v1/6cba47c7283bf3ba24f5a659.jpg"},{"id":62130997,"identity":"a6e4aea3-0f01-453e-a966-9717de7bb17e","added_by":"auto","created_at":"2024-08-09 15:39:08","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":459118,"visible":true,"origin":"","legend":"\u003cp\u003eHeatmap of methylation degree of FAM19A4, EPB41L3 and PAX1 in different groups. Blue represents a high ΔCt value, which corresponds to a low degree of methylation, and red indicates a low ΔCt value, which corresponds to a high degree of methylation\u003c/p\u003e","description":"","filename":"figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4664647/v1/1ea184c790d321acced9a197.jpg"},{"id":62130996,"identity":"6e7f8490-e3f7-4552-a124-14cf4a12a90c","added_by":"auto","created_at":"2024-08-09 15:39:08","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":463730,"visible":true,"origin":"","legend":"\u003cp\u003eROC curve of FAM19A4, EPB41L3 and PAX1 for predictive values to differentiate the LSIL cases from control (A), the HSIL+CC cases from the control+LSIL cases (B) and the CC cases from the HSIL cases (C). All AUC and p values are shown in (D)\u003c/p\u003e","description":"","filename":"figure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4664647/v1/faa451471319fab185d25dfd.jpg"},{"id":62130973,"identity":"cac5e0ed-c907-46b6-8ea2-556ac6ec7568","added_by":"auto","created_at":"2024-08-09 15:39:06","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":193818,"visible":true,"origin":"","legend":"\u003cp\u003eROC curve of logistic regression analysis for predictive values to differentiate the HSIL+CC cases from the control+LSIL cases (A) and the CC cases from the HSIL cases (B). AUC is 0.957 (95% CI, 0.937-0.977) for (A, p \u0026lt; 0.0001) and 0.752 (95%CI, 0.691-0.814) for (B, p \u0026lt; 0.0001)\u003c/p\u003e","description":"","filename":"figure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4664647/v1/c4dfca3dd662ad934244a13b.jpg"},{"id":67681886,"identity":"150940d7-ec3d-4cfd-948a-21cc03fd312a","added_by":"auto","created_at":"2024-10-28 16:10:54","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2113066,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4664647/v1/c5cb1933-eeed-4872-b897-5a7643cbe610.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"A novel methylation-detection panel for HPV associated high-grade squamous intraepithelial lesion and cervical cancer screening","fulltext":[{"header":"Introduction","content":"\u003cp\u003eOver the past few decades, cervical cancer (CC), with the increasing morbidity, has been seriously harming human health and becomes a leading cause of female death worldwide in modern society [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. The persistent infection of high-risk human papillomavirus (hrHPV) is an important factor in the development and progression of CC, and almost all patients with CC are HPV-positive [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Currently, cervical liquid-based cytology examination and hrHPV testing have been proposed as the main CC screening methods. However, the sensitivity and specificity of these methods are limited, leading to an increase in colposcopy referrals, thereby increasing the physical and mental burden on women [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Therefore, a cost-benefical screening strategy with high accuracy and feasibility is urgently needed to predict the occurrence of CC in high-risk patients.\u003c/p\u003e \u003cp\u003eRecent studies have shown that genomic and epigenetic abnormalities are present in the early stages of tumorigenesis. DNA methylation is an epigenetic mechanism that results in heritable silence of genes without changes to their coding sequences [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. The occurrence of a variety of tumors is associated with methylation changes in genomic DNA, and these tumor-specific changes are often detected at an early stage. It has been proved that hypermethylation modification of the promoter regions of the tumor suppressor genes is positively correlated with the degree of cervical lesions, making DNA methylation detection a promising tool for CC diagnosis [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe methylation status of cytosine (C) in CpG dinucleotides in the promoter regions of human genes such as FAM19A4, EPB41L3 or PAX1 has been found to be significantly different in cancerous cervical exfoliated cells, compared to normal cervical exfoliated cells [\u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. However, previous studies usually had small sample sizes and mostly focused on a single gene, resulting in low sensitivity and specificity for diagnosing CC. This exploratory study aimed to develop a methylation-detection panel containing three genes (FAM19A4, EPB41L3 and PAX1) and investigate the predictive value of polygenic methylation assay in CC screening, so as to provide more references for early diagnosis and treatment. The gene methylation assay, as previously described [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e], firstly used bisulfite to treat CpG dinucleotides on genomic DNA, and bisulfite treatment would produce different transformation effects on CpG dinucleotides in different methylation states: if the cytosine (C) in CpG dinucleotide was methylated, it would remain unchanged after treatment; If the cytosine (C) in the CpG dinucleotide was not methylated, it would be converted to uracil (U) after treatment. Subsequently, the methylation status was qualitatively analyzed using the fluorescent probes that specifically identified untransformed CpG dinucleotides.