Experimental study MMP10 Regulates the lymph node metastasis of Oral Squamous Cell Carcinoma Cells

Experimental study MMP10 Regulates the lymph node metastasis of Oral Squamous Cell Carcinoma Cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Experimental study MMP10 Regulates the lymph node metastasis of Oral Squamous Cell Carcinoma Cells Jing Qu, Xiaoting Wu, Ting Lan, Dali Zheng, YouGuang Lu, Ruihuan Gan, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3362133/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Aberrant MMP expression can be detected in almost all primary and recurrent tumors. The aim of this study was to identify the role of MMP10 in the cell biological function of OSCC. We analyzed the expression and survival data analysis were done using data from the Cancer Genome Atlas (TCGA) and the Clinical Proteomic Tumor Analysis Consortium(CPTAC) database, then expression of MMP10 in clinical OSCC samples was detected by using qRT-PCR. We reduced the expression of MMP10 to elucidate the effects of MMP10 on proliferation, migration and invasion. Genes associated with MMP10 were validated by qRT-PCR. The MMP10 expression was raised in HNSC and OSCC, and the high MMP10 expression in HNSC with a poor prognosis outcome. The MMP10 expression was upregulated in OSCC tissues when compared with adjacent tissues. Knockdown the expression of MMP10 inhibited the cell migration and invasion in vitro and lymph node metastasis in vivo . And the expression of MMP10 was regulated by WNT3A. The results of present study indicate that MMP10 plays a significant role in the invasion and migration of OSCC. MMP10 may be a possible target gene for the therapy of OSCC by inhibiting metastasis. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction The oral squamous cell carcinoma (OSCC) is the most prevalent subtype of head and neck squamous cell carcinoma (HNSC), and it is distinguished by high rates of metastasis, recurrence, and resistance to conventional therapies 1 . Metastasis is the most deadly feature of oral cancer. Cells may start to separate from the tumor once it has developed and go to other areas of the body 2 . Currently, surgery combined with adjuvant radiation or chemoradiation therapy is the main treatment for OSCC. Despite major advancements in surgical methods, radiation therapy, and chemoradiation therapy, the overall 5-year survival rate for OSCC patients has remained around 50% for the past 30 years without any appreciable improvement 3 . Therefore, the key to creating more efficient therapies is more research into the molecular pathways behind OSCC development. Matrix metalloproteinases (MMPs) are a class of protein hydrolases that depend on zinc and calcium ion activity and are capable of degrading multiple components of the extracellular matrix (ECM). The ECM is critical for maintaining extracellular microenvironmental homeostasis and tissue turnover, and tumor cells must be able to disrupt the surrounding ECM to proliferate, invade, and metastasize 4 . In addition to degrading ECM-related molecules, the matrix and cleavage products of MMP are able to directly regulate cell growth, differentiation and apoptosis, as well as chemotaxis, migration and angiogenesis 5 . Therefore, aberrant MMP expression can be detected in almost all primary and recurrent tumors. For example, MMP-9 is discovered to mediate the tumor microenvironment, promoting carcinogenesis and development, and to play a part in tumor invasion, metastasis, and angiogenesis 6 . MMP-2 and MMP-9 are able to degrade the physical barrier between tissues and disrupt the fulcrum of epithelial structures and produce biologically active fragments that influence tumor development. MMP-2 and − 9 play a role in aggressive bladder cancer and several other tumors have been found to be aberrantly regulated during malignant transformation and further progression 7 . When MMP11 is overexpressed in macrophages, it can secrete chemokine CCL2, which activates the MAPK pathway via its receptor CCR2 in breast cancer cells, thereby upregulating MMP9 to promote HER2 + breast cancer cell migration and a pro-tumor role in HER2 + breast cancer 8 . In the previous studies of our research group, we found that MMP7 was high expression in human TSCC tissues compared with their respective paired nontumor tissues, and the proliferation, invasion and migration of the cells were positively correlated with the expression of MMP7. Knockdown the expression of MMP7 inhibited lymph nodes metastasis in vivo 9 . MMP7 maybe as an oncogenic role in TSCC. MMP10, also known as stromelysin 2, is normally confined to epithelial cells and is able to target and regulate precursors of MMP1, MMP7, MMP8, MMP9, and MMP13, as well as collagen types III, IV, and V, and has been shown to regulate tumor cell invasiveness 10 . MMP10 can be found in the development and metastasis of head and neck tumors. MMP10 can be detected in the saliva of patients with oral squamous carcinoma 11 . The overexpression of MMP10 is associated with radio-resistance in nasopharyngeal carcinoma and head and neck tumor metastasis 12 . By targeting cancer progression gene expression and pathway analysis in head and neck non-metastatic (PRI-) and metastatic primary (PRI+) cutaneous squamous cell carcinomas, homologous lymph node metastases (MET) and matched sunburned skin (SES), MMP10 has a very significant high expression in PRI + and MET and has a significant activation in the stromal remodeling, cell survival and migration related pathways with significant activation 13 . However, the role of MMP10 in tongue cancer, especially its effect on tongue cancer invasion and metastasis, has not been fully elucidated. In the present study, we will analyze the effect of MMP10 in OSCC to explore whether MMP10 can be as a potential treatment target in OSCC. Materials and Methods Pan-Cancer MMP10 Expression Profile Analysis To create a text file of MMP10 gene expression, we utilized a Perl script. The R package "ggplot2" was used to summarize gene expression. MMP10 protein expression among different cancer types was obtain from TCGA pan-cancer clinical resource (TCGA-CDR) from Gene Expression Profiling Interactive Analysis ( http://xena.ucsc.edu/ ). Data collection from public database and statistical analysis The RNA sequencing data along with HNSC TP5 mutation data and clinical characteristics were downloaded from the TCGA database on March 2020( https://portal.gdc.cancer.gov/repository ) 14 . Protein variance data were analyzed and downloaded from Clinical Proteomic Tumor Analysis Consortium(CPTAC) HNSC project by Proteomic Data Commons(PDC)( https://pdc.cancer.gov/pdc/ ). Kaplan-Meier (KM) survival analysis was adopted to compare the overall survival of different groups of patients by R package 15 survivor and survminer (to determine the optimal cut point), and p-values were calculated using log-rank test. The Wilcoxon rank-sum test was used to assess the differences in expression between groups. P-values less than 0.05 ( p < 0.05) were considered significant. Clinical samples and cell culture Tissue samples were obtained from the First Affiliated Hospital of the Fujian Medical University. Each patient supplied written informed permission for their conduct in accordance with the principles of the Helsinki Declaration. The study received approval from the Ethics Society of Biomedical Research, Stomatological Hospital Affiliated to Fujian Medical University with the ethical number 2021-FJMUSS-086. The Cal-27 cell line was purchased from ATCC (American Type Culture Collection). The cells were maintained in suggested medium and incubated in humidified atmosphere of 95% air and 5% CO 2 at 37 C°. Quantitative real-time PCR analysis Total RNA was extracted from tissue sample with Trizol reagent (Invitrogen, USA) and reverse-transcribed into cDNA with the PrimeScript RT reagent kit (Takara, Dalian, China). The cDNA was used as the template to detect the expression of the genes of MMP-10 and WNT3A by qRT-PCR with SYBR Premix Ex TaqTm (Takara, Dalian, China). The primers used in this study are listed in Table 1 . Data were analyzed according to the 2 −ΔΔCt method. Table 1 The primers of qRT-PCR in the current study Gene Forward Reverse MMP10 TCCACTCACATTCTCCAGGCTG TGTCCTGGGCCATCAAAAGAGT WNT3A ACCATGTTCGGGACCTATTCCA GCCTGTAGCATCTCGCTTCCA ACTB GACAGGATGCAGAAGGAGATCA TTTTAGGATGGCAAGGGACTTC RNAi transfection The Cal-27 cells in the exponential phase of growth were digested, were plated into 6-well plates at 3 × 10 5 . After 10 ~ 14 h the cells were transfected by siRNA. The negative control (NC) siRNA and two siRNAs against MMP-10 were synthesized (GenePharma, Shanghai, China). The siRNA sequences are listed in Table 2 . Cells were transfected with siRNAs using Lipofectamine RNAiMAX (Invitrogen, USA) according to the manufacturer’s instructions. Table 2 The sequence of siRNA in the current study Name Sense Antisense NC 5’-UUCUCCGAACGUGUCACGUTT-3’ 5’-ACGUGACACGUUCGGAGAATT-3’ siRNA-MMP10-1291 5’-GCAAGGCUUCCCUAGACUATT-3’ 5’-UAGUCUAGGGAAGCCUUGCTT-3’ siRNA-MMP10-1336 5’-GCCUAAGGUUGAUGCUGUATT-3’ 5’-UACAGCAUCAACCUUAGGCTT-3’ Plasmid transfection Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) was used for transfection with plasmids containing WNT3A and a controlled plasmid (WZ biosciences, Shandong, China) in accordance with the manufacturer's recommendations. Western blot assay Total protein was separated by 10% SDS-PAGE and transferred onto PVDF membranes (Amersham, USA). Subsequently, the membranes were immunoblotted with primary antibodies (1:1000 dilution, Abcam, UK) in 5% bovine serum albumin overnight, washed thrice with tris-buffered saline with 0.1% Tween20, and then incubated with secondary antibody (1:2000 dilution, Bioss, UK). GAPDH antibody (Abmart, USA), and the immunoreactive protein bands were visualized using CDP STAR reagent (Roche, USA). The signals were scanned with a densitometer for semi-quantification of the signal intensity. Cell viability assay Cell viability was measured by