Telmisartan can promote spermatogenesis in irradiated mice by inhibiting ESR1 protein degradation in Sertoli cells

Telmisartan can promote spermatogenesis in irradiated mice by inhibiting ESR1 protein degradation in Sertoli cells | Authorea try { document.documentElement.classList.add('js'); } catch (e) { } var _gaq = _gaq || []; _gaq.push(['_setAccount', 'G-8VDV14Y67G']); _gaq.push(['_trackPageview']); (function() { var ga = document.createElement('script'); ga.type = 'text/javascript'; ga.async = true; ga.src = ('https:' == document.location.protocol ? 'https://ssl' : 'http://www') + '.google-analytics.com/ga.js'; var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(ga, s); })(); Skip to main content Preprints Collections Wiley Open Research IET Open Research Ecological Society of Japan All Collections About About Authorea FAQs Contact Us Quick Search anywhere Search for preprint articles, keywords, etc. Search Search ADVANCED SEARCH SCROLL This is a preprint and has not been peer reviewed. Data may be preliminary. 10 March 2025 V1 Latest version Share on Telmisartan can promote spermatogenesis in irradiated mice by inhibiting ESR1 protein degradation in Sertoli cells Authors : Ya Luo , Ran Lingxiang , Liu Kang , Ran Yuanshuai , Yao Yao , Duan Nengliang , Wang Huapei , Sun Long , Wang LIxia , and Xue Boxin [email protected] Authors Info & Affiliations https://doi.org/10.22541/au.174160738.80224775/v1 220 views 139 downloads Contents Abstract Information & Authors Metrics & Citations View Options References Figures Tables Media Share Abstract I.Background: Male infertility is a global issue with few remedies, particularly for testicular damage caused by radiation. Investigating new medications to treat radiation-induced testicular damage was the goal of this study. II.Methods: Six male mice (n = 6) received 0.5 Gy whole-body irradiation for 5 consecutive days and were then intraperitoneally injected with telmisartan (1.2 mg/kg). The therapeutic effect of telmisartan was evaluated using quantitative real-time PCR. A drug affinity reactivity target stability (DARTS) assay was used to identify target proteins and pathways. Western blot, CCK-8, EdU 594 and ubiquitination assays were used to investigate the mechanism involved. Finally, rescue experiments were performed by combining telmisartan with ESR1 antagonists and agonists. III.Results: The telmisartan treatment group presented significantly higher mRNA levels of spermatogenic cell markers than did the irradiation treatment group (P < 0.05). The DARTS assay and Western blotting results revealed that telmisartan increased the expression of connexin in Sertoli cells and increased proliferation and activated downstream signalling pathways by controlling ESR1 expression. Ubiquitination pull-down assays revealed that the degradation of ESR1 after irradiation was inhibited by telmisartan. Telmisartan combined with PPT/AZD9496 further upregulated ESR1 expression, which was beneficial for reducing radiation-induced testicular injury. IV.Conclusions: In conclusion, our findings suggest that telmisartan reduces radiation-induced testicular damage in mice by upregulating ESR1 in Sertoli cells. These findings may lead to the development of new approaches for treating testicular damage caused by radiation. Telmisartan can promote spermatogenesis in irradiated mice by inhibiting ESR1 protein degradation in Sertoli cells Introduction Radiation therapy is an important clinical cancer treatment; however, the testes are very sensitive to radiation, and a 0.5 Gy radiation dose can cause infertility and spermatogenic failure [1]. According to previous reports, radiation exposure is a significant risk factor for infertility, which affects 15% of couples of reproductive age worldwide. For more than 50% of these couples, infertility is caused by sperm abnormalities and impaired sperm function[2]. With the progress of early diagnosis and treatment of cancer, survival rates are gradually increasing, so preserving fertility in young patients is particularly important. At present, the most effective and mature method is gonadal tissue cryopreservation and transplantation, which is still in the experimental stage [3,4]. However, an effective treatment method has still not been determined, and male infertility after radiation cannot be treated successfully; thus, developing drugs to combat radiation-induced infertility is highly important. Blood‒testis barrier (BTB) integrity is essential for maintaining spermatogenesis because it creates a microenvironment conducive for spermatocytes to enter meiosis and protects germ cells in the spermatogenic tubules from toxins. Sertoli cells are essential for maintaining the integrity of the BTB[5]. We hypothesize that radiation-induced spermatogenic failure may occur through disruption of BTB integrity. Local oestrogen produced via the oestrogen signalling pathway is very important for male reproduction, and both ESR1 and ESR2 are present in the testis; however, the absence of ESR1 leads to male infertility, whereas the absence of ESR2 does not, suggesting that ESR1 is indispensable in male reproduction[6,7]. Mouse Sertoli cells express ESR1, which mediates oestrogen downstream signaling pathways and can decrease the degree of harm caused to Sertoli cell–cell junctions[8,9]. Telmisartan is an important medication used to treat hypertension. It works by inhibiting the angiotensin II receptor, for which angiotensin II has a high affinity, and preventing the angiotensin II receptor from dissociating from its binding site[10]. Recently, we screened telmisartan from metabolomics data. After the appropriate dose was determined, male mice (6 in each group) were intraperitoneally injected with telmisartan (1.2 mg/kg) after 5 consecutive treatments of 0.5 Gy daily whole-body X-ray irradiation (hereinafter referred to as IR5), and the therapeutic effect of telmisartan was evaluated by testicular haematoxylin and eosin (HE) staining and morphological measurements. To assess spermatogenic function, quantitative real-time PCR of spermatogenic cell markers and computer-assisted sperm analysis (CASA) were used [11]. The mechanism by which telmisartan alleviates radiation-induced spermatogenic dysfunction has not yet been elucidated. Here, we found that telmisartan alleviated radiation-induced spermatogenic dysfunction through the oestrogen signalling pathway using a drug affinity reactivity target stability (DARTS) assay. The aim of this study was to explore the mechanism by which telmisartan improves spermatogenic function. 2. Methods 2.1. Chemical preparationThe following chemicals were purchased: Tween 80 from Sigma (USA), poly(ethylene glycol) from Sigma (USA), dimethyl sulfoxide (DMSO) from Beyotime (China), propyl pyrazole triol (PPT) powder from MedChemExpress (China), and AZD9496 powder. After the powders were completely dissolved, an equal volume of deionized water and an oil solvent carrier were added in accordance with the appropriate ratio (DMSO:Tween 80:PEG400 = 2:1:7), and the mixture was shaken to combine. The above procedure was used to prepare the telmisartan, PPT, and AZD9496 solutions for intraperitoneal injection. 