Mycobacterium tuberculosis antigen containing-exosomes reinforce BCG vaccine efficacy by augmenting long term protection and memory response against experimental tuberculosis in BALB-C mice.

Mycobacterium tuberculosis antigen containing-exosomes reinforce BCG vaccine efficacy by augmenting long term protection and memory response against experimental tuberculosis in BALB-C mice. | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Mycobacterium tuberculosis antigen containing-exosomes reinforce BCG vaccine efficacy by augmenting long term protection and memory response against experimental tuberculosis in BALB-C mice. Manu Sharma, Sher Afghan, Amit Singh, Iqbal Alam, Meetu Agarwal, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7579467/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Tuberculosis (TB), caused by Mycobacterium tuberculosis (M.tb.) , inflicts one third of the humanity. Despite the availability of effective drug regimens, complete eradication of M.tb. remains challenging due to prolong treatment duration. Additionally, MDR-TB and co-infection HIV further exacerbate disease severity. The Bacille Calmette–Guérin (BCG) has shown inconsistent efficacy due to absence of Th-1-antigens. Hence, there is a critical need for either a novel vaccine candidate or an efficient booster to enhance BCG’s prophylactic efficacy. In this study, in-house prepared M.tb. -infected alveolar macrophage-derived exosomes (Rv-Exo) and ESAT-6-containing exosomes (ESAT-6 Exo) were characterized based on size, purity, and pathogen-associated molecular patterns (PAMPs) and their epitope mapping was also performed. These M.tb. protein-containing exosomes (MPE) were utilized for immunization, either alone or as a booster to BCG, and evaluated in BALB/c mice against experimental M.tb. challenge. Our results demonstrate the ESAT-6 Exo and Rv-Exo, either alone or as a BCG booster, enhanced Th1-biased immune responses by activating CD4⁺ and CD8⁺ T cells, increasing memory T-cell populations, and significantly reducing the M.tb. burden in the lungs, spleen, and lymph nodes of infected mice. There finding highlights the potential of MPE as a promising strategy against TB specially in BCG vaccinated population. Exosomes Tuberculosis BCG Prophylactic Vaccine M.tb. T cell memory response long term protection Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 INTRODUCTION Mycobacterium tuberculosis ( M. tb ) is an intracellular bacterium causes tuberculosis (TB), a major public health concern with socioeconomic impact, affecting one-third of the global population . It spreads via inhaled droplets from infected individuals. While 90% remain asymptomatic (latent TB), 10% develop active disease i . In 2021, TB affected 10.6 million people, with higher prevalence in immunocompromised individuals, particularly HIV patients. HIV depletes CD4 + T cells, weakening immune defenses against TB and increasing reactivation risk WHO reported 6.7% TB-HIV co-infection in 2021 while 8% of TB patients were found to be HIV-positive ii . Over the last two decades, there has been a 2% annual drop in tuberculosis cases, which sadly climbed by 3.6% in 2020–2021. In 2021, both incidences and fatalities from tuberculosis rose, with 1.6 million deaths from tuberculosis alone and 0.187 million TB co-infected with HIV ii . Tuberculosis manifests as pulmonary (PTB, 75% of cases) or extra pulmonary (EPTB, 25%) . Diagnosis relies on tests like sputum culture, Mantoux test, IGRA assay, CB-NAAT test, and others . Current diagnostic tests for tuberculosis (TB) have significant limitations despite their ability to detect infection. For instance, skin tests yield false positives in BCG-vaccinated individuals, while blood tests require specialized facilities . Sputum microscopy has low sensitivity, and cultures take weeks . Additionally, Treatment is prolonged (6–9 months) with adherence challenges and side effects . Drug-resistant TB demands more toxic regimens, and latent TB requires months of preventive therapy . Despite diagnostic and treatment advancements, TB remains a challenge, necessitating an effective vaccine. Vaccines offer hope for controlling this devastating pathogen and the Bacillus Calmette-Guérin (BCG) vaccine, derived from Mycobacterium bovis , is currently the only licensed vaccine for human use against tuberculosis . However, the BCG lacks virulence factors containing T cell epitopes, due to which the efficacy of BCG in preventing adult pulmonary tuberculosis remains debatable. The elimination of the RD-1 locus (9.5 kb DNA) carries Rv3871-3879C genes encoding 14 open reading frames (ORFs), responsible for expressions of M. tb , proteins including the 10-kDa culture filtrate protein (CFP-10) and the 6-kDa early secreted antigenic target (ESAT-6)—both secreted by the Esx-I secretion system and recognized as critical virulence factors—results in a reduction of virulence in BCG . This also highlights the urgent need for novel vaccine candidates against tuberculosis or boosters enhancing the BCG's efficacy by complementing T cell epitopes. In 2022, World health organization (WHO) published a report about 16 vaccine candidates, among them six were in phase III trials: M72/AS01E, a sub-unit vaccine, and VPM002, a recombinant BCG vaccine (German firm MTB) . Other vaccine candidates are in early clinical trials included live-attenuated, protein subunit vaccines and viral vector-based vaccinations . Conventional protein-based or killed microbes vaccines typically induce antibody responses but offer limited T helper (Th) cell activation . Antibodies alone are ineffective against intracellular pathogens like M. tb , which requires pathogen-specific CD8 + cytotoxic and CD4 + helper T cells for elimination . Interestingly, M.tb. evades T cell attack by down regulating MHC class II on macrophages, impairing antigen presentation . Antigen dose and exposure duration influence T cell memory differentiation—Effector memory (TEM ) cells combat primary infection but fade quickly, while Central memory (TCM) cells enable rapid response upon reinfection. Thus, establishing durable T-cell immune memory is critical vaccine success. The pathogen specific CD4 + T cells secretes Th-1 (IFN-ꝩ, IL-12, TNF-α), Th-2 (IL-10, IL-4) and Treg (IL-10) cytokines to regulate immune responses. The M.tb. infection tend to reduce Th-1 cytokines, in contrary, the vaccine must provoke Th-1 biased immune response. These responses are controlled by Tbet (Th-1) and GATA (Th-2) signaling. The higher level of ROS and RNS shows pathogen specific immune response and reduced bacterial burden in mice organs. Exosomes, small extracellular vesicles (30–150 nm), are secreted by most eukaryotic cells and play a vital role in intercellular communication by transporting proteins, lipids, and nucleic acids. Initially considered cellular waste, they are now recognized for their potential in diagnostics and therapeutics, particularly in infectious disease . Exosomes from M.tb. -infected cells contain virulence factors and modulate immune responses, making them promising candidates for vaccine delivery , . Their lipid bilayer structure ensures antigen stability, enhances antigen presentation, and induces robust immune responses with minimal risk of adverse effects compared to traditional adjuvants xviii, . Exosomes can be engineered to carry single or multiple antigens, allowing for the development of multivalent vaccines that address complex diseases requiring broad immune responses . Current TB vaccine strategies include modifying BCG to enhance efficacy (e.g., VPM-1002 (Serum Life Science Europe GmbH (formerly VPM) continues to operate as a German entity, but as a subsidiary of SIIPL), rBCG30) and a prime-boost approach, where BCG is supplemented with subunit or viral vector-based boosters . We have previously demonstrated that archaeosome encapsulated ESAT-6 provoked enhanced Th-1 biased immune response and CTL response in murine model xxi . In this study, we thoroughly investigated the vaccine efficacy of in-house prepared exosome-based vaccine candidates, Rv-Exo and ESAT-6 Exo, against tuberculosis, focusing on both as an independent vaccine candidate and "prime-boost" vaccination contexts. The results indicate that exosomes bearing M. tb antigens effectively enhance antigen presentation and modulate immune responses, leading to elevated M.tb. specific Th1 biased and elevated CTL immune responses. The ESAT-6 is a critical virulence factor of M.tb. and a well-recognized cell-mediated immunity inducer. By utilizing the H37Rv infected alveolar macrophages derived exosomes, we were able to educate the immune system more precisely, promoting robust cytotoxic T lymphocyte (CTL) responses. When the BCG immunized animals were boosted with ESAT-6 Exo or Rv-Exo we found i) elevated Th-1 biased cytokine production in serum, ii) elevated population of IFN-γ, TNF-α and IL-12 producing Th1 cells. iii) Higher IgG2a: IgG1 ratio, iv) Increased dose dependent cell M.tb. specific cell proliferation, v) Elevated t-bet response vi) decreased bacterial burden in vital organs, and vii) reduced bacterium in tissue samples. Overall, our results support the potential of exosome-based vaccines containing ESAT-6 and those derived from H37Rv-infected alveolar macrophages as a novel strategy for tuberculosis vaccination. The promising efficacy observed in both naïve and booster contexts highlights the need for further research and clinical trials to evaluate the long-term protective effects of this innovative approach. MATERIAL AND METHODS Chemicals and Reagents: Unless otherwise mentioned, all standard reagents were purchased from Sigma–Aldrich Merck (Massachusetts, USA). The following reagents were procured from BD biosciences Middle-brook 7H9 broth; Middle-brook 7H11 medium; and oleic acid, albumin, dextrose, and catalase (OADC). Cell culture media (RPMI-1640), Fetal bovine serum, antibiotic & anti-mycotic solution were purchased from Gibco, Thermo-Fisher Scientific and plastic-wares were purchased from corning Falcon. ESAT-6 protein expression and purification: pET expression vectors Pmrlb.7 were procured from BEI resources. Plasmid Miniprep kit was purchased from Thermo Scientific (USA), and the Gel extraction kit used for plasmid preparations and DNA purification processes, were from Qiagen. Nickel/nitrilotriacetic acid (Ni/NTA) super flow metal-affinity chromatography matrix was from Qiagen. To concentrate expressed protein, Amicon-Ultra was used (molecular mass cut-off 3.5 kDa; Millipore, Bangalore, India). The ESAT 6 was purified over a Ni/NTA matrix using a standard protocol under denaturing conditions, as per the manufacturer’s instructions, The eluted fractions were checked for purity by SDS/PAGE (15% gel) as well as Western blot analysis following the standard method. The protein was refolded by dialysing it against refolding buffer containing 25 mM NaH2PO4, 100 mM NaCl, 1 mM 20 mM NaH2PO4, 50 mM NaCl, and 0.1% NaN3, pH 6.5. Bacteria and alveolar macrophage cell culture: M. tuberculosis H37Rv strains were kindly provided by the ICMR National JALMA Institute for Leprosy and other Mycobacterial disease, Agra, India. It was cultured into Middle-brook 7H9 broth containing 0.2% glycerol and 0.05% Tween- 80 supplemented with albumin, dextrose, and catalase. The viability of the bacteria was determined by cultivating them on Middle-brook 7H11 medium supplemented with OADC (BD Biosciences, New Jersey, USA) and counting the colony-forming units (CFUs). Mouse alveolar macrophage cell line was purchased from ATCC USA MH-S (ATCC No.- CRL-2019) were cultured in wells or flasks with RPMI-1640 containing 10% exosome depleted FBS, 0.05 mM β-mercaptoethanol, 100 U/ml penicillin and 0.1 mg/ml streptomycin at 37°C with 5% CO2. Alveolar macrophages cells infection with M.tb H37Rv : Mouse alveolar macrophage cell lines were starved for 24 hours then infected with 5 Multiplicity of Infection (MOI) of H37Rv for 24 hours. The infected macrophages were then washed three times with PBS. The cell culture supernatant was collected and centrifuged at 10000 RPM at 4°C for 10 minute to remove any bacilli. In addition, the culture supernatant was filtered with 0.45µm filter. Preparation of M.tb antigen bearing exosomes : The exosomes were purified by ultracentrifuge (BecmenCoulter USA) method ( , ). Briefly, the exosomes depleted FBS was prepared by centrifugation at 100,000 x g at 4°C for 2 hours. A mouse alveolar macrophage cell line at 70–80% cell confluence in RPMI-1640 medium containing 10% exosomes depleted FBS was cultured at 37°C and 5% CO2. Cells were either left uninfected (UI) or infected (IF) with 5MOI of M.tb. H37Rv bacilli, the culture supernatant were collected for exosome isolation and centrifuged at 10,000 rpm at 4°C for 10 minutes to remove cell debris, free cells or bacilli, collected culture supernatant was passed through 0.22µm filter. The filtered supernatant was subjected to ultracentrifugation at 100,000g at 4°C for 2 hours to pellet down the expected exosomes (Rv-exosome). The pellets were suspended in 150 mM saline, and the concentration was determined by BCA analysis. All purified exosomes and their lysates were stored at -80°C until used. The ESAT-6-containing exosomes were prepared by using exosomes derived from UI alveolar macrophages and purified ESAT-6. The sonication method was used to encapsulate the ESAT-6 into exosomes, as standardized in our lab. Briefly, exosomes were isolated by the ultracentrifugation method, and the exosome pellet was dissolved in 150 mM normal saline to form a suspension. The exosomes were mixed with an equal volume of protein solution (400 µg/200 µl stock). The mixture was sonicated for 5 minutes in a bath-type sonicator at 4°C. Several freeze-thaw cycles were executed to increase the efficiency of entrapment. Exosomes with ESAT-6 were pelleted down using centrifuge for 2 hours at 17000 RPM at 4°C. The unentrapped ESAT-6 was collected in the supernatant. Entrapment efficiency was determined by the Bicinchoninic Acid Assay (BCA) method after lysing the exosomes with 1X RIPA buffer and immunoblotting for ESAT-6. Electron microscopy Transmission electron microscopy (TEM; Talos L 120C, Thermo Scientific, USA.) was used to study the morphology of H37Rv-infected alveolar macrophages cells derived exosomes. After being carefully positioned on a carbon-coated 300-mesh copper grid for 20 minutes, purified exosome preparations (25µl) were diluted with an equal volume of 4% paraformaldehyde at 4°C for 30 minutes. They were subsequently fixed for five minutes using 1% glutaraldehyde. The grids were cleaned twice, contrasted with 2% uranyl acetate, and then cleaned twice more. The software was used to examine the exosome pictures from TEM in order to determine the exosome radius. NTA Analysis of Exosomes: All samples were diluted 1:1000 (V:V) in PBS. The prediction of Ideal measurement concentrations was determined by pre-testing the ideal particle per frame value (74 particles/frame). The software provided by manufacturer was use as default settings for extracellular Vesicles (EVs). For each measurement, one cycles were performed by scanning 11 cell positions each and capturing frames per position (video setting: high) under following settings: Focus: autofocus; Camera sensitivity for all samples: 92.0; Shutter: 200; Cell temperature: 25°C. After capture, the videos were analysed by the in-build ZetaView Software 8.05.16 SP3 with specific analysis parameters: Maximum particle size: 1000, Minimum particle size 10, Minimum particle brightness: 30 . The data was analyzed for particles size as well as number and presented here in the form of bar graph. Western Blot analysis: Antibodies against NF-KB, COX‐2, and iNOS were bought from Affinity Biosciences (USA). Antibodies against CD63 mouse monoclonal antibody, SC-5275, MW 26 kDa; and Calnexin, mouse monoclonal antibody, SC-23954, MW 90kDa; Santa Cruz Biotechnology, USA)), pIRF3, pSTING, tubulin, HRP conjugated anti-rabbit IgG and anti-mouse IgG antibodies were from Cell signaling technology (USA). Protein markers were purchased from Bio-Rad (USA). Exosomes were lysed by radio immunoprecipitation assay RIPA buffer supplemented with protease and phosphatase inhibitor cocktail (Abcam). An equal amount of exosomal protein were subjected to electrophoresis using 12% polyacrylamide gel (Bio-Rad, USA) and transferred to PVDF membrane (Millipore, Bedford, MA, USA). Membranes were blocked with TBST Contains 5% skimed milk and 0.1% Tween-20, then incubated with primary antibody, followed by HRP labelled secondary antibody. The blots were developed using ECL specific reagents (BioRad, USA). The images were captured using Chemidoc MP and analyzed using the CFX Maestro Software version 2.2 (BioRad, USA). Exosome protein delivery assay: For protein labeling of EVs, containing 200–500 µg of protein were resuspended in 500 µL of PBS. A 500X labeling dye (Exoglow protein-Protein EV labeling Kit, System Biosciences) was then added to the EV preparation at a 1:500 dilutions, and the mixture was incubated at 37°C with shaking (350 rpm) for 20 minutes. Subsequently, 167 µL of ExoQuick-TC was added to the solution, and the mixture was incubated at 4°C for overnight. The EV-dye complex was then centrifuged at 10,000 rpm for 10 minutes, and the supernatant was carefully aspirated from the corner of the tube. The labeled EV pellet was resuspended in 300 µL PBS J-774 macrophages were seeded into an 8-well chamber slide and incubated with labeled exosomes for 10 minutes and 1 hour at 37°C under 5% CO₂ to evaluate uptake kinetics. Post-incubation, unbound exosomes were removed by PBS washing, and cells were fixed with 4% paraformaldehyde (PFA) for 20 minutes at room temperature. DAPI was used to stain the nucleus. Images were taken using Evos-M7000 (Invitrogen by Thermo Scientific, USA). Mass Spectrometer of H37Rv infected cells derived Exosomes: LC-MS experiments were outsourced and performed on a Morpheus (Agilent, revision 272) that was linked to a Thermo QE Plus, Protein from each sample were inoculated into 1µg on a 50-cm-long, 3.0m-thick C18 column (Thermo Fisher Scientific). At a flow rate of 300 nl/min, a0–40% gradient of buffer B (80% acetonitrile, 0.1% formic acid) was used to elute the peptides, which were then sent to the MS analyzer. For 60 minutes, LC gradients were run. At a resolution of 70k, MS1 spectra were taken with the Orbitrap. Dynamic exclusion was used for 10s, and all charge states for a sequences given precursor were taken out of the equation. MS2 spectra were taken at a resolution of 17500. Epitope prediction of T cell and B cell: Raw data obtained from proteome analysis was used to generate the uniProt ID using NCBI database and at the end we had FASTA sequence of all the protein present in exosomes in FASTA format. Furthermore, predicted T- and B-cell epitopes for selected protein sequences, using online epitope prediction server NetMHCpan El 4., Immune Epitope Databases (IEDB). The IEDB tool uses validated benchmarking methods to predict MHC molecular binding, antigen processing, TCR recognition, and B cell epitopes. MHC Class-I restricted CD8 + cytotoxic T lymphocyte (CTL) epitope selected sequences compatible to respective common human leukocyte antigen (HLA) alleles (i.e., H2-db and H2-kb) having epitope length of 9 amino acids. Similarly, we identified MHC class II-restricted CD4 + helper T lymphocyte (HTL) epitopes of several common HLA alleles (e.g., H2-IAb) using the IEDB-recommended 2.22 prediction method with 15 epitopes. The BepiPred 2.0 server predicted linear B-cell epitopes of selected protein sequences. In the next step, the predicted value is increased sequentially and considered more likely than threshold (default 0.5) epitopes. Mice maintainance and Experimention: This study was approved from National JALMA Animal Ethical committee and approved was also taken from, Jamia Hamdard IEC with approval no. 1566/2019 this study. In accordance with the local guidelines for the care and use of animals, female BALB/c mice between the ages of 6 to 8 weeks were kept at the Animal House Services of Jamia Hamdard under special pathogen-free conditions. Animals were transferred to animal biosafety level 3 laboratory at the ICMR-National JALMA Institute of Leprosy and Other Mycobacterial Disease, Agra, India and acclimatized for 10 days before experimentation. Immunization Schedule: Mice were acclimatized in animal biosafety level-3 facility in accordance with CPCSEA (Committee for the Purpose of Control and Supervision of Experiments on Animals) guidelines. Mice were immunized with various vaccine preparation including, Free ESAT-6 Ag, Exosome-encapsulated ESAT-6 Ag (ESAT 6-Exo), Rv-Exo, BCG alone, BCG boosted with ESAT-6 Exo and BCG boosted with Rv-Exo. The only PBS and sham exosomes were used as control. The animals were vaccinated by subcutaneously administering 100 µg of Ag,100 µl of dose volume per animal, depending on exosome concentration at 1000 µg/injection. In all BCG group, single doses of M. bovis BCG (1×10 6 CFU/mouse, Danish strain) were administered intradermally. On day 28, animals were boosted with the appropriate formulations of the antigen using the similar route of administration. Challenge with Mycobacterial infection and Bacterial load in organs: Two weeks post booster; the mice of various vaccinated groups were challenged with M.tb. H37Rv , using a suspension of 1X10 7 /ml bacteria count in a volume of 10 ml was injected to the Venture nebulizer in the aerosol generator device (Glascol, USA ) that created aerosol cloud of M.tb. bacilli. M.tb. -infected mice were then placed in IVEC Chambers till end of the experiment. To enumerate the deposited bacterial population in the lungs, post challenge of infected animals, 24 hours and the bacterial load in the lungs was measured. To assess the prophylactic efficacy of various in house developed vaccine candidates the bacterial load in the lungs, spleens and lymph nodes of experimental animals at various time points were evaluated. After set periods (Six- and Twelve-weeks’ post-challenge), 3 animals from each group were sacrificed, their spleens, lungs, and lymph nodes were aseptically removed and homogenized in 7H9 medium using homogenizer Polytron; PT 3100 (Indonesia). Various dilutions of the prepared homogenates were plated on 7H11 agar plates supplemented with oleic acid, albumin, dextrose and catalase. In the BCG(Danish) immunized animal group, thiophene carboxylic acid hydrazide (TCH) was used at 2 mg/ml concentration to inhibit the growth of BCG. All plates were incubated at 37°C for 3–4 weeks. The colonies were enumerated for bacterial load determination. This formula was used for calculating CFU/gm (CFU/gm = Number of colonies x dilution factor/ Weight of sample). ELISA for IgG isotype and Th-1/Th-2 cytokine analysis: The sandwich ELISA kits for IgG1, IgG2a isotype kits and IL-12, IL-4, interferon-g (IFN-γ), IL-10 Cytokine GENLISA ELISA kits were procured from Krishgen BioSystem, USA.We analyzed Th-1 (IFN-γ and IL-12) and Th-2 (IL-10 and IL-4) cytokines in serum samples using sandwich ELISA kits using at various time points Pre-immunization, post booster and Twelve-week post challenge (TWPC). Assay plates were incubated with serum samples overnight at 4°C followed by three washes. Then, wells were incubated with detection antibody for 1h at room temperature followed by washing with wash buffer. The plates were further incubated with Streptavidin-HRP labeled secondary antibody for 1h at room temperature followed by development with 3,3,5,5- tetramethylbenzidine (TMB) and added the stop solution for stop the reaction. The absorbance was measured at 450 nm using multi-mode reader (Synergy H1, BioTek, USA.). Isolation and Culture of lymphocytes: Mice belonging to various immunized groups were sacrificed at 6 and 12 weeks’ time points, both after vaccination and post infection. Spleens isolated from animals belonging to different groups were aseptically removed, and the tissue was homogenized in 3 ml of sterile PBS using sterile homogenizer and centrifuged at 300g at 4°C for 10 min. The cells were macerated and a single cell suspension was prepared. Further, the cells were treated with 2 ml of ACK lysis buffer for 5 minutes on ice to lyse the RBCs present in cell suspension. The cell suspension was centrifuged at 1500 g for 5 min, and the cell pellet was washed three times with HBSS and resuspended in RPMI 1640 medium containing 10% FBS and 0.1% antibiotic solution. FACS analysis for immunophenotyping: The following antibodies were procured from BD Biosciences (USA): fluorochrome-labeled anti-mouse antibodies; CD4 (BV 786), CD8 (APC-H7), CD44 (BV480), CD45(BB700), CD62L (BB515), IL-12 (P40/P70), TNF (PECy7), IL-4 (BV711), CD3E (APC), IL-10 (BV605). Splenocytes were isolated and counted using the Trypan Blue exclusion method, with 1 million cells seeded in each well of a 96-well round-bottom culture plate. The cells were stimulated with optimized doses of M.tb. antigens, specifically PPD at 5 µg/ml and ESAT6 at 10 µg/ml, while unstimulated cells served as a negative control. The cultures were incubated for 48 hours in a humidified CO2 incubator at 37°C. Twelve hours before the end of the incubation, 1 µl of 1:100 brefeldin A was added to each well, and the plates continued to incubate at 37°C in a humidified CO2 environment. After incubation, cells were centrifuged at 350 RCF for 5 minutes at 4°C, and the supernatant was discarded. The cell pellet was resuspended in 100 µl of staining buffer and stained with surface marker (CD4 (BV 786), CD8 (APC-H7), CD44 (BV480), CD45(BB700), CD62L (BB515), CD3E (APC) antibodies, followed by a 30-minute incubation at 4°C in the dark. After washing, cytofix buffer was added for fixation, and the cells were permeabilized before being stained with intracellular IL-12 (P40/P70), TNF (PECy7), IL-4 (BV711), IL-10 (BV605) antibodies. Finally, the cells were suspended in staining buffer containing formaldehyde and stored at 4°C until acquisition using a BD FACS Lyric flow cytometer, with data analyzed using BD FACS Suite software. Cell proliferation or MTT Assay: Lymphocytes isolated from the spleens of mice belonging to various immunized groups were incubated in round-bottomed 96-well plates (1 million cells per well) in 200µL of RPMI 1640 medium supplemented with 10% fetal bovine serum. To assess the impact of antigen concentration on T cell activation, varying concentrations (ranging from 1 to 10 µg/well or 1-100ug/well) of ESAT-6 and (ranging from 5 to 20 µg/well) of PPD (Purified protein derivative) were used to prime the T cells to evaluate antigen specific cells activation in the vital organ. Cell proliferation was evaluated using the MTT assay. For the MTT reduction reaction, 10µl of a 5 mg/mL MTT stock solution was added to each well, and the mixtures were incubated at 37°C in the dark for 72 hours. To dissolve the formazan crystals, 100µl/well of a solubilizing buffer was added. The absorbance of the formazan products was determined by measuring the absorbance at 570nm using a microplate reader. Isolation of RNA from Animal tissue: Various vaccinated groups of Balb/c mice were challenged with the H37Rv strain. TWPC, mice were sacrificed individually; lungs, spleen, and lymph nodes were collected, which were homogenized in 1 ml of TRIZOL by using a homogenizer Polytron (Indonesia). Lung, spleen, and lymph node homogenates were stored at -80°C until further processing. Then, 200 µl of chloroform were added per ml of TRIZOL, and after vigorous vortexing, tubes were centrifuged at 12,000 for 15 minutes at 4°C. The aqueous upper phase contained eukaryotic RNA. Then, tubes were centrifuged for 10 minutes at 18,000 g (4°C), and aqueous phase (approximately 500µl) containing mycobacterial RNA (and also remaining eukaryotic RNA) was recovered. A measure of 700µl of isopropanol was added, and incubated at RT for 15 minutes to improve RNA precipitation. Precipitated RNA centrifugation and collected. The pellets were rinsed with 70% ethanol and air dried before being re-dissolved in RNAse-free water and stored at -80°C. RNA integrity was assessed by agarose gel electrophoresis, and the absence of contaminating DNA was checked by a lack of amplification products after 39 PCR cycles. Lungs from uninfected animals were processed as above to be used as a non-infected control in the RT-PCR. For RT-PCR, cDNA synthesized by using 2µg of RNA prepared a standard reverse transcription reaction with the PrimeScriptTM 1st strand cDNA Synthesis Kit (Takara, Japan). RT-PCR ASSAY : PCR reaction was performed using the iQ SYBR Green Supermix (Bio-Rad, USA) under the following conditions: PCR mixtures were denatured at 95° C for 3 minutes, followed by 39 cycles of 10 seconds at 95° C, 30 seconds at 58° C, 10 seconds at 95° C, and 5 seconds at 70° C for amplification. The mRNA expression levels of T-box transcription factor (TBX21), GATA (GATA binding factor one) and (Interleukin-1 beta) IL-1β were normalized to their respective glyceraldehyde 3-phosphate dehydrogenase (GAPDH) expression. The sequences of sense and anti-sense primers are shown in Table 1. Primer Name Tm GC % Sequence IL-1 beta Forward 59.35 55 GCCCATCCTCTGTGACTCAT IL-1 beta Reverse 57.30 50 AGGCCACAGGTATTTTGTCG GAPDH Forward 61.40 60 CTCCCACTCTTCCACCTTCG GAPDH Reverse 61.40 60 GCCTCTCTTGCTCAGTGTCC Tbx-21 Forward 55.2 40 ACGTCTTTACTTTCCAAGAG Tbx-21 Reverse 55.2 42.8 GTACATGGACTCAAAGTTCTC GATA3 Forward 60 50 CCTCTGGAGGAGGAACGCTAAT GATA3 Reverse 60 59.09 GTTTCGGGTCTGGATGCCTTCT Histopathology: Animals were sacrificed, their lungs, spleens, and lymph nodes were immersion-fixed in 10% formalin, tissue blocks (5 mm in size) were processed for paraffin embedding, and 10 mm-thick sections were cut on a rotary microtome. Sections were subjected to both conventional and targeted Zheil-Nielsen staining to identify Mycobacteria. Stained sections were observed under a fluorescence microscope Evos M7000 Imaging system (Invitrogen, Thermo-scientific, USA). Immunohistochemistry: Microtome sections (4µm thick) were cut from formalin-fixed, decalcified, and paraffin-embedded tissue samples. These sections were initially deparaffinized, then subjected to antigen retrieval using 10mM citrate buffer (pH 6.0) in a boiling water bath for 10 minutes, treated with 1% H 2 O 2 for 10 minutes, and blocked with 5% BSA for 1h at room temperature. The tissue sections were then incubated with anti-F4/80, IL-12 and TNF-α antibodies for 12 hours and HRP-conjugated anti-mouse secondary antibodies for 90 minutes. The horseradish peroxidase reaction was visualized using 0.05% diaminobenzidine (DAB) and 0.03% H 2 O 2 . After counterstaining with hematoxylin, the sections were dehydrated and mounted. Stained tissue sections were examined using Evos M7000 Imaging system (Invitrogen, Thermo scientific, USA). All experiments included appropriate isotype-matched control antibodies. Nitric oxide assay: To determine nitric oxide levels using the Griess reagent kit (LDH method), the serum samples were appropriately diluted and added to the wells of the 96-well plate along with Griess reagents R1 and R2, and a nitrite standard. The plate was then incubated for 10 minutes at room temperature without covering it. After incubation, the absorbance of each well was read at 540 nm using the multimode reader. The calculation of nitric oxide content was performed as follows: [Δ OD {Std} = OD {Std} - OD {Blank} ], [Δ OD {Sample} = OD {Sample} - OD {Blank} ]. Subsequently, the Δ OD Sample value was substituted into the equation to obtain the x value (in µM), representing the nitric oxide content. 