counting viable cells with a Cell Counting Kit-8 (Dojindo, Kumamoto, Japan). Cal-27 in good condition at logarithmic growth stage was inoculated in 96-well plates at 3000 per well, and the cells were transfected by siRNA and liposome complexes according to the Lipofectamine RNAiMAX instruction manual for 5 d. For the assay, the original culture medium was discarded, 90 µl of fresh medium without FBS and 10 µl of CCK8 regent. The absorbance values of each well were measured at 450 nm on an enzyme marker, and the average value of each group was taken and the growth curve was plotted. Colony formation Forty-eight hours after siRNA transfection, the cells were plated in to 6-well plates (1000 cells per well), then continuously cultured and observed periodically. After 2 weeks, colonies were stained with 1% crystal violet for 10 min. In vitro cell migration assay Cell invasion was tested by using 24-well transwell chambers (8-µm pore size, BD Science, USA). After siRNA transfection for 24 h, the cells were serum starved for 24 h and then collected in DMEM containing 0.1% FBS. Cells were plated in the upper chamber at a density of 8.0×10 4 /500 µl, and 800 µl of DMEM containing 10% FBS was added to the lower chamber. After incubation at 37°C for 36 h, the cells in the upper chamber were removed with a cotton swab and stained with 500µl 1% crystal violet for 5 min. Cells were counted and photographed by microscopy of at least five random fields (×200). Wound healing experiment After transfecting cells for 24 h, the cells were spread evenly in a monolayer over a 6-well plate. Aspirate the culture fluid and gently cross-hatch with the end of the white Tip. 1×PBS washed 3 times, gently added along the side wall, and after washing away the cells remaining at the scratch, the intersection of the two lines was used as a marker, photographed under the microscope, and the relative distance between the scratches was recorded. Culture medium without FBS was added, then continuously cultured and observed the migration of cells under the microscope at 0 h, 12 h, 24 h, 36 h and 48 h and take pictures. In vitro cell invasion assay This assay followed the same steps as the cell migration assay, with the exception that the transwell was coated with Matrigel. Establishment of stabilized cell lines The lentiviral vector of MMP10 were synthesized (by Genechem Co., LTD., Shanghai, China) according the sequence of siRNA we used before. The human tongue squamous carcinoma high metastatic cell line LN-4 was established in previous experiment of our group. The LN-4 were infected with the lentiviral vector to establish the stabilized cell lines, which knocked down MMP10. The knock down effect was measured by Western blot. Orthotopic Xenograft cancer model The experimental animal protocol was approved by the Animal Care and Use Committee of Fujian Medical University, with the ethical number FJMU IACUC 2021-J-0565. Male BALB/c nude mice 6 ~ 8 week of age were purchased (SLAC Laboratory Animal Co.,Ltd, Shanghai, China) and raised in animal experiment center of Fujian Medical University. Prior to injection, nude mice were assigned at random to three groups. Cells (5×10 6 ) were suspended in 100 µl serum-free Medium and injected into the left anterior lingual margin of each mouse with 20 µl cell suspension. 50 days after the cells were injected, the nude mice were sacrificed. The lymph nodes from submandibular, neck, armpit, inguinal and popliteal fossa were harvested, washed in PBS. The collected lymph nodes were fixed in formalin, and in paraffin for HE staining. All experimental methods were performed in accordance with ARRIVE guidelines. All methods were carried out in accordance with relevant guidelines and regulations. Statistical analysis SPSS 20.0 software was used for data statistics. p 0.05, * when p < 0.05, ** when p < 0.01, *** when p < 0.001 and ****when p < 0.0001. Results MMP10 is highly expressed in cancer and is associated with a poorer prognosis In order to explore the role of MMP10 in tumor development, we constructed the pan-cancer expression landscape of MMP10. Among all 33 cancer type in the database, MMP10 expression was greatly altered in 16 tumors, accounting for 48% of all cancer type (Fig. 1 A). HNSC samples (n = 502) showed that MMP10 expression was significantly increased compared with adjacent normal tissues (n = 44, p < 0.0001); Kaplan-Meier survival analysis showed that patients with high MMP10 expression had lower survival ( p = 0.04, Fig. 1 B). And the data from OSCC samples (n = 330) and adjacent normal tissues (n = 32, p < 0.0001, Fig. 1 C), had the trend was the same as the HNSC. And the results of qRT-PCR showed that in 52 pairs OSCC tissues and adjacent normal tissues, the expression of MMP10 in OSCC tissues was higher than that in adjacent tissues ( p < 0.001, Fig. 1 D). Then, we correlated protein expression of MMP10 in the CPTAC database. MMP10 expression was elevated in a cohort, which included samples of 109 head and neck tumor tissue samples and 70 normal head and neck normal tissue samples. Then the analysis showed that the MMP10 expression was upregulated in HNSC tissues ( p < 0.0001). Meanwhile, MMP10 expression was elevated in the OSCC group, which included samples of 53 OSCC tissue samples and 25 normal oral normal tissue samples. Consistently, the analysis showed that the MMP10 expression was upregulated in OSCC tissues ( p < 0.001, Fig. 1 E). As we know the TP53 gene is a crucial tumor suppressor gene, and its mutation often predicts the poorer survival. Kaplan-Meier survival analysis showed that patients with TP53 mutation expression had lower survival. Thenwe analyzed MMP10 expression in the wild-type group(n = 156) and TP53 mutant group(n = 334), MMP10 expression was higher in the TP53 mutant group (p = 0.017, Fig. 2 A). Despite the range of causes that can lead to cancer, virus is well-known cancer risk factors, such as Human papilloma virus (HPV). In this study, we compared the MMP10 expression in the HPV positive expression HNSC tissue group(n = 69) and HPV negative expression group. The result showed that MMP10 had lower expression in HPV-negative group(n = 412), and this was associated with poorer survival (Fig. 2 B). MMP10 promotes cell proliferation in vitro In order to explore the effect of MMP10 on the proliferation of cancer cells, siRNA-mediated knockdown of MMP10 was employed in Cal-27 cells. The results of qRT-PCR and Western blot showed that both siRNAs targeting MMP10 efficiently reduced MMP10 expression in the Cal-27 cells (Fig. 3 A and B). We used CCK8 regent and colony formation to measure the proliferation change of cell (Fig. 3 C and D). Downregulated the expression of MMP10 can inhibit the proliferation of Cal-27 cells. These data showed that the MMP10 expression is related to the proliferation of cells. MMP10 increases cell migration and invasion in vitro As we know, migration and invasion are two important factors that affect the recurrence and prognosis of squamous cell carcinoma cancer patient. In order to identify the effect of MMP10 in Cal-27cell migration and invasion, we used wound healing and transwell assays to detect change of cell migration and invasion (Fig. 4 ). These dates showed that MMP10 may play an important role in Cal-27 cells, and may contribute the development and recurrence of OSCC. Knockdown MMP10 inhibits OSCC cells metastasis in vivo In order to confirm the effect of MMP10 in OSCC metastasis in vivo, we established the stabilized cell line. According to the Western blot results, the shRNA, which sequence followed by the siRNA-MMP10-1336, had more significant knock down effect (Fig. 5 A). So, we shRNA-1336 and NC group were selected for animal experiment. Finally, we counted the lymph node metastasis rate of 21 nude mice (NC group: 8; 1336 group: 13, formula: lymph node metastasis rate = number of nude mice with lymph node metastasis in each group/total number of statistically available nude mice in each group ×100%). The lymphatic metastasis rates of NC and 1336 groups were 62.5% (5/8) and 23.1% (3/13), respectively (Fig. 5 B and C). These dates indicated that knockdown MMP10 can reduce the metastasis in vivo. The expression of MMP10 was related to the expression of WNT3A In order to explore the potential mechanism of MMP10, we detected the the correlation between MMP10 and WNT signaling pathway genes.At first, we analyzed the correlation between WNT and MMP10 in HNSC tissues using TCGA database, then the result showed that many genes(including WNT3, WNT3A, WNT5A, WNT5B) in the WNT signaling pathway are positively correlated with MMP10(Fig. 6 A). We further examined the correlation between MMP10 and WNT signaling pathway genes in HNSCC cells, and found that when the expression of WNT3A was up-regulated, the expression of MMP10 was also increased(Fig. 6 B). Discussion Originally, MMP was considered only involved in tissue remodeling and destruction. With the further research, it is now widely acknowledged that MMPs take part in a lot of biologic processes, including the release of cytokines and growth factors, the growth and progression of tumors, angiogenesis, and a number of inflammatory conditions 16 . Therefore, the MMP family has emerged as a biomarker for some tumors. Emily 17 et al. found that MMP10 was upregulated in all fifteen cancers she studied, and significant upregulated in ten of fifteen cancers. Pawan 18 et al. presented that MMP10 was over-expression in 48% tongue tumor, and identified MMP10 could be used as a potential prognostic biomarker to categorize the patient who are more prone to occur metastases. Lin 19 et al detected that MMP10 expression was related with poor outcome in the clear cell subtype of renal cell carcinoma (ccRCC), and its significantly upregulated was required for ccRCC invasion. In order to determine the role of MMP10 in oral squamous carcinogenesis, at the beginning of our study, we detected the expression of MMP10 in the public database (TCGA and CPTAC). The MMP10 expression was raised