Generation and Evaluation of Chicken IgY-scFv for the Purposes of CPV Diagnosis and Therapy

preprint OA: gold CC-BY-4.0
📄 Open PDF Full text JSON View at publisher
AI-generated summary by claude@2026-07+body, 2026-07-05

Chicken IgY single chain variable fragments (scFv) targeting CPV-VP2 were generated via T7 phage display, showing diagnostic accuracy and eliminating 55% of CPV infections in vitro.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by claude@2026-07, 2026-07-05 · read from full text

The paper describes generation and characterization of chicken IgY-derived single-chain variable fragments (IgY-scFv) against canine parvovirus type 2 (CPV-VP2) using a T7 phage-display library constructed from hens immunized with CPV virus-like particles (VLP). The authors report that the primary library reached a titer of 1.5×10^6 pfu/mL with 95% phages containing the target fragments, and that the selected scFv recognized CPV-VLP/VP2 in ELISA with results on CPV clinical samples consistent with commercial immunochromatographic assay and PCR, while showing no cross-reactivity with canine distemper virus or canine coronavirus. They additionally expressed the IgY-scFv in CRFK cells and found 55% CPV infection suppression within 24 hours in a virus suppression assay; docking suggested specific VP2 binding-side amino acid positions (AA37 and AA40). This paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via a keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Background: Canine parvovirus (CPV) can cause acute and highly contagious enteritis in dog, antibodies have been used for diagnosis and therapy of CPV disease, generation of functional antibody fragments by using novel antibody engineering platforms is promising in veterinary practice. Results: The IgY single chain fragment variables (scFv) were generated by T7 phage display system and expressed in E. coli system after immunizing hens with virus-like particles (VLP) of CPV-VP2. The titer of the primary scFv library reached to 1.5×10 6 pfu/mL, and 95% of the phages contained the target fragments. The CPV-VLP and CPV-VP2 protein showed similar reaction values to the purified scFv in the ELISA test, and the results of ELISA analysis using IgY-scFv toward CPV clinical samples were consistent with commercial immunochromatographic assay (ICA) and PCR detection, the scFv did not show cross reactivity with canine distemper virus (CDV) and canine coronavirus (CCV). IgY-scFv was successfully expressed in CRFK cells, and in the virus suppression assay, 55% of CPV infections were eliminated within 24 hours. Docking results demonstrated that the number of amino acids of the binding sides between scFv and VP2 were AA37 and AA40, respectively. Conclusions: This study revealed the feasibility of a novel functional antibody fragment development strategy by generating diversified avian IgY-scFv libraries towards the pathogenic target of interest for both detection and therapeutic purposes in veterinary medicine.
Full text 87,190 characters · extracted from preprint-html · click to expand
Generation and Evaluation of Chicken IgY-scFv for the Purposes of CPV Diagnosis and Therapy | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Generation and Evaluation of Chicken IgY-scFv for the Purposes of CPV Diagnosis and Therapy Shikun Ge, Long Xu, Ben Li, Fagang Zhong, XiaoYing Zhang This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-28773/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background: Canine parvovirus (CPV) can cause acute and highly contagious enteritis in dog, antibodies have been used for diagnosis and therapy of CPV disease, generation of functional antibody fragments by using novel antibody engineering platforms is promising in veterinary practice. Results: The IgY single chain fragment variables (scFv) were generated by T7 phage display system and expressed in E. coli system after immunizing hens with virus-like particles (VLP) of CPV-VP2. The titer of the primary scFv library reached to 1.5×10 6 pfu/mL, and 95% of the phages contained the target fragments. The CPV-VLP and CPV-VP2 protein showed similar reaction values to the purified scFv in the ELISA test, and the results of ELISA analysis using IgY-scFv toward CPV clinical samples were consistent with commercial immunochromatographic assay (ICA) and PCR detection, the scFv did not show cross reactivity with canine distemper virus (CDV) and canine coronavirus (CCV). IgY-scFv was successfully expressed in CRFK cells, and in the virus suppression assay, 55% of CPV infections were eliminated within 24 hours. Docking results demonstrated that the number of amino acids of the binding sides between scFv and VP2 were AA37 and AA40, respectively. Conclusions: This study revealed the feasibility of a novel functional antibody fragment development strategy by generating diversified avian IgY-scFv libraries towards the pathogenic target of interest for both detection and therapeutic purposes in veterinary medicine. Biotechnology and Bioengineering Chicken IgY single chain variable fragments (IgY-scFv) Canine parvovirus (CPV) T7 phage display system Virus-like particles (VLP) novel antibody generation platform Background Canine parvovirus (CPV) was first identified in 1978 ( 1 ); it has a single-stranded DNA genome of negative polarity, about 5200 bp in length. The CPV capsid is a 25 nm diameter icosahedron containing three structural viral proteins (VP1, VP2 and VP3) and two non-structural proteins (NS1 and NS2), among them, VP2 accounts for 90% of the viral capsid and represents the major determinant of host range and virus-host interactions ( 2 ). Although the conventional attenuated and inactivated CPV vaccines have been successful in reducing the disease outbreaks, the genus of parvovirus still causes severe epizootics worldwide and leads to severe economic losses in dogs ( 3 ). Antibody based approach is promising in CPV disease diagnosis, therapy and prevention, and the relevant hyper immune serum (IgG) and full-length monoclonal antibody (mAbs) have been routinely applied in the veterinary practices ( 4 ). At present, most commercially available mAbs are produced in mammalian system using hybridoma technology. Functional antibody fragments (i.e.: scFv, Fab) generated by phage-display technology have been not yet routinely evaluated and applied in the veterinary medicine despite it has been well confirmed that such engineered antibodies offer a series of advantages over polyclonal and full-length monoclonal antibodies. Antibody phage display technology is to display polyclonal antibodies on the surface of the phage shell protein and to screen the specific monoclonal antibodies by bio-panning procedure ( 5 ). Phages are more stable and can be stored for years at 4℃; it can be re-produced rapidly, successively and inexpensively with a confirmed sequence in the prokaryote or eukaryote systems without hybridoma and immunization procedure. Furthermore, higher affinity mutants of scFv can be generated through site directed mutagenesis which is much easier and simpler to be performed ( 6 ). Chicken ( Gallus domesticus ) IgY antibody generated by IgY technology is another conventional approach in generating large amount of high specific antibody and have been used for broad biomedical purposes owning to a series of advantages such as higher productivity, better animal welfare, higher immunogenicity to mammal conserved proteins and lower cross-reactivity, as compared to the generation and application of mammalian serum IgG ( 7 ). Our previous work confirmed that the generated polyclonal IgY targeted to CPV-VP2 could applied into the immunotherapy and immunoprophylaxis for the CPV infection ( 8 ). In recent years, as an interesting tendency in IgY technology, generation of IgY-scFv in order to better combine the biological superiorities of both IgY and recombinant antibody fragment, is gaining increasing attention and application ( 9 , 10 ). Our previous studies demonstrated that IgY-scFv can be generated and applied in different immunoassays for the detection of small molecules gentamicin ( 11 ) and large molecules pIFN-γ ( 12 ) in the veterinary practice. As an attempt to understand the feasibility of chicken IgY-scFv in diagnosis and therapy of veterinary diseases, this study aimed to construct and characterize chicken sourced scFv against CPV-VP2 virus like particles (VLP) using phage display technology, and to evaluate the specificity, sensitivity and virus inhibition ability of the obtained scFv. Methods Immunization of chicken Twelve-week old white Leghorn hens were immunized intramuscularly with CPV-VLP (provided by Dr. Shiqi Sun ( 13 )) mixed with Freund’s adjuvant (Sigma-Aldrich, St. Louis, MO, USA) at four different sites of breast muscles. CPV-VLP protein (125 µL, 2 mg/mL) in equal volume of phosphate buffered solution (PBS, 0.01 M, pH 7.4) was emulsified with Freund’s complete adjuvant (FCA; Sigma-Aldrich, St. Louis, MO, USA) in the first immunization, and four booster immunizations were followed up using Freund’s incomplete adjuvant (FIA; Sigma-Aldrich, St. Louis, MO, USA) at 2-week intervals. All experimental animal protocols were reviewed and approved by the institutional Ethics Committee for the use of laboratory animals. Construction Of Anti-cpv-vlp Scfv The hen’s spleen was collected to extract the total RNA using Total RNA Kit (Tiangen Biotech, Beijing, China), and the first-strand cDNA was synthesized using HiScript Q Select RT SuperMix for PCR (+ gDNA wiper, Vazyme Biotech, Nanjing, China). The heavy variable fragment (V H ) and light chain variable fragment (V L ) genes were amplified by PCR with primers (Table 1 ). The V H and V L were assembled using primers HF- Eco R I & LR- Hin d III by Overlap PCR. The products of overlap PCR (scFv) were purified through Gel Extraction Kit (Omega, Norcross, GA, USA). Table 1 Primers used for PCR Name Primer sequences (5’-3’) Application HF- Eco R I CG