Physical interaction with Ephrin B1 promotes CXCR4 intracellular localization and oncogenic potential

Physical interaction with Ephrin B1 promotes CXCR4 intracellular localization and oncogenic potential | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Physical interaction with Ephrin B1 promotes CXCR4 intracellular localization and oncogenic potential Alessandro Rabbito, Omolade Otun, Amos Fumagalli, Martial Séveno, and 10 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7145754/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 5 You are reading this latest preprint version Abstract Chemokine receptor 4 (CXCR4) is a member of the chemokine receptor family, exclusively activated by the chemokine CXCL12. While CXCR4 regulates numerous physiological processes associated with cell migration and embryogenesis, its overexpression has been involved in various cancer types. Studies suggest that intracellular CXCR4 rather than CXCL12-induced signaling at the plasma membrane contributes to its pro-tumorigenic functions. Given the role of GPCR-interacting proteins in their trafficking and subcellular localization, we characterized the CXCR4 interactome using an affinity purification coupled to mass spectrometry (AP-MS) strategy. The most abundant protein identified in the CXCR4 interactome is Ephrin B1, a member of the Ephrin protein family that shares several functions with CXCR4, such as the regulation of cell migration and proliferation. Further studies showed that the interaction between CXCR4 and Ephrin B1 is direct and enhanced upon CXCR4 activation by CXCL12. They also indicated that Ephrin B1 prevents CXCR4 N-glycosylation, decreases CXCR4 cell surface expression, and consistently inhibits CXCL12-induced CXCR4 coupling to G αi1−3 and recruitment of β-arrestins 1 and 2. Conversely, Ephrin B1 signals to Erk1/2 through CXCR4 activation and mediates the decrease in Death Receptor 5 expression elicited by intracellular CXCR4. Collectively, these findings identify Ephrin B1 as a potential mediator of CXCR4-driven tumorigenic signaling. G protein-coupled receptor chemokine signal transduction interactome Ephrin cancer Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction The C-X-C chemokine receptor type 4 (CXCR4) is a conventional chemokine receptor that, unlike many chemokine receptors, binds to a single chemokine, CXCL12, also referred to as SDF-1. CXCR4 is expressed in numerous cell types, including endothelial cells, lymphocytes, fibroblasts, hematopoietic stem cells, neurons, and glial cells where it plays a pivotal role in migration, proliferation and differentiation [ 1 ]. CXCR4 is also involved in several pathological processes, including the Warts, Hypogammaglobulinemia, Immunodeficiency, and Myelokathexis (WHIM) syndrome and Human Immunodeficiency Virus-1 infection [ 2 , 3 ]. It is overexpressed in numerous cancer types and is involved in cancer progression and metastasis [ 4 ]. CXCR4 is canonically coupled to Gα i proteins and inhibits adenylyl cyclase. It also activates the Erk1/2 pathway through several mechanisms involving either its phosphorylation by GRK3 and GRK6 and the recruitment of β-arrestins, or the activation of PI3Kγ heterodimers p110γ-p101 through Gβγ proteins [ 5 , 6 ]. Despite the unequivocal role of CXCR4-operated signaling, such as PI3K-Erk signaling, in cancer growth and metastasis, the limited therapeutic efficacy of CXCR4 antagonists, including the FDA-approved compound AMD3100, in cancer treatment suggests that some tumorigenic effects under the control of the receptor could be independent of the CXCL12-CXCR4 signaling axis [ 7 ]. This conundrum can in part be explained with the recent demonstration of the existence of agonist-independent, CXCR4 oligomer-mediated signaling, which promotes cell survival, migration and tumour growth in lymphoid neoplasms [ 8 ]. Another study has shown that intracellular CXCR4 rather than CXCL12-induced CXCR4 signaling promotes cancer cell survival through the downregulation of the Death Receptor 5 (DR5), thereby rendering cancer cells resistant to chemotherapeutic drugs like paclitaxel [ 9 ].These findings suggest that future therapies targeting CXCR4 should not only consider CXCR4-associated signaling at the plasma membrane, but also mechanisms underlying the localization of CXCR4 in intracellular compartments. There is accumulating evidence indicating that the trafficking and targeting of G protein-coupled receptors (GPCRs) to specific cellular compartments depends on their association with protein partners. For instance, while the association of CXCR4 with Filamin A stabilizes the receptor at the plasma membrane by blocking its endocytosis [ 10 ], its interaction with Reticulon 3 (RTN3) promotes its translocation to the cytoplasm [ 11 , 12 ]. These findings advocate for the in-depth characterization of the CXCR4 interactome to identify novel mechanisms underlying its tumorigenic effects, an issue we addressed thanks to a proteomic strategy combining affinity purification of receptor-interacting proteins and their identification by mass spectrometry. This interactomic screen identified Ephrin B1, a member of the single transmembrane domain Ephrin-B family overexpressed in numerous cancer types and involved in tumor progression and metastasis as well as resistance to chemotherapies [ 13 ]. A previous study showed that Ephrin B1 modulates G protein signaling induced by CXCR4 activation via the recruitment of the regulator of G protein signaling 3 (RGS3) protein through its C-terminal PDZ domain, thus establishing functional interactions between CXCR4 and Ephrin B1 [ 14 ]. In light of these findings, we further explored the impact of Ephrin B1 on CXCR4 post-translational modifications, cellular localization and signal transduction. We show that Ephrin B1 retains CXCR4 in intracellular compartments and contributes to CXCR4-dependent decrease in DR5 expression, suggesting that it might be a key player contributing to CXCR4’s oncogenic potential. Materials and Methods Materials Plasmids and shRNAs The HA-CXCR4-pCDNA3.1 construct was obtained from cDNA.org (Bloomsburg University), and the FLAG-Ephrin B1-pcDNA3.1 plasmid was provided by the Montpellier Genomic Collections platform. The Ephrin B1 ΔCter construct (purchased from GeneCust) was designed by removing 84 amino acids from the C-terminus. Based on the predicted structure, this deletion eliminates the C-terminal domain of the protein, resulting in a truncated version with an approximate molecular weight of 28.5 kDa. The pcDNA3.1 plasmids encoding Venus-Tagged G protein subunit gamma 2 (Venus-γ2), FLAG-tagged G-protein subunit beta 2 (FLAG-β2), Gαi1-RLuc -RLuc, and Gαi3-RLuc were provided by Dr. D. Maurel (IGF, Montpellier, France). ACKR3-NeonGreen, CXCR4-NeonGreen were previously described [15]. HiBiT-CXCR4 plasmid was described in a previous study [16]. Ephrin B1-NeonGreen, Ephrin B1-Nluc were cloned as previously described [15]. LYN-NeonGreen, ACKR3-Nluc, CXCR4-Nluc, LgBiT-β-arrestin1/2, and CXCR4-smBiT in pcDNA3.1 were previously described [17, 18]. ShRNA were obtained from Sigma-Aldrich MISSION shRNA library clones. Specific EphrinB1 shRNA was selected amongst shRNAs targeting the coding sequence (ref NM_004429, target sequence AGCACCATGATTACTACATTA). For the control condition, we used the MISSION Non-Target shRNA Control sequence. This shRNA sequence does not target any known genes from any species. Both control and specific shRNAs were obtained in the pLKO.1-puro-CMV-tGFP backbone. Reagents CXCL12, purchased from R&D Systems (Ref 350-NS-CF), was dissolved in sterile PBS to a concentration of 10 mM, aliquoted, and stored at -80°C. AMD3100 purchased from Tocris (Ref 3299) was dissolved in DMSO to a final concentration of 20 mM, aliquoted, and stored at ‑20°C. Gallein was purchased from Tocris (Ref 3090) and dissolved in DMSO to a final concentration of 75 mM, aliquoted, and stored at -20°C. Antibodies Protein Host Species Dilution & Application Supplier REF Primary antibodies CXCR4 Rabbit 1/1,000 WB Abcam AB124824 Ephrin B1 Rabbit 1/2,000 WB Biorbyt orb395013 HA Rat 1/1,000 WB Roche 11867423001 CXCR4 pS 324/325 Rabbit 1/1,000 WB 7-TM 7TM0071A CXCR4 pS 330 Rabbit 1/1,000 WB 7-TM 7TM0071C CXCR4 pS 346/347 Rabbit 1/1,000 WB 7-TM 7TM0071B DR5 Rabbit 1/1,000 WB Cell signaling Technology 8074 GAPDH Rabbit 1/5,000 WB Cell signaling Technology 51332 p44/42 MAPK Rabbit 1/1,000 WB Cell signaling Technology 9102 p-p44/42 MAPK Rabbit 1/1,000 WB Cell signaling Technology 9101 LAMP1 Rabbit 1/250 ICC Cell signaling Technology 9091 Calnexin Rabbit 1/250 ICC Transduction laboratories C45520 GM130 Mouse 1/250 ICC BD Transduction 610823 Label Target Species Dilution & Application Supplier REF Secondary antibodies Alexa Fluor® 633 Rabbit 1/500 ICC Invitrogen 210071 Alexa Fluor® 633 Mouse 1/500 ICC Invitrogen 210052 HRP Rat 1/5,000 WB Jackson ImmunoResearch 112-035-003 HRP Rabbit 1/5,000 WB Cell signaling 7074 Cell cultures and transfection HEK293T cells, purchased from ATCC (Anassas, VI, ATCC, CRL-1573), were grown in Dulbecco’s Modified Eagle’s Medium (DMEM, Thermo Fisher Scientific, Ref 419960) supplemented with 10% heat-inactivated fetal bovine serum (Thermo Fisher Scientific, Ref 10099-133), 1% penicillin/streptomycin, and maintained in humidified atmosphere containing 5% CO 2 at 37°C. Cells were passed twice a week and used between passages 10 and 25. They were transfected using polyethylenimine (jetPEI ® , Polyplus, Ref 101000053) and used 24/48 h after transfection. MCF7 cells, provided by Dr. Stéphan Jalaguier and Vincent Cavaillès (Institut de Recherche en Cancérologie de Montpellier), were cultured in /Dulbecco’s modified Eagle’s medium/F12 supplemented with 10% heat-inactivated bovine serum (Thermo Fisher Scientific, Ref 10099-133), 1% penicillin/streptomycin, and maintained in a humidified atmosphere containing 5% CO 2 at 37°C. Cells were passed twice a week and used between passages 10 and 25. They were transfected using Lipofectamine TM 2000 (Thermo Fisher Scientific, Ref 11668019) and used 48 h after transfection. Co-immunoprecipitation HEK293T cells transfected with empty vector or vectors expressing HA- or Flag-tagged proteins were lysed in ice-cold lysis buffer containing 1% n-Dodecyl-β-D-Maltopyranoside (DDM, Anatrace, Ref D310), 20 mM Tris-HCl (pH 7.5), 100 mM NaCl, 2.5 mM CaCl 2 , phosphatase inhibitors (NaF, 10 mM; Na + -vanadate, 2 mM; Na+-pyrophosphate, 1 mM; and β-glycerophosphate, 50 mM) and the cOmplete Protease Inhibitor Cocktail (Merck, Ref 11836145001). Samples were maintained under gentle agitation for 1 h, at 4 °C and centrifuged for 15 min at 15,000 × g to eliminate insoluble material. Soluble proteins were quantified by bicinchoninic acid assay (BCA, Merck, Refs B29643 and C2284) and equal protein amounts (5 or 0.5 mg for IP followed by mass spectrometry or Western blotting, respectively) were incubated with agarose-conjugated anti-HA antibody (Merck, Ref A2095) or with anti-FLAG M2 affinity gel (Sigma Aldrich, Ref A2220) overnight at 4 °C. Samples were then washed twice with an ice-cold solution of 0.5 M of NaCl and phosphatase inhibitors and three times with 0.25 M NaCl and phosphatase inhibitors. Immunoprecipitated proteins were then eluted in Laemmli sample buffer. Protein identification by mass spectrometry Immunoprecipitated proteins from cells transfected with an empty vector (Mock) or a vector HA-tagged CXCR4 were separated by SDS-PAGE and stained with Protein Staining Solution (Euromedex, Ref 10-0911). Gel lanes were cut into seven gel pieces and destained with 50 mM TriEthylAmmonium BiCarbonate (TEABC, Merck, Ref T7408) followed by three washes in 100% acetonitrile. After reduction (with 10 mM dithiothreitol in 50 mM TEABC at 60 °C for 30 min) and alkylation (with 55 mM iodoacetamide TEABC at room temperature for 60 min), proteins were digested in-gel using trypsin (500 ng/band, Gold, Promega, Ref V5280). Digest products were dehydrated in a vacuum centrifuge and reduced to 3 μL. The generated peptides were analyzed online by nano-flow liquid chromatography coupled to tandem-mass spectrometry (nanoLCMS/MS) using an Orbitrap Elite mass spectrometer (Thermo Fisher Scientific, Waltham USA) coupled to an Ultimate 3000 HPLC (Thermo Fisher Scientific). Desalting and pre-concentration of samples were