Identification of genes associated with pan-vibrios resistance (PVR) trait of shrimp Litopenaeus vannamei through Genome-wide association study

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher
Full text 133,359 characters · extracted from preprint-html · click to expand
Identification of genes associated with pan-vibrios resistance (PVR) trait of shrimp Litopenaeus vannamei through Genome-wide association study | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Identification of genes associated with pan-vibrios resistance (PVR) trait of shrimp Litopenaeus vannamei through Genome-wide association study Shuyang Wen, Chuhang Cheng, Jiayue Yin, Ying Lv, Xin Zhang, Bo Ma, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6178636/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Vibriosis caused by various Vibrio species is the most serious bacterial disease of shrimp. Due to the prevalence of pathogenic vibrios, genetic breeding of shrimps with the pan-vibrios resistance (PVR) trait has more practical significance for successful shrimp farming. To explore the genetic loci associated with the PVR trait of Litopenaeus vannamei , a genome-wide association study (GWAS) aiming at the PVR trait of the shrimp was conducted by using 300 shrimp individuals from various sources. After stringent screening, 243 single nucleotide polymorphisms (SNPs) corresponding to a selection threshold of -log10(p) value ≥ 2.5 were evaluated for their association with the PVR trait. Twenty candidate SNPs in genes and upstream region of genes (≤ 5000 bp) were screened out for further validation of the association. The genotypes of three SNPs (SNP15, SNP16, and SNP17) were different between G1 (uninfected) and G4/G5 groups (seriously infected), among which GG genotype of SNP15 was significantly associated with low vibrios load. The genotype combination of GG-TT-AA at the three SNPs was linked, and it was significantly associated with the strongest performance of the trait. Notably, three SNPs were found located in the intron region of a gene, LvCthrc1 . The genotype combination can lead to the disappearance of a donor splicing site of LvCthrc1 , which predictably generates a novel transcript affecting the gene function. The highest expression level of LvCthrc1 was observed in immune-related tissues such as hemocytes, gills, and hepatopancreas. This study first put forward the concept of the PVR trait and provides valuable molecular markers for the genetic selection on the trait of shrimp, L. vannamei . GWAS Litopenaeus vannamei pan-vibrio resistance SNPs LvCthrc1 gene Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Pacific white shrimp, Litopenaeus vannamei ( L. vannamei ), is the most farming shrimp species in the world, which accounts for more than 75% of global shrimp farming production (Garlock et al., 2024 ). However, with the extensive farming of the shrimp, bacterial diseases mainly caused by various pathogenic vibrios frequently break out and lead to huge economic loss (Maralit et al., 2018 ). It has been reported that vibriosis outbreaks in China, Vietnam, Malaysia, Mexico and Bangladesh have dramatically reduced shrimp production by about 60 percent in a short period (Noriega-Orozco et al., 2007 ; Chang et al., 2023 ; Liu et al., 2024 ). The prevention of vibrios infections primarily entails the use of antibiotics (Stalin and Srinivasan, 2016 ; Lu et al., 2021 ), immunity enhancement by immunoregulator (Chen et al., 2012 ; Chang et al., 2013 ) and genetic breeding (Zou and Liu, 2015 ; Kongchum et al., 2022 ; Luo et al., 2024 ). Among them, genetic breeding of shrimps has been considered as the most prominent approach for enhancing the resistance to the vibrio infection as it can fundamentally improve the vibrio-resistance trait of shrimps through genetic changes (Luo et al., 2024 ). In recent years, high-throughput sequencing technologies have propelled the rapid development of genetic breeding of animals including aquatic animals. Molecular marker-assisted selection (MAS) that mainly depends on the molecular marker mining acquired from high-throughput sequencing and sequencing data analysis has been frequently used in some aquatic animals, such as Ctenopharyngodon idellus , Cyprinus carpio , Eriocheir sinensis , and L. vannamei (Xiao et al., 2016 ; Fu and Liu, 2022 ; Zhang et al., 2024 ). Genome-wide association study (GWAS) plays an important role in the genetic mapping of complex traits and in the finding of genetic variations under the whole genome scale (Visscher et al., 2012 ). GWAS has been used to explore important loci for MAS aiming at the genetic selection of multiple traits in animals (Li et al., 2015 ). In the genetic breeding of shrimps, for instance, some SNPs associated with WSSV resistance (Robinson et al., 2014 ), growth traits, and sex determination (Guo et al., 2019 ) have been identified in shrimp, Penaeus monodon , through GWAS. Robinson et al ( 2014 ) first analyzed the correlation between WSSV resistance trait and SNPs in L. vannamei through using GWAS. Liu et al (2022) identified seven genes related to ammonia nitrogen tolerance in L. vannamei by the GWAS method. Whankaew et al ( 2024 ) identified 4 SNPs and 17 InDels in three varieties of L. vannamei , related to the tolerance of Acute Hepatopancreatic Necrosis Disease (AHPND). However, until now there is no further screening and verification of candidate SNPs found in the GWAS of vibrio-resistance trait in shrimps. In addition, nearly all the SNPs associated with vibrio resistance in shrimps were obtained to target the genetic improvement of AHPND tolerance, wherein only specific virulent strains of Vibrio species (such as V. parahaemolyticus ) were adopted (Yao et al., 2018 ; Kongchum et al., 2022 ; Luo et al., 2024 ). Vibrio is a genus of ubiquitous bacteria found in a wide variety of aquatic and marine habitats and at least 100 species have been recorded in this genus (Baker-Austin et al., 2018 ), among which over 15 Vibrio species have been reported as opportunistic pathogens to shrimps (Valente and Wan, 2021). Due to the prevalence of pathogenic vibrios in various marine environments, genetic breeding of shrimps with the pan-vibrios resistance (PVR) trait (resistance to wide range of Vibrio pathogens) has more practical significance for successful shrimp farming. In the present study, a GWAS of the PVR trait in 300 shrimp individuals with different sources was performed, and it generated 20 candidate SNPs potentially associated with the PVR trait. Further, genotypes of these candidate SNPs were differentiated in a validation group and their association with the PVR trait was analyzed. Finally, the genotype combination from a gene, LvChrc1 , was screened out, which were strongly associated with the PVR trait. This study put forward the concept of the PVR trait and provides valuable molecular markers for the genetic selection on this trait of shrimp L. vannamei , thereby facilitating the genetic breeding of shrimps toward the substantial improvement of antibacterial ability. Materials and methods 2.1 Shrimp sample collection Individuals of shrimp L. vannamei were collected from nine farms in Sanya (SY), Qionghai (QH), Fuzhou (FZ), Xiamen (XM), Ningde (ND), Zhanjiang (ZJ), Zhuhai (ZH), Shantou (ST) and Guangzhou (GZ) of China. 50 shrimp individuals (weight of 11 ± 4g) in each collected group (from one farm in one area) were used to analyze their performance of the PVR trait. In addition, 210 shrimps (weight of 10 ± 3g) were randomly collected from three farms in Maoming and were used to analyze their performance of the PVR trait for verifying the effectiveness of candidate SNP markers. 2.2 Evaluation of the PVR trait by vibrios load in hepatopancreas Each of shrimp hepatopancreas tissues (0.01g) were taken off and homogenized in 1ml of sterilized seawater, respectively, and then 100 µl of diluted homogenate of each sample was diluted in 10-fold. 100 µl of each dilution was spread onto a TCBS plate with triple repetition. TCBS plates were incubated at 30 ℃ for 24 h and bacterial colonies were calculated and converted into vibrios load in shrimps. Shrimp individuals were classed into five grades (G1, G2, G3, G4, and G5) according to vibrios load to reflect their PVR trait, among which the severity of vibrios infection progressively escalates from grade 1 to grade 5 (G1 to G5). Groups containing ≥ 10% of uninfected individuals are ruled out and finally, a total of 300 shrimp individuals from six groups with different infection levels were selected to comprise an analysis group. In the same way, 300 individuals mentioned above were also graded according to their vibrios load in the hepatopancreas and shrimps in G1 (no vibrios infection observed) and shrimps in G4 to G5 (relatively serious vibrios infection) were selected out to comprise a validation group. 2.3 DNA extraction and library preparation The genomic DNAs of all shrimp samples were extracted using the Marine Animals Genomic DNA Extraction Kit (TIANGEN, China). The genome of each sample was segmented using the HaeIII + Hpy166II restriction enzymes, and the resulting fragments were further processed to isolate the target fragments ranging in length from 314 to 394 bp. After passing quality control checks, the library was subjected to sequencing using specific length amplified fragment sequencing (SLAF-seq) in Biomarker Technologies Corporation (Beijing, China). 2.4 Genotyping and quality control Filtered reads were mapped to the reference genome of L. vannamei (ASM 378908) using BWA software (Li and Durbin 2010 ). GATK (McKenna et al., 2010 ) and SAMtools (Li et al., 2009) were used to develop the SNP tag intersection as the final reliable SNP tag dataset. Subsequently, SnpEff software (Gaudet et al., 2009 ) was used to analyze the location of mutation sites on the reference genome and the gene location information on the reference genome. The " check marker " function in the GenABEL package was used for quality control of genotyping SNPs (Aulchenko et al., 2007 ). The SNPs with low minor allele frequencies (MAF), low profile rates, and deviations from the Hardy-Weinberg were removed before analysis. In addition, the SNPs that were located in gene and within 5000 bp away from the gene are focused on. 2.5 Variant calling analysis and GWAS Combined with EMMAX software (Kang et al., 2010 ), the mixed linear model is used for correlation analysis, and the application model is as follows: $$\:\text{y}=\text{W}{\alpha\:}+\text{x}{\beta\:}+{\mu\:}+\text{e}$$ GEMMA (Zoubarev et al., 2012 ) was used to calculate the kinship µ among samples. As a random effect, if there is a covariable, the W is a fixed effect, x is the genotype, and y is the phenotype. According to the P -value of the SNP, with -log10 (p) ≥ 2.5 as the significance standard, the corresponding Q-Q quantile map and Manhattan map are drawn by using the R qqman package (Paria et al., 2022 ). 2.6 Function analysis of g enes containing discrepant SNPs and Genotyping of discrepant SNPs in a validation group Genes containing discrepant SNPs revealed by GWAS were screened out according to the locations of the SNPs using the genomic information of L. vannamei (ASM 378908v1) and the functions of the genes were annotated using NCBI-NR database. The tag sequence information of the selected genes was obtained from the genome of L. vannamei (ASM 378908v1). Primer premier 6.0 software (Applied Biosystems, Norcross, GA) was used to design primers for PCR targeting DNA fragments near candidate SNP. Two forward primers were designed for each site, and fluorescent sequence tags of FAM (GAAGGTGACCAAGTTCATGCT) and HEX (GAAGGTCGGAGTCAACGGATT) were respectively added. All primers used in this study were designed by Primer premier 6.0 software and placed in Table S1 . Genotyping was performed through a method of competitive allele specific PCR (KASP) using a commercial STO Rox kit (Gudebio, Guangzhou). 2.7 Correlation analysis between genotypes and the performance of the PVR trait in a validation group The validation population selected 210 shrimp with extreme infection amount as resistance group (G1) and susceptible group (G4, G5) for analysis, including 72 shrimp. The correlation between genotypes and the performance of the PVR trait was manually analyzed. SNPs significantly associated with the PVR trait was further used to explore potential interactions among them by linkage disequilibrium (LD) analysis using Haploview software (Barrett et al., 2005 ). Based on the LD analysis, the correlation between the genotype combination and the performance of the PVR trait were also analyzed, which led to the finding of combined SNP markers. 2.8 Protein structure prediction of a target gene related to the PVR trait and expression levels of the gene Use SWISS - MODEL website ( https://swissmodel.expasy.org/ ) to predict 3D structure of the protein coded by a target gene related to the PVR trait. Total RNAs were extracted using RNA Easy Fast Tissue/Cell Kit (TIANGEN, China) and were reverse-transcribed into cDNAs using a Prime Script™II 1st Strand cDNA Synthesis Kit (Takara, Japan). The expression levels of the gene in the brain, eye stalk, hemocytes, gill, hepatopancreas, heart, muscle, intestine and stomach were detected by qRT-PCR using a RT-PCR kit (TaKaRa, China) and β-actin gene was used as the reference gene (Table S1 ). qRT-PCR was performed using Thermal Cycler Dice®Real Time System III (TaKaRa) under the following conditions: 95 ºC for 30 s, 40 cycles of 95 ºC for 5 s and 56 ºC for 30 s, reading of templates at 95 ºC for 15 s, and final melting curve from 60 to 95 ºC. Three biological replicates and three technical replicates were used for qRT-PCR, and the expression levels of the gene were calculated by 2 −ΔΔCT method (Livak and Schmittgen, 2001 ). 2.9 Prediction of splicing sites in intron regions from the genotype NetGene2 ( https://services.healthtech.dtu.dk/ ) was used for the SNP loci of the sequences of introns splicing sites prediction (confidence ≥ 0.85). Results 3.1 Grading the PVR trait of the shrimp individuals According to vibrios load in hepatopancreas, the PVR trait of the shrimp was quantified to five grades, G1 to G5 (Fig. 1a). Among 300 shrimp individuals, only 25 individuals in G1 (8.3%) exhibited no vibrios infection in hepatopancreas, manifesting their excellent performance of PVR trait, while 32 individuals in G5 (10.7%) exhibited serious infection in hepatopancreas, manifesting their weak performance of PVR trait (Fig. 1b). The typical bacterial colonies of different infection grades on the TCBS plates were showed (Fig. 1c). 