in HNSC and OSCC, and the high MMP10 expression in HNSC with a poor prognosis outcome. Then we examined the differential expression in mRNA level of MMP10 in oral squamous carcinoma and normal tissues, there was a significant high expression of MMP10 in tumor tissues. And in protein level, MMP10 was upregulated in HNSC and OSCC. An increasingly frequent risk factor for HNSCC is HPV infection 20 , In our current study, we found that HPV-negative patients had a poorer prognosis and that MMP10 was more highly expressed in HPV-negative tissues, and Paver et al 21 found that HPV-positive oropharyngeal squamous cell carcinoma (HPV-OPSCC) has a better prognosis than typical alcohol- and smoking-related anterior oral cavity squamous cell carcinoma (OSCC), this is consistent with our findings. These results predict that MMP10 may be closely associated with cancer and provides the basis for our subsequent experiments. The invasion and metastasis of cancer cell is a complex cascade process that includes cell adhesion to the ECM, ECM degradation, cell detachment and migration through the degraded stroma, etc. MMPs promote the degradation of the ECM 22 . MMP10 acts as a crucial intermediary in tumor invasion and metastasis. In human endometrial cancer, regulation of cell invasiveness by Lipolysis-stimulated lipoprotein receptor (LSR) is achieved through MMP10 23 . In pancreatic ductal adenocarcinoma (PDAC), the promotion of invasive PDAC growth by hypoxia and matrix interactions is mediated through MMP10 24 . WNT7a can control urinary bladder cancer (UBC) invasion and the expression of WNT7A is positively correlated with MMP10 in UBC 25 . In prostate cancer, MMP10 was revealed as one of the downstream targets of STER2, was associated with driving invasion in prostate cancer 26 . Patinib decreased the invasion and metastasis of liver cells in liver cancer via reducing the expression of MMP10 27 . In present study, based on the results of our proliferation capacity experiments, the effect of MMP10 on the proliferation capacity of OSCC was not significant; however, when MMP10 expression was down-regulated, the number of OSCC crossing transnwell was significantly reduced. Combined with the above two experimental results, it indicates that MMP10 expression can directly regulate the invasion and migration ability of OSCC, rather than achieving reduced invasion and migration by inhibiting cell proliferation. Not only in vitro experiments, but also in vivo experiments we found that the down-regulation of MMP10 expression also significantly reduced the rate of lymph node metastasis in mice, further indicating the direct regulatory effect of MMP10 on OSCC invasion and metastasis. In addition to being heavily linked to many human disorders, the WNT signaling pathway plays a crucial role in embryogenesis and development 28 . Senescence bypass, abnormal cell proliferation, and cancer have all been linked to deregulation of the WNT signaling pathway 29 . In this research, we found that MMP10 is positively correlated with many genes in the WNT signaling pathway in multiple cancer types, and importantly, in HNSCC cells, upregulated WNT3A expression was followed by increased MMP10 expression. Combined with the previous effects of MMP10 on the invasion and migration of OSCC cells, it is speculated that MMP10 may regulate the cells through WNT3A. More research is needed to investigate the molecular mechanism of MMP10 in the invasion and metastasis of OSCC. The findings of this study showed that MMP10 inhibitor may have therapeutic uses in the treatment of OSCC patients by decreasing cell proliferation, invasion and metastasis. Declarations Data Availability statement All data generated or analysed during this study are included in this published article. Acknowledgements This work was supported by the Innovation Foundation of Department of Science and Technology of Fujian (grant number: 2017Y9096), the Natural Science Foundation of Fujian Province (Grant number: 2022J01761, 2022J01270), Fujian Medical Innovation Grant [grant number: 2018-CXB-13]. The funding bodies had no role in the design of the study, and collection, analysis, and interpretation of data and in writing of the manuscript. Author contributions J Q and XT Wu were responsible for the conduct of the experiments, and wrote the main manuscript; T L prepared figures1-2; DL Z and YG L were responsible for the design of the work; RH G and LC prepared figures 4-6, statistics analyzed of the data. All authors reviewed the manuscript Competing Interests No potential conflict of interest was reported by the authors. References Yang, Z. et al. YKT6, as a potential predictor of prognosis and immunotherapy response for oral squamous cell carcinoma, is related to cell invasion, metastasis, and CD8+ T cell infiltration. Oncoimmunology 10 , 1938890. Peng, Q.-S. et al. circRNA_0000140 suppresses oral squamous cell carcinoma growth and metastasis by targeting miR-31 to inhibit Hippo signaling pathway. Cell Death Dis 11 , 112 (2020). Yang, Y., Chen, D., Liu, H. & Yang, K. Increased expression of lncRNA CASC9 promotes tumor progression by suppressing autophagy-mediated cell apoptosis via the AKT/mTOR pathway in oral squamous cell carcinoma. Cell Death Dis 10 , 41 (2019). Pandit, A., Begum, Y., Saha, P., Srivastava, A. K. & Swarnakar, S. Approaches Toward Targeting Matrix Metalloproteases for Prognosis and Therapies in Gynecological Cancer: MicroRNAs as a Molecular Driver. Front Oncol 11 , 720622 (2021). Niland, S., Riscanevo, A. X. & Eble, J. A. Matrix Metalloproteinases Shape the Tumor Microenvironment in Cancer Progression. Int J Mol Sci 23 , 146 (2021). Matrix Metalloproteinase-9 (MMP-9) as a Cancer Biomarker and MMP-9 Biosensors: Recent Advances - PubMed. https://pubmed.ncbi.nlm.nih.gov/30262739/. Curcumin May Prevent Basement Membrane Disassembly by Matrix Metalloproteinases and Progression of the Bladder Cancer - PubMed. https://pubmed.ncbi.nlm.nih.gov/35010907/. Kang, S. U. et al. Matrix metalloproteinase 11 (MMP11) in macrophages promotes the migration of HER2-positive breast cancer cells and monocyte recruitment through CCL2-CCR2 signaling. Lab Invest 102 , 376–390 (2022). Yuan, S. et al. Elevated matrix metalloproteinase 7 expression promotes the proliferation, motility and metastasis of tongue squamous cell carcinoma. BMC Cancer 20 , 33 (2020). Minaei, E. et al. Cancer Progression Gene Expression Profiling Identifies the Urokinase Plasminogen Activator Receptor as a Biomarker of Metastasis in Cutaneous Squamous Cell Carcinoma. Front Oncol 12 , 835929 (2022). Salivary protease spectrum biomarkers of oral cancer - PubMed. https://pubmed.ncbi.nlm.nih.gov/30602733/. Wang, D. et al. Irradiation-induced dynamic changes of gene signatures reveal gain of metastatic ability in nasopharyngeal carcinoma. Am J Cancer Res 9 , 479–495 (2019). Quilty, F. et al. Impact of Deoxycholic Acid on Oesophageal Adenocarcinoma Invasion: Effect on Matrix Metalloproteinases. Int J Mol Sci 21 , E8042 (2020). Colaprico, A. et al. TCGAbiolinks: an R/Bioconductor package for integrative analysis of TCGA data. Nucleic Acids Res 44 , e71 (2016). Mayakonda, A., Lin, D.-C., Assenov, Y., Plass, C. & Koeffler, H. P. Maftools: efficient and comprehensive analysis of somatic variants in cancer. Genome Res 28 , 1747–1756 (2018). Dagher, A. et al. Identification of Novel Non-invasive Biomarkers of Urinary Chronic Pelvic Pain Syndrome (UCPPS): Findings from the Multidisciplinary Approach to the Study of Chronic Pelvic Pain (MAPP) Research Network. BJU Int 120 , 130–142 (2017). Gobin, E. et al. A pan-cancer perspective of matrix metalloproteases (MMP) gene expression profile and their diagnostic/prognostic potential. BMC Cancer 19 , 581 (2019). Upadhyay, P. et al. Genomic characterization of tobacco/nut chewing HPV-negative early stage tongue tumors identify MMP10 asa candidate to predict metastases. Oral Oncol 73 , 56–64 (2017). Lin, T.-C. et al. Ghrelin Upregulates Oncogenic Aurora A to Promote Renal Cell Carcinoma Invasion. Cancers (Basel) 11 , E303 (2019). Solomon, B., Young, R. J. & Rischin, D. Head and neck squamous cell carcinoma: Genomics and emerging biomarkers for immunomodulatory cancer treatments. Semin Cancer Biol 52 , 228–240 (2018). Paver, E. C., Currie, A. M., Gupta, R. & Dahlstrom, J. E. Human papilloma virus related squamous cell carcinomas of the head and neck: diagnosis, clinical implications and detection of HPV. Pathology 52 , 179–191 (2020). Arosarena, O. A. et al. OSTEOACTIVIN REGULATES HEAD AND NECK SQUAMOUS CELL CARCINOMA INVASION BY MODULATING MATRIX METALLOPROTEASES. J Cell Physiol 233 , 409–421 (2018). Shimada, H. et al. Downregulation of lipolysis-stimulated lipoprotein receptor promotes cell invasion via claudin-1-mediated matrix metalloproteinases in human endometrial cancer. Oncol Lett 14 , 6776–6782 (2017). Liu, D. et al. Soluble Compounds Released by Hypoxic Stroma Confer Invasive Properties to Pancreatic Ductal Adenocarcinoma. Biomedicines 8 , E444 (2020). Huang, X. et al. Wnt7a activates canonical Wnt signaling, promotes bladder cancer cell invasion, and is suppressed by miR-370-3p. J Biol Chem 293 , 6693–6706 (2018). Burnell, S. E. A. et al. STEAP2 Knockdown Reduces the Invasive Potential of Prostate Cancer Cells. Sci Rep 8 , 6252 (2018). He, X. et al. Apatinib Inhibits the Invasion and Metastasis of Liver Cancer Cells by Downregulating MMP-Related Proteins via Regulation of the NF-κB Signaling Pathway. Biomed Res Int 2020 , 3126182 (2020). Xie, J., Huang, L., Lu, Y.-G. & Zheng, D.-L. Roles of the Wnt Signaling Pathway in Head and Neck Squamous Cell Carcinoma. Front Mol Biosci 7 , 590912 (2020). GOLPH3/CKAP4 promotes metastasis and tumorigenicity by enhancing the secretion of exosomal WNT3A in non-small-cell lung cancer - PMC. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8528870/. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3362133","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":238973191,"identity":"a60d5a30-9d53-4fb6-a7b9-9ad62d2e5201","order_by":0,"name":"Jing Qu","email":"","orcid":"","institution":"Department of Preventive Dentistry, School and Hospital of Stomatology, Fujian Medical University","correspondingAuthor":false,"prefix":"","firstName":"Jing","middleName":"","lastName":"Qu","suffix":""},{"id":238973192,"identity":"f24768f9-fddf-4f75-80d3-7d6fdf778b90","order_by":1,"name":"Xiaoting Wu","email":"","orcid":"","institution":"Fujian Key Laboratory of Oral Diseases, Fujian Biological Materials Engineering and Technology Center of Stomatology, School and Hospital of Stomatology, Fujian Medical University","correspondingAuthor":false,"prefix":"","firstName":"Xiaoting","middleName":"","lastName":"Wu","suffix":""},{"id":238973193,"identity":"1d10bb6b-5b33-4f43-a2e6-beb7ee513962","order_by":2,"name":"Ting Lan","email":"","orcid":"","institution":"Fujian Key Laboratory of Oral Diseases, Fujian Biological Materials Engineering and Technology Center of Stomatology, School and Hospital of Stomatology, Fujian Medical University","correspondingAuthor":false,"prefix":"","firstName":"Ting","middleName":"","lastName":"Lan","suffix":""},{"id":238973194,"identity":"c47611e8-ff1f-4e9d-a495-ba4da0d9ef8b","order_by":3,"name":"Dali Zheng","email":"","orcid":"","institution":"Fujian Key Laboratory of Oral Diseases, Fujian Biological Materials Engineering and Technology Center of Stomatology, School and Hospital of Stomatology, Fujian Medical University","correspondingAuthor":false,"prefix":"","firstName":"Dali","middleName":"","lastName":"Zheng","suffix":""},{"id":238973195,"identity":"0baab325-3954-4553-bdf6-eae8c4f4a923","order_by":4,"name":"YouGuang Lu","email":"","orcid":"","institution":"Department of Preventive Dentistry, School and Hospital of Stomatology, Fujian Medical University","correspondingAuthor":false,"prefix":"","firstName":"YouGuang","middleName":"","lastName":"Lu","suffix":""},{"id":238973196,"identity":"cb4cf59f-f5fd-49bb-bbd8-ce8bf8a86e6a","order_by":5,"name":"Ruihuan Gan","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA7klEQVRIiWNgGAWjYFACxjY460EFD5hhQLQWZoMzxGlhYIMzJM4wEKHFfEZy22OemjsM8u5nj1UckNmW2MDevE2CASiCC8jcSGw35jn2jMHwTF7ajQM8txMbeI6VSTAARXABCYnENmketsMMhg05Zrc/gLRI5JhJMDYcJqDlH1BL/xuzArAt8m+I0MLbdphBHmg4A1iLBA8BLTwP2yTn9h1mMJB4YywB1GLcxpNWbJFwDI8W9vRnEm++AW3pzzH8cLDntmw/++GNNz7U4NYCA/UbDgBJxh5oNCUQ1AAE8g0g8gcxSkfBKBgFo2CkAQDtS1RY+mkirwAAAABJRU5ErkJggg==","orcid":"","institution":"Department of Preventive Dentistry, School and Hospital of Stomatology, Fujian Medical University","correspondingAuthor":true,"prefix":"","firstName":"Ruihuan","middleName":"","lastName":"Gan","suffix":""},{"id":238973197,"identity":"2db861e3-a38e-4a51-9dae-bc0530d30876","order_by":6,"name":"Lincan Ding","email":"","orcid":"","institution":"Department of Preventive Dentistry, School and Hospital of Stomatology, Fujian Medical University","correspondingAuthor":false,"prefix":"","firstName":"Lincan","middleName":"","lastName":"Ding","suffix":""}],"badges":[],"createdAt":"2023-09-17 00:59:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3362133/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3362133/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":44530855,"identity":"db81fd5e-fa6f-4555-9fd4-927a1cdfda58","added_by":"auto","created_at":"2023-10-12 17:39:26","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":845951,"visible":true,"origin":"","legend":"\u003cp\u003eMMP10 is upregulated in tumor tissue. a, Among all 33 cancer type, the expression of MMP10 was altered in 16 tumors. b, The difference of MMP10 mRNA expression in tumor and adjacent normal tissues in HNSC from TCGA (boxplot and violin plot)； Kaplan-Meier survival curve of overall survival time in HNSC from TCGA. c, The difference of MMP10 mRNA expression in tumor and adjacent normal tissues in OSCC from TCGA (boxplot and violin plot). d, The relative expression levels of MMP-10 in cancer tissue and adjacent normal tissues were detected by qRT-PCR. e, MMP10 protein expression status between normal and tumor tissues in HNSC from CPTAC; MMP10 protein expression situation between normal and tumor tissues in OSCC from CPTAC.\u003c/p\u003e","description":"","filename":"fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-3362133/v1/e13cd0bdd4f65070799a7fa9.png"},{"id":44531887,"identity":"d5d5222a-1239-45fa-b250-e58d46579c16","added_by":"auto","created_at":"2023-10-12 17:47:26","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":870642,"visible":true,"origin":"","legend":"\u003cp\u003eMMP10 mutation status and HPV-associated expression in HNSC. a,\u0026nbsp;Kaplan–Meier survival curve of overall survival time between in HNSC wild-type and TP53 mutation tumor tissues from TCGA; MMP10 mRNA expression status between wild-type and TP53 mutation tumor tissues in HNSC from TCGA.\u0026nbsp;b, Kaplan–Meier survival curve of overall survival time between HPV+ expression and HPV-expression in HNSC; MMP10 mRNA expression status between HPV+ expression and HPV\u003csup\u003e- \u003c/sup\u003eexpression in HNSC.\u003c/p\u003e","description":"","filename":"figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-3362133/v1/05fb68a5de707b0eeda4fc05.png"},{"id":44530858,"identity":"20396096-3a5d-443c-847d-9fdb812dbf8c","added_by":"auto","created_at":"2023-10-12 17:39:26","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":389638,"visible":true,"origin":"","legend":"\u003cp\u003eKnockdown of MMP10 inhibits the proliferation of Cal-27 cells. a,b, The interference effect of siRNA was measured by qRT-PCR(A) and Western blot(B)(The grouping of gels cropped from different parts of the same gel). c, CCK8 assay. Compared with NC group, the cell growth of siRNA-MMP10-1291 was inhibited, \u003cem\u003ep\u003c/em\u003e\u0026lt;0.05 at 48 h, 72 h, 96 h, and 120 h. \u003cem\u003ep\u003c/em\u003e\u0026gt;0.05 for siRNA-MMP10-1336. d, Colony formation rate (number of clones formed/number of inoculated cells ×100%) (a) and the representative images of colonies(b). Using the NC group as a control, the colonies number of the siRNA groups was lower than that of the NC group, \u003cem\u003ep\u003c/em\u003e\u0026lt;0.05 for siRNA-MMP10-1291 and \u003cem\u003ep\u003c/em\u003e\u0026gt;0.05 for siRNA-MMP10-1336.\u003c/p\u003e","description":"","filename":"figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-3362133/v1/e25bf5b64443bc2272510440.png"},{"id":44531889,"identity":"be957d2c-4875-4ca4-85dd-d93635bb5044","added_by":"auto","created_at":"2023-10-12 17:47:26","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":681927,"visible":true,"origin":"","legend":"\u003cp\u003eKnockdown of MMP10 inhibits the migration and invasion abilities of Cal-27 cells. a, A photomicrograph of scratch wounds. Compared with NC group, cellular motility was inhibited in siRNA group. b, after siRNA transfection, representative images of the transwell experiment without (upper panel) or with (lower panel) coated Matrigel. c, the number of cells that were able to pass through uncoated filters, which represents the mobility ability of Cal-27 cells. d, the number of cells that were able to pass through filters precoated with Matrigel, which represents the invasive ability of Cal-27 cells. The number of cells is presented as the mean values per field from at least five randomly selected low-powered fields (x200) from three independent experiments (error bars, means ± SD), \u003cem\u003ep\u003c/em\u003e\u0026lt;0.05 when compared with the control (NC).\u003c/p\u003e","description":"","filename":"figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-3362133/v1/7adcf2c0606d65618b05f2a3.png"},{"id":44530861,"identity":"c07fe949-f0e9-4da9-a70a-741045db7f85","added_by":"auto","created_at":"2023-10-12 17:39:26","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":500408,"visible":true,"origin":"","legend":"\u003cp\u003eMMP10 knockdown inhibits tongue cancer cell metastasis in \u003cem\u003evivo\u003c/em\u003e. a, The knockdown effect of MMP10 was measured by Western blot for these stabilized cell lines (The grouping of gels cropped from different parts of the same gel). b, Representative images of the metastasis lymph node by HE simultaneously. c, The lymphatic metastasis rate of each group.\u003c/p\u003e","description":"","filename":"figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-3362133/v1/96956f71e702d2bffa94b04b.png"},{"id":44532103,"identity":"5859e68e-5069-4878-90c9-5c75249f7eae","added_by":"auto","created_at":"2023-10-12 17:55:26","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":266062,"visible":true,"origin":"","legend":"\u003cp\u003eThe expression of MMP10 was related to the expression of WNT signaling pathway. a, Genes in WNT signaling pathway were positively correlated with MMP10. b, After transfection with WNT3A plasmid, the expression of MMP10 was measured by qRT-PCR.\u003c/p\u003e","description":"","filename":"figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-3362133/v1/54c1eba5f6bd2f42a6d75067.png"},{"id":61766104,"identity":"25d8ed65-005e-4bcb-abb2-d9b39a4d88ba","added_by":"auto","created_at":"2024-08-05 10:30:08","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4347323,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3362133/v1/83f16559-730c-416c-85a2-ddd736fa65c8.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Experimental study MMP10 Regulates the lymph node metastasis of Oral Squamous Cell Carcinoma Cells","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe oral squamous cell carcinoma (OSCC) is the most prevalent subtype of head and neck squamous cell carcinoma (HNSC), and it is distinguished by high rates of metastasis, recurrence, and resistance to conventional therapies\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. Metastasis is the most deadly feature of oral cancer. Cells may start to separate from the tumor once it has developed and go to other areas of the body \u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. Currently, surgery combined with adjuvant radiation or chemoradiation therapy is the main treatment for OSCC. Despite major advancements in surgical methods, radiation therapy, and chemoradiation therapy, the overall 5-year survival rate for OSCC patients has remained around 50% for the past 30 years without any appreciable improvement\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. Therefore, the key to creating more efficient therapies is more research into the molecular pathways behind OSCC development.