performed on-line on a Pepmap® pre-column (0.3 mm × 10 mm, Dionex). A gradient consisting of 0–40% B for 60 min and 80% B for 15 min (A = 0.1% formic acid, 2% acetonitrile in water; B = 0.1% formic acid in acetonitrile) at 300 nL/min was used to elute peptides from the capillary reverse-phase column (0.075 mm × 150 mm, Acclaim Pepmap 100® C18, Thermo Fisher Scientific). Eluted peptides were electrosprayed online at a voltage of 1.8 kV into the Orbitrap Elite mass spectrometer. A cycle of one full-scan mass spectrum (MS1, 400–2,000 m/z) at a resolution of 120,000 (at 400 m/z), followed by 20 data-dependent tandem-mass (MS2) spectra was repeated continuously throughout the nanoLC separation. All MS2 spectra were recorded using normalized collision energy (33%, activation Q 0.25 and activation time 10 ms) with an isolation window of 2 m/z. Data were acquired using the Xcalibur software (v 2.2). For all full scan measurements with the Orbitrap detector a lock-mass ion from ambient air (m/z 445.120024) was used as an internal calibrant63. Mass spectra were processed using the MaxQuant software package (v 1.5.5.1) and MS2 using the Andromeda search engine [19] against the UniProtKB Reference proteome UP000005640 database for Homo sapiens (release 2017_10) and the contaminant database in MaxQuant. The following parameters were used: enzyme specificity set as Trypsin/P with a maximum of two missed cleavages, Oxidation (M) and Phosphorylation (STY) set as variable modifications and carbamidomethyl (C) as fixed modification, and a mass tolerance of 0.5 Da for-fragment ions. The maximum false peptide and protein discovery rate was specified as 0.01. Seven amino acids were required as minimum peptide length. When precursor peptides were present in MS1 spectra but not selected for fragmentation and identification by MS2 in given runs, peptide identification were based on accurate mass and retention times across LC-MS runs using the matching between runs tool in MaxQuant. Only proteins identified in all three biological replicates in at least one group were considered for further analysis. Relative protein quantification in IP from CXCR4-expressing cells and Mock cells was performed using the label-free quantification (LFQ) algorithm “[https://maxquant.net/maxquant/]”. For statistical analysis, missing values were defined using the imputation tool of the Perseus software (v. 1.5.6.072) “[https://maxquant.net/perseus/]”. Western blotting Proteins were separated by SDS-PAGE using 10% polyacrylamide gels and transferred to nitrocellulose membranes (Bio-Rad, Ref 1704271). Membranes were incubated in blocking buffer (Tris-HCl, 50 mM, pH 7.5; NaCl, 200 mM; Tween-20, 0.1% and skimmed dried milk, 5%) for 1 h at room temperature and overnight with primary antibodies in incubating buffer (Tris-HCl, 50 mM, pH 7.5; NaCl, 200 mM; Tween-20, 0.1% and Bovine Serum Albumin (Merck, Ref A2153), 3%) at 4 °C. Then membranes were immunoblotted with either or anti-rat (Jackson ImmunoResearch, Ref 112-035-003) or anti-rabbit (Cell Signaling, Ref 7074) horseradish peroxidase (HRP)-conjugated secondary antibodies (1/5,000) in blocking buffer for 1 h at room temperature. Immunoreactivity was detected with an enhanced chemiluminescence method (Western lightning® Plus-ECL, Perkin Elmer, Ref NEL103E001EA) on a ChemiDoc™ Touch Imaging System (Bio-Rad). Quantification was performed using the Image Lab software (Bio-Rad). Production and purification of CXCR4 and Ephrin B1 For production in insect cells, the full-length genes encoding human CXCR4 or Ephrin B1 was subcloned into pFastBac1 to enable infection of sf9 insect cells. The CXCR4 construct bore a hemagglutinin signal peptide followed by a Flag-tag preceding the receptor sequence. Mutations N11Q, S18A and N33Q residues were introduced to avoid N- or O-glycosylation for improved sample heterogeneity. The Ephrin B1 sequence was followed by a C-terminal 3C human rhinovirus 3C (HRV3C) protease cleavage site and a twin-Strep-tag (Strep-Ephrin B1). Flag-CXCR4 and Strep-Ephrin B1 were expressed in Sf9 cells using the pFastBac baculovirus system (Thermo Fisher Scientific). Cells were grown in suspension in EX-CELL 420 medium (Sigma-Aldrich) and infected at a density of 4 x 10 6 cells/ml with the recombinant baculovirus. Flasks were shaken for 48 h at 28 °C, subsequently harvested by centrifugation (3,000 × g , 20 min) and stored at -80°C until usage. Cell pellets were first thawed and lysed by osmotic shock in a lysis buffer containing 10 mM Tris-HCl (pH 7.4), 1 mM EDTA, 2 mg/ml iodoacetamide, and protease inhibitors: 50 μg/ml Leupeptin (Euromedex), 0.1 mg/ml Bensamidine (Sigma-Aldrich) and 0.1 mg/ml Phenylmethylsulfonyl fluoride (PMSF; Euromedex). Lysates were centrifuged (38,400 × g , 10 min), and the resulting pellet was solubilized in buffer containing 50 mM Tris (pH 7.5), 150 mM NaCl, 2 mg/ml iodoacetamide, 0.5% (w/v) dodecyl maltoside (DDM, Anatrace), Cholesteryl hemisuccinate (CHS, 0.1% w/v) and protease inhibitors (50 μg/ml Leupeptin, 0.1 mg/ml Bensamidine and 0.1 mg/ml PMSF) using a Dounce homogenizer. Resulting homogenates were then stirred for 1 h, at 4 °C and centrifuged (38,400 × g , 30 min). CXCR4 supernatant was loaded onto M2 anti-Flag affinity resin (Sigma-Aldrich Ref A2220) using gravity flow. Ephrin B1 supernatant was supplemented with BioLock (0.75 ml/L) and incubated with Streptactin resin (IBA-Lifesciences, Ref 2-1206-025) for 1 h. Resins were each washed with 10 column volumes (CV) of wash buffer containing 50 mM Tris-HCl pH 7.4, 150 mM NaCl, 0.1% (w/v) DDM, and 0.02% (w/v) CHS. The resin was finally washed with a last wash buffer containing 50 mM Tris-HCl (pH 7.4), 150 mM NaCl, DDM 0.02% (w/v), CHS 0.002% (w/v) and eluted in last wash buffer supplemented with 0.4 mg/ml Flag peptide for elution of CXCR4 or 2.5mM desthiobiotin for elution of Ephrin B1. Each eluate was concentrated using a 50 kDa molecular weight cutoff (MWCO) concentrator (Millipore). CXCR4 was then purified by size exclusion chromatography (SEC) using a Superdex 200 Increase (10/300 GL column) connected to an ÄKTA purifier system (GE Healthcare) and eluted in SEC buffer (50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 0.02% (w/v) DDM, 0.002% (w/v) CHS). Buffers used for CXCR4 purification were supplemented with the CXCR4 antagonist IT1t (1 µM in the lysis and solubilization buffers, 0.1 µM in the wash and elution buffers, Bio-Techne) to stabilize the receptor. Co-immunoprecipitation of purified CXCR4 and Ephrin B1 Complexes of the two purified proteins were formed by mixing them at a 2:1 ratio and incubating the samples at 4°C overnight. The samples were then loaded onto M2 anti-Flag affinity resin, washed with 6 CV of SEC buffer, and eluted with SEC buffer supplemented with 0.4 mg/ml Flag peptide. The resulting eluate was loaded onto a column containing Streptactin resin, washed with 6 CV of SEC buffer, and eluted with SEC buffer supplemented with 2.5 mM Desthiobiotin. BRET HEK293T cells were co-transfected with the indicated constructs and seeded (25,000 cells/well) in white polyornithine-coated 96-well plates (SPL Life Sciences). Twenty-four hours after transfection, cells were washed with PBS. Coelenterazine H (Nanolight Technology, Ref 50909-86-9) was added at a final concentration of 5 μM for 10 min at 37°C. Cells were then exposed to vehicle or CXCL12, and luminescence was measured using a Mithras LB 940 plate reader (Berthold Biotechnologies) that allows the sequential integration of light signals detected with two filter settings (Rluc/NLuc filter, 485 ± 20 nm; and YFP filter, 530 ± 25 nm). Data were collected using the MicroWin2000 software (Berthold Biotechnologies). NanoBRET assay assessing plasma membrane localization of CXCR4 HEK293T cells were co-transfected with vectors encoding human CXCR4 C-terminally fused with Nano-Luciferase (N-Luc) and the first 11 residues of the human Lyn-kinase sequence, fused with Neon-Greem, respectively, in the absence or presence of a vector encoding Ephrin B1. Twenty-four hours after transfection, cells were harvested, incubated for 20 min at 37°C with coelenterazine H in Opti-MEM, and distributed into white 96-well plates (150,000 cells/well). The luminescence generated was measured with a GloMax Discover plate reader (Promega), equipped with 450/10 filter for donor luminescence emission and 530 LP filter for acceptor fluorescence emission [20]. CXCR4 cellular distribution monitoring using Nano-luciferase complementation (HiBiT) Receptor cellular distribution in basal conditions and upon ligand stimulation was monitored by using a nanoluciferase complementation assay based on the NanoGlo HiBiT extracellular and Nano-Glo HiBiT lytic detection systems (Promega). HEK293T cells were co-transfected with pHiBiT vector encoding CXCR4 N-terminally fused to HiBiT and a vector encoding Ephrin B1. Forty-eight hours after transfection, cells were distributed in white 96-well plates (50,000 cells per well) and stimulated with CXCL12 (10 or 50 nM) for 30 min at 37°C. After the addition of Nano-Glo® HiBiT reagent, containing soluble LgBiT protein, in ratio of 1:100 of the final volume, luminescence was recorded for 30 min with a GloMax Discover plate reader (Promega). In unstimulated conditions, surface and total receptor expression were determined using the Nano-Glo HiBiT extracellular detection system (Promega) and Nano-Glo HiBiT lytic detection system (Promega), respectively. β-arrestin recruitment assay based on Nano-luciferase complementation (NanoBiT) β-arrestin-1 and β-arrestin-2 recruitment to CXCR4, was monitored using a Nano-luciferase complementation-based assay (NanoBiT, Promega). HEK293T cells were co-transfected with vectors encoding human β-arrestins N-terminally fused with LgBiT, CXCR4 C-terminally fused with SmBiT in the absence or presence of a vector encoding Ephrin B1. Twenty-four hours after transfection, cells were harvested, incubated for 20 min at 37°C with coelenterazine H in Opti-MEM, and distributed into white 96-well plates (150,000 cells/well). CXCL12 was then added at the indicated concentration, and the luminescence generated upon Nano-luciferase complementation was measured with a GloMax Discover plate reader (Promega). Immunocytochemistry and confocal microscopy HEK293T cells grown on glass coverslips were fixed with a 4% solution of PFA in PBS for 10 min. Excess of PFA was quenched by washing cells in a 0.1 M solution of glycine in PBS for 10 min. Cells were permeabilized with a PBS solution containing 0.5% heat-inactivated bovine serum and 0.1% Triton X-100 for 15 min. Cells were washed three times and incubated with primary antibodies (anti-LAMP1 (rabbit or mouse) or anti-GM130 (mouse), or anti-Calnexin (rabbit)) in PBS containing 0.5% heat-inactivated bovine serum and 0.1% Triton X-100. After three washes in PBS, cells were incubated for 1 h at room temperature in PBS containing 0.5% bovine serum, 0.1% Triton X-100, the appropriate secondary antibody (Alexa Fluor® 633-conjugated anti-mouse antibody (1/250, Invitrogen, Ref 210052), Alexa Fluor® 633-conjugated anti-rabbit antibody (1/250, Invitrogen Ref 210071)) and DAPI (1 µg/ml). Cells were then washed three times with PBS and coverslips were mounted on Superfrost ultra plus glass slides using fluorescent mounting medium. Pictures were acquired with a LSM980 confocal microscope (Zeiss) equipped with a 40X oil-immersed lens, with a 2791 × 2791 resolution, and 1 µm between focus points. Statistics Statistical analysis of the CXCR4 interactome was performed using the Perseus software (v 1.5.6.072). Proteins were considered statistically significant using a t-test by setting the randomization number at 250, the False Discovery Rate at 0.01, and the S0 at 0.1. All other statistical analyses were performed using Prism (v.8.0, GraphPad Software Inc), and the statistical tests used are indicated in each legend. Dose-response curves ( Fig.s 3D,E and 4B ) were fitted by the log (agonist) vs. response (four parameters) non-linear regression using Prism. Saturation BRET experiments were analyzed using Prism. The one-site specific binding model was used to obtain the curve fit. All data are presented as means ± SEM. Significance levels were defined as p < 0.05 (*), p < 0.01 (**), p < 0.001 (***), and p < 0.0001 (****). Results Characterization