1 mg/dl of NO equals 333 µM. The concentration of nitric oxide (NO) was determined using a standard curve. Statistical analysis: Data were analyzed and two groups were compared using the Student’s t test or three groups were compared using the one-way ANOVA (Tukey method) to compare all groups, using GraphPad Prism version 10.0 software. The p values, 0.05 (*), ,0.01(**), ,0.001(***), ,0.0001 (****) were considered as significant for analysis of the data. RESULTS Characterization of M.tb. infected alveolar macrophage derived (Rv-Exo) and ESAT-6 entrapped exosomes (ESAT-6 Exo) : Exosomes isolated either from uninfected or M.tb. H37Rv infected alveolar macrophages were subjected to electron microscopy (TEM). The TEM results suggest that the isolated exosomes vary in size ranging from 102 to 113 nm (Figure-1A and 1B). When particles were analyzed using NTA (zeta view), both UI-Exo (1C) and Rv-Exo (1D) showed 142.53 and 137.56 nm average size and number of particles found to be 2.2x10 6 /ml and 2.86x10 6 /ml, respectively (Figure-1E). Interestingly, the number of particles significantly increased in the M.tb. infected cells, that signifies the impact of infection in extracellular vesicle production (Figure-1E). To confirm whether ESAT-6 gene was present in the plasmid Pmrlb.7, PCR analysis was performed that confirmed the presence of the gene indicated by the PCR product of 300 bp (data not shown). The BL21 E. coli were transformed using Pmrlb.7 plasmids and ESAT-6 protein was induced with the help of IPTG. ESAT-6 protein from E. coli cells lysates were purified by IMAC column as described in our earlier publication xxi , ESAT-6 bearing exosomes (ESAT-6-Exo) were lysed and subjected to western blot analysis (Figure-S1A). The band intensity analysis suggests approximately 69% encapsulation of ESAT-6 protein, this study helped in controlled and accurate vaccination dose in mice. Additionally, the western blot analysis demonstrated the presence of exosome surface markers such as CD63, CD81, Tsg101, CD9 on the isolated extracellular vesicles (Figure-1F). The exosome markers, such as CD63, CD81, and TSG101, showed increased levels in the Rv-Exo sample, which typically indicates a higher release of exosomes from M.tb -infected cells. We also evaluated the exosomes for calnexin, a negative marker, to determine the purity of exosomes. The absence of calnexin in both exosomes confirmed the purity of the samples (Figure-1F). Exosome efficiently delivers antigen via cytosolic and endocytic mode: Exosomes enhance antigen processing and presentation through distinct mechanisms based on their mode of entry into macrophages. To evaluate the antigen delivery mechanism, the Rv-exo were incubated with J774-macrophages (NCCS, Pune) for 10 minutes and 1 hour. The results showed fusion of labelled blue fluorescent protein colored exosomes with the cell membrane, suggestive of cargo release into the cytoplasm (Figure-1G, enlarged panels, red arrows). Intriguingly, the endocytosis can also be seen on the membrane as well as inside the cytoplasm at 10 minutes as well as 1hour post incubation, suggestive of endosomal delivery of exosome content (Figure-1G, enlarged panels, blue arrows). The cytosolic delivery through fusion mechanism enables antigens to be processed through ubiquitination and proteasomal degradation machinery (acts as endogenous antigen) leading to antigen presentation on MHC class I molecules, facilitating cross-presentation to CD8 + T cells and eliciting cytotoxic immune responses. In contrast, when exosomes are internalized via endocytic pathway, as shown in figure-1G (blue arrow), which leads to antigen presentation on MHC class II molecules to activate CD4 + T cells. These complementary mechanisms underscore the critical role of exosomes in bridging innate and adaptive immune responses by enabling antigen presentation through both MHC class I and class II pathways. Together, this data suggests that the isolated extracellular vesicles obtained by ultracentrifugation method were in the size range of exosomes and were pure as well. The alveolar macrophages cell line was used in this study to isolate exosomes were characterized by FACS analysis. About, 96.41% cells were found to express high levels of CD11c, out of that 17.51% were positive for F4/80. On the other hand, 94.06% population showed CD206 low phenotype over all (S1D). CD206 low and CD11c high and F4/80 low also confirms the cells as Alveolar Macrophages (AMΦ). (Figure-S1B-S1E). Rv-Exo proteins demonstrate the presence of both B- and T-cell antigenic determinants: The exosome vaccine candidates characterized for size and purity were subjected to liquid chromatography-mass spectrometry (LCMS). The LCMS data showed 143 proteins of Mycobacterium tuberculosis ( M.tb. ) origin and 1032 host proteins within exosomes isolated from M.tb. -infected alveolar macrophages (Rv-Exo). The intricate host-pathogen interplay during M.tb. infection, emphasizing the roles of specific exosomal proteins. Additionally, the presence of M.tb. proteins in exosomes implies their potential implication in modulating the immune response and bolstering host defense mechanisms against M.tb . Considering exosomes' pivotal roles in intercellular signaling and immune regulation, these findings suggest their involvement in shaping the immune response to M.tb. and may serve as valuable biomarkers for TB diagnosis or as targets for therapeutic interventions aimed at disrupting M.tb. pathogenesis. In this work, the protein sequence was submitted to predictive analysis using IEDB in order to discover possible B cell epitopes (Supplementary Table 1) capable of eliciting humoral and T cell epitopes capable of interacting with different MHC (Major Histocompatibility Complex) Class I (Supplementary Table 2) and Class II alleles (Supplementary Table 3). A total of 49 epitopes were predicted to bind MHC Class I alleles, 48 epitopes to MHC Class II alleles, and 46 B cell epitopes were also predicted (Supplementary Table 1–3). These peptides were selected based on their ability to achieve a predicted binding score below 1, indicating a high probability of binding to the respective MHC alleles. The epitopes identified through this study exhibited a high affinity for their respective MHC alleles, indicating strong potential as vaccine targets or diagnostic markers for tuberculosis. In conclusion the bioinformatics analysis of pathogenic proteins presents in Rv-Exo demonstrated presence of antigenic determinants capable to provoke helper-T cell, Cytotoxic T lymphocytic, responses along with effective humoral responses. The Rv-Exo contain T cell antigens which are absent in BCG Genome: The proteomics analysis of Rv-Exo lysate revealed the presence of 143 protiens of M.tb. H37Rv strain, but that was conspicuously absent in the genome of the Bacillus Calmette-Guérin (BCG) strain. Notably present within in house prepared vaccine candidate (Rv-Exo), derived from H37Rv-infected MS-H murine alveolar macrophage cell line. About 12 immunogenic proteins shown in the Table 2 belonging to H37Rv origin and absent in BCG. This protein discrepancy highlights a potential genetic divergence between the BCG vaccine strain and the pathogenic M. tb. strain H37Rv. Antigenic analysis of 12 proteins depicts those 8 proteins had enormous number of MHC-I agrotope compatible epitopes suggesting of inducing a CTL response by Rv-Exo vaccination. Therefore, Rv-Exo could be used as booster to supplement a strong CTL response. Overall, the presence of this protein within exosomes, which are pivotal mediators of intercellular communication and immune regulation, suggests its involvement in host-pathogen interactions and immune modulation during tuberculosis infection. Tabel-2 : Immunization with Exosomes containing ESAT-6 and Rv-Exo induce enhanced Th1 immune response: Sr. No. Protein Name Absent in BCG Protein ID References 1. Esx conserved component eccd2. esx-2 type vii secretion system protein. probable transmembrane protein (Rv3887c) A0A1R3Y5J4 2. ESX conserved component EccD2 OS = Mycobacterium tuberculosis OX = 1773 GN = eccD2 PE = 3 SV = 1 (Rv3887c) A0A045I5U9 xxvi 3. ATPase P OS = Mycobacterium tuberculosis ( Rv0933) A0A045HTY2 4. Oxidoreductase OS = Mycobacterium tuberculosis ( Rv0484c) A0A045IQY5 xxvii 5. Cytochrome c biogenesis protein OS = Mycobacterium tuberculosis ( Rv3673c) A0A8D5WZQ2 6. Two-component system transcriptional regulator OS = Mycobacterium tuberculosis ( Rv0981) A0A0H3LA31 7. Sugar-transport integral membrane protein ABC transporter OS = Mycobacterium tuberculosis ( Rv2040c) A0A0H3LBB5 8. . Transmembrane protein OS = Mycobacterium tuberculosis ( Rv0355c) A0A2I7WD76 9. 3-methyl-2-oxobutanoate hydroxylmethyltransferase OS = Mycobacterium tuberculosis ( Rv0038) A0A045HAR6 10. FAD-binding dehydrogenase (Fragment) OS = Mycobacterium tuberculosis OX = 1773 GN = E5M23_16735 PE = 4 SV = 1 ( Rv3129) A0A8H2FC55 11. Acyl-CoA dehydrogenase fadE16 OS = Mycobacterium tuberculosis ( Rv1679) A0A654T4K6 12. Transmembrane transporter mmpL12 OS = Mycobacterium tuberculosis ( Rv2536) A0A7U8U5Q7 Exosomes containing ESAT-6 and Rv-Exo induce the production of Th1 immune responses: Here, we have examined the immunogenic potential of exosomes containing the antigens ESAT-6 (ESAT-6 Exo) and H37Rv-infected alveolar macrophage-derived exosomes (Rv-Exo) as an antigen delivery system. Serum samples from various immunized cohorts were assayed for Th1 (IFN-γ and IL-12) and Th2 (IL-4 and IL-10) cytokines using sandwich ELISA to assess the Th1/Th2 ratio. Exosome-based vaccine candidates i.e. ESAT-6 Exo, Rv-Exo, their booster in BCG immunized groups and BCG alone was examined. Exosomes-encapsulated vaccine candidates for ESAT-6 Exo and Rv-Exo induce significantly elevated levels of Th1 cytokines at various time points (Figure-2(A-J)). The Th-1 cytokines (IFN-γ and IL-12) levels are higher in the BCG group boosted by ESAT-6 Exo and Rv- Exo compared to the BCG alone group at post booster time points (Figure-2A and 2C). On the other hand, no significant difference was observed in the Th2 (IL-4 and IL-10) response at any time points at post-booster. However, the IL-4 level was lower but not significantly in vaccinated groups compared to the sham exosome (PBS) group (Figure-2D). The Th2 cytokine IL-10 was significantly high in PBS group (P > .001) compared to ESAT-6 and Rv-Exo booster groups of BCG at the post-booster time point (Figure-2B). The expression level of Th-1/Th-2 cytokine ratio was 28 and 21 times higher in BCG + ESAT Exo and BCG Rv- Exo groups as compared to the BCG alone group at post booster time point (Figure-2E) however, discernible elevation was observed across all groups at the two weeks post challenge (TWPC), indicative of M.tb infection and likely representing the onset of the disease (Figure-2). At TWPC, the serum of vaccinated animals was evaluated for IFN- γ, IL-12 (Th-1 cytokines) as well as IL-4 and IL-10 (Th-2 cytokines). The comparative analysis showed elevated IFN- γ after booster in all groups. The vaccine group i-e ESAT-6 Exo (156 pg/ml PB vs 570.15 pg/ml TWPC), Rv- Exo (390pg/ml PB vs 665.5pg/ml TWPC), and their BCG booster counterparts showed 8-10-fold elevation in compare to BCG alone (Figure-2F). Similarly, the IL-12 level in the ESAT6-Exo and Rv-Exo vaccinated groups were elevated 5-6-fold compared to post-booster time point (Figure-2H). This sustained increase in IL-12 at twelve weeks post challenge signifies protective immune response against M.tb. in immunized animals. When we compared Th2 cytokine, IL4 production at post booster and TWPC time points PBS group showed various fold elevated IL-4 production at TWPC in compare to all vaccinated groups, it may be due to onset of disease (Figure-2D&2I). In contrast, the IL-10 levels were increased in PBS (90.5pg/ml Pb Vs 67.7pg/ml TWPC), and vaccinated groups, ESAT-6 Exo (41pg/ml Pb Vs 49.5pg/ml TWPC), Rv-Exo (68.5pg/ml PB Vs 50pg/ml TWPC) and BCG alone (61 pg/ml Pb Vs 120pg/ml TWPC). Interestingly, the BCG also did not show much increase in IL-4 level (175.5pg/ml Pb Vs 338pg/ml TWPC). However, when the IL-10 level in post challenge sample was compared between groups, the PBS group showed the highest IL-10 level (67 pg/ml) in comparison to other vaccinated groups again proving the notion that M.tb pathogenesis is having more impact on PBS group. The BCG group also showed heightened level of IL-10 (106.588 pg/ml) in compare to its booster counterparts i-e BCG –ESAT-6 Exo (20pg/ml) & BCG Rv-Exo (40 pg/ml). this finding remains in line with the earlier literature that suggests BCG strongly induces IL-10 response (Figure-2G). After the evaluation of serum from immunized animals for Th-1 and Th-2 cytokines, we examined M. tb specific immune response. Equal no. of splenocytes of control and vaccinated animals were either left untreated or activated using PPD 25µg/ml, 50 µg/ml or 100 µg/ml for 72 hours, and culture supernatant were subjected to ELISA for IFN- γ (Figure-2K), and IL-10 (Figure-2L). As the antigen dose increased, the IFN- γ and IL-10 levels were also increased in the BCG + ESAT-6 Exo and Rv-Exo immunized groups (Figure-2K and 2L). The production of Th-1 & Th-2 cytokine exhibits M.tb. specific immune responses in splenocytes of immunized animals. The cytokine profile distinctly illustrates M.tb. antigen-specific bearing exosome vaccine candidates; ESAT-6 Exo and Rv-Exo induce significantly elevated levels of Th1 cytokines at post-infection. It is also observed that ESAT-6 Exo and Rv-Exo boosted BCG groups demonstrated elevated dose-dependent cytokines levels. Overall, their results suggest that the M.tb . antigen-bearing exosomes not only induce Th-1 biased immune response but also efficiently boost M.tb specific Th-1 skewed response in BCG immunized animals both in serum as well as splenocytes culture supernatant upon activation by PPD (Figure − 2). Immunohistochemistry analysis demonstrate Th1 cytokine response in spleen and lung tissues: The microscopic examination of lung and spleen tissues stained for Th-1 (IFN-γ) and Th-2 (IL-10) cytokines revealed distinct patterns of immune response across the different groups. The control group showed minimal staining for both IFN-γ and IL-10, indicating baseline cytokine expression levels with no significant immune activation. In contrast, the BCG ESAT-6 Exo group exhibited intense staining for IFN-γ in both lung and spleen tissues, suggesting a strong Th-1 mediated immune response (Figure-2N), while IL-10 staining was moderate, indicating a balanced immune response with a slight Th-1 dominance (Figure-2O). Similarly, the BCG + Rv-Exo group demonstrated pronounced IFN-γ staining, particularly in the lung tissues, highlighting a robust localized Th-1 response, with IL-10 staining present but less intense, suggesting a predominant Th-1 response with some regulatory Th-2 activity. The Only BCG group showed moderate IFN-γ staining in both lung and spleen tissues, indicating an effective but less pronounced Th-1 response compared to the exosome-treated groups, with slightly elevated IL-10 staining reflecting a balanced immune response with a tendency towards Th-1 dominance. Overall, the tissue microscopic images demonstrate that BCG + ESAT-6-Exo and BCG + Rv-Exo treatments significantly enhance Th-1 (IFN-γ) mediated immune responses in the lungs and spleen compared to the control and Only BCG groups. The presence of Th-2 (IL-10) cytokines suggests a regulatory mechanism to balance the immune response, with a notable Th-1 bias in the exosome-treated groups. These findings underscore the potential of BCG exosome treatments in modulating immune responses more effectively than BCG alone. The administration of exosome-entrapped ESAT-6 vaccine candidates predominantly elicits IgG2a subtype antibodies in mice subjected to immunization Apart from Th-1 and Th-2 cytokines, we examined the importance of IgG antibodies in Antibody-Dependent Cellular Cytotoxicity (ADCC), Antibody Dependent Phagocytosis (ADP) and CD4 activation. We evaluated IgG1 and IgG2a level isolated at post-booster and post-infection time points from various immunized groups using ELISA and their ratio was also calculated. As illustrated in Figure-3, The expression of IgG1 levels is higher in our ESAT + Exo and BCG alone group as compared to the vaccinated groups at post-booster time points (Figure-3A). Similarly, the expression IGg2a level is higher in our BCG + ESAT-6 Exo and BCG + Rv- Exo groups as compared to the only BCG groups (Figure-3B). there was a notable elevation in the IgG2a: IgG1 ratio at post-booster time points, with the BCG + ESAT-6 Exo and BCG + Rv-Exo groups exhibiting higher ratios of 10 and 7.5, respectively, compared to the BCG-alone group (Figure-3C). The post-booster results suggest that the BCG + ESAT-6 Exo and BCG + Rv- Exo groups elicit elevated Th-1 biased immune response and has the potential to educate the immune system for CTL response against M.tb. The post-booster IgG2a/IgG1 ratio measurements were 1.005 ± 0.05545 in pre-immune sera,0.2555 ± 0.08300 for the BCG-alone group, 4.323 ± 0.6875 for the BCG + ESAT-6 Exo group, and 3.563 ± 0.5694 for the BCG + Rv-Exo group. At TWPC, the IgG1 level is higher in only BCG and BCG + Rv-Exo groups (Figure-3D) and the level of IgG2a is higher in BCG + Rv-Exo group (Figure-3E). The IgG2a/IgG1 ratios were higher for the BCG + ESAT-6 Exo and BCG + Rv-Exo groups were 6 and 8.2, respectively than the BCG-only group (Figure-3F). These findings suggest that the Rv-Exo and BCG + ESAT-6 Exo immunized groups induce a more robust Th1 response compared to other groups, including the BCG-alone cohort, with statistical significance (p < 0.001). The higher IgG2a: IgG1 ratio indicates a shift towards a Th1-type immune response, crucial for combating intracellular pathogens like M.tb. Overall, we demonstrated that exosome-based vaccines, particularly those incorporating ESAT-6, significantly enhance the Th1 immune response, making them promising candidates for improved tuberculosis vaccines. Increased pro and anti-inflammatory cytokine gene expression in CD4 + T cells: The transcription factor, T-bet, is a hallmark of Th1 immune response and mainly induces IFN-γ production. To examine M.tb. specific type-1 immune response, we explored the signaling molecules. Quantitative PCR analysis was performed to assess the gene expression in the spleen and lymph nodes of various vaccinated groups at the TWPC. Our findings demonstrated heightened expression of Th1 regulatory genes, TBX21 in the spleen tissue of the Rv-Exo 1.5 fold and BCG + ESAT-Exo 1.6-fold group in comparison to the BCG-alone group (p < 0.001; Figure-4A). The level of TBX21 gene expression was measured in control, BCG-alone, and BCG + Rv-Exo groups, with their respective values being 0.99 ± 0.002, 6.04 ± 0.349, and 9.22 ± 0.315, respectively (Figure-4A). The Th2-regulatory genes GATA, expression was significantly upregulated in spleen of BCG + Rv-Exo and BCG-+ESAT-6-Exo immunized animals (Figure-4B). Interestingly, the pro-inflammatory cytokine IL-1 beta expression was found to be higher in only Rv-Exo and BCG + ESAT-6 Exo groups. In contrary, only BCG and BCG + Rv Exo showed similar response (Figure-4C). In contrast, in the lymph nodes, the expression of Th-1immune response related genes in vaccinated groups showed higher expression in comparison to the BCG-alone group (Figure-4D). Similarly, the expression of GATA-3 gene expression was higher in vaccinated groups as compared to the BCG-alone group (Figure − 4E). IL-1 beta expression is higher in ESAT-6 Exo & BCG + Rv- Exo group and BCG-alone group (Figure-4F). In conclusion, the T-bet (Th1 transcription factor) and GATA (Th2 transcription factor) were elevated in immunized groups. CD3 + /CD8 + and CD3 + /CD8 + T and CD4 + /CD45 + cell responses in vaccinated animals Lymphocytes from the spleens of various immunized animal groups at TWPC were stained with antibodies conjugated with specific cell surface molecules as well as intracellular markers. The cells were stained with anti-CD-3 to (T cells marker), CD4, and CD8 (to distinguish CD4 + helper T cells and CD8 + T lymphocytes (Figure-5A; dot plot). The FACS analysis showed that the BCG + ESAT-6 Exo and BCG + Rv-Exo groups exhibited a 1.6 and 1.34-fold higher population of CD4 + T cells, compared to the BCG-alone group. BCG Vs BCG + Rv-Exo (p < 0.001) & BCG vs BCG + ESAT-6 Exo (Figure-5B). The elevated CD4 + T cell population in BCG ESAT-6 Exo and BCG + Rv Exo booster groups demonstrate proliferation, which is crucial for orchestrating the immune response by activating other immune cells. On the other hand, the ESAT-6 Exo & Rv-Exo formulation was particularly found to be effective at inducing a CD8 + T cell population, which is essential for directly killing infected (Figure-5C). The percentage of CD8 + T cells is 1.57 & 1.6 fold higher in the vaccinated groups as compared to the only BCG groups, as shown in Figure-5C. The increases in CD8 + T cells in the ESAT-6 Exo group were highly significant (P < 0.001). Moreover, the CD4 + /CD45 + T helper cells population was 1.25-fold and 1.5-fold higher in BCG + Rv-Exo and BCG + ESAT-6 Exo groups, respectively (Figure-5D and E). These results highlight that exosome-based vaccine candidates are modulating the immune response, enhancing T cell-mediated immunity, and suggest that these candidates that could be vaccines have the potential to tailor immune responses more effectively than traditional vaccines, which could lead to improved protection against tuberculosis. Th-1 and Th-2 cytokine expression in CD4 + T Cells: The vaccinated groups elicited cytokines at various time points suggestive of strong CD4 + T cell response (Figure-6). Further, we sought to investigate the CD4 + T cells involvement in cytokine production. To enumerate cytokine expression in a T cell population splenocytes of various immunized animal groups were stained for intracellular cytokines with conjugated antibodies specific for intracellular cytokines, The splenocytes were stained with α-CD3 α-CD4 antibodies along with intracellular Th-1 cytokines IL-12 + , TNF-α and Th-2 cytokines IL-4 and IL-10 were stained to assess their intracellular expression levels. The results revealed that animals immunized with BCG and boosted with ESAT-6 and Rv Exo exhibited significantly heightened expression of intracellular IL-12 at 12 weeks post-infection, as shown in (Figures- 6 A and 6 B). When compared the percentage of CD4 + IL-12 + T cells are 2.6 and 2.5fold higher in BCG + ESAT-6 Exo and BCG + Rv-Exo vaccinated groups than BCG-alone group. Next, we examined the expression of another proinflammatory cytokine, TNF- α, in CD4 + T cells. TNF-α was found to be 1.4 and 1.2-fold higher in our BCG + ESAT-6 Exo and BCG + Rv-Exo vaccinated groups, respectively when compared to the BCG-alone group at TWPC (Figure- 6C and 6D). Additionally, we have also examined the expression of Th-2 cytokines IL-4 and IL-10 in CD4 + T cells. IL-4 was higher in animals immunized with the free ESAT-6, BCG-alone, and Sham Exo antigen compared to other vaccinated groups, ESAT-6 Exo and Rv-Exo (Figure-6E and 6F). IL-10 producing CD4 + T cells were found to be higher in animals immunized with the BCG + ESAT-6 Exo and BCG + Rv-Exo compared to the other vaccinated groups (Figure-6G and 6H). The elevated levels of IL-12 + and TNF-α in the BCG + ESAT-6 Exo and BCG + Rv-Exo groups suggest a robust Th1 response, which is critical for effective response against M.tb. The IL-10 producing cells show Th-2 response as well which indicates a balanced immune response in the immunized animals. These findings highlight the enhanced capacity of exosome-based vaccine formulations to elicit strong Th1 immune responses, which are essential for controlling infections. ESAT-6 Exo and Rv-Exo booster to BCG enhances Central and Effector memory response in CD4 + and CD8 + T cells : The success of any vaccine relies on the development of memory responses of lymphocytes. T cell memory remains indispensable for intracellular pathogens like M.tb. In line to evaluate memory response, after evaluating CD4 + and CD8 + T cell phenotypes, we asked if the in-house prepared vaccine candidates induce effector (CD44 high CD62L low ) or long-lasting central memory (CD44 high CD62L high ) population in the splenocytes of the immunized animals at TWPC time points (Figure-7). The FACS data suggested when BCG-immunized animals were given a booster with ESAT-6 Exo or Rv-Exo, the central memory in CD4 + T cells was increased by 2.5-fold and 2-fold higher, respectively, in comparison to the BCG-alone group (Figure-7A and 7B). The evaluation of CD4 + T cell effector memory (CD4 + CD44 high CD62L high ) which plays an instrumental role in fighting concurrent pathogens. The FACS data suggest that the ESAT-6 Exo and BCG-alone groups showed comparable cell populations with slightly increased response in BCG-alone groups. On the other hand, the BCG ESAT-6 Exo showed a 2.2-fold elevated level of effector memory cell population (Figure-7A and 7C). Lymphocytes from the spleens of immunized groups were stained with antibodies conjugated to specific cell surface markers, followed by FACS analysis. The cells were stained with CD3 antibodies to identify T cells, and subsequently with CD4 and CD8 markers to differentiate between CD4 + T cells and CD8 + T cells. Additionally, the cells were analyzed for CD44 and CD62L expression to assess central and effector memory T cell responses in the vaccinated groups. Since the killing of infected cells to reduce the pathogen burden in vital organs relies on CTL response, hence we also examined CD8 + T cell memory responses in the immunized groups. Interestingly, animals immunized with Rv-Exo showed a persistent central memory phenotype (CD44 high CD62L high ) (Figure-7E). In contrast, the CD8 + T cells from the ESAT-6 Exo immunized group exhibited a strong effector memory phenotype (CD44 high CD62L low ) (Figure-7F). The effector memory phenotype (CD44 high CD62L low ) in CD8 + T cells was significantly higher in the BCG + ESAT-6 Exo groups compared to other groups, including the BCG-alone group (p < 0.001), as demonstrated in Figure-7F. In contrast, the BCG + Rv Exo group showed reduced effector memory, Interestingly, the Rv Exo and ESAT-6 Exo also showed a higher population of CD8 + effector memory. These results suggest that different exosome formulations not only enhance targeted memory T cell responses but also indicate a tailored immune memory profile. The BCG + ESAT-6 Exo formulation effectively boosts both CD4 + and CD8 + effector memory T cells, which are crucial for rapid immune responses upon re-exposure to pathogens. Meanwhile, the Rv-Exo formulation appears to support a central memory phenotype, which is important for long-term immunity. This differentiation in immune response profiles underscores the potential of exosome-based vaccines to provide more effective and lasting protection against infectious diseases compared to traditional vaccines. The ESAT-6 and Rv-Exo elicit T cell proliferation in a dose-dependent manner: Splenocytes isolated from the immunized animals were seeded into 96-well plates. The splenocytes from both control and vaccinated animals were either left untreated or activated using ESAT-6 at concentrations of 1 µg/ml, 2.5 µg/ml, 5 µg/ml, and 10 µg/ml, as well as Purified Protein Derivative (PPD) at concentrations of 25µg/ml, 50µg/ml, or 100µg/ml for 72h at 37°C (Figure-8A and 8B). The results showed that BCG + Rv-Exo significantly enhanced T cell proliferation upon activation with the ESAT-6 antigen post-infection in a dose dependent manner (Figure-8A). This enhanced proliferation is notably higher in the BCG + Rv-Exo and BCG + ESAT-6 Exo groups compared to groups treated with the free ESAT-6 antigen, BCG alone, and its physical mixture with sham-Exo. The observed increase in T cell proliferation in the BCG + Rv-Exo and BCG + ESAT-6 Exo groups suggests a superior immunogenic response facilitated by the combination of BCG with Rv-Exo or ESAT-6 Exo. Furthermore, when the lymphocytes are activated with free PPD, a similar trend is observed where T cell proliferation is significantly heightened in the BCG + Rv-Exo immunized groups post-infection (Figure-8B). This indicates a robust and M.tb . specific immune response triggered by the BCG + Rv-Exo immunization strategy. In sharp contrast, lymphocytes isolated from animals in the control group (immunized with PBS or sham exosomes) fail to induce substantial T cell proliferation, even when exposed to higher antigen doses. This lack of significant proliferation in the control group underscores the efficacy of the BCG + Rv-Exo and BCG + ESAT-6 Exo immunization protocols in eliciting a potent T cell-mediated immune response. These findings highlight the potential of exosome-mediated delivery in enhancing T-cell responses, offering promising avenues for improved tuberculosis vaccines. Oxygen burst response was elevated in immunized animals The detection of nitric oxide (NO) and reactive oxygen species (ROS) levels in serum and whole cell lysates of spleen tissue from various immunized mice was conducted at three specific time points: post-booster, 6 weeks post-infection, and 12 weeks post-infection with (M. tb). The results revealed that exosome-encapsulated vaccine candidates, BCG + ESAT-6 Exo and BCG + Rv-Exo, significantly elevated levels of NO and ROS in both serum and spleen tissue at all the time points. Notably, ROS levels were higher in the BCG + ESAT-6 Exo (105 µg/ml) and BCG + Rv-Exo groups compared to the BCG alone group post-booster (Figure-9A). Also, at 6 weeks post-infection, ROS levels were elevated in the ESAT-6 Exo group compared to the BCG-alone group (Figure − 9B), and at 12 weeks post-infection, ROS levels remained high in the ESAT-6 Exo group compared to the BCG-alone group (Figure-9C). Upon comparative analysis of various groups, we found ROS was elevated in comparison to post-booster in all the groups like ESAT-6 Exo (130µg/ml PB vs 110µg/ml TWPC), Rv-Exo (130µg/ml PB vs 100µg/ml TWPC). Additionally, ROS concentrations in splenic whole cell lysates were greater in the BCG + ESAT-6 Exo and BCG + Rv-Exo groups compared to the BCG-alone group at 12 weeks post-infection (Figure-9D). These results suggest that BCG ESAT-6 Exo and BCG Rv-Exo vaccines enhance ROS production, leading to a more robust and sustained immune response against tuberculosis. Similarly, NO levels were significantly elevated in the BCG + ESAT-6 Exo and BCG Rv-Exo groups compared to the BCG group post-booster (Figure-9E), and NO production remained higher in both the BCG ESAT-6 Exo and BCG Rv-Exo groups at 6 weeks (Figure-9F) and 12 weeks post-infection (Figure-9G). These results indicate that the BCG + ESAT-6 Exo and BCG + Rv-Exo vaccines enhance NO production, contributing to a more robust and sustained immune response against tuberculosis. These findings suggest that vaccination effectively enhances nitric oxide and ROS levels, contributing to the host defense mechanisms against TB infection. The exosome-based vaccine for tuberculosis modulates ROS and NO levels, enhancing the long-term immune response against M.tb. and protecting against tissue damage by inducing bactericidal activity, thus making it a promising candidate for TB prevention. Prophylactic efficacy of vaccine Post-infection in the lungs, spleen, and lymph nodes of immunized mice The NF-κB regulates COX-2 and i-NOS to facilitate inflammatory responses, to evaluate inflammatory signaling. The Western blot analysis was performed using whole cell lysates from lungs, spleen, and lymph nodes from various groups of immunized mice and levels of COX-2, i-NOS, and NF-κB were compared between groups. In figure-9(H), the whole cell lysate of lung tissue shows the expression of COX-2 protein which is an inducible enzyme that plays a pivotal role in the inflammatory response during tuberculosis infection. Densitometry analysis was used to quantify the band intensities, which were normalized against tubulin and compared with the PBS control group. The results showed a significant increase in NF-κB expression across the vaccine candidates, Rv-Exo with showing a 1.05 fold increase and BCG + Rv-Exo a 1.8-fold increase. Interestingly, the BCG + Rv Exo and BCG-alone groups showed 1.7 and 2.1 fold increase. The expression of i-NOS is increasesed as shown by fold change in vaccinated groups, ESAT-6 Exo, BCG + ESAT-6-Exo, Rv-Exo and BCG + Rv-Exo respectively 9.81, 2.7, 5.2, and 9.1 as compared to the PBS group. The expression of Pirf-3, NF-κB, i-NOS, Cox-2, and loading control actin was evaluated in the whole cell lysate of spleen tissue (Figure-9I). The results showed a significant increase in pIrf-3 expression across the vaccine candidates, ESAT-6 Exo and BCG + ESAT-6 Exo showing a 1.16 and 1.33 fold increase, and Rv-Exo & BCG + Rv-Exo has 1.33 -fold increase. The expression of i-NOS molecule shows the increases in fold change in vaccinated groups ESAT-6 Exo, BCG + ESAT-6-Exo, Rv-Exo and BCG + Rv-Exo respectively 1.34, 1.56, 1.7 and 1.62 when compared to the PBS group. The expression of Cox-2 molecule shows an increase in fold change in the vaccinated group BCG + Rv-Exo (1.72) over the PBS group. The expression of i-NOS in lymphnodes of different vaccinated animals was also increased as determined by fold change in the intensity of bands in vaccinated groups ESAT-6 Exo, BCG + ESAT-6-Exo, Rv-Exo, and BC + Rv-Exo respectively 5.1, 7.8, 3.9 and 3.4 as compared to the PBS group (Figure-9J). These results are in line with the oxidative burst responses (Figure-9A-9G). Overall, these findings suggest that both Rv-Exo and BCG + Rv-Exo may have a stronger immunogenic potential, making them promising candidates for further vaccine development. The exosome-based vaccine reduces bacterial burden in vital organs In certain cases, though immunization leads to a strong immune response, the prophylactic efficacy of the candidate vaccine remains compromised. To test the potential of our exosome-based vaccines, we have challenged the vaccinated animals with M.tb and the protective efficacy was evaluated based on their ability to reduce bacterial loads in the lungs, spleen, and lymph nodes of immunized mice. As shown in Figure-10, groups immunized with ESAT-6-Exo or Rv-Exo with BCG demonstrated a significant reduction in bacterial burden compared to the PBS or BCG-alone group. At 6 weeks post-challenge, BCG followed by ESAT-6-Exo and Rv-Exo vaccination provided protection when compared to the PBS group (p < .001) in the lungs (Figure-10A). In case of spleen, ESAT-6-Exo and BCG + Rv-Exo vaccination reduce bacterial burden when compared to the PBS group (p < .001) (Figure-10B). In additionally, Lymph nodes showed the reduced in spleen mycobacterial load in BCG + ESAT-Exo and BCG + Rv-Exo log l0 1.7±. 