2.2 Animals and treatments Male BALB/c mice that weighed 20–25 g and were 7–8 weeks old were acquired from Hangzhou Ziyuan Experimental Animal Technology Co., Ltd. The animals were housed at the Soochow University Animal Center in a specific pathogen-free (SPF) setting with a temperature of 20–26 °C and 40–60% humidity under a 12-hour/12-hour light/dark cycle, a temperature of 20–26 °C, and a humidity of 40–60%. These mice were given unlimited access to food and water, and their bedding was replaced every day. The work has been reported in line with the ARRIVE guidelines 2.0. [12]. After the experiment, to ensure animal welfare, mice were euthanized by CO2 asphyxiation according to AVMA guidelines for the euthanasia of animals (2020). The Animal Care/User Ethics Committee of Soochow University and the Ethics Committee at the Second Affiliated Hospital of Soochow University reviewed and approved the research project entitled the Mechanism of Action in Ionizing Radiation Induced Sperm Abnormalities (Approval No. JD-LK-2020–019–02). A summary of every animal experimental group is shown in Fig. 1.Radiation-induced testicular injury and telmisartan administration: Eighteen male BALB/c mice were randomly divided into three groups. The mice in the control group, IR5 group and IR5 + Tel group were subjected to 6 mv X-ray irradiation at a dose rate of 100 cGy/min, 5 times a day, and a total dose of 0.5 Gy using a Philips SL18 linear accelerator. The rats in the IR5 +Tel group received daily intraperitoneal injections of telmisartan (1.2 mg/kg) for 24 consecutive days from the second day of IR5. On day 25 after IR5, samples were taken from each group (Fig. 1).Telmisartan combined with PPT/AZD9496 administration: Twenty-four BALB/c male mice were randomly divided into Control+PPT group, IR5 +Tel+PPT group, Control+AZD9496 group and IR5 +Tel+AZD9496 group. According to the relevant published studies, the doses used for validation were 20 mg/kg for PPT and 5 mg/kg for AZD9496[13–14]. The Control+PPT group was intraperitoneally injected with PPT on days 6, 9 and 13, and the Control+AZD9496 group was intraperitoneally injected with AZD9496 three times every week. The IR5 +Tel+PPT and IR5 +Tel+AZD9496 groups were intraperitoneally injected with the same doses of PPT/AZD9496 as the Control+PPT and Control+AZD9496 groups in addition to telmisartan after IR5. Samples from each group were collected on day 25 after IR5 (Fig. 8A). The work has been reported in line with the ARRIVE guidelines 2.0. Fig.1. The overview of all animal experiment groups (Created with BioRender.com).2.3. Isolation and identification of primary Sertoli cellsAfter being sacrificed via carbon dioxide inhalation, the mice were submerged in 75% ethanol for five minutes. The testicles were isolated and subjected to three rounds of washing in prechilled PBS at 4 °C. The tunica albuginea was dissected immediately after the visible arteries and other connective tissue were carefully removed. Each testis was put into a solution containing 1 mL of PBS, 0.5 mL of collagenase type I (2 mg/ml), 20 μL of hyaluronidase (10 mg/mL) and 60 μL of DNase I (1 mg/mL) (Solarbio, C8140, H8030, D8072). The sample was gently rotated by hand and placed on a vibrating screen at 37 °C at 120 r/min for 5 minutes. The mixture was centrifuged at 180 r/min for 15 min, the supernatant was discarded, and 1 mL of 0.25% trypsin-EDTA solution (Beyotime, C0201-100 ml) and 100 μL of DNase I were added to the remaining tissue. We shook the tissue pieces by hand to fully expose them to the pancreatic enzymes, closely observed the changes in the colour of the cell suspension caused by the pancreatic enzyme reactions, and immediately transferred the suspension to medium containing 10% serum on an ice box when it became yellowish in colour. When digestion was terminated, the maximum ratio of the pancreatic enzyme-containing cell suspension to the medium containing 10% FBS was 1:1. This process can be repeated to completely digest the testicular tissue mass into a single-cell suspension, leaving only collagen tissue that cannot be digested by pancreatic enzymes. After forceps were used to extract the residual tissue pellet, it was filtered through a 70-μm filter. The cells in the supernatant were centrifuged, washed twice with mouse testicular Sertoli cell complete culture media (Pricella, CM-M127), inoculated, and then placed in an incubator with 5% CO2. After two days, nonadherent cells were eliminated, and adherent Sertoli cells were cultured further in fresh media in an incubator with 5% CO2 at 37 °C[15].A total of 90% of the cells were positive for the Sertoli marker WT1 according to the immunostaining results[16].2.4 ImmunofluorescenceFor culture, primary Sertoli cells were seeded onto coverslips coated with Matrigel. After being washed, the cells were permeabilized in PBS/0.1% Triton X-100 in PBS for 5 minutes and fixed in PBS/4% paraformaldehyde for 10 minutes at room temperature. Following blocking in PBS/5% BSA, the cells were stained for one hour at room temperature with primary anti-WT1 antibodies (Cat No. 12609-1-AP; Proteintech) diluted 1:100 in PBS. Following washing, the cells were incubated for one hour at room temperature with secondary antibodies that were labelled with a fluorochrome. After 15 minutes of incubation at room temperature with DAPI (10 μg/ml), coverslips were adhered to slides with DABCO. We used an Axio Imager 2 (Zeiss) for microscopy.2.5 Testicular indices, computer-assisted sperm analysis and quantitative real-time PCRAfter both testes were carefully removed and pictures were taken, the testes were weighed separately, and the testicular index (testicular index = testis weight/body weight × 100%) was calculated.To release the sperm, the cauda epididymis of the mouse was carefully removed, dissected, and incubated for five minutes at 37 °C in a water bath in 1 mL of buffer that included 75 mM NaCl, 24 mM EDTA, and 0.4% FBS. Three microlitres of the sperm suspension was added to the corresponding counting plate and mixed gently and thoroughly, after which it was subjected to computer-assisted sperm analysis (Beijing Weili New Century Technology Co., Ltd.) for automatic detection.Following the manufacturer’s instructions, testis total RNA extraction and reverse transcription were carried out using the Vazyme Biotech total RNA extraction kit and the Novoprotein cDNA synthesis kit. SYBR qPCR Master Mix (Novoprotein) was used in the experiments, which were conducted on quantitative real-time PCR equipment at Life Technologies (USA) using a Viia 7 real-time polymerase chain reaction detection system. The program was configured as follows: 40 amplification cycles were carried out at 95 °C for 15 s and 60 °C for 32 s following denaturation at 95 °C for 2 min. Last, we computed the relative mRNA expression of the target genes after normalizing the cycle numbers. Table 1 lists the primer sequences used. Table 1 Primer sequences used in this study. PLZF CGCCACCTTCGCTCACATACAG TGGTGCTTGAGGCTGAACTTCTTG GFRA1 ACCACCACTGCCACGACTACC GCACCAGCGAGACCATCCTTTC STRA8 TAGGGCTCTTCAACAACCTAAG GCTTTGAGCTTCAGCAACTTAT DMRT1 CCTACTCAGAAGCCAAAGCCAGTG CGCAGACTCACATTCCAGAACTCC SYCP2 ACAAGAGTTACAAGGTGCTGGAATG AGAGGTCATTGCCATCAGATGTTG OVOL2 CGTGTGTGAGGATTGCGGCTAC GAGAAATGTGCTCCCTGGATGGTC CCNA1 ACCACCCATGCCCAGTCAGAG AACCTCCACCAGCCAGTCCAC RUNX2 CCTTCAAGGTTGTAGCCCTC GGAGTAGTTCTCATCATTCCCG TXNDC2 GCCGCCACACAAGATCAAAC ACATTTCTTCTATGGCCAAGTCC TJP3 GAAGCTAGGCAGTCAGATCTTT CACCCCGTTGATCTGTAAGATA TNP1 GTCTTCAAACAACACGGGGC CGAATTTCGTCACGACTGGC PRM3 TGGCCTGTGTGAGTCAAGAC CTTGCCCTTCACCGGGATTT GAPDH AATGGTGAAGGTCGGTGTGA TGAGTGGAGTCATACTGGAACA 2.6 DARTS assay, mass spectrometry and protein differential analysisAs illustrated in Fig. 3A, four testes were cut into smaller pieces and then homogenized using a homogenizer in 1.5 mL tubes filled with 450 μL of Thermo Fisher Scientific T-PER solution and protease inhibitors (APExBIO, EDTA-free). After 30 minutes of standing on ice, the samples were centrifuged for 10 minutes at 17,200 × g. The four supernatants were combined in a 15 mL centrifuge tube. The tube was filled with 200 μL of 10 × TNC (500 mM Tris HCl, 500 mM NaCl, 100 mM CaCl2, pH 8.0). The protein content of the homogenate was diluted to 5 mg/mL and assessed using a BCA assay. The homogenate was aliquoted into two tubes (260 μL/each). The tubes were filled with 40 μL of either a carrier solution or a 13 mg/mL telmisartan solution. After thorough mixing, 10 mg/mL pronase solution was to create 1:100, 1:300, 1:1000, and 1:1500 homogenate dilutions, and the mixtures were allowed to stand for 1 hour at room temperature. For one hour, telmisartan or vector homogenates (50 μL) were treated with each protease mixture. Afterwards, 5 μL of 0.5 M EDTA was added to stop the reaction. Afterwards, each sample was run at 120 V on a 10% polyacrylamide gel. Coomassie Brilliant Blue (P0017C, Beyotime) was used to stain the gels.After the gels were chopped, decolorized, and dried, they were no longer in the liquid phase. Dithiothreitol was then added at a final concentration of 10 mM, and the mixture was incubated for 60 minutes at 37 °C. Following the drying of the gel, iodoacetamide was added at a final concentration of 55 mM and allowed to sit at room temperature in the dark for 45 minutes. The gel fragments were resuspended in 10 ng/μL trypsin in 