of the CXCR4 interactome reveals a physical interaction between CXCR4 and Ephrin B1 We analyzed the CXCR4 interactome in human embryonic kidney (HEK-293T) cells that endogenously express CXCR4 and where CXCR4-dependent signaling has been extensively investigated [ 5 , 6 , 21 ]. Due to the lack of a CXCR4 antibody providing receptor immunoprecipitation yields compatible with mass spectrometry analysis, we expressed hemagglutinin (HA)-tagged CXCR4 in the cells and CXCR4-interacting proteins were immunoprecipitated using an anti-HA monoclonal antibody immobilized onto agarose beads. Control immunoprecipitations were performed using cells transfected with an empty plasmid (Mock condition). Systematic analysis by LC-MS/MS of proteins in immunoprecipitates from both conditions in three biological replicates identified 1,203 proteins. Label-free quantification of their relative abundance in both conditions showed that 19 of them exhibited significant enrichment in immunoprecipitates from CXCR4-expressing cells, compared with immunoprecipitates from control cells (Fig. 1 A and Table S1 ). As expected, CXCR4 (bait protein) was the most enriched one (log 2 LFQ CXCR4 /LFQ Mock = 8.13, -log 10 p-value = 4.82), while the second ranked protein was Ephrin B1 (log 2 LFQ CXCR4 /LFQ Mock = 7.29, -log 10 p-value = 4.96, Fig. 1 A and Table S1 ). Ephrin B1 is a member of the Ephrin-B family comprising three proteins (Ephrin B1-3) that act as ligands of the tyrosine kinase Eph receptors involved in numerous biological processes, including axon guidance and cell migration during neurodevelopment, and the proliferation of various cancer cell types [ 13 ]. Notably, Ephrin B1 was the only member of the Ephrin ligand family identified in the CXCR4 interactome. Considering the strong enrichment of Ephrin B1 in the CXCR4 interactome, their role in common cellular and pathological processes and the existence of functional interactions between both proteins [ 22 – 24 ], we then focused on the CXCR4-Ephrin B1 interaction. Co-immunoprecipitation followed by Western blotting from cells co-expressing HA-CXCR4 and Flag-Ephrin B1 confirmed that Ephrin B1 co-immunoprecipitated with CXCR4 and vice versa (Fig. 1 B). The C-terminal domain of GPCRs has been identified as a major site involved in their interaction with their protein partners [ 25 ]. Nevertheless, the co-immunoprecipitation of Ephrin B1 with CXCR4 was not affected by the deletion of CXCR4’s 15 C-terminal residues (major mutation responsible for the WHIM syndrome, CXCR4-WHIM [ 26 ]) nor of its entire C-terminal domain (CXCR4ΔCter, Figure S1 ), indicating that the CXCR4 C-terminal domain is not involved in the recruitment of Ephrin B1. In contrast, the C-terminal domain of Ephrin B1 seems to be essential to the formation of the CXCR4-Ephrin B1 complex, as its deletion abolished the co-immunoprecipitation of Ephrin B1 with CXCR4 (Fig. 1 C). We next analyzed CXCR4-Ephrin B1 interaction in living HEK-293T cells using bioluminescence resonance energy transfer (BRET). Under conditions of constant Ephrin B1-NLuc expression, the BRET signal increased hyperbolically as a function of the CXCR4-Neon Green expression level (Fig. 1 D). Further, the BRET signal was significantly increased upon CXCR4 activation by CXCL12 (Bmax = 802 ± 54.3 vs. 974 ± 29 mBRET in the absence and presence of CXCL12, respectively, p = 0.011, one-way ANOVA followed by Bonferroni’s multiple comparisons test), indicating that the interaction with Ephrin B1 is promoted by agonist stimulation of CXCR4. Corroborating previous interactomics studies that did not identify Ephrin B1 as a protein partner of ACKR3 [ 27 ], an atypical chemokine receptor known to form heteromers and to be functionally linked with CXCR4 [ 28 – 30 ], the BRET signal was much lower in cells co-expressing Ephrin B1-NLuc and increasing amounts of ACKR3-Neon Green than that measured in cells co-expressing Ephrin B1 and CXCR4 (Fig. 1 D). Furthermore, no CXCL12-induced effect was observed. Collectively, these observations indicate a close and specific interaction between CXCR4 and Ephrin B1. To establish whether the interaction between both proteins is direct, purified recombinant Flag-CXCR4 and Strep-Ephrin B1 were obtained from Sf9 cells, mixed at 2:1 protein ratio and subjected to sequential affinity purification on M2 anti-Flag affinity resin and, after elution of the retained material, on Streptactin resin. We found that Strep-Ephrin B1 was co-purified with Flag-CXCR4 on Flag resin while Flag-CXCR4 was co-copurified with Strep-Ephrin B1 on Streptactin resin, indicative of a direct physical interaction between both proteins (Fig. 1 E). Impact of Ephrin B1 on CXCR4 glycosylation and phosphorylation Co-expression of Ephrin B1 with CXCR4 modified the pattern of CXCR4 migration in SDS-PAGE, leading to a single immunoreactive band at around 40 kDa, instead of two bands (the 40 kDa band and another band of higher apparent molecular weight) when the receptor was expressed alone (Fig. 2 B), suggesting that Ephrin association with CXCR4 might affect CXCR4 post-translational modifications (see Fig. 2 A). Treatment of protein extracts from cells expressing the receptor alone with N-glycosidase F, but not O-glycosidase, led to the disappearance of the higher molecular weight band and to a receptor migration pattern on SDS-PAGE identical to that observed in the presence of Ephrin B1 (single band of apparent molecular weight of 40 kDa, Fig. 2 B). Moreover, N-glycosidase F treatment did not affect the receptor migration pattern in cells co-expressing Ephrin B1. Collectively, these results suggest that the co-expression of Ephrin B1 prevents CXCR4 N-glycosylation. Further supporting this hypothesis, Ephrin B1 expression did not affect the migration of a mutant CXCR4 where residues known to be N-glycosylated (positions 11 and 176) or O-glycosylated (position 18) were mutated into alanine (CXCR4ΔGlyc, Fig. 2 B). We also examined the impact of Ephrin B1 expression on CXCR4 phosphorylation. CXCR4 is known to be sequentially phosphorylated on multiple residues located in its C-terminal domain, first on Ser 346/347 by GRK2/3 and then on Ser 330 , Ser 324/325 and Ser 338/339 by GRK6 (Fig. 2 A) [ 5 , 21 , 31 ]. Studies also suggested that PKC can phosphorylate Ser 324/325 [ 5 , 21 ]. Using phosphosite specific antibodies, we found that Ephrin B1 expression differentially affected the phosphorylation of Ser 346/347 , Ser 330 and Ser 324/325 : while it enhanced Ser 346/347 phosphorylation in cells exposed or not to CXCL12 for 5 min, it abolished the phosphorylation of both Ser 330 and Ser 324/325 in cells stimulated or not with CXCL12 (Fig. 2 C). Impact of Ephrin B1 on CXCR4 subcellular localization Given the role of CXCR4 post-translational modifications in its trafficking, we investigated the effect of Ephrin B1 expression on the subcellular localization of YFP-tagged CXCR4 in HEK-293 cells by confocal fluorescent microscopy. While an important fraction of CXCR4-YFP was detected at the plasma membrane when it was expressed alone, it showed in cells co-expressing Ephrin B1-RFP a more pronounced distribution in intracellular compartments, where both proteins were colocalized (Fig. 3 A, see also Figure S2 ). Co-immunostaining of cells co-expressing CXCR4-YFP and Ephrin B1-RFP with a calnexin (endoplasmic reticulum) or GM130 (Golgi apparatus) antibody showed an important fraction of the receptor in the endoplasmic reticulum and Golgi apparatus specifically in cells co-expressing CXCR4-YFP or Ephrin B1-RFP (Fig. 3 A). Likewise, a fraction of the receptor was detected in the lysosomal compartment of cells co-expressing both proteins, as shown by co-immunostaining with a LAMP1 antibody (Fig. 3 A). We next examined the effect of Ephrin B1 expression on plasma membrane localization of CXCR4-NLuc receptor using a Nano-BRET assay and LYN-NeonGreen as an acceptor anchored at the plasma membrane [ 17 ]. Confirming our confocal microscopy observations, the BRET signal decreased as a function of the amount of Ephrin B1 co-expressed with the receptor (Fig. 3 B). Note that the co-expression of Ephrin B1 did not modify the total expression of CXCR4, as assessed by the total CXCR4-NLuc signal ( Figure S3 ). Given the limited level of CXCR4 internalization measured upon stimulation by CXCL12 for 60 min in our Nano-BRET assay using Neon-Green-LYN (Fig. 3 B), we assessed the impact of Ephrin B1 on CXCL12-induced CXCR4 internalization using a more sensitive cell surface detection approach based on the HiBiT Nano-luciferase complementation technology. Cells expressing N-terminally HiBiT-tagged CXCR4 were stimulated with CXCL12 and the remaining receptors at the plasma membrane were quantified by adding soluble LgBiT fragment. As expected, treatment of cells expressing CXCR4 alone with CXCL12 (10 nM, 30 min) already induced a significant internalization of the receptor that was further enhanced in cells exposed to 50 nM CXCL12, while co-expression of Ephrin B1 prevented CXCL12-induced receptor internalization (Fig. 3 C). Consistent with these observations and with the well-described β-arrestin-dependent CXCR4 internalization elicited by its activation by CXCL12 [ 32 , 33 ], co-expression of Ephrin B1 with CXCR4 inhibited the recruitment of both β-arrestin 1 and β-arrestin 2 by the receptor, as assessed using a Nano-luciferase complementation-based assay (Fig. 3 D,E). Impact of Ephrin B1 on CXCR4 signaling Consistent with previous findings demonstrating that CXCR4 is canonically coupled with Gi proteins [ 34 ], saturation BRET analysis under conditions of constant RLuc-Gα i1 or RLuc-Gα i3 expression and increasing CXCR4-YFP expression level showed that CXCR4 recruits both Gα i1 and Gα i3 proteins in HEK-293T cells (Fig. 4 A). Treatment of cells with CXCL12 did not markedly modify the recruitment of both G proteins by the receptor, whereas it was strongly reduced by the co-expression of Ephrin B1. Corroborating these observations, Ephrin B1 expression also decreased the ability of CXCL12 stimulation of CXCR4 to promote dissociation Gα i1 and Gα i3 from Gβγ, as assessed by the decrease in the BRET signal between venus-Gγ 2 and Gα i1 -RLuc or Gα i3 -RLuc (Fig. 4 B). We next investigated the effect of Ephrin B1 expression on the ability of CXCR4 to activate the Erk1/2 pathway, a key signaling cascade underlying tumor progression elicited by the CXCL12-CXCR4 axis. As previously shown [ 35 ], stimulation of CXCR4 endogenously expressed in HEK-293T cells with CXCL12 (10 nM, 5 min) induced an increase in Erk1/2 phosphorylation that was slightly but not significantly enhanced in cells transfected with a CXCR4 construct (Fig. 4 C). In contrast, the CXCL12 response was strongly enhanced in cells transfected with an Ephrin B1 construct alone or co-transfected with the CXCR4 and Ephrin B1 constructs. The strong Erk1/2 activation induced by CXCL12 in cells overexpressing Ephrin B1 did involve CXCR4 activation, as it was abolished by pretreating cells with the CXCR4 antagonist AMD3100 (1 µM, 30 min, Fig. 4 C). The activation of the Erk1/2 signaling cascade by GPCR ligands is often a complex process that involves G protein-dependent and β-arrestin-dependent mechanisms [ 29 ]. As shown on Fig. 3 D,E, expression of Ephrin B1 inhibits β-arrestin 1 and β-arrestin 2 recruitment by CXCR4, making unlikely a role of β-arrestins in the enhanced CXCR4-operated Erk1/2 signaling observed in the presence of Ephrin B1. A previous study has demonstrated a role Gβγ and its translocation to the Golgi apparatus in Erk1/2 activation induced by CXCR4 stimulation in several cancer cell lines and HEK-293 cells [ 6 ]. Consistent with these findings and the presence of CXCR4 and Ephrin B1 in Golgi apparatus in cells expressing both protein partners (Fig. 3 A), the activation of Erk1/2 induced by CXCL12 in cells expressing both protein partners (or overexpressing Ephrin B1 alone) was abolished by pretreating cells with the Gβγ pharmacological inhibitor Gallein (25 µM, 30 min, Fig. 4 C). Role of Ephrin B1 in the regulation of Death Receptor 5 expression by CXCR4 in breast cancer cells Previous studies have shown that intracellular CXCR4 constitutively promotes the downregulation of Death Receptor 5 (DR5) independently of agonist stimulation of receptor signaling [ 9 ]. In light of these