GAATTC GGCCGTGACGTTGGACG V H HR-Linker CAGAGCCACCTCCGCCTGAACCGCCTCCA V H CCGGAGGAGACGATGAC LF-Linker TTCAGGCGGAGGTGGCTCTGGCGGTGGCG V L GATCGGCGCTGACTCAGCCGTCCT LR- Hin d III AAT AAGCTT ACCTAGGACGGTCAGGG V L Construction Of Library The scFv gene products were digested with Eco R I and Hin d III restriction enzyme and ligated to T7 select 10-3b (0.04 pmol; Novagen, Darmstadt, Germany) using T4 DNA Ligase (TaKaRa Biotechnology, Dalian, China) in a working volume of 5 µL at 16℃ overnight. The ligation products were directly added to T7 packaging extract (25 µL) and the mixtures were incubated at 22℃ for 2 h in vitro packaging to create the primary library by adding LB medium (270 µL) to stop the reaction. The primary scFv library was amplified by liquid lysate amplification according to the T7 select system manual. The titers of the primary and amplified library were evaluated by plaque assay. Bio Panning The amplified library was subjected to four rounds of bio panning on microplates for the enrichment of the specific scFv phages according to the T7 select system manual. The microplates were coated with CPV-VLP overnight (15 µg, 10 µg, 8 µg and 5 µg per well in each round) at 4℃, and washed with Tween-PBS (PBST, tween 0.5%; 150 µL/well) and PBS, respectively. After blocked with skimmed milk (5%) in PBST, the amplified phages from the starting library of each round of panning were added to the microplates and incubated at 37℃ for 1 h, and the bound phage was eluted with SDS (1%) in each round. In the first three rounds, eluted phages were amplified by infecting BL5403 bacterial culture (Novagen, Darmstadt, Germany). The enrichment of specificity was determined from the input/output ration of the phage. A total of random clones of 100 on the plates were selected from the fourth round to identify the positive rate using a pair of universal primers (Table 1 ). The amplified library was added with 1% chloroform and stored at 4℃. Expression And Purification Of Scfv After sequencing, the phage-scFv with the highest binding force was selected to ligate with pET-30a (+) vector using T4 DNA Ligase (TaKaRa Biotech, Dalian, China). The recombinant plasmids were transformed into BL21 (DE3) competent cells, and the scFv expression was induced with isopropyl-β-D-thiogalactopyranoside (IPTG). The bacterial cells were collected by centrifugation and sonication, and the supernatants and pellets were used for SDS-PAGE analysis, respectively. Protein was purified by HisTrap HP histidine-tagged protein cultured columns (GE, Pittsburgh, PA, USA). Identification Of Scfv The CPV-VP2 proteins were separated by SDS-PAGE (5% stacking and 12% resolving) and blotted on nitrocellulose membranes (Schleicher & Schuell, Atlanta, GA, USA). Membranes were blocked with 5% (w/v) nonfat dry milk (NDM) in Tris-buffered saline-Tween (TBS-T) at room temperature (RT) for 30 min. Membranes were incubated with 12.5 mL TBS-T containing 1% NDM and 5 µg prepared scFv proteins at RT under agitation for 1 h. Membranes were washed three times for 10 min in TBS-T, and incubated with 12.5 mL TBS-T containing 1% NDM and mouse anti-His monoclonal antibody conjugated with HRP (1:5000; CWBio, Beijing, China) at RT under agitation for 30 min. Membranes were washed three times for 15 min in TBS-T, and developed using DAB chromogenic solution detection reagents (Boster, Wuhan, China). Analysis On Scfv Sensitivity By Elisa The wells of a 96-well Maxisorp microtiter plate (Nunc, Roskilde, Denmark) were coated with different amounts of CPV-VP2 (0, 0.2, 0.5, 2, 6, 8, 10 ng/µL) dissolved in carbonate buffer (15 mM Na 2 CO 3 , 35 mM NaHCO 3 , 0.001% phenol-red, pH 9.6) and incubated over night at 4℃. The wells were rinsed with PBST and incubated with scFv protein (different amount) diluted in PBST for 1 h. The wells were rinsed with PBST (3 × 5 min) and incubated 1 h with mouse anti-His monoclonal antibody conjugated with HRP (1:5000; CWBio, Beijing, China) followed by three washes with PBST buffer (5 min each). The color will be developed using 3, 3′, 5, 5′ tetramethylbenzidine (TMB; Promega Biotech, Beijing, China) for 10 min and the absorbance was read at 450 nm. Detection Of Clinical Samples To determine the accuracy of scFv, a total of 28 clinical dog stool samples were collected using sterile swabs in an animal hospital (Xinger, Xi’an, China). Among them, 24 samples were confirmed CPV positive and 4 were negative by the hospital using commercial colloidal gold test strip (ICA). The samples were homogenized (10%, w/v) in PBS (1 mL, pH 7.2) and centrifuged, the supernatants were used for indirect ELISA and PCR. In order to verify whether scFv has specificity in clinical practice detection, Canine distemper virus (CDV) and coronavirus (CCV) were used to detect the cross-reaction by ELISA. Indirect Immunofluorescence Assay (ifa) The CRFK cells (LMAI Bio, Shanghai, China) were seeded into 6-well plates and pcMV-3-scFv were transfected when the cell density reached 70%. At 48 h post-transfection, the cells were fixed with paraformaldehyde (4%), permeabilized with Triton X-100 (0.5%) and incubated with BSA (Beyotime, Shanghai, China) to block nonspecific binding sites. They were then incubated with diluted His-tag antibody (100 µL; Affinity Biosciences, OH, USA) for 2 h. After PBS washing, Goat anti-Mouse IgG (H + L) Fluor 594-conjugated (Affinity Biosciences, OH, USA) was added. The stained cells were visualized by using a Nikon Eclipse 80i fluorescence microscope (Nikon, Sendai, Japan). Total protein of the cells transfected 48 h were extracted for western blot; His-tag antibody and Goat anti-Mouse IgG HRP (Biosharp, Hefei, China) were used as primary and secondary antibodies, respectively. Measurement Of Virus Growth Curve Normal CRFK cells (10 5 /mL) were seeded into 96-well plates, and the virus infection was performed when the cell density reached 70%. The original virus solution was serially diluted in 10-fold, added to a 96-well plate, 10 gradients, and 8 wells were repeated for each gradient. The 96-well plate was placed in 37℃ with 5% CO 2 incubator, and the tissue culture infective dose (TCID 50 ) was determined after the number of pathological wells was fixed. Transfected cells and normal cells were seeded into 96-well plates, and the cells were infected with CPV (CPV-HY strain offered by Century Yuanheng Animal Epidemic Prevention Technology Co., Ltd., Beijing, China) in 0.1 MOI. After 1 h, the supernatant virus solution was removed and replaced with a cell maintenance solution. The cell supernatants were collected at 2 h, 4 h, 8 h, 12 h, 24 h, 36 h, 48 h, 60 h, 72 h and 84 h, respectively, and the TCID 50 values of each time point were measured to plot the growth curve. Scfv-vp2 Docking Docking was performed using Discovery Studio 4.5 software (BIOVIA, San Diego, CA, USA) and the Antibody Modeling Cascade program in Discovery Studio software was used to build the molecular model of the scFv. Then, to obtain the docking conformation, the scFv molecular model was docked with VP2 using the ZDock molecular docking program. Finally, the Residues Contact Frequency (RCF) algorithm was used to analyze the predicted results, and the binding surfaces of amino acids in scFv and VP2 were obtained. Results Construction of scFv library The lengths of VH-linker, VL-linker and scFv were approximately 370 bp, 420 bp and 800 bp, respectively (Fig. 1 A and B). The titer of the primary anti-CPV scFv library (Fig. 1 C) and the amplified library were 1.5 × 10 6 pfu/mL, and 8.2 × 10 11 pfu/mL, respectively. There were 95% of the phages containing the target fragments in the primary scFv library. Notes: A : PCR products of VL (370 bp, lane 1 and 2) and VH (420 bp, lane 3 and 4); B : PCR products of scFv, 800 bp (lane 1). M: marker; C : schematic diagram of scFv construction. Screening Of Scfv Phage Library After 4 rounds of "bind-elute-amplify" bio-panning procedure, the data of input and output phages in each round indicated that the phage library had been enriched 100 times (Fig. 2 and Table 2 ). A total of 15 scFv genes showed relatively high binding capacity to CPV-VLP in the reactivity detection of 100 phages, and the sequencing confirmed that all the 15 scFv genes have complementary determining region 3 (CDR3) that was the main mutation region in both VH and VL. There were few clones having limited mutations in framework region (FR, Fig. 3 ). The phage-scFv (No. 96) showed the highest binding force was chosen for further experiments. Table 2 Library size and phage titer of each panning Round Coating concentration (per well) Input (pfu/mL) Output (pfu/mL) Amplification library (pfu/mL) 1 15 µg 1 × 10 12 7.2 × 10 6 4.95 × 10 12 2 10 µg 1 × 10 11 4.64 × 10 7 1.31 × 10 13 3 8 µg 1 × 10 11 8.8 × 10 8 2.8 × 10 12 4 5 µg 1 × 10 11 1.52 × 10 8 -- Note The yellow markers represented the same sequences. Scfv Expression And Purification The solubility analysis showed that scFv mainly existed in the form of inclusion body (38 kDa; Fig. 4 A, lane 2). The denaturation and purification of scFv inclusion body protein showed a single protein band with high purity (Fig. 4 B). The VP2 protein could bind to scFv with a single binding strip (85 kDa; Fig. 4 C). Notes: A : lane 1, E. coli supernatant; lane 2, E. coli precipitation; B : lane 1, the renaturation of scFv protein; C : lane 1, antigen was CPV-VP2 protein, incubated with primary antibody scFv. Scfv Sensitivity Analysis The immunoreactivity of scFv against soluble VP2 was examined by ELISA. scFv bound in a dose-dependent manner to the soluble VP2 (Fig. 5 ). The minimum antibody concentration for the detected antigen was 2 ng/µL. Notes scFv in different concentrations were added to 96-well plates coated with soluble VP2 in different concentrations (0, 0.2, 0.5, 2, 6, 8, 10 ng/µL). Binding was detected with mouse anti-His monoclonal antibody conjugated with HRP. The binding activity was measured as absorbance at 450 nm produced by peroxidase. Data of each point