50 mM ammonium bicarbonate and incubated on ice for 60 minutes after further washing and dehydration. The gel pieces were enzymatically digested overnight at 37 °C after the excess solution was removed. The digested peptides were extracted from the gel in stages using 100% acetonitrile and 50% acetonitrile/5% formic acid. Following dissolution with Liquid Chromatography Mobile Phase A, the resulting peptides were resolved using an EASY-nLC 1000 Ultra Performance Liquid Chromatography System. Thermo Scientific TMQ Exactive Plus mass spectrometry was used to evaluate the peptides after they were separated by liquid chromatography with a nanospray ion (NSI) source. Proteome Discoverer 2.4 was used to identify the proteins in the mass spectrometry data.The differential protein (telmisartan /vector) analysis was carried out immediately following the mass spectrometry analysis. Metascape was used to import gene symbols for pathway enrichment analysis[17], and Proteomap was implemented to import UniProt IDs for protein pathway analysis[18].The TM4 Sertoli cell line and primary Seryoli cells were routinely cultured under the same conditions as those used for the primary testis cells.2.7 Western blot analysisA BCA assay was used to measure the protein concentration following lysis of the samples and extraction of the proteins. The total protein from each sample was added to a 10% polyacrylamide gel and electrophoresed for 60 minutes at 120 V. The membranes were transferred to polyvinylidene fluoride (PVDF) membranes after 60 minutes of continuous flow at 300 mA. They were then washed and blocked for an hour in 5% milk. The membranes were incubated with primary antibodies overnight at 4 °C. The membranes were washed and then incubated for one hour with HRP-conjugated goat anti-rabbit IgG (ABclonal, AS014). The SuperSignal West Pico PLUS Chemiluminescence Kit (Yeasen) was used to visualize particular proteins. Alpha FluorChem M imager detectors were used for imaging and confirmation. β-Actin and GAPDH were used as internal reference proteins. In addition to ESR1, the following proteins were also detected: Z0-1, CDH2, NCAM1, ERK1/2, p-ERK1/2, AKT, and p-AKT. The primary antibodies used were as follows: anti-Z0-1 (1:10000, Proteintech, 21773-1-AP), CDH2 (1:2000, ABclonal, A19083), anti-NCAM1 (1:1000, ABclonal, A0393), anti-ERK1/2 (1:1000, Cell Signaling Technology, 9102S), anti-p-ERK1/2 (1:1000, Cell Signaling Technology, 9272S), anti-AKT (1:1000, Cell Signaling Technology, 9272S), and anti-p-AKT (1:2000, Cell Signaling Technology, 4060T).2.8 Cell culture and treatment of Sertoli cellsTM4 cells (Procell, China) at 100% confluence were used to generate and develop the TM4 mouse supporting cell line. Next, the cells were cultivated in an incubator with 95% air and 5% CO2.Telmisartan administration: Sertoli cells were divided into 3 groups: control, IR (single 2.5 Gy irradiation), and IR+Tel (single 2.5 Gy irradiation followed by single telmisartan administration at a final concentration of 0.013 mg/mL), and each sample was collected the next day after treatment.PPT and AZD9496 administration: Sertoli cells were divided into 3 groups: Control, Con+PPT (single PPT administration at a final concentration of 1 µM), and Con+AZD (single AZD9496 administration at a final concentration of 1 µM). Each sample was collected after 12 hours.2.9 In vitro cell viability assaysThe cells were cultured in an incubator with 5% CO2 at 37 °C after being seeded in quintuplicate in a 96-well plate (1 × 10² cells/well) for the cell proliferation test. A cell counting kit-8 (CCK-8; MedChemExpress, HY-K0301) assay was used to determine cell viability, and the highest and lowest optical density values were eliminated. An EdU kit (Beyotime, C0078S) was used for the EdU incorporation assay to assess Sertoli cell growth. After seeding 6-well plates with treated cells (100 μL of a 2 × 104 cells/mL suspension), 50 mM EdU solution was added, and the mixture was incubated for two hours at 37 °C. Following permeabilization with 1% Triton X-100 and fixation with 4% paraformaldehyde, the cells were treated with 100 μL of Click Reaction Cocktail before being stained with Hoechst 33342. Using an Olympus fluorescence microscope, images of the stained sections were taken and quantitatively assessed.2.10 Ubiquitination pull-down assayIR (single 2.5 Gy irradiation), IR+Tel (single 2.5 Gy irradiation followed by single telmisartan administration at a final concentration of 0.013 mg/mL), and Control were the three groups into which Sertoli cells were split. The cells were then collected and lysed in 1 ml of NP-40 buffer (Beyotime, China) supplemented with complete PMSF (MCE, HY-B0496) on ice for 30 minutes. The cell lysate was centrifuged for 10 minutes at 4 °C at 12,000 rpm. Protein A/G magnetic beads (MCE, HY-K0202) and an anti-ESR1 (ABclonal, A0296) antibody were added to 50 μL of the resuspended lysate, which was then incubated overnight at 4 °C on a rotating apparatus. The magnetic beads were then boiled for 10 minutes in 50 µl of 2 × loading buffer after being cleaned eight times with cold NP-40 buffer. Western blot analysis was performed on the recovered supernatant following centrifugation.2.11 Statistical analysisThe data are presented as the means ± standard errors of means. GraphPad Prism 9 software was used for statistical analysis. Student’s t test was used to compare two groups, and one-way ANOVA and the Bonferroni multiple comparison test were used to evaluate differences between three or more groups. Data were deemed significant if P < 0.05. 3. Results 3.1 Telmisartan promoted spermatogenesis and alleviated BTB dysfunction in IR5 group mice We used quantitative real-time PCR and Western blot analyses to assess how telmisartan improved the spermatogenic function of cells and BTB integrity in IR5 group mice. Quantitative real-time PCR revealed that the relative mRNA expression of all the spermatogenic cell markers was lower in the IR5 group than in the control group, but the IR5 + Tel group presented higher levels of the aforementioned indicators than did the IR5 group did ( P < 0.05) (Fig. 1A-G). Telmisartan treatment promoted spermatogenesis and alleviated BTB dysfunction in the IR5 group animals, although irradiation treatment significantly decreased the expression of important cell adhesion proteins (ZO-1, CDH2, and NCAM1), compromising BTB integrity, according to the Western blot data (Fig. 1H-J). These findings suggest that telmisartan alleviates BTB dysfunction and rescues spermatogenic function in IR5 group mice. Fig.2. Telmisartan promoted spermatogenesis and alleviated BTB dysfunction in IR5 group mice. (A-G) Quantitative real-time PCR with IR5 (whole-body 0.5 Gy of five consecutive X-rays) and IR5+Tel (daily intraperitoneal dose of telmisartan the day following IR5, sampled on day 25). The quantitative real-time PCR results of the three groups (A). Labelled spermatogonial stem cells (GFRA1, PLZF). (B). Labelled differentiated spermatogonia (STRA8, DMRT1). (C). SYCP2+ zygotene spermatocytes. (D). (E) Telophase spermatocytes (TJP3), (F) diplotene spermatocytes and pachytene spermatocytes (OVOL2, CCNA1). Labelled spermatids in the S1 stage (RUNX2, TXNDC2), (G).Labelled spermatids in stages S2–S4 (TNP1, PRM3) (P<0.05 is indicated by *, P<0.01 by **, P<0.001 by ***, P<0.0001 by ****, and no significance is indicated by ns). (H-J). Analysis of ZO-1, CDH2, and NCAM1 levels by Western blot analysis. 