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eStudy participants and samples\u003c/h2\u003e \u003cp\u003e The cervical exfoliated cell samples from participants used in the experiment were all from Obstetrics and Gynecology Hospital Affiliated to Fudan University, Shanghai, China from March 2023 to May 2023, with a total of 492 consecutive cases. According to the WHO 2020 pathological classification criteria for CC and corresponding cervical histopathological test reports, the clinical samples used in the trial were divided into control group (151 cases), low-grade squamous intraepithelial lesion (LSIL) group (107 cases), high-grade squamous intraepithelial lesion (HSIL) group (121 cases), and CC group (113 cases). The histopathological report was verified by two professional pathologists with associate senior titles and above. Specimens are collected by a stationary physician and baseline clinical characteristics were obtained from all participants at the time of admission. This study complied with the Declaration of Helsinki and was approved by the Institutional Ethics Committee of Obstetrics and Gynecology Hospital Affiliated to Fudan University. All participants provided written informed consent.\u003c/p\u003e \u003cp\u003eInclusion criteria for all subjects were as follows: a) Patients with HPV infection who were not pregnant and had not received vaginal medication or vaginal irrigation within 7 days prior to visit; b) Patients with cervical inflammation or intraepithelial neoplasia or CC; c) Patients and their families agreed to participate in the study and signed an informed consent. Exclusion criteria for all subjects were as follows: a) Patients with a history of pelvic chemoradiotherapy; b) Patients with a history of cervical and uterine surgery; c) Patients treated with antibiotics in the last 1 week; d) Patients who were menstruating at the time of enrollment; e) Patients with HPV infection and vaginal lesions but no cervical inflammation.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eDNA extraction and bisulfite transformation\u003c/h2\u003e \u003cp\u003eSamples were collected using a disposable cervical sampling swab and stored in cell preservation solution (PreservCyt Solution, Hologic, National Machinery: 20140197) at -80℃. Genomic DNA extraction was performed from cervical exfoliated cells using UE Genomic DNA Miniprep Kit (Suzhou Youyi Landi Biotechnology, catalog number: UE-MN-MS-GDNA-250 ). 40\u0026thinsp;~\u0026thinsp;1000 ng of genomic DNA was taken and transformed into bisulfite-converted DNA (bisDNA) according to the instructions of the recommended bisulfite conversion kit EZ DNA Methylation-Gold (ZYMO RESEARCH, catalog number: D5006), and finally bisDNA was eluted with 20 \u0026micro;l of ultrapure water and stored at \u0026minus;\u0026thinsp;20℃ until analysis. In general, cytosine (C), which was not methylated on DNA, became uracil (U) due to deamination, while methylated cytosine (C) was not converted by bisulfite and remained unchanged.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eMethylation-specific PCR (MSP) analysis\u003c/h2\u003e \u003cp\u003eThe bisDNA from the previous step was used as a template for methylation-specific PCR (MSP) amplification using Hongshi PCR Analysis System (SLAN-96S), and the specific primers could only amplify the methylated genes, so as to detect the methylation status of the three genes FAM19A4, EPB41L3 and PAX1. ACTB was set as the internal reference gene to monitor the extraction effect of each sample and the amplification of the PCR reaction, in order to effectively avoid false negatives. When the Ct value of the ACTB gene was \u0026le;\u0026thinsp;32.0, the sample test result was valid. The Ct value was defined as 45.0 when the gene was not amplified. Calculated the ΔCt value for each target gene, where the target gene ΔCt\u0026thinsp;=\u0026thinsp;Ct (FAM19A4/EPB41L3/PAX1)-Ct (ACTB). MSP program setting were as follows: 94℃ for 30 seconds in stage 1, 94℃ for 5 seconds and 60℃ for 30 seconds in stage 2 (stage 2 for 45 cycles). A blank control and a positive control were included in each assay.\u003c/p\u003e \u003cp\u003eThe primers and probes were both synthesized by Shanghai Sangon Bioengineering and these specific sequences were summarized in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. All primers were lyophilized powder and dissolved in TE buffer at PH8.0. PAGE electrophoresis did not contain miscellaneous bands. Determined with a visible-ultraviolet spectrophotometer, the OD260nm/OD280nm was between 1.6-2.0. All probes were lyophilized powder and stored in brown tubes,with a purity of HPLC grade. The probes were also dissolved with TE buffer at PH8.0. Visible-ultraviolet spectrophotometer determined that OD260nm/OD280nm was between 1.6-2.0. The probes had a specific absorption peak at the fluorescein excitation wavelength of 494nm (FAM fluorophore) or 576nm (ROX fluorophore). We selected PerfectStart\u0026trade; II Probe qPCR SuperMix (TransGen Biotech, catalog number: AQ711) with the best amplification efficiency and reaction stability as the raw material for the MSP reaction.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSpecific sequences of probes and primers (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFAM19A4\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eEPB41L3\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePAX1\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eACTB\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eForward primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGGTCGGTTTTTTTTTCGTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTTTTTGTTGTAGGAGATATCGAGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGTAGTGACGGGAATTAATGAGTTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eTGGTGATGGAGGAGGTTTAGTAAGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eReverse primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAACCCTAAATCCGTCTTCCTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCCTACGCCAAAACGAAAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCAAACCCAAAATAAACTTCATCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eAACCAATAAAACCTACTCCTCCCTTAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eprobe\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTAGGCGTTTTTTTCGAGCGTTTCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGGGGGTTTACGTTTAGAGAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eATTGTCGAGATTGACGTGGAGGATACG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eACCACCACCCAACACACAATAACA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eStatistic