0.35 and 1.4 ± 0.1386, respectively when compared to the PBS and only BCG group (p < .001) (Figure-10C). By the TWPC, animals immunized with BCG followed by ESAT-6 Exo and Rv-Exo exhibited a mycobacterial load that was log l0 1.71 ± 0.1028 & log l0 1.56 ± .098 lower than that of the PBS group in the lungs (Figure-10D). Similarly, with the spleen animals immunized with BCG followed by ESAT-6 Exo and Rv-Exo exhibited a mycobacterial load that was log l0 1.80 ± .1040 &log l0 1.82 ± 0.154 lower than that of the PBS and only BCG group (Figure-10E). In case of lymph nodes, booster groups showed the reduction of bacterial load that waslog l0 1.64 ± 0.226 and log l0 1.67 ± 0.52 lower than that of the PBS and only BCG group (Figure-10F). Notably, while the BCG + ESAT-Exo and BCG + Rv-Exo showed an increase in CFU count in the lungs at TWPC compared to the bacterial burden at 6 weeks post-challenge in all organs. The residual bacterial load data clearly establish the superiority of the booster in eliminating tuberculosis compared to other control immunized groups. Histopathology analysis suggest reduced tissue damage as well as bacterial burden in lungs of immunized animals : We investigated histopathological alterations and the presence of acid-fast bacilli in the lungs of infected mice to monitor tissue damage immune cell infiltration and overall disease progression (Figure-10G). In mice immunized with BCG followed by ESAT-6 Exo and Rv-Exo, acid-fast bacilli were scarcely observed within granulomas, primarily in areas of caseous necrosis. The bacilli number was significantly reduced compared to the PBS control group, which showed numerous bacilli dispersed throughout the lung parenchyma and within granulomas at TWPC (Figure-10G). This indicates that BCG followed by ESAT-6 Exo and Rv-Exo confers superior protection against tuberculosis, decreasing both bacterial burden and lung damage, compared to BCG alone and PBS. These findings underscore the potential of booster vaccine candidates as more effective strategies against tuberculosis, evidenced by improved histopathological outcomes and a lower prevalence of acid-fast bacilli in lung tissues. The observed reduction in TB-associated lung pathology and bacterial load signifies a stronger prophylactic effect, suggesting that this novel vaccine formulation may elicit a more robust immune response and enhance protective efficacy against TB infection. Discussion A number of approaches have been used to develop improved vaccines for TB, including proteins in adjuvants, modified BCG or viral vectors expressing mycobacterial antigens. There are currently 17 TB vaccine candidates in various phases of clinical trial ( ). These vaccine candidates fall under three broad categories: 1) recombinant BCG or other mycobacteria species, 2) viral vectors expressing various mycobacterial proteins, and 3) recombinant mycobacterial proteins in conjugation with robust adjuvants ( ). At present it remains unclear whether these vaccine candidates will provide the effectiveness required for TB control. Recent data indicates that the MVA85A does not provide efficacious protection when used as a booster vaccine in infants previously immunized with BCG ( ). Early reports with limited evidence suggest that exosomes may offer a novel approach to TB vaccine development. However, comprehensive studies to establish exosomes as viable candidates against tuberculosis remain largely unexplored. To establish the exosome-based vaccine, we employed M. tb -specific antigen bearing Rv-Exo and ESAT-6 Exo, which are absent in BCG, to investigate for their efficacy either as an independent vaccine or as BCG booster (Figure-11). The BCG vaccine, a gold standard for TB prevention, faces several significant challenges that limit its effectiveness. Its efficacy varies widely, ranging from 0–80%, influenced by geographic differences and pre-existing immunity from exposure to non-tuberculous mycobacteria, particularly showing lower effectiveness against pulmonary TB in adults ( ). Additionally, the immunity provided by BCG wanes over time, typically lasting only 10–20 years, which raises concerns about long-term protection, especially as susceptibility increases in young adults ( ). Furthermore, it lacks virulence factors containing T cell epitopes due to the deletion of RD regions, resulting in a "hiding and masking effect ( ). We proposed that supplementing the deleted gene products of BCG could control tuberculosis. To this end, we used M.tb.- infected cells derived Exosomes possessing M.tb. antigens which were absent in BCG as potential vaccine candidate either alone or as a BCG booster to amplify its immune prophylactic potency. In previous studies, CFP incubated RAW.2647 macrophages cells derived exosomes were used as vaccine candidates ( ). In another study the exosomes isolated from M.tb -infected macrophages have shown only immune modulatory activity ( ). Here, we have used alveolar macrophages infected with H37Rv and collected the exosomes from culture supernatant. Those exosomes found to carry 12 unique T cell antigens, to mention few Rv3887c, Rv1707, which were absent in BCG (Table-2). Hence, Rv-Exo could supplement BCG response with this immunity to boost its efficacy. The previous studies suggested that APC derived exosomes expressing antigen bearing MHC-I or MHC-II molecules directly interacted with CD8 and CD4 + T cells. However, these exosomes were not capable of activating T cells directly unless they delivered the antigens to APCs, which in turn can activate T cells ( ). The data of the present study suggests that exosomes derived from alveolar macrophages are capable to deliver the antigens either in cytosol by fusion with macrophages leading to MHC-1 presentation of antigens, hence, improved CTL response is expected. In contrary, exosomes were also found to be internalized by macrophages using endocytosis mechanism (Figure-1G). Our data corroborate the previous studies where it has been shown that exosomes may deliver the content by fusion or by endocytosis. In addition, recent studies suggest the exosomes may interact with target cells through lipid raft, so more exosomes may gather at lipid raft fragment of the membrane making them to fuse together, eventually larger vesicles come into existence ( ). BCG is known to lack T cell antigens containing RD region, hence do not provoke adequate CTL response. In our study, A strong Th1 polarization (IFN-ꝩ:IL-10), was detected in the BCG + ESAT-6 Exo and BCG + Rv-Exo groups, indicating effective cell-mediated immunity in compare to BCG alone, when compare at post booster as well as Post challenge (Figure-2). IFN-γ-producing Th1 cells typically drive the production of IgG2a antibodies. These findings underscore the importance of T cell-mediated immune responses in shaping antibody profiles and enhancing vaccine efficacy, especially in tuberculosis, where a robust Th1 response is critical for protection. The M.tb. antigen bearing exosomes have emerged as promising adjuvants in vaccine development due to their ability to effective antigen delivery and presentation to immune cells. Our data suggest that immunization protocol employing M. tb -specific antigens bearing exosomes, Rv-Exo, ESAT-6 Exo and their BCG booster counterparts, elevate IFN-γ level and increased IFN-γ:IL-10 ratio higher IgG2a: IgG1 ratio at post booster as well as post challenge in immunized animal suggestive of Th1 biased immune response (Figure-3). The histopathological analysis of lung tissues from mice immunized with BCG followed by ESAT-6 Exo and Rv-Exo reveals substantial improvements in disease outcomes relative to BCG alone or PBS control (Figure-10G). The marked reduction in acid-fast bacilli within granulomas and the overall decreased bacillary density indicates enhanced control of M.tb infection. This reduced bacterial burden, along with diminished lung tissue damage, suggests superior bacterial clearance and mitigation of TB-induced tissue destruction (Figure-10G). These findings underscore the potential of exosome-based booster vaccines to overcome the limitations of BCG. The observed histopathological improvements and reduced prevalence of acid-fast bacilli suggest a more comprehensive protective mechanism, likely engaging both innate and adaptive immune responses. Furthermore, the TBx21 upregulation indicates effective Th1 polarization in lungs and spleen of the BCG + ESAT-6 Exo and BCG + Rv-Exo treated mice (Figure-4). The cytokine levels in serum of immunized animals correspond with Tbet and GATA gene expression profile. The splenocytes isolated from BCG-immunized animals boosted with Rv exosomes or ESAT-6 Exo showed dose dependent pattern of T cell proliferation (Figure-8). The higher antigen doses did not only lead to greater stimulation indices but also improved IFN-ꝩ production, reflecting increased M.tb. specific T cell activation proportional to the antigen dosage, which was hampered in BCG alone group. The perturbed T cell activation may be attributed to the lack of T cell antigens in BCG, which was supplemented by injecting the T-cell antigen bearing Rv-Exo and ESAT-6 Exo. The results suggest that Rv-Exo and ESAT-6 Exo are supplementing BCG with T cell antigens. Further research is required to decipher key role of individual proteins present in the exosomes to identify the best antigens contributing to T cell immunity in BCG immunized mice boosted with Rv-Exo. It is well established that the T cell immune response is indispensable to control intracellular pathogen including M.tb . In our study, we found that higher CD3 + CD4 + as well as CD3 + CD8 + phenotype of T cell in splenocytes of Rv-Exo and ESAT-6 Exo-boosted BCG groups. Elevated IL-12 + TNF-α + CD4 + T cell phenotype in mice immunized with BCG boosted with ESAT-6 Exo and BCG boosted with Rv-Exo as compared to BCG alone indicates a Th-1 biased response that is implicated to play a crucial role in activating macrophages to control M. tb infection (Figure-5D-E, Figure-6A and D). The increased IL-12 levels also help in CTL induction, and is an indispensable immune response to combat M.tb. infection and provide protection. In addition, the CD4 + cells also demonstrated an elevated CD45RO expression, indicating their activation (Figure-5E). Tregs are essential for maintaining immune homeostasis and preventing excessive immune reactions that could lead to autoimmunity or chronic inflammation. The secretion of cytokines such as TGF-β and IL-10 by Treg cells modulates the activity of various immune cells, including effector T cells and antigen-presenting cells (APCs). The previous study shows that Exosomes derived from antigen-presenting cells or tumor cells can carry specific antigens and cytokines that may enhance Treg activation Reference. In our study, the BCG showed increased population of Treg cells as compared to free Ag vaccine candidate, however, BCG + ESAT-6 Exo and BCG + Rv-Exo vaccinations generated a stronger Treg immune cell response characterized by the increased secretion of IL-10 by antigen-stimulated T cells when compared to BCG alone (Figure-6H). This demonstrates immunomodulatory role of alveolar macrophages-derived exosomes in regulating the Treg cell population. This activation can lead to a more tolerogenic environment, which is particularly important in tuberculosis, where Treg-mediated suppression may help to balance the immune response and prevent tissue damage. This particular subset of cells has been identified as a correlate of vaccine-induced Th1-mediated protection and reported in other studies examining vaccine-induced protective immunity ( ). The activated T cells further differentiate into concurrent infection clearing effector memory T cells (TEM) and long-term immunity providing central memory T cells (TCM). Effector T cells population clonally contracts after infection clearance. In contrast, central memory T cells stay for longer duration and able to initiate rapid recall response during reinfection with same pathogen due to their lower activation threshold. Therefore, the establishment of immune memory is essential for the efficacy of T-cell during vaccination. In our study, CD4 + T cells derived from animals vaccinated with BCG + ESAT-6 Exo exhibited strong effector memory responses to M.tb. infection, characterized by high levels of CD44 + and low levels of CD62L expression on their surface (Figures- 7 A& 7 C), Meanwhile, CD4 + T cells from animals vaccinated with both BCG + ESAT-6 Exo and BCG + Rv-Exo demonstrated robust long-term central memory responses to infection, marked by high levels of CD44 and high levels of CD62L expression on their surface (Figures- 7 A & 7 B). In case of CD8 + T cells, the effector memory was heightened in ESAT-6 Exo, BCG + ESAT-6 Exo and Rv Exosome alone. Surprisingly, the Rv-Exo booster to BCG could not elevate central memory as well as population of CD8 + T cell (Figure-7D-F). This may be attributed to elevated Treg cells in this group (Figure-6H), as suggested by previous reports indicating Treg cells controlled the CD8 response by reducing the number and exhaustion of T cells . Migration of memory cells to lymph nodes might be another possibility of observed reduced central as well as effector memory population in Rv-Exo booster BCG group. Our vaccine candidates are focused on inducing central memory T-cell responses, which indicates that long-lasting and protective immunity can effectively combat future tuberculosis infections. We found the prophylactic efficacy after giving M.tb . vaccination. Interferon-gamma (IFN-γ) produced by T cells in response to M.tb. infection stimulates inducible nitric oxide synthase (i-NOS) in macrophages, leading to increased production of Nitric oxide (NO) (Figure-9). Vaccination with BCG or novel tuberculosis vaccine candidates can prime the immune system to mount a stronger Th1 response upon M.tb infection, characterized by increased IFN-γ production. In the context of M.tb. infection, there exists a dynamic interplay among inflammation signaling molecules, namely NF-κB, iNOS, and COX-2. NF-κB activation serves as a pivotal trigger in response to Mtb infection, orchestrating the expression of pro-inflammatory genes. This activation often leads to the upregulation of iNOS, prompting the production of nitric oxide (NO) as a part of the host's antimicrobial defense. However, excessive NO production can further stimulate NF-κB and induce COX-2 expression. COX-2, in turn, contributes to inflammation through the synthesis of prostaglandins, which can modulate the immune response against Mtb . Thus, NF-κB, iNOS, and COX-2 collectively regulate the inflammatory milieu during M.tb infection, shaping the host immune response and influencing the outcome of the infection (Figure-9). Our findings show that exosome-encapsulated vaccines, BCG + ESAT-6 Exo and BCG + Rv-Exo, significantly enhanced NO and ROS production in serum and spleen tissues of immunized mice, which was observed post-booster and at six week and twelve week post-challenge with M.tb . (Figure-9A-G). The elevated levels of NO and ROS in serum, lung and spleen tissue lysates of vaccinated and M.tb. challenged animals demonstrate the vaccine's effectiveness in enhancing the innate immune response to curb the bacterial population within the infected cells. We further assessed the role of these exosome-encapsulated vaccines in limiting the mycobacterial burden in three vital organs, including lungs, spleen and lymph nodes. The results indicate that only the BCG ESAT-6 Exo and BCG + Rv Exo treatments led to a significant decrease in bacterial load in the lungs of immunized animals by week 6 post-challenge, with a further reduction observed by week 12. Conversely, the Free ESAT-6 and BCG-only groups exhibited a significantly higher bacterial burden both at week 6 and 12 (Figures- 10 A & 10 D). Similarly, lower mycobacterial burden was observed in in spleen and lymph nodes of the BCG + ESAT-6 Exo and BCG + Rv-Exo treated mice, which was not seen in other immunized groups ( Figure-10 ). The Th-1 Skewed serum cytokine levels were also evident by Immunohistochemistry and cytokines production by splenocytes (Figure-2), greater IgG2a:IgG1 ratio (Figure-3), elevated population of dose dependent CD3 + CD4+, CD3 + CD8 + activated phenotype (Figure-5), CD45 + CD4 + phenotype of activated T cells, heightened CD4 and CD8 + T cells effector and central memory (Figure-7), and increased RNS and ROS response, likely due to reduced bacterial burden (Figure-9). Together, these data suggest that exosome-encapsulated vaccines confer long term protection against tuberculosis in mice. Reduces the load of M. tb in lungs, spleen and lymph nodes organs of mice that have been infected, thereby decreasing the bacterial presence and potentially limiting disease progression in these critical sites (Figure-10A-F). Studies indicate that the effectiveness of the BCG vaccine diminishes after approximately ten years, with limited evidence supporting its protective role in older populations. This decline in immunity underscores the need for new vaccines that can enhance BCG-induced protective immunity. Vaccinating with Rv Exo and ESAT-6 Exo as a booster alongside with BCG may enhance the immune response against tuberculosis. Studies indicate that booster vaccination can improve the activation of dendritic cells and promote a stronger T-cell response, particularly a Th1-mediated response ( ). Exosome-based vaccine candidates offer significant advantages, such as biocompatibility, enhanced antigen presentation, and immunocompitability with the immune system. This can lead to stronger immune responses, innate immune responses due to adjuvant potential which further can lead to enhance CD4 + T helper cells and CD8 + T cells (CTL) immune responses, providing long-lasting protection against pathogens. The exosome was found to partially restore the function of exhausted T cells ( ). However, challenges remain in using exosomes as a vaccine candidate due to batch-to-batch variations, raising concerns about the consistency and reliability of exosomes-based vaccines. This problem could be mitigated by antigen/multiple antigens encapsulation as we employed for ESAT-6 Exo. M. bovis infects humans through zoonotic transmission. Notably, the live attenuated form of M. bovis i.e. BCG remains a virulent due to loss of various virulent factors including T cell antigens. These virulent factors are present in wild type M.bovis , and M. tb that leads to reduce T cell immunity in BCG immunized individuals. The experiments, conducted in animals, in this study as well as earlier studies suggest that boosting BCG with T cell antigens could improve prophylactic efficacy of BCG vaccine. Further we are conducting clinical experiments where PBMCs from the TB patients are sensitized using exosomes isolated from M.tb H37Rv infected THP-1, A549 or HEK293 cells or exosomes isolated from TB patients. So that would established if M.tb specific T cell antigen bearing exosomes could be utilized to boost BCG immune response and prophylactic efficacy in vaccinated individuals. In summary, Our findings indicate that the exosome-based vaccine approach not only effectively addresses the limitations associated with traditional adjuvants but also enhances the induction of both CD4 + and CD8 + T cell responses. This dual activation is crucial for developing a more effective tuberculosis vaccine, capable of providing long-lasting protective immunity. The observed elevation of Th1 immune responses in Ex-vaccinated animals underscores the potential of the exosome platform to improve vaccine efficacy against tuberculosis. Specifically, the exosome-encapsulated vaccines successfully entrapped the ESAT-6 antigen, a critical virulence factor of M.tb , which is known to elicit a robust immune response. The incorporation of ESAT-6 into exosomes derived from infected cells dynamically enhanced Th1 immune responses, characterized by increased production of pro-inflammatory cytokines and the activation of cytotoxic T lymphocytes. The elevation of Th1 responses is particularly significant, as it indicates a shift towards a more effective cell-mediated immunity, essential for controlling and eliminating M.tb infections. This response is vital for developing a protective immune profile that can react swiftly and effectively upon re-exposure to the pathogen. The ability of our exosome-based vaccine candidates to boost Th1 responses suggests that they may provide a promising alternative to traditional vaccination strategies, especially in populations where the efficacy of the BCG vaccine is limited. Furthermore, the use of exosomes as a delivery system not only enhances antigen presentation but also facilitates the targeted activation of immune cells, thereby improving the overall immunogenicity of the vaccine. This targeted approach allows for a more precise modulation of the immune response, potentially overcoming some of the drawbacks associated with conventional adjuvants. By addressing the urgent need for improved tuberculosis mitigation strategies, this work paves the way for the development of more effective vaccines that could potentially enhance protective immunity against tuberculosis. Declarations Conflict of interest: The authors do not have any financial or intellectual conflicts of interest to declare. All coauthors seen and agreed with the contents of the manuscript. Author Contribution Conceptualization: MAA; MS, Formal Analysis: MAA; MS; Data Curation: MAA; MS; SMA; BSL-3 Experimentation: MAA; MS; SA; AKS; Methodology & Experimentation: MAA; MS; SA; MA; Software and validation: MAA; MS, SK; Supervision, Funding and project administration: MAA; Resources: MAA; AKS; MIA; Investigation: MAA, MS, ; Original draft: MS; MAA; Review and editing: MS; MAA; SMA; MS, MIA. Acknowledgement The authors would like to thank the CIF, Jamia Hamdard, for providing the necessary facilities, Director ICMR-JALMA Institute for Leprosy and OMD for supplying M.tb. H37Rv, BCG, and access to ABSL-3 facility. MAA acknowledges the DBT Ramalingaswami Fellowship (BT/RLF/Re-entry/15/2015) and DST-SERB (ECR/2017/003016) for financial support. Ms. MS acknowledges DST INSPIRE for financial support as fellowship (IF-190671). Data Availability Our manuscript has data included as electronic supplementary material. References i. Mohammadnabi, N., Shamseddin, J., Emadi, M., Bodaghi, A. B., Varseh, M., Shariati, A., Rezaei, M., Dastranj, M., & Farahani, A. (2024). Mycobacterium tuberculosis: The Mechanism of Pathogenicity, Immune Responses, and Diagnostic Challenges. Journal of Clinical Laboratory Analysis. https://doi.org/10.1002/jcla.25122 ii. Global Programme on Tuberculosis and Lung Health (GTB). (2021, October 14). Global tuberculosis report 2021. https://www.who.int/publications/i/item/9789240037021. iii. Lee, J. Y. (2015). Diagnosis and treatment of extrapulmonary tuberculosis. Tuberculosis & Respiratory Diseases, 78(2), 47. https://doi.org/10.4046/trd.2015.78.2.47. iv. Sharma, S. K., Vashishtha, R., Chauhan, L. S., Sreenivas, V., & Seth, D. (2017). Comparison of TST and IGRA in diagnosis of latent tuberculosis infection in a high TB-Burden setting. PLoS ONE, 12(1), e0169539. https://doi.org/10.1371/journal.pone.0169539 v. Bacille Calmette-Guérin (BCG) vaccine for tuberculosis. (2025, January 31). Tuberculosis (TB). https://www.cdc.gov/tb/hcp/vaccines/index.html. vi. Ramírez-Rueda, R. Y. (2016). Mycobacterium tuberculosis: clinical and microbiological aspects. In The Microbiology of Respiratory System Infections (pp. 153-166). Academic Press. vii. Centers for Disease Control and Prevention, American Thoracic Society, CDC, and Infectious Diseases Society of America, Centers for Disease Control and Prevention, J. L., Fleming, D. W., Snider, D. E., Thacker, S. B., Ward, J. W., Hewitt, S. M., Smith-Akin, C. K., McIntyre, L., Holland, B. J., Heilman, M. A., Doan, Q. M., Shaver, E. R., & Iseman, M. (2003). Treatment of tuberculosis. In Morbidity and Mortality Weekly Report (Vol. 52, Issue RR-11). https://www.cdc.gov/mmwr/pdf/rr/rr5211.pdf. viii. Seung, K. J., Keshavjee, S., & Rich, M. L. (2015). Multidrug-Resistant tuberculosis and extensively Drug-Resistant tuberculosis. Cold Spring Harbor Perspectives in Medicine , 5 (9), a017863. https://doi.org/10.1101/cshperspect.a017863 ix. Ohara, N. (2012). Current status of tuberculosis and recombinant bacillus Calmette-Guérin vaccines. Journal of Oral Biosciences , 54 (2), 92–95. https://doi.org/10.1016/j.job.2012.04.002. x. Samten, B., Wang, X., & Barnes, P. F. (2009). Mycobacterium tuberculosis ESX-1 system-secreted protein ESAT-6 but not CFP10 inhibits human T-cell immune responses. Tuberculosis (Edinburgh, Scotland) , 89 Suppl 1 , S74–S76. https://doi.org/10.1016/S1472-9792(09)70017-4 xi. World Health Organization. (2022). Global Tuberculosis Report 2022. https://cdn.who.int/media/docs/default-source/hq-tuberculosis/global-tuberculosis-report-2022/global-tb-report-2022-factsheet.pdf?sfvrsn=88f8d76_8&download=true xii. New TB vaccine research . (n.d.). https://www.who.int/teams/global-tuberculosis-programme/research-innovation/vaccines. xiii. Clem, A. S. (2011). Fundamentals of vaccine immunology. Journal of Global Infectious Diseases, 3(1), 73. https://doi.org/10.4103/0974-777x.77299 xiv. Li, F., Dang, W., Du, Y., Xu, X., He, P., Zhou, Y., & Zhu, B. (2024). Tuberculosis vaccines and T cell immune memory. Vaccines, 12(5), 483. https://doi.org/10.3390/vaccines12050483 xv. Chandra, P., Grigsby, S. J., & Philips, J. A. (2022). Immune evasion and provocation by Mycobacterium tuberculosis. Nature Reviews Microbiology, 20(12), 750–766. https://doi.org/10.1038/s41579-022-00763-4 xvi. Zhou, X., Huang, J., Zhang, D., Qian, Z., Zuo, X., & Sun, Y. (2025). Small extracellular vesicles: the origins, current status, future prospects, and applications. Stem Cell Research & Therapy, 16(1). https://doi.org/10.1186/s13287-025-04330-5 xvii. Biadglegne, F., König, B., Rodloff, A. C., Dorhoi, A., & Sack, U. (2021). Composition and Clinical Significance of exosomes in tuberculosis: A systematic literature review. Journal of Clinical Medicine, 10(1), 145. https://doi.org/10.3390/jcm10010145 xviii. Tan, D., Li, G., Fu, W., & Lei, C. (2024). Exosomes: the next frontier in vaccine development and delivery. Frontiers in Immunology, 15. https://doi.org/10.3389/fimmu.2024.1435426 xix. Lener, T., Gimona, M., Aigner, L., Börger, V., Buzas, E., Camussi, G., Chaput, N., Chatterjee, D., Court, F. A., Del Portillo, H. A., O’Driscoll, L., Fais, S., Falcon-Perez, J. M., Felderhoff-Mueser, U., Fraile, L., Gho, Y. S., Görgens, A., Gupta, R. C., Hendrix, A., . . . Giebel, B. Applying extracellular vesicles based therapeutics in clinical trials – an ISEV position paper. Journal of Extracellular Vesicles, 4(1). https://doi.org/10.3402/jev.v4.30087 (2015). xx. Huda, M. N., & Nurunnabi, M. (2022). Potential application of exosomes in vaccine development and delivery. Pharmaceutical Research, 39(11), 2635-2671 xxi. Ansari, M. A., Zubair, S., Mahmood, A., Gupta, P., Khan, A. A., Gupta, U. D., Arora, A., & Owais, M. (2011). RD Antigen Based Nanovaccine Imparts Long Term Protection by Inducing Memory Response against Experimental Murine Tuberculosis. PLoS ONE, 6(8), e22889. https://doi.org/10.1371/journal.pone.0022889. xxii. Singh, V. V., Kerur, N., Bottero, V., Dutta, S., Chakraborty, S., Ansari, M. A., Paudel, N., Chikoti, L., & Chandran, B. (2013). Kaposi’s Sarcoma-Associated herpesvirus latency in endothelial and B cells activates gamma Interferon-Inducible protein 16-Mediated inflammasomes. Journal of Virology, 87(8), 4417–4431. https://doi.org/10.1128/jvi.03282-12 xxiii. Ansari, M. A., Singh, V. V., Dutta, S., Veettil, M. V., Dutta, D., Chikoti, L., Lu, J., Everly, D., & Chandran, B. (2013). Constitutive Interferon-Inducible Protein 16-Inflammasome Activation during Epstein-Barr Virus Latency I, II, and III in B and Epithelial Cells. Journal of Virology, 87(15), 8606–8623. https://doi.org/10.1128/jvi.00805-13 xxiv. Bachurski, D., Schuldner, M., Nguyen, P., Malz, A., Reiners, K. S., Grenzi, P. C., Babatz, F., Schauss, A. C., Hansen, H. P., Hallek, M., & Von Strandmann, E. P. (2019). Extracellular vesicle measurements with nanoparticle tracking analysis – An accuracy and repeatability comparison between NanoSight NS300 and ZetaView. Journal of Extracellular Vesicles, 8(1). https://doi.org/10.1080/20013078.2019.1596016 xxv. Mitra, D. K., De Rosa, S. C., Luke, A., Balamurugan, A., Khaitan, B. K., Tung, J., Mehra, N. K., Terr, A. I., O'Garra, A., Herzenberg, L. A., & Roederer, M. (1999). Differential representations of memory T cell subsets are characteristic of polarized immunity in leprosy and atopic diseases. International immunology, 11(11), 1801–1810. https://doi.org/10.1093/intimm/11.11.1801. xxvi. Li, Y., Zeng, J., Shi, J., Wang, M., Rao, M., Xue, C., Du, Y., & He, Z. (2010). A Proteome-Scale Identification of Novel Antigenic Proteins in Mycobacterium tuberculosis toward Diagnostic and Vaccine Development. Journal of Proteome Research, 9(9), 4812–4822. https://doi.org/10.1021/pr1005108 xxvii. Long, Y., Wang, B., Xie, T., Luo, R., Tang, J., Deng, J., & Wang, C. (2023). Overexpression of efflux pump genes is one of the mechanisms causing drug resistance in Mycobacterium tuberculosis. Microbiology Spectrum, 12(1). https://doi.org/10.1128/spectrum.02510-23 xxviii. Small, J. L., Park, S. W., Kana, B. D., Ioerger, T. R., Sacchettini, J. C., & Ehrt, S. (2013). Perturbation of Cytochrome c Maturation Reveals Adaptability of the Respiratory Chain in Mycobacterium tuberculosis. mBio, 4(5). https://doi.org/10.1128/mbio.00475-13 xxix. Parish, T. (2014). Two-Component regulatory systems of mycobacteria. Microbiology Spectrum, 2(1). https://doi.org/10.1128/microbiolspec.mgm2-0010-2013 xxx. Kim, S., Shin, A., Lee, B., Kim, H., Jeon, B. Y., Cho, S., Park, J., & Shin, S. J. (2009). Characterization of Immune Responses to Mycobacterium tuberculosis Rv2041c Protein. Journal of Bacteriology and Virology, 39(3), 183. https://doi.org/10.4167/jbv.2009.39.3.183 xxxi. Sharma, N., Shariq, M., Quadir, N., Singh, J., Sheikh, J. A., Hasnain, S. E., & Ehtesham, N. Z. (2021). Mycobacterium tuberculosis Protein PE6 (Rv0335c), a Novel TLR4 Agonist, Evokes an Inflammatory Response and Modulates the Cell Death Pathways in Macrophages to Enhance Intracellular Survival. Frontiers in Immunology, 12. https://doi.org/10.3389/fimmu.2021.696491 xxxii. Lunge, A., Gupta, R., Choudhary, E., & Agarwal, N. (2020). The unfoldase ClpC1 of Mycobacterium tuberculosis regulates the expression of a distinct subset of proteins having intrinsically disordered termini. Journal of Biological Chemistry, 295(28), 9455–9473. https://doi.org/10.1074/jbc.ra120.013456 xxxiii. Harold, L. K., Antoney, J., Ahmed, F. H., Hards, K., Carr, P. D., Rapson, T., Greening, C., Jackson, C. J., & Cook, G. M. (2018). FAD-sequestering proteins protect mycobacteria against hypoxic and oxidative stress. Journal of Biological Chemistry, 294(8), 2903–5814. https://doi.org/10.1074/jbc.ra118.006237 xxxiv. Cole, S. T., Brosch, R., Parkhill, J., Garnier, T., Churcher, C., Harris, D., Gordon, S. V., Eiglmeier, K., Gas, S., Barry, C. E., Tekaia, F., Badcock, K., Basham, D., Brown, D., Chillingworth, T., Connor, R., Davies, R., Devlin, K., Feltwell, T., . . . Barrell, B. G. (1998b). Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature, 393(6685), 537–544. https://doi.org/10.1038/31159 xxxv. Domenech, P., Reed, M. B., & Barry, C. E. (2005). Contribution of theMycobacterium tuberculosisMMPL protein family to virulence and drug resistance. Infection and Immunity, 73(6), 3492–3501. https://doi.org/10.1128/iai.73.6.3492-3501.2005 xxxvi. Cayabyab, M. J., Macovei, L., & Campos-Neto, A. (2012). Current and novel approaches to vaccine development against tuberculosis. Frontiers in Cellular and Infection Microbiology, 2. https://doi.org/10.3389/fcimb.2012.00154. xxxvii. Romano, M., Squeglia, F., Kramarska, E., Barra, G., Choi, H. G., Kim, H. J., ... & Berisio, R. (2023). A structural view at vaccine development against M. tuberculosis. Cells, 12(2), 317. xxxviii. Whelan, K. T., Pathan, A. A., Sander, C. R., Fletcher, H. A., Poulton, I., Alder, N. C., Hill, A. V. S., & McShane, H. (2009). Safety and Immunogenicity of Boosting BCG Vaccinated Subjects with BCG: Comparison with Boosting with a New TB Vaccine, MVA85A. PLoS ONE, 4(6), e5934. https://doi.org/10.1371/journal.pone.0005934 xxxix. Brandt, L., Cunha, J. F., Olsen, A. W., Chilima, B., Hirsch, P., Appelberg, R., & Andersen, P. (2002). Failure of the Mycobacterium bovis BCG vaccine: Some species of environmental mycobacteria block multiplication of BCG and induction of protective immunity to tuberculosis. Infection and Immunity, 70(2), 672–678. https://doi.org/10.1128/iai.70.2.672-678.2002. xl. Setiabudiawan, T. P., Reurink, R. K., Hill, P. C., Netea, M. G., Van Crevel, R., & Koeken, V. A. (2021). Protection against tuberculosis by Bacillus Calmette-Guérin (BCG) vaccination: A historical perspective. Med, 3(1), 6–24. https://doi.org/10.1016/j.medj.2021.11.006 xli. Kuan, R., Muskat, K., Peters, B., & Arlehamn, C. S. L. (2020). Is mapping the BCG vaccine-induced immune responses the key to improving the efficacy against tuberculosis? Journal of Internal Medicine, 288(6), 651–660. https://doi.org/10.1111/joim.13191 xlii. Cheng, Y., & Schorey, J. S. (2013). Exosomes carrying mycobacterial antigens can protect mice against Mycobacterium tuberculosis infection. European Journal of Immunology, 43(12), 3279–3290. https://doi.org/10.1002/eji.201343727 xliii. Singh, P. P., Smith, V. L., Karakousis, P. C., & Schorey, J. S. (2012). Exosomes Isolated from Mycobacteria-Infected Mice or Cultured Macrophages Can Recruit and Activate Immune Cells In Vitro and In Vivo. The Journal of Immunology, 189(2), 777–785. https://doi.org/10.4049/jimmunol.1103638 xliv. Zeng, F., & Morelli, A. E. (2018). Extracellular vesicle-mediated MHC cross-dressing in immune homeostasis, transplantation, infectious diseases, and cancer. Seminars in Immunopathology, 40(5), 477–490. https://doi.org/10.1007/s00281-018-0679-8. xlv. Valapala, M., & Vishwanatha, J. K. (2011). Lipid raft endocytosis and exosomal transport facilitate extracellular trafficking of annexin A2. Journal of Biological Chemistry, 286(35), 30911–30925. https://doi.org/10.1074/jbc.m111.271155 xlvi. Rivera-Hernandez, T., Rhyme, M. S., Cork, A. J., Jones, S., Segui-Perez, C., Brunner, L., Richter, J., Petrovsky, N., Lawrenz, M., Goldblatt, D., Collin, N., & Walker, M. J. (2020b). Vaccine-Induced Th1-Type Response Protects against Invasive Group A Streptococcus Infection in the Absence of Opsonizing Antibodies. mBio, 11(2). https://doi.org/10.1128/mbio.00122-20 xlvii. Dicharry, D., & Malek, A. E. (2025). Unlocking the Role of Treg Cells Immune Response and Infectious Risk Following CAR T-Cell Therapy in Patients with Cancer. International Journal of Molecular Sciences , 26 (4), 1602. https://doi.org/10.3390/ijms26041602. xlviii. Zhao, T., Cai, Y., Jiang, Y., He, X., Wei, Y., Yu, Y., & Tian, X. (2023). Vaccine adjuvants: mechanisms and platforms. Signal Transduction and Targeted Therapy, 8(1). https://doi.org/10.1038/s41392-023-01557-7 xlix. Li, P., Xie, Y., Wang, J., Bao, C., Duan, J., Liu, Y., Luo, Q., Xu, J., Ren, Y., Jiang, M., Li, J., Guo, H., Zhao, H., Wang, G., Liang, Y., & Lu, W. (2024). Gene engineered exosome reverses T cell exhaustion in cancer immunotherapy. Bioactive Materials, 34, 466–481. https://doi.org/10.1016/j.bioactmat.2024.01.008. Supplementary Tables Supplementary Tables 1-3 are not available with this version. Additional Declarations No competing interests reported. Supplementary Files s1tiff.pdf s21tiff.pdf controlMadewithClipchamp1.mp4 Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7579467","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":521697046,"identity":"d225d2c6-3f3f-458c-bfd6-a1d9900e211a","order_by":0,"name":"Manu Sharma","email":"","orcid":"","institution":"Jamia Hamdard","correspondingAuthor":false,"prefix":"","firstName":"Manu","middleName":"","lastName":"Sharma","suffix":""},{"id":521697047,"identity":"f3216844-985f-4540-b2aa-a28a3b7737f0","order_by":1,"name":"Sher Afghan","email":"","orcid":"","institution":"Jamia Hamdard","correspondingAuthor":false,"prefix":"","firstName":"Sher","middleName":"","lastName":"Afghan","suffix":""},{"id":521697048,"identity":"c32665d5-5511-4a1a-be63-cec42fb998e2","order_by":2,"name":"Amit Singh","email":"","orcid":"","institution":"National JALMA Institute for Leprosy \u0026 Other Mycobacterial Diseases","correspondingAuthor":false,"prefix":"","firstName":"Amit","middleName":"","lastName":"Singh","suffix":""},{"id":521697049,"identity":"287e4b05-12a6-42c6-9d11-e2ea495bb259","order_by":3,"name":"Iqbal Alam","email":"","orcid":"","institution":"Jamia Hamdard","correspondingAuthor":false,"prefix":"","firstName":"Iqbal","middleName":"","lastName":"Alam","suffix":""},{"id":521697050,"identity":"353f451c-0135-4504-b3ff-cc048b60574e","order_by":4,"name":"Meetu Agarwal","email":"","orcid":"","institution":"Jamia Hamdard","correspondingAuthor":false,"prefix":"","firstName":"Meetu","middleName":"","lastName":"Agarwal","suffix":""},{"id":521697051,"identity":"170ea430-7955-4b4f-a4b7-c1a15ade6233","order_by":5,"name":"Mohd Shahid","email":"","orcid":"","institution":"Rosalind Franklin University of Medicine and Science","correspondingAuthor":false,"prefix":"","firstName":"Mohd","middleName":"","lastName":"Shahid","suffix":""},{"id":521697052,"identity":"d1c298c3-0397-40d2-bdd7-dafe42b7c904","order_by":6,"name":"Muhammad Atif Sheikh","email":"","orcid":"","institution":"University of Colorado Anschutz Medical Campus","correspondingAuthor":false,"prefix":"","firstName":"Muhammad","middleName":"Atif","lastName":"Sheikh","suffix":""},{"id":521697053,"identity":"050fba7f-6964-4811-9c3e-b12d17395d16","order_by":7,"name":"Saif Khan","email":"","orcid":"","institution":"Jamia Hamdard","correspondingAuthor":false,"prefix":"","firstName":"Saif","middleName":"","lastName":"Khan","suffix":""},{"id":521697054,"identity":"37577477-9e27-4c57-be29-c7cd139c74c5","order_by":8,"name":"Saima Malik Syed","email":"","orcid":"","institution":"Jamia Hamdard","correspondingAuthor":false,"prefix":"","firstName":"Saima","middleName":"Malik","lastName":"Syed","suffix":""},{"id":521697055,"identity":"66c29d84-837a-413f-b980-1da18d45d74a","order_by":9,"name":"Vengala Rao Yenuganti","email":"","orcid":"","institution":"SRM University, Andhra Pradesh","correspondingAuthor":false,"prefix":"","firstName":"Vengala","middleName":"Rao","lastName":"Yenuganti","suffix":""},{"id":521697056,"identity":"d5903ba8-ba7e-4c6e-9c29-378d59bd32e2","order_by":10,"name":"Mairaj Ahmed Ansari","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABI0lEQVRIie3OsUoDMRjA8RwH6ZJe1wsZ+goRQSjV+ioJgZuiFgqH0KFxyY1uUhd9hSsHzgc3dPC4WclSFx/ATtIbTMXhhnjiJnj/ISHh+5EA0NX1F8u/dthTDAAK7GJXAPd3nmonKP8tASH73JrEXWAe+XZaTy4CvHl5e5pOzgc3xWp7GYPhQPl64yC4OsvIrRYjTZggkopZaKIZLitwsMy9hDoILfsp6SufQsKYJT5XRlJ8pYGXAk+HbpLtUL2gEOdiJ+mC3xt5+G7JaQt5IAgWFIYgsq8UPDXyaP8K/45gS8Z9vaYQsWgs6ZqvTBSPVBWKZeEmgf2YQfWcDpNSGFnP+Z0R2bOKj0+uk+TVRRoh1jzZYb993tbLfxzp6urq+p99AMsEZA6Jh0DOAAAAAElFTkSuQmCC","orcid":"","institution":"Jamia Hamdard","correspondingAuthor":true,"prefix":"","firstName":"Mairaj","middleName":"Ahmed","lastName":"Ansari","suffix":""}],"badges":[],"createdAt":"2025-09-10 06:38:36","currentVersionCode":1,"declarations":{"humanSubjects":false,"vertebrateSubjects":false,"conflictsOfInterestStatement":false,"humanSubjectEthicalGuidelines":false,"humanSubjectConsent":false,"humanSubjectClinicalTrial":false,"humanSubjectCaseReport":false,"vertebrateSubjectEthicalGuidelines":false},"doi":"10.21203/rs.3.rs-7579467/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7579467/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":92430314,"identity":"761f1c3d-29c9-4b1e-994d-d185bf79091f","added_by":"auto","created_at":"2025-09-29 15:55:12","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1264960,"visible":true,"origin":"","legend":"","description":"","filename":"FinalTBvaccinemanuscript.docx","url":"https://assets-eu.researchsquare.com/files/rs-7579467/v1/0718288e6323422fe111935d.docx"},{"id":92428925,"identity":"61f9b4ad-d4e3-41ea-aa18-811e473f0162","added_by":"auto","created_at":"2025-09-29 15:39:12","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":11606,"visible":true,"origin":"","legend":"","description":"","filename":"a553c292f162490dafbb50ac4a18425e.json","url":"https://assets-eu.researchsquare.com/files/rs-7579467/v1/75422701bdca743159d71d80.json"},{"id":92430461,"identity":"ab71c440-e9c3-463f-ab3b-c9be0fd1e7c8","added_by":"auto","created_at":"2025-09-29 16:05:02","extension":"mp4","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5331002,"visible":true,"origin":"","legend":"","description":"","filename":"controlMadewithClipchamp1.mp4","url":"https://assets-eu.researchsquare.com/files/rs-7579467/v1/f2d7c7d707962b8790f5d581.mp4"},{"id":92429506,"identity":"68f0d31c-efc5-45d5-830d-653c96ef788f","added_by":"auto","created_at":"2025-09-29 15:47:12","extension":"pdf","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":177703,"visible":true,"origin":"","legend":"","description":"","filename":"s1tiff.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7579467/v1/2ef2ac80ccca40817d421b4b.pdf"},{"id":92428937,"identity":"76a58191-3652-4722-bea0-dbde84d1d33f","added_by":"auto","created_at":"2025-09-29 15:39:12","extension":"pdf","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":413853,"visible":true,"origin":"","legend":"","description":"","filename":"s21tiff.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7579467/v1/fa4afede7513372450062c25.pdf"},{"id":92428947,"identity":"fa15442f-faf7-4f33-bff4-f3cb81b182d1","added_by":"auto","created_at":"2025-09-29 15:39:12","extension":"xml","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":157002,"visible":true,"origin":"","legend":"","description":"","filename":"a553c292f162490dafbb50ac4a18425e1enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7579467/v1/5a94d8134e849cb68bb34330.xml"},{"id":92428934,"identity":"421f982a-c0db-4e52-beb7-b50d7d1d1a1c","added_by":"auto","created_at":"2025-09-29 15:39:12","extension":"jpeg","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":100263,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7579467/v1/f427f7bb86479d73ca508d61.jpeg"},{"id":92428939,"identity":"c39c33f7-847d-41f6-8b61-87dfbf1899aa","added_by":"auto","created_at":"2025-09-29 15:39:12","extension":"jpeg","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":130116,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage10.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7579467/v1/9b6b5797a0c3cdee91b9f67a.jpeg"},{"id":92430317,"identity":"52c404ff-5dee-4c14-a38e-a1a50170e433","added_by":"auto","created_at":"2025-09-29 15:55:12","extension":"jpeg","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":205784,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7579467/v1/0546f890d701efa9bd847134.jpeg"},{"id":92430470,"identity":"9d4af948-4d06-4047-8aad-8981c5f69637","added_by":"auto","created_at":"2025-09-29 16:05:09","extension":"jpeg","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":70440,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7579467/v1/90adbe9a18aa60cfee39373b.jpeg"},{"id":92429512,"identity":"bac6ff3b-4b38-47aa-ac13-a13765c463bf","added_by":"auto","created_at":"2025-09-29 15:47:12","extension":"jpeg","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":70152,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7579467/v1/6307d16802a6508e15b16886.jpeg"},{"id":92429509,"identity":"2018ef61-0f24-4338-9fc1-a6226300a013","added_by":"auto","created_at":"2025-09-29 15:47:12","extension":"jpeg","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":73886,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7579467/v1/db3c17d949ba2d1d8018ff33.jpeg"},{"id":92428958,"identity":"bdec2647-3e38-4fec-a6a6-9a0b88756623","added_by":"auto","created_at":"2025-09-29 15:39:12","extension":"jpeg","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":255676,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7579467/v1/c8b87fa829baf9c780d9b314.jpeg"},{"id":92428940,"identity":"0eb87e11-0d8c-49b3-91d6-e4639f7bafe0","added_by":"auto","created_at":"2025-09-29 15:39:12","extension":"jpeg","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":81043,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7579467/v1/0fa8834c72330bef148389ec.jpeg"},{"id":92430318,"identity":"d1accc78-437c-42ee-99e3-d4a359a0acc0","added_by":"auto","created_at":"2025-09-29 15:55:12","extension":"jpeg","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":22564,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage8.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7579467/v1/ddceeb6e37039537e6765d60.jpeg"},{"id":92430474,"identity":"41fc36f3-983a-410e-94b6-b13b78f95935","added_by":"auto","created_at":"2025-09-29 16:05:11","extension":"jpeg","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":161418,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage9.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7579467/v1/1491c67c3a6c7a4c8168cf52.jpeg"},{"id":92428949,"identity":"08f5efcd-9e92-4e21-b06e-ab1e5f4c8371","added_by":"auto","created_at":"2025-09-29 15:39:12","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":74530,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7579467/v1/ca13b15641feb7aa74028cfb.png"},{"id":92430320,"identity":"357b9d51-23fd-4036-9e78-5fda303ac484","added_by":"auto","created_at":"2025-09-29 15:55:12","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":132640,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage10.png","url":"https://assets-eu.researchsquare.com/files/rs-7579467/v1/ac68170dcca13ec6b0ab78c5.png"},{"id":92430323,"identity":"d4530dc6-a40f-4a0d-b9dd-9bc0ca499338","added_by":"auto","created_at":"2025-09-29 15:55:12","extension":"png","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":175158,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7579467/v1/5ef86cecbad675262fb9feab.png"},{"id":92428955,"identity":"274625ad-c593-4636-bc15-83c1f7e3e93e","added_by":"auto","created_at":"2025-09-29 15:39:12","extension":"png","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":37026,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7579467/v1/b459c18265e15998f77fbd69.png"},{"id":92428962,"identity":"7ee03c41-dd2c-4ce5-b909-ee49ffecb1cc","added_by":"auto","created_at":"2025-09-29 15:39:12","extension":"png","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":39371,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7579467/v1/7b9ced891e3ee218bbb1c315.png"},{"id":92428941,"identity":"5566b857-5869-44b3-bf61-ffd2d376e82e","added_by":"auto","created_at":"2025-09-29 15:39:12","extension":"png","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":38995,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7579467/v1/b461a2b67a80273bafacba05.png"},{"id":92428964,"identity":"26aa88e7-20dd-4db5-b52a-7e60967d13cd","added_by":"auto","created_at":"2025-09-29 15:39:13","extension":"png","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":139326,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7579467/v1/d9d29d9d5f77b2d16815a082.png"},{"id":92428959,"identity":"f1f32d3d-3bf5-489a-8211-7aecffd0b391","added_by":"auto","created_at":"2025-09-29 15:39:12","extension":"png","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":42679,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-7579467/v1/cff47075e14069322652b0fd.png"},{"id":92428960,"identity":"9e331adb-c3b7-49eb-8194-6a99db8e3228","added_by":"auto","created_at":"2025-09-29 15:39:12","extension":"png","order_by":24,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":12776,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-7579467/v1/d7423d6459420f4f4d1aa3ae.png"},{"id":92428957,"identity":"6472bec8-92f4-460d-adf2-014eaae6cd89","added_by":"auto","created_at":"2025-09-29 15:39:12","extension":"png","order_by":25,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":67256,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage9.png","url":"https://assets-eu.researchsquare.com/files/rs-7579467/v1/6282f9ad7951d38381806ad5.png"},{"id":92429519,"identity":"c886aede-99f9-496f-a23c-05107b42feec","added_by":"auto","created_at":"2025-09-29 15:47:12","extension":"xml","order_by":26,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":154453,"visible":true,"origin":"","legend":"","description":"","filename":"a553c292f162490dafbb50ac4a18425e1structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7579467/v1/2b7bd99b2cfffde071dddabe.xml"},{"id":92428961,"identity":"c5df40ea-cbd9-4a75-9d79-2e2a6e152d14","added_by":"auto","created_at":"2025-09-29 15:39:12","extension":"html","order_by":27,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":168523,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7579467/v1/d216b2b362e9e0463332cb0d.html"},{"id":92428924,"identity":"a1b6c790-0557-4998-9713-a3827d43edd9","added_by":"auto","created_at":"2025-09-29 15:39:12","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":100263,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIsolation and characterization of exosomes for their size, origin, purity and delivery method:\u003c/strong\u003e The exosomes were isolated from murine alveolar macrophage either left uninfected (UI-Exo) or infected with 5MOI of \u003cem\u003eM.tb.\u003c/em\u003eH37Rv (Rv-Exo) by ultracentrifugation were subjected to size depiction by TEM (A)UI-Exo and (B) Rv-Exo. The NTA-ZetaView analysisof UI-Exo (C) and Rv-Exo (D) depicts particle size distribution that is presented as bar diagram (E, upper panel), number of exosomes was also enumerated using NTA (E, lower panel). The lysates of UI-Exo and Rv-Exo were prepared using RIPA buffer and 30µg protein from each group were subjected to western blot analysis for CD-63, CD81, Tsg101, CD9 and Calnexin (F). Exosomes isolated from J-774 macrophages were labelled with Exo-Glow protein Blue for overnight at 4°C. The labelled exosomes were incubated with J77-4 macrophages for 10 minutes and 1 hour in CO2 incubator. Fusion of stained exosomes with the cell membrane was observed, indicating cargo release into the cytoplasm (G, Neither fusion nor endocytosis, white arrows; membrane fusion panel, red arrows). Endocytosis was also seen on the membrane as well as within the cytoplasm at 10 minutes and 1hour post-incubation, suggesting endosomal delivery of exosome content (G, Endocytosis panel, blue arrows). The white arrows depict nucleus stained by DAPI top panel.\u003c/p\u003e","description":"","filename":"image1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7579467/v1/1233abd6b3de216acdebf70b.jpeg"},{"id":92429500,"identity":"04453b31-3341-45ca-819f-65ef8ccb7910","added_by":"auto","created_at":"2025-09-29 15:47:12","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":205784,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCytokine immune response in serum, in-vitro system and tissue samples: \u003c/strong\u003eThe Th-1 (IFN-γ, IL-12) and Th-2 (IL-4, IL-10) cytokines were quantified in the serum of immunized animals using ELISA at two weeks post-booster: IFN-γ (A), IL-10 (B), IL-12 (C), IL-4 (D) and IFN-γ/IL-10 ratio (E). Twelve weeks post-infection IFN-γ (F), IL-10 (G), IL-12 (H), IL-4 (I) and IFN-γ/IL-10 ratio (J). Additionally, the splenocytes of immunized animals of various groups at twelve weeks post infection were stimulated with PPD for 72 hours and splenocytes culture supernatants were collected to assess the IFN-γ (K) and IL-10 (L) cytokines and IFN-γ/IL-10 ratio was also calculated (M). All experiments were performed in triplicates having three biological replicates in each experiment and data representable here as mean and standard error. Different vaccinated groups were compared to determine statistical significance of the data using ANOVA with the Tukey test analysis with p\u0026lt;.05 (*), p\u0026lt;.01(**), p\u0026lt;.001(***) level of significance.The immunohistochemical analysis of lung (N) and spleen (O) tissues from four distinct groups: (A) Control, (B) BCG+ESAT-6 Exo, (C) BCG+Rv-Exo, and (D) Only BCG were assessed using antibodies specific to Th-1 (IFN-γ) and Th-2 (IL-10) cytokines.\u003c/p\u003e","description":"","filename":"image2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7579467/v1/0d1cff8c0c773d539ea07553.jpeg"},{"id":92428928,"identity":"f3e72351-d2aa-4e2e-88c6-f983482d74ff","added_by":"auto","created_at":"2025-09-29 15:39:12","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":70440,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHumoral immune response in serum of immunized animals: \u003c/strong\u003eThe animal serum was collected from all groups and subjected to ELISA for detecting IgG1 and IgG2a isotypes at post booster IgG1(A), IgG2a (B), IgG2a/IgG1 ratio (C) and twelve-week post infection IgG1 (D), IgG2a (E) and IgG2a/IgG1 ratio (F) was analysed. All experiments were performed in triplicates having three biological replicates in each experiment and data representable here as mean and standard error. Different vaccinated groups were compared to determine statistical significance of the data using ANOVA with the Tukey test analysis with p\u0026lt;.05 (*), p\u0026lt;.01(**), p\u0026lt;.001(***) level of significance.\u003c/p\u003e","description":"","filename":"image3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7579467/v1/57cbcef41cbb7ffa2f0d449a.jpeg"},{"id":92429501,"identity":"edfa4d83-5616-4e11-b6f6-5238d5942f0e","added_by":"auto","created_at":"2025-09-29 15:47:12","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":70152,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe Th1 and Th2 response-associated gene expression levels in the spleen and lymph node tissues of immunized animals. \u003c/strong\u003eThe lung and spleen tissues from various immunized group animals at twelve-week post infection were homogenize then total RNA was isolated using Trizol method. The RNA samples were analyzed for TBx21 (A), GATA3 (B), and IL-1β (C) gene expression in spleen. Similarly in the lymph node tissues significance of the data using ANOVA with the Tukey test analysis with p\u0026lt;.05 (*), p\u0026lt;.01(**), p\u0026lt;.001(***) level of significance. TBx21 (D), GATA3 (E), and IL-1β (F) were analyzed. All experiments were conducted in three biological triplicates, and the data presented here represent the mean and standard error. Different vaccinated groups were compared to determine statistical.\u003c/p\u003e","description":"","filename":"image4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7579467/v1/37e0134d7235aacfdf50b078.jpeg"},{"id":92428932,"identity":"e68a9095-6bd2-4c93-9233-001e53ac0d78","added_by":"auto","created_at":"2025-09-29 15:39:12","extension":"jpeg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":73886,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEvaluation of T cell population and activation in splenocytes of immunized animals: \u003c/strong\u003eThe splenocytes of Free ESAT-6 (i), Sham Exosome (ii), ESAT-6 Exo (iii), BCG+ESAT-6 Exo (iv), Rv-Exo (v), BCG+Rv–Exo (vi), Only BCG (vii) immunized animals isolated at twelve weeks post challenge were subjected to FACS analysis. The CD3\u003csup\u003e+\u003c/sup\u003e cells were gated and analyzed for CD4\u003csup\u003e+\u003c/sup\u003e and CD8\u003csup\u003e+\u003c/sup\u003e T lymphocytes population and represented as dot plot (A). The cells were enumerated and presented as bar diagram for CD4\u003csup\u003e+\u003c/sup\u003e (B) and CD8\u003csup\u003e+\u003c/sup\u003e T cell population. Further, the cell activation marker CD45 expression was analyzed on CD4\u003csup\u003e+ \u003c/sup\u003eT cells as can be seen in dot plot form (D), cells were also enumerated and data is presented here as bar diagram (E). The data were analyzed with ANOVA test and are shown as the means (±S.D.) of two independent experiments with three biological replicates in each experiment. Different vaccinated groups were compared to determine statistical significance of the data using ANOVA with the Tukey test analysis with p\u0026lt;.05 (*), p\u0026lt;.01(**), p\u0026lt;.001(***) level of significance.\u003c/p\u003e","description":"","filename":"image5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7579467/v1/6a0a3dce1700de597d2b57ad.jpeg"},{"id":92429504,"identity":"ce4ef747-b787-4002-9f8a-fe666a83822f","added_by":"auto","created_at":"2025-09-29 15:47:12","extension":"jpeg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":255676,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEvaluation of functional T cell population in splenocytes of immunized animals: \u003c/strong\u003eThe splenocytes of various vaccinated groups were isolated twelve weeks post challenge and analyzed for Th1 and Th2 cytokine producing functional CD4\u003csup\u003e+\u003c/sup\u003eT cells by FACS analysis. The representative dot plot of FACS depicts (A) CD4\u003csup\u003e+\u003c/sup\u003eIL-12\u003csup\u003e+\u003c/sup\u003e, (C) CD4\u003csup\u003e+\u003c/sup\u003eTNFα\u003csup\u003e+\u003c/sup\u003e, (E) CD4\u003csup\u003e+\u003c/sup\u003eIL-4\u003csup\u003e+\u003c/sup\u003e and (G) CD4\u003csup\u003e+\u003c/sup\u003eIL-10\u003csup\u003e+\u003c/sup\u003e phenotype of functional T cells. The total T cells population of various groups were enumerated and presented here as bar diagram; CD4\u003csup\u003e+\u003c/sup\u003eIL-12\u003csup\u003e+\u003c/sup\u003e (B), CD4\u003csup\u003e+\u003c/sup\u003eTNFα\u003csup\u003e+\u003c/sup\u003e (D), CD4\u003csup\u003e+\u003c/sup\u003eIL-4\u003csup\u003e+\u003c/sup\u003e (F) and CD4\u003csup\u003e+\u003c/sup\u003eIL-10\u003csup\u003e+\u003c/sup\u003e T cells (H).\u0026nbsp; The data were analyzed with ANOVA test and are shown as the means (±S.D.) of two independent experiments with three biological replicates in each experiment. Different vaccinated groups were compared to determine statistical significance of the data using ANOVA with the Tukey test analysis with p\u0026lt;.05 (*), p\u0026lt;.01(**), p\u0026lt;.001(***) levels.\u003c/p\u003e","description":"","filename":"image6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7579467/v1/0a2957a7516a070ab9ec2bcb.jpeg"},{"id":92428933,"identity":"b34668cc-9978-4116-a203-7e745ff517ff","added_by":"auto","created_at":"2025-09-29 15:39:12","extension":"jpeg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":81043,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEvaluation of effector and long-lasting central memory CD4\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/sup\u003e\u003cstrong\u003eT and CD8\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/sup\u003e\u003cstrong\u003eT cell population in splenocytes of immunized animals. \u003c/strong\u003eThe\u003cstrong\u003e \u003c/strong\u003eSplenocytes isolated from animals of various vaccinated groups at twelve weeks post challenge were subjected to FACS analysis to enumerate the concurrent functional effector and long-term central memory markers. The representative dot plot images of CD4\u003csup\u003e+\u003c/sup\u003eT cells (A) and their enumeration for CD4\u003csup\u003e+\u003c/sup\u003eCD44\u003csup\u003ehigh\u003c/sup\u003eCD62L\u003csup\u003ehigh \u003c/sup\u003e(Central memory) (B) and CD4\u003csup\u003e+\u003c/sup\u003eCD44\u003csup\u003ehigh\u003c/sup\u003eCD62L\u003csup\u003elow\u003c/sup\u003e (Effector memory) (C) are presents as bar diagram. Similarly, the representative dot plot images of CD8\u003csup\u003e+\u003c/sup\u003eT cells (D) and their enumeration for CD8\u003csup\u003e+\u003c/sup\u003eCD44\u003csup\u003ehigh\u003c/sup\u003eCD62L\u003csup\u003ehigh\u003c/sup\u003e (Central memory) (E) and CD4\u003csup\u003e+\u003c/sup\u003eCD44\u003csup\u003ehigh\u003c/sup\u003eCD62L\u003csup\u003elow\u003c/sup\u003e (Effector memory) (F) are presents as bar diagram. Free ESAT-6, Sham Exosome, ESAT-6 Exo, BCG+ESAT-6 Exo, Rv-Exo, BCG+Rv-Exo, only BCG population were calculated. The data were analyzed with ANOVA test and are shown as the means (±S.D.) of two independent experiments with three biological replicates in each experiment. Different vaccinated groups were compared to determine statistical significance of the data using ANOVA with the Tukey test analysis with p\u0026lt;.05 (*), p\u0026lt;.01(**), p\u0026lt;.001(***) levels.\u003c/p\u003e","description":"","filename":"image7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7579467/v1/463fae18428714959a9aba30.jpeg"},{"id":92430316,"identity":"818588d1-e211-459c-a292-b13a9b986a93","added_by":"auto","created_at":"2025-09-29 15:55:12","extension":"jpeg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":22564,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAntigen dependent T cell proliferation assay in splenocytes of various immunized groups. \u003c/strong\u003eSplenocytes of immunized mice were isolated from PBS, Free ESAT-6, Sham Exosome, ESAT-6 Exo, BCG+ESAT-6 Exo, Rv-Exo, BCG+Rv-Exo and only BCG groups at twelve weeks post infection, were incubated in 100µl of media in a flat-bottomed 96 well plates for 72 hours at 37˚C in the presence of increasing amounts (1-10µg/ml) of ESAT-6 Ag (A) and (10-100µg/ml) of PPD Ag (B), then MTT assay was performed, results were analyzed and presented here in the form of stimulation index. Different vaccinated groups were compared to determine statistical significance of the data using ANOVA with the Tukey test analysis with p\u0026lt;0.05 (*), p\u0026lt;0.01(**), p\u0026lt;0.001(***) levels.\u003c/p\u003e","description":"","filename":"image8.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7579467/v1/5bd8725975797d4fa4a1479c.jpeg"},{"id":92429507,"identity":"9876d69c-6a50-4b06-9ead-7dea423a5e52","added_by":"auto","created_at":"2025-09-29 15:47:12","extension":"jpeg","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":161418,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDetection of ROS and RNS in serum and iNOS in tissue samples of various groups of immunized mice. \u003c/strong\u003eThe serum from animals of various immunized groups were collected at post booster, six-week post infection and twelve-week post infection. The Griess reagent was used to detect nitric oxide level post booster (A), six weeks post infection (B), and twelve weeks post infection (C). The tissue from Lungs (H), spleen (I) and lymph nodes (J) were isolated from various immunized groups at twelfth week post infection and protein lysates were prepared. Protein lysates were subjected to western blot analysis to detect the expression levels of COX-2, iNOS, NF-κB and β-actin was used as control. All experiments were done in triplicates and data represented here as mean and standard error. Different vaccinated groups were compared to determine statistical significance of the data using ANOVA with the Tukey test analysis with p\u0026lt;0.05 (*), p\u0026lt;0.01(**), p\u0026lt;0.001(***) levels.\u003c/p\u003e","description":"","filename":"image9.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7579467/v1/d0b76737624d29ab96b33e7c.jpeg"},{"id":92430480,"identity":"0e27cb48-2fab-486f-8b96-c0f4e004762f","added_by":"auto","created_at":"2025-09-29 16:05:16","extension":"jpeg","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":130116,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEvaluation of prophylactic efficacy of various vaccines in immunized animals: \u003c/strong\u003eTwo weeks post booster various groups of immunized mice were aerosol challenged with \u003cem\u003eM.tb.\u003c/em\u003eH37Rv and mice were analyzed for bacterial burden in tissue homogenates of lungs (A), spleen (B) and lymph nodes (C) at six weeks and twelve weeks post challenge. The tissue homogenates were cultured to quantify colony-forming units (CFUs) at six- and twelve-weeks post-challenge. Results are expressed as mean values with standard deviation (±SD), based on three independent experiments with biological three replicates. Statistical analysis was performed using ANOVA with the Tukey test, with significance levels set at p\u0026lt;0.01 (**) and p\u0026lt;0.001 (***). Additionally, histopathological analysis of lung specimens from different immunization groups was conducted. Lungs collected at twelve weeks post-challenge were fixed in formalin, sectioned, and stained with hematoxylin and eosin (H\u0026amp;E) (G), as well as Ziehl-Nielsen stain for acid-fast bacilli, according to established protocols. The experimental groups included PBS (A), ESAT-6 Exo (B), BCG ESAT-6 Exo (C), RV-Exo (D), BCG RV-Exo (E), and BCG alone (F).\u003c/p\u003e","description":"","filename":"image10.