3.2 Telmisartan binds to and upregulates ESR1 We used a DARTS assay to identify possible targets of telmisartan (Fig. 3A). At a pronase dilution of 1:1000, Coomassie blue staining demonstrated that telmisartan preferentially targeted and bound certain proteins, and these findings were supported by the mass spectrometry results (Fig. 3B). Telmisartan interacted with proteins relevant to the oestrogen signalling pathway, according to a Metascape enrichment analysis of differential proteins (telmisartan/vector) (Fig. 3C). We conducted Western blot analyses to examine the binding effect of telmisartan to proteins involved in the oestrogen signalling pathway. The findings demonstrated that telmisartan administration abrogated the downregulation of ESR1, although the levels of ESR2 and GPER were not substantially different among these three groups. ESR1 expression was also significantly lower in the IR5 group than in the Control group (Fig. 3D-F). This finding implies that by increasing the expression of the ESR1 protein, telmisartan may reduce the testicular damage caused by radiation. Fig.3. Telmisartan binds to and upregulates ESR1. (A-B). A flowchart of the DARTS assay protocol generated via BioRender.com. Images show Coomassie blue staining findings following the completion of the DARTS assay in the mouse testis (black arrow indicates bound protein; pronase is the protease, and the dilution ratios are 1:100, 1:300, 1:1000, and 1:1500). The red boxes indicate the enrichment of the oestrogen signalling pathway in the pathway enrichment results (Metascape) of differentially expressed proteins (telmisartan/vector) identified via the DARTS assay and mass spectrometry experiment (C). The IR5 group: 25 consecutive daily 0.5 Gy whole-body X-rays, sampled on day 25; the IR5 + Tel group daily intraperitoneal injections of 1.2 mg/kg telmisartan for 25 consecutive days after IR5, sampled on day 25; (D-F)Western blot results demonstrating ESR1 (D), GPER (E), and ESR2 (F) expression in the mouse testis samples. 3.3 Telmisartan upregulated ESR1 expression in irradiated Sertoli cells To determine the relationship between telmisartan and ESR1, a DARTS assay and a Western blot analysis were performed on TM4 cells. The results revealed that telmisartan specifically targets and binds to ESR1 at a 1:1500 pronase dilution (Fig. 4A). To study the binding effect of telmisartan on TM4 cells and ESR1, a Western blot analysis was performed. The results revealed that ESR1 expression was significantly lower in the IR group than in the Control group and that telmisartan upregulated ESR1 (Fig. 4B). We extracted primary Sertoli cells (Fig. 4C), and the expression of ESR1 in primary Sertoli cells was consistent with that in TM4 cells (Fig. 4D, E). Given that ER-α exhibits differential localization within cells, primarily localizing the nucleus and plasma membranes[19], we investigated how telmisartan and radiation affect the subcellular location of the protein. Nuclear and membrane fractions were generated using a subcellular protein fractionation kit. Telmisartan treatment increased ESR1 expression in the membrane but had no effect on its expression in the other cell components, while radiation treatment decreased ESR1 expression in the membrane but not in the cytoplasm or nuclear fractions (Fig. 2F-H). These findings indicate that irradiation inhibited the transfer of ER-α from the cytoplasm to the plasma membrane, whereas telmisartan promoted ER-α transfer. Fig.4. Telmisartan upregulated ESR1 expression in irradiated Sertoli cells. (A) TM4 cell lysates were incubated with pronase and protease dilutions of 1:100, 1:300, 1:1000 and 1:1500 for 90 min, and the stabilizing effects of pronase and ESR1 were evaluated via Western blotting. (B) TM4 protein Western blotting results (Control group; the IR group was irradiated with a single dose of 2.5 Gy, and samples were collected 24 h later. IR+Tel group: 13 µg/ml telmisartan was administered after IR irradiation, and samples were collected 24 h later).(C) Immunofluorescence results of the mouse primary Sertoli cell-specific anti-WT1 antibody (green for WT1, blue for nuclei). (D) Primary Sertoli cell lysates were incubated with pronase and protease dilutions of 1:100, 1:300, 1:1000 and 1:1500 for 90 min, and the stabilizing effects of pronase and ESR1 were evaluated by Western blotting. (E) Western blot results of primary Sertoli cell proteins. ER-α expression in the membrane (F), cytoplasm (G), and nuclear (H) fractions was determined using Western blot analysis. β-Actin, GAPDH, and Lamin B were used as loading controls for the whole-cell, membrane and nuclear fractions, respectively. 3.4 Telmisartan can increase the expression of connexin in Sertoli cells downregulated by irradiation by increasing the expression of ESR1 We treated irradiated TM4 cells with telmisartan, and the cell junction proteins ZO-1, CDH2, and NCAM1 were significantly downregulated after IR compared with the control, whereas telmisartan treatment increased the expression of cell junction proteins 24 h after treatment (Fig. 5A-C). We treated normal cells with the ESR1 protein antagonist AZD9496 and the agonist PPT and found that in the AZD9496 treatment group, ESR1 protein expression was inhibited, and the protein expression of the cell linker was decreased, whereas that in the PPT treatment group was increased (Fig. 5D-F). The performance of primary Sertoli cells was consistent with that of TM4 cells (Fig. 5G-L). These findings suggest that telmisartan may increase the expression of connexin in Sertoli cells after irradiation by increasing the expression of ESR1, thereby reducing damage to the BTB after irradiation. Fig.5. Telmisartan can increase the expression of connexin in Sertoli cells downregulated by irradiation by increasing the expression of ESR1. The results of TM4 cell Western blotting are shown in (A-F). (Control group; the IR group was irradiated with a single fraction of 2.5 Gy, and samples were collected 24 hours later. The IR+Tel group: 13 µg/ml telmisartan was added after irradiation, and samples were taken 24 hours later; the Con+AZD9496 group and Con+PPT group: AZD94961 µM and 10 µM PPT were added, and samples were collected after 12 hours). The Western blot results for primary Sertoli cells are shown in (G-L). (Control group; the IR group was irradiated with a single fraction of 2.5 Gy, and samples were collected 24 hours later. The IR+Tel group: 13 µg/ml telmisartan was added after irradiation, and samples were taken 24 hours later; the Con+AZD9496 group and Con+PPT group: 1 µM AZD9496 and 10 µM PPT were added, and samples were collected after 12 hours). 3.5 Telmisartan increases the proliferation of radiation-inhibited Sertoli cells and activates the oestrogen signalling pathway Oestrogen receptors are known to be essential for Sertoli cell development, and we sought to assess the effects of irradiation as well as telmisartan on Sertoli cell proliferation. Cell proliferation was reduced after IR and increased after treatment with telmisartan compared with the control (Fig. 5A). Cell proliferation was assessed by EdU expression in proliferating cells. IR treatment for 2 h resulted in a decrease in the number of proliferating TM4 cells, which increased after treatment with telmisartan (Fig. 5B). The results for primary Sertoli cells were consistent with those for TM4 cells (Fig. 5C, D). These results indicated that telmisartan abrogated the reduction in Sertoli cell proliferation induced by irradiation. ERK/AKT, the downstream signal of ESR1, primarily regulates proliferation, and we examined the effect of irradiation on downstream oestrogen signalling. As expected, p-ERK1/2 levels were decreased in TM4 cells treated with irradiation for 12 h, and telmisartan treatment significantly increased ERK1/2 phosphorylation (p < 0.05) (Fig. 5E). After 12 hours of irradiation, p-Akt levels were decreased, while telmisartan treatment significantly increased p-Akt levels (p < 0.05) (Fig. 5F). The expression of ERK1/2 in primary Sertoli cells was consistent with that in TM4 cells, and there was no change in AKT expression after the addition of drugs (FIG. 5G, H). These results suggest that telmisartan can abrogate the reduction in the proliferation of Sertoli cells induced by irradiation and reactivate oestrogen downstream signalling in Sertoli cells. Full-length blots are presented in Supplementary Figure S3. Fig.6. Telmisartan increases the proliferation of radiation-inhibited Sertoli cells and activates the oestrogen signalling pathway. (A-D) CCK-8 and EdU assays (scale bar = 100 μm) were used to evaluate the effects of IR and IR+Tel on the proliferation of Sertoli cells. (E-H) The protein expression levels of (E), (G) pERK1/2/ERK1/2, (F), and (H) pAKT/AKT were determined by Western blotting. 