\u003c/p\u003e \u003cp\u003eMatrix metalloproteinases (MMPs) are a class of protein hydrolases that depend on zinc and calcium ion activity and are capable of degrading multiple components of the extracellular matrix (ECM). The ECM is critical for maintaining extracellular microenvironmental homeostasis and tissue turnover, and tumor cells must be able to disrupt the surrounding ECM to proliferate, invade, and metastasize \u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. In addition to degrading ECM-related molecules, the matrix and cleavage products of MMP are able to directly regulate cell growth, differentiation and apoptosis, as well as chemotaxis, migration and angiogenesis \u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. Therefore, aberrant MMP expression can be detected in almost all primary and recurrent tumors. For example, MMP-9 is discovered to mediate the tumor microenvironment, promoting carcinogenesis and development, and to play a part in tumor invasion, metastasis, and angiogenesis \u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. MMP-2 and MMP-9 are able to degrade the physical barrier between tissues and disrupt the fulcrum of epithelial structures and produce biologically active fragments that influence tumor development. MMP-2 and \u0026minus;\u0026thinsp;9 play a role in aggressive bladder cancer and several other tumors have been found to be aberrantly regulated during malignant transformation and further progression \u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. When MMP11 is overexpressed in macrophages, it can secrete chemokine CCL2, which activates the MAPK pathway via its receptor CCR2 in breast cancer cells, thereby upregulating MMP9 to promote HER2\u0026thinsp;+\u0026thinsp;breast cancer cell migration and a pro-tumor role in HER2\u0026thinsp;+\u0026thinsp;breast cancer \u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. In the previous studies of our research group, we found that MMP7 was high expression in human TSCC tissues compared with their respective paired nontumor tissues, and the proliferation, invasion and migration of the cells were positively correlated with the expression of MMP7. Knockdown the expression of MMP7 inhibited lymph nodes metastasis in \u003cem\u003evivo\u003c/em\u003e \u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. MMP7 maybe as an oncogenic role in TSCC.\u003c/p\u003e \u003cp\u003eMMP10, also known as stromelysin 2, is normally confined to epithelial cells and is able to target and regulate precursors of MMP1, MMP7, MMP8, MMP9, and MMP13, as well as collagen types III, IV, and V, and has been shown to regulate tumor cell invasiveness\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. MMP10 can be found in the development and metastasis of head and neck tumors. MMP10 can be detected in the saliva of patients with oral squamous carcinoma\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. The overexpression of MMP10 is associated with radio-resistance in nasopharyngeal carcinoma and head and neck tumor metastasis\u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. By targeting cancer progression gene expression and pathway analysis in head and neck non-metastatic (PRI-) and metastatic primary (PRI+) cutaneous squamous cell carcinomas, homologous lymph node metastases (MET) and matched sunburned skin (SES), MMP10 has a very significant high expression in PRI\u0026thinsp;+\u0026thinsp;and MET and has a significant activation in the stromal remodeling, cell survival and migration related pathways with significant activation\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. However, the role of MMP10 in tongue cancer, especially its effect on tongue cancer invasion and metastasis, has not been fully elucidated. In the present study, we will analyze the effect of MMP10 in OSCC to explore whether MMP10 can be as a potential treatment target in OSCC.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003ePan-Cancer MMP10 Expression Profile Analysis\u003c/h2\u003e \u003cp\u003eTo create a text file of MMP10 gene expression, we utilized a Perl script. The R package \"ggplot2\" was used to summarize gene expression. MMP10 protein expression among different cancer types was obtain from TCGA pan-cancer clinical resource (TCGA-CDR) from Gene Expression Profiling Interactive Analysis (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://xena.ucsc.edu/\u003c/span\u003e\u003cspan address=\"http://xena.ucsc.edu/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eData collection from public database and statistical analysis\u003c/h2\u003e \u003cp\u003eThe RNA sequencing data along with HNSC TP5 mutation data and clinical characteristics were downloaded from the TCGA database on March 2020(\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://portal.gdc.cancer.gov/repository\u003c/span\u003e\u003cspan address=\"https://portal.gdc.cancer.gov/repository\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e)\u003csup\u003e14\u003c/sup\u003e. Protein variance data were analyzed and downloaded from Clinical Proteomic Tumor Analysis Consortium(CPTAC) HNSC project by Proteomic Data Commons(PDC)(\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://pdc.cancer.gov/pdc/\u003c/span\u003e\u003cspan address=\"https://pdc.cancer.gov/pdc/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Kaplan-Meier (KM) survival analysis was adopted to compare the overall survival of different groups of patients by R package\u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e survivor and survminer (to determine the optimal cut point), and p-values were calculated using log-rank test. The Wilcoxon rank-sum test was used to assess the differences in expression between groups. P-values less than 0.05 (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) were considered significant.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eClinical samples and cell culture\u003c/h2\u003e \u003cp\u003eTissue samples were obtained from the First Affiliated Hospital of the Fujian Medical University. Each patient supplied written informed permission for their conduct in accordance with the principles of the Helsinki Declaration. The study received approval from the Ethics Society of Biomedical Research, Stomatological Hospital Affiliated to Fujian Medical University with the ethical number 2021-FJMUSS-086. The Cal-27 cell line was purchased from ATCC (American Type Culture Collection). The cells were maintained in suggested medium and incubated in humidified atmosphere of 95% air and 5% CO\u003csub\u003e2\u003c/sub\u003e at 37 C\u0026deg;.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eQuantitative real-time PCR analysis\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted from tissue sample with Trizol reagent (Invitrogen, USA) and reverse-transcribed into cDNA with the PrimeScript RT reagent kit (Takara, Dalian, China). The cDNA was used as the template to detect the expression of the genes of MMP-10 and WNT3A by qRT-PCR with SYBR Premix Ex\u003csup\u003eTaqTm\u003c/sup\u003e (Takara, Dalian, China). The primers used in this study are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Data were analyzed according to the 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e method.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe primers of qRT-PCR in the current study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMMP10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCCACTCACATTCTCCAGGCTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGTCCTGGGCCATCAAAAGAGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWNT3A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACCATGTTCGGGACCTATTCCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCCTGTAGCATCTCGCTTCCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eACTB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGACAGGATGCAGAAGGAGATCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTTTAGGATGGCAAGGGACTTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eRNAi transfection\u003c/h2\u003e \u003cp\u003eThe Cal-27 cells in the exponential phase of growth were digested, were plated into 6-well plates at 3 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e. After 10\u0026thinsp;~\u0026thinsp;14 h the cells were transfected by siRNA. The negative control (NC) siRNA and two siRNAs against MMP-10 were synthesized (GenePharma, Shanghai, China). The siRNA sequences are listed in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. Cells were transfected with siRNAs using Lipofectamine RNAiMAX (Invitrogen, USA) according to the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe sequence of siRNA in the current study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eName\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSense\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAntisense\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026rsquo;-UUCUCCGAACGUGUCACGUTT-3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u0026rsquo;-ACGUGACACGUUCGGAGAATT-3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esiRNA-MMP10-1291\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026rsquo;-GCAAGGCUUCCCUAGACUATT-3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u0026rsquo;-UAGUCUAGGGAAGCCUUGCTT-3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esiRNA-MMP10-1336\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026rsquo;-GCCUAAGGUUGAUGCUGUATT-3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u0026rsquo;-UACAGCAUCAACCUUAGGCTT-3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003ePlasmid transfection\u003c/h2\u003e \u003cp\u003e Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) was used for transfection with plasmids containing WNT3A and a controlled plasmid (WZ biosciences, Shandong, China) in accordance with the manufacturer's recommendations.