analysis\u003c/h2\u003e \u003cp\u003eAll acquired data were analyzed and visualized using SPSS 17.0 and GraphPad Prism 8 software. For continuous variables, normal distribution data presented as means\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation were compared using t-test between two groups or one-way analysis of variance (ANOVA) among multiple groups. Skewed distribution data expressed as median value (interquartile interval) were analyzed using the Mann-Whitney U test between two groups or Kruskal-Wallis H test among multiple groups. Categorical variables were expressed as percentage and evaluated using Fisher's exact test. Receiver-operating characteristic (ROC) curves were established and logistic regression analysis was performed to assess the clinical predictive value of polygenic methylation assay for HSIL and CC. A two-tailed p value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered to be statistically significant.\u003c/p\u003e \u003cp\u003eThe ΔCt data of each target gene were analyzed separately using SPSS 17.0, and the software automatically generated a ROC curve. According to the coordinate point data from SPSS 17.0, excel was used to calculate \"sensitivity\u0026thinsp;+\u0026thinsp;specificity\", and the point with the largest value was the optimal cut-off value. The website for drawning the heatmap was \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.bioinformatics.com.cn/\u003c/span\u003e\u003cspan address=\"https://www.bioinformatics.com.cn/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eCharacteristics of study participants\u003c/h2\u003e \u003cp\u003eAccording to the inclusion criteria, a total of 505 subjects were selected, and according to the exclusion criteria, 492 subjects were finally recruited. They were divided into four groups according to the results of pathological tests from the hospital: control group (151 cases), LSIL group (107 cases), HSIL group (121 cases) and CC group (113 cases) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The age distribution of the four groups was normal and there were no significant differences in these groups (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05, Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The age range for the control group was 20\u0026ndash;62 years old (38.00\u0026thinsp;\u0026plusmn;\u0026thinsp;15.36). For the LSIL group, the age range was 31\u0026ndash;64 years old (40.25\u0026thinsp;\u0026plusmn;\u0026thinsp;12.28). The HSIL group ranged in age from 26 to 74 years old (41.88\u0026thinsp;\u0026plusmn;\u0026thinsp;11.64), while the CC group ranged in age from 28 to 78 years old (40.50\u0026thinsp;\u0026plusmn;\u0026thinsp;12.47). It could be concluded that the incidence of cervical intraepithelial neoplasia and CC is tending towards a younger age group, with the majority of each group being under 35 years old. Obviously, both the HSIL and CC groups had a higher proportion of hrHPV16/18 infection compared to the control and LSIL groups (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eBaseline characteristics of the participants (n\u0026thinsp;=\u0026thinsp;492)\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGroup\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCases\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAge\u003c/p\u003e \u003cp\u003e\u0026gt;35 vs. \u0026le;35\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003ehrHPV 16/18\u003c/p\u003e \u003cp\u003einfection\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eOther types of HPV infection\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eControl group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e151\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e56 (37%)\u003c/p\u003e \u003cp\u003evs.\u003c/p\u003e \u003cp\u003e95 (63%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e71 (47%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e80 (53%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLSIL group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e107\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e45 (42%)\u003c/p\u003e \u003cp\u003evs.\u003c/p\u003e \u003cp\u003e62 (58%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e56 (52%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e51 (48%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHSIL group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e121\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e40 (33%)\u003c/p\u003e \u003cp\u003evs.\u003c/p\u003e \u003cp\u003e81 (67%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e76 (63%) \u003cb\u003e*\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e45 (37%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCC group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e113\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e53 (47%)\u003c/p\u003e \u003cp\u003evs.\u003c/p\u003e \u003cp\u003e60 (58%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e93 (82%)\u003cb\u003e*\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e20 (18%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003eData are expressed as case (percentage), \u003cb\u003e*\u003c/b\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0.05 vs. Control\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eRelationship between gene methylation and cervical lesions\u003c/h2\u003e \u003cp\u003eThe methylation degree of FAM19A4 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA), EPB41L3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB) or PAX1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC) was further compared in the four groups. According to the principle of MSP, a smaller ΔCt value usually indicated a higher methylation level of the target gene. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, the methylation levels of all three genes were significantly higher in the HSIL and CC groups than in the control and LSIL groups (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and the CC group had higher gene methylation degree compared to the HSIL group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). However, it showed no significant difference between control group and LSIL group (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05). The clustering heatmap in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e illustrated the same findings. It could be seen that the higher the methylation level of the target gene, the greater the risk of cervical malignancy, especially HSIL and CC, indicating a positive correlation between the degree of gene methylation and the severity of cervical lesions.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eDiagnostic potential of target gene methylation for HSIL and CC\u003c/h2\u003e \u003cp\u003eROC analysis was conducted to evaluate the predictive value of gene methylation levels including FAM19A4, EPB41L3 and PAX1 to diagnose HSIL and CC patients. To differentiate the HSIL\u0026thinsp;+\u0026thinsp;CC cases from the control\u0026thinsp;+\u0026thinsp;LSIL cases (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB), cut-off value of ΔCt was 10.445 (sensitivity, 84.6%; specificity, 96.1%) for FAM19A4, 9.08 (sensitivity, 86.3%; specificity, 95.3%) for EPB41L3, and 10.015 (sensitivity, 88.0%; specificity, 97.7%) for PAX1. To differentiate the CC cases from the HSIL cases (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC), cut-off value of ΔCt was 5.375 (sensitivity, 68.1%; specificity, 66.9%) for FAM19A4, 2.665 (sensitivity, 54.9%; specificity, 81.8%) for EPB41L3, and 4.955 (sensitivity, 81.4%; specificity, 58.7%) for PAX1. Consistent with the previous result that there was no significant difference in gene methylation degree between control group and LSIL group, it was also of low value in the diagnosis of LSIL (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, p\u0026thinsp;\u0026gt;\u0026thinsp;0.05). Meanwhile, it could be seen that the methylation levels of the three genes had higher diagnostic value for HSIL\u0026thinsp;+\u0026thinsp;CC (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB), but their specificity and sensitivity in differentiating HSIL from CC were relatively low (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). All area under the curve (AUC) and p values were shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWe further performed logistic regression analysis to determine the scoring weights of the three target genes in the model, and established a combined scoring formula based on the ΔCt values of the three target genes. Then, the optimal scoring threshold were determined based on the principle of the largest Youden index. After analysis, the scoring formula for value at risk (VAR) of the logistic regression model differentiating the HSIL\u0026thinsp;+\u0026thinsp;CC cases from the control\u0026thinsp;+\u0026thinsp;LSIL cases was: VAR\u0026thinsp;=\u0026thinsp;6.498\u0026thinsp;\u0026minus;\u0026thinsp;0.107*ΔCt (FAM19A4)-0.167*ΔCt (EPB41L3)-0.305*ΔCt (PAX1). As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA, VAR cut-off value was 0.599 with 88% sensitivity and 97.7% specificity (AUC, 0.957; 95%CI, 0.937\u0026ndash;0.977; p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). However, the scoring formula differentiating the CC cases from the HSIL cases was: VAR\u0026thinsp;=\u0026thinsp;1.475\u0026thinsp;\u0026minus;\u0026thinsp;0.105*ΔCt (EPB41L3) -0.157*ΔCt (PAX1). As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB, VAR cut-off value was 0.257 with 78.8% sensitivity and 62% specificity (AUC, 0.752; 95%CI, 0.691\u0026ndash;0.814; p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). Apparently, compared with the single target gene prediction model, the combined tri-gene methylation assay had higher sensitivity, specificity and AUC for predicting HSIL\u0026thinsp;+\u0026thinsp;CC cases (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). It was worth noting that in the logistic regression model that differentiated HSIL from CC, the sensitivity, specificity, and AUC were relatively low, and the role of gene FAM19A4 even did not reach a statistically significant level (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eFor the first time, we described methylation alterations in genes FAM19A4, EPB41L3 and PAX1 in HPV-positive patients with cervical lesions and explored their relationship with disease progression. The major new findings of this study were: (i) methylation levels of these three genes were markedly elevated in HSIL and CC patients and could be considered as new biomarkers accurately distinguishing between HSIL\u0026thinsp;+\u0026thinsp;CC cases and control\u0026thinsp;+\u0026thinsp;LSIL cases; (ii) The methylation degree of all three genes had high sensitivity and specificity for the diagnosis and prediction of HSIL\u0026thinsp;+\u0026thinsp;CC, especially the diagnostic performance of the tri-gene methylation assay was more prominent; (iii) methylation levels of the three genes were positively correlated with the severity of cervical lesions, and they had significant differences in group HSIL and CC. Although slightly inferior, methylation assay of the three genes still had considerable sensitivity and specificity for distinguishing between HSIL and CC, which could act as novel indicators to monitor disease progression; (iv) Although all of the included subjects were HPV-positive, patients in groups HSIL and CC seemed to have a higher proportion of hrHPV16/18 infection.