3.2 GWAS and gene functional annotation of candidate SNP According to the comparison analysis, 18,184,608 SNP loci were obtained, 78.78% of SNPs located in the intergenic regions (distance from downstream gene > 5KB), while only 5.95% of SNPs located in the upstream regions (distance from downstream gene ≤ 5KB). Moreover, these SNPs were unevenly distributed in the genome, with the largest distribution in scaffolds, NW_020869133.1, NW_020869429.1, and NM_020870026.1 (Fig. 2). The Q-Q result showed the result is statistically significant with an efficient family structure correction, indicating the phenotypic data could fit the selected model well (Fig. 3a). The Manhattan map shows the results of GWAS, with a total of 243 SNPs above the dotted line divider (-log10 (p) ≥ 2.5, Fig. 3b). After focusing SNPs inside genes and promoter regions, a total of 20 SNPs potentially related to the PVR trait were identified. Annotate genes covering these sites are associated with immunity, DNA replication and metabolisms (Table 1). Table 1 The statistics of the associated SNPs to the PVR trait SNP Position Gene Gene function P (-log 10 (p)) SNP1 239608 protogenin-like, partial Encodes immunoglobulins 3.46 SNP2 483631 E3 ubiquitin-protein ligase RFWD3-like Involved DNA metabolic process; 3.15 SNP3 709567 discoidin domain-containing receptor A-like Participate in signaling 3.14 SNP4 390539 trafficking protein particle complex subunit 4-like Involved in autophagy and endoplasmic reticulum to Golgi vesicle-mediated transport. 3.04 SNP5 229720 methylmalonic aciduria and homocystinuria type D protein, mitochondrial-like isoform X1 Coding line stereoprotein, involved in vitamin B12 metabolism 3.03 SNP6 157824 sodium- and chloride-dependent GABA transporter 2-like Encodes transporters 2.87 SNP7 990978 60S acidic ribosomal protein P2 Involved in immune regulation 2.73 SNP8 450675 methyltransferase N6AMT1-like Participates in the methylation of release factor I 2.71 SNP9 44114 hemocyanin C chain-like Has immune, antibacterial function 2.61 SNP10 57624 cGMP-inhibited 3',5'-cyclic phosphodiesterase B Regulators 2.61 SNP11 91727 actin, muscle-like Involved in muscle contraction, cell movement, and cell division 2.59 SNP12 165399 protein timeless homolog involved in cell survival after damage or stress 2.53 SNP13 193075 lysophosphatidylcholine acyltransferase-like, partial Encodes 1-acyl-SN-glycerol-3-phosphoacyltransferase 2.51 SNP14 635323 HEAT repeat containing 1 homolog enables snoRNA binding 3.19 SNP15 635082 2.85 SNP16 635341 2.58 SNP17 635340 2.59 SNP18 53354 tetratricopeptide repeat protein 5-like isoform X2 Involved in immune regulation 2.85 SNP19 50514 2.53 SNP20 1198973 DNA-binding protein D-ETS-3-like isoform X3 Participate in cell multiplication, differentiation, etc 2.57 3.3 Genotyping of SNPs and validation of candidate SNPs and genotypes in a validation group To screen out SNPs and genotypes of the SNPs closely associated with the PVR trait, other batches of shrimps a total of 210 individuals were collected and graded according to the vibrios load in the hepatopancreas. 20 individuals in grade G1 and 52 individuals in grades, G4 and G5, total of 72 shrimp were grouped together to form a validation group. The genotyping of 20 SNPs in the validation group was performed using KASP and the association between the genotypes of SNPs and the performance of the PVR trait was also analyzed manually (Table S3). Only the genotypes of SNP15, SNP16 and SNP17 had preference between the low infection individuals and serious infection individuals (Table 2). Statistical analysis of the correlations between genotypes of three SNPs and vibrios load showed that only genotypes of SNP15 had significant differences in terms of vibrios load, among which genotype GG had the lowest vibrios load ( 0.05, Fig. 4). It indicated that the GG genotype of SNP15 was significantly associated with the PVR trait. Subsequently, LD analysis was performed on the 20 SNP sites. It manifested that there was a strong linkage disequilibrium (LD) among the three SNPs (SNP15, SNP16, SNP17), especially between SNP16 and SNP17 (D '=0.92; r 2 = 0.81, Fig. 5). Therefore, genotype combinations of the three SNP loci associated with the PVR trait were further analyzed to exploit potential robust SNP marker. The result indicated that the genotype combination of GG-TT-AA of the three SNPs all occurred in uninfected individuals (Table 3), which suggested that this genotype combination has a strong correlation with the PVR trait. Table 2 Statistic analysis SNPs associated with the PVR trait in the verification group SNP Genotype Number in χ2 P G4 and G5 G1 SNP15 GG 3 8 9.00 0.0027 AG 15 2 AA 34 10 SNP16 TT 15 11 3.57 0.058 CT 22 5 CC 15 4 SNP17 AA 14 11 3.97 0.046 AT 23 5 TT 15 4 Table 3 The vibrios load of different genotype combinations in the validation group (n=72) Num genotype combination Sample size Average vibrios load (±SE) 1 AA-CC-TT 12 7.31E+04 ± 0.32 2 AA-CT-AT 24 1.40E+05 ± 0.53 3 AA-TT-AA 8 7.39E+04 ± 0.21 4 AG-CC-TT 6 1.49E+05 ± 0.38 5 AG-CC-AA 1 3.08E+06 ± 0.00 6 AG-CT-AT 1 1.13E+06 ± 0.00 7 AG-TT-AA 7 2.72E+05 ± 0.33 8 AG-TT-AT 2 4.92E+06 ± 0.15 9 GG-TT-AA 8 0.00E+00 ± 0.00 10 GG-TT-TT 1 2.71E+06 ± 0.00 11 GG-CT-AT 1 2.53E+06 ± 0.00 12 GG-CT-AA 1 7.56E+05 ± 0.00 3.4 Structure prediction and tissue distribution of the gene harboring the three SNPs All the three SNPs were found in the intron region of a gene, LvCthrc1 , coding for a collagen triple helix repeat containing-1. The prediction of 3D structure of the protein showed that it contains a lot of repeated alpha helices, accounting for about 70.64% of the gene (Fig. 6a), it may be closely related to its function. The expression level of LvCthrc1 was relatively higher in hemocytes, hepatopancreas and gills (Fig. 6b), and the highest expression level of LvCthrc1 occurred in the hemocytes, which is five times more than that of the muscles. 3.5 Variations in SNPs changed the position of predicted splice sites A total of 13 splicing sites were identified, including 7 splicing donor sites and 6 splicing acceptor sites (Table S4). Notably, the genotype combination of GG-TT-AA can lead to the disappearance of a donor splicing site of LvCthrc1 (Fig. 7), which predictably generates a novel transcript that potentially affects protein structure and function. This splicing donor site located in the middle of SNP15 and SNP16, and close to SNP16 (distance < 10bp). Discussion Vibrios, as the most common aquatic bacteria, have caused serious harm and great economic loss in shrimp culture (Nguyen et al., 2021 ; Liu et al., 2024 ). Due to the high diversity and ubiquity of Vibrio species in the estuary and marine environments (Lee et al., 2015 ; Baker-Austin et al., 2018 ), the genetic breeding of shrimp L. vannamei resistant to extensive vibrios species has more practical significance. Likewise, it is likely that breeding materials of shrimps screened through the infection challenge by single or multiple vibrios species may not be capable of adapting to the complicated farming environments full of various vibrios (Noriega-Orozco et al., 2007 ). Based on this consideration, we were inclined to obtain the ideal breeding materials of shrimps from the actual farming environments instead of the infection challenge by specific vibrios species. In this study, the shrimp were continuously exposed to a diverse range of vibrios conditions throughout their growth period, it indicates that have taken up the challenge of mixed strains of vibrios. Hepatopancreas of shrimps is not only a digestive but also an immune organ of shrimp that is frequently invaded by pathogenic bacteria, viruses, and parasites. Diversified vibrios can be easily found in the farmed shrimp, L. vannamei. In long practices of farming and pathological examinations, we found that vibrios load in the hepatopancreas can reflect the healthy state and resistance ability of the shrimp, and similar findings were also reported by other researchers (Niu et al., 2018 ; Noriega-Orozco et al., 2007 ; Robinson et al., 2014 ). For another parasite pathogen, Enterocytozoon hepatopenaei (EHP), EHP load in the hepatopancreas of L. vannamei also reflects the resistance ability of the shrimp (Hakonsholm et al., 2020; Madesh et al., 2024 ; Tian et al., 2024 ). Therefore, in this study, vibrios load in the hepatopancreas of L. vannamei was adopted to quantify the performance of the PVR trait. The ratio of the uninfected shrimp individuals is not more than 10% in the test group and the validation group, which indicated that only a few individuals in a shrimp group have the strong resistance to vibrios infection, likely conferred by the genetic variations in these individuals. In this study, whole genomes of 300 shrimps containing five different vibrio-resistance levels (G1 to G5) were sequenced for GWAS. Through GWAS, 20 SNPs were first screened out, and these SNPs were annotated to the genes related to autophagy, DNA replication, and metabolic pathways. After KASP genotyping, three SNPs (SNP15, SNP16, and SNP17) were further screened out to be likely associated with the PVR trait, In addition, LD analysis is an important method to examine SNP-SNP interaction, which has been shown to play an important role in the selection of species for complex traits (Onay et al., 2006 ; Wang et al., 2013 ; He et al., 2014 ). Furthermore, all the three SNPs located in the promoter region of the LvCthrc1 gene also supported the LD of the three SNPs, which propelled the potential genotype combination that is closely associated with the PVR trait. The application of comminated molecular markers narrows the screening range and increases the accuracy of breeding materials (Barrett et al., 2005 ), which also theoretically matches the rule that most economic traits are controlled by a set of loci in a genome ( Lu et al., 2011 ; Maniatis et al., 2007 ). LvCthrc1 is one kind of HEAT repeat protein, which includes a mammalian target of rapamycin (mTOR) protein the mTOR, owning a common function of mediating protein-protein interactions (Kunz et al., 2000 ). mTOR plays an important role in various cellular activities such as immunity, and it is activated by the formation of polymers in mammalian cells through its N-terminal HEAT repeat region (Takahara et al., 2006 ). In addition, a HEAT repeat protein, ILITYHIA ( ILA ) in Arabidopsis , involves in the plant immune process, and the mutation of ILA leads to increased sensitivity to pathogens and systemic drug resistance defects in plants (Monaghan et al, 2010). The expression distribution of LvCthrc1 in the shrimp showed that the mRNAs were highly expressed in immune-related tissues such as hemocytes, gill and hepatopancreas, which are also frequently attacked by vibrios. Therefore, it can be speculated that LvCthrc1 may play a crucial role in the immune process of L. vannamei although the specific function of HEAT repeat proteins in shrimp has not been elucidated. Generally, introns can’t be transcribed into mRNAs and they are often considered as junk DNA regions (Palmer et al., 2019). However, recent studies have shown that introns are closely related to gene expression and cytoskeleton construction, and exert some influence on life activities (Jacob et al., 2017; Naro et al., 2017). InDels of introns in different cattle groups are extremely enriched in immune-related pathways (Jacob and Smith, 2017 ). Changes in body weight due to the SNPs in intron of RuvBL2 gene have also been found in shrimps (Zhang et al., 2019). SNPs in intron can also lead to the occurrence of different spliceosomes sourced from the same gene (Jo et al., 2015 ; Jacob et al., 2017; Eiholzer et al., 2020 ). In this study, the SNP loci result in alterations to the splicing donor site. The splicing donor site is not present in the resistance-associated GG-TT-AA genotype combination. The loss of this splicing site may potentially generate a novel transcript that affects the protein structure and function. Based on the link between the genotype combination and the alternation of the splicing site, we speculated that the potential novel transcript may confer the shrimp strong resistance to vibrios infection. However, the specific splicing and sequence information of the novel transcript remain unidentified. The existence of novel transcript and its function need to be verified in future. Conclusion In this study, the correlation between SNPs and the PVR trait of L. vannamei was analyzed. Twenty SNPs that potentially associated with the PVR trait were first obtained by using GWAS. The genotypes of three SNPs (SNP15, SNP16, and SNP17) were different between G1 and G4/G5 groups, which were found in located in the intron region of a gene, LvCthrc1 . The genotype combination of GG-TT-AA of the three SNPs was significantly associated with the strongest performance of the trait, which can also lead to the disappearance of a donor splicing site of LvCthrc1 and predictably generates a novel transcript. The highest expression level of LvCthrc1 was observed in immune-related tissues such as hemocytes, gills, and hepatopancreas. This study provides valuable molecular markers for the genetic selection on the PVR trait of shrimp L. vannamei . Declarations Data Availability Statement The data presented in this study are available on request from the corresponding author. Acknowledgments This research was supported by the Guangxi Natural Science Foundation project (2023GXNSFBA026356), the National Key Research and Development Program of China (2023YFD2401701), the Seed Industry Revitalization Project of Provincial Rural Revitalization Strategy Special Funds (2022-SPY-00-001), the Research on breeding technology of candidate species for Guangdong modern marine ranching (2024-MRB-00-001), and the Innovation Team Project of Guangdong Universities (2022KCXTD017). Author contributions All authors contributed to the study conception and approved the final manuscript. Shuyang Wen: Conceptualization, Data curation, Formal analysis, Validation, Writing - original draft; Chuhang Cheng: Funding acquisition; Methodology, Software; Jiayue Yin: Visualization, Writing - review & editing; Ying Lv: Project administration, Supervision; Xin Zhang: Project administration, Visualization; Bo Ma: Methodology; Yang Liu: Visualization; Yueshan Qiu: Visualization; Huteng He: Investigation; Peng Luo: Investigation, Writing - review & editing, Resources, Supervision; Lihong Yuan: Project administration, Funding acquisition, Writing - review & editing. Declaration of Competing Interest The authors declare that they have no known financial interests or personal relationships that could have influenced the work reported in this paper. References Aulchenko, Y.S., Ripke, S., Isaacs, A., van Duijn, C.M., 2007. GenABEL: An R library for genome-wide association analysis. Bioinformatics , 23 (10), 1294–1296. https://doi.org/10.1093/bioinformatics/btm108 Baker-Austin, C., Olive, J.D., Alam, M., Ali, A., 