findings and the ability of Ephrin B1 to promote intracellular localization of the receptor, we next examined its influence on CXCR4-dependent regulation of DR5 expression level in MCF7 breast cancer cells. Expression of CXCR4 in MCF7 cells significantly reduced DR5 levels (Fig. 5 A), consistent with the predominant intracellular localization of the receptor (Fig. 5 B). This reduction in DR5 level was not prevented by treating cells with the CXCR4 antagonist AMD3100 (1 µM, added to the cells immediately after their transfection with the CXCR4 plasmid, Fig. 5 A), confirming that it is independent of agonist receptor stimulation. In contrast, silencing Ephrin B1 expression in MCF7 cells using a shRNA, which reduced Ephrin B1 level by 61.90 ± 4.75% (n = 5, p < 0.0001, ANOVA followed by Dunnett’s test, Figure S4 ), prevented the decrease in DR5 level elicited by CXCR4 overexpression (Fig. 5 A). As expected, silencing Ephrin B1 expression also induced plasma membrane relocalization of a fraction of CXCR4 (Fig. 5 B). These results suggest a key role of Ephrin B1 in the regulation of DR5 expression by CXCR4 in breast cancer cells. Discussion To identify mechanisms underlying tumorigenic effects of intracellular CXCR4 that are independent of CXCL12-induced signaling, we characterized the CXCR4 interactome and identified Ephrin B1 as a novel receptor-interacting protein. To our knowledge, this is the first demonstration of a physical interaction between a GPCR and a member of the Ephrin ligand family that comprises five glycosylphosphatidylinositol-anchored Ephrin-A ligands (Ephrins A1-5) and three transmembrane Ephrin-B ligands (Ephrins B1-3). Strikingly, Ephrin B1 was the most highly enriched protein identified in the CXCR4 interactome, suggesting a robust interaction between both partners. Corroborating this observation, we found that purified CXCR4 and Ephrin B1 can form a complex in vitro , indicative of a direct interaction between both proteins. The ability of Ephrin B1 to associate with CXCR4 in living cells was validated by BRET experiments, which also demonstrated that agonist stimulation of CXCR4 promotes the recruitment of Ephrin B1 by the receptor, indicating that CXCR4-Ephrin B1 interaction is a dynamic process regulated by the receptor’s conformational state. Furthermore, BRET experiments showed a low ability of Ephrin B1 to interact with ACKR3, an atypical chemokine receptor sharing with CXCR4 the chemokine CXCL12 as ligand, reminiscent of a previous interactomic screen performed in the same cellular background (HEK-293T cells) that did not identify Ephrin B1 as an ACKR3 partner [ 27 ]. As ACKR3 and CXCR4 are known to form heteromers in HEK-293T cells [ 24 ], the low BRET signal measured in cells co-expressing ACKR3 and Ephrin B1 might reflect an indirect recruitment of Ephrin B1 through the heteromerization of ACKR3 with endogenously expressed CXCR4. Further supporting the specificity of CXCR4-Ephrin B1 interaction, Ephrin B1 was the only member of the Ephrin ligand family identified in our interactomic screen. The common roles of CXCR4 and Ephrin ligands and their receptors in cancer progression and resistance to chemotherapies prompted us to further investigate the reciprocal impact of Ephrin B1 and CXCR4 on their cellular localization and signaling. Using both confocal fluorescence microscopy and a Nano-BRET assay assessing plasma membrane localization of CXCR4, we provide converging evidence that Ephrin B1 promotes intracellular localization of the receptor in HEK-293T cells stimulated or not with CXCL12. Likewise, while Ephrin B1 was mainly detected at the plasma membrane of cells expressing RFP-Ephrin B1 alone, it was predominantly found in intracellular compartments of cells co-expressing CXCR4-YFP. These include the endoplasmic reticulum and the Golgi apparatus as well as lysosomes, where both proteins were colocalized. The increase in CXCR4 intracellular localization induced by Ephrin B1 expression might result from the retention of receptor in intracellular compartment and/or the increase in its internalization. Using HiBiT surface Nano-luciferase complementation, we found that Ephrin B1 prevents rather than enhances CXCL12-induced CXCR4 internalization, an effect that correlates with the ability of Ephrin B1 to inhibit β-arrestin1 and β-arrestin2 recruitment to the receptor. This suggests that Ephrin B1 promotes CXCR4 intracellular localization through the inhibition of its targeting to the plasma membrane. Consistent with this hypothesis, the ability of Ephrin B1 to associate with non-glycosylated CXCR4 in vitro and to abolish its glycosylation suggests that CXCR4 and Ephrin B1 can associate early in the biosynthetic pathway, an effect leading to the inhibition of the forward trafficking and the intracellular sequestration of an important fraction of both proteins. The decreased CXCR4 plasma membrane localization in cells co-expressing Ephrin B1 might also be one of the mechanisms contributing to the inhibitory effect of Ephrin-B1 on CXCL12-induced β-arrestin1 and β-arrestin2 recruitment to CXCR4. β-arrestin recruitment to GPCRs is known to depend on their phosphorylation on residues located in their C-terminal domain by GRKs and other protein kinases. Our results show that Ephrin B1 expression enhances CXCR4 phosphorylation on Ser 346–347 , two residues phosphorylated by GRK2/3 located in the cytoplasm [ 36 , 37 ]. In contrast, Ephrin B1 expression abolishes the phosphorylation of residues (Ser 324/325 and Ser 330 ) phosphorylated by GRK6, which is constitutively localized at the plasma membrane [ 37 , 38 ]. Collectively, these findings are consistent with the predominant intracellular localization of the receptor in cells expressing Ephrin B1. CXCR4 phosphorylation at these sites also induce contrasting effects on β-arrestin recruitment and receptor internalization [ 5 , 21 ]. Whereas the phosphorylation of Ser 346–347 seems to be prerequisite to β-arrestin recruitment, inhibition of Ser 324/325 , Ser 330 and Ser 339 phosphorylation by their mutation into alanine favors β-arrestin recruitment [ 5 ]. Our results demonstrating that Ephrin B1 expression increases Ser 346–347 phosphorylation while it abolishes Ser 324/325 and Ser 330 phosphorylation suggest that its inhibitory effect on β-arrestin recruitment to CXCR4 (and receptor internalization) is independent of its modulation of the receptor phosphorylation state. This inhibitory effect might rather result from the decreased plasma membrane localization of CXCR4 and/or steric hindrance by Ephrin B1 bound to the receptor. A recent study has shown an interaction between CXCR4 and receptor activity-modifying protein3 (RAMP3), which inhibits both constitutive and agonist-dependent β-arrestin recruitment to the receptor [ 39 ]. This suggests that β-arrestin recruitment to CXCR4 and β-arrestin-dependent CXCR4 signalling are finely regulated by its association with various protein partners. The decrease in CXCR4 plasma membrane localization in cells co-expressing Ephrin B1 might also be one of the mechanisms underlying the inhibitory effect of Ephrin-B1 on CXCL12-induced Gα i protein activation. A previous study has demonstrated that Ephrin B1 interacts with Regulator of G protein signaling 3 (RGS3), a member of the RGS protein family that negatively regulate G protein activation by GPCRs via the GTPase activating protein activity of their RGS domain. This results in the inhibition of the migration of cerebellar granule neurons induced by CXCL12-induced activation of CXCR4 [ 14 ]. It is likely that RGS3 linked to Ephrin B1 also contributes to the inhibition of Gα i activation observed under expression of Ephrin B1, a process which could be favored by the physical interaction of Ephrin B1 with CXCR4. Ephrin forward and reverse signaling involve extensive crosstalk with major cytosolic signaling pathways known to be engaged by tyrosine kinase receptors that control cell survival, migration, and differentiation, such as Erk1/2 signaling [ 40 ]. Here, we show that Ephrin B1 expression, which already increases Erk1/2 activation in the absence of a CXCR4 agonist, strongly potentiates the CXCL12 response, while treatment of cells with the CXCR4 antagonist AMD3100 abolishes Ephrin B1-dependent Erk1/2 activation. These findings indicate that Ephrin B1 engages Erk1/2 signaling through active CXCR4. CXCR4-dependent Erk1/2 activation is known to strongly depend on Gβγ proteins [ 6 ]. Further supporting the implication of CXCR4 in Ephrin B1 stimulation of Erk1/2 signalling, the inhibition of Gβγ proteins also abolished the strong Erk1/2 activation measured in cells expressing Ephrin B1. Collectively, these observations are reminiscent of recent findings indicating that the EGF receptor and the HER3/HER2 receptors signal to Erk1/2 through activated CXCR4/ACKR3 [ 41 ] and suggest that components of the Ephrin/Eph systems can likewise hijack the CXCR4 signaling machinery to activate the Erk1/2 pathway. The synergistic effects of CXCR4 and Ephrin B1 on Erk1/2 signaling might be one of the mechanisms underlying their common deleterious influence on cancer cell growth, invasion and metastasis. Besides CXCR4-operated Erk signaling, it has recently been proposed that the intracellular localization of CXCR4 in cancer cells plays a critical role in the receptor’s tumorigenic effects in vitro and in vivo through the downregulation of DR5 expression [ 9 ]. This prompted us to explore the influence of Ephrin B1 on DR5 expression in breast cancer cells. We found that silencing Ephrin B1 expression in MCF7 cells abolished the reduction of DR5 level induced by overexpressing CXCR4, while promoting relocalization of a fraction of CXCR4 to the plasma membrane, suggesting that Ephrin B1 regulates DR5 expression by promoting intracellular localization of CXCR4. Collectively, these findings indicate that Ephrin B1 can contribute to the tumorigenic potential of CXCR4 through the enhancement of its oncogenic signaling and its retention in intracellular compartments where it inhibits cell apoptosis and thus renders cancer cells resistant to chemotherapeutic drugs. Together with agonist-independent tumorigenic signaling elicited by CXCR4 oligomers [ 8 ], these observations may also explain the limited clinical efficacy of CXCR4 antagonists such as AMD3100. Although the role of the physical CXCR4-Ephrin B1 interaction could not be fully established in the absence of identification of binding motifs within the sequences of both partners, they suggest that targeting Ephrin B1 reverse signaling and/or its interaction with CXCR4 might be a relevant strategy in complement to CXCR4 antagonists to dampen the tumorigenic effects of this receptor. Declarations Competing interests The authors declare no competing interests. Consent for publication All authors have approved the content of this manuscript and provided consent for publication. Funding This research was funded by the European Union’s Horizon2020 MSCA Program (H2020-MSCA Program, Grant agreement 860229-ONCORNET 2.0). A.C. was supported by the Luxembourg Institute of Health (LIH) through the NanoLux Platform, the Cancer Foundation Luxembourg, Luxembourg National Research Fund (INTER/FNRS CXCL12 20/15084569, CORE IMPACTT C23/BM/18068832). P.M. and S.C.D. were also supported by fundings from CNRS, INSERM and the University of Montpellier. Author contributions A.R. designed, performed, and analyze most of the experiments, and wrote the manuscript; O.O. produced purified recombinant CXCR4 and Ephrin B1; A.F. performed the interactomic screen; M. Seveno performed LC-MS/MS experiments and analyzed MS/MS data; S.G. performed confocal microscopy image acquisition and supervised image analysis; M.C. performed β-arrestins recruitment experiments; T.D. contributed to the design of experiments and manuscript revision; M.J.S. participated in the project design and funding and revised the manuscript, M. Szpakowska designed and supervised Nano-BRET and Nano-luciferase Complementation experiments, and revised the manuscript; A.C. designed nano-BRET and nanoluciferase complementation experiments, and revised the manuscript, S.C.D. supervised the project, designed experiments and revised the manuscript; P.M. conceived and supervised the study, and wrote the manuscript. Acknowledgements