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eWestern blot assay\u003c/h2\u003e \u003cp\u003eTotal protein was separated by 10% SDS-PAGE and transferred onto PVDF membranes (Amersham, USA). Subsequently, the membranes were immunoblotted with primary antibodies (1:1000 dilution, Abcam, UK) in 5% bovine serum albumin overnight, washed thrice with tris-buffered saline with 0.1% Tween20, and then incubated with secondary antibody (1:2000 dilution, Bioss, UK). GAPDH antibody (Abmart, USA), and the immunoreactive protein bands were visualized using CDP STAR reagent (Roche, USA). The signals were scanned with a densitometer for semi-quantification of the signal intensity.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eCell viability assay\u003c/h2\u003e \u003cp\u003eCell viability was measured by counting viable cells with a Cell Counting Kit-8 (Dojindo, Kumamoto, Japan). Cal-27 in good condition at logarithmic growth stage was inoculated in 96-well plates at 3000 per well, and the cells were transfected by siRNA and liposome complexes according to the Lipofectamine RNAiMAX instruction manual for 5 d. For the assay, the original culture medium was discarded, 90 \u0026micro;l of fresh medium without FBS and 10 \u0026micro;l of CCK8 regent. The absorbance values of each well were measured at 450 nm on an enzyme marker, and the average value of each group was taken and the growth curve was plotted.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eColony formation\u003c/h2\u003e \u003cp\u003eForty-eight hours after siRNA transfection, the cells were plated in to 6-well plates (1000 cells per well), then continuously cultured and observed periodically. After 2 weeks, colonies were stained with 1% crystal violet for 10 min.\u003c/p\u003e \u003cp\u003e \u003cb\u003eIn vitro\u003c/b\u003e \u003cb\u003ecell migration assay\u003c/b\u003e\u003c/p\u003e \u003cp\u003eCell invasion was tested by using 24-well transwell chambers (8-\u0026micro;m pore size, BD Science, USA). After siRNA transfection for 24 h, the cells were serum starved for 24 h and then collected in DMEM containing 0.1% FBS. Cells were plated in the upper chamber at a density of 8.0\u0026times;10\u003csup\u003e4\u003c/sup\u003e /500 \u0026micro;l, and 800 \u0026micro;l of DMEM containing 10% FBS was added to the lower chamber. After incubation at 37\u0026deg;C for 36 h, the cells in the upper chamber were removed with a cotton swab and stained with 500\u0026micro;l 1% crystal violet for 5 min. Cells were counted and photographed by microscopy of at least five random fields (\u0026times;200).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eWound healing experiment\u003c/h2\u003e \u003cp\u003eAfter transfecting cells for 24 h, the cells were spread evenly in a monolayer over a 6-well plate. Aspirate the culture fluid and gently cross-hatch with the end of the white Tip. 1\u0026times;PBS washed 3 times, gently added along the side wall, and after washing away the cells remaining at the scratch, the intersection of the two lines was used as a marker, photographed under the microscope, and the relative distance between the scratches was recorded. Culture medium without FBS was added, then continuously cultured and observed the migration of cells under the microscope at 0 h, 12 h, 24 h, 36 h and 48 h and take pictures.\u003c/p\u003e \u003cp\u003e \u003cb\u003eIn vitro\u003c/b\u003e \u003cb\u003ecell invasion assay\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThis assay followed the same steps as the cell migration assay, with the exception that the transwell was coated with Matrigel.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eEstablishment of stabilized cell lines\u003c/h2\u003e \u003cp\u003e The lentiviral vector of MMP10 were synthesized (by Genechem Co., LTD., Shanghai, China) according the sequence of siRNA we used before. The human tongue squamous carcinoma high metastatic cell line LN-4 was established in previous experiment of our group. The LN-4 were infected with the lentiviral vector to establish the stabilized cell lines, which knocked down MMP10. The knock down effect was measured by Western blot.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eOrthotopic Xenograft cancer model\u003c/h2\u003e \u003cp\u003e The experimental animal protocol was approved by the Animal Care and Use Committee of Fujian Medical University, with the ethical number FJMU IACUC 2021-J-0565. Male BALB/c nude mice 6\u0026thinsp;~\u0026thinsp;8 week of age were purchased (SLAC Laboratory Animal Co.,Ltd, Shanghai, China) and raised in animal experiment center of Fujian Medical University. Prior to injection, nude mice were assigned at random to three groups. Cells (5\u0026times;10\u003csup\u003e6\u003c/sup\u003e) were suspended in 100 \u0026micro;l serum-free Medium and injected into the left anterior lingual margin of each mouse with 20 \u0026micro;l cell suspension.\u003c/p\u003e \u003cp\u003e50 days after the cells were injected, the nude mice were sacrificed. The lymph nodes from submandibular, neck, armpit, inguinal and popliteal fossa were harvested, washed in PBS. The collected lymph nodes were fixed in formalin, and in paraffin for HE staining. All experimental methods were performed in accordance with ARRIVE guidelines. All methods were carried out in accordance with relevant guidelines and regulations.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eSPSS 20.0 software was used for data statistics. \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant, and it was indicated in the figures as n.s when \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05, * when \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, ** when \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01, *** when \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001 and ****when \u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.0001.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eMMP10 is highly expressed in cancer and is associated with a poorer prognosis\u003c/h2\u003e \u003cp\u003eIn order to explore the role of MMP10 in tumor development, we constructed the pan-cancer expression landscape of MMP10. Among all 33 cancer type in the database, MMP10 expression was greatly altered in 16 tumors, accounting for 48% of all cancer type (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eHNSC samples (n\u0026thinsp;=\u0026thinsp;502) showed that MMP10 expression was significantly increased compared with adjacent normal tissues (n\u0026thinsp;=\u0026thinsp;44, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001); Kaplan-Meier survival analysis showed that patients with high MMP10 expression had lower survival (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.04, Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). And the data from OSCC samples (n\u0026thinsp;=\u0026thinsp;330) and adjacent normal tissues (n\u0026thinsp;=\u0026thinsp;32, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001, Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC), had the trend was the same as the HNSC. And the results of qRT-PCR showed that in 52 pairs OSCC tissues and adjacent normal tissues, the expression of MMP10 in OSCC tissues was higher than that in adjacent tissues (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001, Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). Then, we correlated protein expression of MMP10 in the CPTAC database. MMP10 expression was elevated in a cohort, which included samples of 109 head and neck tumor tissue samples and 70 normal head and neck normal tissue samples. Then the analysis showed that the MMP10 expression was upregulated in HNSC tissues (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). Meanwhile, MMP10 expression was elevated in the OSCC group, which included samples of 53 OSCC tissue samples and 25 normal oral normal tissue samples. Consistently, the analysis showed that the MMP10 expression was upregulated in OSCC tissues (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001, Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE).\u003c/p\u003e \u003cp\u003eAs we know the TP53 gene is a crucial tumor suppressor gene, and its mutation often predicts the poorer survival. Kaplan-Meier survival analysis showed that patients with TP53 mutation expression had lower survival. Thenwe analyzed MMP10 expression in the wild-type group(n\u0026thinsp;=\u0026thinsp;156) and TP53 mutant group(n\u0026thinsp;=\u0026thinsp;334), MMP10 expression was higher in the TP53 mutant group (p\u0026thinsp;=\u0026thinsp;0.017, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Despite the range of causes that can lead to cancer, virus is well-known cancer risk factors, such as Human papilloma virus (HPV). In this study, we compared the MMP10 expression in the HPV positive expression HNSC tissue group(n\u0026thinsp;=\u0026thinsp;69) and HPV negative expression group. The result showed that MMP10 had lower expression in HPV-negative group(n\u0026thinsp;=\u0026thinsp;412), and this was associated with poorer survival (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eMMP10 promotes cell proliferation\u003c/b\u003e \u003cb\u003ein vitro\u003c/b\u003e\u003c/p\u003e \u003cp\u003eIn order to explore the effect of MMP10 on the proliferation of cancer cells, siRNA-mediated knockdown of MMP10 was employed in Cal-27 cells. The results of qRT-PCR and Western blot showed that both siRNAs targeting MMP10 efficiently reduced MMP10 expression in the Cal-27 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA and B). We used CCK8 regent and colony formation to measure the proliferation change of cell (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC and D). Downregulated the expression of MMP10 can inhibit the proliferation of Cal-27 cells. These data showed that the MMP10 expression is related to the proliferation of cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eMMP10 increases cell migration and invasion\u003c/b\u003e \u003cb\u003ein vitro\u003c/b\u003e\u003c/p\u003e \u003cp\u003eAs we know, migration and invasion are two important factors that affect the recurrence and prognosis of squamous cell carcinoma cancer patient. In order to identify the effect of MMP10 in Cal-27cell migration and invasion, we used wound healing and transwell assays to detect change of cell migration and invasion (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). These dates showed that MMP10 may play an important role in Cal-27 cells, and may contribute the development and recurrence of OSCC.