3.6 Telmisartan inhibits radiation-induced ubiquitination and degradation of ESR1 We found that ESR1 is degraded via ubiquitination in uterine leiomyomas [20]. We sought to investigate the mode of ESR1 degradation in Sertoli cells. The protein synthesis inhibitor cycloheximide (CHX) or the proteasome inhibitor MG132 were used to observe their effects on ESR1 protein levels in TM4 cells. As expected, CHX treatment decreased ESR1 protein levels, whereas MG132 treatment increased ESR1 expression, suggesting that ESR1 is degraded via ubiquitination in TM4 cells (Fig. 7A, B). When CHX alone or in combination with telmisartan was added to irradiated TM4 cells, ESR1 protein levels were further reduced in the CHX alone group, suggesting that ESR1 levels were reduced after irradiation by mechanisms other than ubiquitination (Fig. 7C). To investigate whether this effect was mediated by the induction of ESR1 degradation, we added MG132 alone or in combination with telmisartan; as expected, MG132 inhibited ESR1 degradation, thereby increasing ESR1 levels in TM4 cells, whereas treatment with MG132 plus telmisartan did not affect ESR1 levels (Fig. 7D). Interestingly, treatment with MG132 abolished the effect of radiation on ESR1 levels, and treatment with MG132 in combination with telmisartan was as effective as treatment with MG132 alone, suggesting that the radiation-induced reduction in ESR1 protein levels and the effect of telmisartan on postradiation ESR1 levels are mediated by the induction of proteasomal degradation. The same conclusion was drawn for primary Sertoli cells (Fig. S1). We then investigated how telmisartan prevents ESR1 degradation and how radiation causes it. We investigated how radiation and telmisartan affect ESR1 ubiquitination because it is recognized as a crucial regulator of ESR1 degradation. MG132 was used as a pretreatment for TM4 cells before they were exposed to radiation. This process stops proteasomal degradation and enables ubiquitinated ESR1 to accumulate so that its level can be determined. Afterwards, ubiquitin-affinity beads were used to precipitate the cell lysates when anti-ESR1 antibodies were present. The findings demonstrated that ESR1 ubiquitination was increased in the radiation group compared to the control group and was decreased by the addition of telmisartan following radiation (Fig. 7E). The unaltered protein band was marked by the input channel. To obtain the immunoprecipitates of the total ubiquitinated proteins, the membrane was inspected once more using an anti-ubiquitin antibody (Fig. 7F). These findings suggest that telmisartan inhibits ESR1 degradation and ubiquitination induced by radiation. In primary Sertoli cells, comparable outcomes were observed (Fig. S1). Fig.7. Telmisartan inhibits radiation-induced ubiquitination and degradation of ESR1. A. TM4 cells were treated with 50 μg/mL CHX for 6 h. B. TM4 cells were treated with 20 μM MG132 for 1 h. C. In the IR group, no treatment was performed after irradiation; in the IR+CHX group, the cells were treated with 50 μg/mL CHX for 6 h after irradiation; and in the IR+CHX+Tel group, after irradiation, the cells were treated with 13 µg/ml telmisartan for 24 h and CHX for 6 h in the presence of telmisartan. D. The IR+MG group was treated with MG132 (20 µM) for 1 h after irradiation; the IR+MG+Tel group was treated with 13 µg/ml telmisartan for 24 h, followed by an additional hour of MG132 treatment in the presence of telmisartan. Whole-cell ESR1 protein expression levels were determined by Western blotting, and β-actin was used as a loading control. ESR1 ubiquitination was determined by Western blotting. The membranes were probed with an anti-ESR1 antibody (E, G) and again with a ubiquitinated antibody (F, H). The input channel served as a marker for the unmodified protein band. 3.7 Effects of telmisartan combined with an ESR1 agonist/antagonist on the testes of IR5 mice To confirm that the upregulation of ESR1 by telmisartan ameliorates testicular damage, we administered telmisartan together with an agonist (PPT)/antagonist (AZD9496) of ESR1 to IR5 mice to observe the effects (Fig. 8A). To demonstrate the therapeutic effect of PPT, we determined the testicular index and performed computer-assisted sperm analysis and real-time PCR experiments in normal mice injected with PPT or AZD9496 alone. The results revealed that neither PPT nor AZD9496 alone had any effect on the sperm concentration, total sperm motility and testicular size in mice. (Fig. S2.A-C). To further evaluate the effect of the agonist/antagonist in addition to telmisartan on testicular damage, we determined the testicular index and performed computer-assisted sperm analysis and real-time quantitative PCR experiments. The results revealed that IR5+Tel+AZD9496 caused a decrease in the testicular index, whereas IR5+Tel+PPT increased it (Fig. 8B). IR5+Tel+PPT significantly increased the sperm concentration and total sperm motility in the IR5+Tel group mice (Fig. 8C, D). The results of real-time PCR revealed that the IR5+Tel+AZD9496 group presented significantly lower relative mRNA expression levels of most spermatogenic cell markers than did the control group did, whereas the IR5+Tel+ PPT group presented significantly higher relative mRNA expression levels of most spermatogenic cell markers than did the IR5+Tel group did (P < 0.05) (Fig. 8E-K). Fig.8. Effects of telmisartan combined with an ESR1 agonist/antagonist on the testes of IR5 mice. (A) Dosing procedure diagram (created by BioRender.com); (B) Testicular index; (C)(D) The results of the computer-assisted sperm analysis: (C) sperm concentration; (D) total sperm motility (PR + NP); (E-K) (E) spermatogonial stem cells (PLZF and GFRA1); (F) differentiated spermatogonial cells (STRA8 and DMRT1); (G) fertilized ovum spermatocytes (SYCP2); (H) thick fibroblastic and double-collagenous spermatocytes (OVOL2 and CCNA1); (I) late spermatocytes (TJP3); (J) S1 stage spermatids (RUNX2 and TXNDC2); (K) S2-S4 stage spermatids (TNP1 and PRM3) (* denotes P < 0.05, ** denotes P < 0.01, *** denotes P < 0.001, ** denotes P < 0.001, ** denotes P < 0.05). **** for P < 0.0001, ns for not significant) Fig.S1. Telmisartan inhibits radiation-induced ubiquitination and degradation of ESR1. A. primary Sertoli cells were treated with 50 μg/mL CHX for 12 h. B. primary Sertoli cells were treated with 20 μM MG132 for 1 h. C. In the IR group, no treatment was performed after irradiation; in the IR+CHX group, the cells were treated with 50 μg/mL CHX for 12 h after irradiation; and in the IR+CHX+Tel group, after irradiation, the cells were treated with 13 µg/ml telmisartan for 24 h and CHX for 6 h in the presence of telmisartan. D. The IR+MG group was treated with MG132 (20 µM) for 1 h after irradiation; the IR+MG+Tel group was treated with 13 µg/ml telmisartan for 24 h, followed by an additional hour of MG132 treatment in the presence of telmisartan. Fig.S2. Effects of telmisartan combined with an ESR1 agonist/antagonist on the testes of IR5 mice. (A) Testicular index; (B)(C) The results of the computer-assisted sperm analysis: (B) sperm concentration; (C) total sperm motility (PR + NP) 4. Discussion In this study, a mouse model of testicular irradiation was established by subjecting mice to IR5. We conducted a metabolomics analysis of the testicular supernatant to determine how IR5 affects the testis and to investigate potential novel therapeutic approaches. Among the many differentially abundant metabolites, telmisartan was much less abundant in the IR5 group than in the Control group. We also verified that telmisartan alleviated spermatogenesis disorders in mice caused by low-dose fractionated irradiation [11]. Telmisartan, known as 4’[(1,4’ -dimethyl-2’-propyl [2,6’ -bis-1H-benzimidazole]-1’ -yl) methyl] [1,1’ -biphenyl] -2-carboxylic acid, prevents the binding of the vasoconstrictor angiotensin II by selectively blocking AT1 receptors [20]. In addition to causing vasoconstriction, Ang II affects the transcription of several genes involved in cell proliferation, angiogenesis, inflammation, and atherogenesis or thrombosis [21]. Diarrhoea, syncope, and hypotension were not noted during drug administration in our study. Before and after medication, there were no alterations in the nutritional status, sleep pattern, habitat, or hair condition of the mice, and no mouse deaths occurred. These findings indicate that telmisartan is a generally safe medicine. Our data suggest that telmisartan has promising efficacy in alleviating radiation-induced testicular injury. Telmisartan