We thank all our colleagues from the ONCORNET 2.0 consortium for continuous scientific discussions and support. Mass spectrometry experiments were carried out using the facilities of the Montpellier Proteomics Platform (PPM, BioCampus Montpellier), a member of the national Proteomics French Infrastructure (ProFI UAR 2048) supported by the French National Research Agency (ANR-24-INBS-0015, Investments for the future F2030). BRET experiments were performed using the facilities of the Arpege pharmacological screening platform (Biocampus Montpellier) and confocal microscopy image acquisition using the facilities of the Montpellier Ressources Imagerie (MRI) platform (BioCampus Montpellier). Data availability All data generated in this study are included in this article and its supplementary information file. The raw data are available upon request from the corresponding authors. The mass spectrometry proteomics data have been deposited at the ProteomeXchange Consortium via the PRIDE partner repository [ 42 ] with the dataset identifier PXD054221. References Teixido J, Martinez-Moreno M, Diaz-Martinez M and Sevilla-Movilla S (2018) The good and bad faces of the CXCR4 chemokine receptor. Int J Biochem Cell Biol 95:121-131 doi:10.1016/j.biocel.2017.12.018 Liu Q et al. (2016) WHIM Syndrome Caused by Waldenstrom's Macroglobulinemia-Associated Mutation CXCR4 (L329fs). J Clin Immunol 36(4):397-405 doi:10.1007/s10875-016-0276-3 Moore JP, Kitchen SG, Pugach P and Zack JA (2004) The CCR5 and CXCR4 coreceptors--central to understanding the transmission and pathogenesis of human immunodeficiency virus type 1 infection. AIDS Res Hum Retroviruses 20(1):111-126 doi:10.1089/088922204322749567 Muller A et al. (2001) Involvement of chemokine receptors in breast cancer metastasis. Nature 410(6824):50-56 doi:10.1038/35065016 Busillo JM et al. (2010) Site-specific phosphorylation of CXCR4 is dynamically regulated by multiple kinases and results in differential modulation of CXCR4 signaling. J Biol Chem 285(10):7805-7817 doi:10.1074/jbc.M109.091173 Khater M et al. (2021) G protein betagamma translocation to the Golgi apparatus activates MAPK via p110gamma-p101 heterodimers. J Biol Chem 296:100325 doi:10.1016/j.jbc.2021.100325 De Clercq E (2019) Mozobil(R) (Plerixafor, AMD3100), 10 years after its approval by the US Food and Drug Administration. Antivir Chem Chemother 27:2040206619829382 doi:10.1177/2040206619829382 Mobach S et al. (2025) Disruption of constitutive CXCR4 oligomers impairs oncogenic properties in lymphoid neoplasms. Proc Natl Acad Sci U S A 122(24):e2424186122 doi:10.1073/pnas.2424186122 Nengroo MA et al. (2021) CXCR4 intracellular protein promotes drug resistance and tumorigenic potential by inversely regulating the expression of Death Receptor 5. Cell Death Dis 12(5):464 doi:10.1038/s41419-021-03730-8 Gomez-Mouton C et al. (2015) Filamin A interaction with the CXCR4 third intracellular loop regulates endocytosis and signaling of WT and WHIM-like receptors. Blood 125(7):1116-1125 doi:10.1182/blood-2014-09-601807 Li H et al. (2016) RTN3 Regulates the Expression Level of Chemokine Receptor CXCR4 and is Required for Migration of Primordial Germ Cells. Int J Mol Sci 17(4):382 doi:10.3390/ijms17040382 Lee JT et al. (2009) Over-expression of Reticulon 3 (RTN3) enhances TRAIL-mediated apoptosis via up-regulation of death receptor 5 (DR5) and down-regulation of c-FLIP. Cancer Lett 279(2):185-192 doi:10.1016/j.canlet.2009.01.035 Pasquale EB (2024) Eph receptors and ephrins in cancer progression. Nat Rev Cancer 24(1):5-27 doi:10.1038/s41568-023-00634-x Lu Q, Sun EE, Klein RS and Flanagan JG (2001) Ephrin-B reverse signaling is mediated by a novel PDZ-RGS protein and selectively inhibits G protein-coupled chemoattraction. Cell 105(1):69-79 doi:10.1016/s0092-8674(01)00297-5 Meyrath M et al. (2021) Proadrenomedullin N-Terminal 20 Peptides (PAMPs) Are Agonists of the Chemokine Scavenger Receptor ACKR3/CXCR7. ACS Pharmacol Transl Sci 4(2):813-823 doi:10.1021/acsptsci.1c00006 Kumar R et al. (2023) Reduced G protein signaling despite impaired internalization and beta-arrestin recruitment in patients carrying a CXCR4Leu317fsX3 mutation causing WHIM syndrome. JCI Insight 8(5) doi:10.1172/jci.insight.145688 Palmer CB et al. (2022) Nanoluciferase-based complementation assay for systematic profiling of GPCR-GRK interactions. Methods Cell Biol 169:309-321 doi:10.1016/bs.mcb.2022.04.001 Luis R et al. (2022) Nanoluciferase-based methods to monitor activation, modulation and trafficking of atypical chemokine receptors. Methods Cell Biol 169:279-294 doi:10.1016/bs.mcb.2022.03.002 Cox J et al. (2011) Andromeda: a peptide search engine integrated into the MaxQuant environment. J Proteome Res 10(4):1794-1805 doi:10.1021/pr101065j Namkung Y et al. (2016) Monitoring G protein-coupled receptor and beta-arrestin trafficking in live cells using enhanced bystander BRET. Nat Commun 7:12178 doi:10.1038/ncomms12178 Mueller W et al. (2013) Hierarchical organization of multi-site phosphorylation at the CXCR4 C terminus. PLoS One 8(5):e64975 doi:10.1371/journal.pone.0064975 Holm NT et al. (2007) Elevated levels of chemokine receptor CXCR4 in HER-2 negative breast cancer specimens predict recurrence. J Surg Res 141(1):53-59 doi:10.1016/j.jss.2007.03.015 Konoplev S et al. (2007) Overexpression of CXCR4 predicts adverse overall and event-free survival in patients with unmutated FLT3 acute myeloid leukemia with normal karyotype. Cancer 109(6):1152-1156 doi:10.1002/cncr.22510 McKinney N et al. (2015) EphrinB1 expression is dysregulated and promotes oncogenic signaling in medulloblastoma. J Neurooncol 121(1):109-118 doi:10.1007/s11060-014-1618-8 Bockaert J, Marin P, Dumuis A and Fagni L (2003) The 'magic tail' of G protein-coupled receptors: an anchorage for functional protein networks. FEBS Lett 546(1):65-72 doi:10.1016/s0014-5793(03)00453-8 Lagane B et al. (2008) CXCR4 dimerization and beta-arrestin-mediated signaling account for the enhanced chemotaxis to CXCL12 in WHIM syndrome. Blood 112(1):34-44 doi:10.1182/blood-2007-07-102103 Fumagalli A et al. (2020) The atypical chemokine receptor 3 interacts with Connexin 43 inhibiting astrocytic gap junctional intercellular communication. Nat Commun 11(1):4855 doi:10.1038/s41467-020-18634-y Levoye A et al. (2009) CXCR7 heterodimerizes with CXCR4 and regulates CXCL12-mediated G protein signaling. Blood 113(24):6085-6093 doi:10.1182/blood-2008-12-196618 Fumagalli A et al. (2019) CXCR4/ACKR3 Phosphorylation and Recruitment of Interacting Proteins: Key Mechanisms Regulating Their Functional Status. Mol Pharmacol 96(6):794-808 doi:10.1124/mol.118.115360 Gustavsson M et al. (2017) Structural basis of ligand interaction with atypical chemokine receptor 3. Nat Commun 8:14135 doi:10.1038/ncomms14135 Zhuo Y, Crecelius JM and Marchese A (2022) G protein-coupled receptor kinase phosphorylation of distal C-tail sites specifies betaarrestin1-mediated signaling by chemokine receptor CXCR4. J Biol Chem 298(9):102351 doi:10.1016/j.jbc.2022.102351 Cheng ZJ et al. (2000) beta-arrestin differentially regulates the chemokine receptor CXCR4-mediated signaling and receptor internalization, and this implicates multiple interaction sites between beta-arrestin and CXCR4. J Biol Chem 275(4):2479-2485 doi:10.1074/jbc.275.4.2479 Robleto VL et al. (2024) SNX9 family mediates betaarrestin-independent GPCR endocytosis. Commun Biol 7(1):1455 doi:10.1038/s42003-024-07157-7 Busillo JM and Benovic JL (2007) Regulation of CXCR4 signaling. Biochim Biophys Acta 1768(4):952-963 doi:10.1016/j.bbamem.2006.11.002 Cassier E et al. (2017) Phosphorylation of beta-arrestin2 at Thr(383) by MEK underlies beta-arrestin-dependent activation of Erk1/2 by GPCRs. Elife 6 doi:10.7554/eLife.23777 Gardner J et al. (2024) GPCR kinases differentially modulate biased signaling downstream of CXCR3 depending on their subcellular localization. Sci Signal 17(823):eadd9139 doi:10.1126/scisignal.add9139 Touhara K et al. (1994) Binding of G protein beta gamma-subunits to pleckstrin homology domains. J Biol Chem 269(14):10217-10220 Jiang X, Benovic JL and Wedegaertner PB (2007) Plasma membrane and nuclear localization of G protein coupled receptor kinase 6A. Mol Biol Cell 18(8):2960-2969 doi:10.1091/mbc.e07-01-0013 Pfersdorf F, Romanazzi L, Rosenkilde MM and Gustavsson M (2025) Regulation of the chemokine receptors CXCR4 and ACKR3 by receptor activity-modifying proteins. J Biol Chem 301(1):108055 doi:10.1016/j.jbc.2024.108055 Boyd AW, Bartlett PF and Lackmann M (2014) Therapeutic targeting of EPH receptors and their ligands. Nat Rev Drug Discov 13(1):39-62 doi:10.1038/nrd4175 Neves M, Marolda V, Mayor F, Jr. and Penela P (2022) Crosstalk between CXCR4/ACKR3 and EGFR Signaling in Breast Cancer Cells. Int J Mol Sci 23(19) doi:10.3390/ijms231911887 Perez-Riverol Y et al. (2019) The PRIDE database and related tools and resources in 2019: improving support for quantification data. Nucleic Acids Res 47(D1):D442-D450 doi:10.1093/nar/gky1106 Farzan M et al. (2002) The role of post-translational modifications of the CXCR4 amino terminus in stromal-derived factor 1 alpha association and HIV-1 entry. J Biol Chem 277(33):29484-29489 doi:10.1074/jbc.M203361200 Chabot DJ, Chen H, Dimitrov DS and Broder CC (2000) N-linked glycosylation of CXCR4 masks coreceptor function for CCR5-dependent human immunodeficiency virus type 1 isolates. J Virol 74(9):4404-4413 doi:10.1128/jvi.74.9.4404-4413.2000 Bhandari D, Robia SL and Marchese A (2009) The E3 ubiquitin ligase atrophin interacting protein 4 binds directly to the chemokine receptor CXCR4 via a novel WW domain-mediated interaction. Mol Biol Cell 20(5):1324-1339 doi:10.1091/mbc.e08-03-0308 Luo J, Busillo JM, Stumm R and Benovic JL (2017) G Protein-Coupled Receptor Kinase 3 and Protein Kinase C Phosphorylate the Distal C-Terminal Tail of the Chemokine Receptor CXCR4 and Mediate Recruitment of beta-Arrestin. Mol Pharmacol 91(6):554-566 doi:10.1124/mol.116.106468 Supplementary Files Rabbitosupplementaryinformation.pdf Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Major Revision 27 Dec, 2025 Reviewers agreed at journal 03 Dec, 2025 Reviewers invited by journal 15 Aug, 2025 Editor assigned by journal 18 Jul, 2025 First submitted to journal 16 Jul, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7145754","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":501161377,"identity":"f9005e21-fe5a-42f6-a9ff-052b7ce19227","order_by":0,"name":"Alessandro Rabbito","email":"","orcid":"","institution":"Institut de génomique fonctionnelle: Institut de genomique fonctionnelle","correspondingAuthor":false,"prefix":"","firstName":"Alessandro","middleName":"","lastName":"Rabbito","suffix":""},{"id":501161378,"identity":"b34eb49b-e25e-4a51-b564-f28731702bce","order_by":1,"name":"Omolade Otun","email":"","orcid":"","institution":"Institut de génomique fonctionnelle: Institut de genomique fonctionnelle","correspondingAuthor":false,"prefix":"","firstName":"Omolade","middleName":"","lastName":"Otun","suffix":""},{"id":501161379,"identity":"61d2c7dc-1727-46c4-8d78-96026dca3b61","order_by":2,"name":"Amos Fumagalli","email":"","orcid":"","institution":"Institut de génomique fonctionnelle: Institut de genomique fonctionnelle","correspondingAuthor":false,"prefix":"","firstName":"Amos","middleName":"","lastName":"Fumagalli","suffix":""},{"id":501161380,"identity":"3594588a-9b6f-4f0c-b3c7-48c279535df2","order_by":3,"name":"Martial Séveno","email":"","orcid":"","institution":"BioCampus Montpellier","correspondingAuthor":false,"prefix":"","firstName":"Martial","middleName":"","lastName":"Séveno","suffix":""},{"id":501161381,"identity":"97f1784f-bb98-4a97-9d54-28b803a626e9","order_by":4,"name":"Sonya Galant","email":"","orcid":"","institution":"Institut de génomique fonctionnelle: Institut de genomique fonctionnelle","correspondingAuthor":false,"prefix":"","firstName":"Sonya","middleName":"","lastName":"Galant","suffix":""},{"id":501161382,"identity":"a5899fc9-ab7d-4b24-a852-1eb942f9580e","order_by":5,"name":"Manuel Counson","email":"","orcid":"","institution":"Luxembourg Institute of Health","correspondingAuthor":false,"prefix":"","firstName":"Manuel","middleName":"","lastName":"Counson","suffix":""},{"id":501161383,"identity":"21fb9bf9-46bd-4bf0-a075-e33294ad7103","order_by":6,"name":"Thierry