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eKnockdown MMP10 inhibits OSCC cells metastasis\u003c/b\u003e \u003cb\u003ein vivo\u003c/b\u003e\u003c/p\u003e \u003cp\u003eIn order to confirm the effect of MMP10 in OSCC metastasis in vivo, we established the stabilized cell line. According to the Western blot results, the shRNA, which sequence followed by the siRNA-MMP10-1336, had more significant knock down effect (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). So, we shRNA-1336 and NC group were selected for animal experiment.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eFinally, we counted the lymph node metastasis rate of 21 nude mice (NC group: 8; 1336 group: 13, formula: lymph node metastasis rate\u0026thinsp;=\u0026thinsp;number of nude mice with lymph node metastasis in each group/total number of statistically available nude mice in each group \u0026times;100%). The lymphatic metastasis rates of NC and 1336 groups were 62.5% (5/8) and 23.1% (3/13), respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB and C). These dates indicated that knockdown MMP10 can reduce the metastasis in vivo.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eThe expression of MMP10 was related to the expression of WNT3A\u003c/h2\u003e \u003cp\u003eIn order to explore the potential mechanism of MMP10, we detected the the correlation between MMP10 and WNT signaling pathway genes.At first, we analyzed the correlation between WNT and MMP10 in HNSC tissues using TCGA database, then the result showed that many genes(including WNT3, WNT3A, WNT5A, WNT5B) in the WNT signaling pathway are positively correlated with MMP10(Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). We further examined the correlation between MMP10 and WNT signaling pathway genes in HNSCC cells, and found that when the expression of WNT3A was up-regulated, the expression of MMP10 was also increased(Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eOriginally, MMP was considered only involved in tissue remodeling and destruction. With the further research, it is now widely acknowledged that MMPs take part in a lot of biologic processes, including the release of cytokines and growth factors, the growth and progression of tumors, angiogenesis, and a number of inflammatory conditions \u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e. Therefore, the MMP family has emerged as a biomarker for some tumors. Emily\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e et al. found that MMP10 was upregulated in all fifteen cancers she studied, and significant upregulated in ten of fifteen cancers. Pawan\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e et al. presented that MMP10 was over-expression in 48% tongue tumor, and identified MMP10 could be used as a potential prognostic biomarker to categorize the patient who are more prone to occur metastases. Lin\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e et al detected that MMP10 expression was related with poor outcome in the clear cell subtype of renal cell carcinoma (ccRCC), and its significantly upregulated was required for ccRCC invasion. In order to determine the role of MMP10 in oral squamous carcinogenesis, at the beginning of our study, we detected the expression of MMP10 in the public database (TCGA and CPTAC). The MMP10 expression was raised in HNSC and OSCC, and the high MMP10 expression in HNSC with a poor prognosis outcome. Then we examined the differential expression in mRNA level of MMP10 in oral squamous carcinoma and normal tissues, there was a significant high expression of MMP10 in tumor tissues. And in protein level, MMP10 was upregulated in HNSC and OSCC.\u003c/p\u003e \u003cp\u003eAn increasingly frequent risk factor for HNSCC is HPV infection\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e, In our current study, we found that HPV-negative patients had a poorer prognosis and that MMP10 was more highly expressed in HPV-negative tissues, and Paver et al\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e found that HPV-positive oropharyngeal squamous cell carcinoma (HPV-OPSCC) has a better prognosis than typical alcohol- and smoking-related anterior oral cavity squamous cell carcinoma (OSCC), this is consistent with our findings. These results predict that MMP10 may be closely associated with cancer and provides the basis for our subsequent experiments.\u003c/p\u003e \u003cp\u003eThe invasion and metastasis of cancer cell is a complex cascade process that includes cell adhesion to the ECM, ECM degradation, cell detachment and migration through the degraded stroma, etc. MMPs promote the degradation of the ECM\u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e. MMP10 acts as a crucial intermediary in tumor invasion and metastasis. In human endometrial cancer, regulation of cell invasiveness by Lipolysis-stimulated lipoprotein receptor (LSR) is achieved through MMP10\u003csup\u003e23\u003c/sup\u003e. In pancreatic ductal adenocarcinoma (PDAC), the promotion of invasive PDAC growth by hypoxia and matrix interactions is mediated through MMP10\u003csup\u003e24\u003c/sup\u003e. WNT7a can control urinary bladder cancer (UBC) invasion and the expression of WNT7A is positively correlated with MMP10 in UBC\u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e. In prostate cancer, MMP10 was revealed as one of the downstream targets of STER2, was associated with driving invasion in prostate cancer\u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. Patinib decreased the invasion and metastasis of liver cells in liver cancer via reducing the expression of MMP10\u003csup\u003e27\u003c/sup\u003e. In present study, based on the results of our proliferation capacity experiments, the effect of MMP10 on the proliferation capacity of OSCC was not significant; however, when MMP10 expression was down-regulated, the number of OSCC crossing transnwell was significantly reduced. Combined with the above two experimental results, it indicates that MMP10 expression can directly regulate the invasion and migration ability of OSCC, rather than achieving reduced invasion and migration by inhibiting cell proliferation. Not only in \u003cem\u003evitro\u003c/em\u003e experiments, but also in \u003cem\u003evivo\u003c/em\u003e experiments we found that the down-regulation of MMP10 expression also significantly reduced the rate of lymph node metastasis in mice, further indicating the direct regulatory effect of MMP10 on OSCC invasion and metastasis.\u003c/p\u003e \u003cp\u003eIn addition to being heavily linked to many human disorders, the WNT signaling pathway plays a crucial role in embryogenesis and development\u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e. Senescence bypass, abnormal cell proliferation, and cancer have all been linked to deregulation of the WNT signaling pathway\u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. In this research, we found that MMP10 is positively correlated with many genes in the WNT signaling pathway in multiple cancer types, and importantly, in HNSCC cells, upregulated WNT3A expression was followed by increased MMP10 expression. Combined with the previous effects of MMP10 on the invasion and migration of OSCC cells, it is speculated that MMP10 may regulate the cells through WNT3A. More research is needed to investigate the molecular mechanism of MMP10 in the invasion and metastasis of OSCC.\u003c/p\u003e \u003cp\u003eThe findings of this study showed that MMP10 inhibitor may have therapeutic uses in the treatment of OSCC patients by decreasing cell proliferation, invasion and metastasis.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData Availability statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAll data generated or analysed during this study are included in this published article.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Innovation Foundation of Department of Science and Technology of Fujian (grant number: 2017Y9096), the Natural Science Foundation of Fujian Province (Grant number: 2022J01761, 2022J01270), Fujian Medical Innovation Grant [grant number: 2018-CXB-13].\u0026nbsp;The funding bodies had no role in the design of the study, and collection, analysis, and interpretation of data and in writing of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eJ Q and XT Wu were responsible for the conduct of the experiments, and wrote the main manuscript; T L prepared figures1-2; DL Z and YG L were responsible for the design of the work; RH G and LC prepared figures 4-6, statistics analyzed of the data. All authors reviewed the manuscript\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo potential conflict of interest was reported by the authors.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eYang, Z. \u003cem\u003eet al.\u003c/em\u003e YKT6, as a potential predictor of prognosis and immunotherapy response for oral squamous cell carcinoma, is related to cell invasion, metastasis, and CD8+ T cell infiltration. \u003cem\u003eOncoimmunology\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, 1938890.\u003c/li\u003e\n\u003cli\u003ePeng, Q.-S. \u003cem\u003eet al.\u003c/em\u003e circRNA_0000140 suppresses oral squamous cell carcinoma growth and metastasis by targeting miR-31 to inhibit Hippo signaling pathway. \u003cem\u003eCell Death Dis\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 112 (2020).