increased the number of spermatogenic cells at all time points after IR5 (Fig. 2A-G). Additionally, GFR1 is involved in spermatogonial proliferation[22] and STRA8 mediates spermatogonial differentiation[23]. Here, telmisartan was found to increase the expression of these two genes, demonstrating that it can promote spermatogenesis induced by IR5. Compared with those of IR5, the levels of SYCP2, TNP1 and PRM3 were significantly greater, indicating that telmisartan can promote the development of spermatogenic cells during meiosis. It has been established that TM4 cell junctional protein deficiency may lead to impaired BTB function, which may trigger an immune response against germ cells and eventually lead to male infertility [24]. The results of this study revealed that the expression of ZO-1, CDH2 and NCAM1 was significantly decreased in the testes of the IR5 group mice, whereas it was increased in the those of the IR5+Tel group mice, and telmisartan maintained the expression of connexin in the testes of the mice (Fig. 2H, I, J). These results indicate that telmisartan increases the number of spermatogenic cells as well as the number of connexin-expressing Sertoli cells after IR5, indicating that telmisartan has high therapeutic value. The target of telmisartan was elucidated using a DARTS assay, which is based on the theory that a molecule protects its target protein from protease hydrolysis when it is attached to it [25]. To do this, we diluted telmisartan with a pronase solution to varying concentrations to preserve certain proteins in testis samples that were both normal and untreated. We conducted mass spectrometry detection in the telmisartan group, and we discovered that it differed from the vector group the most at a dilution of 1:1000 (Fig. 3B). We conducted a Metascape pathway enrichment analysis to compare the two groups of differentially expressed proteins (telmisartan/vector). These results indicate that telmisartan may target proteins linked to the oestrogen signalling pathway, but it is yet unknown whether these proteins can help mitigate testicular injury caused by IR5. Among the differentially expressed proteins, ESR1, a crucial protein in the oestrogen signalling pathway, was identified. We conducted Western blot experiments on prior mouse testis samples to examine the impact of telmisartan on ESR1 protein expression. We discovered that IR5 could significantly reduce the protein level of ESR1, whereas telmisartan could increase the protein level. These findings suggested that telmisartan may activate the oestrogen signalling pathway in the testis following IR5 (Fig. 3D). The contents of the key factors GPER and ESR2 were also examined at the same time, although the levels in the three groups did not differ significantly (Fig. 3E, F). The BTB is formed by tight junctions between Sertoli cells, through which Sertoli cells help maintain the microenvironment and protect germ cells from toxins and microbes[26]. In our study, the BTB was disrupted after IR5, and treatment with telmisartan somewhat restored BTB integrity, so we chose Sertoli cells for subsequent experiments. A DART assay revealed that the ESR1 protein bound to telmisartan (Fig. 4A, D). Moreover, Western blot analysis revealed that ESR1 expression was decreased after IR and increased after telmisartan addition to TM4 and primary Sertoli cells (Fig. 4B, E). ESR1 is expressed primarily in the nucleus and on the cell membrane. In TM4 cells, the expression of the connexins ZO-1, CDH2 and NCAM1 decreased in the IR group, whereas the expression of connexins increased in the IR+Tel group (Fig. 5A‒C). We considered that these changes were related to the ESR1 protein, so we treated TM4 cells with 0.1 µM PPT, and ESR1 agonist, or 0.1 µM AZD9496, an ESR1 antagonist, for 12 hours and found that the expression of cell junction proteins increased or decreased with the change in ESR1 protein expression (Fig. 5D-F). These results were also observed in primary Sertoli cells (Fig. 5G-I). These results suggest that telmisartan protects the function of TM4 cells by increasing the expression of ESR1, thereby protecting the integrity of the BTB and promoting spermatogenesis. By controlling the transcription of genes in the nucleus, ERK, a significant member of the MAPK family of serine/threonine kinases, can control migration, apoptosis, differentiation, and proliferation. It also plays a role in numerous disorders[27]. In the present study, we found that the p-ERK/ERK ratio was significantly reduced in TM4 cells after IR accompanied by decreases in cell viability and proliferation, which were abrogated by treatment with telmisartan (Fig. 6E). In both healthy and diseased situations, cell survival and proliferation depend on the serine/threonine kinase signalling cascade phosphatidylinositol 3-kinase/Akt. We also assessed the impact of IR on Akt signalling in this work, and the results were consistent with ERK performance (Fig. 6F). These results were similar to those in primary Sertoli cells (Fig. 6G, H). These results indicated that the p-ERK/ERK and p-AKT/AKT ratios were decreased after IR, while telmisartan increased the ratios of these proteins and significantly abrogated the reduction in TM4 cell viability and proliferation induced by IR (Fig. 6A-D). In tumours, ESR1 expression is regulated by many factors, including posttranslational modification (PTM), histone modification, SUMOylation, somatic mutation, and the ESR1 fusion gene. Ubiquitination is a common PTM[28]. In this study, we revealed that ESR1 is degraded by ubiquitination in Sertoli cells (Fig. 7A-D), that ESR1 expression was decreased after IR, and that the ubiquitination and subsequent degradation of ESR1 were increased after IR, whereas its degradation was reduced by the addition of telmisartan. We conclude that telmisartan protects against radiation-induced ESR1 depletion by inhibiting ESR1 ubiquitination and degradation (Fig. E-H). To confirm that the upregulation of ESR1 by telmisartan ameliorated irradiation-induced testicular injury, we administered telmisartan and ESR1 agonists/antagonists to IR5 group mice. AZD9496 is an ESR1 antagonist that also targets ESR1 binding and inhibits ESR1 expression, whereas PPT is a well-known ESR1 agonist that targets ESR1 binding and upregulates ESR1. We selected these two medications in conjunction with telmisartan to confirm the effect, along with our DARTS assay results. The testicular index results demonstrated that neither PPT nor AZD9496 alone significantly affected the testes of normal mice but that telmisartan plus PPT more effectively reduced testicular damage in IR5 group mice, whereas telmisartan plus AZD9496 abrogated the effects of telmisartan (Fig. 8B-D). The mouse testes quantitative real-time PCR results and computer-assisted sperm analysis further supported this conclusion (Fig. 8E-K). These findings demonstrated that variations in ESR1 levels in Sertoli cells may, in fact, affect recovery from testicular damage following radiation exposure. Sertoli cells (SCs) provide structural support to sperm cells during spermatogenesis; maintain the size of the testes and seminiferous tubules; and generate numerous proteins that are essential for the growth, differentiation, and metabolism of germ cells [29]. In light of these findings, we propose that radiation may cause certain modifications in Sertoli cells, leading to aberrant inhibition of the oestrogen signalling pathway, which could affect the function of these cells. Additionally, we counteracted the adverse effects of irradiation by upregulating ESR1 in Sertoli cells through the administration of telmisartan, representing a novel method for alleviating irradiated testicular injury. our research shows that telmisartan can reduce irradiation-induced testicular damage in mice by increasing ESR1 expression. This study provides a fresh perspective and a treatment approach for issues related to irradiation-induced testicular damage. 5.Study Highlights 5.1 Male infertility is a global problem in which radiation-induced testicular damage is an important cause. There are currently few treatments available, and in our previous study telmisartan improved radiation-induced spermatogenesis disorders in mice by promoting spermatogenesis. 