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7579467/v1/18adbc63a7b0e27b94c85400.jpeg"},{"id":95525357,"identity":"b20ed0e0-bf94-476f-b29b-e4d5fdb69bd3","added_by":"auto","created_at":"2025-11-10 10:04:53","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3574474,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7579467/v1/0f08b919-ae8d-4176-a928-a2096f693304.pdf"},{"id":92428926,"identity":"a9071e49-7e2b-4e74-9f37-7484e03af701","added_by":"auto","created_at":"2025-09-29 15:39:12","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":177703,"visible":true,"origin":"","legend":"","description":"","filename":"s1tiff.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7579467/v1/6c71016af4c1ca236e5b23bf.pdf"},{"id":92430469,"identity":"11c51a41-c664-4773-a410-50cfc6aa6245","added_by":"auto","created_at":"2025-09-29 16:05:07","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":413853,"visible":true,"origin":"","legend":"","description":"","filename":"s21tiff.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7579467/v1/9e307de535b17d3bcd65f6d2.pdf"},{"id":92429516,"identity":"a66d6b6a-5044-4a4c-ab7a-3055c773cebc","added_by":"auto","created_at":"2025-09-29 15:47:12","extension":"mp4","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":5331002,"visible":true,"origin":"","legend":"","description":"","filename":"controlMadewithClipchamp1.mp4","url":"https://assets-eu.researchsquare.com/files/rs-7579467/v1/636ebe4155558d0d1eb3d432.mp4"}],"financialInterests":"No competing interests reported.","formattedTitle":"\u003cp\u003eMycobacterium tuberculosis antigen containing-exosomes reinforce BCG vaccine efficacy by augmenting long term protection and memory response against experimental tuberculosis in BALB-C mice.\u003c/p\u003e","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003e\u003cem\u003eMycobacterium tuberculosis\u003c/em\u003e (\u003cem\u003eM. tb\u003c/em\u003e) is an intracellular bacterium causes tuberculosis (TB), a major public health concern with socioeconomic impact, affecting one-third of the global population\u003ca class=\"FNLink\" href=\"#Fn1\" id=\"#FNLinkFn1\"\u003e\u003c/a\u003e. It spreads via inhaled droplets from infected individuals. While 90% remain asymptomatic (latent TB), 10% develop active disease\u003csup\u003ei\u003c/sup\u003e. In 2021, TB affected 10.6\u0026nbsp;million people, with higher prevalence in immunocompromised individuals, particularly HIV patients. HIV depletes CD4\u003csup\u003e+\u003c/sup\u003e T cells, weakening immune defenses against TB and increasing reactivation risk\u003ca class=\"FNLink\" href=\"#Fn2\" id=\"#FNLinkFn2\"\u003e\u003c/a\u003e WHO reported 6.7% TB-HIV co-infection in 2021 while 8% of TB patients were found to be HIV-positive\u003csup\u003eii\u003c/sup\u003e. Over the last two decades, there has been a 2% annual drop in tuberculosis cases, which sadly climbed by 3.6% in 2020\u0026ndash;2021. In 2021, both incidences and fatalities from tuberculosis rose, with 1.6\u0026nbsp;million deaths from tuberculosis alone and 0.187\u0026nbsp;million TB co-infected with HIV\u003csup\u003eii\u003c/sup\u003e. Tuberculosis manifests as pulmonary (PTB, 75% of cases) or extra pulmonary (EPTB, 25%) \u003ca class=\"FNLink\" href=\"#Fn3\" id=\"#FNLinkFn3\"\u003e\u003c/a\u003e. Diagnosis relies on tests like sputum culture, Mantoux test, IGRA assay, CB-NAAT test, and others \u003ca class=\"FNLink\" href=\"#Fn4\" id=\"#FNLinkFn4\"\u003e\u003c/a\u003e. Current diagnostic tests for tuberculosis (TB) have significant limitations despite their ability to detect infection. For instance, skin tests yield false positives in BCG-vaccinated individuals, while blood tests require specialized facilities\u003ca class=\"FNLink\" href=\"#Fn5\" id=\"#FNLinkFn5\"\u003e\u003c/a\u003e. Sputum microscopy has low sensitivity, and cultures take weeks \u003ca class=\"FNLink\" href=\"#Fn6\" id=\"#FNLinkFn6\"\u003e\u003c/a\u003e. Additionally, Treatment is prolonged (6\u0026ndash;9 months) with adherence challenges and side effects \u003ca class=\"FNLink\" href=\"#Fn7\" id=\"#FNLinkFn7\"\u003e\u003c/a\u003e. Drug-resistant TB demands more toxic regimens, and latent TB requires months of preventive therapy \u003ca class=\"FNLink\" href=\"#Fn8\" id=\"#FNLinkFn8\"\u003e\u003c/a\u003e. Despite diagnostic and treatment advancements, TB remains a challenge, necessitating an effective vaccine.\u003c/p\u003e\u003cp\u003eVaccines offer hope for controlling this devastating pathogen and the Bacillus Calmette-Gu\u0026eacute;rin (BCG) vaccine, derived from \u003cem\u003eMycobacterium bovis\u003c/em\u003e, is currently the only licensed vaccine for human use against tuberculosis\u003ca class=\"FNLink\" href=\"#Fn9\" id=\"#FNLinkFn9\"\u003e\u003c/a\u003e. However, the BCG lacks virulence factors containing T cell epitopes, due to which the efficacy of BCG in preventing adult pulmonary tuberculosis remains debatable. The elimination of the RD-1 locus (9.5 kb DNA) carries \u003cem\u003eRv3871-3879C genes\u003c/em\u003e encoding 14 open reading frames (ORFs), responsible for expressions of \u003cem\u003eM. tb\u003c/em\u003e, proteins including the 10-kDa culture filtrate protein (CFP-10) and the 6-kDa early secreted antigenic target (ESAT-6)\u0026mdash;both secreted by the Esx-I secretion system and recognized as critical virulence factors\u0026mdash;results in a reduction of virulence in BCG\u003ca class=\"FNLink\" href=\"#Fn10\" id=\"#FNLinkFn10\"\u003e\u003c/a\u003e.\u003c/p\u003e\u003cp\u003eThis also highlights the urgent need for novel vaccine candidates against tuberculosis or boosters enhancing the BCG's efficacy by complementing T cell epitopes. In 2022, World health organization (WHO) published a report about 16 vaccine candidates, among them six were in phase III trials: M72/AS01E, a sub-unit vaccine, and VPM002, a recombinant BCG vaccine (German firm MTB) \u003ca class=\"FNLink\" href=\"#Fn11\" id=\"#FNLinkFn11\"\u003e\u003c/a\u003e. Other vaccine candidates are in early clinical trials included live-attenuated, protein subunit vaccines and viral vector-based vaccinations \u003ca class=\"FNLink\" href=\"#Fn12\" id=\"#FNLinkFn12\"\u003e\u003c/a\u003e.\u003c/p\u003e\u003cp\u003eConventional protein-based or killed microbes vaccines typically induce antibody responses but offer limited T helper (Th) cell activation\u003ca class=\"FNLink\" href=\"#Fn13\" id=\"#FNLinkFn13\"\u003e\u003c/a\u003e. Antibodies alone are ineffective against intracellular pathogens like \u003cem\u003eM. tb\u003c/em\u003e, which requires pathogen-specific CD8\u0026thinsp;+\u0026thinsp;cytotoxic and CD4\u0026thinsp;+\u0026thinsp;helper T cells for elimination\u003ca class=\"FNLink\" href=\"#Fn14\" id=\"#FNLinkFn14\"\u003e\u003c/a\u003e. Interestingly, \u003cem\u003eM.tb.\u003c/em\u003e evades T cell attack by down regulating MHC class II on macrophages, impairing antigen presentation\u003ca class=\"FNLink\" href=\"#Fn15\" id=\"#FNLinkFn15\"\u003e\u003c/a\u003e. Antigen dose and exposure duration influence T cell memory differentiation\u0026mdash;Effector memory (TEM\u003cem\u003e)\u003c/em\u003e cells combat primary infection but fade quickly, while Central memory (TCM) cells enable rapid response upon reinfection. Thus, establishing durable T-cell immune memory is critical vaccine success.\u003c/p\u003e\u003cp\u003eThe pathogen specific CD4\u0026thinsp;+\u0026thinsp;T cells secretes Th-1 (IFN-ꝩ, IL-12, TNF-α), Th-2 (IL-10, IL-4) and Treg (IL-10) cytokines to regulate immune responses. The \u003cem\u003eM.tb.\u003c/em\u003e infection tend to reduce Th-1 cytokines, in contrary, the vaccine must provoke Th-1 biased immune response. These responses are controlled by Tbet (Th-1) and GATA (Th-2) signaling. The higher level of ROS and RNS shows pathogen specific immune response and reduced bacterial burden in mice organs.\u003c/p\u003e\u003cp\u003eExosomes, small extracellular vesicles (30\u0026ndash;150 nm), are secreted by most eukaryotic cells and play a vital role in intercellular communication by transporting proteins, lipids, and nucleic acids. Initially considered cellular waste, they are now recognized for their potential in diagnostics and therapeutics, particularly in infectious disease\u003ca class=\"FNLink\" href=\"#Fn16\" id=\"#FNLinkFn16\"\u003e\u003c/a\u003e. Exosomes from \u003cem\u003eM.tb.\u003c/em\u003e-infected cells contain virulence factors and modulate immune responses, making them promising candidates for vaccine delivery\u003ca class=\"FNLink\" href=\"#Fn17\" id=\"#FNLinkFn17\"\u003e\u003c/a\u003e\u003csup\u003e,\u003c/sup\u003e \u003ca class=\"FNLink\" href=\"#Fn18\" id=\"#FNLinkFn18\"\u003e\u003c/a\u003e. Their lipid bilayer structure ensures antigen stability, enhances antigen presentation, and induces robust immune responses with minimal risk of adverse effects compared to traditional adjuvants \u003csup\u003exviii,\u003c/sup\u003e \u003ca class=\"FNLink\" href=\"#Fn19\" id=\"#FNLinkFn19\"\u003e\u003c/a\u003e. Exosomes can be engineered to carry single or multiple antigens, allowing for the development of multivalent vaccines that address complex diseases requiring broad immune responses\u003ca class=\"FNLink\" href=\"#Fn20\" id=\"#FNLinkFn20\"\u003e\u003c/a\u003e. Current TB vaccine strategies include modifying BCG to enhance efficacy (e.g., VPM-1002 (Serum Life Science Europe GmbH (formerly VPM) continues to operate as a German entity, but as a subsidiary of SIIPL), rBCG30) and a prime-boost approach, where BCG is supplemented with subunit or viral vector-based boosters \u003ca class=\"FNLink\" href=\"#Fn21\" id=\"#FNLinkFn21\"\u003e\u003c/a\u003e. We have previously demonstrated that archaeosome encapsulated ESAT-6 provoked enhanced Th-1 biased immune response and CTL response in murine model\u003csup\u003exxi\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eIn this study, we thoroughly investigated the vaccine efficacy of in-house prepared exosome-based vaccine candidates, Rv-Exo and ESAT-6 Exo, against tuberculosis, focusing on both as an independent vaccine candidate and \"prime-boost\" vaccination contexts. The results indicate that exosomes bearing \u003cem\u003eM. tb\u003c/em\u003e antigens effectively enhance antigen presentation and modulate immune responses, leading to elevated \u003cem\u003eM.tb.\u003c/em\u003e specific Th1 biased and elevated CTL immune responses. The ESAT-6 is a critical virulence factor of \u003cem\u003eM.tb.\u003c/em\u003e and a well-recognized cell-mediated immunity inducer. By utilizing the H37Rv infected alveolar macrophages derived exosomes, we were able to educate the immune system more precisely, promoting robust cytotoxic T lymphocyte (CTL) responses. When the BCG immunized animals were boosted with ESAT-6 Exo or Rv-Exo we found i) elevated Th-1 biased cytokine production in serum, ii) elevated population of IFN-γ, TNF-α and IL-12 producing Th1 cells. iii) Higher IgG2a: IgG1 ratio, iv) Increased dose dependent cell \u003cem\u003eM.tb.\u003c/em\u003e specific cell proliferation, v) Elevated t-bet response vi) decreased bacterial burden in vital organs, and vii) reduced bacterium in tissue samples. Overall, our results support the potential of exosome-based vaccines containing ESAT-6 and those derived from H37Rv-infected alveolar macrophages as a novel strategy for tuberculosis vaccination. The promising efficacy observed in both na\u0026iuml;ve and booster contexts highlights the need for further research and clinical trials to evaluate the long-term protective effects of this innovative approach.\u003c/p\u003e"},{"header":"MATERIAL AND METHODS","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eChemicals and Reagents:\u003c/h2\u003e\u003cp\u003eUnless otherwise mentioned, all standard reagents were purchased from Sigma\u0026ndash;Aldrich Merck (Massachusetts, USA). The following reagents were procured from BD biosciences Middle-brook 7H9 broth; Middle-brook 7H11 medium; and oleic acid, albumin, dextrose, and catalase (OADC). Cell culture media (RPMI-1640), Fetal bovine serum, antibiotic \u0026amp; anti-mycotic solution were purchased from Gibco, Thermo-Fisher Scientific and plastic-wares were purchased from corning Falcon.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eESAT-6 protein expression and purification:\u003c/h3\u003e\n\u003cp\u003epET expression vectors Pmrlb.7 were procured from BEI resources. Plasmid Miniprep kit was purchased from Thermo Scientific (USA), and the Gel extraction kit used for plasmid preparations and DNA purification processes, were from Qiagen. Nickel/nitrilotriacetic acid (Ni/NTA) super flow metal-affinity chromatography matrix was from Qiagen. To concentrate expressed protein, Amicon-Ultra was used (molecular mass cut-off 3.5 kDa; Millipore, Bangalore, India). The ESAT 6 was purified over a Ni/NTA matrix using a standard protocol under denaturing conditions, as per the manufacturer\u0026rsquo;s instructions, The eluted fractions were checked for purity by SDS/PAGE (15% gel) as well as Western blot analysis following the standard method. The protein was refolded by dialysing it against refolding buffer containing 25 mM NaH2PO4, 100 mM NaCl, 1 mM 20 mM NaH2PO4, 50 mM NaCl, and 0.1% NaN3, pH 6.5.\u003c/p\u003e\n\u003ch3\u003eBacteria and alveolar macrophage cell culture:\u003c/h3\u003e\n\u003cp\u003e\u003cem\u003eM. tuberculosis\u003c/em\u003e H37Rv strains were kindly provided by the ICMR National JALMA Institute for Leprosy and other Mycobacterial disease, Agra, India. It was cultured into Middle-brook 7H9 broth containing 0.2% glycerol and 0.05% Tween- 80 supplemented with albumin, dextrose, and catalase. The viability of the bacteria was determined by cultivating them on Middle-brook 7H11 medium supplemented with OADC (BD Biosciences, New Jersey, USA) and counting the colony-forming units (CFUs). Mouse alveolar macrophage cell line was purchased from ATCC USA MH-S (ATCC No.- CRL-2019) were cultured in wells or flasks with RPMI-1640 containing 10% exosome depleted FBS, 0.05 mM β-mercaptoethanol, 100 U/ml penicillin and 0.1 mg/ml streptomycin at 37\u0026deg;C with 5% CO2.\u003c/p\u003e\u003cp\u003e\u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003eAlveolar macrophages cells infection with\u003c/span\u003e \u003cspan type=\"BoldItalicUnderline\" class=\"BoldItalicUnderline\" name=\"Emphasis\"\u003eM.tb\u003c/span\u003e \u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003eH37Rv\u003c/span\u003e:\u003c/p\u003e\u003cp\u003eMouse alveolar macrophage cell lines were starved for 24 hours then infected with 5 Multiplicity of Infection (MOI) of H37Rv for 24 hours. The infected macrophages were then washed three times with PBS. The cell culture supernatant was collected and centrifuged at 10000 RPM at 4\u0026deg;C for 10 minute to remove any bacilli. In addition, the culture supernatant was filtered with 0.45\u0026micro;m filter.\u003c/p\u003e\u003cp\u003e\u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003ePreparation of\u003c/span\u003e \u003cspan type=\"BoldItalicUnderline\" class=\"BoldItalicUnderline\" name=\"Emphasis\"\u003eM.tb\u003c/span\u003e \u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003eantigen bearing exosomes\u003c/span\u003e:\u003c/p\u003e\u003cp\u003eThe exosomes were purified by ultracentrifuge (BecmenCoulter USA) method (\u003ca class=\"FNLink\" href=\"#Fn22\" id=\"#FNLinkFn22\"\u003e\u003c/a\u003e, \u003ca class=\"FNLink\" href=\"#Fn23\" id=\"#FNLinkFn23\"\u003e\u003c/a\u003e). Briefly, the exosomes depleted FBS was prepared by centrifugation at 100,000 x g at 4\u0026deg;C for 2 hours. A mouse alveolar macrophage cell line at 70\u0026ndash;80% cell confluence in RPMI-1640 medium containing 10% exosomes depleted FBS was cultured at 37\u0026deg;C and 5% CO2. Cells were either left uninfected (UI) or infected (IF) with 5MOI of \u003cem\u003eM.tb.\u003c/em\u003eH37Rv bacilli, the culture supernatant were collected for exosome isolation and centrifuged at 10,000 rpm at 4\u0026deg;C for 10 minutes to remove cell debris, free cells or bacilli, collected culture supernatant was passed through 0.22\u0026micro;m filter. The filtered supernatant was subjected to ultracentrifugation at 100,000g at 4\u0026deg;C for 2 hours to pellet down the expected exosomes (Rv-exosome). The pellets were suspended in 150 mM saline, and the concentration was determined by BCA analysis. All purified exosomes and their lysates were stored at -80\u0026deg;C until used.\u003c/p\u003e\u003cp\u003eThe ESAT-6-containing exosomes were prepared by using exosomes derived from UI alveolar macrophages and purified ESAT-6. The sonication method was used to encapsulate the ESAT-6 into exosomes, as standardized in our lab. Briefly, exosomes were isolated by the ultracentrifugation method, and the exosome pellet was dissolved in 150 mM normal saline to form a suspension. The exosomes were mixed with an equal volume of protein solution (400 \u0026micro;g/200 \u0026micro;l stock). The mixture was sonicated for 5 minutes in a bath-type sonicator at 4\u0026deg;C. Several freeze-thaw cycles were executed to increase the efficiency of entrapment. Exosomes with ESAT-6 were pelleted down using centrifuge for 2 hours at 17000 RPM at 4\u0026deg;C. The unentrapped ESAT-6 was collected in the supernatant. Entrapment efficiency was determined by the Bicinchoninic Acid Assay (BCA) method after lysing the exosomes with 1X RIPA buffer and immunoblotting for ESAT-6.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eElectron microscopy\u003c/strong\u003e\u003cp\u003eTransmission electron microscopy (TEM; Talos L 120C, Thermo Scientific, USA.) was used to study the morphology of H37Rv-infected alveolar macrophages cells derived exosomes. After being carefully positioned on a carbon-coated 300-mesh copper grid for 20 minutes, purified exosome preparations (25\u0026micro;l) were diluted with an equal volume of 4% paraformaldehyde at 4\u0026deg;C for 30 minutes. They were subsequently fixed for five minutes using 1% glutaraldehyde. The grids were cleaned twice, contrasted with 2% uranyl acetate, and then cleaned twice more. The software was used to examine the exosome pictures from TEM in order to determine the exosome radius.\u003c/p\u003e\u003c/p\u003e\n\u003ch3\u003eNTA Analysis of Exosomes:\u003c/h3\u003e\n\u003cp\u003eAll samples were diluted 1:1000 (V:V) in PBS. The prediction of Ideal measurement concentrations was determined by pre-testing the ideal particle per frame value (74 particles/frame). The software provided by manufacturer was use as default settings for extracellular Vesicles (EVs). For each measurement, one cycles were performed by scanning 11 cell positions each and capturing frames per position (video setting: high) under following settings: Focus: autofocus; Camera sensitivity for all samples: 92.0; Shutter: 200; Cell temperature: 25\u0026deg;C. After capture, the videos were analysed by the in-build ZetaView Software 8.05.16 SP3 with specific analysis parameters: Maximum particle size: 1000, Minimum particle size 10, Minimum particle brightness: 30\u003ca class=\"FNLink\" href=\"#Fn24\" id=\"#FNLinkFn24\"\u003e\u003c/a\u003e. The data was analyzed for particles size as well as number and presented here in the form of bar graph.\u003c/p\u003e\n\u003ch3\u003eWestern Blot analysis:\u003c/h3\u003e\n\u003cp\u003eAntibodies against NF-KB, COX‐2, and iNOS were bought from Affinity Biosciences (USA). Antibodies against CD63 mouse monoclonal antibody, SC-5275, MW 26 kDa; and Calnexin, mouse monoclonal antibody, SC-23954, MW 90kDa; Santa Cruz Biotechnology, USA)), pIRF3, pSTING, tubulin, HRP conjugated anti-rabbit IgG and anti-mouse IgG antibodies were from Cell signaling technology (USA). Protein markers were purchased from Bio-Rad (USA).\u003c/p\u003e\u003cp\u003eExosomes were lysed by radio immunoprecipitation assay RIPA buffer supplemented with protease and phosphatase inhibitor cocktail (Abcam). An equal amount of exosomal protein were subjected to electrophoresis using 12% polyacrylamide gel (Bio-Rad, USA) and transferred to PVDF membrane (Millipore, Bedford, MA, USA). Membranes were blocked with TBST Contains 5% skimed milk and 0.1% Tween-20, then incubated with primary antibody, followed by HRP labelled secondary antibody. The blots were developed using ECL specific reagents (BioRad, USA). The images were captured using Chemidoc MP and analyzed using the CFX Maestro Software version 2.2 (BioRad, USA).\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eExosome protein delivery assay:\u003c/h2\u003e\u003cp\u003eFor protein labeling of EVs, containing 200\u0026ndash;500 \u0026micro;g of protein were resuspended in 500 \u0026micro;L of PBS. A 500X labeling dye (Exoglow protein-Protein EV labeling Kit, System Biosciences) was then added to the EV preparation at a 1:500 dilutions, and the mixture was incubated at 37\u0026deg;C with shaking (350 rpm) for 20 minutes. Subsequently, 167 \u0026micro;L of ExoQuick-TC was added to the solution, and the mixture was incubated at 4\u0026deg;C for overnight. The EV-dye complex was then centrifuged at 10,000 rpm for 10 minutes, and the supernatant was carefully aspirated from the corner of the tube. The labeled EV pellet was resuspended in 300 \u0026micro;L PBS J-774 macrophages were seeded into an 8-well chamber slide and incubated with labeled exosomes for 10 minutes and 1 hour at 37\u0026deg;C under 5% CO₂ to evaluate uptake kinetics. Post-incubation, unbound exosomes were removed by PBS washing, and cells were fixed with 4% paraformaldehyde (PFA) for 20 minutes at room temperature. DAPI was used to stain the nucleus. Images were taken using Evos-M7000 (Invitrogen by Thermo Scientific, USA).\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eMass Spectrometer of H37Rv infected cells derived Exosomes:\u003c/h3\u003e\n\u003cp\u003eLC-MS experiments were outsourced and performed on a Morpheus (Agilent, revision 272) that was linked to a Thermo QE Plus, Protein from each sample were inoculated into 1\u0026micro;g on a 50-cm-long, 3.0m-thick C18 column (Thermo Fisher Scientific). At a flow rate of 300 nl/min, a0\u0026ndash;40% gradient of buffer B (80% acetonitrile, 0.1% formic acid) was used to elute the peptides, which were then sent to the MS analyzer. For 60 minutes, LC gradients were run. At a resolution of 70k, MS1 spectra were taken with the Orbitrap. Dynamic exclusion was used for 10s, and all charge states for a sequences given precursor were taken out of the equation. MS2 spectra were taken at a resolution of 17500.\u003c/p\u003e\n\u003ch3\u003eEpitope prediction of T cell and B cell:\u003c/h3\u003e\n\u003cp\u003eRaw data obtained from proteome analysis was used to generate the uniProt ID using NCBI database and at the end we had FASTA sequence of all the protein present in exosomes in FASTA format. Furthermore, predicted T- and B-cell epitopes for selected protein sequences, using online epitope prediction server NetMHCpan El 4., Immune Epitope Databases (IEDB). The IEDB tool uses validated benchmarking methods to predict MHC molecular binding, antigen processing, TCR recognition, and B cell epitopes. MHC Class-I restricted CD8\u0026thinsp;+\u0026thinsp;cytotoxic T lymphocyte (CTL) epitope selected sequences compatible to respective common human leukocyte antigen (HLA) alleles (i.e., H2-db and H2-kb) having epitope length of 9 amino acids. Similarly, we identified MHC class II-restricted CD4\u003csup\u003e+\u003c/sup\u003e helper T lymphocyte (HTL) epitopes of several common HLA alleles (e.g., H2-IAb) using the IEDB-recommended 2.22 prediction method with 15 epitopes. The BepiPred 2.0 server predicted linear B-cell epitopes of selected protein sequences. In the next step, the predicted value is increased sequentially and considered more likely than threshold (default 0.5) epitopes.\u003c/p\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eMice maintainance and Experimention:\u003c/h2\u003e\u003cp\u003e This study was approved from National JALMA Animal Ethical committee and approved was also taken from, Jamia Hamdard IEC with approval no. 1566/2019 this study. In accordance with the local guidelines for the care and use of animals, female BALB/c mice between the ages of 6 to 8 weeks were kept at the Animal House Services of Jamia Hamdard under special pathogen-free conditions. Animals were transferred to animal biosafety level 3 laboratory at the ICMR-National JALMA Institute of Leprosy and Other Mycobacterial Disease, Agra, India and acclimatized for 10 days before experimentation.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eImmunization Schedule:\u003c/h2\u003e\u003cp\u003e Mice were acclimatized in animal biosafety level-3 facility in accordance with CPCSEA (Committee for the Purpose of Control and Supervision of Experiments on Animals) guidelines. Mice were immunized with various vaccine preparation including, Free ESAT-6 Ag, Exosome-encapsulated ESAT-6 Ag (ESAT 6-Exo), Rv-Exo, BCG alone, BCG boosted with ESAT-6 Exo and BCG boosted with Rv-Exo. The only PBS and sham exosomes were used as control. The animals were vaccinated by subcutaneously administering 100 \u0026micro;g of Ag,100 \u0026micro;l of dose volume per animal, depending on exosome concentration at 1000 \u0026micro;g/injection. In all BCG group, single doses of \u003cem\u003eM. bovis\u003c/em\u003e BCG (1\u0026times;10\u003csup\u003e6\u003c/sup\u003e CFU/mouse, Danish strain) were administered intradermally. On day 28, animals were boosted with the appropriate formulations of the antigen using the similar route of administration.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003eChallenge with Mycobacterial infection and Bacterial load in organs:\u003c/h2\u003e\u003cp\u003eTwo weeks post booster; the mice of various vaccinated groups were challenged with \u003cem\u003eM.tb. H37Rv\u003c/em\u003e, using a suspension of 1X10\u003csup\u003e7\u003c/sup\u003e/ml bacteria count in a volume of 10 ml was injected to the Venture nebulizer in the aerosol generator device (Glascol, USA\u003cem\u003e)\u003c/em\u003e that created aerosol cloud of \u003cem\u003eM.tb.\u003c/em\u003e bacilli. \u003cem\u003eM.tb.\u003c/em\u003e -infected mice were then placed in IVEC Chambers till end of the experiment. To enumerate the deposited bacterial population in the lungs, post challenge of infected animals, 24 hours and the bacterial load in the lungs was measured. To assess the prophylactic efficacy of various in house developed vaccine candidates the bacterial load in the lungs, spleens and lymph nodes of experimental animals at various time points were evaluated. After set periods (Six- and Twelve-weeks\u0026rsquo; post-challenge), 3 animals from each group were sacrificed, their spleens, lungs, and lymph nodes were aseptically removed and homogenized in 7H9 medium using homogenizer Polytron; PT 3100 (Indonesia). Various dilutions of the prepared homogenates were plated on 7H11 agar plates supplemented with oleic acid, albumin, dextrose and catalase. In the BCG(Danish) immunized animal group, thiophene carboxylic acid hydrazide (TCH) was used at 2 mg/ml concentration to inhibit the growth of BCG. All plates were incubated at 37\u0026deg;C for 3\u0026ndash;4 weeks. The colonies were enumerated for bacterial load determination. This formula was used for calculating CFU/gm (CFU/gm\u0026thinsp;=\u0026thinsp;Number of colonies x dilution factor/ Weight of sample).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003eELISA for IgG isotype and Th-1/Th-2 cytokine analysis:\u003c/h2\u003e\u003cp\u003eThe sandwich ELISA kits for IgG1, IgG2a isotype kits and IL-12, IL-4, interferon-g (IFN-γ), IL-10 Cytokine GENLISA ELISA kits were procured from Krishgen BioSystem, USA.We analyzed Th-1 (IFN-γ and IL-12) and Th-2 (IL-10 and IL-4) cytokines in serum samples using sandwich ELISA kits using at various time points Pre-immunization, post booster and Twelve-week post challenge (TWPC). Assay plates were incubated with serum samples overnight at 4\u0026deg;C followed by three washes. Then, wells were incubated with detection antibody for 1h at room temperature followed by washing with wash buffer.\u003c/p\u003e\u003cp\u003eThe plates were further incubated with Streptavidin-HRP labeled secondary antibody for 1h at room temperature followed by development with 3,3,5,5- tetramethylbenzidine (TMB) and added the stop solution for stop the reaction. The absorbance was measured at 450 nm using multi-mode reader (Synergy H1, BioTek, USA.).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003eIsolation and Culture of lymphocytes:\u003c/h2\u003e\u003cp\u003eMice belonging to various immunized groups were sacrificed at 6 and 12 weeks\u0026rsquo; time points, both after vaccination and post infection. Spleens isolated from animals belonging to different groups were aseptically removed, and the tissue was homogenized in 3 ml of sterile PBS using sterile homogenizer and centrifuged at 300g at 4\u0026deg;C for 10 min. The cells were macerated and a single cell suspension was prepared. Further, the cells were treated with 2 ml of ACK lysis buffer for 5 minutes on ice to lyse the RBCs present in cell suspension. The cell suspension was centrifuged at 1500 g for 5 min, and the cell pellet was washed three times with HBSS and resuspended in RPMI 1640 medium containing 10% FBS and 0.1% antibiotic solution.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003eFACS analysis for immunophenotyping:\u003c/h2\u003e\u003cp\u003eThe following antibodies were procured from BD Biosciences (USA): fluorochrome-labeled anti-mouse antibodies; CD4 (BV 786), CD8 (APC-H7), CD44 (BV480), CD45(BB700), CD62L (BB515), IL-12 (P40/P70), TNF (PECy7), IL-4 (BV711), CD3E (APC), IL-10 (BV605). Splenocytes were isolated and counted using the Trypan Blue exclusion method, with 1\u0026nbsp;million cells seeded in each well of a 96-well round-bottom culture plate. The cells were stimulated with optimized doses of \u003cem\u003eM.tb.\u003c/em\u003e antigens, specifically PPD at 5 \u0026micro;g/ml and ESAT6 at 10 \u0026micro;g/ml, while unstimulated cells served as a negative control. The cultures were incubated for 48 hours in a humidified CO2 incubator at 37\u0026deg;C. Twelve hours before the end of the incubation, 1 \u0026micro;l of 1:100 brefeldin A was added to each well, and the plates continued to incubate at 37\u0026deg;C in a humidified CO2 environment. After incubation, cells were centrifuged at 350 RCF for 5 minutes at 4\u0026deg;C, and the supernatant was discarded. The cell pellet was resuspended in 100 \u0026micro;l of staining buffer and stained with surface marker (CD4 (BV 786), CD8 (APC-H7), CD44 (BV480), CD45(BB700), CD62L (BB515), CD3E (APC) antibodies, followed by a 30-minute incubation at 4\u0026deg;C in the dark. After washing, cytofix buffer was added for fixation, and the cells were permeabilized before being stained with intracellular IL-12 (P40/P70), TNF (PECy7), IL-4 (BV711), IL-10 (BV605) antibodies. Finally, the cells were suspended in staining buffer containing formaldehyde and stored at 4\u0026deg;C until acquisition using a BD FACS Lyric flow cytometer, with data analyzed using BD FACS Suite software.\u003ca class=\"FNLink\" href=\"#Fn25\" id=\"#FNLinkFn25\"\u003e\u003c/a\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003eCell proliferation or MTT Assay:\u003c/h2\u003e\u003cp\u003eLymphocytes isolated from the spleens of mice belonging to various immunized groups were incubated in round-bottomed 96-well plates (1\u0026nbsp;million cells per well) in 200\u0026micro;L of RPMI 1640 medium supplemented with 10% fetal bovine serum. To assess the impact of antigen concentration on T cell activation, varying concentrations (ranging from 1 to 10 \u0026micro;g/well or 1-100ug/well) of ESAT-6 and (ranging from 5 to 20 \u0026micro;g/well) of PPD (Purified protein derivative) were used to prime the T cells to evaluate antigen specific cells activation in the vital organ. Cell proliferation was evaluated using the MTT assay. For the MTT reduction reaction, 10\u0026micro;l of a 5 mg/mL MTT stock solution was added to each well, and the mixtures were incubated at 37\u0026deg;C in the dark for 72 hours. To dissolve the formazan crystals, 100\u0026micro;l/well of a solubilizing buffer was added. The absorbance of the formazan products was determined by measuring the absorbance at 570nm using a microplate reader.