Fatal infection of a novel canine/human reassortant H3N2 influenza A virus in the zoo-housed golden monkeys

Fatal infection of a novel canine/human reassortant H3N2 influenza A virus in the zoo-housed golden monkeys | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Fatal infection of a novel canine/human reassortant H3N2 influenza A virus in the zoo-housed golden monkeys X Wen, Xia Wen, Rong Chen, Yingjun Lv, Jinzhu Geng, Jingjing Guo, and 7 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6582619/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 6 You are reading this latest preprint version Abstract Influenza A virus (IAV) is one of the most challenging pathogens that threaten human and animal health. In June 2022, seven golden monkeys ( Rhinopithecus roxellanaes ) developed flu-like symptoms in succession at a zoo in Jiangsu Province of China, two of which died of respiratory distress. All the swab samples from affected golden monkeys were tested positive for IAV. In the dead animals, the most notable involved organ is the lung, which manifested as emphysema and pulmonary parenchymatous carnification. Histopathological and immunostaining data supported a diagnosis of pulmonary infection with influenza virus. One strain of H3N2 virus, named A/golden monkey/Jiangsu/1/2022 (Gm-1), was isolated from the lungs of dead golden monkeys. Sequence and phylogenetic analysis revealed that its PB1 gene is most closely related to an influenza isolate obtained from human (A/Hong Kong/4801/2014), while the remaining 7 genes show 100% sequence identity with those of canine H3N2 virus (A/canine/Jiangsu/06/2010, JS06). Experimental infection of two rescued viruses (rGm-1 and rJS06) by reverse genetics in BALB/c mice revealed that the rGm-1 virus induced more persistent pathological damage in the lungs, and was less likely to be cleared, compared to the rJS06 virus. Further investigation indicated that human-origin PB1 could induce higher levels of proinflammatory cytokines than canine-origin PB1, which might be a contributing factor to pathobiological characteristics displayed by the rGm-1 virus. This study extends the host range of influenza viruses, and underscores the need for efficient biosecurity practices and enhanced surveillance efforts in the endangered species. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction Influenza A virus (IAV) is an enveloped segmented, negative-sense RNA virus in the family Orthomyxoviridae, which infects a broad range of avian and mammalian species. Based on the antigenic differences of the surface glycoproteins, hemagglutinin (HA) and neuraminidase (NA), IAVs are divided into 18 HA and 11 NA subtypes. Because the IAV RNA polymerase has low fidelity and lacks exonuclease activity, antigen drift might occur during viral replication, which increases the possibility of virus escaping host immunity. Moreover, IAVs are prone to gene recombination because of the segmented nature of the genome, when two or more different viruses infect a same host. The exchange of gene fragments between different IAV strains accelerates viral evolution and the emergence of new viruses with pandemic potential. Since the early 20th century, three human influenza pandemics have been caused by genetically reassortant viruses. 1 The natural reservoir of IAVs is the wild bird ecosystem. However, in the last hundred years, IAVs derived from wild birds have breached the species barrier and been stably adapted to humans and a variety of animals including horses, dogs, pigs, cats and other mammals. In 2022, two cases of avian influenza A H3N8 virus were reported in China. 2 Spill-over events of IAVs from wild water-birds to seals have been reported on different occasions. 3 From 2014 to 2015, three strains of highly pathogenic H5N1 influenza virus were isolated and identified from four tigers that died of respiratory failure in a zoo in Yunnan Province, China. 4 In late 2016, two zoos in Japan experienced highly pathogenic avian influenza (HPAI) outbreaks, in which multiple zoo-housed birds were infected with H5N6 subtype HPAI virus (HPAIV). 5 In 2008, avian-origin H3N2 canine influenza virus (CIV) was first reported in South Korea, causing an outbreak of respiratory disease in dog populations. 6 Subsequently, this virus spreads widely across some geographical areas in Asia, including China 7 and Thailand. 8 In 2015, H3N2 influenza virus emerged in the United States, causing an outbreak of respiratory disease in thousands of dogs. 9 This virus was subsequently detected in Canada as well. 10 Further studies suggest that this H3N2 virus has adapted to dogs and diverged genetically from avian influenza virus. 11 Due to the mild clinical symptoms caused by this viral infection in dogs, there is a lack of effective control and prevention strategies. This leads to the possibility that dogs harboring H3N2 virus may transmit it to other species with which they are in close contact, thus accelerating influenza evolution and transmission. These findings suggest that the host range of IAV infection is constantly expanding, which may be related to the direct contact of hosts with infected animals or contaminated environment. The genome of IAV comprises eight RNA segments (vRNA) that are transcribed and replicated by the heterotrimeric RNA-dependent RNA-polymerase (RdRp) consisting of PA (polymerase acidic), PB1 (polymerase basic 1) and PB2 (polymerase basic 2). PB1 protein is the catalytic core of the polymerase complex, which is responsible for catalyzing RNA polymerization and binding to the viral RNA promoter, while PB2 and PA proteins play a role in the cap-grab process of viral messenger RNA (mRNA) synthesis. RdRp can significantly affect viral virulence, innate immunity and host adaptability. Studies have shown that the avian-origin PB1 segment can increase polymerase activity of human influenza virus and improve replication efficiency of the recombinant virus in mammalian cells, 12 even enhance virulence in mice. 13 It has also been reported that the PB1 protein of the 1968 H3N2 pandemic influenza virus can inhibit the antiviral response induced by the interferon (IFN) after adaptive synonymous codon mutation. 14 In this study, we isolated and identified a canine/human reassortment H3N2 virus from the golden monkey ( Rhinopithecus roxellana ) died of respiratory failure at a zoo in Jiangsu Province. This viral strain has PB1 segment derived from human influenza virus, while the remaining seven fragments are all derived from the canine virus. Further investigation demonstrated that the human-origin PB1 promotes the production of proinflammatory cytokines and chemokines, and exacerbates influenza lesions in mice. To our knowledge, this is the first report of IAV infection in golden monkeys. Materials and methods Ethics Statement All SPF BALB/c mice(5 weeks old, female)were purchased from the Animal Experiment Center, Yangzhou University. Before conducting animal experiments, we obtained approval for the experimental program from the Animal Ethics Committee of Nanjing Agricultural University, China (License No.:SYXK (Su) 2021-0086). All animal experiments were conducted following the guidelines of the China Animal Welfare Commission. All efforts were made to minimize the animals’suffering. Case identification and sample collection In June 2022, seven adult female golden monkeys living at a zoo in Jiangsu province of China developed flu-like symptoms in succession, and two animals died on the 3rd and 7th day after onset of illness, respectively. Clinical samples including nasal swabs, sera and lung tissues were collected by field veterinarians from the affected zoo. Virus detection Nasal swabs collected from the clinically affected animals (n = 7) were used to test for the infection of influenza viruses. Viral RNA was extracted from the supernatants of nasal swabs using the Virus Nucleic Acid Extraction Kit II (Geneaid, Taiwan). Reverse transcription was carried out using primer Uni12 (5′AGCRAAAGCAGG3′), then a nested PCR for the matrix (M) gene (target for IAV detection) was performed. Virus isolation Lung samples from dead animals were homogenated in phosphate-buffered saline (PBS, pH 7.2) and centrifuged at 12, 000 g for 10 min. The supernatants were filtered using 0.22-µm membrane filter (Millipore, USA). Then the resulting filtrates were inoculated into Madin-Darby Canine Kidney (MDCK) cells. The infected monolayers with cytopathic effect (CPE) were harvested at 4 days post-infection (dpi) by three cycles of alternative freezing and thawing. The isolated virus was identified by whole genome sequencing. Genomic sequencing and phylogenetic analysis To identify and characterize the influenza virus isolated from the golden monkey, whole genome sequencing was conducted. Viral RNA from the infected cells was extracted using Viral RNA Kit (Omega, USA), and the cDNA was synthesized with the primer Uni12 (5’AGCAAAAGCAGG3’) using HiScript II Q Select RT SuperMix (Vazyme, China), followed by PCR amplification as previously described, 15 using primers specific for each of the eight RNA segments. PCR products were purified with a PCR purification kit (Omega Bio-Tek, USA) and sequenced on an ABI3500XL DNA sequencer. Sequence data were analyzed using MegAlign software and BLAST ( http://blast.ncbi.nlm.nih.gov/Blast.cgi ). The reference nucleotide sequences were obtained from the Global Influenza Shared Database (GISAID) for phylogenetic analysis. Phylogenetic trees were generated based on maximum likelihood method (ML) with 1,000 bootstrap replicates by MEGA software (version 7.0). Virus rescuing by reverse genetics The recombinant viruses were rescued by an eight plasmid reverse genetics system. Eight expression plasmids containing influenza virus genomic segments were transfected into 293T cells using Lipomaster 2000 Transfection Regent (Vazyme, China) according to the manufacturer’s protocol. Supernatants were collected at 3 days post transinfection, and titrated by plaque assay in MDCK cells. Virus titration by plaque assay MDCK cells were seeded in 12-well plates and infected with 10-fold serial dilutions of supernatants of lung homogenates in DMEM medium(Wisent, Canada) containing 0.5 µg/mL L-1-tosylamide-2-phenylethyl chloromethyl ketone (TPCK) (Sigma, USA)-treated trypsin for 1 h at 37°C. Then MDCK cells were washed three times with PBS and overlaid with 1% low-melting point agarose (Beyotime Biotechology, China) in DMEM medium containing 0.5 µg/mL TPCK-treated trypsin. After 72 h of incubation, the cells were fixed with 4% formalin, and plaques were stained with 0.05% crystal violet and counted. Virus concentration was calculated as plaque forming units (PFU) /mL. The experiments were performed in triplicate. Viral growth kinetics A549 and MDCK cells were respectively seeded in 12-well plates to develop into a monolayer, and then inoculated with each viruses. After absorption of the viruses for 1 h, the cells were washed three times with PBS, and incubated at 37°C in 5% CO 2 . Supernatants were sampled at 12, 24, 36, 48, 60 and 72 hours post infection (hpi), respectively, and virus titers were determined by plaque assay on MDCK cells. Experimental infection of mice Forty-five groups of 6-week-old female BALB/c mice (Animal Experiment Center, Yangzhou university, China) were divided into three group. GroupⅠ(n = 15) and group Ⅱ (n = 15) were inoculated intranasally with 2×10 6 PFU of each virus, respectively in a total volume of 50 µL, while group Ⅲ was treated with PBS as control. The body weight loss of mice were monitored daily for 14 d. Three mice from each group were euthanized at 2, 4, 6, 8 and 14 dpi, and tissues including lungs and nasal turbinates were collected for virus titration and quantitation of cytokine levels. A lobe of lung tissue was fixed in 4% neutral buffered formalin for histopathological and immunohistochemical examination. All experimental procedures are approved by the Animal Protection and Ethics Committee of Nanjing Agricultural University (approval number PT2020022) . Histopathology and immunochemistry The histopathological examination was performed with hematoxylin and eosin (H&E) staining with paraffin-embedded sections (4 µm thickness). The histopathological scores were graded based on the percentage of pathological changes observed of each lung tissue section, such as changes of lung structure, the degeneration and necrosis of bronchiole epithelial cells and alveoli pneumocytes, edema or fibrinous protein exudation in the alveolar lumina, and infiltration of inflammatory cells. The semiquantitative assessment was performed using the following scoring system: 16 0, no visible lesions; 1, lesion areas (< 10%); 2, lesion areas (< 30%, ≥ 10%); 3, lesion areas (< 50%, ≥ 30%); 5, lesion areas (< 50%). As for immunohistochemical evaluation, the lung sections were immunostained with a rabbit polyclonal antibody against viral nucleoprotein (NP) (prepared in our laboratory) and horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG (Biosharp, China). Cells showing a brownish yellow membrane or cytoplasm were determined to be NP positive. The scores was assigned based on the percentage of NP-positive cells as the following: 16 0, no positive cells; 1, positive cells (< 5%); 2, positive cells (< 10%, ≥ 5%); 3, positive cells (< 20%, ≥ 10%); 4, positive cells (≥ 20%). Quantitation of cytokine levels Real-time quantitative PCR (RT-qPCR) was used for quantitation of cytokines interleukin (IL)-1β, IL-6, interferon (IFN)-β and IFN-γ, and chemokines CCL2 and CCL3 levels. Total RNA of lung was extracted by using a total tissue RNA extraction kit (Omega Bio-Tek), and reverse-transcribed into cDNA using HiScript II Q RT SuperMix for kit (Vazyme). Then ChamQ SYBR qPCR Master Mix kit (Vazyme) was applied for quantitative PCR using gene-specific primers on 7300 Real-Time PCR System (Applied Biosystems). The β-actin housekeeping gene was amplified as an internal control. The comparative cycle threshold (2 −△△CT ) method was used to determine the mRNA levels. The sequences of the primers were as follows: IL-1β-F/R 5’GAAATGCCACCTTTTGACAGTG3’/5’TGGATGCTCTCATCAGGACAG3’;IL-6-F/R ’CTGCAAGAGACTTCCATCCAG3’/5’CTGCAAGAGACTTCCA TCCAG3’; IFN-β-F/R 5’CA GCTCCAAGAAAGGACGAAC3’/5’GGCAGTGTAA CTCTTCTGCAT3’; IFN-γ-F/R 5’ATGAACGCTACA CACTGCATC3’/5’CCATCC TTTTGCCAGTTCCTC3’;CCL2-F/R 5’TTAAAAACCTGGATCGGAACCAA3’/ 5’GCATTAGCTTCAGATTTACGGGT3’; CCL3-F/R 5’TTCTCTGTACCATGACA CTCTGC3’/5’CGTGGAATCTTCCGGCTGTAG3’; β-actin-F/R 5’TGACAGGATG CAGAAGGAGA3’/ 5’GCTGGAAGGTGGACAGTGAG3’. Serological survey of the H3N2 virus infection in golden monkeys Serum samples obtained from golden monkeys were collected to determine the haemagglutination inhibition (HI) activity according to the standard method (WHO Manual on Animal Influenza Diagnosis and Surveillance, http://www.who.int/iris/handle/10665/68026 ). The HI titers were expressed as the log 2 of the reciprocal of the highest dilution, resulting in complete inhibition of red blood cells. Statistical analysis All statistical analyses were performed with GraphPad Prism version 9 ( www.graphpad.com ). An unpaired Student’s t-test was employed to determine statistical differences among groups. A significance level of less than 0.05 was considered