represented as Mean ± SD of triplicate. Specificity and cross-reactivity of IgY-scFv in CPV clinical sample tests The coincidence of ELISA (Fig. 6 A) and PCR (Fig. 6 C) with ICA (data not show) was 100% and 85.7%, respectively. The scFv showed no cross reactivity with CDV and CCV (Fig. 6 B). Notes Clinical samples of CPV were analyzed by ELISA (A), PCR (C) and ICA (data not shown); the cross reactivities of anti-CPV-IgY-scFv with CDV and CCV were analyzed by ELISA (B). CPV was CPV-HY strain; VP2 was expressed in the prokaryotic system. Neutralization Effect Of Scfv To Cpv In Crfk Cells The sequencing results showed that the scFv and pcMV-3 vectors were successfully connected (Fig. 7 A), IFA confirmed that scFv was significantly expressed in CRFK cells (Fig. 7 B). Immunoblotting further confirmed that the scFv protein was correctly folded and modified in the cell (Fig. 7 C). The CRFK cells expressing scFv showed a small amount of cytopathic effect (CPE) after CPV infection; the cells without scFv expression were broke away significantly from the bottom wall, became round, and some cells even broke up (Fig. 7 D). Virus TCID 50 at different time points was determined; the growth rate of virus in cells expressing scFv was significantly lower than that in cells not expressing scFv (Fig. 7 E). The inhibition rates of scFv on virus growth at 24 h, 48 h, and 72 h were 55%, 38% and 30%, respectively (Fig. 7 F). Notes: A , scFv gene was ligated pcMV-3 vector mode. B , control: CRFK cells of pcMV-3 without scFv, scFv: CRFK cells of pcMV-3 with scFv, DAPI: staining nuclei. C , western blot detection scFv transfected CRFK cells, control represent empty pcMV-3 transfected CRFK cells. D , after transfecting the cells with scFv for 24 h, the cells were infected with CPV (MOI = 0.1). E , growth curve of CPV in CRFK cells with scFv and without scFv expression. F , The proportion of TCID50 of virus in different cell treatment groups (scFv group and without scFv group) at different time points. The Binding Sides Of The Scfv-vp2 The main structural domains of scFv were VLCDR1, VLCDR2, VLDR3, VHCDR1, VHDCR2, and VHCDR3, with 13 antigen-binding sites on scFv (Fig. 8 A). The 3 dimensional scFv model was subsequently constructed (Fig. 8 B). A total of 5 highly similar VP2 homologous sequences were simulated by software (Fig. 8 C), the VP2 molecular stereo model was established by combining the characteristics of each sequence (Fig. 8 D). After analysis on ScFv and VP2 binding mode (Fig. 8 E), the interacting amino acids at the binding sides of scFv (AA37) and VP2 (AA40) were confirmed (Fig. 8 F and 8 G). Notes : All docking analysis were performed by Discovery Studio software. ScFv modeling: Antibody Modeling Cascade program; VP2 modeling: Build Homology Models program; Docking: ZDock program. Discussion The mAbs have been widely applied in the biomedical areas owning to their high specificity and homogeneity. However, mAbs produced by mammals may have the side effects of immunogenicity, thrombocytopenia and hypersensitivity reactions, etc, which has greatly limited the application of mAbs in target detection and treatment ( 14 , 15 ). With the development of antibody library technology and humanized antibody modification technology, increasing humanized recombinant antibodies have been gradually developed and entered the clinic trials ( 16 ). Diversified antibody generation strategies could be a future tendency in antibody engineering in order to better combine the characteristics and advantages of antibodies from different sources. As a notable example, Brolucizumab (Beovu) is the first FDA approved rabbit-derived scFv used as vascular endothelial growth factor (VEGF) inhibitor for the treatment of exudative (wet) age-related macular degeneration (AMD), diabetic macular oedema and macular oedema secondary to retinal vein occlusion, which could better overcome the possible side effects (discomfort and increased tears in the affected eyes, itchy or watery eyes, dry eyes, swelling of the eyelids, etc.) of murine-derived IgG-Fab fragment (Lucentis) ( 17 ). In avian IgY, similar attempts have also been made. For instance, the snake venom contains neurotoxic proteins, the urgent administration of hyperimmune serum from horse used to be the most efficient treatment, which can recognize many different antigenic determinants. However, generation of equine anti- venom is costly and associated with several potential side effects. Chicken IgY-scFv has been generated against glutaraldehyde-attenuated Daboia russelii formosensis (DRF) venom proteins for passive immunization, which can identify and neutralize the toxic activity of the venom components, with only small quantity of antigens required to induce a significant antibody response in hens, and can be also used as a rapid diagnostic tool for wound secretions to determine snake types ( 18 ). As summarized by previous authors, owning to the unique structure, phylogenetic distance and the mechanism of molecular diversification, IgY antibodies provide a series of important advantages over mammal IgG, including the stronger immune responses of chicken system to the proteins conserved among mammals, decreased/avoid cross-reactivities (ie.: rheumatoid factor, human anti-mouse IgG antibody, complement system, Fc receptors) in the mammal systems ( 19 , 20 ), and more convenient to design a primer against IgY-scFv (Table 1 ), as IgY only has one isotype and it is lack of hinge region ( 9 ). Furthermore, it is noteworthy to address, recent studies confirm that from the glycobiology point of view, recombinant IgY antibody could be a potentially promising immune-therapeutic candidate after proper antibody engineering and expression as IgY is more heavily glycosylated ( 21 ), and has higher sialic acid content ( 22 ) as compared to mammal IgG. Recombinant functional antibody fragments remove or reduce irrelevant structures, while retain the specificity and main biological activities of natural antibodies, which offers a wider application prospect than natural antibodies ( 23 ). Recombinant IgY-scFv could combine the advantages of both IgY molecular and functional antibody fragment ( 9 ). Designing on chimeric antibody could be the next step for IgY-scFv study in order to provide better compatibility of the antibody in the host system, and to recoup the possibly decreased specificity and affinity of antibody fragments as compared to full length antibody. Recent study confirmed that mammalian IgG and avian IgY shared compatible V-C region interfaces, which may be conducive for the design and utilization of mammalian-avian chimeric Abs ( 24 ). In our study, the high consistency of ELISA analysis to PCR and ICA on clinical samples confirmed the specificity of the obtained IgY-scFv (Fig. 6 ), which offers the potential using IgY-scFv for rapid detection of CPV. scFv neutralized the virus (Fig. 7 D), inhibited CPV replication with significantly reduced growth rates of the CPV observed in the CRFK cells (Fig. 7 E, F), which provides the value of further therapeutic investigation of obtained IgY-scFv. As alternative to viral components, CPV-VP2-VLP was used as immunogen in this study. With increasing applications in vaccine design and immunization, VLP has been recognized as safe and effective particle to stimulate adequate immune responses for both viral and non-viral diseases by inducing lymphocyte proliferation and specific antibody with high titer ( 25 ). The docking of scFv-VP2 shows that there were 13 antigen-binding sites on scFv, with high binding force to VP2. According to Residues Contact Frequency (RCF) algorithm analysis, 37 binding amino acids on scFv and 40 binding amino acids on VP2 were involved in the binding (Fig. 8 ), these results provide us confidence that a well-designed CPV-VLP can be used as a potent immunogen to induce qualified specific antibodies. In Conclusion, we demonstrated that specific IgY-scFv can be generated with high specificity and significant inhibition to CPV growth. As a preliminary evaluation, our work revealed the potential of IgY-scFv as a novel approach in veterinary diagnosis and therapy. Abbreviations CPV canine parvovirus; VLP:virus-like particles; scFv:single chain fragment variables; ICA:immunochromatographic assay; CDV:canine distemper virus; CCV:coronavirus; IgG:immune serum; mAbs:monoclonal antibody; IgY-scFv:Chicken IgY single chain variable fragments; IPTG:isopropyl-β-D-thiogalactopyranoside Declarations Acknowledgements Dr. XY Zhang acknowledges the adjunct position and supports offered by the University of Guelph, Canada. Funding This work was finically supported by the grand of China Natural Science Foundation (31873006, 31572556) and the Incubation Project on State Key Laboratory of Biological Resources and Ecological Environment of Qinba Areas (SLGPT2019KF04-04). Availability of data and materials All data supporting our findings are included in the manuscript. Authors’ contributions XYZ, FGZ and SKG conceived this project. SKG, LX and BL performed the experiments. SKG, LX and XYZ wrote the manuscript. All authors read and approved this manuscript. Ethics approval and consent to participate Not applicable. Consent for publication Not applicable. Competing interests The authors declare that they have no competing interests. References Thomson GW, Gagnon AN. Canine gastroenteritis associated with a parvovirus-like agent. The Canadian veterinary journal = La revue veterinaire canadienne. 1978;19(12):346. Tsao J, Chapman M, Agbandje M, Keller W, Smith K, Wu H, et al. The Three-Dimensional Structure of Canine Parvovirus and Its Functional Implications. 251. New York: Science; 1991. pp. 1456–64. Hu J-J, Zhang X, Han S-Z, Zhao J-Z, Tian Z-H. A Survey of Diagnosis and Treatment of Pet Canine Parvovirus Disease in China. Journal of Animal Veterinary Advances. 2011;10:2058–60. Braganza A, Wallace K, Pell L, Parrish CR, Siegel DL, Mason NJ. Generation and validation of canine single chain variable fragment phage display libraries. Vet Immunol Immunopathol. 