\u003c/p\u003e \u003cp\u003eCC is one of the most common malignant tumors in wome with extremely high morbidity and mortality rate [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Although the incidence rate of CC in China has been dramatically increasing in recent years, the screening rate in China is markedly lower than those in developed countries [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. HPV has emerged as a primary cause of CC worldwide. To date, 228 genotypes of HPV have been identified. Persistent infection of hrHPV (mainly with HPV16 and HPV18) usually results in the development of malignancy of cervix [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eScientific screening, rational triage of risk groups and active interventions are critical to effectively prevent disease progression, improve prognosis and reduce fatality. Cervical liquid-based cytology examination is mainly used to stain the exfoliated cells from the cervix to observe morphological changes and then determine whether the cells are cancerous. The specificity of cytology examination is high, but the sensitivity is low, which is easy to lead to missed diagnosis and treatment. The judgment of cytology results needs to be interpreted by professional pathologists under the microscope, and as a result, results are susceptible to subjective decisions [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. HPV testing is an etiological examination to detect whether the cervix is infected with HPV virus through nucleic acid testing for pathogens [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. The sensitivity of HPV testing is high, but the specificity is poor. The false-positive rate is relatively high, and it is impossible to distinguish between transient infection and pathogenic infection. Transient HPV infection will not develop into cervical precancerous lesions or CC, which is easy to increase the rate of colposcopy referral and cervical tissue biopsy, causing unnecessary suffering to women [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAberrant genomic DNA methylation of cervical exfoliated cells is a common epigenetic alteration in the process of CC. HPV can induce hypermethylation of the promoter of certain tumor suppressor genes in the host, thereby causing gene silencing and participating in the occurrence of CC [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. The quantitative detection of DNA methylation of related genes can act as a new means for CC screening, which has important clinical value for monitoring high-risk populations [\u003cspan additionalcitationids=\"CR19 CR20 CR21 CR22\" citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eFAM19A4 gene is a member of the TAFA family, which is low in most normal tissues and slightly higher in brain tissues, and is generally considered to be involved in immune response as immunomodulators, with the function of preventing pathogen invasion [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. It was found that the promoter of FAM19A4 gene had a high degree of abnormal methylation in cervical precancerous lesions and CC, and the methylation detection of FAM19A4 gene promoter had a higher specificity than cytology examination and HPV testing in CC screening [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Luttmer et al. [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e] found that the sensitivity of FAM19A4 methylation assay, cytology examination and HPV16/18-genotyping testing for the detection of cervical lesion (grade\u0026thinsp;\u0026ge;\u0026thinsp;CIN 3) was 75.6%, 85.6% and 72.2%, respectively, and the specificity was 71.1%, 49.8% and 57.4%, respectively. According to another study, patients with a positive FAM19A4 methylation test could be directly referred for colposcopy, while a negative test could predict a transient HPV infection and a low risk of CC [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. In our study, methylation levels of FAM19A4 gene promoter had a higher sensitivity and specificity for the diagnosis of HSIL\u0026thinsp;+\u0026thinsp;CC, at 84.6% and 96.1%, respectively. The sensitivity and specificity of further differentiating HSIL from CC were 68.1% and 66.9%, respectively.\u003c/p\u003e \u003cp\u003eEPB41L3 (erythrocyte membrane protein band 4.1 like 3), also known as 4.1B or DAI-1, is an important membrane skeleton protein belonging to the protein 4.1 family. As a candidate tumor suppressor gene, EPB41L3 inhibits cell overgrowth by inducing cell apoptosis and arresting the cell cycle [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. It was found that the expression of EPB41L3 in various malignant tumors such as CC was significantly down-regulated compared with that in normal tissues, and the aberrant methylation of its promoter played an important role in the regulation of the expression of EPB41L3 genes [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Boers et al. [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e] showed that the sensitivity and specificity of EPB41L3 promoter methylation for the screening of CIN3 cervical precancerous lesions reached 79% and 88%, respectively, with good shunt guidance significance for HPV-positive patients. In our study, methylation levels of EPB41L3 gene promoter had a higher sensitivity and specificity for the prediction of HSIL\u0026thinsp;+\u0026thinsp;CC, at 86.3% and 95.3%, respectively. The sensitivity and specificity of further differentiating HSIL from CC were 54.9% and 81.8%, respectively.