\u003c/li\u003e\n\u003cli\u003eYang, Y., Chen, D., Liu, H. \u0026amp; Yang, K. Increased expression of lncRNA CASC9 promotes tumor progression by suppressing autophagy-mediated cell apoptosis via the AKT/mTOR pathway in oral squamous cell carcinoma. \u003cem\u003eCell Death Dis\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, 41 (2019).\u003c/li\u003e\n\u003cli\u003ePandit, A., Begum, Y., Saha, P., Srivastava, A. K. \u0026amp; Swarnakar, S. Approaches Toward Targeting Matrix Metalloproteases for Prognosis and Therapies in Gynecological Cancer: MicroRNAs as a Molecular Driver. \u003cem\u003eFront Oncol\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 720622 (2021).\u003c/li\u003e\n\u003cli\u003eNiland, S., Riscanevo, A. X. \u0026amp; Eble, J. A. Matrix Metalloproteinases Shape the Tumor Microenvironment in Cancer Progression. \u003cem\u003eInt J Mol Sci\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, 146 (2021).\u003c/li\u003e\n\u003cli\u003eMatrix Metalloproteinase-9 (MMP-9) as a Cancer Biomarker and MMP-9 Biosensors: Recent Advances - PubMed. https://pubmed.ncbi.nlm.nih.gov/30262739/.\u003c/li\u003e\n\u003cli\u003eCurcumin May Prevent Basement Membrane Disassembly by Matrix Metalloproteinases and Progression of the Bladder Cancer - PubMed. https://pubmed.ncbi.nlm.nih.gov/35010907/.\u003c/li\u003e\n\u003cli\u003eKang, S. U. \u003cem\u003eet al.\u003c/em\u003e Matrix metalloproteinase 11 (MMP11) in macrophages promotes the migration of HER2-positive breast cancer cells and monocyte recruitment through CCL2-CCR2 signaling. \u003cem\u003eLab Invest\u003c/em\u003e \u003cstrong\u003e102\u003c/strong\u003e, 376\u0026ndash;390 (2022).\u003c/li\u003e\n\u003cli\u003eYuan, S. \u003cem\u003eet al.\u003c/em\u003e Elevated matrix metalloproteinase 7 expression promotes the proliferation, motility and metastasis of tongue squamous cell carcinoma. \u003cem\u003eBMC Cancer\u003c/em\u003e \u003cstrong\u003e20\u003c/strong\u003e, 33 (2020).\u003c/li\u003e\n\u003cli\u003eMinaei, E. \u003cem\u003eet al.\u003c/em\u003e Cancer Progression Gene Expression Profiling Identifies the Urokinase Plasminogen Activator Receptor as a Biomarker of Metastasis in Cutaneous Squamous Cell Carcinoma. \u003cem\u003eFront Oncol\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 835929 (2022).\u003c/li\u003e\n\u003cli\u003eSalivary protease spectrum biomarkers of oral cancer - PubMed. https://pubmed.ncbi.nlm.nih.gov/30602733/.\u003c/li\u003e\n\u003cli\u003eWang, D. \u003cem\u003eet al.\u003c/em\u003e Irradiation-induced dynamic changes of gene signatures reveal gain of metastatic ability in nasopharyngeal carcinoma. \u003cem\u003eAm J Cancer Res\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, 479\u0026ndash;495 (2019).\u003c/li\u003e\n\u003cli\u003eQuilty, F. \u003cem\u003eet al.\u003c/em\u003e Impact of Deoxycholic Acid on Oesophageal Adenocarcinoma Invasion: Effect on Matrix Metalloproteinases. \u003cem\u003eInt J Mol Sci\u003c/em\u003e \u003cstrong\u003e21\u003c/strong\u003e, E8042 (2020).\u003c/li\u003e\n\u003cli\u003eColaprico, A. \u003cem\u003eet al.\u003c/em\u003e TCGAbiolinks: an R/Bioconductor package for integrative analysis of TCGA data. \u003cem\u003eNucleic Acids Res\u003c/em\u003e \u003cstrong\u003e44\u003c/strong\u003e, e71 (2016).\u003c/li\u003e\n\u003cli\u003eMayakonda, A., Lin, D.-C., Assenov, Y., Plass, C. \u0026amp; Koeffler, H. P. Maftools: efficient and comprehensive analysis of somatic variants in cancer. \u003cem\u003eGenome Res\u003c/em\u003e \u003cstrong\u003e28\u003c/strong\u003e, 1747\u0026ndash;1756 (2018).\u003c/li\u003e\n\u003cli\u003eDagher, A. \u003cem\u003eet al.\u003c/em\u003e Identification of Novel Non-invasive Biomarkers of Urinary Chronic Pelvic Pain Syndrome (UCPPS): Findings from the Multidisciplinary Approach to the Study of Chronic Pelvic Pain (MAPP) Research Network. \u003cem\u003eBJU Int\u003c/em\u003e \u003cstrong\u003e120\u003c/strong\u003e, 130\u0026ndash;142 (2017).\u003c/li\u003e\n\u003cli\u003eGobin, E. \u003cem\u003eet al.\u003c/em\u003e A pan-cancer perspective of matrix metalloproteases (MMP) gene expression profile and their diagnostic/prognostic potential. \u003cem\u003eBMC Cancer\u003c/em\u003e \u003cstrong\u003e19\u003c/strong\u003e, 581 (2019).\u003c/li\u003e\n\u003cli\u003eUpadhyay, P. \u003cem\u003eet al.\u003c/em\u003e Genomic characterization of tobacco/nut chewing HPV-negative early stage tongue tumors identify MMP10 asa candidate to predict metastases. \u003cem\u003eOral Oncol\u003c/em\u003e \u003cstrong\u003e73\u003c/strong\u003e, 56\u0026ndash;64 (2017).\u003c/li\u003e\n\u003cli\u003eLin, T.-C. \u003cem\u003eet al.\u003c/em\u003e Ghrelin Upregulates Oncogenic Aurora A to Promote Renal Cell Carcinoma Invasion. \u003cem\u003eCancers (Basel)\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, E303 (2019).\u003c/li\u003e\n\u003cli\u003eSolomon, B., Young, R. J. \u0026amp; Rischin, D. Head and neck squamous cell carcinoma: Genomics and emerging biomarkers for immunomodulatory cancer treatments. \u003cem\u003eSemin Cancer Biol\u003c/em\u003e \u003cstrong\u003e52\u003c/strong\u003e, 228\u0026ndash;240 (2018).\u003c/li\u003e\n\u003cli\u003ePaver, E. C., Currie, A. M., Gupta, R. \u0026amp; Dahlstrom, J. E. Human papilloma virus related squamous cell carcinomas of the head and neck: diagnosis, clinical implications and detection of HPV. \u003cem\u003ePathology\u003c/em\u003e \u003cstrong\u003e52\u003c/strong\u003e, 179\u0026ndash;191 (2020).\u003c/li\u003e\n\u003cli\u003eArosarena, O. A. \u003cem\u003eet al.\u003c/em\u003e OSTEOACTIVIN REGULATES HEAD AND NECK SQUAMOUS CELL CARCINOMA INVASION BY MODULATING MATRIX METALLOPROTEASES. \u003cem\u003eJ Cell Physiol\u003c/em\u003e \u003cstrong\u003e233\u003c/strong\u003e, 409\u0026ndash;421 (2018).\u003c/li\u003e\n\u003cli\u003eShimada, H. \u003cem\u003eet al.\u003c/em\u003e Downregulation of lipolysis-stimulated lipoprotein receptor promotes cell invasion via claudin-1-mediated matrix metalloproteinases in human endometrial cancer. \u003cem\u003eOncol Lett\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, 6776\u0026ndash;6782 (2017).\u003c/li\u003e\n\u003cli\u003eLiu, D. \u003cem\u003eet al.\u003c/em\u003e Soluble Compounds Released by Hypoxic Stroma Confer Invasive Properties to Pancreatic Ductal Adenocarcinoma. \u003cem\u003eBiomedicines\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, E444 (2020).\u003c/li\u003e\n\u003cli\u003eHuang, X. \u003cem\u003eet al.\u003c/em\u003e Wnt7a activates canonical Wnt signaling, promotes bladder cancer cell invasion, and is suppressed by miR-370-3p. \u003cem\u003eJ Biol Chem\u003c/em\u003e \u003cstrong\u003e293\u003c/strong\u003e, 6693\u0026ndash;6706 (2018).\u003c/li\u003e\n\u003cli\u003eBurnell, S. E. A. \u003cem\u003eet al.\u003c/em\u003e STEAP2 Knockdown Reduces the Invasive Potential of Prostate Cancer Cells. \u003cem\u003eSci Rep\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, 6252 (2018).\u003c/li\u003e\n\u003cli\u003eHe, X. \u003cem\u003eet al.\u003c/em\u003e Apatinib Inhibits the Invasion and Metastasis of Liver Cancer Cells by Downregulating MMP-Related Proteins via Regulation of the NF-\u0026kappa;B Signaling Pathway. \u003cem\u003eBiomed Res Int\u003c/em\u003e \u003cstrong\u003e2020\u003c/strong\u003e, 3126182 (2020).\u003c/li\u003e\n\u003cli\u003eXie, J., Huang, L., Lu, Y.-G. \u0026amp; Zheng, D.-L. Roles of the Wnt Signaling Pathway in Head and Neck Squamous Cell Carcinoma. \u003cem\u003eFront Mol Biosci\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, 590912 (2020).\u003c/li\u003e\n\u003cli\u003eGOLPH3/CKAP4 promotes metastasis and tumorigenicity by enhancing the secretion of exosomal WNT3A in non-small-cell lung cancer - PMC. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8528870/.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-3362133/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3362133/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAberrant MMP expression can be detected in almost all primary and recurrent tumors. The aim of this study was to identify the role of MMP10 in the cell biological function of OSCC. We analyzed the expression and survival data analysis were done using data from the Cancer Genome Atlas (TCGA) and the Clinical Proteomic Tumor Analysis Consortium(CPTAC) database, then expression of MMP10 in clinical OSCC samples was detected by using qRT-PCR. We reduced the expression of MMP10 to elucidate the effects of MMP10 on proliferation, migration and invasion. Genes associated with MMP10 were validated by qRT-PCR. The MMP10 expression was raised in HNSC and OSCC, and the high MMP10 expression in HNSC with a poor prognosis outcome. The MMP10 expression was upregulated in OSCC tissues when compared with adjacent tissues. Knockdown the expression of MMP10 inhibited the cell migration and invasion in \u003cem\u003evitro\u003c/em\u003e and lymph node metastasis \u003cem\u003ein vivo\u003c/em\u003e. And the expression of MMP10 was regulated by WNT3A. The results of present study indicate that MMP10 plays a significant role in the invasion and migration of OSCC. MMP10 may be a possible target gene for the therapy of OSCC by inhibiting metastasis.\u003c/p\u003e","manuscriptTitle":"Experimental study MMP10 Regulates the lymph node metastasis of Oral Squamous Cell Carcinoma Cells","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-10-12 17:39:21","doi":"10.21203/rs.3.rs-3362133/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"0e76c4cf-d966-451a-b0af-4111f88ba5e5","owner":[],"postedDate":"October 12th, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-08-05T10:21:58+00:00","versionOfRecord":[],"versionCreatedAt":"2023-10-12 17:39:21","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3362133","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3362133","identity":"rs-3362133","version":["v1"]},"buildId":"_2-kVJe1T_tPrBINL-cwx","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}