2011;139(1):27–40. Kotlan B, Glassy MC. Antibody phage display: overview of a powerful technology that has quickly translated to the clinic. Methods in molecular biology (Clifton NJ). 2009;562:1–15. Ma H, O'Kennedy R. Recombinant antibody fragment production. Methods (San Diego, Calif). 2017;116:23–33. Schade R, Zhang X, Horacio Raúl T. Use of IgY Antibodies in Human and Veterinary Medicine. 252007. p. 213–22. Han S, Zhang X, Zhao J. Production of Egg Yolk Antibody (IgY) against Recombinant Canine Parvovirus VP2 Protein. Acta Scientiae Veterinariae. 2012;40. Zhang X, Chen H, Tian Z, Chen S, Schade R. Chicken monoclonal IgY antibody: a novel antibody development strategy. Avian Biol Res. 2010;3(3):97–106. Lee W, Syed Atif A, Tan SC, Leow CH. Insights into the chicken IgY with emphasis on the generation and applications of chicken recombinant monoclonal antibodies. J Immunol Methods. 2017;447:71–85. Indran IR, Liang RLZ, Min TE, Yong E-L. Preclinical studies and clinical evaluation of compounds from the genus Epimedium for osteoporosis and bone health. Pharmacology and Therapeutics. 2016;162. Chen HX, He F, Sun Y, Luo Y, Qiu HJ, Zhang XY, et al. Generation and characterization of chicken-sourced single-chain variable fragments (scFvs) against porcine interferon-gamma (pIFN-gamma). J Immunoass Immunochem. 2015;36(1):27–44. Xu J, Guo HC, Wei YQ, Dong H, Han SC, Ao D, et al. Self-assembly of virus-like particles of canine parvovirus capsid protein expressed from Escherichia coli and application as virus-like particle vaccine. Appl Microbiol Biotechnol. 2014;98(8):3529–38. Hansel T, Kropshofer H, Singer T, Mitchell J, George A. The safety and side effects of monoclonal antibodies. Nature reviews Drug discovery. 2010;9:325–38. Dimitrov DS. Therapeutic antibodies, vaccines and antibodyomes. mAbs. 2010;2(3):347–56. Dal Ferro M, Rizzo S, Rizzo E, Marano F, Luisi I, Tarasiuk O, et al. Phage Display Technology for Human Monoclonal Antibodies. Methods in molecular biology (Clifton, NJ). 2019;1904:319 – 38. Supuran CT. Agents for the prevention and treatment of age-related macular degeneration and macular edema: a literature and patent review. Expert Opin Ther Pat. 2019;29(10):761–7. Lee CH, Lee YC, Lee YL, Leu SJ, Lin LT, Chen CC, et al. Single Chain Antibody Fragment against Venom from the Snake Daboia russelii formosensis. Toxins. 2017;9(11). Schade R, Calzado EG, Sarmiento R, Chacana PA, Porankiewicz-Asplund J, Terzolo HR. Chicken egg yolk antibodies (IgY-technology): a review of progress in production and use in research and human and veterinary medicine. Alternatives to laboratory animals: ATLA. 2005;33(2):129–54. Pereira EPV, van Tilburg MF, Florean E, Guedes MIF. Egg yolk antibodies (IgY) and their applications in human and veterinary health: A review. Int Immunopharmacol. 2019;73:293–303. Sheng L, He Z, Chen J, Liu Y, Ma M, Cai Z. The impact of N-glycosylation on conformation and stability of immunoglobulin Y from egg yolk. Int J Biol Macromol. 2017;96:129–36. Gilgunn S, Millan S, Wormald M, Zapatero Rodríguez J, Conroy P, O’Kennedy R, et al. Comprehensive N-Glycan Profiling of Avian Immunoglobulin Y. PLOS ONE. 2016;11:e0159859. Waldmann H. Human Monoclonal Antibodies: The Benefits of Humanization. Methods in molecular biology. (Clifton NJ). 2019;1904:1–10. Choi J, Kim M, Lee J, Seo Y, Ham Y, Lee J, et al. Antigen-binding affinity and thermostability of chimeric mouse-chicken IgY and mouse-human IgG antibodies with identical variable domains. Sci Rep. 2019;9(1):19242. Jain NK, Sahni N, Kumru OS, Joshi SB, Volkin DB, Russell Middaugh C. Formulation and stabilization of recombinant protein based virus-like particle vaccines. Adv Drug Deliv Rev. 2015;93:42–55. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-28773","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research","associatedPublications":[],"authors":[{"id":575864,"identity":"cc383caf-28c9-4668-b6f0-2f50859ff08e","order_by":1,"name":"Shikun Ge","email":"","orcid":"","institution":"\"Universidade do Minho\"","correspondingAuthor":false,"prefix":"","firstName":"Shikun","middleName":"","lastName":"Ge","suffix":""},{"id":575865,"identity":"9f3db917-d276-4996-81f0-07fb2fc447fa","order_by":2,"name":"Long Xu","email":"","orcid":"","institution":"\"Universidade do Minho\"","correspondingAuthor":false,"prefix":"","firstName":"Long","middleName":"","lastName":"Xu","suffix":""},{"id":575866,"identity":"15f1282e-db6e-4265-a5dc-8f111d1f126c","order_by":3,"name":"Ben Li","email":"","orcid":"","institution":"Shannxi University of Technology","correspondingAuthor":false,"prefix":"","firstName":"Ben","middleName":"","lastName":"Li","suffix":""},{"id":575867,"identity":"47da61ed-2cbb-4baa-908d-c450255fffc1","order_by":4,"name":"Fagang Zhong","email":"","orcid":"","institution":"Xinjiang Academy of Environmental Protection Science","correspondingAuthor":false,"prefix":"","firstName":"Fagang","middleName":"","lastName":"Zhong","suffix":""},{"id":575868,"identity":"bf760ca5-c84b-477a-983d-0a5e33cf31ad","order_by":5,"name":"XiaoYing Zhang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAz0lEQVRIiWNgGAWjYDACCRBRcYAHzElgOECsljMoWpiJ0MLYBjecCC3ys5ufPfw6744MPwOP6YaHO+7IMUj343cd45xj5say257xSDbwmN1IPPPMmEHmMH5bmCUSzKQltx3mMTgA0tJ2OLFBIhm/FjaJ9G/SknNI0cIjkWMm+bGBFC0SEjll0gzHgH5pZisDaTFmkzlsgFeL/Iz0bZI/au7Y87M3b7v5s+2wHL904wP81gABMzgeYbHBJkFQAzCgf6C6lQgto2AUjIJRMKIAAEMXRdIFIH3UAAAAAElFTkSuQmCC","orcid":"","institution":"\"Universidade do Minho\"","correspondingAuthor":true,"prefix":"","firstName":"XiaoYing","middleName":"","lastName":"Zhang","suffix":""}],"badges":[],"createdAt":"2020-05-14 06:53:44","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-28773/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-28773/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":13504805,"identity":"56112f09-b06e-4b41-9530-b0a2ede1c67e","added_by":"auto","created_at":"2021-09-16 23:24:36","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":403412,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-28773/v1/5c455d49-d588-48bb-a963-a045da3951d8.pdf"}],"financialInterests":"","formattedTitle":"\u003cp\u003eGeneration and Evaluation of Chicken IgY-scFv for the Purposes of CPV Diagnosis and Therapy\u003c/p\u003e","fulltext":[{"header":"Background","content":" \u003cp\u003eCanine parvovirus (CPV) was first identified in 1978 (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e); it has a single-stranded DNA genome of negative polarity, about 5200\u0026nbsp;bp in length. The CPV capsid is a 25\u0026nbsp;nm diameter icosahedron containing three structural viral proteins (VP1, VP2 and VP3) and two non-structural proteins (NS1 and NS2), among them, VP2 accounts for 90% of the viral capsid and represents the major determinant of host range and virus-host interactions (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). Although the conventional attenuated and inactivated CPV vaccines have been successful in reducing the disease outbreaks, the genus of parvovirus still causes severe epizootics worldwide and leads to severe economic losses in dogs (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAntibody based approach is promising in CPV disease diagnosis, therapy and prevention, and the relevant hyper immune serum (IgG) and full-length monoclonal antibody (mAbs) have been routinely applied in the veterinary practices (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e). At present, most commercially available mAbs are produced in mammalian system using hybridoma technology. Functional antibody fragments (i.e.: scFv, Fab) generated by phage-display technology have been not yet routinely evaluated and applied in the veterinary medicine despite it has been well confirmed that such engineered antibodies offer a series of advantages over polyclonal and full-length monoclonal antibodies. Antibody phage display technology is to display polyclonal antibodies on the surface of the phage shell protein and to screen the specific monoclonal antibodies by bio-panning procedure (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e). Phages are more stable and can be stored for years at 4℃; it can be re-produced rapidly, successively and inexpensively with a confirmed sequence in the prokaryote or eukaryote systems without hybridoma and immunization procedure. Furthermore, higher affinity mutants of scFv can be generated through site directed mutagenesis which is much easier and simpler to be performed (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eChicken (\u003cem\u003eGallus domesticus\u003c/em\u003e) IgY antibody generated by IgY technology is another conventional approach in generating large amount of high specific antibody and have been used for broad biomedical purposes owning to a series of advantages such as higher productivity, better animal welfare, higher immunogenicity to mammal conserved proteins and lower cross-reactivity, as compared to the generation and application of mammalian serum IgG (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e). Our previous work confirmed that the generated polyclonal IgY targeted to CPV-VP2 could applied into the immunotherapy and immunoprophylaxis for the CPV infection (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). In recent years, as an interesting tendency in IgY technology, generation of IgY-scFv in order to better combine the biological superiorities of both IgY and recombinant antibody fragment, is gaining increasing attention and application (\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e). Our previous studies demonstrated that IgY-scFv can be generated and applied in different immunoassays for the detection of small molecules gentamicin (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e) and large molecules pIFN-γ (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e) in the veterinary practice.