5.2 With the young age of tumor patients, male infertility caused by radiation has been paid more and more attention. We found that the drug telmisartan can protect the BTB structure of the testes of irradiated mice by promoting ESR1 expression, thus promoting spermatogenesis. 5.3 Telmisartan is a drug for the treatment of hypertension. We screened it through metabolomics and found that it is a potential drug for improving testicular radiation injury, and its efficacy was verified by in vitro and in vivo experiments. Draw a conclusion: elmisartan reduces radiation-induced testicular damage in mice by upregulating ESR1 in Sertoli cells. 5.4 Telmisartan redefines clinical pharmacology by incorporating cardiovascular protection and reproductive salvage. Its promotion of ESR1 provides a way to shield against radiation toxicity and warrants clinical trials to verify its protective efficacy in human fertility. This will make Telmisartan a first-in-class adjuvant therapy in oncology, bridging the gap between survival and quality of life. 6.Acknowledgements I would first like to thank my supervisor，Lixia Wang and Boxin Xue, whose expertise was invaluable in formulating the research questions and methodology. Your insightful feedback pushed me to sharpen my thinking and brought my work to a higher level. 7.Author Contributions statement Ya Luo performed all experiments of this study, completed all data analysis and visualization procedures, and wrote the original manuscript, as well as completed the revision procedure and response to reviewer’s comments. Lingxiang Ran conceived and supervised the research. Kang Liu, Nengliang Duan, Huapei Wang, Long Sun and Yao yao assisted with data collection. Lixia Wang and Boxin Xue funded the research. All authors read and approved the final manuscript. [1]Ma J, Dong S, Lu H, Chen Z, Yu H, Sun X, Peng R, Li W, Wang S, Jiang Q, Li F, Ma L. The hydrogen storage nanomaterial MgH2 improves irradiation-induced male fertility impairment by suppressing oxidative stress. Biomater Res. 2022 May 26;26(1):20. doi: 10.1186/s40824-022-00266-6. PMID: 35619159; PMCID: PMC9134580. [2] Barazani Y, Katz BF, Nagler HM, Stember DS. Lifestyle, environment, and male reproductive health. Urol Clin North Am. 2014 Feb;41(1):55-66. doi: 10.1016/j.ucl.2013.08.017. Epub 2013 Sep 26. PMID: 24286767. [3]Yokonishi T, Sato T, Komeya M, Katagiri K, Kubota Y, Nakabayashi K, Hata K, Inoue K, Ogonuki N, Ogura A, Ogawa T. Offspring production with sperm grown in vitro from cryopreserved testis tissues. Nat Commun. 2014 Jul 1;5:4320. doi: 10.1038/ncomms5320. PMID: 24984101. [4] Yokonishi T, Ogawa T. Cryopreservation of testis tissues and in vitro spermatogenesis. Reprod Med Biol. 2016;15(1):21-28. doi: 10.1007/s12522-015-0218-4. Epub 2015 Aug 5. PMID: 26709347; PMCID: PMC4686543. [5]Huang X, Fu Y, Wang S, Guo Q, Wu Y, Zheng X, Wang J, Wu S, Shen L, Wei G. 2,2’,4,4’-Tetrabromodiphenyl ether exposure disrupts blood-testis barrier integrity through CMA-mediated ferroptosis. Sci Total Environ. 2024 Oct 20;948:174738. doi: 10.1016/j.scitotenv.2024.174738. Epub 2024 Jul 14. PMID: 39009145. [6]. Walker VR, Korach KS. Estrogen receptor knockout mice as a model for endocrine research. ILAR J. 2004;45(4):455-61. [7]. Carreau S, Hess RA. Oestrogens and spermatogenesis. Philos Trans R Soc Lond B Biol Sci. 2010 May 27;365(1546):1517-35. [8]. Lin J, Zhu J, Li X, Li S, Lan Z, Ko J, Lei Z. Expression of genomic functional estrogen receptor 1 in mouse sertoli cells. Reprod Sci. 2014 Nov;21(11):1411-22. [9]Ma X, Zhu K, Yao Z, Yuan D, Wu J, Zhang C, Zhao H. Icariin alleviates the injury of Sertoli cell junction function by upregulating PKR pathway via ERα/c-fos signaling in aged mice. J Ethnopharmacol. 2024 Dec 5;335:118673. doi: 10.1016/j.jep.2024.118673. Epub 2024 Aug 8. PMID: 39121931. [10]Bakheit AHH, Abd-Elgalil AA, Mustafa B, Haque A, Wani TA (2015) Telmisartan. Profiles Drug Subst Excip Relat Methodol 40:371–429. [11]Ran L, Gao Z, Chen Q, Ran Y, Duan N, Hu G, Lu X, Xia R, Li Q, Cui F, Liu X, Xue B. Improving effects of telmisartan on spermatogenic disorder induced by fractionated low-dose irradiation in mice. Int Urol Nephrol. 2023 Jun;55(6):1427-1439. doi: 10.1007/s11255-023-03601-5. Epub 2023 Apr 24. PMID: 37093439. [12] Percie du Sert N, Hurst V, Ahluwalia A, Alam S, Avey MT, Baker M, Browne WJ, Clark A, Cuthill IC, Dirnagl U, Emerson M, Garner P, Holgate ST, Howells DW, Karp NA, Lazic SE, Lidster K, MacCallum CJ, Macleod M, Pearl EJ, Petersen OH, Rawle F, Reynolds P, Rooney K, Sena ES, Silberberg SD, Steckler T, Würbel H. The ARRIVE guidelines 2.0: Updated guidelines for reporting animal research. Br J Pharmacol. 2020 Aug;177(16):3617-3624. doi: 10.1111/bph.15193. Epub 2020 Jul 14. PMID: 32662519; PMCID: PMC7393194. [13] Li Y, Wang P, Zou Z, Pan Q, Li X, Liang Z, Li L, Lin Y, Peng X, Zhang R, Tian H, Han L. Ginsenoside (20S)-protopanaxatriol induces non-protective autophagy and apoptosis by inhibiting Akt/mTOR signaling pathway in triple-negative breast cancer cells. Biochem Biophys Res Commun. 2021 Nov 2;583:184-191. doi: 10.1016/j.bbrc.2021.10.067. Epub ahead of print. PMID: 34749235. [14] Weir HM, Bradbury RH, Lawson M, Rabow AA, Buttar D, Callis RJ, Curwen JO, de Almeida C, Ballard P, Hulse M, Donald CS, Feron LJ, Karoutchi G, MacFaul P, Moss T, Norman RA, Pearson SE, Tonge M, Davies G, Walker GE, Wilson Z, Rowlinson R, Powell S, Sadler C, Richmond G, Ladd B, Pazolli E, Mazzola AM, D’Cruz C, De Savi C. AZD9496: An Oral Estrogen Receptor Inhibitor That Blocks the Growth of ER-Positive and ESR1-Mutant Breast Tumors in Preclinical Models. Cancer Res. 2016 Jun 1;76(11):3307-18. doi: 10.1158/0008-5472.CAN-15-2357. Epub 2016 Mar 28. PMID: 27020862. [15] Wu D, Zhang K, Khan FA, Pandupuspitasari NS, Liang W, Huang C, Sun F. Smtnl2 regulates apoptotic germ cell clearance and lactate metabolism in mouse Sertoli cells. Mol Cell Endocrinol. 2022 Jul 1;551:111664. doi: 10.1016/j.mce.2022.111664. Epub 2022 May 10. PMID: 35551947. [16] Huang D, Zuo Y, Zhang C, Sun G, Jing Y, Lei J, Ma S, Sun S, Lu H, Cai Y, Zhang W, Gao F, Peng Xiang A, Belmonte JCI, Liu GH, Qu J, Wang S. A single-nucleus transcriptomic atlas of primate testicular aging reveals exhaustion of the spermatogonial stem cell reservoir and loss of Sertoli cell homeostasis. Protein Cell. 2023 Dec 1;14(12):888-907. doi: 10.1093/procel/pwac057. PMID: 36929025; PMCID: PMC10691849. [17] Zhou Y, Zhou B, Pache L, Chang M, Khodabakhshi AH, Tanaseichuk O, Benner C, Chanda SK. Metascape provides a biologist-oriented resource for the analysis of systems-level datasets. Nat Commun. 2019 Apr 3;10(1):1523. doi: 10.1038/s41467-019-09234-6. PMID: 30944313; PMCID: PMC6447622. [18] Liebermeister W, Noor E, Flamholz A, Davidi D, Bernhardt J, Milo R. Visual account of protein investment in cellular functions. Proc Natl Acad Sci U S A. 2014 Jun 10;111(23):8488-93. doi: 10.1073/pnas.1314810111. Epub 2014 Jun 2. PMID: 24889604; PMCID: PMC4060655. [19] Lucas TF, Siu ER, Esteves CA, Monteiro HP, Oliveira CA, Porto CS, Lazari MF. 17beta-estradiol induces the translocation of the estrogen receptors ESR1 and ESR2 to the cell membrane, MAPK3/1 phosphorylation and proliferation of cultured immature rat Sertoli cells. Biol Reprod. 2008 Jan;78(1):101-14. doi: 10.1095/biolreprod.107.063909. Epub 2007 Oct 10. PMID: 17928626. [20] Afrin S, El Sabeh M, Islam MS, Miyashita-Ishiwata M, Malik M, Catherino WH, Akimzhanov AM, Boehning D, Yang Q, Al-Hendy A, Segars JH, Borahay MA. Simvastatin modulates estrogen signaling in uterine leiomyoma via regulating receptor palmitoylation, trafficking and degradation. Pharmacol Res. 2021 Oct;172:105856. doi: 10.1016/j.phrs.2021.105856. Epub 2021 Aug 28. PMID: 34461224; PMCID: PMC8455458. [21] Amer MM, Backer L, Buschmann H, Handler N, Scherf-Clavel O, Holzgrabe U, Bolm C. Prediction of Degradation Profiles for Various Sartans under Solvent-Free Mechanochemical Conditions. Anal Chem. 2024 Aug 13;96(32):13166-13173. doi: 10.1021/acs.analchem.4c02025. Epub 2024 Aug 2. PMID: 39092810. [22] Isobe A, Takeda T, Sakata M, Miyake A, Yamamoto T, Minekawa R, Nishimoto F, Oskamoto Y, Walker CL, Kimura T. Dual repressive effect of angiotensin II-type 1 receptor blocker telmisartan on angiotensin II-induced and estradiol-induced uterine leiomyoma cell proliferation. Hum Reprod. 