statistically significant for all analyses. Results On 5 June, 2022, one adult male golden monkey experienced flu-like symptoms such as fever, cough, shortness of breath, lethargy and anorexia at a zoo in Jiangsu province of China. Nasal swabs from this animal were collected for detection of IAV M gene by nested PCR. As expected, the samples were tested positive for IAV infection. Therefore, this diseased animal received oral treatment with oseltamivir, a specific anti-influenza drug, and other supportive therapy. Regretfully, however, this animal died from severe respiratory failure on the 3rd day after onset of illness. Two days later, on June 9th, another adult male golden monkey showed flu symptoms, and rapidly developed severe pneumonia. Despite timely treatment, this animal died on the 7th day after onset of illness. On June 15th, out of the remaining 10 golden monkeys in the same group, 5 more showed the symptoms of influenza. Fortunately, the five animals recovered after 7 days of treatment. The disease details of seven animals are shown in Fig. 1 . To determine the cause of death, the two animals were dissected. The most notable involved organ is the lung, characterized by emphysema and pulmonary parenchymatous carnification (Fig. 2 ). Therefore, lung tissues were collected for histopathology and immunochemistry examination and virus isolation. We also performed bacterial isolation, but no pathogenic bacteria were identified. As shown by Fig. 2 , two lung tissues exhibited similar histopathological lesions, manifested with thickening of the alveolar septa, edema, and interstitial inflammatory cell infiltration, with a large area of consolidation. Further, sections from the two lung tissues were immunostained with a mouse polyclonal antibody against IAV nucleoprotein (NP), and positive staining alveolar and bronchial epithelial cells were detectable. These data supported a diagnosis of pulmonary infection with influenza virus in the golden monkey. Next, we made efforts to isolate and identify the influenza virus derived from golden monkeys. After serially passaged in MDCK cells, one strain of influenza virus, named A/golden monkey/Jiangsu/1/2022 (herein Gm-1), was isolated out of the lung samples from dead golden monkeys. To characterize the molecular properties of the isolated virus, we determined the nucleotide sequences of the eight RNA segments of the viral genome. Sequence data have been submitted to GenBank, with the accession numbers from PO764562 to PO764569. Sequence comparison with known influenza virus genes showed that except for the PB1 gene, intriguingly, the remaining seven fragments exhibit 100% of identity to a canine H3N2 virus, A/canine/Jiangsu/06/2010 (herein JS06). The PB1 gene of the Gm-1 shows the highest identity (97.3% sequence identity) with the human strain A/Hong Kong/4801/2014, but only has 81.4% of sequence identity with the canine strain JS06. To explore the origin of PB1 gene in the Gm-1 virus, we included the sequences of human, swine, canine and avian influenza viruses reported in different regions of China from January 2014 to December 2024 to perform the phylogenetic analysis. As shown in Fig. 3 , these viruses could be grouped into approximately 8 clusters, with 3 human virus clusters, 3 avian virus clusters, 1 swine virus cluster and 1 canine virus cluster. The golden monkey isolate fell within a human virus cluster and formed an independent phylogenetic subclade, in which the virus stains were isolated from humans in Shanghai, Fujian, Guizhou, Hubei and Hong Kong. Therefore, we speculate that the PB1 gene is most likely to have originated from human viruses, and the Gm-1 is a canine/human reassortant influenza virus. Six months after the outbreak, we collected nasal swabs and serum samples from 5 recovered golden monkeys and 5 asymptomatic contacts for detection of viral M gene and HI activity, respectively. Our data indicated that all the nasal swabs were tested negative for IAV infection, but the 10 animals were seropositive using the Gm-1 virus as antigen, with the HI antibody titers of 7log2 (30%), 5log2 (50%) and 4log2 (20%), respectively. The high seroprevalence in golden monkeys suggests that the virus can spread efficiently among golden monkeys, and antibodies induced by this virus can be maintained for a long time after remission of influenza infection. To determine whether substitution of the PB1 segment of a canine parent by that of an human parent enhances viral replication, we developed a reverse genetic system to reconstruct this reassortment event. Because the exact origin of canine-human reassortant virus are not known, we focused on the closest available viruses. Therefore, we used the JS06 as a model of the canine virus parent, and the Gm-1 as a source of human-origin PB1 gene. To produce infectious influenza viruses, we constructed eight plasmids that contain cDNAs for the full-length viral RNAs and transinfected them into the 293T cells. At 72h post transinfection, we obtained two recombinant virues, rGm-1 and rJS06, which differed solely by the origin of the PB1 segment. Further, we evaluated their replication ability in human alveolar epithelial cell A549 and canine kidney epithelial cell MDCK. As shown in Fig. 4 A, rJS06 displayed a relatively higher growth capacity than rGm-1 in canine MDCK cells, especially at 36 hours post-infection (hpi) ( P < 0.001) and 72 hpi ( P < 0.05). In contrast, the two viruses exhibited similar growth kinetics in human A549 cells (Fig. 4 B), indicating that human PB1 did not provide the virus with a replicative advantage in human cells. In order to determine the role of human PB1 gene in influenza virus pathogenicity, we evaluated viral virulence in a well-established BALB/c mouse model. 9 Two infection groups of mice were inoculated with 2×10 6 PFU of rGm-1 or rJS06, while mice in the control group were inoculated with PBS. As expected, all the mice of three groups survived through day 14, when the experiment was terminated. Although all three groups of mice gained weight at the end of the observation period, mice infected with rGm-1 or rJS06 exhibited clearly evident body weight loss compared to PBS group from the 4 dpi (Fig. 5 A). In particular, the weight loss of mice in rGm-1 group was statistically significantly higher than that in rJS06 group at the 3, 4, 5, 7 and 8 dpi ( P < 0.05 or P < 0.01 or P < 0.001). Three mice per group were euthanized at 2, 4, 6, 8 and 14 dpi, respectively, and the lung and nasal turbinate were taken and viral load was determined in MDCK cells by plaque assay. High virus loads were observed in the lung (Fig. 5 B) and nasal turbinate (Fig. 5 C) of either rGm-1- or rJS06-inoculated mice before the 6th dpi, while no infectious virus was detected in lung or nasal turbinate from day 8. When comparing two virus infection groups, no significant difference was observed in virus titers of the lung and nasal turbinate between rGm-1- and rJS06-inoculated mice at 2 dpi. But at 4 and 6 dpi, compared with rJS06, virus titer of rGm-1 in the lung were significantly increased ( P < 0.01 or P < 0.001), while in nasal turbinate, mice infected with rGm-1 also exhibited higher titers than the rJS06-inoculated mice ( P < 0.01) at 6 dpi. This finding indicated that the rGm-1 was less easily cleared from the mice as compared to the rJS06. We also performed histopathological evaluation on the lung sections from the mice inoculated with rGm-1 and rJS06 viruses. Severe peribronchiolitis, manifested with thickening of the alveolar septa, degeneration and necrosis of bronchiolar epithelial cells, and numerous interstitial inflammatory cell infiltration in vessel were evident in rGm-1- and rJS06-infected mice at 2 and 4 dpi (Fig. 6 ). But the histopathology scores of the lungs of rGm-1-infected mice did not show significant difference from those of rJS06-inoculated mice at the two time points. At 6 dpi, mice infected with the rGm-1 virus exhibited more severe lung lesions than rJS06-infected mice, along with a statistically higher level of histopathology score (Fig. 6 ). In accordance with the severe of lung lesion, immunostaining analysis revealed numerous viral antigen-positive alveolar and bronchial epithelial cells in mice infected with the rGm-1 and rJS06 viruses at 2 to 4 dpi (Fig. 7 ). However at 6 dpi, plenty of viral antigen-positive alveolar epithelial cells were found in the lungs of rGm-1-infected mice, whereas few were found in rJS06-infected mice (Fig. 7 ). To further investigate if the two viral strains induced different immune responses, we measured the transcription levels of proinflammatory cytokines IL-1β, IL-6, IFN-β and IFN-γ, and chemokines CCL2 and CCL3 in the lungs of mice. As shown by Fig. 8 , expression of four proinflammatory cytokines in each virus group showed similar trends from 2 to 6 dpi, all of which significantly increased as compared to the PBS group ( P < 0.05 or P < 0.01 or P < 0.001 or P 0.05). At 8 dpi, although no significant differences were observed in the IL-1β (Fig. 8 A) and IL-6 (Fig. 8 B) between virus infected groups and PBS group ( P > 0.05), while IFN-β (Fig. 8 C) and IFN-γ (Fig. 8 D) in virus infection groups showed statistically higher expression levels than those in the PBS group ( P < 0.01 or P < 0.001). Interestingly, expression of all the four proinflammatory cytokines was statistically higher in the rGm-1 group than that in the rJS06 group ( P 0.05). As for the two chemokines, the mRNA transcription of CCL2 in the rGm-1 group showed a significant increase at 2 and 4 dpi ( P < 0.0001) but a significant decrease at 6 and 8 dpi ( P < 0.0001), as compared to the rJS06 group (Fig. 8 E). The CCL3 gene expression exhibited consistently lower level in the rGm-1 group ( P < 0.0001) than did the rJS06 group from 2 to 8 dpi (Fig. 8 F). At 14 dpi, there was no significant difference for CCL2 or CCL3 gene expression between the two infected groups. Compare with the PBS group, the rJS06 group exhibited a higher expression level of CCL2 before day 6 ( P < 0.05 or P < 0.0001) and a significant upregulation of CCL3 at 2 dpi ( P < 0.0001), while the rGm-1 group showed significantly elevated levels of both CCL2 and CCL3 until day 8 ( P < 0.0001). All these data indicated that the origin of the PB1 fragment is linked to the host inflammatory response induced by influenza viruses. Discussion Since 2007, H3N2 virus is the predominant circulating influenza subtype detected among dog populations in most countries, including China and South Korea. Given the closeness of dogs to humans and some other animals (cats, birds, ducks, etc.), dogs can act as a “mixing vessel”of the influenza virus. 24 Numerous studies have shown that dogs could be infected from various origins of influenza viruses, such as human H1N1 and H3N2, swine H1N1, avian H5N1, H5N6 and H6N1, and recombinant H3N6 viruses. 24 – 28 If a dog is co-infected with different subtypes of influenza viruses, it is likely that a novel virus strain can be generated by gene mutation or exchange of segments. Then this virus can undergo an adaptive evolution that facilitates cross-species transmission, posing a potential pandemic risks. Here, we report the golden monkey case of infection with a novel reassortant virus containing the PB1 gene from a human H1N1 virus and the rest of the RNA segments from previously circulating canine H3N2. This is the first report of IAV infection in golden monkey. Golden monkey is an endangered species endemic to China. Most of investigations conducted in this species of monkeys have focused on its breeding and behaviour. Recently, however, some studies have shown that golden monkeys are susceptible to a number of zoonotic pathogens, such as hepatitis B virus (HBV), macacine herpesvirus-1 (MaHV-1), hepatitis A virus (HAV) and cytomegalovirus (CMV). 29 , 30 In this study, influenza A was detected in seven golden monkeys diagnosed with pneumonia, and even cause deadly illness. Phylogenetic analysis for the influenza virus strain from this case revealed that seven segment sequences were 100% homologous to the canine H3N2 virus found in Jiangsu, while only the PB1 gene exhibited high identity with a human viruses. Epidemiological investigation revealed the keeper, who kept a contact with golden monkeys by feeding and caring with them, has suffered from a bad cold before the onset of clinical signs in golden monkeys, although no pathogens have been detected timely. And notably, the molecular test on the nasal and anal swab samples from two dogs kept in the zoo yielded positive results for IAV. Because golden monkeys, an endangered species with the highest level of protection and care, have no preexisting immunity against IAVs, a new intrusion of the pathogen may result in high fatalities. Currently, we are not known how the IAVs spill over to golden monkeys, and cause respiratory infections. We speculate that both the respiratory and gastrointestinal routes of infection may cause horizontal transmission among dog, golden monkeys and humans. This reassortment event might occur in three pathways (figure S1 ). The first pathway involves simultaneous infection with both human and canine influenza viruses and exchange of gene fragments to form a novel virus in golden monkeys; the second pathway involves a human or dog host where the parental viruses coinfect and the reassortment event occurs, followed by adaptive evolution and transmission to golden monkeys; the third pathway involves an unknown animal host that is coinfected with two parental viruses and serves as a mixer to form a novel virus that retains the ability to infection in golden monkeys. Certainly, these are only hints and guesses, and there is currently not enough epidemiological evidence in support of them . Since PB1 is the only gene that differs between Gm-1 and JS06, it is possible that PB1 is involved in the more severe pathogenic phenotype of Gm-1. Historically, the recombination event of avian PB1 fragment has been seen in the 1957, 1968, and 2009 IAV pandemics, and has been shown to play an important role in the adaptation of avian influenza virus strains to mammal. 40 , 41 In this study, the novel H3N2 recombinant virus could successfully cross the species barrier to golden monkeys, suggesting that the human PB1 may enhance the pathogenicity of recombinant virus. This idea can be supported by the finding that infection of the rGm-1 virus caused more obvious weight loss and more persistent lesions in mice, when compared with the rJS06 virus. The severity caused by influenza viruses is linked with excessive host inflammatory response. 31 – 33 During the infection of influenza virus, infected epithelial cells, endothelial cells, and alveolar macrophages could produce and release a large number of cytokines and chemokines, which affects the clearance of pathogenic microorganisms and the outcome of the disease. 34 IL-1β and IL-6 are well-known proinflammatory cytokines that play key roles in inflammation and inmmunologic reactions. High levels of the two cytokines can aggravate the disease in the infection process of H1N1, H3N2, and H7N9 influenza virus. 35 , 36 In addition, overexpression of the IFNs has been found to aggravate the disease by amplifying inflammatory reaction and exacerbating lung damage. 