\u003c/p\u003e \u003cp\u003eAs an attempt to understand the feasibility of chicken IgY-scFv in diagnosis and therapy of veterinary diseases, this study aimed to construct and characterize chicken sourced scFv against CPV-VP2 virus like particles (VLP) using phage display technology, and to evaluate the specificity, sensitivity and virus inhibition ability of the obtained scFv.\u003c/p\u003e "},{"header":"Methods","content":" \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eImmunization of chicken\u003c/h2\u003e \u003cp\u003eTwelve-week old white Leghorn hens were immunized intramuscularly with CPV-VLP (provided by Dr. Shiqi Sun (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e)) mixed with Freund\u0026rsquo;s adjuvant (Sigma-Aldrich, St. Louis, MO, USA) at four different sites of breast muscles. CPV-VLP protein (125\u0026nbsp;\u0026micro;L, 2\u0026nbsp;mg/mL) in equal volume of phosphate buffered solution (PBS, 0.01\u0026nbsp;M, pH 7.4) was emulsified with Freund\u0026rsquo;s complete adjuvant (FCA; Sigma-Aldrich, St. Louis, MO, USA) in the first immunization, and four booster immunizations were followed up using Freund\u0026rsquo;s incomplete adjuvant (FIA; Sigma-Aldrich, St. Louis, MO, USA) at 2-week intervals. All experimental animal protocols were reviewed and approved by the institutional Ethics Committee for the use of laboratory animals.\u003c/p\u003e \u003c/div\u003e \n\u003ch2\u003eConstruction Of Anti-cpv-vlp Scfv\u003c/h2\u003e\n \u003cp\u003eThe hen\u0026rsquo;s spleen was collected to extract the total RNA using Total RNA Kit (Tiangen Biotech, Beijing, China), and the first-strand cDNA was synthesized using HiScript Q Select RT SuperMix for PCR (+\u0026thinsp;gDNA wiper, Vazyme Biotech, Nanjing, China). The heavy variable fragment (V\u003csub\u003eH\u003c/sub\u003e) and light chain variable fragment (V\u003csub\u003eL\u003c/sub\u003e) genes were amplified by PCR with primers (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The V\u003csub\u003eH\u003c/sub\u003e and V\u003csub\u003eL\u003c/sub\u003e were assembled using primers HF-\u003cem\u003eEco\u003c/em\u003eR I \u0026amp; LR-\u003cem\u003eHin\u003c/em\u003ed III by Overlap PCR. The products of overlap PCR (scFv) were purified through Gel Extraction Kit (Omega, Norcross, GA, USA).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers used for PCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eName\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer sequences (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eApplication\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHF-\u003cem\u003eEco\u003c/em\u003eR I\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCG\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eGAATTC\u003c/span\u003eGGCCGTGACGTTGGACG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eV\u003csub\u003eH\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eHR-Linker\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAGAGCCACCTCCGCCTGAACCGCCTCCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eV\u003csub\u003eH\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCGGAGGAGACGATGAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eLF-Linker\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTCAGGCGGAGGTGGCTCTGGCGGTGGCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eV\u003csub\u003eL\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGATCGGCGCTGACTCAGCCGTCCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLR-\u003cem\u003eHin\u003c/em\u003ed III\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAT\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eAAGCTT\u003c/span\u003eACCTAGGACGGTCAGGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eV\u003csub\u003eL\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \n\u003ch2\u003eConstruction Of Library\u003c/h2\u003e\n \u003cp\u003eThe scFv gene products were digested with \u003cem\u003eEco\u003c/em\u003eR I and \u003cem\u003eHin\u003c/em\u003ed III restriction enzyme and ligated to T7 select 10-3b (0.04\u0026nbsp;pmol; Novagen, Darmstadt, Germany) using T4 DNA Ligase (TaKaRa Biotechnology, Dalian, China) in a working volume of 5\u0026nbsp;\u0026micro;L at 16℃ overnight. The ligation products were directly added to T7 packaging extract (25\u0026nbsp;\u0026micro;L) and the mixtures were incubated at 22℃ for 2\u0026nbsp;h \u003cem\u003ein vitro\u003c/em\u003e packaging to create the primary library by adding LB medium (270\u0026nbsp;\u0026micro;L) to stop the reaction. The primary scFv library was amplified by liquid lysate amplification according to the T7 select system manual. The titers of the primary and amplified library were evaluated by plaque assay.\u003c/p\u003e \n\u003ch2\u003eBio Panning\u003c/h2\u003e\n \u003cp\u003eThe amplified library was subjected to four rounds of bio panning on microplates for the enrichment of the specific scFv phages according to the T7 select system manual. The microplates were coated with CPV-VLP overnight (15\u0026nbsp;\u0026micro;g, 10\u0026nbsp;\u0026micro;g, 8\u0026nbsp;\u0026micro;g and 5\u0026nbsp;\u0026micro;g per well in each round) at 4℃, and washed with Tween-PBS (PBST, tween 0.5%; 150\u0026nbsp;\u0026micro;L/well) and PBS, respectively. After blocked with skimmed milk (5%) in PBST, the amplified phages from the starting library of each round of panning were added to the microplates and incubated at 37℃ for 1\u0026nbsp;h, and the bound phage was eluted with SDS (1%) in each round. In the first three rounds, eluted phages were amplified by infecting BL5403 bacterial culture (Novagen, Darmstadt, Germany). The enrichment of specificity was determined from the input/output ration of the phage. A total of random clones of 100 on the plates were selected from the fourth round to identify the positive rate using a pair of universal primers (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The amplified library was added with 1% chloroform and stored at 4℃.\u003c/p\u003e \n\u003ch2\u003eExpression And Purification Of Scfv\u003c/h2\u003e\n \u003cp\u003eAfter sequencing, the phage-scFv with the highest binding force was selected to ligate with pET-30a (+) vector using T4 DNA Ligase (TaKaRa Biotech, Dalian, China). The recombinant plasmids were transformed into BL21 (DE3) competent cells, and the scFv expression was induced with isopropyl-β-D-thiogalactopyranoside (IPTG). The bacterial cells were collected by centrifugation and sonication, and the supernatants and pellets were used for SDS-PAGE analysis, respectively. Protein was purified by HisTrap HP histidine-tagged protein cultured columns (GE, Pittsburgh, PA, USA).\u003c/p\u003e \n\u003ch2\u003eIdentification Of Scfv\u003c/h2\u003e\n \u003cp\u003eThe CPV-VP2 proteins were separated by SDS-PAGE (5% stacking and 12% resolving) and blotted on nitrocellulose membranes (Schleicher \u0026amp; Schuell, Atlanta, GA, USA). Membranes were blocked with 5% (w/v) nonfat dry milk (NDM) in Tris-buffered saline-Tween (TBS-T) at room temperature (RT) for 30\u0026nbsp;min. Membranes were incubated with 12.5\u0026nbsp;mL TBS-T containing 1% NDM and 5\u0026nbsp;\u0026micro;g prepared scFv proteins at RT under agitation for 1\u0026nbsp;h. Membranes were washed three times for 10\u0026nbsp;min in TBS-T, and incubated with 12.5\u0026nbsp;mL TBS-T containing 1% NDM and mouse anti-His monoclonal antibody conjugated with HRP (1:5000; CWBio, Beijing, China) at RT under agitation for 30\u0026nbsp;min. Membranes were washed three times for 15\u0026nbsp;min in TBS-T, and developed using DAB chromogenic solution detection reagents (Boster, Wuhan, China).\u003c/p\u003e \n\u003ch2\u003eAnalysis On Scfv Sensitivity By Elisa\u003c/h2\u003e\n \u003cp\u003eThe wells of a 96-well Maxisorp microtiter plate (Nunc, Roskilde, Denmark) were coated with different amounts of CPV-VP2 (0, 0.2, 0.5, 2, 6, 8, 10\u0026nbsp;ng/\u0026micro;L) dissolved in carbonate buffer (15\u0026nbsp;mM Na\u003csub\u003e2\u003c/sub\u003eCO\u003csub\u003e3\u003c/sub\u003e, 35\u0026nbsp;mM NaHCO\u003csub\u003e3\u003c/sub\u003e, 0.001% phenol-red, pH 9.6) and incubated over night at 4℃. The wells were rinsed with PBST and incubated with scFv protein (different amount) diluted in PBST for 1\u0026nbsp;h. The wells were rinsed with PBST (3\u0026thinsp;\u0026times;\u0026thinsp;5\u0026nbsp;min) and incubated 1\u0026nbsp;h with mouse anti-His monoclonal antibody conjugated with HRP (1:5000; CWBio, Beijing, China) followed by three washes with PBST buffer (5\u0026nbsp;min each). The color will be developed using 3, 3\u0026prime;, 5, 5\u0026prime; tetramethylbenzidine (TMB; Promega Biotech, Beijing, China) for 10\u0026nbsp;min and the absorbance was read at 450\u0026nbsp;nm.\u003c/p\u003e \n\u003ch2\u003eDetection Of Clinical Samples\u003c/h2\u003e\n \u003cp\u003eTo determine the accuracy of scFv, a total of 28 clinical dog stool samples were collected using sterile swabs in an animal hospital (Xinger, Xi\u0026rsquo;an, China). Among them, 24 samples were confirmed CPV positive and 4 were negative by the hospital using commercial colloidal gold test strip (ICA). The samples were homogenized (10%, w/v) in PBS (1\u0026nbsp;mL, pH 7.2) and centrifuged, the supernatants were used for indirect ELISA and PCR. In order to verify whether scFv has specificity in clinical practice detection, Canine distemper virus (CDV) and coronavirus (CCV) were used to detect the cross-reaction by ELISA.\u003c/p\u003e \n\u003ch2\u003eIndirect Immunofluorescence Assay (ifa)\u003c/h2\u003e\n \u003cp\u003eThe CRFK cells (LMAI Bio, Shanghai, China) were seeded into 6-well plates and pcMV-3-scFv were transfected when the cell density reached 70%. At 48\u0026nbsp;h post-transfection, the cells were fixed with paraformaldehyde (4%), permeabilized with Triton X-100 (0.5%) and incubated with BSA (Beyotime, Shanghai, China) to block nonspecific binding sites. They were then incubated with diluted His-tag antibody (100\u0026nbsp;\u0026micro;L; Affinity Biosciences, OH, USA) for 2\u0026nbsp;h. After PBS washing, Goat anti-Mouse IgG (H\u0026thinsp;+\u0026thinsp;L) Fluor 594-conjugated (Affinity Biosciences, OH, USA) was added. The stained cells were visualized by using a Nikon Eclipse 80i fluorescence microscope (Nikon, Sendai, Japan). Total protein of the cells transfected 48\u0026nbsp;h were extracted for western blot; His-tag antibody and Goat anti-Mouse IgG HRP (Biosharp, Hefei, China) were used as primary and secondary antibodies, respectively.