2018. Vibrio spp. Infections. Nature Reviews Disease Primers , 4 , 1–19. https://doi.org/10.1038/s41572-018-0005-8 Barrett, J.C., Fry, B., Maller, J., Daly, M.J., 2005. Haploview: Analysis and visualization of LD and haplotype maps. Bioinformatics , 21 (2), 263–265. https://doi.org/10.1093/bioinformatics/bth457 Chang, C.C., Tan, H.C., Cheng, W., 2013. Effects of dietary administration of water hyacinth ( Eichhornia crassipes ) extracts on the immune responses and disease resistance of giant freshwater prawn, Macrobrachium rosenbergii . Fish & Shellfish Immunology , 35 (1), 92–100. https://doi.org/10.1016/j.fsi.2013.04.008 Chang, Y.T., Ko, H.T., Wu, P.L., Kumar, R., Wang, H.C., Lu HP (2023) Gut microbiota of Pacific white shrimp ( Litopenaeus vannamei ) exhibits distinct responses to pathogenic and non-pathogenic Vibrio parahaemolyticus . Microbiology Spectrum . https://doi.org/10.1128/spectrum.01180-23 Chen, Y.Y., Sim, S.S., Chiew, S.L., Yeh, S.T., Liou, C.H., Chen, J.C. 2012. Dietary administration of a Gracilaria tenuistipitata extract produces protective immunity of white shrimp Litopenaeus vannamei in response to ammonia stress. Aquaculture , 370–371 , 26–31. https://doi.org/10.1016/j.aquaculture.2012.09.031 Eiholzer, R.A., Mehta, S., Kazantseva, M., Drummond, C.J., McKinney, C., Young, K., Slater, D., Morten, B.C., Avery-Kiejda, K.A., Lasham, A., Fleming, N., Morrin, H.R., Reader, K., Royds, J.A., Landmann, M., Petrich, S., Reddel, R., Huschtscha, L., Taha, A., Braithwaite, A.W., 2020. Intronic TP53 polymorphisms are associated with increased Δ133TP53 transcript, immune infiltration and cancer risk. Cancers , 12 (9), Article 9. https://doi.org/10.3390/cancers12092472 Fu, S., Liu, J. 2022. Genome-wide association study identified genes associated with ammonia nitrogen tolerance in Litopenaeus vannamei . Frontiers in Genetics , 13 . https://doi.org/10.3389/fgene.2022.961009 Garlock, T.M., Asche, F., Anderson, J.L., Eggert, H., Anderson, T.M., Che, B., Chávez, C.A., Chu, J., Chukwuone, N., Dey, M.M., Fitzsimmons, K., Flores, J., Guillen, J., Kumar, G., Liu, L., Llorente, I., Nguyen, L., Nielsen, R., Pincinato, R.B.M., Tveteras, R., 2024. Environmental, economic, and social sustainability in aquaculture: The aquaculture performance indicators. Nature Communications , 15 (1), 5274. https://doi.org/10.1038/s41467-024-49556-8 Gaudet, M., Fara, A.G., Beritognolo, I., Sabatti, M., 2009. Allele-Specific PCR in SNP Genotyping. In A. A. Komar (Ed.), Single Nucleotide Polymorphisms: Methods and Protocols Totowa, NJ, pp: 415–424. Guo, L., Xu, Y.H., Zhang, N., Zhou, F.L., Huang, J.H., Liu, B.S., Jiang, S.G., Zhang, D.C., 2019. A High-Density Genetic linkage map and QTL mapping for sex in black tiger shrimp ( Penaeus monodon ) Frontiers in Genetics , 10, 326. https://doi.org/10.3389/fgene.2019.00326 Håkonsholm, F., Lunestad, B.T., Aguirre, Sánchez, J.R., Martinez-Urtaza, J., Marathe, N.P., Svanevik, C.S., 2020 Vibrios from the Norwegian marine environment: Characterization of associated antibiotic resistance and virulence genes. MicrobiologyOpen , 9 (9), e1093. https://doi.org/10.1002/mbo3.1093 He, T., Zhong, P.S., Cui, Y., 2014. A set-based association test identifies sex-specific gene sets associated with type 2 diabetes. Frontiers in Genetics , 5 . https://doi.org/10.3389/fgene.2014.00395 Jacob, A.G., Smith, C.W.J., 2017. Intron retention as a component of regulated gene expression programs. Human Genetics , 136 (9), 1043–1057. https://doi.org/10.1007/s00439-017-1791-x Jo, B.S., and Choi, S.S., 2015 Introns: The functional benefits of introns in genomes. Genomics & Informatics , 13 (4), 112–118. https://doi.org/10.5808/GI.2015.13.4.112 Kang, H.M., Sul, J.H., Service, S.K., Zaitlen, N.A., Kong, S., Freimer, N.B., Sabatti, C., Eskin, E., 2010. Variance component model to account for sample structure in genome-wide association studies. Nature Genetics , 42 (4), 348–354. https://doi.org/10.1038/ng.548 Kongchum, P., Chimtong, S., Prapaiwong, N., 2022. Association between single nucleotide polymorphisms of nLvALF1 and PEN2-1 genes and resistance to Vibrio parahaemolyticus in the Pacific white shrimp Litopenaeus vannamei . Aquaculture and Fisheries , 7 (4), 373–381. https://doi.org/10.1016/j.aaf.2021.08.003 Kunz, J., Schneider, U., Howald, I., Schmidt, A., Hall, M.N., 2000. HEAT repeats mediate plasma membrane localization of tor2p in yeast. Journal of Biological Chemistry , 275 (47), 37011–37020. https://doi.org/10.1074/jbc.M007296200 Lee, C.T., Chen, I.T., Yang, Y. T., Ko, T.P., Huang, Y.T., Huang, J.Y., Huang, M.F., Lin, S.J., Chen, C.Y., Lin, S.S., Lightner, D.V., Wang, H.C., Wang, A.H.J., Wang, H.C., Hor, L.I., and Lo, C.F., 2015. The opportunistic marine pathogen Vibrio parahaemolyticus becomes virulent by acquiring a plasmid that expresses a deadly toxin. Proceedings of the National Academy of Sciences , 112 (34), 10798–10803. https://doi.org/10.1073/pnas.1503129112 Li, H., Durbin, R., 2010. Fast and accurate long-read alignment with Burrows–Wheeler transform. Bioinformatics , 26 (5), 589–595. https://doi.org/10.1093/bioinformatics/btp698 Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., Marth, G., Abecasis, G., Durbin, R. .2009. The Sequence Alignment/Map format and SAMtools. Bioinformatics , 25 (16), 2078–2079. https://doi.org/10.1093/bioinformatics/btp352 Li, P., Guo, M., Wang, C., Liu, X., Zou, Q., 2015. An overview of SNP interactions in genome-wide association studies. Briefings in Functional Genomics , 14 (2), 143–155. https://doi.org/10.1093/bfgp/elu036 Liu, J., Wu, Q., Xu, H., Zhang, Z., 2024. Change of antibiotic resistance in Vibrio spp. During shrimp culture in Shanghai. Aquaculture , 580 , e740303. https://doi.org/10.1016/j.aquaculture.2023.740303 Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using Real-Time Quantitative PCR and the 2 − ΔΔ CT method. Methods , 25 (4), 402–408. https://doi.org/10.1006/meth.2001.1262 Lu, J., Zhang, X., Wang, C., Li, M., Chen, J., Xiong, J., 2021 Responses of sediment resistome, virulence factors and potential pathogens to decades of antibiotics pollution in a shrimp aquafarm. The Science of the Total Environment , 794 , 148760. https://doi.org/10.1016/j.scitotenv.2021.148760 Lu, Y., Shah, T., Hao, Z., Taba, S., Zhang, S., Gao, S., Liu, J., Cao, M., Wang, J., Prakash, A.B., Rong, T., Xu, Y., 2011. Comparative SNP and haplotype analysis reveals a higher genetic diversity and rapider ld decay in tropical than temperate germplasm in maize. PLOS ONE , 6 (9), e24861. https://doi.org/10.1371/journal.pone.0024861 Luo, S.S., Chen, X.L., Wang, A.J., Liu, Q.Y., Peng, M., Yang, C.L., Zeng, D.G., Zhao, Y.Z., Wang, H.L., 2024. Identification, functional analysis of chitin-binding proteins and the association of its single nucleotide polymorphisms with Vibrio parahaemolyticus resistance in Penaeus vannamei . Fish & Shellfish Immunology , 154 , 109966. https://doi.org/10.1016/j.fsi.2024.109966 Luo SS, Chen XL, Wang AJ, Liu QY, Peng M, Yang C, Zeng DG, Zhao YZ, Wang HL (2024) Identification, functional analysis of chitin-binding proteins and the association of its single nucleotide polymorphisms with Vibrio parahaemolyticus resistance in Penaeus vannamei . Fish & Shellfish Immunology , 154 , 109966. https://doi.org/10.1016/j.fsi.2024.109966 Madesh S, Sudhakaran G, Sreekutty A R, Kesavan D, Almutairi BO, Arokiyaraj S, Dhanaraj M, Seetharaman S, Arockiaraj J (2024) Exploring neem aqueous extracts as an eco-friendly strategy to enhance shrimp health and combat EHP in aquaculture. Aquaculture International , 32 (3), 3357–3377. https://doi.org/10.1007/s10499-023-01326-x Maniatis N, Collins A, Morton NE (2007) Effects of single SNPs, haplotypes, and whole‐genome LD maps on accuracy of association mapping. Genetic Epidemiology , 31(15), 179-188. https://doi.org/10.1002/gepi.20199 Maralit BA, Jaree P, Boonchuen P, Tassanakajon A, Somboonwiwat K (2018) Differentially expressed genes in hemocytes of Litopenaeus vannamei challenged with Vibrio parahaemolyticus AHPND (VPAHPND) and VPAHPND toxin. Fish & Shellfish Immunology , 81 , 284–296. https://doi.org/10.1016/j.fsi.2018.06.054 McKenna A, Hanna M, Banks E, Sivachenko A, Cibulskis K, Kernytsky A, Garimella K, Altshuler D, Gabriel S, Daly M, DePristo MA (2010) The Genome Analysis Toolkit: A MapReduce framework for analyzing next-generation DNA sequencing data. Genome Research , 20 (9), 1297–1303. https://doi.org/10.1101/gr.107524.110 Monaghan J, Li X (2010) The HEAT Repeat Protein ILITYHIA is required for plant immunity. Plant and Cell Physiology , 51 (5), 742–753. https://doi.org/10.1093/pcp/pcq038 Naro C, Sette C (2017) Timely-regulated intron retention as device to fine-tune protein expression. Cell Cycle , 16 (14), 1321–1322. https://doi.org/10.1080/15384101.2017.1337983 Nguyen TV, Alfaro A, Arroyo BB, Leon JAR, Sonnenholzner S (2021) Metabolic responses of penaeid shrimp to acute hepatopancreatic necrosis disease caused by Vibrio parahaemolyticus . Aquaculture , 533 , 736174. https://doi.org/10.1016/j.aquaculture.2020.736174 Niu B, Hong B, Zhang Z, Mu L, Malakar PK, Liu H, Pan Y, Zhao Y (2018) A novel qPCR method for simultaneous detection and quantification of Viable Pathogenic and Non-pathogenic Vibrio parahaemolyticus (tlh+, tdh+, and ureR+) Frontiers in Microbiology , 9 . https://doi.org/10.3389/fmicb.2018.01747 Noriega-Orozco L, Acedo-Félix E, Higuera-Ciapara I, Jiménez-Flores R, Cano R (2007) Pathogenic and non-pathogenic Vibrio species in aquaculture shrimp ponds. Revista Latinoamericana de Microbiología , 49 (3–4), 60–67. https://www.medigraphic.com/cgi-bin/new/resumen.cgi?IDARTICULO=16748 Onay VÜ, Briollais L, Knight JA, Shi E, Wang Y, Wells S, Li H, Rajendram I, Andrulis IL, Ozcelik H (2006) SNP-SNP interactions in breast cancer susceptibility. BMC Cancer , 6 (1), 114. https://doi.org/10.1186/1471-2407-6-114 Palmer J, Poon AFY (2019) Phylogenetic measures of indel rate variation among the HIV-1 group M subtypes. Virus Evolution , 5 (2), vez022. https://doi.org/10.1093/ve/vez022 Paria, S. S., Rahman, S. R., & Adhikari, K. (2022) fastman: A fast algorithm for visualizing GWAS results using Manhattan and Q-Q plots. BioRxiv preprint. https://doi.org/10.1101/2022.04.19.488738 Robinson NA, Gopikrishna G, Baranski M, Katneni VK, Shekhar MS, Shanmugakarthik J, Jothivel S, Gopal C, Ravichandran P, Gitterle T, Ponniah AG (2014) QTL for white spot syndrome virus resistance and the sex-determining locus in the Indian black tiger shrimp ( Penaeus monodon ) BMC Genomics , 15 (1), 731. https://doi.org/10.1186/1471-2164-15-731 Stalin N, Srinivasan P (2016) Molecular characterization of antibiotic resistant Vibrio harveyi isolated from shrimp aquaculture environment in the south east coast of India. Microbial Pathogenesis , 97 , 110–118. https://doi.org/10.1016/j.micpath.2016.05.021 Takahara T, Hara K, Yonezawa K, Sorimachi H, Maeda T (2006) Nutrient-dependent multimerization of the mammalian target of rapamycin through the N-terminal HEAT Repeat Region. Journal of Biological Chemistry , 281 (39), 28605–28614. https://doi.org/10.1074/jbc.M606087200 Tian X, Xu W, Du Y, Chen J (2024) Transcriptomic analysis provides insights into the mechanisms underlying the resistance of Penaeus vannamei to Enterocytozoon hepatopenaei (EHP) Fish & Shellfish Immunology , 154 , 109902. https://doi.org/10.1016/j.fsi.2024.109902 Valente C, De S, Wan AHL (2021) Vibrio and major commercially important vibriosis diseases in decapod crustaceans. Journal of Invertebrate Pathology , 181 , 107527. https://doi.org/10.1016/j.jip.2020.107527 Visscher PM, Brown MA, McCarthy MI, Yang J (2012) Five years of GWAS discovery. The American Journal of Human Genetics , 90 (1), 7–24. https://doi.org/10.1016/j.ajhg.2011.11.029 Wang M, Wang Q, Pan Y (2013) From QTL to QTN: candidate gene set approach and a case study in porcine IGF1-FoxO pathway. PLOS ONE , 8 (1), e53452. https://doi.org/10.1371/journal.pone.0053452 Whankaew S, Suksri P, Sinprasertporn A, Thawonsuwan J, & Sathapondecha P. (2024) Development of DNA markers for acute hepatopancreatic necrosis disease tolerance in Litopenaeus vannamei through a Genome-Wide Association Study. Biology , 13 (9), Article 9. https://doi.org/10.3390/biology13090731 Xiao S, Wang P, Dong L, Zhang Y, Han Z, Wang Q, Wang Z (2016) Whole-genome single-nucleotide polymorphism (SNP) marker discovery and association analysis with the eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) content in Larimichthys crocea . PeerJ , 4 , e2664. https://doi.org/10.7717/peerj.2664 Yao D, Su H, Zhu J, Zhao X, Aweya JJ, Wang F, Zhong M, Zhang Y (2018) SNPs in the Toll1 receptor of Litopenaeus vannamei are associated with immune response. Fish & Shellfish Immunology , 72 , 410–417. https://doi.org/10.1016/j.fsi.2017.11.018 Zhan F, Qu K, Chen N, Hanif Q, Jia Y, Huang Y, Dang R, Zhang J, Lan X, Chen H, Huang B, Lei C (2019) Genome-Wide SNPs and InDels Characteristics of three Chinese cattle breeds. Animals , 9 (9), Article 9. https://doi.org/10.3390/ani9090596 Zhang Y, Xu C, Li Q (2024) Whole-genome resequencing identifies candidate genes and SNPs in genomic regions associated with shell color selection in the Pacific oyster, Crassostrea gigas . Aquaculture , 586 , 740768. https://doi.org/10.1016/j.aquaculture.2024.740768 Zou L, Liu B (2015) Identification of a Serum amyloid A gene and the association of SNPs with Vibrio -resistance and growth traits in the clam Meretrix meretrix . Fish & Shellfish Immunology , 43 (2), 301–309. https://doi.org/10.1016/j.fsi.2015.01.007 Zoubarev A, Hamer KM, Keshav KD, McCarthy EL, Santos JR, Van Rossum T, McDonald C, Hall A, Wan X, Lim R, Gillis J, Pavlidis P (2012) Gemma: A resource for the reuse, sharing and meta-analysis of expression profiling data. Bioinformatics , 28 (17), 2272–2273. https://doi.org/10.1093/bioinformatics/bts430 Additional Declarations No competing interests reported. Supplementary Files Supplementary.