37 In this study, infection with the rGm-1 virus significantly upregulated the expression of IL-1β, IL-6, IFN-β and IFN-γ compared to the rJS06 virus in the early stage of infection, which may be the cause of lung damage and severe disease in mice. Of note, different from the above four cytokines, proinflammatory chemokines CCL2 (at 6 and 8 dpi) and CCL3 (from 2 to 8 dpi) exhibited a relatively lower level in rGm-1-infected mice compared to rJS06-infected mice. The two chemokines are known to play key role in guiding the migration of mononuclear cells to the site of inflammation, which is conducive to virus control. 38 , 39 In this study, our data from plaque assay and immunostaining indicated a much slower clearance of the rGm-1 from the mice, as compared to the rJS06. The relatively lower CCL2 and CCL3 levels induced by rGm-1 infection might provide an explanation for this phenomenon. Although it is unclear how human PB1 affects the severity of influenza in golden monkeys, the PB1-F2 protein encoded by an alternate open reading frame within the PB1 gene has been shown to contribute to the pathogenesis of influenza infection. 42 This protein has been reported to degrade the mitochondrial antiviral-signaling (MAVS) protein by mitophagy, and inhibit type I IFN production. 43 Several studies demonstrated that this protein enhance viral virulence due to lower clearance from the lungs, and increased neutrophil infiltration and immunopathology. 44 – 46 In this study, we examined the molecular characterization of PB1-F2 in the Gm-1 and JS06 viruses, and used two human H1N1 strains, PR8 and A/California/04/2009 (herein CA), as controls. As shown in Fig.S2, the CA virus contained a truncated and presumably non-functional PB1-F2 protein, while PR8, Gm-1 and JS06 encode full-length PB1-F2 (87–90 amino acids). Previous studies demonstrated that last one third of PB1-F2, including four inflammatory amino acids (62L, 75R, 79R and 82L) 47 and a cytotoxic motif (68I, 69L and 70V) 48 , at the C terminus, is linked with enhanced inflammatory response and pathogenicity during IAV infection. A previous study believed that the well-known fact that infection with the pandemic CA strain in 2009 caused milder illness symptoms than those induced by the previous pandemic viruses is likely due to the lacking of a fully functional PB1-F2. 49 In this study, three of four inflammatory residues could be identified in the PB1-F2 gene in either Gm-1 or JS06, so we speculate that difference in disease severity caused by the two viruses might be independent of inflammatory amino acids. Interestingly, however, the Gm-1 virus contains the cytotoxic motif but JS06 does not. It has been shown that full-length PB1-F2 protein with I68, L69, and V70 caused more cell death than those without. 48 This led us to speculate that this ILV motif from amino acids 68–70 in the Gm-1 virus could be main contributing factor to promoting lung immunopathology and exacerbating disease severity, although further investigation is needed to confirm this hypothesis. Future detailed study on the function of PB1-F2 in a panel of the recombinant viruses constructed on the JS06 background could provide more insights into the pathogenesis of the canine/human reassortment virus isolated from golden monkeys. In conclusion, our study provides virological and molecular evidence for identification of an H3N2 canine/human reassortment virus isolated from golden monkeys. This finding extends the host range of influenza viruses, and more importantly, highlights the risk posed by this pathogen to golden monkeys. Golden monkeys are at risk of influenza infection through close contact with humans. To protect the endangered species from this reverse zoonotic transmissible disease, the daily implement of biosecurity measures is essential. Animal keepers should get annual vaccinations against seasonal influenza and avoid contact with animals when they have flu-like symptoms. Considering the pandemic potential of newly emerging IAV and its risk of transmission between animals and humans, the ongoing surveillance are urgently needed. Declarations Ethics approval and consent to participate(Not applicable) Consent for publication(Not applicable) Availability of data and materials The original contributions presented in the study are included in the article, and further inquiries can be directed to the corresponding author(s). Contributors All authors conceptualised the study. XW performed virus direction, isolation, genomic sequencing and virus rescuing. XW, JZG, JJG, YRS, AHY and YHD conducted the mouse challenge experiment. XW, RC, YJL, MRL, CLD and GDW collected the samples and performed pathological and histological evaluation. XW, RC and YJL curated the data and performed the formal analysis. XW wrote the original draft of the manuscript. YJL performed the supervision of the research, data verification and analysis, writing, reviewing, editing and funding. Acknowledgements The study is supported by the National Natural Science Foundation of China (32273094), Jiangsu Provincial Science and Technology Plan Special Fund (Innovation Support Plan International Science and Technology Cooperation) (BZ2023048), Nanjing Greening and Landscape Bureau 2023 Technology Plan Projects (YLKJ202309JH), and Jiangsu Province Key Industry Talent Project. Funding National Natural Science Foundation of China, Jiangsu Provincial Science and Technology Plan Special Fund (Innovation Support Plan International Science and Technology Cooperation), Nanjing Greening and Landscape Bureau 2023 Technology Plan Projects, and Jiangsu Province Key Industry Talent Project. Competing interests We declare no competing interests. References Webster RG, Laver WG, Air GM, Schild GC(1982) Molecular mechanisms of variation in influenza viruses. Nature 296: 115–121. https://doi.org/10.1038/296115a0 Smith GJ, Vijaykrishna D, Bahl J, Lycett SJ, Worobey M, Pybus OG, Ma SK, Cheung CL, Raghwani J, Bhatt S, Peiri JS, Guan Y, Rambaut A(2009) Origins and evolutionary genomics of the 2009 swine-origin H1N1 influenza A epidemic. Nature 459: 1122–1125. https://doi.org/10.1038/nature08182 Kilbourne ED(2006) Influenza pandemics of the 20th century. Emerg Infect Dis 12: 9–14. https://doi.org/10.3201/eid1201.051254 Yang R, Sun H, Gao F, Luo K, Huang Z, Tong Q, Song H, Han Q, Liu J, Lan Y, Qi J, Li H, Chen S, Xu M, Qiu J, Zeng G, Zhang X, Huang C, Pei R, Zhan Z, Liu J(2022) Human infection of avian influenza A H3N8 virus and the viral origins: a descriptive study. Lancet Microbe 3: e824–e834. https://doi.org/10.1016/S2666-5247(22)00192-6 Lair S, Quesnel L, Signore AV, Delnatte P, Embury-Hyatt C, Nadeau MS, Lung O, Ferrell ST, Michaud R, Berhane Y(2024) Outbreak of Highly Pathogenic Avian Influenza A(H5N1) Virus in Seals, St. Lawrence Estuary, Quebec, Canada1. Emerg Infect Dis 30: 1133–1143. https://doi.org/10.3201/eid3006.231033 Berhane Y, Joseph T, Lung O, Embury-Hyatt C, Xu W, Cottrell P, Raverty S(2022) Isolation and Characterization of Novel Reassortant Influenza A(H10N7) Virus in a Harbor Seal, British Columbia, Canada. Emerg Infect Dis 28: 1480–1484. https://doi.org/10.3201/eid2807.212302 Hu T, Zhao H, Zhang Y, Zhang W, Kong Q, Zhang Z, Cui Q, Qiu W, Deng B, Fan Q, Zhang F(2016) Fatal influenza A (H5N1) virus Infection in zoo-housed Tigers in Yunnan Province, China. Sci Rep 6: 25845. https://doi.org/10.1038/srep25845 Usui T, Soda K, Sumi K, Ozaki H, Tomioka Y, Ito H, Murase T, Kawamoto T, Miura M, Komatsu M, Imanishi T, Kurobe M, Ito T, Yamaguchi T(2020) Outbreaks of highly pathogenic avian influenza in zoo birds caused by HA clade 2.3.4.4 H5N6 subtype viruses in Japan in winter 2016. Transbound Emerg Dis 67: 686–697. https://doi.org/10.1111/tbed.13386 Li S, Shi Z, Jiao P, Zhang G, Zhong Z, Tian W, Long LP, Cai Z, Zhu X, Liao M, Wan XF(2010) Avian-origin H3N2 canine influenza A viruses in Southern China. Infect Genet Evol 10: 1286–1288. https://doi.org/10.1016/j.meegid.2010.08.010 Lin Y, Zhao Y, Zeng X, Lu C, Liu Y(2012) Genetic and pathobiologic characterization of H3N2 canine influenza viruses isolated in the Jiangsu Province of China in 2009-2010. Vet Microbiol 158: 247–258. https://doi.org/10.1016/j.vetmic.2012.02.016 Bunpapong N, Nonthabenjawan N, Chaiwong S, Tangwangvivat R, Boonyapisitsopa S, Jairak W, Tuanudom R, Prakairungnamthip D, Suradhat S, Thanawongnuwech R, Amonsin A(2014) Genetic characterization of canine influenza A virus (H3N2) in Thailand. Virus genes 48: 56–63. https://doi.org/10.1007/s11262-013-0978-z Voorhees IEH, Glaser AL, Toohey-Kurth K, Newbury S, Dalziel BD, Dubovi EJ, Poulsen K, Leutenegger C, Willgert KJE, Brisbane-Cohen L, Richardson-Lopez J, Holmes EC, Parrish CR(2017) Spread of Canine Influenza A(H3N2) Virus, United States. Emerg Infect Dis 23: 1950–1957. https://doi.org/10.3201/eid2312.170246 Weese JS, Anderson MEC, Berhane Y, Doyle KF, Leutenegger C, Chan R, Chiunti M, Marchildon K, Dumouchelle N, DeGelder T, Murison K, Filejksi C, Ojkic D(2019) Emergence and Containment of Canine Influenza Virus A(H3N2), Ontario, Canada, 2017-2018. Emerg Infect Dis 25: 1810–1816. https://doi.org/10.3201/eid2510.190196 Zhu H, Hughes J, Murcia PR(2015) Origins and Evolutionary Dynamics of H3N2 Canine Influenza Virus. J Virol 89: 5406–5418. https://doi.org/10.1128/JVI.03395-14 Chauhan RP, Gordon ML(2022) An overview of influenza A virus genes, protein functions, and replication cycle highlighting important updates. Virus genes 58: 255–269. https://doi.org/10.1007/s11262-022-01904-w Wendel I, Rubbenstroth D, Doedt J, Kochs G, Wilhelm J, Staeheli P, Klenk HD, Matrosovich M(2015) The avian-origin PB1 gene segment facilitated replication and transmissibility of the H3N2/1968 pandemic influenza virus. J Virol 89: 4170–4179. https://doi.org/10.1128/JVI.03194-14 Cui H, Che G, de Jong MCM, Li X, Liu Q, Yang J, Teng Q, Li Z, Beerens N(2022) The PB1 gene from H9N2 avian influenza virus showed high compatibility and increased mutation rate after reassorting with a human H1N1 influenza virus. Virol J 19: 20. https://doi.org/10.1186/s12985-022-01745-x Smith BL, Chen G, Wilke CO, Krug RM(2018) Avian Influenza Virus PB1 Gene in H3N2 Viruses Evolved in Humans To Reduce Interferon Inhibition by Skewing Codon Usage toward Interferon-Altered tRNA Pools. mBio 9: e01222-18. https://doi.org/10.1128/mBio.01222-18 Ellis JS, Zambon MC(2001) Combined PCR-heteroduplex mobility assay for detection and differentiation of influenza A viruses from different animal species. J Clin Microbiol 39: 4097–4102. https://doi.org/10.1128/JCM.39.11.4097-4102.2001 Hoffmann E, Stech J, Guan Y, Webster RG, Perez DR (2001). Universal primer set for the full-length amplification of all influenza A viruses. Arch Virol 146: 2275–2289. https://doi.org/10.1007/s007050170002 Lin Y, Xie X, Zhao Y, Kalhoro DH, Lu C, Liu Y(2016) Enhanced replication of avian-origin H3N2 canine influenza virus in eggs, cell cultures and mice by a two-amino acid insertion in neuraminidase stalk. Vet Res 47: 53. https://doi.org/10.1186/s13567-016-0337-x Sun H, Li H, Tong Q, Han Q, Liu J, Yu H, Song H, Qi J, Li J, Yang J, Lan R, Deng G, Chang H, Qu Y, Pu J, Sun Y, Lan Y, Wang D, Shi Y, Liu WJ, Chang KC, Gao GF, Liu J(2023) Airborne transmission of human-isolated avian H3N8 influenza virus between ferrets. Cell 186: 4074–4084. https://doi.org/10.1016/j.cell.2023.08.011 Schmittgen TD, Livak KJ(2008) Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc 3: 1101–1108. https://doi.org/10.1038/nprot.2008.73 Chen Y, Trovão NS, Wang G, Zhao W, He P, Zhou H, Mo Y, Wei Z, Ouyang K, Huang W, García-Sastre A, Nelson MI(2018) Emergence and Evolution of Novel Reassortant Influenza A Viruses in Canines in Southern China. mBio 9: e00909-18. https://doi.org/10.1128/mBio.00909-18 Brown JD, Black A, Haman KH, Diel DG, Ramirez VE, Ziejka RS, Fenelon HT, Rabinowitz PM, Stevens L, Poulson R, Stallknecht DE(2024) Antibodies to Influenza A(H5N1) Virus in Hunting Dogs Retrieving Wild Fowl, Washington, USA. Emerg Infect Dis 30: 1271–1274. https://doi.org/10.3201/eid3006.231459 Yao XY, Lian CY, Lv ZH, Zhang XL, Shao JW(2023) Emergence of a novel reassortant H5N6 subtype highly pathogenic avian influenza virus in farmed dogs in China. J Infect 87: e70–e72. https://doi.org/10.1016/j.jinf.2023.07.013 Lin HT, Wang CH, Chueh LL, Su BL, Wang LC(2015) Influenza A(H6N1) Virus in Dogs, Taiwan. Emerg Infect Dis 21: 2154–2157. https://doi.org/10.3201/eid2112.141229 Meng B, Li H, Feng C, Guo W, Feng Y, Zhu D, Chen H, Zhang Y(2023) Emergence of a novel reassortant H3N6 canine influenza virus. Front Microbiol 14: 1186869. https://doi.org/10.3389/fmicb.2023.1186869 Lu G, Pan J, Zhang Y, Sun X, Ou J, Ji J, Yin X, Li S(2021) Hepatitis B virus detected in a golden monkey fatal case, China. Infect Genet Evol 94: 105032. https://doi.org/10.1016/j.meegid.2021.105032 Qi M, Wang Q, Wang Y, Chen Y, Hu C, Yang W, Wu F, Huang T, Dawood AS, Zubair M, Li X, Chen J, Robertson ID, Chen H, Guo A(2023) Epidemiological Survey and Risk Factor Analysis of 14 Potential Pathogens in Golden Snub-Nosed Monkeys at Shennongjia National Nature Reserve, China. Pathogens 12: 483. https://doi.org/10.3390/pathogens12030483 Oshansky CM, Gartland AJ, Wong SS, Jeevan T, Wang D, Roddam PL, Caniza MA, Hertz T, Devincenzo JP, Webby RJ, Thomas PG(2014) Mucosal immune responses predict clinical outcomes during influenza infection independently of age and viral load. Am J Respir Crit Care Med 189: 449–462. https://doi.org/10.1164/rccm.201309-1616OC Wei F, Gao C, Wang Y(2022) The role of influenza A virus-induced hypercytokinemia. Crit Rev Microbiol 48: 240–256. https://doi.org/10.1080/1040841X.2021.1960482 Zeng H, Belser JA, Goldsmith CS, Gustin KM, Veguilla V, Katz JM, Tumpey TM(2015) A(H7N9) virus results in early induction of proinflammatory cytokine responses in both human lung epithelial and endothelial cells and shows increased human adaptation compared with avian H5N1 virus. J Virol 89: 4655–4667. https://doi.org/10.1128/JVI.03095-14 Riyaz Tramboo S, Elkhalifa AME, Quibtiya S, Ali SI, Nazir Shah N, Taifa S, Rakhshan R, Hussain Shah I, Ahmad Mir M, Malik M, Ramzan Z, Bashir N, Ahad S, Khursheed I, Bazie EA, Mohamed Ahmed E, Elderdery AY, Alenazy FO, Alanazi A, Alzahrani B, Alruwaili M, Manni E, E Hussein S, Abdalhabib EK, Nabi SU (2024) The critical impacts of cytokine storms in respiratory disorders. Heliyon 10: e29769. https://doi.org/10.1016/j.heliyon.2024.e29769 Bawazeer AO, Rosli S, Harpur CM, Docherty CA, Mansell A, Tate MD(2021) Interleukin-1β exacerbates disease and is a potential therapeutic target to reduce pulmonary inflammation during severe influenza A virus infection. Immunol Cell Biol 99: 737–748. https://doi.org/10.1111/imcb.12459 Ren R, Wu S, Cai J, Yang Y, Ren X, Feng Y, Chen L, Qin B, Xu C, Yang H, Song Z, Tian D, Hu Y, Zhou X, Meng G(2017) The H7N9 influenza A virus infection results in lethal inflammation in the mammalian host via the NLRP3-caspase-1 inflammasome. Sci Rep 7: 7625. https://doi.org/10.1038/s41598-017-07384-5 McNab F, Mayer-Barber K, Sher A, Wack A, O'Garra A(2015) Type I interferons in infectious disease. Nat Rev Immunol 15: 87–103. https://doi.org/10.1038/nri3787 Palomino-Segura M, Perez L, Farsakoglu Y, Virgilio T, Latino I, D'Antuono R, Chatziandreou N, Pizzagalli DU, Wang