\u003c/p\u003e \n\u003ch2\u003eMeasurement Of Virus Growth Curve\u003c/h2\u003e\n \u003cp\u003eNormal CRFK cells (10\u003csup\u003e5\u003c/sup\u003e/mL) were seeded into 96-well plates, and the virus infection was performed when the cell density reached 70%. The original virus solution was serially diluted in 10-fold, added to a 96-well plate, 10 gradients, and 8 wells were repeated for each gradient. The 96-well plate was placed in 37℃ with 5% CO\u003csub\u003e2\u003c/sub\u003e incubator, and the tissue culture infective dose (TCID\u003csub\u003e50\u003c/sub\u003e) was determined after the number of pathological wells was fixed.\u003c/p\u003e \u003cp\u003eTransfected cells and normal cells were seeded into 96-well plates, and the cells were infected with CPV (CPV-HY strain offered by Century Yuanheng Animal Epidemic Prevention Technology Co., Ltd., Beijing, China) in 0.1 MOI. After 1\u0026nbsp;h, the supernatant virus solution was removed and replaced with a cell maintenance solution. The cell supernatants were collected at 2\u0026nbsp;h, 4\u0026nbsp;h, 8\u0026nbsp;h, 12\u0026nbsp;h, 24\u0026nbsp;h, 36\u0026nbsp;h, 48\u0026nbsp;h, 60\u0026nbsp;h, 72\u0026nbsp;h and 84\u0026nbsp;h, respectively, and the TCID\u003csub\u003e50\u003c/sub\u003e values of each time point were measured to plot the growth curve.\u003c/p\u003e \n\u003ch2\u003eScfv-vp2 Docking\u003c/h2\u003e\n \u003cp\u003eDocking was performed using Discovery Studio 4.5 software (BIOVIA, San Diego, CA, USA) and the Antibody Modeling Cascade program in Discovery Studio software was used to build the molecular model of the scFv. Then, to obtain the docking conformation, the scFv molecular model was docked with VP2 using the ZDock molecular docking program. Finally, the Residues Contact Frequency (RCF) algorithm was used to analyze the predicted results, and the binding surfaces of amino acids in scFv and VP2 were obtained.\u003c/p\u003e "},{"header":"Results","content":" \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eConstruction of scFv library\u003c/h2\u003e \u003cp\u003eThe lengths of VH-linker, VL-linker and scFv were approximately 370\u0026nbsp;bp, 420\u0026nbsp;bp and 800\u0026nbsp;bp, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA and B). The titer of the primary anti-CPV scFv library (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC) and the amplified library were 1.5\u0026thinsp;\u0026times;\u0026thinsp;10\u003csup\u003e6\u003c/sup\u003e pfu/mL, and 8.2\u0026thinsp;\u0026times;\u0026thinsp;10\u003csup\u003e11\u003c/sup\u003e pfu/mL, respectively. There were 95% of the phages containing the target fragments in the primary scFv library.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eNotes: A\u003c/b\u003e: PCR products of VL (370\u0026nbsp;bp, lane 1 and 2) and VH (420\u0026nbsp;bp, lane 3 and 4); \u003cb\u003eB\u003c/b\u003e: PCR products of scFv, 800\u0026nbsp;bp (lane 1). M: marker; \u003cb\u003eC\u003c/b\u003e: schematic diagram of scFv construction.\u003c/p\u003e \u003c/div\u003e \n\u003ch2\u003eScreening Of Scfv Phage Library\u003c/h2\u003e\n \u003cp\u003eAfter 4 rounds of \"bind-elute-amplify\" bio-panning procedure, the data of input and output phages in each round indicated that the phage library had been enriched 100 times (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e and Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). A total of 15 scFv genes showed relatively high binding capacity to CPV-VLP in the reactivity detection of 100 phages, and the sequencing confirmed that all the 15 scFv genes have complementary determining region 3 (CDR3) that was the main mutation region in both VH and VL. There were few clones having limited mutations in framework region (FR, Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). The phage-scFv (No. 96) showed the highest binding force was chosen for further experiments.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eLibrary size and phage titer of each panning\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRound\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCoating concentration (per well)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eInput\u003c/p\u003e \u003cp\u003e(pfu/mL)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eOutput\u003c/p\u003e \u003cp\u003e(pfu/mL)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eAmplification library (pfu/mL)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e15\u0026nbsp;\u0026micro;g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026times;\" colname=\"c3\"\u003e \u003cp\u003e1\u0026thinsp;\u0026times;\u0026thinsp;10\u003csup\u003e12\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026times;\" colname=\"c4\"\u003e \u003cp\u003e7.2\u0026thinsp;\u0026times;\u0026thinsp;10\u003csup\u003e6\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4.95\u0026thinsp;\u0026times;\u0026thinsp;10\u003csup\u003e12\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e10\u0026nbsp;\u0026micro;g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026times;\" colname=\"c3\"\u003e \u003cp\u003e1\u0026thinsp;\u0026times;\u0026thinsp;10\u003csup\u003e11\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026times;\" colname=\"c4\"\u003e \u003cp\u003e4.64\u0026thinsp;\u0026times;\u0026thinsp;10\u003csup\u003e7\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.31\u0026thinsp;\u0026times;\u0026thinsp;10\u003csup\u003e13\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e8\u0026nbsp;\u0026micro;g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026times;\" colname=\"c3\"\u003e \u003cp\u003e1\u0026thinsp;\u0026times;\u0026thinsp;10\u003csup\u003e11\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026times;\" colname=\"c4\"\u003e \u003cp\u003e8.8\u0026thinsp;\u0026times;\u0026thinsp;10\u003csup\u003e8\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.8\u0026thinsp;\u0026times;\u0026thinsp;10\u003csup\u003e12\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026nbsp;\u0026micro;g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026times;\" colname=\"c3\"\u003e \u003cp\u003e1\u0026thinsp;\u0026times;\u0026thinsp;10\u003csup\u003e11\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026times;\" colname=\"c4\"\u003e \u003cp\u003e1.52\u0026thinsp;\u0026times;\u0026thinsp;10\u003csup\u003e8\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e--\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eNote\u003c/strong\u003e \u003cp\u003eThe yellow markers represented the same sequences.\u003c/p\u003e \u003c/p\u003e \u003ch2\u003eScfv Expression And Purification\u003c/h2\u003e\n \u003cp\u003eThe solubility analysis showed that scFv mainly existed in the form of inclusion body (38\u0026nbsp;kDa; Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, lane 2). The denaturation and purification of scFv inclusion body protein showed a single protein band with high purity (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). The VP2 protein could bind to scFv with a single binding strip (85\u0026nbsp;kDa; Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eNotes: A\u003c/b\u003e: lane 1, \u003cem\u003eE. coli\u003c/em\u003e supernatant; lane 2, \u003cem\u003eE. coli\u003c/em\u003e precipitation; \u003cb\u003eB\u003c/b\u003e: lane 1, the renaturation of scFv protein; \u003cb\u003eC\u003c/b\u003e: lane 1, antigen was CPV-VP2 protein, incubated with primary antibody scFv.\u003c/p\u003e \n\u003ch2\u003eScfv Sensitivity Analysis\u003c/h2\u003e\n \u003cp\u003eThe immunoreactivity of scFv against soluble VP2 was examined by ELISA. scFv bound in a dose-dependent manner to the soluble VP2 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). The minimum antibody concentration for the detected antigen was 2\u0026nbsp;ng/\u0026micro;L.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eNotes\u003c/strong\u003e \u003cp\u003escFv in different concentrations were added to 96-well plates coated with soluble VP2 in different concentrations (0, 0.2, 0.5, 2, 6, 8, 10\u0026nbsp;ng/\u0026micro;L). Binding was detected with mouse anti-His monoclonal antibody conjugated with HRP. The binding activity was measured as absorbance at 450\u0026nbsp;nm produced by peroxidase. Data of each point represented as Mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD of triplicate.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eSpecificity and cross-reactivity of IgY-scFv in CPV clinical sample tests\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe coincidence of ELISA (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA) and PCR (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC) with ICA (data not show) was 100% and 85.7%, respectively. The scFv showed no cross reactivity with CDV and CCV (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eNotes\u003c/strong\u003e \u003cp\u003eClinical samples of CPV were analyzed by ELISA (A), PCR (C) and ICA (data not shown); the cross reactivities of anti-CPV-IgY-scFv with CDV and CCV were analyzed by ELISA (B). CPV was CPV-HY strain; VP2 was expressed in the prokaryotic system.