\u003c/p\u003e \u003cp\u003ePAX1 has been revealed to be a key tumor suppressor gene that regulates cell differentiation and maturation. In cervical cells, once the PAX1 gene promoter is methylated, it will cause the gene to be silenced or inactivated, thus losing the function of inhibiting tumor growth and resulting in CC, which has been widely recognized and studied internationally [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. In 2010, Lai's research team [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e] found that PAX1 methylation assay has a sensitivity of 78% and a specificity of 91% for CIN3\u0026thinsp;+\u0026thinsp;cervical precancer. In 2014, Kan's study [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e] confirmed that methylation detection of PAX1 has an 86% sensitivity and 85% specificity for CIN3\u0026thinsp;+\u0026thinsp;cervical precancer. In another study, Yang L et al. [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e] found that in non-HPV16/18 hrHPV-positive populations, PAX1 methylation detection had a sensitivity and specificity of 86.2% and 75.5%, respectively, for CIN2 cervical precancerous lesions, while CIN3 cervical precancerous lesions had a sensitivity and specificity of 90% and 69.3%, respectively, which were significantly better than cytology detection. According to the latest research, hypermethylation of PAX1 was positively associated with high HPV viral load, especially HPV16/18, and PAX1 methylation had a specificity of 86.6% for detecting CIN2+ [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. From our experimental data, the methylation detection of gene PAX1 also had high sensitivity and specificity for the diagnosis of HSIL\u0026thinsp;+\u0026thinsp;CC, which is 88.0% and 97.7%, respectively. The sensitivity and specificity of further differentiating HSIL from CC were 81.4% and 58.7%, respectively.\u003c/p\u003e \u003cp\u003eMeanwhile, there were also some limitations in this study. First, due to the fact that there was no difference in methylation degree of the three genes in the control cases and the LSIL cases, other screening indicators need to be further explored and confirmed for cervical lesions below HSIL. Second, on the basis that both HSIL and CC cases had high methylation levels of FAM19A4, EPB41L3 and PAX1 and high rates of hrHPV16/18 infection, further studies are needed to investigate the relationship between methylation alterations and hrHPV16/18 viral load. Last but not least, further basic researches are needed to explore the mechanism of these tumor suppressor genes with abnormal methylation status in the pathogenesis of CC, so as to provide more effective and precise therapies and interventions.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn all, this exploratory study aimd to explore the possible role of methylation detection in CC screening. We firstly provided evidence that the methylation levels of FAM19A4, EPB41L3 and PAX1 increased as cervical lesions worsened, thus promising to be new biomarkers for monitoring disease progression. In particular, if possible, the combinationed performance of tri-gene methylation assay and logistic regression model will have the greatest predictive value. Our experimental results revealed that methylation detection of these three genes has extremely high sensitivity and specificity for HSIL and above, including CC. however, if further differentiation between HSIL and CC is required, additional ancillary evidence may be necessary to ensure that the diagnosis is not flawed.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003e\u003cspan\u003eLSIL: low-grade squamous intraepithelial lesion\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n\u003cp\u003e\u003cspan\u003eHSIL: high-grade squamous intraepithelial lesion\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n\u003cp\u003e\u003cspan\u003eCC: cervical cancer\u003c/span\u003e\u003c/p\u003e\n\u003cp\u003e\u003cspan\u003ehrHPV: high-risk human papillomavirus\u003c/span\u003e\u003c/p\u003e\n\u003cp\u003e\u003cspan\u003eHPV: human papillomavirus\u003c/span\u003e\u003c/p\u003e\n\u003cp\u003e\u003cspan\u003eROC: the receiver-operating characteristic curve\u003c/span\u003e\u003c/p\u003e\n\u003cp\u003e\u003cspan\u003eAUC: area under the curve\u003c/span\u003e\u003c/p\u003e\n\u003cp\u003e\u003cspan\u003eCI: confidence interval\u003c/span\u003e\u003c/p\u003e\n\u003cp\u003e\u003cspan\u003eMSP: methylation-specific PCR\u003c/span\u003e\u003c/p\u003e\n\u003cp\u003e\u003cspan\u003eANOVA: one-way analysis of variance\u003c/span\u003e\u003c/p\u003e\n\u003cp\u003e\u003cspan\u003eVAR: value at risk\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n\u003cp\u003e\u003cspan\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eSupplementary Information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe would like to thank all the participants and their families who agreed on taking part into the study. We also thank all the researchers and clinical staff that helped collecting the data used in this research. In particular, we acknowledge Dr. Wu Kang for giving professional advice on this article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eYK, WFL and TZ made substantial contributions in conception and design; XBC, RRC, YJC, FQF, YFY, GQJ, TTL, HW, JWD, MZ, YHH, QZT and ZQS made contributions to acquisition of clinical data and samples; WWS and TZ performed experiments and data analysis; YQJ and TZ wrote the original draft of the manuscript under the supervision of YK and WFL; XBC took part in reviewing the article or revising it critically for important intellectual content. All authors read and approved the final manuscript, and agreed to submit to the current journal and to be accountable for all aspects of the work.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData are available from the corresponding author on request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll study protocols comply with the Declaration of Helsinki. All participants provided written and informed consent before being included in the research. The protocol for the study has been approved by the Institutional Ethics Committee of Obstetrics and Gynecology Hospital Affiliated to Fudan University.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor details\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e1\u003c/sup\u003eClinical Research Center, Obstetrics \u0026amp; Gynecology Hospital of Fudan University, Shanghai 200090, P.R. China.\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e2\u003c/sup\u003eShanghai Ruisai Biotechnology Co., Ltd., No. 3399 Kangxin Highway, Pudong New Area, Shanghai, China.