G, García-Sastre A, Sallusto F, Carroll MC, Neyrolles O, Gonzalez(2019) Protection against influenza infection requires early recognition by inflammatory dendritic cells through C-type lectin receptor SIGN-R1. Nat Microbiol 4: 1930–1940. https://doi.org/10.1038/s41564-019-0506-6 Hudspeth K, Fogli M, Correia DV, Mikulak J, Roberto A, Della Bella S, Silva-Santos B, Mavilio D(2012) Engagement of NKp30 on Vδ1 T cells induces the production of CCL3, CCL4, and CCL5 and suppresses HIV-1 replication. Blood 119: 4013–4016. https://doi.org/10.1182/blood-2011-11-390153 Guo F, Yang J, Pan J, Liang X, Shen X, Irwin DM, Chen RA, Shen Y(2020) Origin and Evolution of H1N1/pdm2009: A Codon Usage Perspective. Front Microbiol 11: 1615. https://doi.org/10.3389/fmicb.2020.01615 Sun T, Guo Y, Zhao L, Fan M, Huang N, Tian M, Liu Q, Huang J, Liu Z, Zhao Y, Ji Z, Ping J(2022) Evolution of the PB1 gene of human influenza A (H3N2) viruses circulating between 1968 and 2019. Transbound Emerg Dis 69: 1824–1836. https://doi.org/10.1111/tbed.14161 Marjuki H, Scholtissek C, Franks J, Negovetich NJ, Aldridge JR, Salomon R, Finkelstein D, Webster RG(2010) Three amino acid changes in PB1-F2 of highly pathogenic H5N1 avian influenza virus affect pathogenicity in mallard ducks. Arch Virol 155: 925–934. https://doi.org/10.1007/s00705-010-0666-4 Le Goffic R, Leymarie O, Chevalier C, Rebours E, Da Costa B, Vidic J, Descamps D, Sallenave JM, Rauch M, Samson M, Delmas B(2011). Transcriptomic analysis of host immune and cell death responses associated with the influenza A virus PB1-F2 protein. PLoS Pathog 7: e1002202. https://doi.org/10.1371/journal.ppat.1002202 Varga ZT, Grant A, Manicassamy B, Palese P(2012) Influenza virus protein PB1-F2 inhibits the induction of type I interferon by binding to MAVS and decreasing mitochondrial membrane potential. J Virol 86: 8359–8366. https://doi.org/10.1128/JVI.01122-12 Zamarin D, Ortigoza MB, Palese P(2006) Influenza A virus PB1-F2 protein contributes to viral pathogenesis in mice. J Virol 80: 7976–7983. https://doi.org/10.1128/JVI.00415-06 Chen W, Calvo PA, Malide D, Gibbs J, Schubert U, Bacik I, Basta S, O'Neill R, Schickli J, Palese P, Henklein P, Bennink JR, Yewdell JW(2001) A novel influenza A virus mitochondrial protein that induces cell death. Nat Med 7: 1306–1312. https://doi.org/10.1038/nm1201-1306 Alymova IV, Green AM, van de Velde N, McAuley JL, Boyd KL, Ghoneim HE, McCullers JA(2011) Immunopathogenic and antibacterial effects of H3N2 influenza A virus PB1-F2 map to amino acid residues 62, 75, 79, and 82. J Virol 85: 12324–12333. https://doi.org/10.1128/JVI.05872-11 Alymova IV, Samarasinghe A, Vogel P, Green AM, Weinlich R, McCullers JA(2014) A novel cytotoxic sequence contributes to influenza A viral protein PB1-F2 pathogenicity and predisposition to secondary bacterial infection. J Virol 88: 503–515. https://doi.org/10.1128/JVI.01373-13 Pinar A, Dowling JK, Bitto NJ, Robertson AA, Latz E, Stewart CR, Drummond GR, Cooper MA, McAuley JL, Tate MD, Mansell A(2017) PB1-F2 Peptide Derived from Avian Influenza A Virus H7N9 Induces Inflammation via Activation of the NLRP3 Inflammasome. J Biol Chem 292: 826–836. https://doi.org/10.1074/jbc.M116.756379 Supplementary Files SupplementaryMaterial.docx Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Reject, do not transfer 15 Jun, 2025 Reviewers agreed at journal 19 May, 2025 Reviewers invited by journal 19 May, 2025 Editor invited by journal 19 May, 2025 Editor assigned by journal 14 May, 2025 First submitted to journal 14 May, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6582619","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":458742850,"identity":"5894d22b-05e5-4fd0-ab5d-42c8f4edd610","order_by":0,"name":"X Wen","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABJklEQVRIie3RMUvDQBTA8XccpMuVrK9L/ApXAl0U/Co5hLoUEYSQ8YpwXVK6njj4GbJ09Uqg05G5g4Ml4OQQ6eKgaMzgYgwZBe8/3HC8H+/gAFyuP5hPqTEV/2DkrjTNDZFfp/c7GS2U2OuEBlROIzB9CLc2DJml4UDOOJjv+w4Cu2iCQ+WJpbSHw4uCC7qwHKo4B/9WtgqioymOFBM38+UaNwquSDrjRBc54INpJRSjLY4Viux6uIaaiHn9QjpUOXCMWomHop5XXNxvWVk1ZPXM6XsHYSyn3NgoJCkDbIiut5AOggNF9jIxAdHeBG2BNXm63KTFOcNdOznN/Sp/44YRTcsqiU9EtjrLHl/j48DX7eTHVhhLaP6H9ZpvOuo/6nK5XP+kT3L6Z1mc2LC0AAAAAElFTkSuQmCC","orcid":"https://orcid.org/0009-0009-9290-9230","institution":"Nanjing Agricultural University - Weigang Campus: Nanjing Agricultural University","correspondingAuthor":true,"prefix":"","firstName":"X","middleName":"","lastName":"Wen","suffix":""},{"id":458742851,"identity":"118ace1f-134f-41e8-8d86-f869308f1d0d","order_by":1,"name":"Xia Wen","email":"","orcid":"","institution":"Nanjing Agricultural University - Weigang Campus: Nanjing Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Xia","middleName":"","lastName":"Wen","suffix":""},{"id":458742852,"identity":"1417b011-fa93-4447-81a3-571d7a1a8b70","order_by":2,"name":"Rong Chen","email":"","orcid":"","institution":"Nanjing Hongshan Forest Zoo","correspondingAuthor":false,"prefix":"","firstName":"Rong","middleName":"","lastName":"Chen","suffix":""},{"id":458742853,"identity":"adfbe04f-802c-4b81-a66b-13366d4f5d16","order_by":3,"name":"Yingjun Lv","email":"","orcid":"","institution":"Nanjing Agricultural University - Weigang Campus: Nanjing Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yingjun","middleName":"","lastName":"Lv","suffix":""},{"id":458742854,"identity":"32838f28-1afb-435f-aec3-ff4d36ef9143","order_by":4,"name":"Jinzhu Geng","email":"","orcid":"","institution":"Nanjing Agricultural University - Weigang Campus: Nanjing Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Jinzhu","middleName":"","lastName":"Geng","suffix":""},{"id":458742855,"identity":"e04cd1a0-f030-496a-ac26-9b396a5cb49f","order_by":5,"name":"Jingjing Guo","email":"","orcid":"","institution":"Nanjing Agricultural University - Weigang Campus: Nanjing Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Jingjing","middleName":"","lastName":"Guo","suffix":""},{"id":458742856,"identity":"3061aac3-e8ec-4e4b-8262-ccaee3c23788","order_by":6,"name":"Yaru Sun","email":"","orcid":"","institution":"Nanjing Agricultural University - Weigang Campus: Nanjing Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yaru","middleName":"","lastName":"Sun","suffix":""},{"id":458742857,"identity":"b01af265-d697-49da-ac54-b135f21bd354","order_by":7,"name":"Aohan Yang","email":"","orcid":"","institution":"Nanjing Agricultural University - Weigang Campus: Nanjing Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Aohan","middleName":"","lastName":"Yang","suffix":""},{"id":458742858,"identity":"9cfd4972-8da7-4b54-8a29-29ac9723a24f","order_by":8,"name":"Yuhao Dong","email":"","orcid":"","institution":"Nanjing Agricultural University - Weigang Campus: Nanjing Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yuhao","middleName":"","lastName":"Dong","suffix":""},{"id":458742859,"identity":"3049df68-92b1-4cde-b543-34685f133a3b","order_by":9,"name":"Meirong Li","email":"","orcid":"","institution":"Nanjing Hongshan Forest Zoo","correspondingAuthor":false,"prefix":"","firstName":"Meirong","middleName":"","lastName":"Li","suffix":""},{"id":458742860,"identity":"479ce935-a80b-48ef-b5a3-33927e88cb24","order_by":10,"name":"Changlin Deng","email":"","orcid":"","institution":"Nanjing Hongshan Forest Zoo","correspondingAuthor":false,"prefix":"","firstName":"Changlin","middleName":"","lastName":"Deng","suffix":""},{"id":458742861,"identity":"2c9407bc-dd34-4f77-bf59-49374d4331bb","order_by":11,"name":"Guodong Wang","email":"","orcid":"","institution":"Nanjing Hongshan Forest Zoo","correspondingAuthor":false,"prefix":"","firstName":"Guodong","middleName":"","lastName":"Wang","suffix":""},{"id":458742862,"identity":"6eac1db4-285c-4929-9f27-1b4be98bcec2","order_by":12,"name":"Yongjie Liu","email":"","orcid":"https://orcid.org/0000-0001-7301-9501","institution":"Nanjing Agricultural University - Weigang Campus: Nanjing Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yongjie","middleName":"","lastName":"Liu","suffix":""}],"badges":[],"createdAt":"2025-05-03 07:30:38","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6582619/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6582619/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":83223314,"identity":"88979a4b-e373-4c91-a159-0efb833a77c4","added_by":"auto","created_at":"2025-05-21 10:50:55","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1217539,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTimeline of the clinical course of the diseased golden monkeys\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-6582619/v1/fdccc28afc84a9a44a5e933a.png"},{"id":83222993,"identity":"5c1ba0dc-e68b-4d57-816b-fcaff576caa3","added_by":"auto","created_at":"2025-05-21 10:42:55","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":433004,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGross lesions, histopathological examination and viral antigen staining in the lungs of dead golden monkeys.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHistopathological examination of lung tissue was shown by H\u0026amp;E staining. As for immunohistochemical detection, lung tissue sections were probed with a mouse polyclonal antibody to nucleoprotein (NP) of influenza viruses and binding was detected by immunoperoxidase reaction (brown precipitate).\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-6582619/v1/64e1eac6bb387c5a52b0e2cc.png"},{"id":83222991,"identity":"5c0662ff-8f43-4ae0-9d57-1dafef8d174d","added_by":"auto","created_at":"2025-05-21 10:42:55","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":921009,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePhylogenetic tree of the PB1 gene of influenza viruses from different host species.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEvolutionary analyses were conducted based on the full-length nucleotide sequence of the PB1 gene (2,274 bp) of human, swine, canine and avian strains. For purposes of clarity, most strains are collapsed and animal pictures are assigned to indicate the origin of the gene. The golden monkey virus isolated in this study was highlighted with red triangle.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-6582619/v1/1c96e93b30ac8f643e643afa.png"},{"id":83223312,"identity":"2852132c-8494-408b-832d-cf33cc3c5607","added_by":"auto","created_at":"2025-05-21 10:50:55","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":344354,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eReplication kinetics of rGm-1 and rJS06 strains in cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA549 and MDCK cells were inoculated with the indicated virus at an MOI of 0.01 and 0.1, respectively. Supernatants were collected at the indicated time points to determine the virus titers by plaque assays. Viral titers were determined as log10 pfu/mL in MDCK cells. * P \u0026lt; 0.05; ** P \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-6582619/v1/1b95924e7c9a17d8dd991eba.png"},{"id":83222998,"identity":"8a0b91f1-48d4-445e-8dd2-3cbc02c3095b","added_by":"auto","created_at":"2025-05-21 10:42:55","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":402283,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eBALB/c mice inoculated with rGm-1 and rJS06 strains.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMice were inoculated with 2 ×105 PFU of indicated viruses. The percent of body weight change in each group was calculated from body weights of 10 mice recorded daily after infection relative to that at day 0 (pre-infection). To determine the viral loads, three mice per group were euthanized at 3 and 5 dpi, respectively. The lung and nasal turbinate samples were collected for virus titration by plaque assays in MDCK cells. Compared with the rJS06 group, * indicates P \u0026lt; 0.05; ** indicates P \u0026lt; 0.01; *** indicates P \u0026lt;0.001.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-6582619/v1/866a1a9141b0d70e6411b658.png"},{"id":83222996,"identity":"36d35dd8-44f9-42a8-836a-f7b2aeeba694","added_by":"auto","created_at":"2025-05-21 10:42:55","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":561541,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eRepresentative histopathological appearance shown in the lungs of mice infected with the indicated viruses.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe histopathological scoring standard was based on the percentage of pathological changes: 0, no visible lesions; 1, lesions area (\u0026lt; 10%); 2, lesions area (\u0026lt; 30%, ≥10%); 3, lesions area (\u0026lt; 50%, ≥30%); 5, lesions area (\u0026lt; 50%). ns, not significant; * P \u0026lt;0.05.\u003c/p\u003e\n\u003cp\u003eWhite arrows indicate numerous lymphocytes cell infiltration in perivascular spaces; black arrows indicate peribronchiolitis in lung; blue arrow indicates a large number of inflammatory cells were found in the alveoli. Scale bars, 100 μm.\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-6582619/v1/66b32070398ad07194fece75.png"},{"id":83223853,"identity":"43c75437-783d-4fec-8e1f-1b6d7a876682","added_by":"auto","created_at":"2025-05-21 10:58:55","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":555961,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eImmunohistochemical detection of viral antigen in the lungs of mice infected with the indicated viruses.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLung tissue sections were probed with a mouse polyclonal antibody to viral NP and binding was detected by immunoperoxidase reaction (brown precipitate). The immunohistochemical scoring standard was based on the percentage of viral NP positive cells: 0, no positive cells; 1, positive cells(\u0026lt;5%); 2, positive cells (\u0026lt;10%, ≥5%); 3, positive cells (\u0026lt;20%, ≥10%); 4, positive cells (≥20%). ns, not significant; ** P\u0026lt;0.01. Scale bars, 100 μm.\u003c/p\u003e","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-6582619/v1/bbd7502a025b7f9bb96dbc17.png"},{"id":83223322,"identity":"f35a586e-c964-4775-8e3b-c463d6e028d9","added_by":"auto","created_at":"2025-05-21 10:50:55","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":864148,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTranscription levels of proinflammatory cytokines and chemokines mice infected with the indicated viruses.