\u003c/p\u003e \u003c/p\u003e \u003ch2\u003eNeutralization Effect Of Scfv To Cpv In Crfk Cells\u003c/h2\u003e\n \u003cp\u003eThe sequencing results showed that the scFv and pcMV-3 vectors were successfully connected (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA), IFA confirmed that scFv was significantly expressed in CRFK cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB). Immunoblotting further confirmed that the scFv protein was correctly folded and modified in the cell (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC). The CRFK cells expressing scFv showed a small amount of cytopathic effect (CPE) after CPV infection; the cells without scFv expression were broke away significantly from the bottom wall, became round, and some cells even broke up (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD). Virus TCID\u003csub\u003e50\u003c/sub\u003e at different time points was determined; the growth rate of virus in cells expressing scFv was significantly lower than that in cells not expressing scFv (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eE). The inhibition rates of scFv on virus growth at 24\u0026nbsp;h, 48\u0026nbsp;h, and 72\u0026nbsp;h were 55%, 38% and 30%, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eF).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eNotes: A\u003c/b\u003e, scFv gene was ligated pcMV-3 vector mode. \u003cb\u003eB\u003c/b\u003e, control: CRFK cells of pcMV-3 without scFv, scFv: CRFK cells of pcMV-3 with scFv, DAPI: staining nuclei. \u003cb\u003eC\u003c/b\u003e, western blot detection scFv transfected CRFK cells, control represent empty pcMV-3 transfected CRFK cells. \u003cb\u003eD\u003c/b\u003e, after transfecting the cells with scFv for 24\u0026nbsp;h, the cells were infected with CPV (MOI\u0026thinsp;=\u0026thinsp;0.1). \u003cb\u003eE\u003c/b\u003e, growth curve of CPV in CRFK cells with scFv and without scFv expression. \u003cb\u003eF\u003c/b\u003e, The proportion of TCID50 of virus in different cell treatment groups (scFv group and without scFv group) at different time points.\u003c/p\u003e \u003ch2\u003eThe Binding Sides Of The Scfv-vp2\u003c/h2\u003e\n \u003cp\u003eThe main structural domains of scFv were VLCDR1, VLCDR2, VLDR3, VHCDR1, VHDCR2, and VHCDR3, with 13 antigen-binding sites on scFv (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA). The 3 dimensional scFv model was subsequently constructed (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB). A total of 5 highly similar VP2 homologous sequences were simulated by software (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eC), the VP2 molecular stereo model was established by combining the characteristics of each sequence (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eD). After analysis on ScFv and VP2 binding mode (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eE), the interacting amino acids at the binding sides of scFv (AA37) and VP2 (AA40) were confirmed (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eF and \u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eG).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eNotes\u003c/b\u003e: All docking analysis were performed by Discovery Studio software. ScFv modeling: Antibody Modeling Cascade program; VP2 modeling: Build Homology Models program; Docking: ZDock program.\u003c/p\u003e "},{"header":"Discussion","content":" \u003cp\u003eThe mAbs have been widely applied in the biomedical areas owning to their high specificity and homogeneity. However, mAbs produced by mammals may have the side effects of immunogenicity, thrombocytopenia and hypersensitivity reactions, etc, which has greatly limited the application of mAbs in target detection and treatment (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e). With the development of antibody library technology and humanized antibody modification technology, increasing humanized recombinant antibodies have been gradually developed and entered the clinic trials (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e). Diversified antibody generation strategies could be a future tendency in antibody engineering in order to better combine the characteristics and advantages of antibodies from different sources. As a notable example, Brolucizumab (Beovu) is the first FDA approved rabbit-derived scFv used as vascular endothelial growth factor (VEGF) inhibitor for the treatment of exudative (wet) age-related macular degeneration (AMD), diabetic macular oedema and macular oedema secondary to retinal vein occlusion, which could better overcome the possible side effects (discomfort and increased tears in the affected eyes, itchy or watery eyes, dry eyes, swelling of the eyelids, etc.) of murine-derived IgG-Fab fragment (Lucentis) (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e). In avian IgY, similar attempts have also been made. For instance, the snake venom contains neurotoxic proteins, the urgent administration of hyperimmune serum from horse used to be the most efficient treatment, which can recognize many different antigenic determinants. However, generation of equine anti- venom is costly and associated with several potential side effects. Chicken IgY-scFv has been generated against glutaraldehyde-attenuated \u003cem\u003eDaboia russelii formosensis\u003c/em\u003e (DRF) venom proteins for passive immunization, which can identify and neutralize the toxic activity of the venom components, with only small quantity of antigens required to induce a significant antibody response in hens, and can be also used as a rapid diagnostic tool for wound secretions to determine snake types (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAs summarized by previous authors, owning to the unique structure, phylogenetic distance and the mechanism of molecular diversification, IgY antibodies provide a series of important advantages over mammal IgG, including the stronger immune responses of chicken system to the proteins conserved among mammals, decreased/avoid cross-reactivities (ie.: rheumatoid factor, human anti-mouse IgG antibody, complement system, Fc receptors) in the mammal systems (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e), and more convenient to design a primer against IgY-scFv (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), as IgY only has one isotype and it is lack of hinge region (\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e). Furthermore, it is noteworthy to address, recent studies confirm that from the glycobiology point of view, recombinant IgY antibody could be a potentially promising immune-therapeutic candidate after proper antibody engineering and expression as IgY is more heavily glycosylated (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e), and has higher sialic acid content (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e) as compared to mammal IgG. Recombinant functional antibody fragments remove or reduce irrelevant structures, while retain the specificity and main biological activities of natural antibodies, which offers a wider application prospect than natural antibodies (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e). Recombinant IgY-scFv could combine the advantages of both IgY molecular and functional antibody fragment (\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eDesigning on chimeric antibody could be the next step for IgY-scFv study in order to provide better compatibility of the antibody in the host system, and to recoup the possibly decreased specificity and affinity of antibody fragments as compared to full length antibody. Recent study confirmed that mammalian IgG and avian IgY shared compatible V-C region interfaces, which may be conducive for the design and utilization of mammalian-avian chimeric Abs (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn our study, the high consistency of ELISA analysis to PCR and ICA on clinical samples confirmed the specificity of the obtained IgY-scFv (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e), which offers the potential using IgY-scFv for rapid detection of CPV. scFv neutralized the virus (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD), inhibited CPV replication with significantly reduced growth rates of the CPV observed in the CRFK cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eE, F), which provides the value of further therapeutic investigation of obtained IgY-scFv.\u003c/p\u003e \u003cp\u003eAs alternative to viral components, CPV-VP2-VLP was used as immunogen in this study. With increasing applications in vaccine design and immunization, VLP has been recognized as safe and effective particle to stimulate adequate immune responses for both viral and non-viral diseases by inducing lymphocyte proliferation and specific antibody with high titer (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e). The docking of scFv-VP2 shows that there were 13 antigen-binding sites on scFv, with high binding force to VP2. According to Residues Contact Frequency (RCF) algorithm analysis, 37 binding amino acids on scFv and 40 binding amino acids on VP2 were involved in the binding (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e), these results provide us confidence that a well-designed CPV-VLP can be used as a potent immunogen to induce qualified specific antibodies.\u003c/p\u003e \u003cp\u003eIn Conclusion, we demonstrated that specific IgY-scFv can be generated with high specificity and significant inhibition to CPV growth. As a preliminary evaluation, our work revealed the potential of IgY-scFv as a novel approach in veterinary diagnosis and therapy.\u003c/p\u003e "},{"header":"Abbreviations","content":" \u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eCPV\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ecanine parvovirus; VLP:virus-like particles; scFv:single chain fragment variables; ICA:immunochromatographic assay; CDV:canine distemper virus; CCV:coronavirus; IgG:immune serum; mAbs:monoclonal antibody; IgY-scFv:Chicken IgY single chain variable fragments; IPTG:isopropyl-β-D-thiogalactopyranoside\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e "},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDr. XY Zhang acknowledges the adjunct position and supports offered by the University of Guelph, Canada.