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6178636","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":428008051,"identity":"2e86efea-a65d-4c60-8843-cd422ef9dfaa","order_by":0,"name":"Shuyang Wen","email":"","orcid":"","institution":"Guangdong Pharmaceutical University","correspondingAuthor":false,"prefix":"","firstName":"Shuyang","middleName":"","lastName":"Wen","suffix":""},{"id":428008053,"identity":"e9bc856e-6297-4030-8dac-33f282249618","order_by":1,"name":"Chuhang Cheng","email":"","orcid":"","institution":"Guangxi Academy of Marine Sciences, Guangxi Academy of Sciences","correspondingAuthor":false,"prefix":"","firstName":"Chuhang","middleName":"","lastName":"Cheng","suffix":""},{"id":428008054,"identity":"4140ceb0-67d4-440e-89ac-7ed756e16943","order_by":2,"name":"Jiayue Yin","email":"","orcid":"","institution":"South China Sea Institute Of Oceanology","correspondingAuthor":false,"prefix":"","firstName":"Jiayue","middleName":"","lastName":"Yin","suffix":""},{"id":428008055,"identity":"7af58ba2-5148-4105-85e2-9898368b4726","order_by":3,"name":"Ying Lv","email":"","orcid":"","institution":"Beibu Gulf Marine Ecological Environment Field Observation and Research Station of Guangxi, Beibu Gulf University","correspondingAuthor":false,"prefix":"","firstName":"Ying","middleName":"","lastName":"Lv","suffix":""},{"id":428008056,"identity":"32beb04b-f1e9-4cb1-8f38-f3a1d09c77a4","order_by":4,"name":"Xin Zhang","email":"","orcid":"","institution":"South China Sea Institute Of Oceanology","correspondingAuthor":false,"prefix":"","firstName":"Xin","middleName":"","lastName":"Zhang","suffix":""},{"id":428008057,"identity":"cf2ffbef-852c-429e-8143-7cd709cfec26","order_by":5,"name":"Bo Ma","email":"","orcid":"","institution":"South China Sea Institute Of Oceanology","correspondingAuthor":false,"prefix":"","firstName":"Bo","middleName":"","lastName":"Ma","suffix":""},{"id":428008058,"identity":"3ad8b76c-aee9-4258-9abd-b0bd1c4834f9","order_by":6,"name":"Yang Liu","email":"","orcid":"","institution":"South China Sea Institute Of Oceanology","correspondingAuthor":false,"prefix":"","firstName":"Yang","middleName":"","lastName":"Liu","suffix":""},{"id":428008059,"identity":"2d823f3a-0d09-4676-884f-28b05d749f0b","order_by":7,"name":"Yueshan Qiu","email":"","orcid":"","institution":"Beibu Gulf Marine Ecological Environment Field Observation and Research Station of Guangxi, Beibu Gulf University","correspondingAuthor":false,"prefix":"","firstName":"Yueshan","middleName":"","lastName":"Qiu","suffix":""},{"id":428008060,"identity":"e37836b8-c03f-4a18-9a3e-691714231609","order_by":8,"name":"Huteng He","email":"","orcid":"","institution":"Xi'an Jiaotong-Liverpool University","correspondingAuthor":false,"prefix":"","firstName":"Huteng","middleName":"","lastName":"He","suffix":""},{"id":428008061,"identity":"04f35465-ca98-4537-988d-3195dd54d01f","order_by":9,"name":"Peng Luo","email":"","orcid":"","institution":"South China Sea Institute Of Oceanology","correspondingAuthor":false,"prefix":"","firstName":"Peng","middleName":"","lastName":"Luo","suffix":""},{"id":428008062,"identity":"6098b36c-53aa-430d-805d-55c854d1801b","order_by":10,"name":"Lihong Yuan","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAs0lEQVRIiWNgGAWjYDACdh7GBwxsYKYBkVqYeZgNSNbCJkGaFoPDvMcqv5TdSWxgb94mwVBzhxgtfGm3Zc49S2zgOVYmwXDsGTFaeMxuS7YdTmyQyDGTYGw4TJyWYrAW+TckaGH8CLaFh0gtkod5jKUZzj0zbuNJK7ZIOEaEFr7jPYYff5Tdke1nP7zxxocaIrQoHABFDcMBSNQkENbAwCDfwMDA+AOoZRSMglEwCkYBTgAAiv86JLkJmJsAAAAASUVORK5CYII=","orcid":"","institution":"Guangdong Pharmaceutical University","correspondingAuthor":true,"prefix":"","firstName":"Lihong","middleName":"","lastName":"Yuan","suffix":""}],"badges":[],"createdAt":"2025-03-07 13:23:33","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6178636/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6178636/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":78457210,"identity":"4c9572fa-c844-42e0-9a4c-b3f3076a1eeb","added_by":"auto","created_at":"2025-03-13 12:45:04","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":455392,"visible":true,"origin":"","legend":"\u003cp\u003eVibrios load of different infection grades. (a) Vibrios load of different infection grades in the test group; (b) Number of individuals with different levels of infection grades; (c) Bacterial colonies of typical individuals with different infection grades\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-6178636/v1/e6b5c9f249f67056d05bc77c.png"},{"id":78456358,"identity":"bb954e75-ce0b-4d21-90a0-7491be57874c","added_by":"auto","created_at":"2025-03-13 12:37:04","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1130123,"visible":true,"origin":"","legend":"\u003cp\u003eThe distribution of SNPs on the top 20 longest scaffolds across the chromosomes in \u003cem\u003eLitopenaeus vannamei\u003c/em\u003e. The color bar represents the number of SNPs within 0.1 Mb window size with reference to the index shown on the right.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-6178636/v1/ca3d66c93a4e058a82102466.png"},{"id":78457466,"identity":"54760d8d-08f7-4414-ad2b-2ea6d86223bf","added_by":"auto","created_at":"2025-03-13 12:53:04","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":468120,"visible":true,"origin":"","legend":"\u003cp\u003eGWAS of the PVR trait of the shrimp. (a) Q-Q map; (b) Manhattan map. The dashed blue lines and solid black lines are -lg (\u003cem\u003eP\u003c/em\u003e) =2.5 and -lg (\u003cem\u003eP\u003c/em\u003e) =5, respectively. Since the genome of \u003cem\u003eL. vannamei \u003c/em\u003eis not assembled at the chromosomal level, in this study, only the SNP distribution of the top 20 scaffold sequences with the longest splintering length was illustrated.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-6178636/v1/870715262cf6c8b5497ac3c9.png"},{"id":78457208,"identity":"ce5bfd76-b47b-47bd-ac9d-649048b0fbaa","added_by":"auto","created_at":"2025-03-13 12:45:04","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":110455,"visible":true,"origin":"","legend":"\u003cp\u003eThe correlation between genotypes of the three SNPs and vibrios load in the validation group\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-6178636/v1/284031bc83d1263a20a6a45b.png"},{"id":78456368,"identity":"c22fee8a-9cc3-4e1e-85b5-43d48179c62e","added_by":"auto","created_at":"2025-03-13 12:37:04","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":174417,"visible":true,"origin":"","legend":"\u003cp\u003eLD analysis of the 20 SNPs. The circle in the lower left corner is r\u003csup\u003e2\u003c/sup\u003e, and the circle in the upper right corner is colored with the D 'value\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-6178636/v1/9dd31b3c6ebaa5a13fa4ad39.png"},{"id":78456362,"identity":"ebb90731-cb9c-449b-ae9e-937c0ca49e49","added_by":"auto","created_at":"2025-03-13 12:37:04","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":347351,"visible":true,"origin":"","legend":"\u003cp\u003eAnalysis of \u003cem\u003eLvCthrc1\u003c/em\u003e gene function (a) 3D structure of protein encoded by the gene \u003cem\u003eLvCthrc1\u003c/em\u003e (b) and the expression distribution of \u003cem\u003eLvCthrc1\u003c/em\u003e\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-6178636/v1/f20e25968bd7b3e639cbd904.png"},{"id":78456369,"identity":"0bb1e733-b68e-4b16-9882-e591885a3054","added_by":"auto","created_at":"2025-03-13 12:37:04","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":253455,"visible":true,"origin":"","legend":"\u003cp\u003ePrediction of the altered splicing site in the genotype combination. The bases with red color are the three SNPs\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-6178636/v1/92ba005a3f856c57da374d46.png"},{"id":79280122,"identity":"be3bf8e1-7241-489c-b22b-348b75488ac9","added_by":"auto","created_at":"2025-03-26 13:16:48","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4992914,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6178636/v1/2020e761-fdcf-46d1-b87f-97e8a077632d.pdf"},{"id":78456357,"identity":"586d2a22-8566-473f-b713-42fffb734c6d","added_by":"auto","created_at":"2025-03-13 12:37:04","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":36059,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementary.docx","url":"https://assets-eu.researchsquare.com/files/rs-6178636/v1/74950ba117f5f03179df5f2e.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Identification of genes associated with pan-vibrios resistance (PVR) trait of shrimp Litopenaeus vannamei through Genome-wide association study","fulltext":[{"header":"Introduction","content":"\u003cp\u003ePacific white shrimp, \u003cem\u003eLitopenaeus vannamei\u003c/em\u003e (\u003cem\u003eL. vannamei\u003c/em\u003e), is the most farming shrimp species in the world, which accounts for more than 75% of global shrimp farming production (Garlock et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). However, with the extensive farming of the shrimp, bacterial diseases mainly caused by various pathogenic vibrios frequently break out and lead to huge economic loss (Maralit et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). It has been reported that vibriosis outbreaks in China, Vietnam, Malaysia, Mexico and Bangladesh have dramatically reduced shrimp production by about 60 percent in a short period (Noriega-Orozco et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Chang et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Liu et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). The prevention of vibrios infections primarily entails the use of antibiotics (Stalin and Srinivasan, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Lu et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), immunity enhancement by immunoregulator (Chen et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Chang et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2013\u003c/span\u003e) and genetic breeding (Zou and Liu, \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Kongchum et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Luo et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Among them, genetic breeding of shrimps has been considered as the most prominent approach for enhancing the resistance to the vibrio infection as it can fundamentally improve the vibrio-resistance trait of shrimps through genetic changes (Luo et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2024\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn recent years, high-throughput sequencing technologies have propelled the rapid development of genetic breeding of animals including aquatic animals. Molecular marker-assisted selection (MAS) that mainly depends on the molecular marker mining acquired from high-throughput sequencing and sequencing data analysis has been frequently used in some aquatic animals, such as \u003cem\u003eCtenopharyngodon idellus\u003c/em\u003e, \u003cem\u003eCyprinus carpio\u003c/em\u003e, \u003cem\u003eEriocheir sinensis\u003c/em\u003e, and \u003cem\u003eL. vannamei\u003c/em\u003e (Xiao et al., \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Fu and Liu, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Zhang et al., \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Genome-wide association study (GWAS) plays an important role in the genetic mapping of complex traits and in the finding of genetic variations under the whole genome scale (Visscher et al., \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). GWAS has been used to explore important loci for MAS aiming at the genetic selection of multiple traits in animals (Li et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). In the genetic breeding of shrimps, for instance, some SNPs associated with WSSV resistance (Robinson et al., \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2014\u003c/span\u003e), growth traits, and sex determination (Guo et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) have been identified in shrimp, \u003cem\u003ePenaeus monodon\u003c/em\u003e, through GWAS. Robinson et al (\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2014\u003c/span\u003e) first analyzed the correlation between WSSV resistance trait and SNPs in \u003cem\u003eL. vannamei\u003c/em\u003e through using GWAS. Liu et al (2022) identified seven genes related to ammonia nitrogen tolerance in \u003cem\u003eL. vannamei\u003c/em\u003e by the GWAS method. Whankaew et al (\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2024\u003c/span\u003e) identified 4 SNPs and 17 InDels in three varieties of \u003cem\u003eL. vannamei\u003c/em\u003e, related to the tolerance of Acute Hepatopancreatic Necrosis Disease (AHPND). However, until now there is no further screening and verification of candidate SNPs found in the GWAS of vibrio-resistance trait in shrimps. In addition, nearly all the SNPs associated with vibrio resistance in shrimps were obtained to target the genetic improvement of AHPND tolerance, wherein only specific virulent strains of \u003cem\u003eVibrio\u003c/em\u003e species (such as \u003cem\u003eV. parahaemolyticus\u003c/em\u003e) were adopted (Yao et al., \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Kongchum et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Luo et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). \u003cem\u003eVibrio\u003c/em\u003e is a genus of ubiquitous bacteria found in a wide variety of aquatic and marine habitats and at least 100 species have been recorded in this genus (Baker-Austin et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), among which over 15 \u003cem\u003eVibrio\u003c/em\u003e species have been reported as opportunistic pathogens to shrimps (Valente and Wan, 2021). Due to the prevalence of pathogenic vibrios in various marine environments, genetic breeding of shrimps with the pan-vibrios resistance (PVR) trait (resistance to wide range of \u003cem\u003eVibrio\u003c/em\u003e pathogens) has more practical significance for successful shrimp farming.\u003c/p\u003e \u003cp\u003eIn the present study, a GWAS of the PVR trait in 300 shrimp individuals with different sources was performed, and it generated 20 candidate SNPs potentially associated with the PVR trait. Further, genotypes of these candidate SNPs were differentiated in a validation group and their association with the PVR trait was analyzed. Finally, the genotype combination from a gene, \u003cem\u003eLvChrc1\u003c/em\u003e, was screened out, which were strongly associated with the PVR trait. This study put forward the concept of the PVR trait and provides valuable molecular markers for the genetic selection on this trait of shrimp \u003cem\u003eL. vannamei\u003c/em\u003e, thereby facilitating the genetic breeding of shrimps toward the substantial improvement of antibacterial ability.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Shrimp sample collection\u003c/h2\u003e \u003cp\u003eIndividuals of shrimp \u003cem\u003eL. vannamei\u003c/em\u003e were collected from nine farms in Sanya (SY), Qionghai (QH), Fuzhou (FZ), Xiamen (XM), Ningde (ND), Zhanjiang (ZJ), Zhuhai (ZH), Shantou (ST) and Guangzhou (GZ) of China. 50 shrimp individuals (weight of 11\u0026thinsp;\u0026plusmn;\u0026thinsp;4g) in each collected group (from one farm in one area) were used to analyze their performance of the PVR trait. In addition, 210 shrimps (weight of 10\u0026thinsp;\u0026plusmn;\u0026thinsp;3g) were randomly collected from three farms in Maoming and were used to analyze their performance of the PVR trait for verifying the effectiveness of candidate SNP markers.