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTranscription levels of proinflammatory cytokines (IL-1β, IL-6, IFN-β, IFN-γ) and chemokine (CCL2, CCL3) were determined by real-time quantitative PCR (RT-qPCR). The β-actin was used for the housekeeping gene to normalize the expression levels of them. The relative expression was calculated using the threshold cycle (2\u003csup\u003e-△△CT\u003c/sup\u003e) method. * \u003cem\u003eP\u003c/em\u003e \u0026lt;0.05; ** \u003cem\u003eP\u003c/em\u003e \u0026lt;0.01; **** \u003cem\u003eP \u003c/em\u003e\u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"floatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-6582619/v1/42d17323a3bcf84ce27ed2c6.png"},{"id":83223857,"identity":"7d4b4ad9-61ab-4000-b227-e31bb1dbd7ed","added_by":"auto","created_at":"2025-05-21 10:59:02","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":6328794,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6582619/v1/0b98da0a-10b3-4300-80b4-655907ae9b36.pdf"},{"id":83223005,"identity":"49303bfb-5b30-44d3-b962-ce2718d6c151","added_by":"auto","created_at":"2025-05-21 10:42:55","extension":"docx","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":2602153,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryMaterial.docx","url":"https://assets-eu.researchsquare.com/files/rs-6582619/v1/df7ee88bdbf2300b9905687c.docx"}],"financialInterests":"","formattedTitle":"Fatal infection of a novel canine/human reassortant H3N2 influenza A virus in the zoo-housed golden monkeys","fulltext":[{"header":"Introduction","content":"\u003cp\u003eInfluenza A virus (IAV) is an enveloped segmented, negative-sense RNA virus in the family Orthomyxoviridae, which infects a broad range of avian and mammalian species. Based on the antigenic differences of the surface glycoproteins, hemagglutinin (HA) and neuraminidase (NA), IAVs are divided into 18 HA and 11 NA subtypes. Because the IAV RNA polymerase has low fidelity and lacks exonuclease activity, antigen drift might occur during viral replication, which increases the possibility of virus escaping host immunity. Moreover, IAVs are prone to gene recombination because of the segmented nature of the genome, when two or more different viruses infect a same host. The exchange of gene fragments between different IAV strains accelerates viral evolution and the emergence of new viruses with pandemic potential. Since the early 20th century, three human influenza pandemics have been caused by genetically reassortant viruses.\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e \u003cp\u003eThe natural reservoir of IAVs is the wild bird ecosystem. However, in the last hundred years, IAVs derived from wild birds have breached the species barrier and been stably adapted to humans and a variety of animals including horses, dogs, pigs, cats and other mammals. In 2022, two cases of avian influenza A H3N8 virus were reported in China.\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e Spill-over events of IAVs from wild water-birds to seals have been reported on different occasions.\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e From 2014 to 2015, three strains of highly pathogenic H5N1 influenza virus were isolated and identified from four tigers that died of respiratory failure in a zoo in Yunnan Province, China.\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e In late 2016, two zoos in Japan experienced highly pathogenic avian influenza (HPAI) outbreaks, in which multiple zoo-housed birds were infected with H5N6 subtype HPAI virus (HPAIV).\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e In 2008, avian-origin H3N2 canine influenza virus (CIV) was first reported in South Korea, causing an outbreak of respiratory disease in dog populations.\u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e Subsequently, this virus spreads widely across some geographical areas in Asia, including China\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e and Thailand.\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e In 2015, H3N2 influenza virus emerged in the United States, causing an outbreak of respiratory disease in thousands of dogs.\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e This virus was subsequently detected in Canada as well.\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e Further studies suggest that this H3N2 virus has adapted to dogs and diverged genetically from avian influenza virus.\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e Due to the mild clinical symptoms caused by this viral infection in dogs, there is a lack of effective control and prevention strategies. This leads to the possibility that dogs harboring H3N2 virus may transmit it to other species with which they are in close contact, thus accelerating influenza evolution and transmission. These findings suggest that the host range of IAV infection is constantly expanding, which may be related to the direct contact of hosts with infected animals or contaminated environment.\u003c/p\u003e \u003cp\u003eThe genome of IAV comprises eight RNA segments (vRNA) that are transcribed and replicated by the heterotrimeric RNA-dependent RNA-polymerase (RdRp) consisting of PA (polymerase acidic), PB1 (polymerase basic 1) and PB2 (polymerase basic 2). PB1 protein is the catalytic core of the polymerase complex, which is responsible for catalyzing RNA polymerization and binding to the viral RNA promoter, while PB2 and PA proteins play a role in the cap-grab process of viral messenger RNA (mRNA) synthesis. RdRp can significantly affect viral virulence, innate immunity and host adaptability. Studies have shown that the avian-origin PB1 segment can increase polymerase activity of human influenza virus and improve replication efficiency of the recombinant virus in mammalian cells,\u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e even enhance virulence in mice.\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e It has also been reported that the PB1 protein of the 1968 H3N2 pandemic influenza virus can inhibit the antiviral response induced by the interferon (IFN) after adaptive synonymous codon mutation.\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e In this study, we isolated and identified a canine/human reassortment H3N2 virus from the golden monkey (\u003cem\u003eRhinopithecus roxellana\u003c/em\u003e) died of respiratory failure at a zoo in Jiangsu Province. This viral strain has PB1 segment derived from human influenza virus, while the remaining seven fragments are all derived from the canine virus. Further investigation demonstrated that the human-origin PB1 promotes the production of proinflammatory cytokines and chemokines, and exacerbates influenza lesions in mice. To our knowledge, this is the first report of IAV infection in golden monkeys.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eEthics Statement\u003c/h2\u003e \u003cp\u003eAll SPF BALB/c mice(5 weeks old, female)were purchased from the Animal Experiment Center, Yangzhou University. Before conducting animal experiments, we obtained approval for the experimental program from the Animal Ethics Committee of Nanjing Agricultural University, China (License No.:SYXK (Su) 2021-0086). All animal experiments were conducted following the guidelines of the China Animal Welfare Commission. All efforts were made to minimize the animals\u0026rsquo;suffering.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eCase identification and sample collection\u003c/h3\u003e\n\u003cp\u003eIn June 2022, seven adult female golden monkeys living at a zoo in Jiangsu province of China developed flu-like symptoms in succession, and two animals died on the 3rd and 7th day after onset of illness, respectively. Clinical samples including nasal swabs, sera and lung tissues were collected by field veterinarians from the affected zoo.\u003c/p\u003e\n\u003ch3\u003eVirus detection\u003c/h3\u003e\n\u003cp\u003eNasal swabs collected from the clinically affected animals (n\u0026thinsp;=\u0026thinsp;7) were used to test for the infection of influenza viruses. Viral RNA was extracted from the supernatants of nasal swabs using the Virus Nucleic Acid Extraction Kit II (Geneaid, Taiwan). Reverse transcription was carried out using primer Uni12 (5\u0026prime;AGCRAAAGCAGG3\u0026prime;), then a nested PCR for the matrix (M) gene (target for IAV detection) was performed.\u003c/p\u003e\n\u003ch3\u003eVirus isolation\u003c/h3\u003e\n\u003cp\u003eLung samples from dead animals were homogenated in phosphate-buffered saline (PBS, pH 7.2) and centrifuged at 12, 000 \u003cem\u003eg\u003c/em\u003e for 10 min. The supernatants were filtered using 0.22-\u0026micro;m membrane filter (Millipore, USA). Then the resulting filtrates were inoculated into Madin-Darby Canine Kidney (MDCK) cells. The infected monolayers with cytopathic effect (CPE) were harvested at 4 days post-infection (dpi) by three cycles of alternative freezing and thawing. The isolated virus was identified by whole genome sequencing.\u003c/p\u003e\n\u003ch3\u003eGenomic sequencing and phylogenetic analysis\u003c/h3\u003e\n\u003cp\u003eTo identify and characterize the influenza virus isolated from the golden monkey, whole genome sequencing was conducted. Viral RNA from the infected cells was extracted using Viral RNA Kit (Omega, USA), and the cDNA was synthesized with the primer Uni12 (5\u0026rsquo;AGCAAAAGCAGG3\u0026rsquo;) using HiScript II Q Select RT SuperMix (Vazyme, China), followed by PCR amplification as previously described,\u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e using primers specific for each of the eight RNA segments. PCR products were purified with a PCR purification kit (Omega Bio-Tek, USA) and sequenced on an ABI3500XL DNA sequencer. Sequence data were analyzed using MegAlign software and BLAST (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://blast.ncbi.nlm.nih.gov/Blast.cgi\u003c/span\u003e\u003cspan address=\"http://blast.ncbi.nlm.nih.gov/Blast.cgi\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The reference nucleotide sequences were obtained from the Global Influenza Shared Database (GISAID) for phylogenetic analysis. Phylogenetic trees were generated based on maximum likelihood method (ML) with 1,000 bootstrap replicates by MEGA software (version 7.0).\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eVirus rescuing by reverse genetics\u003c/h2\u003e \u003cp\u003eThe recombinant viruses were rescued by an eight plasmid reverse genetics system. Eight expression plasmids containing influenza virus genomic segments were transfected into 293T cells using Lipomaster 2000 Transfection Regent (Vazyme, China) according to the manufacturer\u0026rsquo;s protocol. Supernatants were collected at 3 days post transinfection, and titrated by plaque assay in MDCK cells.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eVirus titration by plaque assay\u003c/h3\u003e\n\u003cp\u003eMDCK cells were seeded in 12-well plates and infected with 10-fold serial dilutions of supernatants of lung homogenates in DMEM medium(Wisent, Canada) containing 0.5 \u0026micro;g/mL L-1-tosylamide-2-phenylethyl chloromethyl ketone (TPCK) (Sigma, USA)-treated trypsin for 1 h at 37\u0026deg;C. Then MDCK cells were washed three times with PBS and overlaid with 1% low-melting point agarose (Beyotime Biotechology, China) in DMEM medium containing 0.5 \u0026micro;g/mL TPCK-treated trypsin. After 72 h of incubation, the cells were fixed with 4% formalin, and plaques were stained with 0.05% crystal violet and counted. Virus concentration was calculated as plaque forming units (PFU) /mL. The experiments were performed in triplicate.\u003c/p\u003e\n\u003ch3\u003eViral growth kinetics\u003c/h3\u003e\n\u003cp\u003eA549 and MDCK cells were respectively seeded in 12-well plates to develop into a monolayer, and then inoculated with each viruses. After absorption of the viruses for 1 h, the cells were washed three times with PBS, and incubated at 37\u0026deg;C in 5% CO\u003csub\u003e2\u003c/sub\u003e. Supernatants were sampled at 12, 24, 36, 48, 60 and 72 hours post infection (hpi), respectively, and virus titers were determined by plaque assay on MDCK cells.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eExperimental infection of mice\u003c/h2\u003e \u003cp\u003eForty-five groups of 6-week-old female BALB/c mice (Animal Experiment Center, Yangzhou university, China) were divided into three group. GroupⅠ(n\u0026thinsp;=\u0026thinsp;15) and group Ⅱ (n\u0026thinsp;=\u0026thinsp;15) were inoculated intranasally with 2\u0026times;10\u003csup\u003e6\u003c/sup\u003e PFU of each virus, respectively in a total volume of 50 \u0026micro;L, while group Ⅲ was treated with PBS as control. The body weight loss of mice were monitored daily for 14 d. Three mice from each group were euthanized at 2, 4, 6, 8 and 14 dpi, and tissues including lungs and nasal turbinates were collected for virus titration and quantitation of cytokine levels. A lobe of lung tissue was fixed in 4% neutral buffered formalin for histopathological and immunohistochemical examination. All experimental procedures are approved by the Animal Protection and Ethics Committee of Nanjing Agricultural University (approval number PT2020022) .\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eHistopathology and immunochemistry\u003c/h2\u003e \u003cp\u003eThe histopathological examination was performed with hematoxylin and eosin (H\u0026amp;E) staining with paraffin-embedded sections (4 \u0026micro;m thickness). The histopathological scores were graded based on the percentage of pathological changes observed of each lung tissue section, such as changes of lung structure, the degeneration and necrosis of bronchiole epithelial cells and alveoli pneumocytes, edema or fibrinous protein exudation in the alveolar lumina, and infiltration of inflammatory cells. The semiquantitative assessment was performed using the following scoring system:\u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e 0, no visible lesions; 1, lesion areas (\u0026lt;\u0026thinsp;10%); 2, lesion areas (\u0026lt;\u0026thinsp;30%, \u0026ge;\u0026thinsp;10%); 3, lesion areas (\u0026lt;\u0026thinsp;50%, \u0026ge;\u0026thinsp;30%); 5, lesion areas (\u0026lt;\u0026thinsp;50%).\u003c/p\u003e \u003cp\u003eAs for immunohistochemical evaluation, the lung sections were immunostained with a rabbit polyclonal antibody against viral nucleoprotein (NP) (prepared in our laboratory) and horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG (Biosharp, China). Cells showing a brownish yellow membrane or cytoplasm were determined to be NP positive. The scores was assigned based on the percentage of NP-positive cells as the following:\u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e 0, no positive cells; 1, positive cells (\u0026lt;\u0026thinsp;5%); 2, positive cells (\u0026lt;\u0026thinsp;10%, \u0026ge;\u0026thinsp;5%); 3, positive cells (\u0026lt;\u0026thinsp;20%, \u0026ge;\u0026thinsp;10%); 4, positive cells (\u0026ge;\u0026thinsp;20%).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eQuantitation of cytokine levels\u003c/h2\u003e \u003cp\u003eReal-time quantitative PCR (RT-qPCR) was used for quantitation of cytokines interleukin (IL)-1β, IL-6, interferon (IFN)-β and IFN-γ, and chemokines CCL2 and CCL3 levels. Total RNA of lung was extracted by using a total tissue RNA extraction kit (Omega Bio-Tek), and reverse-transcribed into cDNA using HiScript II Q RT SuperMix for kit (Vazyme). Then ChamQ SYBR qPCR Master Mix kit (Vazyme) was applied for quantitative PCR using gene-specific primers on 7300 Real-Time PCR System (Applied Biosystems). The β-actin housekeeping gene was amplified as an internal control. The comparative cycle threshold (2\u003csup\u003e\u0026minus;△△CT\u003c/sup\u003e) method was used to determine the mRNA levels. The sequences of the primers were as follows: IL-1β-F/R 5\u0026rsquo;GAAATGCCACCTTTTGACAGTG3\u0026rsquo;/5\u0026rsquo;TGGATGCTCTCATCAGGACAG3\u0026rsquo;;IL-6-F/R \u0026rsquo;CTGCAAGAGACTTCCATCCAG3\u0026rsquo;/5\u0026rsquo;CTGCAAGAGACTTCCA\u003c/p\u003e \u003cp\u003eTCCAG3\u0026rsquo;; IFN-β-F/R 5\u0026rsquo;CA GCTCCAAGAAAGGACGAAC3\u0026rsquo;/5\u0026rsquo;GGCAGTGTAA\u003c/p\u003e \u003cp\u003eCTCTTCTGCAT3\u0026rsquo;; IFN-γ-F/R 5\u0026rsquo;ATGAACGCTACA CACTGCATC3\u0026rsquo;/5\u0026rsquo;CCATCC\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eTTTTGCCAGTTCCTC3\u0026rsquo;;CCL2-F/R 5\u0026rsquo;TTAAAAACCTGGATCGGAACCAA3\u0026rsquo;/\u003c/h2\u003e \u003cdiv id=\"Sec15\" class=\"Section3\"\u003e \u003ch2\u003e5\u0026rsquo;GCATTAGCTTCAGATTTACGGGT3\u0026rsquo;; CCL3-F/R 5\u0026rsquo;TTCTCTGTACCATGACA\u003c/h2\u003e \u003cp\u003eCTCTGC3\u0026rsquo;/5\u0026rsquo;CGTGGAATCTTCCGGCTGTAG3\u0026rsquo;; β-actin-F/R 5\u0026rsquo;TGACAGGATG\u003c/p\u003e \u003cp\u003eCAGAAGGAGA3\u0026rsquo;/ 5\u0026rsquo;GCTGGAAGGTGGACAGTGAG3\u0026rsquo;.