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eSingh D, Vignat J, Lorenzoni V, et al. Global estimates of incidence and mortality of cervical cancer in 2020: a baseline analysis of the WHO Global Cervical Cancer Elimination Initiative.Lancet Glob Health. 2023;11:E197-E206.\u003c/li\u003e\n\u003cli\u003eSankaranarayanan R, Prabhu PR, Pawlita M. Immunogenicity and HPV infection after one, two, and three doses of quadrivalent HPV vaccine in girls in India: a multicentre prospective cohort study. Lancet Oncol. 2016;17(1):67-77.\u003c/li\u003e\n\u003cli\u003eMacLaughlin KL, Jacobson RM, Radecki Breitkopf C, et al. Trends over time in pap and Pap-HPV cotesting for cervical cancer screening. J Womens Health. 2019;28(2):244-249. \u003c/li\u003e\n\u003cli\u003eNkwabong E, Laure Bessi Badjan I, Sando Z, et al. Pap smear accuracy for the diagnosis of cervical precancerous lesions. Trop Doct. 2019;49(1):34-39.\u003c/li\u003e\n\u003cli\u003eLechner M, Boshoff C, Beck S, et al. cancer epigenome. Adv Genet. 2010;70:247-276. \u003c/li\u003e\n\u003cli\u003eKristensen LS, Hansen LL. PCR-based methods for detecting single-locus DNA methylation biomarkers in cancer diagnostics, prognostics, and response to treatment. Clin Chem. 2009;55(8):1471-1483. \u003c/li\u003e\n\u003cli\u003eWentzensen N, Sherman ME, Schiffman M, et al. Utility of methylation markers in cervical cancer early detection: appraisal of the state-of-thescience. Gynecol Oncol. 2009;112(2):293-299. \u003c/li\u003e\n\u003cli\u003eYu-Ligh, Liou., Tao-Lan, et al. Combined clinical and genetic testing algorithm for cervical cancer diagnosis. Clin Epigenetics. 2016; 8(0), 0. \u003c/li\u003e\n\u003cli\u003eQiaowen, Bu., Sanfeng, et al. The clinical significance of FAM19A4 methylation in high-risk HPV-positive cervical samples for the detection of cervical (pre)cancer in Chinese women. BMC Cancer. 2018;18(1), 0. \u003c/li\u003e\n\u003cli\u003eYing, Sha., Yunyun, et al. Exploring the Diagnostic Potential of EPB41L3 Methylation in Cervical Cancer and Precancerous Lesions: A Systematic Review and Meta-Analysis. Gynecol Obstet Invest. 2023;89(1), 0. \u003c/li\u003e\n\u003cli\u003eXiang, Li., Lu, et al. BRIF-Seq: Bisulfite-Converted Randomly Integrated Fragments Sequencing at the Single-Cell Level. Mol Plant. 2019;12(3), 0. \u003c/li\u003e\n\u003cli\u003eThe bioinformatics cluster heatmap. https://www.bioinformatics.com.cn/. Accessed 21 May 2024.\u003c/li\u003e\n\u003cli\u003eBray F, Ferlay J, Soerjomataram I, et al. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA: Cancer J Clin. 2018;68(6):394-424. \u003c/li\u003e\n\u003cli\u003eBao H, Zhang L, Wang L, et al. Significant variations in the cervical cancer screening rate in China by individual-level and geographical measures of socioeconomic status: a multilevel model analysis of a nationally representative survey dataset. Cancer Med;2018,7(5):2089-2100. \u003c/li\u003e\n\u003cli\u003eJee B, Yadav R, Pankaj S, et al. Immunology of HPV-mediated cervical cancer: current understanding. Int Rev Immunol. 2021;40:359-378. \u003c/li\u003e\n\u003cli\u003eKoliopoulos G, Nyaga VN, Santesso N, et al. Cytology versus HPV testing for cervical cancer screening in the general population. Cochrane Database Syst Rev. 2017;8(8):CD008587.\u003c/li\u003e\n\u003cli\u003eBowden SJ, Lathouras K, Kyrgiou M, et al. Can DNA methylation tests improve the accuracy of cervical screening?. BJOG. 2021;128(3):515.\u003c/li\u003e\n\u003cli\u003ede Waard J, Bhattacharya A, de Boer MT, et al. Identification of a methylation panel as an alternative triage to detect CIN3+ in hrHPV-positive self-samples from the population-based cervical cancer screening programme. Clin Epigenetics. 2023;15(1):103.\u003c/li\u003e\n\u003cli\u003eReuter C, Preece M, Banwait R, et al. Consistency of the S5 DNA methylation classifier in formalin-fixed biopsies versus corresponding exfoliated cells for the detection of pre-cancerous cervical lesions. Cancer Med. 2021;10(8):2668-2679.\u003c/li\u003e\n\u003cli\u003eZhang J, Yang C, Wu C, et al. DNA methyltransferases in cancer: biology, paradox, aberrations, and targeted therapy. Cancers (Basel). 2020;12(8):2123.\u003c/li\u003e\n\u003cli\u003eFeng C, Dong J, Chang W, et al. The progress of methylation regulation in gene expression of cervical cancer. Int J Genomics. 2018;2018:8260652. \u003c/li\u003e\n\u003cli\u003eHernandez-Lopez R, Lorincz AT, Torres-Ibarra L, et al. Methylation estimates the risk of precancer in HPV-infected women with discrepant results between cytology and HPV16/18 genotyping. Clin Epigenetics. 2019;11(1):140.\u003c/li\u003e\n\u003cli\u003eKelly H, Benavente Y, Pavon MA, et al. Performance of DNA methylation assays for detection of high-grade cervical intraepithelial neoplasia (CIN2+): a systematic review and Meta-analysis. Br J Cancer. 2019;121(11):954-965. \u003c/li\u003e\n\u003cli\u003eTom TY, Emtage P, Funk WD, et al. TAFA: a novel secreted family with conserved cysteine residues and restricted expression in the brain. Genomics. 2004;83(4):727-734. \u003c/li\u003e\n\u003cli\u003eWang W, Li T, Wang X, et al. FAM19A4 is a novel cytokine ligand of formyl peptide receptor 1 (FPR1) and is able to promote the migration and phagocytosis of macrophages. Cell Mol Immunol. 2015;12(5):615-624.\u003c/li\u003e\n\u003cli\u003eDe Strooper LMA, Meijer CJ, Berkhof J, et al. Methylation analysis of the FAM19A4 gene in cervical scrapes is highly efficient in detecting cervical carcinomas and advanced CIN2/3 lesions. Cancer Prev Res (Phila). 2014;7(12):1251-1257. \u003c/li\u003e\n\u003cli\u003eLuttmer R, De Strooper LM, Berkhof J, et al. Comparing the performance of FAM19A4 methylation analysis, cytology and HPV16/18 genotyping for the detection of cervical (pre)cancer in high-risk HPV-positive women of a gynecologic outpatient population (COMETH study). Int J Cancer. 