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Evaluation of the PVR trait by vibrios load in hepatopancreas\u003c/h2\u003e \u003cp\u003eEach of shrimp hepatopancreas tissues (0.01g) were taken off and homogenized in 1ml of sterilized seawater, respectively, and then 100 \u0026micro;l of diluted homogenate of each sample was diluted in 10-fold. 100 \u0026micro;l of each dilution was spread onto a TCBS plate with triple repetition. TCBS plates were incubated at 30 ℃ for 24 h and bacterial colonies were calculated and converted into vibrios load in shrimps. Shrimp individuals were classed into five grades (G1, G2, G3, G4, and G5) according to vibrios load to reflect their PVR trait, among which the severity of vibrios infection progressively escalates from grade 1 to grade 5 (G1 to G5). Groups containing\u0026thinsp;\u0026ge;\u0026thinsp;10% of uninfected individuals are ruled out and finally, a total of 300 shrimp individuals from six groups with different infection levels were selected to comprise an analysis group. In the same way, 300 individuals mentioned above were also graded according to their vibrios load in the hepatopancreas and shrimps in G1 (no vibrios infection observed) and shrimps in G4 to G5 (relatively serious vibrios infection) were selected out to comprise a validation group.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 DNA extraction and library preparation\u003c/h2\u003e \u003cp\u003eThe genomic DNAs of all shrimp samples were extracted using the Marine Animals Genomic DNA Extraction Kit (TIANGEN, China). The genome of each sample was segmented using the HaeIII\u0026thinsp;+\u0026thinsp;Hpy166II restriction enzymes, and the resulting fragments were further processed to isolate the target fragments ranging in length from 314 to 394 bp. After passing quality control checks, the library was subjected to sequencing using specific length amplified fragment sequencing (SLAF-seq) in Biomarker Technologies Corporation (Beijing, China).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e\u003cb\u003e2.4 Genotyping and quality control\u003c/b\u003e\u003c/h2\u003e \u003cp\u003eFiltered reads were mapped to the reference genome of \u003cem\u003eL. vannamei\u003c/em\u003e (ASM 378908) using BWA software (Li and Durbin \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). GATK (McKenna et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2010\u003c/span\u003e) and SAMtools (Li et al., 2009) were used to develop the SNP tag intersection as the final reliable SNP tag dataset. Subsequently, SnpEff software (Gaudet et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2009\u003c/span\u003e) was used to analyze the location of mutation sites on the reference genome and the gene location information on the reference genome. The \"\u003cem\u003echeck marker\u003c/em\u003e\" function in the GenABEL package was used for quality control of genotyping SNPs (Aulchenko et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). The SNPs with low minor allele frequencies (MAF), low profile rates, and deviations from the Hardy-Weinberg were removed before analysis. In addition, the SNPs that were located in gene and within 5000 bp away from the gene are focused on.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Variant calling analysis and GWAS\u003c/h2\u003e \u003cp\u003eCombined with EMMAX software (Kang et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2010\u003c/span\u003e), the mixed linear model is used for correlation analysis, and the application model is as follows:\u003cdiv id=\"Equa\" class=\"Equation\"\u003e\u003cdiv format=\"TEX\" class=\"mathdisplay\" id=\"FileID_Equa\" name=\"EquationSource\"\u003e\n$$\\:\\text{y}=\\text{W}{\\alpha\\:}+\\text{x}{\\beta\\:}+{\\mu\\:}+\\text{e}$$\u003c/div\u003e\u003c/div\u003e\u003c/p\u003e \u003cp\u003eGEMMA (Zoubarev et al., \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2012\u003c/span\u003e) was used to calculate the kinship \u0026micro; among samples. As a random effect, if there is a covariable, the W is a fixed effect, x is the genotype, and y is the phenotype. According to the \u003cem\u003eP\u003c/em\u003e-value of the SNP, with -log10 (p)\u0026thinsp;\u0026ge;\u0026thinsp;2.5 as the significance standard, the corresponding Q-Q quantile map and Manhattan map are drawn by using the R qqman package (Paria et al., \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cb\u003e2.6 Function analysis of\u003c/b\u003e g\u003cb\u003eenes containing discrepant SNPs and Genotyping of discrepant SNPs in a validation group\u003c/b\u003e\u003c/p\u003e \u003cp\u003eGenes containing discrepant SNPs revealed by GWAS were screened out according to the locations of the SNPs using the genomic information of \u003cem\u003eL. vannamei\u003c/em\u003e (ASM 378908v1) and the functions of the genes were annotated using NCBI-NR database. The tag sequence information of the selected genes was obtained from the genome of \u003cem\u003eL. vannamei\u003c/em\u003e (ASM 378908v1). Primer premier 6.0 software (Applied Biosystems, Norcross, GA) was used to design primers for PCR targeting DNA fragments near candidate SNP. Two forward primers were designed for each site, and fluorescent sequence tags of FAM (GAAGGTGACCAAGTTCATGCT) and HEX (GAAGGTCGGAGTCAACGGATT) were respectively added. All primers used in this study were designed by Primer premier 6.0 software and placed in Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e. Genotyping was performed through a method of competitive allele specific PCR (KASP) using a commercial STO Rox kit (Gudebio, Guangzhou).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Correlation analysis between genotypes and the performance of the PVR trait in a validation group\u003c/h2\u003e \u003cp\u003eThe validation population selected 210 shrimp with extreme infection amount as resistance group (G1) and susceptible group (G4, G5) for analysis, including 72 shrimp. The correlation between genotypes and the performance of the PVR trait was manually analyzed. SNPs significantly associated with the PVR trait was further used to explore potential interactions among them by linkage disequilibrium (LD) analysis using Haploview software (Barrett et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). Based on the LD analysis, the correlation between the genotype combination and the performance of the PVR trait were also analyzed, which led to the finding of combined SNP markers.\u003c/p\u003e \u003cp\u003e \u003cb\u003e2.8 Protein structure prediction of a target gene related to the PVR trait and expression levels of the gene\u003c/b\u003e \u003c/p\u003e \u003cp\u003eUse SWISS - MODEL website (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://swissmodel.expasy.org/\u003c/span\u003e\u003cspan address=\"https://swissmodel.expasy.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) to predict 3D structure of the protein coded by a target gene related to the PVR trait. Total RNAs were extracted using RNA Easy Fast Tissue/Cell Kit (TIANGEN, China) and were reverse-transcribed into cDNAs using a Prime Script\u0026trade;II 1st Strand cDNA Synthesis Kit (Takara, Japan). The expression levels of the gene in the brain, eye stalk, hemocytes, gill, hepatopancreas, heart, muscle, intestine and stomach were detected by qRT-PCR using a RT-PCR kit (TaKaRa, China) and \u003cem\u003eβ-actin\u003c/em\u003e gene was used as the reference gene (Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). qRT-PCR was performed using Thermal Cycler Dice\u0026reg;Real Time System III (TaKaRa) under the following conditions: 95 \u0026ordm;C for 30 s, 40 cycles of 95 \u0026ordm;C for 5 s and 56 \u0026ordm;C for 30 s, reading of templates at 95 \u0026ordm;C for 15 s, and final melting curve from 60 to 95 \u0026ordm;C. Three biological replicates and three technical replicates were used for qRT-PCR, and the expression levels of the gene were calculated by 2\u003csup\u003e\u0026minus;ΔΔCT\u003c/sup\u003e method (Livak and Schmittgen, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2001\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.9 Prediction of splicing sites in intron regions from the genotype\u003c/h2\u003e \u003cp\u003eNetGene2 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://services.healthtech.dtu.dk/\u003c/span\u003e\u003cspan address=\"https://services.healthtech.dtu.dk/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) was used for the SNP loci of the sequences of introns splicing sites prediction (confidence\u0026thinsp;\u0026ge;\u0026thinsp;0.85).\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec11\"\u003e\n \u003ch2\u003e\u003cstrong\u003e3.1 Grading the PVR trait of the shrimp individuals\u003c/strong\u003e\u003c/h2\u003e\n \u003cp\u003eAccording to vibrios load in hepatopancreas, the PVR trait of the shrimp was quantified to five grades, G1 to G5 (Fig.\u0026nbsp;1a). Among 300 shrimp individuals, only 25 individuals in G1 (8.3%) exhibited no vibrios infection in hepatopancreas, manifesting their excellent performance of PVR trait, while 32 individuals in G5 (10.7%) exhibited serious infection in hepatopancreas, manifesting their weak performance of PVR trait (Fig.\u0026nbsp;1b). The typical bacterial colonies of different infection grades on the TCBS plates were showed (Fig.\u0026nbsp;1c).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\"\u003e\n \u003ch2\u003e3.2 GWAS and gene functional annotation of candidate SNP\u003c/h2\u003e\n \u003cp\u003eAccording to the comparison analysis, 18,184,608 SNP loci were obtained, 78.78% of SNPs located in the intergenic regions (distance from downstream gene\u0026thinsp;\u0026gt;\u0026thinsp;5KB), while only 5.95% of SNPs located in the upstream regions (distance from downstream gene\u0026thinsp;\u0026le;\u0026thinsp;5KB). Moreover, these SNPs were unevenly distributed in the genome, with the largest distribution in scaffolds, NW_020869133.1, NW_020869429.1, and NM_020870026.1 (Fig.\u0026nbsp;2). The Q-Q result showed the result is statistically significant with an efficient family structure correction, indicating the phenotypic data could fit the selected model well (Fig.\u0026nbsp;3a). The Manhattan map shows the results of GWAS, with a total of 243 SNPs above the dotted line divider (-log10 (p)\u0026thinsp;\u0026ge;\u0026thinsp;2.5, Fig.\u0026nbsp;3b). After focusing SNPs inside genes and promoter regions, a total of 20 SNPs potentially related to the PVR trait were identified. Annotate genes covering these sites are associated with immunity, DNA replication and metabolisms (Table\u0026nbsp;1).\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eTable 1\u003c/strong\u003e The statistics of the associated SNPs to the PVR trait\u0026nbsp;\u003c/p\u003e\n \u003cdiv\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"593\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eSNP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003ePosition\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eGene\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eGene function\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eP (-log\u003csub\u003e10\u003c/sub\u003e (p))\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eSNP1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e239608\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eprotogenin-like, partial\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eEncodes immunoglobulins\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e3.46\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eSNP2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e483631\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eE3 ubiquitin-protein ligase RFWD3-like\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eInvolved DNA metabolic process;\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e3.15\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eSNP3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e709567\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003ediscoidin domain-containing receptor A-like\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eParticipate in signaling\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e3.14\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eSNP4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e390539\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003etrafficking protein particle complex subunit 4-like\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eInvolved in autophagy and endoplasmic reticulum to Golgi vesicle-mediated transport.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e3.04\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eSNP5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e229720\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003emethylmalonic aciduria and homocystinuria type D protein, mitochondrial-like isoform X1\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eCoding line stereoprotein, involved in vitamin B12 metabolism\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e3.03\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eSNP6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e157824\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003esodium- and chloride-dependent GABA transporter 2-like\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eEncodes transporters\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e2.87\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eSNP7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e990978\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e60S acidic ribosomal protein P2\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eInvolved in immune regulation\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e2.73\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eSNP8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e450675\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003emethyltransferase N6AMT1-like\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eParticipates in the methylation of release factor I\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e2.71\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eSNP9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e44114\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003ehemocyanin C chain-like\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eHas immune, antibacterial function\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e2.61\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eSNP10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e57624\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003ecGMP-inhibited 3\u0026apos;,5\u0026apos;-cyclic phosphodiesterase B\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eRegulators\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e2.61\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n \u003cp\u003e\u003c/p\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"586\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eSNP11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e91727\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eactin, muscle-like\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eInvolved in muscle contraction, cell movement, and cell division\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e2.59\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eSNP12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e165399\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eprotein timeless homolog\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003einvolved in cell survival after damage or stress\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e2.53\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eSNP13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e193075\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003elysophosphatidylcholine acyltransferase-like, partial\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eEncodes 1-acyl-SN-glycerol-3-phosphoacyltransferase\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e2.51\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eSNP14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e635323\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"4\"\u003e\n \u003cp\u003eHEAT repeat containing 1 homolog\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"4\"\u003e\n \u003cp\u003eenables snoRNA binding\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e3.19\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eSNP15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e635082\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e2.85\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eSNP16\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e635341\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e2.58\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eSNP17\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e635340\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e2.59\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eSNP18\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e53354\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003etetratricopeptide repeat protein 5-like isoform X2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003eInvolved in immune regulation\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e2.85\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eSNP19\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e50514\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e2.53\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eSNP20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1198973\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eDNA-binding protein D-ETS-3-like isoform X3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eParticipate in cell multiplication, differentiation, etc\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e2.57\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003cp\u003e\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec13\"\u003e\n \u003ch2\u003e\u003cstrong\u003e3.3 Genotyping of SNPs and validation of candidate SNPs and genotypes in a validation group\u003c/strong\u003e\u003c/h2\u003e\n \u003cp\u003eTo screen out SNPs and genotypes of the SNPs closely associated with the PVR trait, other batches of shrimps a total of 210 individuals were collected and graded according to the vibrios load in the hepatopancreas. 20 individuals in grade G1 and 52 individuals in grades, G4 and G5, total of 72 shrimp were grouped together to form a validation group. The genotyping of 20 SNPs in the validation group was performed using KASP and the association between the genotypes of SNPs and the performance of the PVR trait was also analyzed manually (Table S3). Only the genotypes of SNP15, SNP16 and SNP17 had preference between the low infection individuals and serious infection individuals (Table\u0026nbsp;2). Statistical analysis of the correlations between genotypes of three SNPs and vibrios load showed that only genotypes of SNP15 had significant differences in terms of vibrios load, among which genotype GG had the lowest vibrios load (\u0026lt;\u0026thinsp;10\u003csup\u003e2\u003c/sup\u003e CFU/g), significantly different from other genotypes (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05, Fig.\u0026nbsp;4). It indicated that the GG genotype of SNP15 was significantly associated with the PVR trait. Subsequently, LD analysis was performed on the 20 SNP sites. It manifested that there was a strong linkage disequilibrium (LD) among the three SNPs (SNP15, SNP16, SNP17), especially between SNP16 and SNP17 (D \u0026apos;=0.92; r\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.81, Fig.\u0026nbsp;5). Therefore, genotype combinations of the three SNP loci associated with the PVR trait were further analyzed to exploit potential robust SNP marker. The result indicated that the genotype combination of GG-TT-AA of the three SNPs all occurred in uninfected individuals (Table\u0026nbsp;3), which suggested that this genotype combination has a strong correlation with the PVR trait.\u003c/p\u003e\n \u003cdiv\u003e\n \u003cp\u003e\u003cstrong\u003eTable 2\u0026nbsp;\u003c/strong\u003eStatistic analysis SNPs associated with the PVR trait in the verification group\u003c/p\u003e\n \u003cdiv\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003eSNP\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003eGenotype\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003eNumber in\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026chi;2\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003eP\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eG4 and G5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eG1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"3\"\u003e\n \u003cp\u003eSNP15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"3\"\u003e\n \u003cp\u003e9.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"3\"\u003e\n \u003cp\u003e0.0027\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e34\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"3\"\u003e\n \u003cp\u003eSNP16\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eTT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"3\"\u003e\n \u003cp\u003e3.57\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"3\"\u003e\n \u003cp\u003e0.058\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eCT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e22\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"3\"\u003e\n \u003cp\u003eSNP17\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"3\"\u003e\n \u003cp\u003e3.97\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"3\"\u003e\n \u003cp\u003e0.046\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n \u003c/div\u003e\n \u003cp\u003e\u003cstrong\u003eTable 3\u003c/strong\u003e The vibrios load of different genotype combinations in the validation group (n=72)\u003c/p\u003e\n \u003cdiv\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eNum\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003egenotype combination\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eSample size\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eAverage vibrios load (\u0026plusmn;SE)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eAA-CC-TT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e7.31E+04 \u0026plusmn; 0.32\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eAA-CT-AT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e24\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1.40E+05 \u0026plusmn; 0.53\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eAA-TT-AA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e7.39E+04 \u0026plusmn; 0.21\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eAG-CC-TT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1.49E+05 \u0026plusmn; 0.38\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eAG-CC-AA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e3.08E+06 \u0026plusmn; 0.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eAG-CT-AT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1.13E+06 \u0026plusmn; 0.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003e7\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eAG-TT-AA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e2.72E+05 \u0026plusmn; 0.33\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eAG-TT-AT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e4.92E+06 \u0026plusmn; 0.15\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eGG-TT-AA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e0.00E+00 \u0026plusmn; 0.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eGG-TT-TT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e2.71E+06 \u0026plusmn; 0.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eGG-CT-AT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e2.53E+06 \u0026plusmn; 0.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eGG-CT-AA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e7.56E+05 \u0026plusmn; 0.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec14\"\u003e\n \u003ch2\u003e3.4 Structure prediction and tissue distribution of the gene harboring the three SNPs\u003c/h2\u003e\n \u003cp\u003eAll the three SNPs were found in the intron region of a gene, \u003cem\u003eLvCthrc1\u003c/em\u003e, coding for a collagen triple helix repeat containing-1. The prediction of 3D structure of the protein showed that it contains a lot of repeated alpha helices, accounting for about 70.64% of the gene (Fig.\u0026nbsp;6a), it may be closely related to its function. The expression level of \u003cem\u003eLvCthrc1\u003c/em\u003e was relatively higher in hemocytes, hepatopancreas and gills (Fig.\u0026nbsp;6b), and the highest expression level of \u003cem\u003eLvCthrc1\u003c/em\u003e occurred in the hemocytes, which is five times more than that of the muscles.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec15\"\u003e\n \u003ch2\u003e3.5 Variations in SNPs changed the position of predicted splice sites\u003c/h2\u003e\n \u003cp\u003eA total of 13 splicing sites were identified, including 7 splicing donor sites and 6 splicing acceptor sites (Table S4). Notably, the genotype combination of GG-TT-AA can lead to the disappearance of a donor splicing site of \u003cem\u003eLvCthrc1\u003c/em\u003e (Fig.\u0026nbsp;7), which predictably generates a novel transcript that potentially affects protein structure and function. This splicing donor site located in the middle of SNP15 and SNP16, and close to SNP16 (distance\u0026thinsp;\u0026lt;\u0026thinsp;10bp).\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":" \u003cp\u003eVibrios, as the most common aquatic bacteria, have caused serious harm and great economic loss in shrimp culture (Nguyen et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Liu et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Due to the high diversity and ubiquity of \u003cem\u003eVibrio\u003c/em\u003e species in the estuary and marine environments (Lee et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Baker-Austin et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), the genetic breeding of shrimp \u003cem\u003eL. vannamei\u003c/em\u003e resistant to extensive vibrios species has more practical significance. Likewise, it is likely that breeding materials of shrimps screened through the infection challenge by single or multiple vibrios species may not be capable of adapting to the complicated farming environments full of various vibrios (Noriega-Orozco et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). Based on this consideration, we were inclined to obtain the ideal breeding materials of shrimps from the actual farming environments instead of the infection challenge by specific vibrios species. In this study, the shrimp were continuously exposed to a diverse range of vibrios conditions throughout their growth period, it indicates that have taken up the challenge of mixed strains of vibrios. Hepatopancreas of shrimps is not only a digestive but also an immune organ of shrimp that is frequently invaded by pathogenic bacteria, viruses, and parasites. Diversified vibrios can be easily found in the farmed shrimp, \u003cem\u003eL. vannamei.\u003c/em\u003e In long practices of farming and pathological examinations, we found that vibrios load in the hepatopancreas can reflect the healthy state and resistance ability of the shrimp, and similar findings were also reported by other researchers (Niu et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Noriega-Orozco et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Robinson et al., \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). For another parasite pathogen, \u003cem\u003eEnterocytozoon hepatopenaei\u003c/em\u003e (EHP), EHP load in the hepatopancreas of \u003cem\u003eL. vannamei\u003c/em\u003e also reflects the resistance ability of the shrimp (Hakonsholm et al., 2020; Madesh et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Tian et al., \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Therefore, in this study, vibrios load in the hepatopancreas of \u003cem\u003eL. vannamei\u003c/em\u003e was adopted to quantify the performance of the PVR trait. The ratio of the uninfected shrimp individuals is not more than 10% in the test group and the validation group, which indicated that only a few individuals in a shrimp group have the strong resistance to vibrios infection, likely conferred by the genetic variations in these individuals.