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eSerological survey of the H3N2 virus infection in golden monkeys\u003c/h2\u003e \u003cp\u003eSerum samples obtained from golden monkeys were collected to determine the haemagglutination inhibition (HI) activity according to the standard method (WHO Manual on Animal Influenza Diagnosis and Surveillance, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.who.int/iris/handle/10665/68026\u003c/span\u003e\u003cspan address=\"http://www.who.int/iris/handle/10665/68026\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The HI titers were expressed as the log\u003csub\u003e2\u003c/sub\u003e of the reciprocal of the highest dilution, resulting in complete inhibition of red blood cells.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eAll statistical analyses were performed with GraphPad Prism version 9 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ewww.graphpad.com\u003c/span\u003e\u003cspan address=\"http://www.graphpad.com\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). An unpaired Student\u0026rsquo;s t-test was employed to determine statistical differences among groups. A significance level of less than 0.05 was considered statistically significant for all analyses.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003eOn 5 June, 2022, one adult male golden monkey experienced flu-like symptoms such as fever, cough, shortness of breath, lethargy and anorexia at a zoo in Jiangsu province of China. Nasal swabs from this animal were collected for detection of IAV M gene by nested PCR. As expected, the samples were tested positive for IAV infection. Therefore, this diseased animal received oral treatment with oseltamivir, a specific anti-influenza drug, and other supportive therapy. Regretfully, however, this animal died from severe respiratory failure on the 3rd day after onset of illness. Two days later, on June 9th, another adult male golden monkey showed flu symptoms, and rapidly developed severe pneumonia. Despite timely treatment, this animal died on the 7th day after onset of illness. On June 15th, out of the remaining 10 golden monkeys in the same group, 5 more showed the symptoms of influenza. Fortunately, the five animals recovered after 7 days of treatment. The disease details of seven animals are shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo determine the cause of death, the two animals were dissected. The most notable involved organ is the lung, characterized by emphysema and pulmonary parenchymatous carnification (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Therefore, lung tissues were collected for histopathology and immunochemistry examination and virus isolation. We also performed bacterial isolation, but no pathogenic bacteria were identified. As shown by Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, two lung tissues exhibited similar histopathological lesions, manifested with thickening of the alveolar septa, edema, and interstitial inflammatory cell infiltration, with a large area of consolidation. Further, sections from the two lung tissues were immunostained with a mouse polyclonal antibody against IAV nucleoprotein (NP), and positive staining alveolar and bronchial epithelial cells were detectable. These data supported a diagnosis of pulmonary infection with influenza virus in the golden monkey.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eNext, we made efforts to isolate and identify the influenza virus derived from golden monkeys. After serially passaged in MDCK cells, one strain of influenza virus, named A/golden monkey/Jiangsu/1/2022 (herein Gm-1), was isolated out of the lung samples from dead golden monkeys. To characterize the molecular properties of the isolated virus, we determined the nucleotide sequences of the eight RNA segments of the viral genome. Sequence data have been submitted to GenBank, with the accession numbers from PO764562 to PO764569. Sequence comparison with known influenza virus genes showed that except for the PB1 gene, intriguingly, the remaining seven fragments exhibit 100% of identity to a canine H3N2 virus, A/canine/Jiangsu/06/2010 (herein JS06). The PB1 gene of the Gm-1 shows the highest identity (97.3% sequence identity) with the human strain A/Hong Kong/4801/2014, but only has 81.4% of sequence identity with the canine strain JS06. To explore the origin of PB1 gene in the Gm-1 virus, we included the sequences of human, swine, canine and avian influenza viruses reported in different regions of China from January 2014 to December 2024 to perform the phylogenetic analysis. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, these viruses could be grouped into approximately 8 clusters, with 3 human virus clusters, 3 avian virus clusters, 1 swine virus cluster and 1 canine virus cluster. The golden monkey isolate fell within a human virus cluster and formed an independent phylogenetic subclade, in which the virus stains were isolated from humans in Shanghai, Fujian, Guizhou, Hubei and Hong Kong. Therefore, we speculate that the PB1 gene is most likely to have originated from human viruses, and the Gm-1 is a canine/human reassortant influenza virus.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eSix months after the outbreak, we collected nasal swabs and serum samples from 5 recovered golden monkeys and 5 asymptomatic contacts for detection of viral M gene and HI activity, respectively. Our data indicated that all the nasal swabs were tested negative for IAV infection, but the 10 animals were seropositive using the Gm-1 virus as antigen, with the HI antibody titers of 7log2 (30%), 5log2 (50%) and 4log2 (20%), respectively. The high seroprevalence in golden monkeys suggests that the virus can spread efficiently among golden monkeys, and antibodies induced by this virus can be maintained for a long time after remission of influenza infection.\u003c/p\u003e \u003cp\u003eTo determine whether substitution of the PB1 segment of a canine parent by that of an human parent enhances viral replication, we developed a reverse genetic system to reconstruct this reassortment event. Because the exact origin of canine-human reassortant virus are not known, we focused on the closest available viruses. Therefore, we used the JS06 as a model of the canine virus parent, and the Gm-1 as a source of human-origin PB1 gene. To produce infectious influenza viruses, we constructed eight plasmids that contain cDNAs for the full-length viral RNAs and transinfected them into the 293T cells. At 72h post transinfection, we obtained two recombinant virues, rGm-1 and rJS06, which differed solely by the origin of the PB1 segment. Further, we evaluated their replication ability in human alveolar epithelial cell A549 and canine kidney epithelial cell MDCK. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, rJS06 displayed a relatively higher growth capacity than rGm-1 in canine MDCK cells, especially at 36 hours post-infection (hpi) (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) and 72 hpi (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). In contrast, the two viruses exhibited similar growth kinetics in human A549 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB), indicating that human PB1 did not provide the virus with a replicative advantage in human cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn order to determine the role of human PB1 gene in influenza virus pathogenicity, we evaluated viral virulence in a well-established BALB/c mouse model.\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e Two infection groups of mice were inoculated with 2\u0026times;10\u003csup\u003e6\u003c/sup\u003e PFU of rGm-1 or rJS06, while mice in the control group were inoculated with PBS. As expected, all the mice of three groups survived through day 14, when the experiment was terminated. Although all three groups of mice gained weight at the end of the observation period, mice infected with rGm-1 or rJS06 exhibited clearly evident body weight loss compared to PBS group from the 4 dpi (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). In particular, the weight loss of mice in rGm-1 group was statistically significantly higher than that in rJS06 group at the 3, 4, 5, 7 and 8 dpi (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 or \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01 or \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThree mice per group were euthanized at 2, 4, 6, 8 and 14 dpi, respectively, and the lung and nasal turbinate were taken and viral load was determined in MDCK cells by plaque assay. High virus loads were observed in the lung (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB) and nasal turbinate (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC) of either rGm-1- or rJS06-inoculated mice before the 6th dpi, while no infectious virus was detected in lung or nasal turbinate from day 8. When comparing two virus infection groups, no significant difference was observed in virus titers of the lung and nasal turbinate between rGm-1- and rJS06-inoculated mice at 2 dpi. But at 4 and 6 dpi, compared with rJS06, virus titer of rGm-1 in the lung were significantly increased (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01 or \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001), while in nasal turbinate, mice infected with rGm-1 also exhibited higher titers than the rJS06-inoculated mice (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) at 6 dpi. This finding indicated that the rGm-1 was less easily cleared from the mice as compared to the rJS06.\u003c/p\u003e \u003cp\u003eWe also performed histopathological evaluation on the lung sections from the mice inoculated with rGm-1 and rJS06 viruses. Severe peribronchiolitis, manifested with thickening of the alveolar septa, degeneration and necrosis of bronchiolar epithelial cells, and numerous interstitial inflammatory cell infiltration in vessel were evident in rGm-1- and rJS06-infected mice at 2 and 4 dpi (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). But the histopathology scores of the lungs of rGm-1-infected mice did not show significant difference from those of rJS06-inoculated mice at the two time points. At 6 dpi, mice infected with the rGm-1 virus exhibited more severe lung lesions than rJS06-infected mice, along with a statistically higher level of histopathology score (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). In accordance with the severe of lung lesion, immunostaining analysis revealed numerous viral antigen-positive alveolar and bronchial epithelial cells in mice infected with the rGm-1 and rJS06 viruses at 2 to 4 dpi (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). However at 6 dpi, plenty of viral antigen-positive alveolar epithelial cells were found in the lungs of rGm-1-infected mice, whereas few were found in rJS06-infected mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo further investigate if the two viral strains induced different immune responses, we measured the transcription levels of proinflammatory cytokines IL-1β, IL-6, IFN-β and IFN-γ, and chemokines CCL2 and CCL3 in the lungs of mice. As shown by Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e, expression of four proinflammatory cytokines in each virus group showed similar trends from 2 to 6 dpi, all of which significantly increased as compared to the PBS group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 or \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01 or \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001 or \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), except for the IL-6 (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB) in the rJS06 group at 6 dpi (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05). At 8 dpi, although no significant differences were observed in the IL-1β (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA) and IL-6 (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB) between virus infected groups and PBS group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05), while IFN-β (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eC) and IFN-γ (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eD) in virus infection groups showed statistically higher expression levels than those in the PBS group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01 or \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Interestingly, expression of all the four proinflammatory cytokines was statistically higher in the rGm-1 group than that in the rJS06 group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) from 2 to 6 dpi. From day 8, no significant differences were recorded between the two infected groups (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05). As for the two chemokines, the mRNA transcription of CCL2 in the rGm-1 group showed a significant increase at 2 and 4 dpi (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) but a significant decrease at 6 and 8 dpi (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), as compared to the rJS06 group (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eE). The CCL3 gene expression exhibited consistently lower level in the rGm-1 group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) than did the rJS06 group from 2 to 8 dpi (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eF). At 14 dpi, there was no significant difference for CCL2 or CCL3 gene expression between the two infected groups. Compare with the PBS group, the rJS06 group exhibited a higher expression level of CCL2 before day 6 (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 or \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) and a significant upregulation of CCL3 at 2 dpi (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), while the rGm-1 group showed significantly elevated levels of both CCL2 and CCL3 until day 8 (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). All these data indicated that the origin of the PB1 fragment is linked to the host inflammatory response induced by influenza viruses.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eSince 2007, H3N2 virus is the predominant circulating influenza subtype detected among dog populations in most countries, including China and South Korea. Given the closeness of dogs to humans and some other animals (cats, birds, ducks, etc.), dogs can act as a \u0026ldquo;mixing vessel\u0026rdquo;of the influenza virus.\u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e Numerous studies have shown that dogs could be infected from various origins of influenza viruses, such as human H1N1 and H3N2, swine H1N1, avian H5N1, H5N6 and H6N1, and recombinant H3N6 viruses.