Durroux","email":"","orcid":"","institution":"Institut de génomique fonctionnelle: Institut de genomique fonctionnelle","correspondingAuthor":false,"prefix":"","firstName":"Thierry","middleName":"","lastName":"Durroux","suffix":""},{"id":501161384,"identity":"9541ce8c-21e7-4f4e-bb9c-c2116c60933f","order_by":7,"name":"Cherine Bechara","email":"","orcid":"","institution":"Institut de génomique fonctionnelle: Institut de genomique fonctionnelle","correspondingAuthor":false,"prefix":"","firstName":"Cherine","middleName":"","lastName":"Bechara","suffix":""},{"id":501161385,"identity":"dece7b81-f9e5-4603-be57-5eb62280d9a2","order_by":8,"name":"Martine J Smit","email":"","orcid":"","institution":"Vrije Universiteit Amsterdam","correspondingAuthor":false,"prefix":"","firstName":"Martine","middleName":"J","lastName":"Smit","suffix":""},{"id":501161386,"identity":"373e4e65-07cd-414d-b425-4e9a61ca43bf","order_by":9,"name":"Sébastien Granier","email":"","orcid":"","institution":"Institut de génomique fonctionnelle: Institut de genomique fonctionnelle","correspondingAuthor":false,"prefix":"","firstName":"Sébastien","middleName":"","lastName":"Granier","suffix":""},{"id":501161387,"identity":"62f4684d-227b-4304-9f49-8ad73e592e2e","order_by":10,"name":"Martyna Szpakowska","email":"","orcid":"","institution":"Luxembourg Institute of Health","correspondingAuthor":false,"prefix":"","firstName":"Martyna","middleName":"","lastName":"Szpakowska","suffix":""},{"id":501161388,"identity":"5e023dc8-3189-4c78-8aa4-37516727cbd6","order_by":11,"name":"Andy Chevigné","email":"","orcid":"","institution":"Luxembourg Institute of Health","correspondingAuthor":false,"prefix":"","firstName":"Andy","middleName":"","lastName":"Chevigné","suffix":""},{"id":501161389,"identity":"5d9d7e2b-81a4-4a66-81fc-ff0829b6c1d7","order_by":12,"name":"Séverine Chaumont-Dubel","email":"","orcid":"","institution":"Institut de génomique fonctionnelle: Institut de genomique fonctionnelle","correspondingAuthor":false,"prefix":"","firstName":"Séverine","middleName":"","lastName":"Chaumont-Dubel","suffix":""},{"id":501161390,"identity":"c0833acb-287c-4ee6-9ece-8851b62d6c32","order_by":13,"name":"Philippe Marin","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABD0lEQVRIie3RMUvDQBTA8XccxOWhmxSe9L5CQ4ZSELv5Oe4QmqWLuNeTwn2GDIIfwiWDw5UDp6KrYJcsmYVM3bxUWzLk6Cp4/yHhJfmRFwIQi/3FBuzByv0g4RKB25/hRAeJ7pIZQvI7og0RgO4tB0fJmJbaVuVmCOeu/qrK9wtxDay5fVkAUr+ZPK60Ves6A5plhVp/YvoKnIraAZ7KXjL6UJ4YpzTJDJTx5EknHK2FKfYvtif3mvLGkzdMDbTEL3aESKB5+xaLItkRHiSTQu2+JTU0v/PkBkcJWxJahyEyHuRVtS034ozyZ7Y1V1Nh+Krxiw2Di7UH/zchOVyxTLfnAOiQQ0KHno3FYrH/2jftJV1hWRf2pAAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0002-5977-7274","institution":"Institut de génomique fonctionnelle: Institut de genomique fonctionnelle","correspondingAuthor":true,"prefix":"","firstName":"Philippe","middleName":"","lastName":"Marin","suffix":""}],"badges":[],"createdAt":"2025-07-17 07:00:53","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7145754/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7145754/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":89823152,"identity":"4d489f0f-7b9c-455b-bb72-978a3c4e7039","added_by":"auto","created_at":"2025-08-25 12:06:20","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1678040,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePhysical interaction of Ephrin B1 with CXCR4\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA \u003c/strong\u003eVolcano plot representing proteins identified by nano-LC-MS/MS in immunoprecipitations from HEK293T cells transfected with HA-CXCR4 or empty plasmid. \u003cstrong\u003eB \u003c/strong\u003eRepresentative Western blot of HA and Flag immunoprecipitations performed from HEK293T cells expressing or not HA-CXCR4 or FLAG-Ephrin B1 or both proteins. \u003cstrong\u003eC\u003c/strong\u003e Representative Western blot of HA-immunoprecipitations performed from HEK293T cells expressing or not HA-CXCR4, or FLAG-Ephrin B1 or Ephrin B1 deleted of its C-terminal domain (Ephrin B1 ΔC-ter) alone or in combination. In \u003cstrong\u003eB\u003c/strong\u003e and \u003cstrong\u003eC\u003c/strong\u003e, the illustrated blots are representative of three independent experiments performed on different sets of cultured cells. \u003cstrong\u003eD \u003c/strong\u003eNormalized BRET values measured in HEK293T cells co-expressing the indicated proteins. BRET signal variations were fitted with the one-site total binding equation and background constraint to a constant\u003cstrong\u003e \u003c/strong\u003evalue of 0 using Prism\u003cem\u003e. \u003c/em\u003e\u003cstrong\u003eE\u003c/strong\u003e \u003cem\u003eLeft\u003c/em\u003e: Coomassie blue staining of purified FLAG-CXCR4 and STREP-Ephrin B1 produced in the SF9 cell line. \u003cem\u003eRight\u003c/em\u003e: Western blots of sequential Flag/Strep chromatography purification. The illustrated data are representative of three independent experiments.\u003cstrong\u003e \u003c/strong\u003eFT: flow-through.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-7145754/v1/b5edd670c43dc6c9896cad2d.png"},{"id":89822914,"identity":"977a6f9d-786b-4053-a128-3fb9a992ff9b","added_by":"auto","created_at":"2025-08-25 11:58:20","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":2506095,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eImpact of Ephrin B1 on CXCR4 glycosylation and phosphorylation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA \u003c/strong\u003eSnake plot of CXCR4. Glycosylation sites [43, 44], and phosphorylation sites on the C-terminal domain of the receptor are highlighted [5, 45, 46].\u003cstrong\u003e B \u003c/strong\u003eRepresentative Western blots obtained from HEK293T cells expressing either wild-type HA-CXCR4 or CXCR4 mutated into alanine at positions 11, 18, and 176 (glycosylated residues, CXCR4DGlyc) in the presence or absence of Flag-Ephrin B1. Cell lysates were treated or not with PNGaseF (10 IU/100 mg) and/or O-glycosidase (20 IU/100 mg) for 30 min at 37°C to remove N-glycosylation and/or O-glycosylation, respectively. The illustrated blots are representative of 3 independent experiments performed on different sets of cultured cells. \u003cstrong\u003eC \u003c/strong\u003eRepresentative Western blots performed from HEK293T cells, expressing or not HA-CXCR4 in the absence or presence of FLAG-Ephrin B1. Data are means ± SEM from 3 independent experiments performed from different sets of cultured cells. They were analyzed with a 2-way ANOVA with Bonferroni’s multiple comparison test. ns: non-significant.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-7145754/v1/4580cd2317c0212c1cecc42b.png"},{"id":89822913,"identity":"7e925bd2-9f4b-4571-a2ad-ad994e301fc1","added_by":"auto","created_at":"2025-08-25 11:58:20","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":2662772,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eInfluence of Ephrin B1 on CXCR4 cell surface expression and internalization\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA \u003c/strong\u003eStacked images of CXCR4-YFP (cyan) and Ephrin B1-RFP (magenta) fluorescent signals in different cellular compartments in HEK293T cells co-expressing CXCR4-YFP and Ephrin B1-RFP. The anti-calnexin immunostaining was used to label the endoplasmic reticulum, the anti-GM130 immunostaining the cis-Golgi, and the anti-LAMP1 immunostaining lysosomes (yellow). The illustrated fields are representative of three independent experiments performed on different sets of cultured cells. Scale bar: 10 mm. The line graphs were generated in Image J using the lines represented on the merged images, highlighting the colocalization of CXCR4 and Ephrin B1 in the three compartments. PM, plasma membrane signal.\u003cstrong\u003e B \u003c/strong\u003e\u003cem\u003eLeft:\u003c/em\u003e\u003cstrong\u003e \u003c/strong\u003eschematic representation of the nano-BRET assay assessing the interaction between CXCR4-NLuc and Lyn-mNeonGreen used to evaluate the plasma membrane localization of CXCR4 in cells expressing CXCR4-NLuc alone or coexpressing CXCR4-NLuc and FLAG-Ephrin B1 (transfected plasmid ratios, 1:1 and 1:3). Cells were exposed to vehicle or CXCL12 (10 or 50 nM) for 60 min.\u003cstrong\u003e \u003c/strong\u003e\u003cem\u003eRight:\u003c/em\u003e the data represent the BRET ratio normalized to the vehicle condition in cells expressing CXCR4-NLuc alone. They are the means ± SEM of values obtained in duplicate in three independent experiments performed on different sets of cultured cells. \u003cstrong\u003eC \u003c/strong\u003e\u003cem\u003eLeft:\u003c/em\u003e\u003cstrong\u003e \u003c/strong\u003eschematic representation of the nano-luciferase complementation assay used to evaluate the CXCL12-induced internalization of CXCR4.\u003cstrong\u003e \u003c/strong\u003e\u003cem\u003eRight:\u003c/em\u003e\u003cstrong\u003e \u003c/strong\u003ethe data represent CXCL12-induced internalization of CXCR4 normalized to vehicle in the corresponding condition, in cells expressing HiBIT-CXCR4 alone or coexpressing HiBIT-CXCR4 and FLAG-Ephrin B1 (plasmid ratios, 1:1 and 1:10). They are means ± SEM of duplicate determinations in three independent experiments performed on different sets of cultured cells. In \u003cstrong\u003eB\u003c/strong\u003e and \u003cstrong\u003eC\u003c/strong\u003e, the statistical analysis was the 2-way ANOVA with Bonferroni’s multiple comparison test. ns: non-significant. \u003cstrong\u003eD,E\u003c/strong\u003eβ-arrestin 1 (D) and β-arrestin 2 (E) recruitment to CXCR4 in response to exposure of HEK293T cells co-expressing CXCR4-LgBiT and SmBiT-β-arrestin1 or 2 in the absence or presence of \u0026nbsp;FLAG-Ephrin B1 (CXCR4-LgBiT/FLAG-Ephrin B1 plasmid ratios, 1:1 and 1:10) to the indicated concentrations of CXCL12.\u003cstrong\u003e \u003c/strong\u003eThe data are the means ± SEM of duplicate determinations performed in three independent experiments on different sets of cultured cells. Curves were fitted by the log[CXCL12] \u003cem\u003evs.\u003c/em\u003e luminescence non-linear regression using Prism.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-7145754/v1/ce609f3de0a8c0606c46551b.png"},{"id":89823153,"identity":"fa12e915-5502-4a63-bdb3-f568e3f770fa","added_by":"auto","created_at":"2025-08-25 12:06:20","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1412269,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eInfluence of Ephrin B1 on CXCR4 signaling\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003e Gα\u003csub\u003ei1/3\u003c/sub\u003e recruitment to CXCR4 in HEK293T cells expressing CXCR4-YFP alone or co-expressing CXCR4-YFP and FLAG-Ephrin B1, in presence of either Rluc-Gα\u003csub\u003ei1\u003c/sub\u003e or Rluc-Gα\u003csub\u003ei3\u003c/sub\u003e and exposed or not to CXCL12 (10 nM). BRET values were normalized to the maximum BRET measured in cells expressing CXCR4 and challenged with CXCL12. The data are means ± SEM of triplicate determinations performed in three independent experiments on different sets of cultured cells. Normalized BRET variations were fitted with the one-site total binding equation and background constraint to constant\u003cstrong\u003e \u003c/strong\u003evalue of 0 using Prism\u003cem\u003e.\u003c/em\u003e \u003cstrong\u003eB\u003c/strong\u003e Gα\u003csub\u003ei1/3\u003c/sub\u003e-Gβγ dissociation elicited by exposure of HEK-293T cells expressing HACXCR4, alone or in combination with FLAG-Ephrin B1 (plasmid ratios 1:1 and 1:10), Rluc-Gαi1/3, Venus-γ2, and Flag-β2, to the indicated concentrations of CXCL12. The data were normalized to the values measured in vehicle-treated cells for in each condition. They are means ± SEM of triplicate determinations performed in three independent experiments on different sets of cultured cells. Curves were fitted by the log[CXCL12] \u003cem\u003evs.\u003c/em\u003e mBRET non-linear regression using Prism. \u003cstrong\u003eC\u003c/strong\u003e Representative Western blots performed from HEK293T cells expressing HA-CXCR4 or FLAG-Ephrin B1 or co-expressing HA-CXCR4 and FLAG-Ephrin B1, and treated with vehicle or CXCL12 (10 nM) for 5 min. When indicated, Gallein (25 µM) or AMD 3100 (1 µM) were added to cells 30 min before the vehicle/CXCL12 treatment. The data represent the pErk1/2/Total Erk1/2 ratio (in %). They are means ± SEM of values obtained in three independent experiments performed on different sets of cultured cells. They were analyzed with the 2-way ANOVA with Bonferroni’s multiple comparison test. ns: non-significant.