\u003c/p\u003e \u003cp\u003eIn this study, whole genomes of 300 shrimps containing five different vibrio-resistance levels (G1 to G5) were sequenced for GWAS. Through GWAS, 20 SNPs were first screened out, and these SNPs were annotated to the genes related to autophagy, DNA replication, and metabolic pathways. After KASP genotyping, three SNPs (SNP15, SNP16, and SNP17) were further screened out to be likely associated with the PVR trait, In addition, LD analysis is an important method to examine SNP-SNP interaction, which has been shown to play an important role in the selection of species for complex traits (Onay et al., \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2006\u003c/span\u003e; Wang et al., \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; He et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Furthermore, all the three SNPs located in the promoter region of the \u003cem\u003eLvCthrc1\u003c/em\u003e gene also supported the LD of the three SNPs, which propelled the potential genotype combination that is closely associated with the PVR trait. The application of comminated molecular markers narrows the screening range and increases the accuracy of breeding materials (Barrett et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2005\u003c/span\u003e), which also theoretically matches the rule that most economic traits are controlled by a set of loci in a genome ( Lu et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Maniatis et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). \u003cem\u003eLvCthrc1\u003c/em\u003e is one kind of HEAT repeat protein, which includes a mammalian target of rapamycin (mTOR) protein the mTOR, owning a common function of mediating protein-protein interactions (Kunz et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2000\u003c/span\u003e). mTOR plays an important role in various cellular activities such as immunity, and it is activated by the formation of polymers in mammalian cells through its N-terminal HEAT repeat region (Takahara et al., \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). In addition, a HEAT repeat protein, \u003cem\u003eILITYHIA\u003c/em\u003e (\u003cem\u003eILA\u003c/em\u003e) in \u003cem\u003eArabidopsis\u003c/em\u003e, involves in the plant immune process, and the mutation of \u003cem\u003eILA\u003c/em\u003e leads to increased sensitivity to pathogens and systemic drug resistance defects in plants (Monaghan et al, 2010). The expression distribution of \u003cem\u003eLvCthrc1\u003c/em\u003e in the shrimp showed that the mRNAs were highly expressed in immune-related tissues such as hemocytes, gill and hepatopancreas, which are also frequently attacked by vibrios. Therefore, it can be speculated that \u003cem\u003eLvCthrc1\u003c/em\u003e may play a crucial role in the immune process of \u003cem\u003eL. vannamei\u003c/em\u003e although the specific function of HEAT repeat proteins in shrimp has not been elucidated.\u003c/p\u003e \u003cp\u003eGenerally, introns can\u0026rsquo;t be transcribed into mRNAs and they are often considered as junk DNA regions (Palmer et al., 2019). However, recent studies have shown that introns are closely related to gene expression and cytoskeleton construction, and exert some influence on life activities (Jacob et al., 2017; Naro et al., 2017). InDels of introns in different cattle groups are extremely enriched in immune-related pathways (Jacob and Smith, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Changes in body weight due to the SNPs in intron of \u003cem\u003eRuvBL2\u003c/em\u003e gene have also been found in shrimps (Zhang et al., 2019). SNPs in intron can also lead to the occurrence of different spliceosomes sourced from the same gene (Jo et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Jacob et al., 2017; Eiholzer et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). In this study, the SNP loci result in alterations to the splicing donor site. The splicing donor site is not present in the resistance-associated GG-TT-AA genotype combination. The loss of this splicing site may potentially generate a novel transcript that affects the protein structure and function. Based on the link between the genotype combination and the alternation of the splicing site, we speculated that the potential novel transcript may confer the shrimp strong resistance to vibrios infection. However, the specific splicing and sequence information of the novel transcript remain unidentified. The existence of novel transcript and its function need to be verified in future.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn this study, the correlation between SNPs and the PVR trait of \u003cem\u003eL. vannamei\u003c/em\u003e was analyzed. Twenty SNPs that potentially associated with the PVR trait were first obtained by using GWAS. The genotypes of three SNPs (SNP15, SNP16, and SNP17) were different between G1 and G4/G5 groups, which were found in located in the intron region of a gene, \u003cem\u003eLvCthrc1\u003c/em\u003e. The genotype combination of GG-TT-AA of the three SNPs was significantly associated with the strongest performance of the trait, which can also lead to the disappearance of a donor splicing site of \u003cem\u003eLvCthrc1\u003c/em\u003e and predictably generates a novel transcript. The highest expression level of \u003cem\u003eLvCthrc1\u003c/em\u003e was observed in immune-related tissues such as hemocytes, gills, and hepatopancreas. This study provides valuable molecular markers for the genetic selection on the PVR trait of shrimp \u003cem\u003eL. vannamei\u003c/em\u003e.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData Availability Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data presented in this study are available on request from the corresponding author.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was supported by the Guangxi Natural Science Foundation project (2023GXNSFBA026356), the National Key Research and Development Program of China (2023YFD2401701), the Seed Industry Revitalization Project of Provincial Rural Revitalization Strategy Special Funds (2022-SPY-00-001), the Research on breeding technology of candidate species for Guangdong modern marine ranching (2024-MRB-00-001), and the Innovation Team Project of Guangdong Universities (2022KCXTD017).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors contributed to the study conception and approved the final manuscript. Shuyang Wen: Conceptualization, Data curation, Formal analysis, Validation, Writing - original draft; Chuhang Cheng: Funding acquisition; Methodology, Software; Jiayue Yin: Visualization, Writing - review \u0026amp; editing; Ying Lv: Project administration, Supervision; Xin Zhang: Project administration, Visualization; Bo Ma: Methodology; Yang Liu: Visualization; Yueshan Qiu: Visualization; Huteng He: Investigation; Peng Luo: Investigation, Writing - review \u0026amp; editing, Resources, Supervision; Lihong Yuan: Project administration, Funding acquisition, Writing - review \u0026amp; editing.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of Competing Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no known financial interests or personal relationships that could have influenced the work reported in this paper.\u003c/p\u003e\n"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAulchenko, Y.S., Ripke, S., Isaacs, A., van Duijn, C.M., 2007. GenABEL: An R library for genome-wide association analysis. \u003cem\u003eBioinformatics\u003c/em\u003e, \u003cem\u003e23\u003c/em\u003e(10), 1294\u0026ndash;1296. https://doi.org/10.1093/bioinformatics/btm108\u003c/li\u003e\n\u003cli\u003eBaker-Austin, C., Olive, J.D., Alam, M., Ali, A., 2018.\u003cem\u003e Vibrio \u003c/em\u003espp. Infections. \u003cem\u003eNature Reviews Disease Primers\u003c/em\u003e, \u003cem\u003e4\u003c/em\u003e, 1\u0026ndash;19. https://doi.org/10.1038/s41572-018-0005-8\u003c/li\u003e\n\u003cli\u003eBarrett, J.C., Fry, B., Maller, J., Daly, M.J., 2005. Haploview: Analysis and visualization of LD and haplotype maps. \u003cem\u003eBioinformatics\u003c/em\u003e, \u003cem\u003e21\u003c/em\u003e(2), 263\u0026ndash;265. https://doi.org/10.1093/bioinformatics/bth457\u003c/li\u003e\n\u003cli\u003eChang, C.C., Tan, H.C., Cheng, W., 2013. Effects of dietary administration of water hyacinth (\u003cem\u003eEichhornia crassipes\u003c/em\u003e) extracts on the immune responses and disease resistance of giant freshwater prawn, \u003cem\u003eMacrobrachium rosenbergii\u003c/em\u003e. \u003cem\u003eFish \u0026amp; Shellfish Immunology\u003c/em\u003e, \u003cem\u003e35\u003c/em\u003e(1), 92\u0026ndash;100. https://doi.org/10.1016/j.fsi.2013.04.008\u003c/li\u003e\n\u003cli\u003eChang, Y.T., Ko, H.T., Wu, P.L., Kumar, R., Wang, H.C., Lu HP (2023) Gut microbiota of Pacific white shrimp (\u003cem\u003eLitopenaeus vannamei\u003c/em\u003e) exhibits distinct responses to pathogenic and non-pathogenic \u003cem\u003eVibrio parahaemolyticus\u003c/em\u003e. \u003cem\u003eMicrobiology Spectrum\u003c/em\u003e. https://doi.org/10.1128/spectrum.01180-23\u003c/li\u003e\n\u003cli\u003eChen, Y.Y., Sim, S.S., Chiew, S.L., Yeh, S.T., Liou, C.H., Chen, J.C. 2012. Dietary administration of a \u003cem\u003eGracilaria tenuistipitata\u003c/em\u003e extract produces protective immunity of white shrimp \u003cem\u003eLitopenaeus vannamei\u003c/em\u003e in response to ammonia stress. \u003cem\u003eAquaculture\u003c/em\u003e, \u003cem\u003e370\u0026ndash;371\u003c/em\u003e, 26\u0026ndash;31. https://doi.org/10.1016/j.aquaculture.2012.09.031\u003c/li\u003e\n\u003cli\u003eEiholzer, R.A., Mehta, S., Kazantseva, M., Drummond, C.J., McKinney, C., Young, K., Slater, D., Morten, B.C., Avery-Kiejda, K.A., Lasham, A., Fleming, N., Morrin, H.R., Reader, K., Royds, J.A., Landmann, M., Petrich, S., Reddel, R., Huschtscha, L., Taha, A., Braithwaite, A.W., 2020. Intronic \u003cem\u003eTP53\u003c/em\u003e polymorphisms are associated with increased\u003cem\u003e \u0026Delta;133TP53\u003c/em\u003e transcript, immune infiltration and cancer risk. \u003cem\u003eCancers\u003c/em\u003e, \u003cem\u003e12\u003c/em\u003e(9), Article 9. https://doi.org/10.3390/cancers12092472\u003c/li\u003e\n\u003cli\u003eFu, S., Liu, J. 2022. Genome-wide association study identified genes associated with ammonia nitrogen tolerance in \u003cem\u003eLitopenaeus vannamei\u003c/em\u003e. \u003cem\u003eFrontiers in Genetics\u003c/em\u003e, \u003cem\u003e13\u003c/em\u003e. https://doi.org/10.3389/fgene.2022.961009\u003c/li\u003e\n\u003cli\u003eGarlock, T.M., Asche, F., Anderson, J.L., Eggert, H., Anderson, T.M., Che, B., Ch\u0026aacute;vez, C.A., Chu, J., Chukwuone, N., Dey, M.M., Fitzsimmons, K., Flores, J., Guillen, J., Kumar, G., Liu, L., Llorente, I., Nguyen, L., Nielsen, R., Pincinato, R.B.M., Tveteras, R., 2024. Environmental, economic, and social sustainability in aquaculture: The aquaculture performance indicators. \u003cem\u003eNature Communications\u003c/em\u003e, \u003cem\u003e15\u003c/em\u003e(1), 5274. https://doi.org/10.1038/s41467-024-49556-8\u003c/li\u003e\n\u003cli\u003eGaudet, M., Fara, A.G., Beritognolo, I., Sabatti, M., 2009. Allele-Specific PCR in SNP Genotyping. In A. A. Komar (Ed.), \u003cem\u003eSingle Nucleotide Polymorphisms: Methods and Protocols\u003c/em\u003e Totowa, NJ, pp: 415\u0026ndash;424. \u003c/li\u003e\n\u003cli\u003eGuo, L., Xu, Y.H., Zhang, N., Zhou, F.L., Huang, J.H., Liu, B.S., Jiang, S.G., Zhang, D.C., 2019. A High-Density Genetic linkage map and QTL mapping for sex in black tiger shrimp (\u003cem\u003ePenaeus monodon\u003c/em\u003e) \u003cem\u003eFrontiers in Genetics\u003c/em\u003e, 10, 326. https://doi.org/10.3389/fgene.2019.00326\u003c/li\u003e\n\u003cli\u003eH\u0026aring;konsholm, F., Lunestad, B.T., Aguirre, S\u0026aacute;nchez, J.R., Martinez-Urtaza, J., Marathe, N.P., Svanevik, C.S., 2020 Vibrios from the Norwegian marine environment: Characterization of associated antibiotic resistance and virulence genes. \u003cem\u003eMicrobiologyOpen\u003c/em\u003e, \u003cem\u003e9\u003c/em\u003e(9), e1093. https://doi.org/10.1002/mbo3.1093\u003c/li\u003e\n\u003cli\u003eHe, T., Zhong, P.S., Cui, Y., 2014. A set-based association test identifies sex-specific gene sets associated with type 2 diabetes. \u003cem\u003eFrontiers in Genetics\u003c/em\u003e, \u003cem\u003e5\u003c/em\u003e. https://doi.org/10.3389/fgene.2014.00395\u003c/li\u003e\n\u003cli\u003eJacob, A.G., Smith, C.W.J., 2017. Intron retention as a component of regulated gene expression programs. \u003cem\u003eHuman Genetics\u003c/em\u003e, \u003cem\u003e136\u003c/em\u003e(9), 1043\u0026ndash;1057. https://doi.org/10.1007/s00439-017-1791-x\u003c/li\u003e\n\u003cli\u003eJo, B.S., and Choi, S.S., 2015 Introns: The functional benefits of introns in genomes. \u003cem\u003eGenomics \u0026amp; Informatics\u003c/em\u003e, \u003cem\u003e13\u003c/em\u003e(4), 112\u0026ndash;118. https://doi.org/10.5808/GI.2015.13.4.112\u003c/li\u003e\n\u003cli\u003eKang, H.M., Sul, J.H., Service, S.K., Zaitlen, N.A., Kong, S., Freimer, N.B., Sabatti, C., Eskin, E., 2010. Variance component model to account for sample structure in genome-wide association studies. \u003cem\u003eNature Genetics\u003c/em\u003e, \u003cem\u003e42\u003c/em\u003e(4), 348\u0026ndash;354. https://doi.org/10.1038/ng.548\u003c/li\u003e\n\u003cli\u003eKongchum, P., Chimtong, S., Prapaiwong, N., 2022. Association between single nucleotide polymorphisms of \u003cem\u003enLvALF1\u003c/em\u003e and \u003cem\u003ePEN2-1\u003c/em\u003e genes and resistance to \u003cem\u003eVibrio parahaemolyticus\u003c/em\u003e in the Pacific white shrimp \u003cem\u003eLitopenaeus\u003c/em\u003e \u003cem\u003evannamei\u003c/em\u003e. \u003cem\u003eAquaculture and Fisheries\u003c/em\u003e, \u003cem\u003e7\u003c/em\u003e(4), 373\u0026ndash;381. https://doi.org/10.1016/j.aaf.2021.08.003\u003c/li\u003e\n\u003cli\u003eKunz, J., Schneider, U., Howald, I., Schmidt, A., Hall, M.N., 2000. HEAT repeats mediate plasma membrane localization of tor2p in yeast. \u003cem\u003eJournal of Biological Chemistry\u003c/em\u003e, \u003cem\u003e275\u003c/em\u003e(47), 37011\u0026ndash;37020. https://doi.org/10.1074/jbc.M007296200\u003c/li\u003e\n\u003cli\u003eLee, C.T., Chen, I.T., Yang, Y. T., Ko, T.P., Huang, Y.T., Huang, J.Y., Huang, M.F., Lin, S.J., Chen, C.Y., Lin, S.S., Lightner, D.V., Wang, H.C., Wang, A.H.J., Wang, H.C., Hor, L.I., and Lo, C.F., 2015. The opportunistic marine pathogen \u003cem\u003eVibrio\u003c/em\u003e \u003cem\u003eparahaemolyticus\u003c/em\u003e becomes virulent by acquiring a plasmid that expresses a deadly toxin. \u003cem\u003eProceedings of the National Academy of Sciences\u003c/em\u003e, \u003cem\u003e112\u003c/em\u003e(34), 10798\u0026ndash;10803. https://doi.org/10.1073/pnas.1503129112\u003c/li\u003e\n\u003cli\u003eLi, H., Durbin, R., 2010. Fast and accurate long-read alignment with Burrows\u0026ndash;Wheeler transform. \u003cem\u003eBioinformatics\u003c/em\u003e, \u003cem\u003e26\u003c/em\u003e(5), 589\u0026ndash;595. https://doi.org/10.1093/bioinformatics/btp698\u003c/li\u003e\n\u003cli\u003eLi, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., Marth, G., Abecasis, G., Durbin, R. .2009. The Sequence Alignment/Map format and SAMtools. \u003cem\u003eBioinformatics\u003c/em\u003e, \u003cem\u003e25\u003c/em\u003e(16), 2078\u0026ndash;2079. https://doi.org/10.1093/bioinformatics/btp352\u003c/li\u003e\n\u003cli\u003eLi, P., Guo, M., Wang, C., Liu, X., Zou, Q., 2015. An overview of SNP interactions in genome-wide association studies. \u003cem\u003eBriefings in Functional Genomics\u003c/em\u003e, \u003cem\u003e14\u003c/em\u003e(2), 143\u0026ndash;155. https://doi.org/10.1093/bfgp/elu036\u003c/li\u003e\n\u003cli\u003eLiu, J., Wu, Q., Xu, H., Zhang, Z., 2024. Change of antibiotic resistance in \u003cem\u003eVibrio\u003c/em\u003e spp. During shrimp culture in