\u003csup\u003e\u003cspan additionalcitationids=\"CR25 CR26 CR27\" citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e If a dog is co-infected with different subtypes of influenza viruses, it is likely that a novel virus strain can be generated by gene mutation or exchange of segments. Then this virus can undergo an adaptive evolution that facilitates cross-species transmission, posing a potential pandemic risks. Here, we report the golden monkey case of infection with a novel reassortant virus containing the PB1 gene from a human H1N1 virus and the rest of the RNA segments from previously circulating canine H3N2. This is the first report of IAV infection in golden monkey.\u003c/p\u003e \u003cp\u003eGolden monkey is an endangered species endemic to China. Most of investigations conducted in this species of monkeys have focused on its breeding and behaviour. Recently, however, some studies have shown that golden monkeys are susceptible to a number of zoonotic pathogens, such as hepatitis B virus (HBV), macacine herpesvirus-1 (MaHV-1), hepatitis A virus (HAV) and cytomegalovirus (CMV).\u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e,\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e In this study, influenza A was detected in seven golden monkeys diagnosed with pneumonia, and even cause deadly illness. Phylogenetic analysis for the influenza virus strain from this case revealed that seven segment sequences were 100% homologous to the canine H3N2 virus found in Jiangsu, while only the PB1 gene exhibited high identity with a human viruses. Epidemiological investigation revealed the keeper, who kept a contact with golden monkeys by feeding and caring with them, has suffered from a bad cold before the onset of clinical signs in golden monkeys, although no pathogens have been detected timely. And notably, the molecular test on the nasal and anal swab samples from two dogs kept in the zoo yielded positive results for IAV. Because golden monkeys, an endangered species with the highest level of protection and care, have no preexisting immunity against IAVs, a new intrusion of the pathogen may result in high fatalities. Currently, we are not known how the IAVs spill over to golden monkeys, and cause respiratory infections. We speculate that both the respiratory and gastrointestinal routes of infection may cause horizontal transmission among dog, golden monkeys and humans. This reassortment event might occur in three pathways (figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). The first pathway involves simultaneous infection with both human and canine influenza viruses and exchange of gene fragments to form a novel virus in golden monkeys; the second pathway involves a human or dog host where the parental viruses coinfect and the reassortment event occurs, followed by adaptive evolution and transmission to golden monkeys; the third pathway involves an unknown animal host that is coinfected with two parental viruses and serves as a mixer to form a novel virus that retains the ability to infection in golden monkeys. Certainly, these are only hints and guesses, and there is currently not enough epidemiological evidence in support of them .\u003c/p\u003e \u003cp\u003eSince PB1 is the only gene that differs between Gm-1 and JS06, it is possible that PB1 is involved in the more severe pathogenic phenotype of Gm-1. Historically, the recombination event of avian PB1 fragment has been seen in the 1957, 1968, and 2009 IAV pandemics, and has been shown to play an important role in the adaptation of avian influenza virus strains to mammal.\u003csup\u003e\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e,\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e In this study, the novel H3N2 recombinant virus could successfully cross the species barrier to golden monkeys, suggesting that the human PB1 may enhance the pathogenicity of recombinant virus. This idea can be supported by the finding that infection of the rGm-1 virus caused more obvious weight loss and more persistent lesions in mice, when compared with the rJS06 virus.\u003c/p\u003e \u003cp\u003eThe severity caused by influenza viruses is linked with excessive host inflammatory response.\u003csup\u003e\u003cspan additionalcitationids=\"CR32\" citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e During the infection of influenza virus, infected epithelial cells, endothelial cells, and alveolar macrophages could produce and release a large number of cytokines and chemokines, which affects the clearance of pathogenic microorganisms and the outcome of the disease.\u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e IL-1β and IL-6 are well-known proinflammatory cytokines that play key roles in inflammation and inmmunologic reactions. High levels of the two cytokines can aggravate the disease in the infection process of H1N1, H3N2, and H7N9 influenza virus.\u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e,\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e In addition, overexpression of the IFNs has been found to aggravate the disease by amplifying inflammatory reaction and exacerbating lung damage.\u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e In this study, infection with the rGm-1 virus significantly upregulated the expression of IL-1β, IL-6, IFN-β and IFN-γ compared to the rJS06 virus in the early stage of infection, which may be the cause of lung damage and severe disease in mice. Of note, different from the above four cytokines, proinflammatory chemokines CCL2 (at 6 and 8 dpi) and CCL3 (from 2 to 8 dpi) exhibited a relatively lower level in rGm-1-infected mice compared to rJS06-infected mice. The two chemokines are known to play key role in guiding the migration of mononuclear cells to the site of inflammation, which is conducive to virus control.\u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e,\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e In this study, our data from plaque assay and immunostaining indicated a much slower clearance of the rGm-1 from the mice, as compared to the rJS06. The relatively lower CCL2 and CCL3 levels induced by rGm-1 infection might provide an explanation for this phenomenon.\u003c/p\u003e \u003cp\u003eAlthough it is unclear how human PB1 affects the severity of influenza in golden monkeys, the PB1-F2 protein encoded by an alternate open reading frame within the PB1 gene has been shown to contribute to the pathogenesis of influenza infection.\u003csup\u003e\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e This protein has been reported to degrade the mitochondrial antiviral-signaling (MAVS) protein by mitophagy, and inhibit type I IFN production.\u003csup\u003e\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e Several studies demonstrated that this protein enhance viral virulence due to lower clearance from the lungs, and increased neutrophil infiltration and immunopathology.\u003csup\u003e\u003cspan additionalcitationids=\"CR45\" citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u003c/sup\u003e In this study, we examined the molecular characterization of PB1-F2 in the Gm-1 and JS06 viruses, and used two human H1N1 strains, PR8 and A/California/04/2009 (herein CA), as controls. As shown in Fig.S2, the CA virus contained a truncated and presumably non-functional PB1-F2 protein, while PR8, Gm-1 and JS06 encode full-length PB1-F2 (87\u0026ndash;90 amino acids). Previous studies demonstrated that last one third of PB1-F2, including four inflammatory amino acids (62L, 75R, 79R and 82L)\u003csup\u003e\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u003c/sup\u003e and a cytotoxic motif (68I, 69L and 70V)\u003csup\u003e\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u003c/sup\u003e, at the C terminus, is linked with enhanced inflammatory response and pathogenicity during IAV infection. A previous study believed that the well-known fact that infection with the pandemic CA strain in 2009 caused milder illness symptoms than those induced by the previous pandemic viruses is likely due to the lacking of a fully functional PB1-F2.\u003csup\u003e\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e\u003c/sup\u003e In this study, three of four inflammatory residues could be identified in the PB1-F2 gene in either Gm-1 or JS06, so we speculate that difference in disease severity caused by the two viruses might be independent of inflammatory amino acids. Interestingly, however, the Gm-1 virus contains the cytotoxic motif but JS06 does not. It has been shown that full-length PB1-F2 protein with I68, L69, and V70 caused more cell death than those without.\u003csup\u003e\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u003c/sup\u003e This led us to speculate that this ILV motif from amino acids 68\u0026ndash;70 in the Gm-1 virus could be main contributing factor to promoting lung immunopathology and exacerbating disease severity, although further investigation is needed to confirm this hypothesis. Future detailed study on the function of PB1-F2 in a panel of the recombinant viruses constructed on the JS06 background could provide more insights into the pathogenesis of the canine/human reassortment virus isolated from golden monkeys.\u003c/p\u003e \u003cp\u003eIn conclusion, our study provides virological and molecular evidence for identification of an H3N2 canine/human reassortment virus isolated from golden monkeys. This finding extends the host range of influenza viruses, and more importantly, highlights the risk posed by this pathogen to golden monkeys. Golden monkeys are at risk of influenza infection through close contact with humans. To protect the endangered species from this reverse zoonotic transmissible disease, the daily implement of biosecurity measures is essential. Animal keepers should get annual vaccinations against seasonal influenza and avoid contact with animals when they have flu-like symptoms. Considering the pandemic potential of newly emerging IAV and its risk of transmission between animals and humans, the ongoing surveillance are urgently needed.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate(Not applicable)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication(Not applicable)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe original contributions presented in the study are included in the article, and further inquiries can be directed to the corresponding author(s).\u003c/p\u003e\n\u003cp\u003eContributors\u003c/p\u003e\n\u003cp\u003eAll authors conceptualised the study. XW performed virus direction, isolation, genomic sequencing and virus rescuing. XW, JZG, JJG, YRS, AHY and YHD conducted the mouse challenge experiment. XW, RC, YJL, MRL, CLD and GDW collected the samples and performed pathological and histological evaluation. XW, RC and YJL curated the data and performed the formal analysis. XW wrote the original draft of the manuscript. YJL performed the supervision of the research, data verification and analysis, writing, reviewing, editing and funding.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study is supported by the National Natural Science Foundation of China (32273094), Jiangsu Provincial Science and Technology Plan Special Fund (Innovation Support Plan International Science and Technology Cooperation) (BZ2023048), Nanjing Greening and Landscape Bureau 2023 Technology Plan Projects (YLKJ202309JH), and Jiangsu Province Key Industry Talent Project.\u003c/p\u003e\n\u003cp\u003eFunding\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eNational Natural Science Foundation of China,\u0026nbsp;Jiangsu Provincial Science and Technology Plan Special Fund (Innovation Support Plan International Science and Technology Cooperation),\u0026nbsp;Nanjing Greening and Landscape Bureau 2023 Technology Plan Projects,\u0026nbsp;and Jiangsu Province Key Industry Talent Project.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting\u003c/strong\u003e \u003cstrong\u003einterests\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe declare no competing interests. \u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eWebster RG, Laver WG, Air GM, Schild GC(1982) Molecular mechanisms of variation in influenza viruses. Nature 296: 115\u0026ndash;121. https://doi.org/10.1038/296115a0\u003c/li\u003e\n\u003cli\u003eSmith GJ, Vijaykrishna D, Bahl J, Lycett SJ, Worobey M, Pybus OG, Ma SK, Cheung CL, Raghwani J, Bhatt S, Peiri JS, Guan Y, Rambaut A(2009) Origins and evolutionary genomics of the 2009 swine-origin H1N1 influenza A epidemic. Nature 459: 1122\u0026ndash;1125. https://doi.org/10.1038/nature08182\u003c/li\u003e\n\u003cli\u003eKilbourne ED(2006) Influenza pandemics of the 20th century. Emerg Infect Dis 12: 9\u0026ndash;14. https://doi.org/10.3201/eid1201.051254\u003c/li\u003e\n\u003cli\u003eYang R, Sun H, Gao F, Luo K, Huang Z, Tong Q, Song H, Han Q, Liu J, Lan Y, Qi J, Li H, Chen S, Xu M, Qiu J, Zeng G, Zhang X, Huang C, Pei R, Zhan Z, Liu J(2022) Human infection of avian influenza A H3N8 virus and the viral origins: a descriptive study. Lancet Microbe 3: e824\u0026ndash;e834. https://doi.org/10.1016/S2666-5247(22)00192-6 \u003c/li\u003e\n\u003cli\u003eLair S, Quesnel L, Signore AV, Delnatte P, Embury-Hyatt C, Nadeau MS, Lung O, Ferrell ST, Michaud R, Berhane Y(2024) Outbreak of Highly Pathogenic Avian Influenza A(H5N1) Virus in Seals, St. Lawrence Estuary, Quebec, Canada1. Emerg Infect Dis 30: 1133\u0026ndash;1143. https://doi.org/10.3201/eid3006.231033\u003c/li\u003e\n\u003cli\u003eBerhane Y, Joseph T, Lung O, Embury-Hyatt C, Xu W, Cottrell P, Raverty S(2022) Isolation and Characterization of Novel Reassortant Influenza A(H10N7) Virus in a Harbor Seal, British Columbia, Canada. Emerg Infect Dis 28: 1480\u0026ndash;1484. https://doi.org/10.3201/eid2807.212302\u003c/li\u003e\n\u003cli\u003eHu T, Zhao H, Zhang Y, Zhang W, Kong Q, Zhang Z, Cui Q, Qiu W, Deng B, Fan Q, Zhang F(2016) Fatal influenza A (H5N1) virus Infection in zoo-housed Tigers in Yunnan Province, China. Sci Rep 6: 25845. https://doi.org/10.1038/srep25845\u003c/li\u003e\n\u003cli\u003eUsui T, Soda K, Sumi K, Ozaki H, Tomioka Y, Ito H, Murase T, Kawamoto T, Miura M, Komatsu M, Imanishi T, Kurobe M, Ito T, Yamaguchi T(2020) Outbreaks of highly pathogenic avian influenza in zoo birds caused by HA clade 2.3.4.4 H5N6 subtype viruses in Japan in winter 2016. Transbound Emerg Dis 67: 686\u0026ndash;697. https://doi.org/10.1111/tbed.13386\u003c/li\u003e\n\u003cli\u003eLi S, Shi Z, Jiao P, Zhang G, Zhong Z, Tian W, Long LP, Cai Z, Zhu X, Liao M, Wan XF(2010) Avian-origin H3N2 canine influenza A viruses in Southern China. Infect Genet Evol 10: 1286\u0026ndash;1288. https://doi.org/10.1016/j.meegid.2010.08.010\u003c/li\u003e\n\u003cli\u003eLin Y, Zhao Y, Zeng X, Lu C, Liu Y(2012) Genetic and pathobiologic characterization of H3N2 canine influenza viruses isolated in the Jiangsu Province of China in 2009-2010. Vet Microbiol 158: 247\u0026ndash;258. https://doi.org/10.1016/j.vetmic.2012.02.016\u003c/li\u003e\n\u003cli\u003eBunpapong N, Nonthabenjawan N, Chaiwong S, Tangwangvivat R, Boonyapisitsopa S, Jairak W, Tuanudom R, Prakairungnamthip D, Suradhat S, Thanawongnuwech R, Amonsin A(2014) Genetic characterization of canine influenza A virus (H3N2) in Thailand. Virus genes 48: 56\u0026ndash;63. https://doi.org/10.1007/s11262-013-0978-z \u003c/li\u003e\n\u003cli\u003eVoorhees IEH, Glaser AL, Toohey-Kurth K, Newbury S, Dalziel BD, Dubovi EJ, Poulsen K, Leutenegger C, Willgert KJE, Brisbane-Cohen L, Richardson-Lopez J, Holmes EC, Parrish CR(2017) Spread of Canine Influenza A(H3N2) Virus, United States. Emerg Infect Dis 23: 1950\u0026ndash;1957. https://doi.org/10.3201/eid2312.170246\u003c/li\u003e\n\u003cli\u003eWeese JS, Anderson MEC, Berhane Y, Doyle KF, Leutenegger C, Chan R, Chiunti M, Marchildon K, Dumouchelle N, DeGelder T, Murison K, Filejksi C, Ojkic D(2019) Emergence and Containment of Canine Influenza Virus A(H3N2), Ontario, Canada, 2017-2018. Emerg Infect Dis 25: 1810\u0026ndash;1816. https://doi.org/10.3201/eid2510.190196\u003c/li\u003e\n\u003cli\u003eZhu H, Hughes J, Murcia PR(2015) Origins and Evolutionary Dynamics of H3N2 Canine Influenza Virus. J Virol 89: 5406\u0026ndash;5418. https://doi.org/10.1128/JVI.03395-14\u003c/li\u003e\n\u003cli\u003eChauhan RP, Gordon ML(2022) An overview of influenza A virus genes, protein functions, and replication cycle highlighting important updates. Virus genes 58: 255\u0026ndash;269. https://doi.org/10.1007/s11262-022-01904-w\u003c/li\u003e\n\u003cli\u003eWendel I, Rubbenstroth D, Doedt J, Kochs G, Wilhelm J, Staeheli P, Klenk HD, Matrosovich M(2015) The avian-origin PB1 gene segment facilitated replication and transmissibility of the H3N2/1968 pandemic influenza virus. J Virol 89: 4170\u0026ndash;4179. https://doi.org/10.1128/JVI.03194-14 \u003c/li\u003e\n\u003cli\u003eCui H, Che G, de Jong MCM, Li X, Liu Q, Yang J, Teng Q, Li Z, Beerens N(2022) The PB1 gene from H9N2 avian influenza virus showed high compatibility and increased mutation rate after reassorting with a human H1N1 influenza virus. Virol J 19: 20. https://doi.org/10.1186/s12985-022-01745-x\u003c/li\u003e\n\u003cli\u003eSmith BL, Chen G, Wilke CO, Krug RM(2018) Avian Influenza Virus PB1 Gene in H3N2 Viruses Evolved in Humans To Reduce Interferon Inhibition by Skewing Codon Usage toward Interferon-Altered tRNA Pools. mBio 9: e01222-18. https://doi.org/10.1128/mBio.01222-18\u003c/li\u003e\n\u003cli\u003eEllis JS, Zambon MC(2001) Combined PCR-heteroduplex mobility assay for detection and differentiation of influenza A viruses from different animal species. J Clin Microbiol 39: 4097\u0026ndash;4102. https://doi.org/10.1128/JCM.39.11.4097-4102.2001\u003c/li\u003e\n\u003cli\u003eHoffmann E, Stech J, Guan Y, Webster RG, Perez DR (2001). Universal primer set for the full-length amplification of all influenza A viruses. Arch Virol 146: 2275\u0026ndash;2289. https://doi.org/10.1007/s007050170002\u003c/li\u003e\n\u003cli\u003eLin Y, Xie X, Zhao Y, Kalhoro DH, Lu C, Liu Y(2016) Enhanced replication of avian-origin H3N2 canine influenza virus in eggs, cell cultures and mice by a two-amino acid insertion in neuraminidase stalk. Vet Res 47: 53. https://doi.org/10.1186/s13567-016-0337-x\u003c/li\u003e\n\u003cli\u003eSun H, Li H, Tong Q, Han Q, Liu J, Yu H, Song H, Qi J, Li J, Yang J, Lan R, Deng G, Chang H, Qu Y, Pu J, Sun Y, Lan Y, Wang D, Shi Y, Liu WJ, Chang KC, Gao GF, Liu J(2023) Airborne transmission of human-isolated avian H3N8 influenza virus between ferrets. Cell 186: 4074\u0026ndash;4084. https://doi.org/10.1016/j.cell.2023.08.011\u003c/li\u003e\n\u003cli\u003eSchmittgen TD, Livak KJ(2008) Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc 3: 1101\u0026ndash;1108. https://doi.org/10.1038/nprot.2008.73\u003c/li\u003e\n\u003cli\u003eChen Y, Trov\u0026atilde;o NS, Wang G, Zhao W, He P, Zhou H, Mo Y, Wei Z, Ouyang K, Huang W, Garc\u0026iacute;a-Sastre A, Nelson MI(2018) Emergence and Evolution of Novel Reassortant Influenza A Viruses in Canines in Southern China. mBio 9: e00909-18. https://doi.org/10.1128/mBio.00909-18\u003c/li\u003e\n\u003cli\u003eBrown JD, Black A, Haman KH, Diel DG, Ramirez VE, Ziejka RS, Fenelon HT, Rabinowitz PM, Stevens L, Poulson R, Stallknecht DE(2024) Antibodies to Influenza A(H5N1) Virus in Hunting Dogs Retrieving Wild Fowl, Washington, USA. Emerg Infect Dis 30: 1271\u0026ndash;1274. https://doi.org/10.3201/eid3006.231459\u003c/li\u003e\n\u003cli\u003eYao XY, Lian CY, Lv ZH, Zhang XL, Shao JW(2023) Emergence of a novel reassortant H5N6 subtype highly pathogenic avian influenza virus in farmed dogs in China. J Infect 87: e70\u0026ndash;e72. https://doi.org/10.1016/j.jinf.2023.07.013\u003c/li\u003e\n\u003cli\u003eLin HT, Wang CH, Chueh LL, Su BL, Wang LC(2015) Influenza A(H6N1) Virus in Dogs, Taiwan. Emerg Infect Dis 21: 2154\u0026ndash;2157. https://doi.org/10.3201/eid2112.141229 \u003c/li\u003e\n\u003cli\u003eMeng B, Li H, Feng C, Guo W, Feng Y, Zhu D, Chen H, Zhang Y(2023) Emergence of a novel reassortant H3N6 canine influenza virus. Front Microbiol 14: 1186869. https://doi.org/10.3389/fmicb.2023.1186869\u003c/li\u003e\n\u003cli\u003eLu G, Pan J, Zhang Y, Sun X, Ou J, Ji J, Yin X, Li S(2021) Hepatitis B virus detected in a golden monkey fatal case, China. Infect Genet Evol 94: 105032. https://doi.org/10.1016/j.meegid.2021.105032\u003c/li\u003e\n\u003cli\u003eQi M, Wang Q, Wang Y, Chen Y, Hu C, Yang W, Wu F, Huang T, Dawood AS, Zubair M, Li X, Chen J, Robertson ID, Chen H, Guo A(2023) Epidemiological Survey and Risk Factor Analysis of 14 Potential Pathogens in Golden Snub-Nosed Monkeys at Shennongjia National Nature Reserve, China. Pathogens 12: 483. https://doi.org/10.3390/pathogens12030483\u003c/li\u003e\n\u003cli\u003eOshansky CM, Gartland AJ, Wong SS, Jeevan T, Wang D, Roddam PL, Caniza MA, Hertz T, Devincenzo JP, Webby RJ, Thomas PG(2014) Mucosal immune responses predict clinical outcomes during influenza infection independently of age and viral load. Am J Respir Crit Care Med 189: 449\u0026ndash;462. https://doi.org/10.1164/rccm.201309-1616OC\u003c/li\u003e\n\u003cli\u003eWei F, Gao C, Wang Y(2022) The role of influenza A virus-induced hypercytokinemia. Crit Rev Microbiol 48: 240\u0026ndash;256. https://doi.org/10.1080/1040841X.2021.1960482\u003c/li\u003e\n\u003cli\u003eZeng H, Belser JA, Goldsmith CS, Gustin KM, Veguilla V, Katz JM, Tumpey TM(2015) A(H7N9) virus results in early induction of proinflammatory cytokine responses in both human lung epithelial and endothelial cells and shows increased human adaptation compared with avian H5N1 virus. J Virol 89: 4655\u0026ndash;4667. https://doi.org/10.1128/JVI.03095-14\u003c/li\u003e\n\u003cli\u003eRiyaz Tramboo S, Elkhalifa AME, Quibtiya S, Ali SI, Nazir Shah N, Taifa S, Rakhshan R, Hussain Shah I, Ahmad Mir M, Malik M, Ramzan Z, Bashir N, Ahad S, Khursheed I, Bazie EA, Mohamed Ahmed E, Elderdery AY, Alenazy FO, Alanazi A, Alzahrani B, Alruwaili M, Manni E, E Hussein S, Abdalhabib EK, Nabi SU (2024) The critical impacts of cytokine storms in respiratory disorders. Heliyon 10: e29769. https://doi.org/10.1016/j.heliyon.2024.e29769\u003c/li\u003e\n\u003cli\u003eBawazeer AO, Rosli S, Harpur CM, Docherty CA, Mansell A, Tate MD(2021) Interleukin-1\u0026beta; exacerbates disease and is a potential therapeutic target to reduce pulmonary inflammation during severe influenza A virus infection. Immunol Cell Biol 99: 737\u0026ndash;748. https://doi.org/10.1111/imcb.12459\u003c/li\u003e\n\u003cli\u003eRen R, Wu S, Cai J, Yang Y, Ren X, Feng Y, Chen L, Qin B, Xu C, Yang H, Song Z, Tian D, Hu Y, Zhou X, Meng G(2017) The H7N9 influenza A virus infection results in lethal inflammation in the mammalian host via the NLRP3-caspase-1 inflammasome. Sci Rep 7: 7625. https://doi.org/10.1038/s41598-017-07384-5 \u003c/li\u003e\n\u003cli\u003eMcNab F, Mayer-Barber K, Sher A, Wack A, O\u0026apos;Garra A(2015) Type I interferons in infectious disease. Nat Rev Immunol 15: 87\u0026ndash;103. https://doi.org/10.1038/nri3787\u003c/li\u003e\n\u003cli\u003ePalomino-Segura M, Perez L, Farsakoglu Y, Virgilio T, Latino I, D\u0026apos;Antuono R, Chatziandreou N, Pizzagalli DU, Wang G, Garc\u0026iacute;a-Sastre A, Sallusto F, Carroll MC, Neyrolles O, Gonzalez(2019) Protection against influenza infection requires early recognition by inflammatory dendritic cells through C-type lectin receptor SIGN-R1. Nat Microbiol 4: 1930\u0026ndash;1940. https://doi.org/10.1038/s41564-019-0506-6\u003c/li\u003e\n\u003cli\u003eHudspeth K, Fogli M, Correia DV, Mikulak J, Roberto A, Della Bella S, Silva-Santos B, Mavilio D(2012) Engagement of NKp30 on V\u0026delta;1 T cells induces the production of CCL3, CCL4, and CCL5 and suppresses HIV-1 replication. Blood 119: 4013\u0026ndash;4016. https://doi.org/10.1182/blood-2011-11-390153\u003c/li\u003e\n\u003cli\u003eGuo F, Yang J, Pan J, Liang X, Shen X, Irwin DM, Chen RA, Shen Y(2020) Origin and Evolution of H1N1/pdm2009: A Codon Usage Perspective. Front Microbiol 11: 1615. https://doi.org/10.3389/fmicb.2020.01615\u003c/li\u003e\n\u003cli\u003eSun T, Guo Y, Zhao L, Fan M, Huang N, Tian M, Liu Q, Huang J, Liu Z, Zhao Y, Ji Z, Ping J(2022) Evolution of the PB1 gene of human influenza A (H3N2) viruses circulating between 1968 and 2019. Transbound Emerg Dis 69: 1824\u0026ndash;1836. https://doi.org/10.1111/tbed.14161\u003c/li\u003e\n\u003cli\u003eMarjuki H, Scholtissek C, Franks J, Negovetich NJ, Aldridge JR, Salomon R, Finkelstein D, Webster RG(2010) Three amino acid changes in PB1-F2 of highly pathogenic H5N1 avian influenza virus affect pathogenicity in mallard ducks. Arch Virol 155: 925\u0026ndash;934. https://doi.org/10.1007/s00705-010-0666-4\u003c/li\u003e\n\u003cli\u003eLe Goffic R, Leymarie O, Chevalier C, Rebours E, Da Costa B, Vidic J, Descamps D, Sallenave JM, Rauch M, Samson M, Delmas B(2011). Transcriptomic analysis of host immune and cell death responses associated with the influenza A virus PB1-F2 protein. PLoS Pathog 7: e1002202. https://doi.org/10.1371/journal.ppat.1002202\u003c/li\u003e\n\u003cli\u003eVarga ZT, Grant A, Manicassamy B, Palese P(2012) Influenza virus protein PB1-F2 inhibits the induction of type I interferon by binding to MAVS and decreasing mitochondrial membrane potential. J Virol 86: 8359\u0026ndash;8366. https://doi.org/10.1128/JVI.01122-12\u003c/li\u003e\n\u003cli\u003eZamarin D, Ortigoza MB, Palese P(2006) Influenza A virus PB1-F2 protein contributes to viral pathogenesis in mice. J Virol 80: 7976\u0026ndash;7983. https://doi.org/10.1128/JVI.00415-06\u003c/li\u003e\n\u003cli\u003eChen W, Calvo PA, Malide D, Gibbs J, Schubert U, Bacik I, Basta S, O\u0026apos;Neill R, Schickli J, Palese P, Henklein P, Bennink JR, Yewdell JW(2001) A novel influenza A virus mitochondrial protein that induces cell death. Nat Med 7: 1306\u0026ndash;1312. https://doi.org/10.1038/nm1201-1306\u003c/li\u003e\n\u003cli\u003eAlymova IV, Green AM, van de Velde N, McAuley JL, Boyd KL, Ghoneim HE, McCullers JA(2011) Immunopathogenic and antibacterial effects of H3N2 influenza A virus PB1-F2 map to amino acid residues 62, 75, 79, and 82. J Virol 85: 12324\u0026ndash;12333. https://doi.org/10.1128/JVI.05872-11\u003c/li\u003e\n\u003cli\u003eAlymova IV, Samarasinghe A, Vogel P, Green AM, Weinlich R, McCullers JA(2014) A novel cytotoxic sequence contributes to influenza A viral protein PB1-F2 pathogenicity and predisposition to secondary bacterial infection. J Virol 88: 503\u0026ndash;515. https://doi.org/10.1128/JVI.01373-13\u003c/li\u003e\n\u003cli\u003ePinar A, Dowling JK, Bitto NJ, Robertson AA, Latz E, Stewart CR, Drummond GR, Cooper MA, McAuley JL, Tate MD, Mansell A(2017) PB1-F2 Peptide Derived from Avian Influenza A Virus H7N9 Induces Inflammation via Activation of the NLRP3 Inflammasome. J Biol Chem 292: 826\u0026ndash;836. https://doi.org/10.1074/jbc.M116.756379\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-veterinary-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [BMC Veterinary Research](http://bmcvetres.biomedcentral.com/)","snPcode":"12917","submissionUrl":"https://submission.nature.com/new-submission/12917/3?","title":"BMC Veterinary Research","twitterHandle":"@BMC_series","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-6582619/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6582619/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eInfluenza A virus (IAV) is one of the most challenging pathogens that threaten human and animal health. In June 2022, seven golden monkeys (\u003cem\u003eRhinopithecus roxellanaes\u003c/em\u003e) developed flu-like symptoms in succession at a zoo in Jiangsu Province of China, two of which died of respiratory distress. All the swab samples from affected golden monkeys were tested positive for IAV. In the dead animals, the most notable involved organ is the lung, which manifested as emphysema and pulmonary parenchymatous carnification. Histopathological and immunostaining data supported a diagnosis of pulmonary infection with influenza virus. One strain of H3N2 virus, named A/golden monkey/Jiangsu/1/2022 (Gm-1), was isolated from the lungs of dead golden monkeys. Sequence and phylogenetic analysis revealed that its PB1 gene is most closely related to an influenza isolate obtained from human (A/Hong Kong/4801/2014), while the remaining 7 genes show 100% sequence identity with those of canine H3N2 virus (A/canine/Jiangsu/06/2010, JS06). Experimental infection of two rescued viruses (rGm-1 and rJS06) by reverse genetics in BALB/c mice revealed that the rGm-1 virus induced more persistent pathological damage in the lungs, and was less likely to be cleared, compared to the rJS06 virus. Further investigation indicated that human-origin PB1 could induce higher levels of proinflammatory cytokines than canine-origin PB1, which might be a contributing factor to pathobiological characteristics displayed by the rGm-1 virus. This study extends the host range of influenza viruses, and underscores the need for efficient biosecurity practices and enhanced surveillance efforts in the endangered species.\u003c/p\u003e","manuscriptTitle":"Fatal infection of a novel canine/human reassortant H3N2 influenza A virus in the zoo-housed golden monkeys","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-05-21 10:42:50","doi":"10.21203/rs.3.rs-6582619/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Reject, do not transfer","date":"2025-06-16T00:34:29+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"","date":"2025-05-19T13:07:30+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-05-19T13:02:59+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"BMC Veterinary Research","date":"2025-05-19T11:58:58+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-05-14T09:32:59+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Veterinary Research","date":"2025-05-14T05:23:21+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-veterinary-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [BMC Veterinary Research](http://bmcvetres.biomedcentral.com/)","snPcode":"12917","submissionUrl":"https://submission.nature.com/new-submission/12917/3?","title":"BMC Veterinary Research","twitterHandle":"@BMC_series","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"36088684-0a2c-4c45-a6ef-4fcf98983089","owner":[],"postedDate":"May 21st, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2025-05-21T10:42:50+00:00","versionOfRecord":[],"versionCreatedAt":"2025-05-21 10:42:50","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6582619","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6582619","identity":"rs-6582619","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}