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003eIsolation of RNA from Animal tissue:\u003c/h2\u003e\u003cp\u003eVarious vaccinated groups of Balb/c mice were challenged with the H37Rv strain. TWPC, mice were sacrificed individually; lungs, spleen, and lymph nodes were collected, which were homogenized in 1 ml of TRIZOL by using a homogenizer Polytron (Indonesia). Lung, spleen, and lymph node homogenates were stored at -80\u0026deg;C until further processing. Then, 200 \u0026micro;l of chloroform were added per ml of TRIZOL, and after vigorous vortexing, tubes were centrifuged at 12,000 for 15 minutes at 4\u0026deg;C. The aqueous upper phase contained eukaryotic RNA. Then, tubes were centrifuged for 10 minutes at 18,000\u003cem\u003eg\u003c/em\u003e (4\u0026deg;C), and aqueous phase (approximately 500\u0026micro;l) containing mycobacterial RNA (and also remaining eukaryotic RNA) was recovered. A measure of 700\u0026micro;l of isopropanol was added, and incubated at RT for 15 minutes to improve RNA precipitation. Precipitated RNA centrifugation and collected. The pellets were rinsed with 70% ethanol and air dried before being re-dissolved in RNAse-free water and stored at -80\u0026deg;C. RNA integrity was assessed by agarose gel electrophoresis, and the absence of contaminating DNA was checked by a lack of amplification products after 39 PCR cycles. Lungs from uninfected animals were processed as above to be used as a non-infected control in the RT-PCR. For RT-PCR, cDNA synthesized by using 2\u0026micro;g of RNA prepared a standard reverse transcription reaction with the PrimeScriptTM 1st strand cDNA Synthesis Kit (Takara, Japan).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003e\u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003eRT-PCR ASSAY\u003c/span\u003e:\u003c/h2\u003e\u003cp\u003ePCR reaction was performed using the iQ SYBR Green Supermix (Bio-Rad, USA) under the following conditions: PCR mixtures were denatured at 95\u0026deg; C for 3 minutes, followed by 39 cycles of 10 seconds at 95\u0026deg; C, 30 seconds at 58\u0026deg; C, 10 seconds at 95\u0026deg; C, and 5 seconds at 70\u0026deg; C for amplification. The mRNA expression levels of T-box transcription factor (TBX21), GATA (GATA binding factor one) and (Interleukin-1 beta) IL-1β were normalized to their respective glyceraldehyde 3-phosphate dehydrogenase (GAPDH) expression. The sequences of sense and anti-sense primers are shown in Table\u0026nbsp;1.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Taba\" border=\"1\"\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePrimer Name\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTm\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGC %\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eSequence\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eIL-1 beta\u003c/p\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e59.35\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e55\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eGCCCATCCTCTGTGACTCAT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eIL-1 beta\u003c/p\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e57.30\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e50\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eAGGCCACAGGTATTTTGTCG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGAPDH\u003c/p\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e61.40\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCTCCCACTCTTCCACCTTCG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGAPDH\u003c/p\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e61.40\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eGCCTCTCTTGCTCAGTGTCC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTbx-21\u003c/p\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e55.2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e40\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eACGTCTTTACTTTCCAAGAG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTbx-21\u003c/p\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e55.2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e42.8\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eGTACATGGACTCAAAGTTCTC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGATA3\u003c/p\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e50\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCCTCTGGAGGAGGAACGCTAAT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGATA3\u003c/p\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e59.09\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eGTTTCGGGTCTGGATGCCTTCT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003ch2\u003eHistopathology:\u003c/h2\u003e\u003cp\u003eAnimals were sacrificed, their lungs, spleens, and lymph nodes were immersion-fixed in 10% formalin, tissue blocks (5 mm in size) were processed for paraffin embedding, and 10 mm-thick sections were cut on a rotary microtome. Sections were subjected to both conventional and targeted Zheil-Nielsen staining to identify Mycobacteria. Stained sections were observed under a fluorescence microscope Evos M7000 Imaging system (Invitrogen, Thermo-scientific, USA).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\u003ch2\u003eImmunohistochemistry:\u003c/h2\u003e\u003cp\u003eMicrotome sections (4\u0026micro;m thick) were cut from formalin-fixed, decalcified, and paraffin-embedded tissue samples. These sections were initially deparaffinized, then subjected to antigen retrieval using 10mM citrate buffer (pH 6.0) in a boiling water bath for 10 minutes, treated with 1% H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e for 10 minutes, and blocked with 5% BSA for 1h at room temperature. The tissue sections were then incubated with anti-F4/80, IL-12 and TNF-α antibodies for 12 hours and HRP-conjugated anti-mouse secondary antibodies for 90 minutes. The horseradish peroxidase reaction was visualized using 0.05% diaminobenzidine (DAB) and 0.03% H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e. After counterstaining with hematoxylin, the sections were dehydrated and mounted. Stained tissue sections were examined using Evos M7000 Imaging system (Invitrogen, Thermo scientific, USA). All experiments included appropriate isotype-matched control antibodies.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec22\" class=\"Section2\"\u003e\u003ch2\u003eNitric oxide assay:\u003c/h2\u003e\u003cp\u003eTo determine nitric oxide levels using the Griess reagent kit (LDH method), the serum samples were appropriately diluted and added to the wells of the 96-well plate along with Griess reagents R1 and R2, and a nitrite standard. The plate was then incubated for 10 minutes at room temperature without covering it. After incubation, the absorbance of each well was read at 540 nm using the multimode reader. The calculation of nitric oxide content was performed as follows: [Δ OD\u003csub\u003e{Std}\u003c/sub\u003e = OD\u003csub\u003e{Std}\u003c/sub\u003e - OD\u003csub\u003e{Blank}\u003c/sub\u003e], [Δ OD\u003csub\u003e{Sample}\u003c/sub\u003e = OD\u003csub\u003e{Sample}\u003c/sub\u003e - OD\u003csub\u003e{Blank}\u003c/sub\u003e]. Subsequently, the Δ OD Sample value was substituted into the equation to obtain the x value (in \u0026micro;M), representing the nitric oxide content. 1 mg/dl of NO equals 333 \u0026micro;M. The concentration of nitric oxide (NO) was determined using a standard curve.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec23\" class=\"Section2\"\u003e\u003ch2\u003eStatistical analysis:\u003c/h2\u003e\u003cp\u003eData were analyzed and two groups were compared using the Student\u0026rsquo;s t test or three groups were compared using the one-way ANOVA (Tukey method) to compare all groups, using GraphPad Prism version 10.0 software. The p values, 0.05 (*), ,0.01(**), ,0.001(***), ,0.0001 (****) were considered as significant for analysis of the data.\u003c/p\u003e\u003c/div\u003e"},{"header":"RESULTS","content":"\u003cp\u003e\u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003eCharacterization of\u003c/span\u003e \u003cspan type=\"BoldItalicUnderline\" class=\"BoldItalicUnderline\" name=\"Emphasis\"\u003eM.tb.\u003c/span\u003e \u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003einfected alveolar macrophage derived (Rv-Exo) and ESAT-6 entrapped exosomes (ESAT-6 Exo)\u003c/span\u003e:\u003c/p\u003e\u003cp\u003eExosomes isolated either from uninfected or \u003cem\u003eM.tb. H37Rv\u003c/em\u003e infected alveolar macrophages were subjected to electron microscopy (TEM). The TEM results suggest that the isolated exosomes vary in size ranging from 102 to 113 nm (Figure-1A and 1B). When particles were analyzed using NTA (zeta view), both UI-Exo (1C) and Rv-Exo (1D) showed 142.53 and 137.56 nm average size and number of particles found to be 2.2x10\u003csup\u003e6\u003c/sup\u003e/ml and 2.86x10\u003csup\u003e6\u003c/sup\u003e/ml, respectively (Figure-1E). Interestingly, the number of particles significantly increased in the \u003cem\u003eM.tb.\u003c/em\u003e infected cells, that signifies the impact of infection in extracellular vesicle production (Figure-1E). To confirm whether ESAT-6 gene was present in the plasmid Pmrlb.7, PCR analysis was performed that confirmed the presence of the gene indicated by the PCR product of 300 bp (data not shown). The BL21 \u003cem\u003eE. coli\u003c/em\u003e were transformed using Pmrlb.7 plasmids and ESAT-6 protein was induced with the help of IPTG. ESAT-6 protein from \u003cem\u003eE. coli\u003c/em\u003e cells lysates were purified by IMAC column as described in our earlier publication \u003csup\u003exxi\u003c/sup\u003e, ESAT-6 bearing exosomes (ESAT-6-Exo) were lysed and subjected to western blot analysis (Figure-S1A). The band intensity analysis suggests approximately 69% encapsulation of ESAT-6 protein, this study helped in controlled and accurate vaccination dose in mice. Additionally, the western blot analysis demonstrated the presence of exosome surface markers such as CD63, CD81, Tsg101, CD9 on the isolated extracellular vesicles (Figure-1F). The exosome markers, such as CD63, CD81, and TSG101, showed increased levels in the Rv-Exo sample, which typically indicates a higher release of exosomes from \u003cem\u003eM.tb\u003c/em\u003e-infected cells. We also evaluated the exosomes for calnexin, a negative marker, to determine the purity of exosomes. The absence of calnexin in both exosomes confirmed the purity of the samples (Figure-1F).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cdiv id=\"Sec25\" class=\"Section2\"\u003e\u003ch2\u003eExosome efficiently delivers antigen via cytosolic and endocytic mode:\u003c/h2\u003e\u003cp\u003eExosomes enhance antigen processing and presentation through distinct mechanisms based on their mode of entry into macrophages. To evaluate the antigen delivery mechanism, the Rv-exo were incubated with J774-macrophages (NCCS, Pune) for 10 minutes and 1 hour. The results showed fusion of labelled blue fluorescent protein colored exosomes with the cell membrane, suggestive of cargo release into the cytoplasm (Figure-1G, enlarged panels, red arrows). Intriguingly, the endocytosis can also be seen on the membrane as well as inside the cytoplasm at 10 minutes as well as 1hour post incubation, suggestive of endosomal delivery of exosome content (Figure-1G, enlarged panels, blue arrows). The cytosolic delivery through fusion mechanism enables antigens to be processed through ubiquitination and proteasomal degradation machinery (acts as endogenous antigen) leading to antigen presentation on MHC class I molecules, facilitating cross-presentation to CD8\u003csup\u003e+\u003c/sup\u003eT cells and eliciting cytotoxic immune responses. In contrast, when exosomes are internalized via endocytic pathway, as shown in figure-1G (blue arrow), which leads to antigen presentation on MHC class II molecules to activate CD4\u0026thinsp;+\u0026thinsp;T cells. These complementary mechanisms underscore the critical role of exosomes in bridging innate and adaptive immune responses by enabling antigen presentation through both MHC class I and class II pathways.\u003c/p\u003e\u003cp\u003eTogether, this data suggests that the isolated extracellular vesicles obtained by ultracentrifugation method were in the size range of exosomes and were pure as well. The alveolar macrophages cell line was used in this study to isolate exosomes were characterized by FACS analysis. About, 96.41% cells were found to express high levels of CD11c, out of that 17.51% were positive for F4/80. On the other hand, 94.06% population showed CD206 low phenotype over all (S1D). CD206 low and CD11c high and F4/80 low also confirms the cells as Alveolar Macrophages (AMΦ). (Figure-S1B-S1E).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec26\" class=\"Section2\"\u003e\u003ch2\u003eRv-Exo proteins demonstrate the presence of both B- and T-cell antigenic determinants:\u003c/h2\u003e\u003cp\u003eThe exosome vaccine candidates characterized for size and purity were subjected to liquid chromatography-mass spectrometry (LCMS). The LCMS data showed 143 proteins of \u003cem\u003eMycobacterium tuberculosis\u003c/em\u003e (\u003cem\u003eM.tb.\u003c/em\u003e) origin and 1032 host proteins within exosomes isolated from \u003cem\u003eM.tb.\u003c/em\u003e -infected alveolar macrophages (Rv-Exo). The intricate host-pathogen interplay during \u003cem\u003eM.tb.\u003c/em\u003e infection, emphasizing the roles of specific exosomal proteins. Additionally, the presence of \u003cem\u003eM.tb.\u003c/em\u003e proteins in exosomes implies their potential implication in modulating the immune response and bolstering host defense mechanisms against \u003cem\u003eM.tb\u003c/em\u003e. Considering exosomes' pivotal roles in intercellular signaling and immune regulation, these findings suggest their involvement in shaping the immune response to \u003cem\u003eM.tb.\u003c/em\u003e and may serve as valuable biomarkers for TB diagnosis or as targets for therapeutic interventions aimed at disrupting \u003cem\u003eM.tb.\u003c/em\u003e pathogenesis. In this work, the protein sequence was submitted to predictive analysis using IEDB in order to discover possible B cell epitopes (Supplementary Table\u0026nbsp;1) capable of eliciting humoral and T cell epitopes capable of interacting with different MHC (Major Histocompatibility Complex) Class I (Supplementary Table\u0026nbsp;2) and Class II alleles (Supplementary Table\u0026nbsp;3). A total of 49 epitopes were predicted to bind MHC Class I alleles, 48 epitopes to MHC Class II alleles, and 46 B cell epitopes were also predicted (Supplementary Table\u0026nbsp;1\u0026ndash;3). These peptides were selected based on their ability to achieve a predicted binding score below 1, indicating a high probability of binding to the respective MHC alleles. The epitopes identified through this study exhibited a high affinity for their respective MHC alleles, indicating strong potential as vaccine targets or diagnostic markers for tuberculosis. In conclusion the bioinformatics analysis of pathogenic proteins presents in Rv-Exo demonstrated presence of antigenic determinants capable to provoke helper-T cell, Cytotoxic T lymphocytic, responses along with effective humoral responses.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec27\" class=\"Section2\"\u003e\u003ch2\u003eThe Rv-Exo contain T cell antigens which are absent in BCG Genome:\u003c/h2\u003e\u003cp\u003eThe proteomics analysis of Rv-Exo lysate revealed the presence of 143 protiens of \u003cem\u003eM.tb.\u003c/em\u003e H37Rv strain, but that was conspicuously absent in the genome of the Bacillus Calmette-Gu\u0026eacute;rin (BCG) strain. Notably present within in house prepared vaccine candidate (Rv-Exo), derived from H37Rv-infected MS-H murine alveolar macrophage cell line. About 12 immunogenic proteins shown in the Table\u0026nbsp;2 belonging to H37Rv origin and absent in BCG. This protein discrepancy highlights a potential genetic divergence between the BCG vaccine strain and the pathogenic \u003cem\u003eM. tb.\u003c/em\u003e strain H37Rv. Antigenic analysis of 12 proteins depicts those 8 proteins had enormous number of MHC-I agrotope compatible epitopes suggesting of inducing a CTL response by Rv-Exo vaccination. Therefore, Rv-Exo could be used as booster to supplement a strong CTL response. Overall, the presence of this protein within exosomes, which are pivotal mediators of intercellular communication and immune regulation, suggests its involvement in host-pathogen interactions and immune modulation during tuberculosis infection.\u003c/p\u003e\u003ch2\u003eTabel-2 : Immunization with Exosomes containing ESAT-6 and Rv-Exo induce enhanced Th1 immune response:\u003c/h2\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Tabb\" border=\"1\"\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSr. No.\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eProtein Name Absent in BCG\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eProtein ID\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eReferences\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003e1.\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eEsx conserved component eccd2. esx-2 type vii secretion system protein. probable transmembrane protein\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e(Rv3887c)\u003c/p\u003e\u003cp\u003e\u003cb\u003eA0A1R3Y5J4\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003e2.\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eESX conserved component EccD2 OS\u0026thinsp;=\u0026thinsp;Mycobacterium tuberculosis OX\u0026thinsp;=\u0026thinsp;1773 GN\u0026thinsp;=\u0026thinsp;eccD2 PE\u0026thinsp;=\u0026thinsp;3 SV\u0026thinsp;=\u0026thinsp;1\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e(Rv3887c)\u003c/p\u003e\u003cp\u003e\u003cb\u003eA0A045I5U9\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003exxvi\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003e3.\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eATPase P OS\u0026thinsp;=\u0026thinsp;Mycobacterium tuberculosis\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cb\u003e(\u003c/b\u003eRv0933)\u003c/p\u003e\u003cp\u003e\u003cb\u003eA0A045HTY2\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003e4.\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eOxidoreductase OS\u0026thinsp;=\u0026thinsp;Mycobacterium tuberculosis\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cb\u003e(\u003c/b\u003e Rv0484c)\u003c/p\u003e\u003cp\u003e\u003cb\u003eA0A045IQY5\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003exxvii\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003e5.\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eCytochrome c biogenesis protein OS\u0026thinsp;=\u0026thinsp;Mycobacterium tuberculosis\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cb\u003e(\u003c/b\u003e Rv3673c)\u003c/p\u003e\u003cp\u003e\u003cb\u003eA0A8D5WZQ2\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003e6.\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eTwo-component system transcriptional regulator OS\u0026thinsp;=\u0026thinsp;Mycobacterium tuberculosis\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cb\u003e(\u003c/b\u003e Rv0981)\u003c/p\u003e\u003cp\u003e\u003cb\u003eA0A0H3LA31\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003e7.\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eSugar-transport integral membrane protein ABC transporter OS\u0026thinsp;=\u0026thinsp;Mycobacterium tuberculosis\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cb\u003e(\u003c/b\u003eRv2040c)\u003c/p\u003e\u003cp\u003e\u003cb\u003eA0A0H3LBB5\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003e8.\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e. \u003cb\u003eTransmembrane protein OS\u0026thinsp;=\u0026thinsp;Mycobacterium tuberculosis\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cb\u003e(\u003c/b\u003e Rv0355c)\u003c/p\u003e\u003cp\u003e\u003cb\u003eA0A2I7WD76\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003e9.\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003e3-methyl-2-oxobutanoate hydroxylmethyltransferase OS\u0026thinsp;=\u0026thinsp;Mycobacterium tuberculosis\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cb\u003e(\u003c/b\u003eRv0038)\u003c/p\u003e\u003cp\u003e\u003cb\u003eA0A045HAR6\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003e10.\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eFAD-binding dehydrogenase (Fragment) OS\u0026thinsp;=\u0026thinsp;Mycobacterium tuberculosis OX\u0026thinsp;=\u0026thinsp;1773 GN\u0026thinsp;=\u0026thinsp;E5M23_16735 PE\u0026thinsp;=\u0026thinsp;4 SV\u0026thinsp;=\u0026thinsp;1\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cb\u003e(\u003c/b\u003e Rv3129)\u003c/p\u003e\u003cp\u003e\u003cb\u003eA0A8H2FC55\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003e11.\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eAcyl-CoA dehydrogenase fadE16 OS\u0026thinsp;=\u0026thinsp;Mycobacterium tuberculosis\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cb\u003e(\u003c/b\u003e Rv1679)\u003c/p\u003e\u003cp\u003e\u003cb\u003eA0A654T4K6\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003e12.\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eTransmembrane transporter mmpL12 OS\u0026thinsp;=\u0026thinsp;Mycobacterium tuberculosis\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cb\u003e(\u003c/b\u003e Rv2536)\u003c/p\u003e\u003cp\u003e\u003cb\u003eA0A7U8U5Q7\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec28\" class=\"Section2\"\u003e\u003cdiv id=\"Sec29\" class=\"Section3\"\u003e\u003ch2\u003eExosomes containing ESAT-6 and Rv-Exo induce the production of Th1 immune responses:\u003c/h2\u003e\u003cp\u003eHere, we have examined the immunogenic potential of exosomes containing the antigens ESAT-6 (ESAT-6 Exo) and H37Rv-infected alveolar macrophage-derived exosomes (Rv-Exo) as an antigen delivery system. Serum samples from various immunized cohorts were assayed for Th1 (IFN-γ and IL-12) and Th2 (IL-4 and IL-10) cytokines using sandwich ELISA to assess the Th1/Th2 ratio. Exosome-based vaccine candidates i.e. ESAT-6 Exo, Rv-Exo, their booster in BCG immunized groups and BCG alone was examined. Exosomes-encapsulated vaccine candidates for ESAT-6 Exo and Rv-Exo induce significantly elevated levels of Th1 cytokines at various time points (Figure-2(A-J)). The Th-1 cytokines (IFN-γ and IL-12) levels are higher in the BCG group boosted by ESAT-6 Exo and Rv- Exo compared to the BCG alone group at post booster time points (Figure-2A and 2C). On the other hand, no significant difference was observed in the Th2 (IL-4 and IL-10) response at any time points at post-booster. However, the IL-4 level was lower but not significantly in vaccinated groups compared to the sham exosome (PBS) group (Figure-2D). The Th2 cytokine IL-10 was significantly high in PBS group (P\u0026thinsp;\u0026gt;\u0026thinsp;.001) compared to ESAT-6 and Rv-Exo booster groups of BCG at the post-booster time point (Figure-2B). The expression level of Th-1/Th-2 cytokine ratio was 28 and 21 times higher in BCG\u0026thinsp;+\u0026thinsp;ESAT Exo and BCG Rv- Exo groups as compared to the BCG alone group at post booster time point (Figure-2E) however, discernible elevation was observed across all groups at the two weeks post challenge (TWPC), indicative of \u003cem\u003eM.tb\u003c/em\u003e infection and likely representing the onset of the disease (Figure-2). At TWPC, the serum of vaccinated animals was evaluated for IFN- γ, IL-12 (Th-1 cytokines) as well as IL-4 and IL-10 (Th-2 cytokines). The comparative analysis showed elevated IFN- γ after booster in all groups. The vaccine group i-e ESAT-6 Exo (156 pg/ml PB vs 570.15 pg/ml TWPC), Rv- Exo (390pg/ml PB vs 665.5pg/ml TWPC), and their BCG booster counterparts showed 8-10-fold elevation in compare to BCG alone (Figure-2F). Similarly, the IL-12 level in the ESAT6-Exo and Rv-Exo vaccinated groups were elevated 5-6-fold compared to post-booster time point (Figure-2H). This sustained increase in IL-12 at twelve weeks post challenge signifies protective immune response against \u003cem\u003eM.tb.\u003c/em\u003e in immunized animals. When we compared Th2 cytokine, IL4 production at post booster and TWPC time points PBS group showed various fold elevated IL-4 production at TWPC in compare to all vaccinated groups, it may be due to onset of disease (Figure-2D\u0026amp;2I). In contrast, the IL-10 levels were increased in PBS (90.5pg/ml Pb Vs 67.7pg/ml TWPC), and vaccinated groups, ESAT-6 Exo (41pg/ml Pb Vs 49.5pg/ml TWPC), Rv-Exo (68.5pg/ml PB Vs 50pg/ml TWPC) and BCG alone (61 pg/ml Pb Vs 120pg/ml TWPC). Interestingly, the BCG also did not show much increase in IL-4 level (175.5pg/ml Pb Vs 338pg/ml TWPC). However, when the IL-10 level in post challenge sample was compared between groups, the PBS group showed the highest IL-10 level (67 pg/ml) in comparison to other vaccinated groups again proving the notion that \u003cem\u003eM.tb\u003c/em\u003e pathogenesis is having more impact on PBS group. The BCG group also showed heightened level of IL-10 (106.588 pg/ml) in compare to its booster counterparts i-e BCG \u0026ndash;ESAT-6 Exo (20pg/ml) \u0026amp; BCG Rv-Exo (40 pg/ml). this finding remains in line with the earlier literature that suggests BCG strongly induces IL-10 response (Figure-2G).\u003c/p\u003e\u003cp\u003eAfter the evaluation of serum from immunized animals for Th-1 and Th-2 cytokines, we examined \u003cem\u003eM. tb\u003c/em\u003e specific immune response. Equal no. of splenocytes of control and vaccinated animals were either left untreated or activated using PPD 25\u0026micro;g/ml, 50 \u0026micro;g/ml or 100 \u0026micro;g/ml for 72 hours, and culture supernatant were subjected to ELISA for IFN- γ (Figure-2K), and IL-10 (Figure-2L). As the antigen dose increased, the IFN- γ and IL-10 levels were also increased in the BCG\u0026thinsp;+\u0026thinsp;ESAT-6 Exo and Rv-Exo immunized groups (Figure-2K and 2L). The production of Th-1 \u0026amp; Th-2 cytokine exhibits \u003cem\u003eM.tb.\u003c/em\u003e specific immune responses in splenocytes of immunized animals. The cytokine profile distinctly illustrates \u003cem\u003eM.tb.\u003c/em\u003e antigen-specific bearing exosome vaccine candidates; ESAT-6 Exo and Rv-Exo induce significantly elevated levels of Th1 cytokines at post-infection. It is also observed that ESAT-6 Exo and Rv-Exo boosted BCG groups demonstrated elevated dose-dependent cytokines levels. Overall, their results suggest that the \u003cem\u003eM.tb\u003c/em\u003e. antigen-bearing exosomes not only induce Th-1 biased immune response but also efficiently boost \u003cem\u003eM.tb\u003c/em\u003e specific Th-1 skewed response in BCG immunized animals both in serum as well as splenocytes culture supernatant upon activation by PPD (Figure \u0026minus;\u0026thinsp;2).\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\n\u003ch3\u003eImmunohistochemistry analysis demonstrate Th1 cytokine response in spleen and lung tissues:\u003c/h3\u003e\n\u003cp\u003eThe microscopic examination of lung and spleen tissues stained for Th-1 (IFN-γ) and Th-2 (IL-10) cytokines revealed distinct patterns of immune response across the different groups. The control group showed minimal staining for both IFN-γ and IL-10, indicating baseline cytokine expression levels with no significant immune activation. In contrast, the BCG ESAT-6 Exo group exhibited intense staining for IFN-γ in both lung and spleen tissues, suggesting a strong Th-1 mediated immune response (Figure-2N), while IL-10 staining was moderate, indicating a balanced immune response with a slight Th-1 dominance (Figure-2O). Similarly, the BCG\u0026thinsp;+\u0026thinsp;Rv-Exo group demonstrated pronounced IFN-γ staining, particularly in the lung tissues, highlighting a robust localized Th-1 response, with IL-10 staining present but less intense, suggesting a predominant Th-1 response with some regulatory Th-2 activity. The Only BCG group showed moderate IFN-γ staining in both lung and spleen tissues, indicating an effective but less pronounced Th-1 response compared to the exosome-treated groups, with slightly elevated IL-10 staining reflecting a balanced immune response with a tendency towards Th-1 dominance.\u003c/p\u003e\u003cp\u003eOverall, the tissue microscopic images demonstrate that BCG\u0026thinsp;+\u0026thinsp;ESAT-6-Exo and BCG\u0026thinsp;+\u0026thinsp;Rv-Exo treatments significantly enhance Th-1 (IFN-γ) mediated immune responses in the lungs and spleen compared to the control and Only BCG groups. The presence of Th-2 (IL-10) cytokines suggests a regulatory mechanism to balance the immune response, with a notable Th-1 bias in the exosome-treated groups. These findings underscore the potential of BCG exosome treatments in modulating immune responses more effectively than BCG alone.\u003c/p\u003e\u003cp\u003e\u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003eThe administration of exosome-entrapped ESAT-6 vaccine candidates predominantly elicits IgG2a subtype antibodies in mice subjected to immunization\u003c/span\u003e\u003c/p\u003e\u003cp\u003eApart from Th-1 and Th-2 cytokines, we examined the importance of IgG antibodies in Antibody-Dependent Cellular Cytotoxicity (ADCC), Antibody Dependent Phagocytosis (ADP) and CD4 activation. We evaluated IgG1 and IgG2a level isolated at post-booster and post-infection time points from various immunized groups using ELISA and their ratio was also calculated. As illustrated in Figure-3, The expression of IgG1 levels is higher in our ESAT\u0026thinsp;+\u0026thinsp;Exo and BCG alone group as compared to the vaccinated groups at post-booster time points (Figure-3A). Similarly, the expression IGg2a level is higher in our BCG\u0026thinsp;+\u0026thinsp;ESAT-6 Exo and BCG\u0026thinsp;+\u0026thinsp;Rv- Exo groups as compared to the only BCG groups (Figure-3B). there was a notable elevation in the IgG2a: IgG1 ratio at post-booster time points, with the BCG\u0026thinsp;+\u0026thinsp;ESAT-6 Exo and BCG\u0026thinsp;+\u0026thinsp;Rv-Exo groups exhibiting higher ratios of 10 and 7.5, respectively, compared to the BCG-alone group (Figure-3C). The post-booster results suggest that the BCG\u0026thinsp;+\u0026thinsp;ESAT-6 Exo and BCG\u0026thinsp;+\u0026thinsp;Rv- Exo groups elicit elevated Th-1 biased immune response and has the potential to educate the immune system for CTL response against \u003cem\u003eM.tb.\u003c/em\u003e The post-booster IgG2a/IgG1 ratio measurements were 1.005\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05545 in pre-immune sera,0.2555\u0026thinsp;\u0026plusmn;\u0026thinsp;0.08300 for the BCG-alone group, 4.323\u0026thinsp;\u0026plusmn;\u0026thinsp;0.6875 for the BCG\u0026thinsp;+\u0026thinsp;ESAT-6 Exo group, and 3.563\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5694 for the BCG\u0026thinsp;+\u0026thinsp;Rv-Exo group. At TWPC, the IgG1 level is higher in only BCG and BCG\u0026thinsp;+\u0026thinsp;Rv-Exo groups (Figure-3D) and the level of IgG2a is higher in BCG\u0026thinsp;+\u0026thinsp;Rv-Exo group (Figure-3E). The IgG2a/IgG1 ratios were higher for the BCG\u0026thinsp;+\u0026thinsp;ESAT-6 Exo and BCG\u0026thinsp;+\u0026thinsp;Rv-Exo groups were 6 and 8.2, respectively than the BCG-only group (Figure-3F). These findings suggest that the Rv-Exo and BCG\u0026thinsp;+\u0026thinsp;ESAT-6 Exo immunized groups induce a more robust Th1 response compared to other groups, including the BCG-alone cohort, with statistical significance (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). The higher IgG2a: IgG1 ratio indicates a shift towards a Th1-type immune response, crucial for combating intracellular pathogens like \u003cem\u003eM.tb.\u003c/em\u003e Overall, we demonstrated that exosome-based vaccines, particularly those incorporating ESAT-6, significantly enhance the Th1 immune response, making them promising candidates for improved tuberculosis vaccines.\u003c/p\u003e\u003cdiv id=\"Sec31\" class=\"Section2\"\u003e\u003ch2\u003eIncreased pro and anti-inflammatory cytokine gene expression in CD4\u003csup\u003e+\u003c/sup\u003e T cells:\u003c/h2\u003e\u003cp\u003eThe transcription factor, T-bet, is a hallmark of Th1 immune response and mainly induces IFN-γ production. To examine \u003cem\u003eM.tb.\u003c/em\u003e specific type-1 immune response, we explored the signaling molecules. Quantitative PCR analysis was performed to assess the gene expression in the spleen and lymph nodes of various vaccinated groups at the TWPC. Our findings demonstrated heightened expression of Th1 regulatory genes, TBX21 in the spleen tissue of the Rv-Exo 1.5 fold and BCG\u0026thinsp;+\u0026thinsp;ESAT-Exo 1.6-fold group in comparison to the BCG-alone group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001; Figure-4A). The level of TBX21 gene expression was measured in control, BCG-alone, and BCG\u0026thinsp;+\u0026thinsp;Rv-Exo groups, with their respective values being 0.99\u0026thinsp;\u0026plusmn;\u0026thinsp;0.002, 6.04\u0026thinsp;\u0026plusmn;\u0026thinsp;0.349, and 9.22\u0026thinsp;\u0026plusmn;\u0026thinsp;0.315, respectively (Figure-4A). The Th2-regulatory genes GATA, expression was significantly upregulated in spleen of BCG\u0026thinsp;+\u0026thinsp;Rv-Exo and BCG-+ESAT-6-Exo immunized animals (Figure-4B). Interestingly, the pro-inflammatory cytokine IL-1 beta expression was found to be higher in only Rv-Exo and BCG\u0026thinsp;+\u0026thinsp;ESAT-6 Exo groups. In contrary, only BCG and BCG\u0026thinsp;+\u0026thinsp;Rv Exo showed similar response (Figure-4C). In contrast, in the lymph nodes, the expression of Th-1immune response related genes in vaccinated groups showed higher expression in comparison to the BCG-alone group (Figure-4D). Similarly, the expression of GATA-3 gene expression was higher in vaccinated groups as compared to the BCG-alone group (Figure \u0026minus;\u0026thinsp;4E). IL-1 beta expression is higher in ESAT-6 Exo \u0026amp; BCG\u0026thinsp;+\u0026thinsp;Rv- Exo group and BCG-alone group (Figure-4F). In conclusion, the T-bet (Th1 transcription factor) and GATA (Th2 transcription factor) were elevated in immunized groups.