Shanghai. \u003cem\u003eAquaculture\u003c/em\u003e, \u003cem\u003e580\u003c/em\u003e, e740303. https://doi.org/10.1016/j.aquaculture.2023.740303\u003c/li\u003e\n\u003cli\u003eLivak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using Real-Time Quantitative PCR and the 2\u003csup\u003e\u0026minus;\u003c/sup\u003e\u003csup\u003e\u0026Delta;\u0026Delta;\u003c/sup\u003e\u003csup\u003eCT\u003c/sup\u003e method. \u003cem\u003eMethods\u003c/em\u003e, \u003cem\u003e25\u003c/em\u003e(4), 402\u0026ndash;408. https://doi.org/10.1006/meth.2001.1262\u003c/li\u003e\n\u003cli\u003eLu, J., Zhang, X., Wang, C., Li, M., Chen, J., Xiong, J., 2021 Responses of sediment resistome, virulence factors and potential pathogens to decades of antibiotics pollution in a shrimp aquafarm. \u003cem\u003eThe Science of the Total Environment\u003c/em\u003e, \u003cem\u003e794\u003c/em\u003e, 148760. https://doi.org/10.1016/j.scitotenv.2021.148760\u003c/li\u003e\n\u003cli\u003eLu, Y., Shah, T., Hao, Z., Taba, S., Zhang, S., Gao, S., Liu, J., Cao, M., Wang, J., Prakash, A.B., Rong, T., Xu, Y., 2011. Comparative SNP and haplotype analysis reveals a higher genetic diversity and rapider ld decay in tropical than temperate germplasm in maize. \u003cem\u003ePLOS ONE\u003c/em\u003e, \u003cem\u003e6\u003c/em\u003e(9), e24861. https://doi.org/10.1371/journal.pone.0024861\u003c/li\u003e\n\u003cli\u003eLuo, S.S., Chen, X.L., Wang, A.J., Liu, Q.Y., Peng, M., Yang, C.L., Zeng, D.G., Zhao, Y.Z., Wang, H.L., 2024. Identification, functional analysis of chitin-binding proteins and the association of its single nucleotide polymorphisms with \u003cem\u003eVibrio parahaemolyticus\u003c/em\u003e resistance in \u003cem\u003ePenaeus vannamei\u003c/em\u003e. \u003cem\u003eFish \u0026amp; Shellfish Immunology\u003c/em\u003e, \u003cem\u003e154\u003c/em\u003e, 109966. https://doi.org/10.1016/j.fsi.2024.109966\u003c/li\u003e\n\u003cli\u003eLuo SS, Chen XL, Wang AJ, Liu QY, Peng M, Yang C, Zeng DG, Zhao YZ, Wang HL (2024) Identification, functional analysis of chitin-binding proteins and the association of its single nucleotide polymorphisms with \u003cem\u003eVibrio parahaemolyticus\u003c/em\u003e resistance in \u003cem\u003ePenaeus vannamei\u003c/em\u003e. \u003cem\u003eFish \u0026amp; Shellfish Immunology\u003c/em\u003e, \u003cem\u003e154\u003c/em\u003e, 109966. https://doi.org/10.1016/j.fsi.2024.109966\u003c/li\u003e\n\u003cli\u003eMadesh S, Sudhakaran G, Sreekutty A R, Kesavan D, Almutairi BO, Arokiyaraj S, Dhanaraj M, Seetharaman S, Arockiaraj J (2024) Exploring neem aqueous extracts as an eco-friendly strategy to enhance shrimp health and combat EHP in aquaculture. \u003cem\u003eAquaculture International\u003c/em\u003e, \u003cem\u003e32\u003c/em\u003e(3), 3357\u0026ndash;3377. https://doi.org/10.1007/s10499-023-01326-x\u003c/li\u003e\n\u003cli\u003eManiatis N, Collins A, Morton NE (2007) Effects of single SNPs, haplotypes, and whole‐genome LD maps on accuracy of association mapping. \u003cem\u003eGenetic Epidemiology\u003c/em\u003e, 31(15), 179-188. https://doi.org/10.1002/gepi.20199\u003c/li\u003e\n\u003cli\u003eMaralit BA, Jaree P, Boonchuen P, Tassanakajon A, Somboonwiwat K (2018) Differentially expressed genes in hemocytes of \u003cem\u003eLitopenaeus vannamei\u003c/em\u003e challenged with \u003cem\u003eVibrio parahaemolyticus\u003c/em\u003e AHPND (VPAHPND) and VPAHPND toxin. \u003cem\u003eFish \u0026amp; Shellfish Immunology\u003c/em\u003e, \u003cem\u003e81\u003c/em\u003e, 284\u0026ndash;296. https://doi.org/10.1016/j.fsi.2018.06.054\u003c/li\u003e\n\u003cli\u003eMcKenna A, Hanna M, Banks E, Sivachenko A, Cibulskis K, Kernytsky A, Garimella K, Altshuler D, Gabriel S, Daly M, DePristo MA (2010) The Genome Analysis Toolkit: A MapReduce framework for analyzing next-generation DNA sequencing data. \u003cem\u003eGenome Research\u003c/em\u003e, \u003cem\u003e20\u003c/em\u003e(9), 1297\u0026ndash;1303. https://doi.org/10.1101/gr.107524.110\u003c/li\u003e\n\u003cli\u003eMonaghan J, Li X (2010) The HEAT Repeat Protein \u003cem\u003eILITYHIA\u003c/em\u003e is required for plant immunity. \u003cem\u003ePlant and Cell Physiology\u003c/em\u003e, \u003cem\u003e51\u003c/em\u003e(5), 742\u0026ndash;753. https://doi.org/10.1093/pcp/pcq038\u003c/li\u003e\n\u003cli\u003eNaro C, Sette C (2017) Timely-regulated intron retention as device to fine-tune protein expression. \u003cem\u003eCell Cycle\u003c/em\u003e, \u003cem\u003e16\u003c/em\u003e(14), 1321\u0026ndash;1322. https://doi.org/10.1080/15384101.2017.1337983\u003c/li\u003e\n\u003cli\u003eNguyen TV, Alfaro A, Arroyo BB, Leon JAR, Sonnenholzner S (2021) Metabolic responses of penaeid shrimp to acute hepatopancreatic necrosis disease caused by \u003cem\u003eVibrio parahaemolyticus\u003c/em\u003e. \u003cem\u003eAquaculture\u003c/em\u003e, \u003cem\u003e533\u003c/em\u003e, 736174. https://doi.org/10.1016/j.aquaculture.2020.736174\u003c/li\u003e\n\u003cli\u003eNiu B, Hong B, Zhang Z, Mu L, Malakar PK, Liu H, Pan Y, Zhao Y (2018) A novel qPCR method for simultaneous detection and quantification of Viable Pathogenic and Non-pathogenic \u003cem\u003eVibrio parahaemolyticus \u003c/em\u003e(tlh+, tdh+, and ureR+) \u003cem\u003eFrontiers in Microbiology\u003c/em\u003e, \u003cem\u003e9\u003c/em\u003e. https://doi.org/10.3389/fmicb.2018.01747\u003c/li\u003e\n\u003cli\u003eNoriega-Orozco L, Acedo-F\u0026eacute;lix E, Higuera-Ciapara I, Jim\u0026eacute;nez-Flores R, Cano R (2007) Pathogenic and non-pathogenic \u003cem\u003eVibrio\u003c/em\u003e species in aquaculture shrimp ponds. \u003cem\u003eRevista Latinoamericana de Microbiolog\u0026iacute;a\u003c/em\u003e, \u003cem\u003e49\u003c/em\u003e(3\u0026ndash;4), 60\u0026ndash;67. https://www.medigraphic.com/cgi-bin/new/resumen.cgi?IDARTICULO=16748\u003c/li\u003e\n\u003cli\u003eOnay V\u0026Uuml;, Briollais L, Knight JA, Shi E, Wang Y, Wells S, Li H, Rajendram I, Andrulis IL, Ozcelik H (2006) SNP-SNP interactions in breast cancer susceptibility. \u003cem\u003eBMC Cancer\u003c/em\u003e, \u003cem\u003e6\u003c/em\u003e(1), 114. https://doi.org/10.1186/1471-2407-6-114\u003c/li\u003e\n\u003cli\u003ePalmer J, Poon AFY (2019) Phylogenetic measures of indel rate variation among the HIV-1 group M subtypes. \u003cem\u003eVirus Evolution\u003c/em\u003e, \u003cem\u003e5\u003c/em\u003e(2), vez022. https://doi.org/10.1093/ve/vez022\u003c/li\u003e\n\u003cli\u003eParia, S. S., Rahman, S. R., \u0026amp; Adhikari, K. (2022) fastman:\u003cem\u003e \u003c/em\u003eA fast algorithm for visualizing GWAS results using Manhattan and Q-Q plots. BioRxiv preprint. https://doi.org/10.1101/2022.04.19.488738\u003c/li\u003e\n\u003cli\u003eRobinson NA, Gopikrishna G, Baranski M, Katneni VK, Shekhar MS, Shanmugakarthik J, Jothivel S, Gopal C, Ravichandran P, Gitterle T, Ponniah AG (2014) QTL for white spot syndrome virus resistance and the sex-determining locus in the Indian black tiger shrimp (\u003cem\u003ePenaeus monodon\u003c/em\u003e) \u003cem\u003eBMC Genomics\u003c/em\u003e, \u003cem\u003e15\u003c/em\u003e(1), 731. https://doi.org/10.1186/1471-2164-15-731\u003c/li\u003e\n\u003cli\u003eStalin N, Srinivasan P (2016) Molecular characterization of antibiotic resistant \u003cem\u003eVibrio harveyi\u003c/em\u003e isolated from shrimp aquaculture environment in the south east coast of India. \u003cem\u003eMicrobial Pathogenesis\u003c/em\u003e, \u003cem\u003e97\u003c/em\u003e, 110\u0026ndash;118. https://doi.org/10.1016/j.micpath.2016.05.021\u003c/li\u003e\n\u003cli\u003eTakahara T, Hara K, Yonezawa K, Sorimachi H, Maeda T (2006) Nutrient-dependent multimerization of the mammalian target of rapamycin through the N-terminal HEAT Repeat Region. \u003cem\u003eJournal of Biological Chemistry\u003c/em\u003e, \u003cem\u003e281\u003c/em\u003e(39), 28605\u0026ndash;28614. https://doi.org/10.1074/jbc.M606087200\u003c/li\u003e\n\u003cli\u003eTian X, Xu W, Du Y, Chen J (2024) Transcriptomic analysis provides insights into the mechanisms underlying the resistance of \u003cem\u003ePenaeus vannamei\u003c/em\u003e to \u003cem\u003eEnterocytozoon hepatopenaei\u003c/em\u003e (EHP) \u003cem\u003eFish \u0026amp; Shellfish Immunology\u003c/em\u003e, \u003cem\u003e154\u003c/em\u003e, 109902. https://doi.org/10.1016/j.fsi.2024.109902\u003c/li\u003e\n\u003cli\u003eValente C, De S, Wan AHL (2021) \u003cem\u003eVibrio\u003c/em\u003e and major commercially important vibriosis diseases in decapod crustaceans. \u003cem\u003eJournal of Invertebrate Pathology\u003c/em\u003e, \u003cem\u003e181\u003c/em\u003e, 107527. https://doi.org/10.1016/j.jip.2020.107527\u003c/li\u003e\n\u003cli\u003eVisscher PM, Brown MA, McCarthy MI, Yang J (2012) Five years of GWAS discovery. \u003cem\u003eThe American Journal of Human Genetics\u003c/em\u003e, \u003cem\u003e90\u003c/em\u003e(1), 7\u0026ndash;24. https://doi.org/10.1016/j.ajhg.2011.11.029\u003c/li\u003e\n\u003cli\u003eWang M, Wang Q, Pan Y (2013) From QTL to QTN: candidate gene set approach and a case study in porcine \u003cem\u003eIGF1-FoxO\u003c/em\u003e pathway. \u003cem\u003ePLOS ONE\u003c/em\u003e, \u003cem\u003e8\u003c/em\u003e(1), e53452. https://doi.org/10.1371/journal.pone.0053452\u003c/li\u003e\n\u003cli\u003eWhankaew S, Suksri P, Sinprasertporn A, Thawonsuwan J, \u0026amp; Sathapondecha P. (2024) Development of DNA markers for acute hepatopancreatic necrosis disease tolerance in\u003cem\u003e Litopenaeus vannamei \u003c/em\u003ethrough a Genome-Wide Association Study. \u003cem\u003eBiology\u003c/em\u003e, \u003cem\u003e13\u003c/em\u003e(9), Article 9. https://doi.org/10.3390/biology13090731\u003c/li\u003e\n\u003cli\u003eXiao S, Wang P, Dong L, Zhang Y, Han Z, Wang Q, Wang Z (2016) Whole-genome single-nucleotide polymorphism (SNP) marker discovery and association analysis with the eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) content in \u003cem\u003eLarimichthys crocea\u003c/em\u003e. \u003cem\u003ePeerJ\u003c/em\u003e, \u003cem\u003e4\u003c/em\u003e, e2664. https://doi.org/10.7717/peerj.2664\u003c/li\u003e\n\u003cli\u003eYao D, Su H, Zhu J, Zhao X, Aweya JJ, Wang F, Zhong M, Zhang Y (2018) SNPs in the Toll1 receptor of \u003cem\u003eLitopenaeus vannamei\u003c/em\u003e are associated with immune response. \u003cem\u003eFish \u0026amp; Shellfish Immunology\u003c/em\u003e, \u003cem\u003e72\u003c/em\u003e, 410\u0026ndash;417. https://doi.org/10.1016/j.fsi.2017.11.018\u003c/li\u003e\n\u003cli\u003eZhan F, Qu K, Chen N, Hanif Q, Jia Y, Huang Y, Dang R, Zhang J, Lan X, Chen H, Huang B, Lei C (2019) Genome-Wide SNPs and InDels Characteristics of three Chinese cattle breeds. \u003cem\u003eAnimals\u003c/em\u003e, \u003cem\u003e9\u003c/em\u003e(9), Article 9. https://doi.org/10.3390/ani9090596\u003c/li\u003e\n\u003cli\u003eZhang Y, Xu C, Li Q (2024) Whole-genome resequencing identifies candidate genes and SNPs in genomic regions associated with shell color selection in the Pacific oyster, \u003cem\u003eCrassostrea gigas\u003c/em\u003e. \u003cem\u003eAquaculture\u003c/em\u003e, \u003cem\u003e586\u003c/em\u003e, 740768. https://doi.org/10.1016/j.aquaculture.2024.740768\u003c/li\u003e\n\u003cli\u003eZou L, Liu B (2015) Identification of a Serum amyloid A gene and the association of SNPs with \u003cem\u003eVibrio\u003c/em\u003e-resistance and growth traits in the clam \u003cem\u003eMeretrix meretrix\u003c/em\u003e. \u003cem\u003eFish \u0026amp; Shellfish Immunology\u003c/em\u003e, \u003cem\u003e43\u003c/em\u003e(2), 301\u0026ndash;309. https://doi.org/10.1016/j.fsi.2015.01.007\u003c/li\u003e\n\u003cli\u003eZoubarev A, Hamer KM, Keshav KD, McCarthy EL, Santos JR, Van Rossum T, McDonald C, Hall A, Wan X, Lim R, Gillis J, Pavlidis P (2012) Gemma: A resource for the reuse, sharing and meta-analysis of expression profiling data. \u003cem\u003eBioinformatics\u003c/em\u003e, \u003cem\u003e28\u003c/em\u003e(17), 2272\u0026ndash;2273. https://doi.org/10.1093/bioinformatics/bts430\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"GWAS, Litopenaeus vannamei, pan-vibrio resistance, SNPs, LvCthrc1 gene","lastPublishedDoi":"10.21203/rs.3.rs-6178636/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6178636/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eVibriosis caused by various \u003cem\u003eVibrio\u003c/em\u003e species is the most serious bacterial disease of shrimp. Due to the prevalence of pathogenic vibrios, genetic breeding of shrimps with the pan-vibrios resistance (PVR) trait has more practical significance for successful shrimp farming. To explore the genetic loci associated with the PVR trait of \u003cem\u003eLitopenaeus vannamei\u003c/em\u003e, a genome-wide association study (GWAS) aiming at the PVR trait of the shrimp was conducted by using 300 shrimp individuals from various sources. After stringent screening, 243 single nucleotide polymorphisms (SNPs) corresponding to a selection threshold of -log10(p) value\u0026thinsp;\u0026ge;\u0026thinsp;2.5 were evaluated for their association with the PVR trait. Twenty candidate SNPs in genes and upstream region of genes (\u0026le;\u0026thinsp;5000 bp) were screened out for further validation of the association. The genotypes of three SNPs (SNP15, SNP16, and SNP17) were different between G1 (uninfected) and G4/G5 groups (seriously infected), among which GG genotype of SNP15 was significantly associated with low vibrios load. The genotype combination of GG-TT-AA at the three SNPs was linked, and it was significantly associated with the strongest performance of the trait. Notably, three SNPs were found located in the intron region of a gene, \u003cem\u003eLvCthrc1\u003c/em\u003e. The genotype combination can lead to the disappearance of a donor splicing site of \u003cem\u003eLvCthrc1\u003c/em\u003e, which predictably generates a novel transcript affecting the gene function. The highest expression level of \u003cem\u003eLvCthrc1\u003c/em\u003e was observed in immune-related tissues such as hemocytes, gills, and hepatopancreas. This study first put forward the concept of the PVR trait and provides valuable molecular markers for the genetic selection on the trait of shrimp, \u003cem\u003eL. vannamei\u003c/em\u003e.\u003c/p\u003e","manuscriptTitle":"Identification of genes associated with pan-vibrios resistance (PVR) trait of shrimp Litopenaeus vannamei through Genome-wide association study","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-03-13 12:36:59","doi":"10.21203/rs.3.rs-6178636/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"865b86db-870e-4f99-984c-087031a12045","owner":[],"postedDate":"March 13th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-03-26T13:08:38+00:00","versionOfRecord":[],"versionCreatedAt":"2025-03-13 12:36:59","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6178636","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6178636","identity":"rs-6178636","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-23T02:00:01.238055+00:00
License: CC-BY-4.0