2008 Feb;23(2):440-6. doi: 10.1093/humrep/dem247. Epub 2007 Nov 9. PMID: 17993476. [23] Parker N, Laychur A, Sukwani M, Orwig KE, Oatley JM, Zhang C, Rutaganira FU, Shokat K, Wright WW. Spermatogonial Stem Cell Numbers Are Reduced by Transient Inhibition of GDNF Signaling but Restored by Self-Renewing Replication when Signaling Resumes. Stem Cell Reports. 2021 Mar 9;16(3):597-609. doi: 10.1016/j.stemcr.2021.01.015. Epub 2021 Feb 25. PMID: 33636117; PMCID: PMC7940257. [24] Kojima ML, de Rooij DG, Page DC. Amplification of a broad transcriptional program by a common factor triggers the meiotic cell cycle in mice. Elife. 2019 Feb 27;8:e43738. doi: 10.7554/eLife.43738. PMID: 30810530; PMCID: PMC6392498. [25] Zeng Y, Yang Q, Ouyang Y, Lou Y, Cui H, Deng H, Zhu Y, Geng Y, Ouyang P, Chen L, Zuo Z, Fang J, Guo H. Nickel induces blood-testis barrier damage through ROS-mediated p38 MAPK pathways in mice. Redox Biol. 2023 Nov;67:102886. doi: 10.1016/j.redox.2023.102886. Epub 2023 Sep 15. PMID: 37742495; PMCID: PMC10520947. [26] Zeng Y, Yang Q, Ouyang Y, Lou Y, Cui H, Deng H, Zhu Y, Geng Y, Ouyang P, Chen L, Zuo Z, Fang J, Guo H. Nickel induces blood-testis barrier damage through ROS-mediated p38 MAPK pathways in mice. Redox Biol. 2023 Nov;67:102886. doi: 10.1016/j.redox.2023.102886. Epub 2023 Sep 15. PMID: 37742495; PMCID: PMC10520947. [27] Peng BX, Li F, Mortimer M, Xiao X, Ni Y, Lei Y, Li M, Guo LH. Perfluorooctanoic acid alternatives hexafluoropropylene oxides exert male reproductive toxicity by disrupting blood-testis barrier. Sci Total Environ. 2022 Nov 10;846:157313. doi: 10.1016/j.scitotenv.2022.157313. Epub 2022 Jul 14. PMID: 35842142. [28] Lucas TF, Siu ER, Esteves CA, Monteiro HP, Oliveira CA, Porto CS, Lazari MF. 17beta-estradiol induces the translocation of the estrogen receptors ESR1 and ESR2 to the cell membrane, MAPK3/1 phosphorylation and proliferation of cultured immature rat Sertoli cells. Biol Reprod. 2008 Jan;78(1):101-14. doi: 10.1095/biolreprod.107.063909. Epub 2007 Oct 10. PMID: 17928626. [29] Zhuang T, Zhang S, Liu D, Li Z, Li X, Li J, Yang P, Zhang C, Cui J, Fu M, Shen F, Yuan L, Zhang Z, Su P, Zhu J, Yang H. USP36 promotes tumorigenesis and tamoxifen resistance in breast cancer by deubiquitinating and stabilizing ERα. J Exp Clin Cancer Res. 2024 Aug 31;43(1):249. doi: 10.1186/s13046-024-03160-2. PMID: 39215346; PMCID: PMC11365244. [30] Ma J, Dong S, Lu H, Chen Z, Yu H, Sun X, Peng R, Li W, Wang S, Jiang Q, Li F, Ma L. The hydrogen storage nanomaterial MgH2 improves irradiation-induced male fertility impairment by suppressing oxidative stress. Biomater Res. 2022 May 26;26(1):20. doi: 10.1186/s40824-022-00266-6. PMID: 35619159; PMCID: PMC9134580. Declarations Ethics approval and consent to participate The Animal Care/User Ethics Committee of Soochow University and the Ethics Committee at the Second Affiliated Hospital of Soochow University reviewed and approved the research project entitled the Mechanism of Action in Ionizing Radiation Induced Sperm Abnormalities (Approval No. JD-LK-2020–019–02) on May 10, 2021. Consent for publication Not applicable. Availability of data and materials all additional files are included in the manuscript. Competing interests The authors declare no competing interests. Funding This work was funded by Suzhou Municipal Bureau of Science and Technology(2023SS19). Author contributions Ya Luo performed all experiments of this study, completed all data analysis and visualization procedures, and wrote the original manuscript, as well as completed the revision procedure and response to reviewer’s comments. Lingxiang Ran conceived and supervised the research. Kang Liu, Nengliang Duan, Huapei Wang, Long Sun and Yao yao assisted with data collection. Lixia Wang and Boxin Xue funded the research. All authors read and approved the final manuscript. Acknowledgements The authors declare that they have not use AI-generated work in this manuscript. Information & Authors Information Version history V1 Version 1 10 March 2025 Copyright This work is licensed under a Non Exclusive No Reuse License. Keywords drug delivery estrogen/oestrogens and estrogen receptors reproduction pharmacology Authors Affiliations Ya Luo Second Affiliated Hospital of Soochow University View all articles by this author Ran Lingxiang Peking University First Hospital View all articles by this author Liu Kang Second Affiliated Hospital of Soochow University View all articles by this author Ran Yuanshuai Second Affiliated Hospital of Soochow University View all articles by this author Yao Yao Second Affiliated Hospital of Soochow University View all articles by this author Duan Nengliang Second Affiliated Hospital of Soochow University View all articles by this author Wang Huapei Second Affiliated Hospital of Soochow University View all articles by this author Sun Long Second Affiliated Hospital of Soochow University View all articles by this author Wang LIxia Second Affiliated Hospital of Soochow University View all articles by this author Xue Boxin [email protected] Second Affiliated Hospital of Soochow University View all articles by this author Metrics & Citations Metrics Article Usage 220 views 139 downloads .FvxKWukQNSOunydq8rnd { width: 100px; } Citations Download citation Ya Luo, Ran Lingxiang, Liu Kang, et al. Telmisartan can promote spermatogenesis in irradiated mice by inhibiting ESR1 protein degradation in Sertoli cells. Authorea . 10 March 2025. DOI: https://doi.org/10.22541/au.174160738.80224775/v1 If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. Simply select your manager software from the list below and click Download. For more information or tips please see 'Downloading to a citation manager' in the Help menu . Format Please select one from the list RIS (ProCite, Reference Manager) EndNote BibTex Medlars RefWorks Direct import Tips for downloading citations document.getElementById('citMgrHelpLink').addEventListener('click', function() { popupHelp(this.href); return false; }); $(".js__slcInclude").on("change", function(e){ if ($(this).val() == 'refworks') $('#direct').prop("checked", false); $('#direct').prop("disabled", ($(this).val() == 'refworks')); }); View Options View options PDF View PDF Figures Tables Media Share Share Share article link Copy Link Copied! Copying failed. Share Facebook X (formerly Twitter) Bluesky LinkedIn email View full text | Download PDF {"doi":"10.22541/au.174160738.80224775/v1","type":"Article"} Now Reading: Share Figures Tables Close figure viewer Back to article Figure title goes here Change zoom level Go to figure location within the article Download figure Toggle share panel Toggle share panel Share Toggle information panel Toggle information panel Go to previous graphic Go to next graphic Go to previous table Go to next table All figures All tables View all material View all material xrefBack.goTo xrefBack.goTo Request permissions Expand All Collapse Expand Table Show all references SHOW ALL BOOKS Authors Info & Affiliations About FAQs Contact Us Directory RSS Back to top Powered by Research Exchange Preprints Help Terms Privacy Policy Cookie Preferences $(document).ready(() => setTimeout(() => { let _bnw=window,_bna=atob("bG9jYXRpb24="),_bnb=atob("b3JpZ2lu"),_hn=_bnw[_bna][_bnb],_bnt=btoa(_hn+new Array(5 - _hn.length % 4).join(" ")); $.get("/resource/lodash?t="+_bnt); },4000)); (function(){function c(){var b=a.contentDocument||a.contentWindow.document;if(b){var d=b.createElement('script');d.innerHTML="window.__CF$cv$params={r:'a0031c24ef041b23',t:'MTc3OTUyOTMzOQ=='};var a=document.createElement('script');a.src='/cdn-cgi/challenge-platform/scripts/jsd/main.js';document.getElementsByTagName('head')[0].appendChild(a);";b.getElementsByTagName('head')[0].appendChild(d)}}if(document.body){var a=document.createElement('iframe');a.height=1;a.width=1;a.style.position='absolute';a.style.top=0;a.style.left=0;a.style.border='none';a.style.visibility='hidden';document.body.appendChild(a);if('loading'!==document.readyState)c();else if(window.addEventListener)document.addEventListener('DOMContentLoaded',c);else{var e=document.onreadystatechange||function(){};document.onreadystatechange=function(b){e(b);'loading'!==document.readyState&&(document.onreadystatechange=e,c())}}}})();