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec32\" class=\"Section2\"\u003e\u003ch2\u003eCD3\u003csup\u003e+\u003c/sup\u003e/CD8\u003csup\u003e+\u003c/sup\u003e and CD3\u003csup\u003e+\u003c/sup\u003e/CD8\u003csup\u003e+\u003c/sup\u003e T and CD4\u003csup\u003e+\u003c/sup\u003e/CD45\u003csup\u003e+\u003c/sup\u003e cell responses in vaccinated animals\u003c/h2\u003e\u003cp\u003eLymphocytes from the spleens of various immunized animal groups at TWPC were stained with antibodies conjugated with specific cell surface molecules as well as intracellular markers. The cells were stained with anti-CD-3 to (T cells marker), CD4, and CD8 (to distinguish CD4\u003csup\u003e+\u003c/sup\u003e helper T cells and CD8\u003csup\u003e+\u003c/sup\u003e T lymphocytes (Figure-5A; dot plot). The FACS analysis showed that the BCG\u0026thinsp;+\u0026thinsp;ESAT-6 Exo and BCG\u0026thinsp;+\u0026thinsp;Rv-Exo groups exhibited a 1.6 and 1.34-fold higher population of CD4\u0026thinsp;+\u0026thinsp;T cells, compared to the BCG-alone group. BCG Vs BCG\u0026thinsp;+\u0026thinsp;Rv-Exo (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) \u0026amp; BCG vs BCG\u0026thinsp;+\u0026thinsp;ESAT-6 Exo (Figure-5B). The elevated CD4\u0026thinsp;+\u0026thinsp;T cell population in BCG ESAT-6 Exo and BCG\u0026thinsp;+\u0026thinsp;Rv Exo booster groups demonstrate proliferation, which is crucial for orchestrating the immune response by activating other immune cells. On the other hand, the ESAT-6 Exo \u0026amp; Rv-Exo formulation was particularly found to be effective at inducing a CD8\u003csup\u003e+\u003c/sup\u003e T cell population, which is essential for directly killing infected (Figure-5C). The percentage of CD8\u003csup\u003e+\u003c/sup\u003e T cells is 1.57 \u0026amp; 1.6 fold higher in the vaccinated groups as compared to the only BCG groups, as shown in Figure-5C. The increases in CD8\u003csup\u003e+\u003c/sup\u003e T cells in the ESAT-6 Exo group were highly significant (P\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Moreover, the CD4\u003csup\u003e+\u003c/sup\u003e/CD45\u003csup\u003e+\u003c/sup\u003e T helper cells population was 1.25-fold and 1.5-fold higher in BCG\u0026thinsp;+\u0026thinsp;Rv-Exo and BCG\u0026thinsp;+\u0026thinsp;ESAT-6 Exo groups, respectively (Figure-5D and E). These results highlight that exosome-based vaccine candidates are modulating the immune response, enhancing T cell-mediated immunity, and suggest that these candidates that could be vaccines have the potential to tailor immune responses more effectively than traditional vaccines, which could lead to improved protection against tuberculosis.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cdiv id=\"Sec33\" class=\"Section3\"\u003e\u003ch2\u003eTh-1 and Th-2 cytokine expression in CD4\u003csup\u003e+\u003c/sup\u003e T Cells:\u003c/h2\u003e\u003cp\u003eThe vaccinated groups elicited cytokines at various time points suggestive of strong CD4\u0026thinsp;+\u0026thinsp;T cell response (Figure-6). Further, we sought to investigate the CD4\u003csup\u003e+\u003c/sup\u003e T cells involvement in cytokine production. To enumerate cytokine expression in a T cell population splenocytes of various immunized animal groups were stained for intracellular cytokines with conjugated antibodies specific for intracellular cytokines, The splenocytes were stained with α-CD3 α-CD4 antibodies along with intracellular Th-1 cytokines IL-12\u003csup\u003e+\u003c/sup\u003e, TNF-α and Th-2 cytokines IL-4 and IL-10 were stained to assess their intracellular expression levels. The results revealed that animals immunized with BCG and boosted with ESAT-6 and Rv Exo exhibited significantly heightened expression of intracellular IL-12 at 12 weeks post-infection, as shown in (Figures-\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA and \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). When compared the percentage of CD4\u003csup\u003e+\u003c/sup\u003e IL-12\u003csup\u003e+\u003c/sup\u003e T cells are 2.6 and 2.5fold higher in BCG\u0026thinsp;+\u0026thinsp;ESAT-6 Exo and BCG\u0026thinsp;+\u0026thinsp;Rv-Exo vaccinated groups than BCG-alone group. Next, we examined the expression of another proinflammatory cytokine, TNF- α, in CD4\u0026thinsp;+\u0026thinsp;T cells. TNF-α was found to be 1.4 and 1.2-fold higher in our BCG\u0026thinsp;+\u0026thinsp;ESAT-6 Exo and BCG\u0026thinsp;+\u0026thinsp;Rv-Exo vaccinated groups, respectively when compared to the BCG-alone group at TWPC (Figure- 6C and 6D). Additionally, we have also examined the expression of Th-2 cytokines IL-4 and IL-10 in CD4\u0026thinsp;+\u0026thinsp;T cells. IL-4 was higher in animals immunized with the free ESAT-6, BCG-alone, and Sham Exo antigen compared to other vaccinated groups, ESAT-6 Exo and Rv-Exo (Figure-6E and 6F). IL-10 producing CD4\u003csup\u003e+\u003c/sup\u003e T cells were found to be higher in animals immunized with the BCG\u0026thinsp;+\u0026thinsp;ESAT-6 Exo and BCG\u0026thinsp;+\u0026thinsp;Rv-Exo compared to the other vaccinated groups (Figure-6G and 6H). The elevated levels of IL-12\u003csup\u003e+\u003c/sup\u003e and TNF-α in the BCG\u0026thinsp;+\u0026thinsp;ESAT-6 Exo and BCG\u0026thinsp;+\u0026thinsp;Rv-Exo groups suggest a robust Th1 response, which is critical for effective response against \u003cem\u003eM.tb.\u003c/em\u003e The IL-10 producing cells show Th-2 response as well which indicates a balanced immune response in the immunized animals. These findings highlight the enhanced capacity of exosome-based vaccine formulations to elicit strong Th1 immune responses, which are essential for controlling infections.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003eESAT-6 Exo and Rv-Exo booster to BCG enhances Central and Effector memory response in CD4\u0026thinsp;+\u0026thinsp;and CD8\u0026thinsp;+\u0026thinsp;T cells\u003c/span\u003e:\u003c/p\u003e\u003cp\u003eThe success of any vaccine relies on the development of memory responses of lymphocytes. T cell memory remains indispensable for intracellular pathogens like \u003cem\u003eM.tb.\u003c/em\u003e In line to evaluate memory response, after evaluating CD4\u003csup\u003e+\u003c/sup\u003e and CD8\u003csup\u003e+\u003c/sup\u003e T cell phenotypes, we asked if the in-house prepared vaccine candidates induce effector (CD44\u003csup\u003ehigh\u003c/sup\u003e CD62L\u003csup\u003elow\u003c/sup\u003e) or long-lasting central memory (CD44 \u003csup\u003ehigh\u003c/sup\u003e CD62L \u003csup\u003ehigh\u003c/sup\u003e) population in the splenocytes of the immunized animals at TWPC time points (Figure-7). The FACS data suggested when BCG-immunized animals were given a booster with ESAT-6 Exo or Rv-Exo, the central memory in CD4\u003csup\u003e+\u003c/sup\u003e T cells was increased by 2.5-fold and 2-fold higher, respectively, in comparison to the BCG-alone group (Figure-7A and 7B). The evaluation of CD4\u003csup\u003e+\u003c/sup\u003e T cell effector memory (CD4\u003csup\u003e+\u003c/sup\u003e CD44 \u003csup\u003ehigh\u003c/sup\u003e CD62L\u003csup\u003ehigh\u003c/sup\u003e) which plays an instrumental role in fighting concurrent pathogens. The FACS data suggest that the ESAT-6 Exo and BCG-alone groups showed comparable cell populations with slightly increased response in BCG-alone groups. On the other hand, the BCG ESAT-6 Exo showed a 2.2-fold elevated level of effector memory cell population (Figure-7A and 7C).\u003c/p\u003e\u003cp\u003eLymphocytes from the spleens of immunized groups were stained with antibodies conjugated to specific cell surface markers, followed by FACS analysis. The cells were stained with CD3 antibodies to identify T cells, and subsequently with CD4 and CD8 markers to differentiate between CD4\u003csup\u003e+\u003c/sup\u003e T cells and CD8\u003csup\u003e+\u003c/sup\u003e T cells. Additionally, the cells were analyzed for CD44 and CD62L expression to assess central and effector memory T cell responses in the vaccinated groups. Since the killing of infected cells to reduce the pathogen burden in vital organs relies on CTL response, hence we also examined CD8\u0026thinsp;+\u0026thinsp;T cell memory responses in the immunized groups. Interestingly, animals immunized with Rv-Exo showed a persistent central memory phenotype (CD44\u003csup\u003ehigh\u003c/sup\u003e CD62L\u003csup\u003ehigh\u003c/sup\u003e) (Figure-7E). In contrast, the CD8\u003csup\u003e+\u003c/sup\u003e T cells from the ESAT-6 Exo immunized group exhibited a strong effector memory phenotype (CD44\u003csup\u003ehigh\u003c/sup\u003eCD62L\u003csup\u003elow\u003c/sup\u003e) (Figure-7F). The effector memory phenotype (CD44\u003csup\u003ehigh\u003c/sup\u003eCD62L\u003csup\u003elow\u003c/sup\u003e) in CD8\u003csup\u003e+\u003c/sup\u003e T cells was significantly higher in the BCG\u0026thinsp;+\u0026thinsp;ESAT-6 Exo groups compared to other groups, including the BCG-alone group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001), as demonstrated in Figure-7F. In contrast, the BCG\u0026thinsp;+\u0026thinsp;Rv Exo group showed reduced effector memory, Interestingly, the Rv Exo and ESAT-6 Exo also showed a higher population of CD8\u003csup\u003e+\u003c/sup\u003e effector memory. These results suggest that different exosome formulations not only enhance targeted memory T cell responses but also indicate a tailored immune memory profile. The BCG\u0026thinsp;+\u0026thinsp;ESAT-6 Exo formulation effectively boosts both CD4\u003csup\u003e+\u003c/sup\u003e and CD8\u003csup\u003e+\u003c/sup\u003e effector memory T cells, which are crucial for rapid immune responses upon re-exposure to pathogens. Meanwhile, the Rv-Exo formulation appears to support a central memory phenotype, which is important for long-term immunity. This differentiation in immune response profiles underscores the potential of exosome-based vaccines to provide more effective and lasting protection against infectious diseases compared to traditional vaccines.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec34\" class=\"Section3\"\u003e\u003ch2\u003eThe ESAT-6 and Rv-Exo elicit T cell proliferation in a dose-dependent manner:\u003c/h2\u003e\u003cp\u003eSplenocytes isolated from the immunized animals were seeded into 96-well plates. The splenocytes from both control and vaccinated animals were either left untreated or activated using ESAT-6 at concentrations of 1 \u0026micro;g/ml, 2.5 \u0026micro;g/ml, 5 \u0026micro;g/ml, and 10 \u0026micro;g/ml, as well as Purified Protein Derivative (PPD) at concentrations of 25\u0026micro;g/ml, 50\u0026micro;g/ml, or 100\u0026micro;g/ml for 72h at 37\u0026deg;C (Figure-8A and 8B). The results showed that BCG\u0026thinsp;+\u0026thinsp;Rv-Exo significantly enhanced T cell proliferation upon activation with the ESAT-6 antigen post-infection in a dose dependent manner (Figure-8A). This enhanced proliferation is notably higher in the BCG\u0026thinsp;+\u0026thinsp;Rv-Exo and BCG\u0026thinsp;+\u0026thinsp;ESAT-6 Exo groups compared to groups treated with the free ESAT-6 antigen, BCG alone, and its physical mixture with sham-Exo. The observed increase in T cell proliferation in the BCG\u0026thinsp;+\u0026thinsp;Rv-Exo and BCG\u0026thinsp;+\u0026thinsp;ESAT-6 Exo groups suggests a superior immunogenic response facilitated by the combination of BCG with Rv-Exo or ESAT-6 Exo. Furthermore, when the lymphocytes are activated with free PPD, a similar trend is observed where T cell proliferation is significantly heightened in the BCG\u0026thinsp;+\u0026thinsp;Rv-Exo immunized groups post-infection (Figure-8B). This indicates a robust and \u003cem\u003eM.tb\u003c/em\u003e. specific immune response triggered by the BCG\u0026thinsp;+\u0026thinsp;Rv-Exo immunization strategy. In sharp contrast, lymphocytes isolated from animals in the control group (immunized with PBS or sham exosomes) fail to induce substantial T cell proliferation, even when exposed to higher antigen doses. This lack of significant proliferation in the control group underscores the efficacy of the BCG\u0026thinsp;+\u0026thinsp;Rv-Exo and BCG\u0026thinsp;+\u0026thinsp;ESAT-6 Exo immunization protocols in eliciting a potent T cell-mediated immune response. These findings highlight the potential of exosome-mediated delivery in enhancing T-cell responses, offering promising avenues for improved tuberculosis vaccines.\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\n\u003ch3\u003eOxygen burst response was elevated in immunized animals\u003c/h3\u003e\n\u003cp\u003eThe detection of nitric oxide (NO) and reactive oxygen species (ROS) levels in serum and whole cell lysates of spleen tissue from various immunized mice was conducted at three specific time points: post-booster, 6 weeks post-infection, and 12 weeks post-infection with \u003cem\u003e(M. tb).\u003c/em\u003e The results revealed that exosome-encapsulated vaccine candidates, BCG\u0026thinsp;+\u0026thinsp;ESAT-6 Exo and BCG\u0026thinsp;+\u0026thinsp;Rv-Exo, significantly elevated levels of NO and ROS in both serum and spleen tissue at all the time points. Notably, ROS levels were higher in the BCG\u0026thinsp;+\u0026thinsp;ESAT-6 Exo (105 \u0026micro;g/ml) and BCG\u0026thinsp;+\u0026thinsp;Rv-Exo groups compared to the BCG alone group post-booster (Figure-9A). Also, at 6 weeks post-infection, ROS levels were elevated in the ESAT-6 Exo group compared to the BCG-alone group (Figure \u0026minus;\u0026thinsp;9B), and at 12 weeks post-infection, ROS levels remained high in the ESAT-6 Exo group compared to the BCG-alone group (Figure-9C). Upon comparative analysis of various groups, we found ROS was elevated in comparison to post-booster in all the groups like ESAT-6 Exo (130\u0026micro;g/ml PB vs 110\u0026micro;g/ml TWPC), Rv-Exo (130\u0026micro;g/ml PB vs 100\u0026micro;g/ml TWPC). Additionally, ROS concentrations in splenic whole cell lysates were greater in the BCG\u0026thinsp;+\u0026thinsp;ESAT-6 Exo and BCG\u0026thinsp;+\u0026thinsp;Rv-Exo groups compared to the BCG-alone group at 12 weeks post-infection (Figure-9D). These results suggest that BCG ESAT-6 Exo and BCG Rv-Exo vaccines enhance ROS production, leading to a more robust and sustained immune response against tuberculosis. Similarly, NO levels were significantly elevated in the BCG\u0026thinsp;+\u0026thinsp;ESAT-6 Exo and BCG Rv-Exo groups compared to the BCG group post-booster (Figure-9E), and NO production remained higher in both the BCG ESAT-6 Exo and BCG Rv-Exo groups at 6 weeks (Figure-9F) and 12 weeks post-infection (Figure-9G). These results indicate that the BCG\u0026thinsp;+\u0026thinsp;ESAT-6 Exo and BCG\u0026thinsp;+\u0026thinsp;Rv-Exo vaccines enhance NO production, contributing to a more robust and sustained immune response against tuberculosis. These findings suggest that vaccination effectively enhances nitric oxide and ROS levels, contributing to the host defense mechanisms against TB infection. The exosome-based vaccine for tuberculosis modulates ROS and NO levels, enhancing the long-term immune response against \u003cem\u003eM.tb.\u003c/em\u003e and protecting against tissue damage by inducing bactericidal activity, thus making it a promising candidate for TB prevention.\u003c/p\u003e\n\u003ch3\u003eProphylactic efficacy of vaccine Post-infection in the lungs, spleen, and lymph nodes of immunized mice\u003c/h3\u003e\n\u003cp\u003eThe NF-κB regulates COX-2 and i-NOS to facilitate inflammatory responses, to evaluate inflammatory signaling. The Western blot analysis was performed using whole cell lysates from lungs, spleen, and lymph nodes from various groups of immunized mice and levels of COX-2, i-NOS, and NF-κB were compared between groups. In figure-9(H), the whole cell lysate of lung tissue shows the expression of COX-2 protein which is an inducible enzyme that plays a pivotal role in the inflammatory response during tuberculosis infection. Densitometry analysis was used to quantify the band intensities, which were normalized against tubulin and compared with the PBS control group. The results showed a significant increase in NF-κB expression across the vaccine candidates, Rv-Exo with showing a 1.05 fold increase and BCG\u0026thinsp;+\u0026thinsp;Rv-Exo a 1.8-fold increase. Interestingly, the BCG\u0026thinsp;+\u0026thinsp;Rv Exo and BCG-alone groups showed 1.7 and 2.1 fold increase. The expression of i-NOS is increasesed as shown by fold change in vaccinated groups, ESAT-6 Exo, BCG\u0026thinsp;+\u0026thinsp;ESAT-6-Exo, Rv-Exo and BCG\u0026thinsp;+\u0026thinsp;Rv-Exo respectively 9.81, 2.7, 5.2, and 9.1 as compared to the PBS group. The expression of Pirf-3, NF-κB, i-NOS, Cox-2, and loading control actin was evaluated in the whole cell lysate of spleen tissue (Figure-9I). The results showed a significant increase in pIrf-3 expression across the vaccine candidates, ESAT-6 Exo and BCG\u0026thinsp;+\u0026thinsp;ESAT-6 Exo showing a 1.16 and 1.33 fold increase, and Rv-Exo \u0026amp; BCG\u0026thinsp;+\u0026thinsp;Rv-Exo has 1.33 -fold increase. The expression of i-NOS molecule shows the increases in fold change in vaccinated groups ESAT-6 Exo, BCG\u0026thinsp;+\u0026thinsp;ESAT-6-Exo, Rv-Exo and BCG\u0026thinsp;+\u0026thinsp;Rv-Exo respectively 1.34, 1.56, 1.7 and 1.62 when compared to the PBS group. The expression of Cox-2 molecule shows an increase in fold change in the vaccinated group BCG\u0026thinsp;+\u0026thinsp;Rv-Exo (1.72) over the PBS group. The expression of i-NOS in lymphnodes of different vaccinated animals was also increased as determined by fold change in the intensity of bands in vaccinated groups ESAT-6 Exo, BCG\u0026thinsp;+\u0026thinsp;ESAT-6-Exo, Rv-Exo, and BC\u0026thinsp;+\u0026thinsp;Rv-Exo respectively 5.1, 7.8, 3.9 and 3.4 as compared to the PBS group (Figure-9J). These results are in line with the oxidative burst responses (Figure-9A-9G). Overall, these findings suggest that both Rv-Exo and BCG\u0026thinsp;+\u0026thinsp;Rv-Exo may have a stronger immunogenic potential, making them promising candidates for further vaccine development.\u003c/p\u003e\u003cdiv id=\"Sec37\" class=\"Section2\"\u003e\u003ch2\u003eThe exosome-based vaccine reduces bacterial burden in vital organs\u003c/h2\u003e\u003cp\u003eIn certain cases, though immunization leads to a strong immune response, the prophylactic efficacy of the candidate vaccine remains compromised. To test the potential of our exosome-based vaccines, we have challenged the vaccinated animals with \u003cem\u003eM.tb\u003c/em\u003e and the protective efficacy was evaluated based on their ability to reduce bacterial loads in the lungs, spleen, and lymph nodes of immunized mice. As shown in Figure-10, groups immunized with ESAT-6-Exo or Rv-Exo with BCG demonstrated a significant reduction in bacterial burden compared to the PBS or BCG-alone group. At 6 weeks post-challenge, BCG followed by ESAT-6-Exo and Rv-Exo vaccination provided protection when compared to the PBS group (p\u0026thinsp;\u0026lt;\u0026thinsp;.001) in the lungs (Figure-10A). In case of spleen, ESAT-6-Exo and BCG\u0026thinsp;+\u0026thinsp;Rv-Exo vaccination reduce bacterial burden when compared to the PBS group (p\u0026thinsp;\u0026lt;\u0026thinsp;.001) (Figure-10B). In additionally, Lymph nodes showed the reduced in spleen mycobacterial load in BCG\u0026thinsp;+\u0026thinsp;ESAT-Exo and BCG\u0026thinsp;+\u0026thinsp;Rv-Exo log\u003csub\u003el0\u003c/sub\u003e1.7\u0026plusmn;. 0.35 and 1.4\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1386, respectively when compared to the PBS and only BCG group (p\u0026thinsp;\u0026lt;\u0026thinsp;.001) (Figure-10C). By the TWPC, animals immunized with BCG followed by ESAT-6 Exo and Rv-Exo exhibited a mycobacterial load that was log\u003csub\u003el0\u003c/sub\u003e1.71\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1028 \u0026amp; log\u003csub\u003el0\u003c/sub\u003e 1.56\u0026thinsp;\u0026plusmn;\u0026thinsp;.098 lower than that of the PBS group in the lungs (Figure-10D). Similarly, with the spleen animals immunized with BCG followed by ESAT-6 Exo and Rv-Exo exhibited a mycobacterial load that was log\u003csub\u003el0\u003c/sub\u003e1.80\u0026thinsp;\u0026plusmn;\u0026thinsp;.1040 \u0026amp;log\u003csub\u003el0\u003c/sub\u003e1.82\u0026thinsp;\u0026plusmn;\u0026thinsp;0.154 lower than that of the PBS and only BCG group (Figure-10E). In case of lymph nodes, booster groups showed the reduction of bacterial load that waslog\u003csub\u003el0\u003c/sub\u003e1.64\u0026thinsp;\u0026plusmn;\u0026thinsp;0.226 and log\u003csub\u003el0\u003c/sub\u003e1.67\u0026thinsp;\u0026plusmn;\u0026thinsp;0.52 lower than that of the PBS and only BCG group (Figure-10F). Notably, while the BCG\u0026thinsp;+\u0026thinsp;ESAT-Exo and BCG\u0026thinsp;+\u0026thinsp;Rv-Exo showed an increase in CFU count in the lungs at TWPC compared to the bacterial burden at 6 weeks post-challenge in all organs. The residual bacterial load data clearly establish the superiority of the booster in eliminating tuberculosis compared to other control immunized groups.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003eHistopathology analysis suggest reduced tissue damage as well as bacterial burden in lungs of immunized animals\u003c/span\u003e:\u003c/p\u003e\u003cp\u003eWe investigated histopathological alterations and the presence of acid-fast bacilli in the lungs of infected mice to monitor tissue damage immune cell infiltration and overall disease progression (Figure-10G). In mice immunized with BCG followed by ESAT-6 Exo and Rv-Exo, acid-fast bacilli were scarcely observed within granulomas, primarily in areas of caseous necrosis. The bacilli number was significantly reduced compared to the PBS control group, which showed numerous bacilli dispersed throughout the lung parenchyma and within granulomas at TWPC (Figure-10G). This indicates that BCG followed by ESAT-6 Exo and Rv-Exo confers superior protection against tuberculosis, decreasing both bacterial burden and lung damage, compared to BCG alone and PBS. These findings underscore the potential of booster vaccine candidates as more effective strategies against tuberculosis, evidenced by improved histopathological outcomes and a lower prevalence of acid-fast bacilli in lung tissues. The observed reduction in TB-associated lung pathology and bacterial load signifies a stronger prophylactic effect, suggesting that this novel vaccine formulation may elicit a more robust immune response and enhance protective efficacy against TB infection.\u003c/p\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eA number of approaches have been used to develop improved vaccines for TB, including proteins in adjuvants, modified BCG or viral vectors expressing mycobacterial antigens. There are currently 17 TB vaccine candidates in various phases of clinical trial (\u003ca class=\"FNLink\" href=\"#Fn26\" id=\"#FNLinkFn26\"\u003e\u003c/a\u003e). These vaccine candidates fall under three broad categories: 1) recombinant BCG or other mycobacteria species, 2) viral vectors expressing various mycobacterial proteins, and 3) recombinant mycobacterial proteins in conjugation with robust adjuvants (\u003ca class=\"FNLink\" href=\"#Fn27\" id=\"#FNLinkFn27\"\u003e\u003c/a\u003e). At present it remains unclear whether these vaccine candidates will provide the effectiveness required for TB control. Recent data indicates that the MVA85A does not provide efficacious protection when used as a booster vaccine in infants previously immunized with BCG (\u003ca class=\"FNLink\" href=\"#Fn28\" id=\"#FNLinkFn28\"\u003e\u003c/a\u003e). Early reports with limited evidence suggest that exosomes may offer a novel approach to TB vaccine development. However, comprehensive studies to establish exosomes as viable candidates against tuberculosis remain largely unexplored. To establish the exosome-based vaccine, we employed \u003cem\u003eM. tb\u003c/em\u003e-specific antigen bearing Rv-Exo and ESAT-6 Exo, which are absent in BCG, to investigate for their efficacy either as an independent vaccine or as BCG booster (Figure-11).\u003c/p\u003e\u003cp\u003eThe BCG vaccine, a gold standard for TB prevention, faces several significant challenges that limit its effectiveness. Its efficacy varies widely, ranging from 0\u0026ndash;80%, influenced by geographic differences and pre-existing immunity from exposure to non-tuberculous mycobacteria, particularly showing lower effectiveness against pulmonary TB in adults (\u003ca class=\"FNLink\" href=\"#Fn29\" id=\"#FNLinkFn29\"\u003e\u003c/a\u003e). Additionally, the immunity provided by BCG wanes over time, typically lasting only 10\u0026ndash;20 years, which raises concerns about long-term protection, especially as susceptibility increases in young adults (\u003ca class=\"FNLink\" href=\"#Fn30\" id=\"#FNLinkFn30\"\u003e\u003c/a\u003e). Furthermore, it lacks virulence factors containing T cell epitopes due to the deletion of RD regions, resulting in a \"hiding and masking effect (\u003ca class=\"FNLink\" href=\"#Fn31\" id=\"#FNLinkFn31\"\u003e\u003c/a\u003e). We proposed that supplementing the deleted gene products of BCG could control tuberculosis. To this end, we used \u003cem\u003eM.tb.-\u003c/em\u003einfected cells derived Exosomes possessing \u003cem\u003eM.tb.\u003c/em\u003e antigens which were absent in BCG as potential vaccine candidate either alone or as a BCG booster to amplify its immune prophylactic potency.\u003c/p\u003e\u003cp\u003eIn previous studies, CFP incubated RAW.2647 macrophages cells derived exosomes were used as vaccine candidates (\u003ca class=\"FNLink\" href=\"#Fn32\" id=\"#FNLinkFn32\"\u003e\u003c/a\u003e). In another study the exosomes isolated from \u003cem\u003eM.tb\u003c/em\u003e-infected macrophages have shown only immune modulatory activity (\u003ca class=\"FNLink\" href=\"#Fn33\" id=\"#FNLinkFn33\"\u003e\u003c/a\u003e). Here, we have used alveolar macrophages infected with H37Rv and collected the exosomes from culture supernatant. Those exosomes found to carry 12 unique T cell antigens, to mention few Rv3887c, Rv1707, which were absent in BCG (Table-2). Hence, Rv-Exo could supplement BCG response with this immunity to boost its efficacy. The previous studies suggested that APC derived exosomes expressing antigen bearing MHC-I or MHC-II molecules directly interacted with CD8 and CD4\u0026thinsp;+\u0026thinsp;T cells. However, these exosomes were not capable of activating T cells directly unless they delivered the antigens to APCs, which in turn can activate T cells (\u003ca class=\"FNLink\" href=\"#Fn34\" id=\"#FNLinkFn34\"\u003e\u003c/a\u003e). The data of the present study suggests that exosomes derived from alveolar macrophages are capable to deliver the antigens either in cytosol by fusion with macrophages leading to MHC-1 presentation of antigens, hence, improved CTL response is expected. In contrary, exosomes were also found to be internalized by macrophages using endocytosis mechanism (Figure-1G). Our data corroborate the previous studies where it has been shown that exosomes may deliver the content by fusion or by endocytosis. In addition, recent studies suggest the exosomes may interact with target cells through lipid raft, so more exosomes may gather at lipid raft fragment of the membrane making them to fuse together, eventually larger vesicles come into existence (\u003ca class=\"FNLink\" href=\"#Fn35\" id=\"#FNLinkFn35\"\u003e\u003c/a\u003e).\u003c/p\u003e\u003cp\u003eBCG is known to lack T cell antigens containing RD region, hence do not provoke adequate CTL response. In our study, A strong Th1 polarization (IFN-ꝩ:IL-10), was detected in the BCG\u0026thinsp;+\u0026thinsp;ESAT-6 Exo and BCG\u0026thinsp;+\u0026thinsp;Rv-Exo groups, indicating effective cell-mediated immunity in compare to BCG alone, when compare at post booster as well as Post challenge (Figure-2). IFN-γ-producing Th1 cells typically drive the production of IgG2a antibodies. These findings underscore the importance of T cell-mediated immune responses in shaping antibody profiles and enhancing vaccine efficacy, especially in tuberculosis, where a robust Th1 response is critical for protection. The \u003cem\u003eM.tb.\u003c/em\u003e antigen bearing exosomes have emerged as promising adjuvants in vaccine development due to their ability to effective antigen delivery and presentation to immune cells.\u003c/p\u003e\u003cp\u003eOur data suggest that immunization protocol employing \u003cem\u003eM. tb\u003c/em\u003e-specific antigens bearing exosomes, Rv-Exo, ESAT-6 Exo and their BCG booster counterparts, elevate IFN-γ level and increased IFN-γ:IL-10 ratio higher IgG2a: IgG1 ratio at post booster as well as post challenge in immunized animal suggestive of Th1 biased immune response (Figure-3).\u003c/p\u003e\u003cp\u003eThe histopathological analysis of lung tissues from mice immunized with BCG followed by ESAT-6 Exo and Rv-Exo reveals substantial improvements in disease outcomes relative to BCG alone or PBS control (Figure-10G). The marked reduction in acid-fast bacilli within granulomas and the overall decreased bacillary density indicates enhanced control of \u003cem\u003eM.tb\u003c/em\u003e infection. This reduced bacterial burden, along with diminished lung tissue damage, suggests superior bacterial clearance and mitigation of TB-induced tissue destruction (Figure-10G). These findings underscore the potential of exosome-based booster vaccines to overcome the limitations of BCG. The observed histopathological improvements and reduced prevalence of acid-fast bacilli suggest a more comprehensive protective mechanism, likely engaging both innate and adaptive immune responses.\u003c/p\u003e\u003cp\u003eFurthermore, the TBx21 upregulation indicates effective Th1 polarization in lungs and spleen of the BCG\u0026thinsp;+\u0026thinsp;ESAT-6 Exo and BCG\u0026thinsp;+\u0026thinsp;Rv-Exo treated mice (Figure-4). The cytokine levels in serum of immunized animals correspond with Tbet and GATA gene expression profile.\u003c/p\u003e\u003cp\u003eThe splenocytes isolated from BCG-immunized animals boosted with Rv exosomes or ESAT-6 Exo showed dose dependent pattern of T cell proliferation (Figure-8). The higher antigen doses did not only lead to greater stimulation indices but also improved IFN-ꝩ production, reflecting increased \u003cem\u003eM.tb.\u003c/em\u003e specific T cell activation proportional to the antigen dosage, which was hampered in BCG alone group. The perturbed T cell activation may be attributed to the lack of T cell antigens in BCG, which was supplemented by injecting the T-cell antigen bearing Rv-Exo and ESAT-6 Exo. The results suggest that Rv-Exo and ESAT-6 Exo are supplementing BCG with T cell antigens. Further research is required to decipher key role of individual proteins present in the exosomes to identify the best antigens contributing to T cell immunity in BCG immunized mice boosted with Rv-Exo. It is well established that the T cell immune response is indispensable to control intracellular pathogen including \u003cem\u003eM.tb\u003c/em\u003e. In our study, we found that higher CD3\u003csup\u003e+\u003c/sup\u003eCD4\u003csup\u003e+\u003c/sup\u003e as well as CD3\u003csup\u003e+\u003c/sup\u003eCD8\u003csup\u003e+\u003c/sup\u003e phenotype of T cell in splenocytes of Rv-Exo and ESAT-6 Exo-boosted BCG groups. Elevated IL-12\u003csup\u003e+\u003c/sup\u003eTNF-α\u003csup\u003e+\u003c/sup\u003eCD4\u003csup\u003e+\u003c/sup\u003e T cell phenotype in mice immunized with BCG boosted with ESAT-6 Exo and BCG boosted with Rv-Exo as compared to BCG alone indicates a Th-1 biased response that is implicated to play a crucial role in activating macrophages to control \u003cem\u003eM. tb\u003c/em\u003e infection (Figure-5D-E, Figure-6A and D). The increased IL-12 levels also help in CTL induction, and is an indispensable immune response to combat \u003cem\u003eM.tb.\u003c/em\u003e infection and provide protection. In addition, the CD4\u003csup\u003e+\u003c/sup\u003e cells also demonstrated an elevated CD45RO expression, indicating their activation (Figure-5E).