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was finically supported by the grand of China Natural Science Foundation (31873006, 31572556) and the Incubation Project on State Key Laboratory of Biological Resources and Ecological Environment of Qinba Areas (SLGPT2019KF04-04).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data supporting our findings are included in the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eXYZ,\u0026nbsp;FGZ\u0026nbsp;and\u0026nbsp;SKG\u0026nbsp;conceived\u0026nbsp;this\u0026nbsp;project.\u0026nbsp;SKG,\u0026nbsp;LX\u0026nbsp;and\u0026nbsp;BL\u0026nbsp;performed\u0026nbsp;the\u0026nbsp;experiments.\u0026nbsp;SKG,\u0026nbsp;LX\u0026nbsp;and\u0026nbsp;XYZ\u0026nbsp;wrote\u0026nbsp;the\u0026nbsp;manuscript.\u0026nbsp;All\u0026nbsp;authors\u0026nbsp;read\u0026nbsp;and\u0026nbsp;approved\u0026nbsp;this\u0026nbsp;manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e \u003cspan\u003eThomson GW, Gagnon AN. Canine gastroenteritis associated with a parvovirus-like agent. The Canadian veterinary journal = La revue veterinaire canadienne. 1978;19(12):346.\u003c/span\u003e \u003c/li\u003e \u003cli\u003e \u003cspan\u003eTsao J, Chapman M, Agbandje M, Keller W, Smith K, Wu H, et al. The Three-Dimensional Structure of Canine Parvovirus and Its Functional Implications. 251. New York: Science; 1991. pp.\u0026nbsp;1456\u0026ndash;64.\u003c/span\u003e \u003c/li\u003e \u003cli\u003e \u003cspan\u003eHu J-J, Zhang X, Han S-Z, Zhao J-Z, Tian Z-H. A Survey of Diagnosis and Treatment of Pet Canine Parvovirus Disease in China. Journal of Animal Veterinary Advances. 2011;10:2058\u0026ndash;60.\u003c/span\u003e \u003c/li\u003e \u003cli\u003e \u003cspan\u003eBraganza A, Wallace K, Pell L, Parrish CR, Siegel DL, Mason NJ. Generation and validation of canine single chain variable fragment phage display libraries. Vet Immunol Immunopathol. 2011;139(1):27\u0026ndash;40.\u003c/span\u003e \u003c/li\u003e \u003cli\u003e \u003cspan\u003eKotlan B, Glassy MC. Antibody phage display: overview of a powerful technology that has quickly translated to the clinic. Methods in molecular biology (Clifton NJ). 2009;562:1\u0026ndash;15.\u003c/span\u003e \u003c/li\u003e \u003cli\u003e \u003cspan\u003eMa H, O'Kennedy R. Recombinant antibody fragment production. Methods (San Diego, Calif). 2017;116:23\u0026ndash;33.\u003c/span\u003e \u003c/li\u003e \u003cli\u003e \u003cspan\u003eSchade R, Zhang X, Horacio Ra\u0026uacute;l T. Use of IgY Antibodies in Human and Veterinary Medicine. 252007. p.\u0026nbsp;213\u0026ndash;22.\u003c/span\u003e \u003c/li\u003e \u003cli\u003e \u003cspan\u003eHan S, Zhang X, Zhao J. Production of Egg Yolk Antibody (IgY) against Recombinant Canine Parvovirus VP2 Protein. Acta Scientiae Veterinariae. 2012;40.\u003c/span\u003e \u003c/li\u003e \u003cli\u003e \u003cspan\u003eZhang X, Chen H, Tian Z, Chen S, Schade R. Chicken monoclonal IgY antibody: a novel antibody development strategy. Avian Biol Res. 2010;3(3):97\u0026ndash;106.\u003c/span\u003e \u003c/li\u003e \u003cli\u003e \u003cspan\u003eLee W, Syed Atif A, Tan SC, Leow CH. Insights into the chicken IgY with emphasis on the generation and applications of chicken recombinant monoclonal antibodies. J Immunol Methods. 2017;447:71\u0026ndash;85.\u003c/span\u003e \u003c/li\u003e \u003cli\u003e \u003cspan\u003eIndran IR, Liang RLZ, Min TE, Yong E-L. Preclinical studies and clinical evaluation of compounds from the genus Epimedium for osteoporosis and bone health. Pharmacology and Therapeutics. 2016;162.\u003c/span\u003e \u003c/li\u003e \u003cli\u003e \u003cspan\u003eChen HX, He F, Sun Y, Luo Y, Qiu HJ, Zhang XY, et al. Generation and characterization of chicken-sourced single-chain variable fragments (scFvs) against porcine interferon-gamma (pIFN-gamma). J Immunoass Immunochem. 2015;36(1):27\u0026ndash;44.\u003c/span\u003e \u003c/li\u003e \u003cli\u003e \u003cspan\u003eXu J, Guo HC, Wei YQ, Dong H, Han SC, Ao D, et al. Self-assembly of virus-like particles of canine parvovirus capsid protein expressed from Escherichia coli and application as virus-like particle vaccine. Appl Microbiol Biotechnol. 2014;98(8):3529\u0026ndash;38.\u003c/span\u003e \u003c/li\u003e \u003cli\u003e \u003cspan\u003eHansel T, Kropshofer H, Singer T, Mitchell J, George A. The safety and side effects of monoclonal antibodies. Nature reviews Drug discovery. 2010;9:325\u0026ndash;38.\u003c/span\u003e \u003c/li\u003e \u003cli\u003e \u003cspan\u003eDimitrov DS. Therapeutic antibodies, vaccines and antibodyomes. mAbs. 2010;2(3):347\u0026ndash;56.\u003c/span\u003e \u003c/li\u003e \u003cli\u003e \u003cspan\u003eDal Ferro M, Rizzo S, Rizzo E, Marano F, Luisi I, Tarasiuk O, et al. Phage Display Technology for Human Monoclonal Antibodies. Methods in molecular biology (Clifton, NJ). 2019;1904:319 \u0026ndash; 38.\u003c/span\u003e \u003c/li\u003e \u003cli\u003e \u003cspan\u003eSupuran CT. Agents for the prevention and treatment of age-related macular degeneration and macular edema: a literature and patent review. Expert Opin Ther Pat. 2019;29(10):761\u0026ndash;7.\u003c/span\u003e \u003c/li\u003e \u003cli\u003e \u003cspan\u003eLee CH, Lee YC, Lee YL, Leu SJ, Lin LT, Chen CC, et al. Single Chain Antibody Fragment against Venom from the Snake Daboia russelii formosensis. Toxins. 2017;9(11).\u003c/span\u003e \u003c/li\u003e \u003cli\u003e \u003cspan\u003eSchade R, Calzado EG, Sarmiento R, Chacana PA, Porankiewicz-Asplund J, Terzolo HR. Chicken egg yolk antibodies (IgY-technology): a review of progress in production and use in research and human and veterinary medicine. Alternatives to laboratory animals: ATLA. 2005;33(2):129\u0026ndash;54.\u003c/span\u003e \u003c/li\u003e \u003cli\u003e \u003cspan\u003ePereira EPV, van Tilburg MF, Florean E, Guedes MIF. Egg yolk antibodies (IgY) and their applications in human and veterinary health: A review. Int Immunopharmacol. 2019;73:293\u0026ndash;303.\u003c/span\u003e \u003c/li\u003e \u003cli\u003e \u003cspan\u003eSheng L, He Z, Chen J, Liu Y, Ma M, Cai Z. The impact of N-glycosylation on conformation and stability of immunoglobulin Y from egg yolk. Int J Biol Macromol. 2017;96:129\u0026ndash;36.\u003c/span\u003e \u003c/li\u003e \u003cli\u003e \u003cspan\u003eGilgunn S, Millan S, Wormald M, Zapatero Rodr\u0026iacute;guez J, Conroy P, O\u0026rsquo;Kennedy R, et al. Comprehensive N-Glycan Profiling of Avian Immunoglobulin Y. PLOS ONE. 2016;11:e0159859.\u003c/span\u003e \u003c/li\u003e \u003cli\u003e \u003cspan\u003eWaldmann H. Human Monoclonal Antibodies: The Benefits of Humanization. Methods in molecular biology. (Clifton NJ). 2019;1904:1\u0026ndash;10.\u003c/span\u003e \u003c/li\u003e \u003cli\u003e \u003cspan\u003eChoi J, Kim M, Lee J, Seo Y, Ham Y, Lee J, et al. Antigen-binding affinity and thermostability of chimeric mouse-chicken IgY and mouse-human IgG antibodies with identical variable domains. Sci Rep. 2019;9(1):19242.\u003c/span\u003e \u003c/li\u003e \u003cli\u003e \u003cspan\u003eJain NK, Sahni N, Kumru OS, Joshi SB, Volkin DB, Russell Middaugh C. Formulation and stabilization of recombinant protein based virus-like particle vaccines. Adv Drug Deliv Rev. 2015;93:42\u0026ndash;55.\u003c/span\u003e \u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Chicken IgY single chain variable fragments (IgY-scFv), Canine parvovirus (CPV), T7 phage display system, Virus-like particles (VLP), novel antibody generation platform","lastPublishedDoi":"10.21203/rs.3.rs-28773/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-28773/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground:\u003c/strong\u003e\u0026nbsp;Canine parvovirus (CPV) can cause acute and highly contagious enteritis in dog, antibodies have been used for diagnosis and therapy of CPV disease, generation of functional antibody fragments by using novel antibody engineering platforms is promising in veterinary practice. \u003c/p\u003e\u003cp\u003eResults: The IgY single chain fragment variables (scFv) were generated by T7 phage display system and expressed in E. coli system after immunizing hens with virus-like particles (VLP) of CPV-VP2. The titer of the primary scFv library reached to 1.5×10 6 pfu/mL, and 95% of the phages contained the target fragments. The CPV-VLP and CPV-VP2 protein showed similar reaction values to the purified scFv in the ELISA test, and the results of ELISA analysis using IgY-scFv toward CPV clinical samples were consistent with commercial immunochromatographic assay (ICA) and PCR detection, the scFv did not show cross reactivity with canine distemper virus (CDV) and canine coronavirus (CCV). IgY-scFv was successfully expressed in CRFK cells, and in the virus suppression assay, 55% of CPV infections were eliminated within 24 hours. Docking results demonstrated that the number of amino acids of the binding sides between scFv and VP2 were AA37 and AA40, respectively. \u003c/p\u003e\u003cp\u003eConclusions: This study revealed the feasibility of a novel functional antibody fragment development strategy by generating diversified avian IgY-scFv libraries towards the pathogenic target of interest for both detection and therapeutic purposes in veterinary medicine.\u003c/p\u003e","manuscriptTitle":"Generation and Evaluation of Chicken IgY-scFv for the Purposes of CPV Diagnosis and Therapy","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2020-05-19 21:26:01","doi":"10.21203/rs.3.rs-28773/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"9e1bf577-ba9e-4f60-91bd-ebf91d01f60a","owner":[],"postedDate":"May 19th, 2020","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":102958,"name":"Biotechnology and Bioengineering"}],"tags":[],"updatedAt":"2020-05-29T02:56:28+00:00","versionOfRecord":[],"versionCreatedAt":"2020-05-19 21:26:01","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-28773","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-28773","identity":"rs-28773","version":["v1"]},"buildId":"J0_U0BvcaRcwD8yVFaRlm","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00
unpaywall
last seen: 2026-05-21T05:10:58.409756+00:00
License: CC-BY-4.0