2016;138(4):992-1002. \u003c/li\u003e\n\u003cli\u003eBu Q, Wang S, Ma J, et al. The clinical significance of FAM19A4 methylation in high-risk HPV-positive cervical samples for the detection of cervical (pre)cancer in Chinese women. BMC Cancer. 2018;18(1):1182. \u003c/li\u003e\n\u003cli\u003eXiaofeng, Yuan., Lianhua, et al. Pivotal roles of protein 4.1B/DAL-1, a FERM‑domain containing protein, in tumor progression (Review). Int J Oncol. 2019;55(5),0.\u003c/li\u003e\n\u003cli\u003eKelly HA, Chikandiwa A, Warman R, et al. Associations of human gene EPB41L3 DNA methylation and cervical intraepithelial neoplasia in women living with HIV-1 in Africa. AIDS. 2018;32(15):2227-2236. \u003c/li\u003e\n\u003cli\u003eBoersA, Bosgraaf RP, van Leeuwen RW, et al. DNA methylation analysis in self-sampled brush material as a triage test in hrHPV-positive women. Br J Cancer. 2014;111(6):1095-101.\u003c/li\u003e\n\u003cli\u003eLi X, Liu H, Zhou X, et al. PAX1 hypomethylation as a prognostic biomarker for radioresistance of cervical cancer. Clin Epigenetics. 2023;15(1):123.\u003c/li\u003e\n\u003cli\u003eLai H.C., Lin Y.W., Huang R.L., et al. Quantitative DNA methylation analysis detects cervical intraepithelial neoplasms type 3 and worse. Cancer. 2010;116,4266-4274. \u003c/li\u003e\n\u003cli\u003eKan Y.Y., Liou Y.L., Wang H.J., et al. PAX1 methylation as a potential biomarker for cervical cancer screening. Int. J. Gynecol Cancer. 2014;24,928-934.\u003c/li\u003e\n\u003cli\u003eYang L, Tao H, Lin B, et al. Utilization of PAX1 methylation test for cervical cancer screening of non-HPV16/18 high-risk HPV infection in women. Future Oncol. 2023;19: 1917-1927.\u003c/li\u003e\n\u003cli\u003eLi M, Zhao C, Zhao Y, et al. Association and Effectiveness of PAX1 Methylation and HPV Viral Load for the Detection of Cervical High-Grade Squamous Intraepithelial Lesion. Pathogens. 2022;12(1):63.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"DNA methylation detection, early screening, cervical squamous intraepithelial lesion, cervical cancer","lastPublishedDoi":"10.21203/rs.3.rs-4664647/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4664647/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eObjective\u003c/h2\u003e \u003cp\u003eCervical cancer (CC) was considered to be the most common gynaecological cancer, with an estimated 342,000 deaths worldwide each year, as the majority of patients were diagnosed at an advanced stage of the disease. The purpose of this study was to evaluate the predictive value of multi-locus methylation assay for the early detection of CC.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eThe cervical exfoliated cell samples from 492 HPV-positive females with cervical lesions were collected and subjected to methylation detection of gene FAM19A4, EPB41L3 and PAX1 after bisulfite conversion. The levels of gene methylation in patients with different severity of cervical lesions were evaluated and compared. The receiver-operating characteristic (ROC) curve was established and efficacy indexes such as sensitivity, specificity and area under the curve (AUC) were calculated to assess the diagnostic value of DNA methylation detection at multiple gene loci for CC.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eThe methylation levels of FAM19A4, EPB41L3 and PAX1 were significantly increased with the grade of cervical squamous intraepithelial lesions. The sensitivities of FAM19A4, EPB41L3 and PAX1 alone for high-grade squamous intraepithelial lesion (HSIL) and CC diagnosis were 84.6%, 86.3% and 88.0%, respectively; when three markers were combined by a logistic regression model, the sensitivity was 88.0%, with a high specificity of 97.7% and AUC of 0.957 (95% CI: 0.937\u0026ndash;0.977).\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eMethylation status of FAM19A4, EPB41L3 and PAX1 were highly specific and effective for monitoring the progression of cervical lesions and the tri-gene methylation assay provided an alternatively non-invasive choice for CC early screening.\u003c/p\u003e","manuscriptTitle":"A novel methylation-detection panel for HPV associated high-grade squamous intraepithelial lesion and cervical cancer screening","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-08-09 15:38:58","doi":"10.21203/rs.3.rs-4664647/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-07-30T08:40:51+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-07-30T05:03:09+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-07-26T15:06:21+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-07-25T13:07:30+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"154894166362159643469952178785828849003","date":"2024-07-17T03:23:18+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"140965441114875179368724619954663020721","date":"2024-07-15T11:49:09+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"32990198069543615141463574406302355255","date":"2024-07-15T08:28:46+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-07-05T11:35:21+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-07-05T10:02:15+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2024-07-05T07:40:18+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-07-05T07:36:39+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2024-07-01T01:29:34+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"8cfa24a6-64a6-4c68-9ab7-c54ec7ad8801","owner":[],"postedDate":"August 9th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-10-28T16:02:54+00:00","versionOfRecord":{"articleIdentity":"rs-4664647","link":"https://doi.org/10.1038/s41598-024-75047-3","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2024-10-26 15:57:05","publishedOnDateReadable":"October 26th, 2024"},"versionCreatedAt":"2024-08-09 15:38:58","video":"","vorDoi":"10.1038/s41598-024-75047-3","vorDoiUrl":"https://doi.org/10.1038/s41598-024-75047-3","workflowStages":[]},"version":"v1","identity":"rs-4664647","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4664647","identity":"rs-4664647","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-23T02:00:01.238055+00:00
License: CC-BY-4.0