\u003c/p\u003e\u003cp\u003eTregs are essential for maintaining immune homeostasis and preventing excessive immune reactions that could lead to autoimmunity or chronic inflammation. The secretion of cytokines such as TGF-β and IL-10 by Treg cells modulates the activity of various immune cells, including effector T cells and antigen-presenting cells (APCs). The previous study shows that Exosomes derived from antigen-presenting cells or tumor cells can carry specific antigens and cytokines that may enhance Treg activation Reference. In our study, the BCG showed increased population of Treg cells as compared to free Ag vaccine candidate, however, BCG\u0026thinsp;+\u0026thinsp;ESAT-6 Exo and BCG\u0026thinsp;+\u0026thinsp;Rv-Exo vaccinations generated a stronger Treg immune cell response characterized by the increased secretion of IL-10 by antigen-stimulated T cells when compared to BCG alone (Figure-6H). This demonstrates immunomodulatory role of alveolar macrophages-derived exosomes in regulating the Treg cell population. This activation can lead to a more tolerogenic environment, which is particularly important in tuberculosis, where Treg-mediated suppression may help to balance the immune response and prevent tissue damage. This particular subset of cells has been identified as a correlate of vaccine-induced Th1-mediated protection and reported in other studies examining vaccine-induced protective immunity (\u003ca class=\"FNLink\" href=\"#Fn36\" id=\"#FNLinkFn36\"\u003e\u003c/a\u003e).\u003c/p\u003e\u003cp\u003eThe activated T cells further differentiate into concurrent infection clearing effector memory T cells (TEM) and long-term immunity providing central memory T cells (TCM). Effector T cells population clonally contracts after infection clearance. In contrast, central memory T cells stay for longer duration and able to initiate rapid recall response during reinfection with same pathogen due to their lower activation threshold. Therefore, the establishment of immune memory is essential for the efficacy of T-cell during vaccination. In our study, CD4\u003csup\u003e+\u003c/sup\u003e T cells derived from animals vaccinated with BCG\u0026thinsp;+\u0026thinsp;ESAT-6 Exo exhibited strong effector memory responses to \u003cem\u003eM.tb.\u003c/em\u003e infection, characterized by high levels of CD44\u003csup\u003e+\u003c/sup\u003e and low levels of CD62L expression on their surface (Figures-\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA\u0026amp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC), Meanwhile, CD4\u003csup\u003e+\u003c/sup\u003eT cells from animals vaccinated with both BCG\u0026thinsp;+\u0026thinsp;ESAT-6 Exo and BCG\u0026thinsp;+\u0026thinsp;Rv-Exo demonstrated robust long-term central memory responses to infection, marked by high levels of CD44 and high levels of CD62L expression on their surface (Figures-\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA \u0026amp; \u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB). In case of CD8\u003csup\u003e+\u003c/sup\u003e T cells, the effector memory was heightened in ESAT-6 Exo, BCG\u0026thinsp;+\u0026thinsp;ESAT-6 Exo and Rv Exosome alone. Surprisingly, the Rv-Exo booster to BCG could not elevate central memory as well as population of CD8\u0026thinsp;+\u0026thinsp;T cell (Figure-7D-F). This may be attributed to elevated Treg cells in this group (Figure-6H), as suggested by previous reports indicating Treg cells controlled the CD8 response by reducing the number and exhaustion of T cells\u003ca class=\"FNLink\" href=\"#Fn37\" id=\"#FNLinkFn37\"\u003e\u003c/a\u003e. Migration of memory cells to lymph nodes might be another possibility of observed reduced central as well as effector memory population in Rv-Exo booster BCG group. Our vaccine candidates are focused on inducing central memory T-cell responses, which indicates that long-lasting and protective immunity can effectively combat future tuberculosis infections.\u003c/p\u003e\u003cp\u003eWe found the prophylactic efficacy after giving \u003cem\u003eM.tb\u003c/em\u003e. vaccination. Interferon-gamma (IFN-γ) produced by T cells in response to \u003cem\u003eM.tb.\u003c/em\u003e infection stimulates inducible nitric oxide synthase (i-NOS) in macrophages, leading to increased production of Nitric oxide (NO) (Figure-9). Vaccination with BCG or novel tuberculosis vaccine candidates can prime the immune system to mount a stronger Th1 response upon \u003cem\u003eM.tb\u003c/em\u003e infection, characterized by increased IFN-γ production.\u003c/p\u003e\u003cp\u003eIn the context of \u003cem\u003eM.tb.\u003c/em\u003e infection, there exists a dynamic interplay among inflammation signaling molecules, namely NF-κB, iNOS, and COX-2. NF-κB activation serves as a pivotal trigger in response to Mtb infection, orchestrating the expression of pro-inflammatory genes. This activation often leads to the upregulation of iNOS, prompting the production of nitric oxide (NO) as a part of the host's antimicrobial defense. However, excessive NO production can further stimulate NF-κB and induce COX-2 expression. COX-2, in turn, contributes to inflammation through the synthesis of prostaglandins, which can modulate the immune response against \u003cem\u003eMtb\u003c/em\u003e. Thus, NF-κB, iNOS, and COX-2 collectively regulate the inflammatory milieu during \u003cem\u003eM.tb\u003c/em\u003e infection, shaping the host immune response and influencing the outcome of the infection (Figure-9). Our findings show that exosome-encapsulated vaccines, BCG\u0026thinsp;+\u0026thinsp;ESAT-6 Exo and BCG\u0026thinsp;+\u0026thinsp;Rv-Exo, significantly enhanced NO and ROS production in serum and spleen tissues of immunized mice, which was observed post-booster and at six week and twelve week post-challenge with \u003cem\u003eM.tb\u003c/em\u003e. (Figure-9A-G). The elevated levels of NO and ROS in serum, lung and spleen tissue lysates of vaccinated and \u003cem\u003eM.tb.\u003c/em\u003e challenged animals demonstrate the vaccine's effectiveness in enhancing the innate immune response to curb the bacterial population within the infected cells.\u003c/p\u003e\u003cp\u003eWe further assessed the role of these exosome-encapsulated vaccines in limiting the mycobacterial burden in three vital organs, including lungs, spleen and lymph nodes. The results indicate that only the BCG ESAT-6 Exo and BCG\u0026thinsp;+\u0026thinsp;Rv Exo treatments led to a significant decrease in bacterial load in the lungs of immunized animals by week 6 post-challenge, with a further reduction observed by week 12. Conversely, the Free ESAT-6 and BCG-only groups exhibited a significantly higher bacterial burden both at week 6 and 12 (Figures-\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eA \u0026amp; \u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eD). Similarly, lower mycobacterial burden was observed in in spleen and lymph nodes of the BCG\u0026thinsp;+\u0026thinsp;ESAT-6 Exo and BCG\u0026thinsp;+\u0026thinsp;Rv-Exo treated mice, which was not seen in other immunized groups (\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eFigure-10\u003c/span\u003e). The Th-1 Skewed serum cytokine levels were also evident by Immunohistochemistry and cytokines production by splenocytes (Figure-2), greater IgG2a:IgG1 ratio (Figure-3), elevated population of dose dependent CD3\u0026thinsp;+\u0026thinsp;CD4+, CD3\u0026thinsp;+\u0026thinsp;CD8\u0026thinsp;+\u0026thinsp;activated phenotype (Figure-5), CD45\u0026thinsp;+\u0026thinsp;CD4\u0026thinsp;+\u0026thinsp;phenotype of activated T cells, heightened CD4 and CD8\u0026thinsp;+\u0026thinsp;T cells effector and central memory (Figure-7), and increased RNS and ROS response, likely due to reduced bacterial burden (Figure-9). Together, these data suggest that exosome-encapsulated vaccines confer long term protection against tuberculosis in mice. Reduces the load of \u003cem\u003eM. tb\u003c/em\u003e in lungs, spleen and lymph nodes organs of mice that have been infected, thereby decreasing the bacterial presence and potentially limiting disease progression in these critical sites (Figure-10A-F). Studies indicate that the effectiveness of the BCG vaccine diminishes after approximately ten years, with limited evidence supporting its protective role in older populations. This decline in immunity underscores the need for new vaccines that can enhance BCG-induced protective immunity. Vaccinating with Rv Exo and ESAT-6 Exo as a booster alongside with BCG may enhance the immune response against tuberculosis. Studies indicate that booster vaccination can improve the activation of dendritic cells and promote a stronger T-cell response, particularly a Th1-mediated response (\u003ca class=\"FNLink\" href=\"#Fn38\" id=\"#FNLinkFn38\"\u003e\u003c/a\u003e).\u003c/p\u003e\u003cp\u003eExosome-based vaccine candidates offer significant advantages, such as biocompatibility, enhanced antigen presentation, and immunocompitability with the immune system. This can lead to stronger immune responses, innate immune responses due to adjuvant potential which further can lead to enhance CD4\u003csup\u003e+\u003c/sup\u003e T helper cells and CD8\u003csup\u003e+\u003c/sup\u003e T cells (CTL) immune responses, providing long-lasting protection against pathogens. The exosome was found to partially restore the function of exhausted T cells (\u003ca class=\"FNLink\" href=\"#Fn39\" id=\"#FNLinkFn39\"\u003e\u003c/a\u003e). However, challenges remain in using exosomes as a vaccine candidate due to batch-to-batch variations, raising concerns about the consistency and reliability of exosomes-based vaccines. This problem could be mitigated by antigen/multiple antigens encapsulation as we employed for ESAT-6 Exo. \u003cem\u003eM. bovis\u003c/em\u003e infects humans through zoonotic transmission. Notably, the live attenuated form of \u003cem\u003eM. bovis\u003c/em\u003e i.e. BCG remains a virulent due to loss of various virulent factors including T cell antigens. These virulent factors are present in wild type \u003cem\u003eM.bovis\u003c/em\u003e, and \u003cem\u003eM. tb\u003c/em\u003e that leads to reduce T cell immunity in BCG immunized individuals. The experiments, conducted in animals, in this study as well as earlier studies suggest that boosting BCG with T cell antigens could improve prophylactic efficacy of BCG vaccine. Further we are conducting clinical experiments where PBMCs from the TB patients are sensitized using exosomes isolated from \u003cem\u003eM.tb\u003c/em\u003e H37Rv infected THP-1, A549 or HEK293 cells or exosomes isolated from TB patients. So that would established if \u003cem\u003eM.tb\u003c/em\u003e specific T cell antigen bearing exosomes could be utilized to boost BCG immune response and prophylactic efficacy in vaccinated individuals.\u003c/p\u003e\u003cp\u003eIn summary, Our findings indicate that the exosome-based vaccine approach not only effectively addresses the limitations associated with traditional adjuvants but also enhances the induction of both CD4\u0026thinsp;+\u0026thinsp;and CD8\u0026thinsp;+\u0026thinsp;T cell responses. This dual activation is crucial for developing a more effective tuberculosis vaccine, capable of providing long-lasting protective immunity. The observed elevation of Th1 immune responses in Ex-vaccinated animals underscores the potential of the exosome platform to improve vaccine efficacy against tuberculosis. Specifically, the exosome-encapsulated vaccines successfully entrapped the ESAT-6 antigen, a critical virulence factor of \u003cem\u003eM.tb\u003c/em\u003e, which is known to elicit a robust immune response. The incorporation of ESAT-6 into exosomes derived from infected cells dynamically enhanced Th1 immune responses, characterized by increased production of pro-inflammatory cytokines and the activation of cytotoxic T lymphocytes. The elevation of Th1 responses is particularly significant, as it indicates a shift towards a more effective cell-mediated immunity, essential for controlling and eliminating \u003cem\u003eM.tb\u003c/em\u003e infections. This response is vital for developing a protective immune profile that can react swiftly and effectively upon re-exposure to the pathogen. The ability of our exosome-based vaccine candidates to boost Th1 responses suggests that they may provide a promising alternative to traditional vaccination strategies, especially in populations where the efficacy of the BCG vaccine is limited. Furthermore, the use of exosomes as a delivery system not only enhances antigen presentation but also facilitates the targeted activation of immune cells, thereby improving the overall immunogenicity of the vaccine. This targeted approach allows for a more precise modulation of the immune response, potentially overcoming some of the drawbacks associated with conventional adjuvants. By addressing the urgent need for improved tuberculosis mitigation strategies, this work paves the way for the development of more effective vaccines that could potentially enhance protective immunity against tuberculosis.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eConflict of interest:\u003c/h2\u003e\u003cp\u003eThe authors do not have any financial or intellectual conflicts of interest to declare. All coauthors seen and agreed with the contents of the manuscript.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eConceptualization: MAA; MS, Formal Analysis: MAA; MS; Data Curation: MAA; MS; SMA; BSL-3 Experimentation: MAA; MS; SA; AKS; Methodology \u0026amp; Experimentation: MAA; MS; SA; MA; Software and validation: MAA; MS, SK; Supervision, Funding and project administration: MAA; Resources: MAA; AKS; MIA; Investigation: MAA, MS, ; Original draft: MS; MAA; Review and editing: MS; MAA; SMA; MS, MIA.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eThe authors would like to thank the CIF, Jamia Hamdard, for providing the necessary facilities, Director ICMR-JALMA Institute for Leprosy and OMD for supplying M.tb. H37Rv, BCG, and access to ABSL-3 facility. MAA acknowledges the DBT Ramalingaswami Fellowship (BT/RLF/Re-entry/15/2015) and DST-SERB (ECR/2017/003016) for financial support. Ms. MS acknowledges DST INSPIRE for financial support as fellowship (IF-190671).\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eOur manuscript has data included as electronic supplementary material.\u003c/p\u003e"},{"header":"References","content":"\u003cp\u003ei. Mohammadnabi, N., Shamseddin, J., Emadi, M., Bodaghi, A. B., Varseh, M., Shariati, A., Rezaei, M., Dastranj, M., \u0026amp; Farahani, A. (2024). Mycobacterium tuberculosis: The Mechanism of Pathogenicity, Immune Responses, and Diagnostic Challenges. Journal of Clinical Laboratory Analysis. https://doi.org/10.1002/jcla.25122\u003c/p\u003e\n\u003cp\u003eii. Global Programme on Tuberculosis and Lung Health (GTB). (2021, October 14). Global tuberculosis report 2021. https://www.who.int/publications/i/item/9789240037021.\u003c/p\u003e\n\u003cp\u003eiii. Lee, J. Y. (2015). Diagnosis and treatment of extrapulmonary tuberculosis. Tuberculosis \u0026amp; Respiratory Diseases, 78(2), 47. https://doi.org/10.4046/trd.2015.78.2.47.\u003c/p\u003e\n\u003cp\u003eiv. Sharma, S. K., Vashishtha, R., Chauhan, L. S., Sreenivas, V., \u0026amp; Seth, D. (2017). Comparison of TST and IGRA in diagnosis of latent tuberculosis infection in a high TB-Burden setting. PLoS ONE, 12(1), e0169539. https://doi.org/10.1371/journal.pone.0169539\u003c/p\u003e\n\u003cp\u003ev. \u003cem\u003eBacille Calmette-Gu\u0026eacute;rin (BCG) vaccine for tuberculosis. (2025, January 31). Tuberculosis (TB). \u003c/em\u003e\u003cem\u003ehttps://www.cdc.gov/tb/hcp/vaccines/index.html.\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003evi. Ram\u0026iacute;rez-Rueda, R. Y. (2016). Mycobacterium tuberculosis: clinical and microbiological aspects. In \u003cem\u003eThe Microbiology of Respiratory System Infections\u003c/em\u003e (pp. 153-166). Academic Press.\u003c/p\u003e\n\u003cp\u003evii. Centers for Disease Control and Prevention, American Thoracic Society, CDC, and Infectious Diseases Society of America, Centers for Disease Control and Prevention, J. L., Fleming, D. W., Snider, D. E., Thacker, S. B., Ward, J. W., Hewitt, S. M., Smith-Akin, C. K., McIntyre, L., Holland, B. J., Heilman, M. A., Doan, Q. M., Shaver, E. R., \u0026amp; Iseman, M. (2003). Treatment of tuberculosis. In \u003cem\u003eMorbidity and Mortality Weekly Report\u003c/em\u003e (Vol. 52, Issue RR-11). https://www.cdc.gov/mmwr/pdf/rr/rr5211.pdf.\u003c/p\u003e\n\u003cp\u003eviii. Seung, K. J., Keshavjee, S., \u0026amp; Rich, M. L. (2015). Multidrug-Resistant tuberculosis and extensively Drug-Resistant tuberculosis. \u003cem\u003eCold Spring Harbor Perspectives in Medicine\u003c/em\u003e, \u003cem\u003e5\u003c/em\u003e(9), a017863. https://doi.org/10.1101/cshperspect.a017863\u003c/p\u003e\n\u003cp\u003eix. Ohara, N. (2012). Current status of tuberculosis and recombinant bacillus Calmette-Gu\u0026eacute;rin vaccines. \u003cem\u003eJournal of Oral Biosciences\u003c/em\u003e, \u003cem\u003e54\u003c/em\u003e(2), 92\u0026ndash;95. https://doi.org/10.1016/j.job.2012.04.002.\u003c/p\u003e\n\u003cp\u003ex. Samten, B., Wang, X., \u0026amp; Barnes, P. F. (2009). Mycobacterium tuberculosis ESX-1 system-secreted protein ESAT-6 but not CFP10 inhibits human T-cell immune responses. \u003cem\u003eTuberculosis (Edinburgh, Scotland)\u003c/em\u003e, \u003cem\u003e89 Suppl 1\u003c/em\u003e, S74\u0026ndash;S76. https://doi.org/10.1016/S1472-9792(09)70017-4\u003c/p\u003e\n\u003cp\u003exi. World Health Organization. (2022). Global Tuberculosis Report 2022. https://cdn.who.int/media/docs/default-source/hq-tuberculosis/global-tuberculosis-report-2022/global-tb-report-2022-factsheet.pdf?sfvrsn=88f8d76_8\u0026amp;download=true\u003c/p\u003e\n\u003cp\u003exii. \u003cem\u003eNew TB vaccine research\u003c/em\u003e. (n.d.). https://www.who.int/teams/global-tuberculosis-programme/research-innovation/vaccines.\u003c/p\u003e\n\u003cp\u003exiii. Clem, A. S. (2011). Fundamentals of vaccine immunology. Journal of Global Infectious Diseases, 3(1), 73. https://doi.org/10.4103/0974-777x.77299\u003c/p\u003e\n\u003cp\u003exiv. Li, F., Dang, W., Du, Y., Xu, X., He, P., Zhou, Y., \u0026amp; Zhu, B. (2024). Tuberculosis vaccines and T cell immune memory. Vaccines, 12(5), 483. https://doi.org/10.3390/vaccines12050483\u003c/p\u003e\n\u003cp\u003exv. Chandra, P., Grigsby, S. J., \u0026amp; Philips, J. A. (2022). Immune evasion and provocation by Mycobacterium tuberculosis. Nature Reviews Microbiology, 20(12), 750\u0026ndash;766. https://doi.org/10.1038/s41579-022-00763-4\u003c/p\u003e\n\u003cp\u003exvi. Zhou, X., Huang, J., Zhang, D., Qian, Z., Zuo, X., \u0026amp; Sun, Y. (2025). Small extracellular vesicles: the origins, current status, future prospects, and applications. Stem Cell Research \u0026amp; Therapy, 16(1). https://doi.org/10.1186/s13287-025-04330-5\u003c/p\u003e\n\u003cp\u003exvii. Biadglegne, F., K\u0026ouml;nig, B., Rodloff, A. C., Dorhoi, A., \u0026amp; Sack, U. (2021). Composition and Clinical Significance of exosomes in tuberculosis: A systematic literature review. Journal of Clinical Medicine, 10(1), 145. https://doi.org/10.3390/jcm10010145\u003c/p\u003e\n\u003cp\u003exviii. Tan, D., Li, G., Fu, W., \u0026amp; Lei, C. (2024). Exosomes: the next frontier in vaccine development and delivery. Frontiers in Immunology, 15. https://doi.org/10.3389/fimmu.2024.1435426\u003c/p\u003e\n\u003cp\u003exix. Lener, T., Gimona, M., Aigner, L., B\u0026ouml;rger, V., Buzas, E., Camussi, G., Chaput, N., Chatterjee, D., Court, F. A., Del Portillo, H. A., O\u0026rsquo;Driscoll, L., Fais, S., Falcon-Perez, J. M., Felderhoff-Mueser, U., Fraile, L., Gho, Y. S., G\u0026ouml;rgens, A., Gupta, R. C., Hendrix, A., . . . Giebel, B. Applying extracellular vesicles based therapeutics in clinical trials \u0026ndash; an ISEV position paper. Journal of Extracellular Vesicles, 4(1). https://doi.org/10.3402/jev.v4.30087 (2015).\u003c/p\u003e\n\u003cp\u003exx. Huda, M. N., \u0026amp; Nurunnabi, M. (2022). Potential application of exosomes in vaccine development and delivery. Pharmaceutical Research, 39(11), 2635-2671\u003c/p\u003e\n\u003cp\u003exxi. Ansari, M. A., Zubair, S., Mahmood, A., Gupta, P., Khan, A. A., Gupta, U. D., Arora, A., \u0026amp; Owais, M. (2011). RD Antigen Based Nanovaccine Imparts Long Term Protection by Inducing Memory Response against Experimental Murine Tuberculosis. PLoS ONE, 6(8), e22889. https://doi.org/10.1371/journal.pone.0022889.\u003c/p\u003e\n\u003cp\u003exxii. Singh, V. V., Kerur, N., Bottero, V., Dutta, S., Chakraborty, S., Ansari, M. A., Paudel, N., Chikoti, L., \u0026amp; Chandran, B. (2013). Kaposi\u0026rsquo;s Sarcoma-Associated herpesvirus latency in endothelial and B cells activates gamma Interferon-Inducible protein 16-Mediated inflammasomes. Journal of Virology, 87(8), 4417\u0026ndash;4431. https://doi.org/10.1128/jvi.03282-12\u003c/p\u003e\n\u003cp\u003exxiii. Ansari, M. A., Singh, V. V., Dutta, S., Veettil, M. V., Dutta, D., Chikoti, L., Lu, J., Everly, D., \u0026amp; Chandran, B. (2013). Constitutive Interferon-Inducible Protein 16-Inflammasome Activation during Epstein-Barr Virus Latency I, II, and III in B and Epithelial Cells. Journal of Virology, 87(15), 8606\u0026ndash;8623. https://doi.org/10.1128/jvi.00805-13\u003c/p\u003e\n\u003cp\u003exxiv. Bachurski, D., Schuldner, M., Nguyen, P., Malz, A., Reiners, K. S., Grenzi, P. C., Babatz, F., Schauss, A. C., Hansen, H. P., Hallek, M., \u0026amp; Von Strandmann, E. P. (2019). Extracellular vesicle measurements with nanoparticle tracking analysis \u0026ndash; An accuracy and repeatability comparison between NanoSight NS300 and ZetaView. Journal of Extracellular Vesicles, 8(1). https://doi.org/10.1080/20013078.2019.1596016\u003c/p\u003e\n\u003cp\u003exxv. Mitra, D. K., De Rosa, S. C., Luke, A., Balamurugan, A., Khaitan, B. K., Tung, J., Mehra, N. K., Terr, A. I., O\u0026apos;Garra, A., Herzenberg, L. A., \u0026amp; Roederer, M. (1999). Differential representations of memory T cell subsets are characteristic of polarized immunity in leprosy and atopic diseases. International immunology, 11(11), 1801\u0026ndash;1810. https://doi.org/10.1093/intimm/11.11.1801.\u003c/p\u003e\n\u003cp\u003exxvi. Li, Y., Zeng, J., Shi, J., Wang, M., Rao, M., Xue, C., Du, Y., \u0026amp; He, Z. (2010). A Proteome-Scale Identification of Novel Antigenic Proteins in Mycobacterium tuberculosis toward Diagnostic and Vaccine Development. Journal of Proteome Research, 9(9), 4812\u0026ndash;4822. https://doi.org/10.1021/pr1005108\u003c/p\u003e\n\u003cp\u003exxvii. Long, Y., Wang, B., Xie, T., Luo, R., Tang, J., Deng, J., \u0026amp; Wang, C. (2023). Overexpression of efflux pump genes is one of the mechanisms causing drug resistance in Mycobacterium tuberculosis. Microbiology Spectrum, 12(1). https://doi.org/10.1128/spectrum.02510-23 \u003c/p\u003e\n\u003cp\u003exxviii. Small, J. L., Park, S. W., Kana, B. D., Ioerger, T. R., Sacchettini, J. C., \u0026amp; Ehrt, S. (2013). Perturbation of Cytochrome c Maturation Reveals Adaptability of the Respiratory Chain in Mycobacterium tuberculosis. mBio, 4(5). https://doi.org/10.1128/mbio.00475-13\u003c/p\u003e\n\u003cp\u003exxix. Parish, T. (2014). Two-Component regulatory systems of mycobacteria. Microbiology Spectrum, 2(1). https://doi.org/10.1128/microbiolspec.mgm2-0010-2013\u003c/p\u003e\n\u003cp\u003exxx. Kim, S., Shin, A., Lee, B., Kim, H., Jeon, B. Y., Cho, S., Park, J., \u0026amp; Shin, S. J. (2009). Characterization of Immune Responses to Mycobacterium tuberculosis Rv2041c Protein. Journal of Bacteriology and Virology, 39(3), 183. https://doi.org/10.4167/jbv.2009.39.3.183\u003c/p\u003e\n\u003cp\u003exxxi. Sharma, N., Shariq, M., Quadir, N., Singh, J., Sheikh, J. A., Hasnain, S. E., \u0026amp; Ehtesham, N. Z. (2021). Mycobacterium tuberculosis Protein PE6 (Rv0335c), a Novel TLR4 Agonist, Evokes an Inflammatory Response and Modulates the Cell Death Pathways in Macrophages to Enhance Intracellular Survival. Frontiers in Immunology, 12. https://doi.org/10.3389/fimmu.2021.696491\u003c/p\u003e\n\u003cp\u003exxxii. Lunge, A., Gupta, R., Choudhary, E., \u0026amp; Agarwal, N. (2020). The unfoldase ClpC1 of Mycobacterium tuberculosis regulates the expression of a distinct subset of proteins having intrinsically disordered termini. Journal of Biological Chemistry, 295(28), 9455\u0026ndash;9473. https://doi.org/10.1074/jbc.ra120.013456\u003c/p\u003e\n\u003cp\u003exxxiii. Harold, L. K., Antoney, J., Ahmed, F. H., Hards, K., Carr, P. D., Rapson, T., Greening, C., Jackson, C. J., \u0026amp; Cook, G. M. (2018). FAD-sequestering proteins protect mycobacteria against hypoxic and oxidative stress. Journal of Biological Chemistry, 294(8), 2903\u0026ndash;5814. https://doi.org/10.1074/jbc.ra118.006237\u003c/p\u003e\n\u003cp\u003exxxiv. Cole, S. T., Brosch, R., Parkhill, J., Garnier, T., Churcher, C., Harris, D., Gordon, S. V., Eiglmeier, K., Gas, S., Barry, C. E., Tekaia, F., Badcock, K., Basham, D., Brown, D., Chillingworth, T., Connor, R., Davies, R., Devlin, K., Feltwell, T., . . . Barrell, B. G. (1998b). Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature, 393(6685), 537\u0026ndash;544. https://doi.org/10.1038/31159\u003c/p\u003e\n\u003cp\u003exxxv. Domenech, P., Reed, M. B., \u0026amp; Barry, C. E. (2005). Contribution of theMycobacterium tuberculosisMMPL protein family to virulence and drug resistance. Infection and Immunity, 73(6), 3492\u0026ndash;3501. https://doi.org/10.1128/iai.73.6.3492-3501.2005\u003c/p\u003e\n\u003cp\u003exxxvi. Cayabyab, M. J., Macovei, L., \u0026amp; Campos-Neto, A. (2012). Current and novel approaches to vaccine development against tuberculosis. Frontiers in Cellular and Infection Microbiology, 2. https://doi.org/10.3389/fcimb.2012.00154.\u003c/p\u003e\n\u003cp\u003exxxvii. Romano, M., Squeglia, F., Kramarska, E., Barra, G., Choi, H. G., Kim, H. J., ... \u0026amp; Berisio, R. (2023). A structural view at vaccine development against M. tuberculosis. Cells, 12(2), 317.\u003c/p\u003e\n\u003cp\u003exxxviii. Whelan, K. T., Pathan, A. A., Sander, C. R., Fletcher, H. A., Poulton, I., Alder, N. C., Hill, A. V. S., \u0026amp; McShane, H. (2009). Safety and Immunogenicity of Boosting BCG Vaccinated Subjects with BCG: Comparison with Boosting with a New TB Vaccine, MVA85A. PLoS ONE, 4(6), e5934. https://doi.org/10.1371/journal.pone.0005934\u003c/p\u003e\n\u003cp\u003exxxix. Brandt, L., Cunha, J. F., Olsen, A. W., Chilima, B., Hirsch, P., Appelberg, R., \u0026amp; Andersen, P. (2002). Failure of the \u003cem\u003eMycobacterium bovis\u003c/em\u003e BCG vaccine: Some species of environmental mycobacteria block multiplication of BCG and induction of protective immunity to tuberculosis. Infection and Immunity, 70(2), 672\u0026ndash;678. https://doi.org/10.1128/iai.70.2.672-678.2002.\u003c/p\u003e\n\u003cp\u003exl. Setiabudiawan, T. P., Reurink, R. K., Hill, P. C., Netea, M. G., Van Crevel, R., \u0026amp; Koeken, V. A. (2021). Protection against tuberculosis by Bacillus Calmette-Gu\u0026eacute;rin (BCG) vaccination: A historical perspective. Med, 3(1), 6\u0026ndash;24. https://doi.org/10.1016/j.medj.2021.11.006\u003c/p\u003e\n\u003cp\u003exli. Kuan, R., Muskat, K., Peters, B., \u0026amp; Arlehamn, C. S. L. (2020). Is mapping the BCG vaccine-induced immune responses the key to improving the efficacy against tuberculosis? Journal of Internal Medicine, 288(6), 651\u0026ndash;660. https://doi.org/10.1111/joim.13191\u003c/p\u003e\n\u003cp\u003exlii. Cheng, Y., \u0026amp; Schorey, J. S. (2013). Exosomes carrying mycobacterial antigens can protect mice against Mycobacterium tuberculosis infection. European Journal of Immunology, 43(12), 3279\u0026ndash;3290. https://doi.org/10.1002/eji.201343727\u003c/p\u003e\n\u003cp\u003exliii. Singh, P. P., Smith, V. L., Karakousis, P. C., \u0026amp; Schorey, J. S. (2012). Exosomes Isolated from Mycobacteria-Infected Mice or Cultured Macrophages Can Recruit and Activate Immune Cells In Vitro and In Vivo. The Journal of Immunology, 189(2), 777\u0026ndash;785. https://doi.org/10.4049/jimmunol.1103638\u003c/p\u003e\n\u003cp\u003exliv. Zeng, F., \u0026amp; Morelli, A. E. (2018). Extracellular vesicle-mediated MHC cross-dressing in immune homeostasis, transplantation, infectious diseases, and cancer. Seminars in Immunopathology, 40(5), 477\u0026ndash;490. https://doi.org/10.1007/s00281-018-0679-8.\u003c/p\u003e\n\u003cp\u003exlv. Valapala, M., \u0026amp; Vishwanatha, J. K. (2011). Lipid raft endocytosis and exosomal transport facilitate extracellular trafficking of annexin A2. Journal of Biological Chemistry, 286(35), 30911\u0026ndash;30925. https://doi.org/10.1074/jbc.m111.271155\u003c/p\u003e\n\u003cp\u003exlvi. Rivera-Hernandez, T., Rhyme, M. S., Cork, A. J., Jones, S., Segui-Perez, C., Brunner, L., Richter, J., Petrovsky, N., Lawrenz, M., Goldblatt, D., Collin, N., \u0026amp; Walker, M. J. (2020b). Vaccine-Induced Th1-Type Response Protects against Invasive Group A Streptococcus Infection in the Absence of Opsonizing Antibodies. mBio, 11(2). https://doi.org/10.1128/mbio.00122-20\u003c/p\u003e\n\u003cp\u003exlvii. Dicharry, D., \u0026amp; Malek, A. E. (2025). Unlocking the Role of Treg Cells Immune Response and Infectious Risk Following CAR T-Cell Therapy in Patients with Cancer. \u003cem\u003eInternational Journal of Molecular Sciences\u003c/em\u003e, \u003cem\u003e26\u003c/em\u003e(4), 1602. https://doi.org/10.3390/ijms26041602.\u003c/p\u003e\n\u003cp\u003exlviii. Zhao, T., Cai, Y., Jiang, Y., He, X., Wei, Y., Yu, Y., \u0026amp; Tian, X. (2023). Vaccine adjuvants: mechanisms and platforms. Signal Transduction and Targeted Therapy, 8(1). https://doi.org/10.1038/s41392-023-01557-7\u003c/p\u003e\n\u003cp\u003exlix. Li, P., Xie, Y., Wang, J., Bao, C., Duan, J., Liu, Y., Luo, Q., Xu, J., Ren, Y., Jiang, M., Li, J., Guo, H., Zhao, H., Wang, G., Liang, Y., \u0026amp; Lu, W. (2024). Gene engineered exosome reverses T cell exhaustion in cancer immunotherapy. Bioactive Materials, 34, 466\u0026ndash;481. https://doi.org/10.1016/j.bioactmat.2024.01.008.\u003c/p\u003e"},{"header":"Supplementary Tables","content":"\u003cp\u003eSupplementary Tables 1-3 are not available with this version.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Exosomes, Tuberculosis, BCG, Prophylactic Vaccine, M.tb., T cell memory response, long term protection","lastPublishedDoi":"10.21203/rs.3.rs-7579467/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7579467/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eTuberculosis (TB), caused by \u003cem\u003eMycobacterium tuberculosis (M.tb.)\u003c/em\u003e, inflicts one third of the humanity. Despite the availability of effective drug regimens, complete eradication of \u003cem\u003eM.tb.\u003c/em\u003e remains challenging due to prolong treatment duration. Additionally, MDR-TB and co-infection HIV further exacerbate disease severity. The Bacille Calmette\u0026ndash;Gu\u0026eacute;rin (BCG) has shown inconsistent efficacy due to absence of Th-1-antigens. Hence, there is a critical need for either a novel vaccine candidate or an efficient booster to enhance BCG\u0026rsquo;s prophylactic efficacy.\u003c/p\u003e\u003cp\u003eIn this study, in-house prepared \u003cem\u003eM.tb.\u003c/em\u003e-infected alveolar macrophage-derived exosomes (Rv-Exo) and ESAT-6-containing exosomes (ESAT-6 Exo) were characterized based on size, purity, and pathogen-associated molecular patterns (PAMPs) and their epitope mapping was also performed. These \u003cem\u003eM.tb.\u003c/em\u003e protein-containing exosomes (MPE) were utilized for immunization, either alone or as a booster to BCG, and evaluated in \u003cem\u003eBALB/c\u003c/em\u003e mice against experimental \u003cem\u003eM.tb.\u003c/em\u003e challenge.\u003c/p\u003e\u003cp\u003eOur results demonstrate the ESAT-6 Exo and Rv-Exo, either alone or as a BCG booster, enhanced Th1-biased immune responses by activating CD4⁺ and CD8⁺ T cells, increasing memory T-cell populations, and significantly reducing the \u003cem\u003eM.tb.\u003c/em\u003e burden in the lungs, spleen, and lymph nodes of infected mice. There finding highlights the potential of MPE as a promising strategy against TB specially in BCG vaccinated population.\u003c/p\u003e","manuscriptTitle":"Mycobacterium tuberculosis antigen containing-exosomes reinforce BCG vaccine efficacy by augmenting long term protection and memory response against experimental tuberculosis in BALB-C mice.","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-29 15:39:07","doi":"10.21203/rs.3.rs-7579467/v1","editorialEvents":[{"type":"communityComments","content":2}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"c68c2aa6-7053-4348-b596-5f6314387618","owner":[],"postedDate":"September 29th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-11-07T06:23:50+00:00","versionOfRecord":[],"versionCreatedAt":"2025-09-29 15:39:07","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7579467","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7579467","identity":"rs-7579467","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}