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-7145754/v1/3e9c63aeba39887e1c14ca78.png"},{"id":89822915,"identity":"ada20134-f7bd-4f05-97b1-11d31e5d4479","added_by":"auto","created_at":"2025-08-25 11:58:20","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1493814,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eImpact of Ephrin B1 on CXCR4 regulation of Death Receptor 5 expression\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003e Representative Western blots assessing DR5, HA-CXCR4 and GAPDH expression in MCF7 cells transfected with empty vector (pCDNA3.1) or HA-CXCR4 constructs. Cells were also either transfected with control (scramble) shRNA or shRNA targeting Ephrin B1, or exposed to either vehicle or AMD3100 (1mM, added to cells after the transfection). The histogram shows immunoreactive signals of DR5 normalized to GAPDH signal. The data represent the means ± SEM of values obtained in five independent experiments performed on different sets of cultured cells. They were analyzed using multiple paired t-tests. \u003cstrong\u003eB \u003c/strong\u003e\u003cem\u003eLeft: \u003c/em\u003eStacked images of CXCR4-YFP fluorescent signal in MCF7 cells co-transfected with the CXCR4-YFP construct and either the control shRNA or the Ephrin B1 shRNA. The illustrated fields are representative of three independent experiments performed on different sets of cultured cells. Scale bar: 10 mm. \u003cem\u003eRight:\u003c/em\u003e Line graphs generated in Image J using the lines represented on the images highlight the subcellular localization of CXCR4. PM, plasma membrane signal.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-7145754/v1/a34f72732056e83e525d2d9b.png"},{"id":89825460,"identity":"8b1b9a46-edda-48e6-b1c1-6e65dfeba84b","added_by":"auto","created_at":"2025-08-25 12:30:25","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":7888726,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7145754/v1/34edfa49-45a1-417d-bf09-a4bc0e3e439e.pdf"},{"id":89822926,"identity":"3b4e8294-61ce-4b20-b750-11c1d8daa7f3","added_by":"auto","created_at":"2025-08-25 11:58:20","extension":"pdf","order_by":9,"title":"","display":"","copyAsset":false,"role":"supplement","size":2322662,"visible":true,"origin":"","legend":"","description":"","filename":"Rabbitosupplementaryinformation.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7145754/v1/620b242dadfe08351dd05352.pdf"}],"financialInterests":"","formattedTitle":"Physical interaction with Ephrin B1 promotes CXCR4 intracellular localization and oncogenic potential","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe C-X-C chemokine receptor type 4 (CXCR4) is a conventional chemokine receptor that, unlike many chemokine receptors, binds to a single chemokine, CXCL12, also referred to as SDF-1. CXCR4 is expressed in numerous cell types, including endothelial cells, lymphocytes, fibroblasts, hematopoietic stem cells, neurons, and glial cells where it plays a pivotal role in migration, proliferation and differentiation [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. CXCR4 is also involved in several pathological processes, including the Warts, Hypogammaglobulinemia, Immunodeficiency, and Myelokathexis (WHIM) syndrome and Human Immunodeficiency Virus-1 infection [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. It is overexpressed in numerous cancer types and is involved in cancer progression and metastasis [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eCXCR4 is canonically coupled to Gα\u003csub\u003ei\u003c/sub\u003e proteins and inhibits adenylyl cyclase. It also activates the Erk1/2 pathway through several mechanisms involving either its phosphorylation by GRK3 and GRK6 and the recruitment of β-arrestins, or the activation of PI3Kγ heterodimers p110γ-p101 through Gβγ proteins [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Despite the unequivocal role of CXCR4-operated signaling, such as PI3K-Erk signaling, in cancer growth and metastasis, the limited therapeutic efficacy of CXCR4 antagonists, including the FDA-approved compound AMD3100, in cancer treatment suggests that some tumorigenic effects under the control of the receptor could be independent of the CXCL12-CXCR4 signaling axis [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. This conundrum can in part be explained with the recent demonstration of the existence of agonist-independent, CXCR4 oligomer-mediated signaling, which promotes cell survival, migration and tumour growth in lymphoid neoplasms [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Another study has shown that intracellular CXCR4 rather than CXCL12-induced CXCR4 signaling promotes cancer cell survival through the downregulation of the Death Receptor 5 (DR5), thereby rendering cancer cells resistant to chemotherapeutic drugs like paclitaxel [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e].These findings suggest that future therapies targeting CXCR4 should not only consider CXCR4-associated signaling at the plasma membrane, but also mechanisms underlying the localization of CXCR4 in intracellular compartments.\u003c/p\u003e\u003cp\u003eThere is accumulating evidence indicating that the trafficking and targeting of G protein-coupled receptors (GPCRs) to specific cellular compartments depends on their association with protein partners. For instance, while the association of CXCR4 with Filamin A stabilizes the receptor at the plasma membrane by blocking its endocytosis [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e], its interaction with Reticulon 3 (RTN3) promotes its translocation to the cytoplasm [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. These findings advocate for the in-depth characterization of the CXCR4 interactome to identify novel mechanisms underlying its tumorigenic effects, an issue we addressed thanks to a proteomic strategy combining affinity purification of receptor-interacting proteins and their identification by mass spectrometry.\u003c/p\u003e\u003cp\u003eThis interactomic screen identified Ephrin B1, a member of the single transmembrane domain Ephrin-B family overexpressed in numerous cancer types and involved in tumor progression and metastasis as well as resistance to chemotherapies [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. A previous study showed that Ephrin B1 modulates G protein signaling induced by CXCR4 activation via the recruitment of the regulator of G protein signaling 3 (RGS3) protein through its C-terminal PDZ domain, thus establishing functional interactions between CXCR4 and Ephrin B1 [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. In light of these findings, we further explored the impact of Ephrin B1 on CXCR4 post-translational modifications, cellular localization and signal transduction. We show that Ephrin B1 retains CXCR4 in intracellular compartments and contributes to CXCR4-dependent decrease in DR5 expression, suggesting that it might be a key player contributing to CXCR4\u0026rsquo;s oncogenic potential.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e\u003cstrong\u003eMaterials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003ePlasmids and shRNAs\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThe HA-CXCR4-pCDNA3.1 construct was obtained from cDNA.org (Bloomsburg University), and the FLAG-Ephrin B1-pcDNA3.1 plasmid was provided by the Montpellier Genomic Collections platform. The Ephrin B1 \u0026Delta;Cter construct (purchased from GeneCust) was designed by removing 84 amino acids from the C-terminus. Based on the predicted structure, this deletion eliminates the C-terminal domain of the protein, resulting in a truncated version with an approximate molecular weight of 28.5 kDa. The pcDNA3.1 plasmids encoding Venus-Tagged G protein subunit gamma 2 (Venus-\u0026gamma;2), FLAG-tagged G-protein subunit beta 2 (FLAG-\u0026beta;2), G\u0026alpha;i1-RLuc -RLuc, and G\u0026alpha;i3-RLuc were provided by Dr. D. Maurel (IGF, Montpellier, France). ACKR3-NeonGreen, CXCR4-NeonGreen were previously described [15]. HiBiT-CXCR4 plasmid was described in a previous study [16]. Ephrin B1-NeonGreen, Ephrin B1-Nluc were cloned as previously described\u0026nbsp;[15].\u0026nbsp;LYN-NeonGreen, ACKR3-Nluc, CXCR4-Nluc, LgBiT-\u0026beta;-arrestin1/2, and CXCR4-smBiT in pcDNA3.1 were previously described\u0026nbsp;[17, 18]. ShRNA were obtained from Sigma-Aldrich MISSION shRNA library clones. Specific EphrinB1 shRNA was selected amongst shRNAs targeting the coding sequence (ref NM_004429, target sequence AGCACCATGATTACTACATTA). For the control condition, we used the MISSION Non-Target shRNA Control sequence. This shRNA sequence does not target any known genes from any species. Both control and specific shRNAs were obtained in the pLKO.1-puro-CMV-tGFP backbone.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eReagents\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eCXCL12, purchased from R\u0026amp;D Systems (Ref 350-NS-CF), was dissolved in sterile PBS to a concentration of 10\u0026nbsp;mM, aliquoted, and stored at -80\u0026deg;C. AMD3100 purchased from Tocris (Ref 3299) was dissolved in DMSO to a final concentration of 20 mM, aliquoted, and stored at ‑20\u0026deg;C. Gallein was purchased from Tocris (Ref 3090) and dissolved in DMSO to a final concentration of 75 mM, aliquoted, and stored at -20\u0026deg;C.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eAntibodies\u003c/em\u003e\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"671\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 85px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 123px;\"\u003e\n \u003cp\u003eProtein\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 92px;\"\u003e\n \u003cp\u003eHost Species\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 92px;\"\u003e\n \u003cp\u003eDilution \u0026amp; Application\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 175px;\"\u003e\n \u003cp\u003eSupplier\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 104px;\"\u003e\n \u003cp\u003eREF\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"13\" style=\"width: 85px;\"\u003e\n \u003cp\u003ePrimary antibodies\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 123px;\"\u003e\n \u003cp\u003eCXCR4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 92px;\"\u003e\n \u003cp\u003eRabbit\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 92px;\"\u003e\n \u003cp\u003e1/1,000 WB\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 175px;\"\u003e\n \u003cp\u003eAbcam\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 104px;\"\u003e\n \u003cp\u003eAB124824\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 123px;\"\u003e\n \u003cp\u003eEphrin B1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 92px;\"\u003e\n \u003cp\u003eRabbit\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 92px;\"\u003e\n \u003cp\u003e1/2,000 WB\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 175px;\"\u003e\n \u003cp\u003eBiorbyt\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 104px;\"\u003e\n \u003cp\u003eorb395013\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 123px;\"\u003e\n \u003cp\u003eHA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 92px;\"\u003e\n \u003cp\u003eRat\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 92px;\"\u003e\n \u003cp\u003e1/1,000 WB\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 175px;\"\u003e\n \u003cp\u003eRoche\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 104px;\"\u003e\n \u003cp\u003e11867423001\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 123px;\"\u003e\n \u003cp\u003eCXCR4 pS\u003csup\u003e324/325\u003c/sup\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 92px;\"\u003e\n \u003cp\u003eRabbit\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 92px;\"\u003e\n \u003cp\u003e1/1,000 WB\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 175px;\"\u003e\n \u003cp\u003e7-TM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 104px;\"\u003e\n \u003cp\u003e7TM0071A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 123px;\"\u003e\n \u003cp\u003eCXCR4 pS\u003csup\u003e330\u003c/sup\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 92px;\"\u003e\n \u003cp\u003eRabbit\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 92px;\"\u003e\n \u003cp\u003e1/1,000 WB\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 175px;\"\u003e\n \u003cp\u003e7-TM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 104px;\"\u003e\n \u003cp\u003e7TM0071C\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 123px;\"\u003e\n \u003cp\u003eCXCR4 pS\u003csup\u003e346/347\u003c/sup\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 92px;\"\u003e\n \u003cp\u003eRabbit\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 92px;\"\u003e\n \u003cp\u003e1/1,000 WB\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 175px;\"\u003e\n \u003cp\u003e7-TM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 104px;\"\u003e\n \u003cp\u003e7TM0071B\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 123px;\"\u003e\n \u003cp\u003eDR5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 92px;\"\u003e\n \u003cp\u003eRabbit\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 92px;\"\u003e\n \u003cp\u003e1/1,000 WB\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 175px;\"\u003e\n \u003cp\u003eCell signaling Technology\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 104px;\"\u003e\n \u003cp\u003e8074\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 123px;\"\u003e\n \u003cp\u003eGAPDH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 92px;\"\u003e\n \u003cp\u003eRabbit\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 92px;\"\u003e\n \u003cp\u003e1/5,000 WB\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 175px;\"\u003e\n \u003cp\u003eCell signaling Technology\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 104px;\"\u003e\n \u003cp\u003e51332\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 123px;\"\u003e\n \u003cp\u003ep44/42 MAPK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 92px;\"\u003e\n \u003cp\u003eRabbit\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 92px;\"\u003e\n \u003cp\u003e1/1,000 WB\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 175px;\"\u003e\n \u003cp\u003eCell signaling Technology\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 104px;\"\u003e\n \u003cp\u003e9102\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 123px;\"\u003e\n \u003cp\u003ep-p44/42 MAPK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 92px;\"\u003e\n \u003cp\u003eRabbit\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 92px;\"\u003e\n \u003cp\u003e1/1,000 WB\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 175px;\"\u003e\n \u003cp\u003eCell signaling Technology\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 104px;\"\u003e\n \u003cp\u003e9101\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 123px;\"\u003e\n \u003cp\u003eLAMP1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 92px;\"\u003e\n \u003cp\u003eRabbit\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 92px;\"\u003e\n \u003cp\u003e1/250 ICC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 175px;\"\u003e\n \u003cp\u003eCell signaling Technology\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 104px;\"\u003e\n \u003cp\u003e9091\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 123px;\"\u003e\n \u003cp\u003eCalnexin\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 92px;\"\u003e\n \u003cp\u003eRabbit\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 92px;\"\u003e\n \u003cp\u003e1/250 ICC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 175px;\"\u003e\n \u003cp\u003eTransduction laboratories\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 104px;\"\u003e\n \u003cp\u003eC45520\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 123px;\"\u003e\n \u003cp\u003eGM130\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 92px;\"\u003e\n \u003cp\u003eMouse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 92px;\"\u003e\n \u003cp\u003e1/250 ICC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 175px;\"\u003e\n \u003cp\u003eBD Transduction\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 104px;\"\u003e\n \u003cp\u003e610823\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 85px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 123px;\"\u003e\n \u003cp\u003eLabel\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 92px;\"\u003e\n \u003cp\u003eTarget Species\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 92px;\"\u003e\n \u003cp\u003eDilution \u0026amp; Application\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 175px;\"\u003e\n \u003cp\u003eSupplier\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 104px;\"\u003e\n \u003cp\u003eREF\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"4\" style=\"width: 85px;\"\u003e\n \u003cp\u003eSecondary antibodies\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 123px;\"\u003e\n \u003cp\u003eAlexa Fluor\u0026reg; 633\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 92px;\"\u003e\n \u003cp\u003eRabbit\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 92px;\"\u003e\n \u003cp\u003e1/500 ICC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 175px;\"\u003e\n \u003cp\u003eInvitrogen\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 104px;\"\u003e\n \u003cp\u003e210071\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 123px;\"\u003e\n \u003cp\u003eAlexa Fluor\u0026reg; 633\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 92px;\"\u003e\n \u003cp\u003eMouse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 92px;\"\u003e\n \u003cp\u003e1/500 ICC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 175px;\"\u003e\n \u003cp\u003eInvitrogen\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 104px;\"\u003e\n \u003cp\u003e210052\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 123px;\"\u003e\n \u003cp\u003eHRP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 92px;\"\u003e\n \u003cp\u003eRat\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 92px;\"\u003e\n \u003cp\u003e1/5,000 WB\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 175px;\"\u003e\n \u003cp\u003eJackson ImmunoResearch\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 104px;\"\u003e\n \u003cp\u003e112-035-003\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 123px;\"\u003e\n \u003cp\u003eHRP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 92px;\"\u003e\n \u003cp\u003eRabbit\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 92px;\"\u003e\n \u003cp\u003e1/5,000 WB\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 175px;\"\u003e\n \u003cp\u003eCell signaling\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 104px;\"\u003e\n \u003cp\u003e7074\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eCell cultures and transfection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHEK293T cells, purchased from ATCC (Anassas, VI, ATCC, CRL-1573), were grown in Dulbecco\u0026rsquo;s Modified Eagle\u0026rsquo;s Medium (DMEM, Thermo Fisher Scientific, Ref 419960) supplemented with 10% heat-inactivated fetal bovine serum (Thermo Fisher Scientific, Ref 10099-133), 1% penicillin/streptomycin, \u0026nbsp;and maintained in humidified atmosphere containing 5% CO\u003csub\u003e2\u003c/sub\u003e at 37\u0026deg;C. Cells were passed twice a week and used between passages 10 and 25. They were transfected using polyethylenimine (jetPEI\u003csup\u003e\u0026reg;\u003c/sup\u003e, Polyplus, Ref 101000053) and used 24/48 h after transfection.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eMCF7 cells, provided by Dr. St\u0026eacute;phan Jalaguier and Vincent Cavaill\u0026egrave;s (Institut de Recherche en Canc\u0026eacute;rologie de Montpellier), were cultured in /Dulbecco\u0026rsquo;s modified Eagle\u0026rsquo;s medium/F12 supplemented with 10% heat-inactivated bovine serum (Thermo Fisher Scientific, Ref 10099-133), 1% penicillin/streptomycin, and maintained in a humidified atmosphere containing 5% CO\u003csub\u003e2\u003c/sub\u003e at 37\u0026deg;C. Cells were passed twice a week and used between passages 10 and 25. They were transfected using Lipofectamine\u003csup\u003eTM\u003c/sup\u003e 2000 (Thermo Fisher Scientific, Ref 11668019) and used 48 h after transfection.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCo-immunoprecipitation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHEK293T cells transfected with empty vector or vectors expressing HA- or Flag-tagged proteins were lysed in ice-cold lysis buffer containing 1% n-Dodecyl-\u0026beta;-D-Maltopyranoside (DDM, Anatrace, Ref D310), 20 mM Tris-HCl (pH 7.5), 100 mM NaCl, 2.5 mM CaCl\u003csub\u003e2\u003c/sub\u003e, phosphatase inhibitors (NaF, 10 mM; Na\u003csup\u003e+\u003c/sup\u003e-vanadate, 2 mM; Na+-pyrophosphate, 1 mM; and \u0026beta;-glycerophosphate, 50 mM) and the cOmplete Protease Inhibitor Cocktail (Merck, Ref 11836145001). Samples were maintained under gentle agitation for 1 h, at 4 \u0026deg;C and centrifuged for 15 min at 15,000 \u0026times; g to eliminate insoluble material. Soluble proteins were quantified by bicinchoninic acid assay (BCA, Merck, Refs B29643 and C2284) and equal protein amounts (5 or 0.5 mg for IP followed by mass spectrometry or Western blotting, respectively) were incubated with agarose-conjugated anti-HA antibody (Merck, Ref A2095) or with anti-FLAG M2 affinity gel (Sigma Aldrich, Ref A2220) overnight at 4 \u0026deg;C. Samples were then washed twice with an ice-cold solution of 0.5 M of NaCl and phosphatase inhibitors and three times with 0.25 M NaCl and phosphatase inhibitors. Immunoprecipitated proteins were then eluted in Laemmli sample buffer.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eProtein identification by mass spectrometry\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eImmunoprecipitated proteins from cells transfected with an empty vector (Mock) or a vector HA-tagged CXCR4 were separated by SDS-PAGE and stained with Protein Staining Solution (Euromedex, Ref 10-0911). Gel lanes were cut into seven gel pieces and destained with 50 mM TriEthylAmmonium BiCarbonate (TEABC, Merck, Ref T7408) followed by three washes in 100% acetonitrile. After reduction (with 10 mM dithiothreitol in 50 mM TEABC at 60 \u0026deg;C for 30 min) and alkylation (with 55 mM iodoacetamide TEABC at room temperature for 60 min), proteins were digested in-gel using trypsin (500 ng/band, Gold, Promega, Ref V5280). Digest products were dehydrated in a vacuum centrifuge and reduced to 3 \u0026mu;L. The generated peptides were analyzed online by nano-flow liquid chromatography coupled to tandem-mass spectrometry (nanoLCMS/MS) using an Orbitrap Elite mass spectrometer (Thermo Fisher Scientific, Waltham USA) coupled to an Ultimate 3000 HPLC (Thermo Fisher Scientific). Desalting and pre-concentration of samples were performed on-line on a Pepmap\u0026reg; pre-column (0.3 mm \u0026times; 10 mm, Dionex). A gradient consisting of 0\u0026ndash;40% B for 60 min and 80% B for 15 min (A = 0.1% formic acid, 2% acetonitrile in water; B = 0.1% formic acid in acetonitrile) at 300 nL/min was used to elute peptides from the capillary reverse-phase column (0.075 mm \u0026times; 150 mm, Acclaim Pepmap 100\u0026reg; C18, Thermo Fisher Scientific). Eluted peptides were electrosprayed online at a voltage of 1.8 kV into the Orbitrap Elite mass spectrometer. A cycle of one full-scan mass spectrum (MS1, 400\u0026ndash;2,000 m/z) at a resolution of 120,000 (at 400 m/z), followed by 20 data-dependent tandem-mass (MS2) spectra was repeated continuously throughout the nanoLC separation. All MS2 spectra were recorded using normalized collision energy (33%, activation Q 0.25 and activation time 10 ms) with an isolation window of 2 m/z. Data were acquired using the Xcalibur software (v 2.2). For all full scan measurements with the Orbitrap detector a lock-mass ion from ambient air (m/z 445.120024) was used as an internal calibrant63. Mass spectra were processed using the MaxQuant software package (v 1.5.5.1) and MS2 using the Andromeda search engine [19] against the UniProtKB Reference proteome UP000005640 database for Homo sapiens (release 2017_10) and the contaminant database in MaxQuant. The following parameters were used: enzyme specificity set as Trypsin/P with a maximum of two missed cleavages, Oxidation (M) and Phosphorylation (STY) set as variable modifications and carbamidomethyl (C) as fixed modification, and a mass tolerance of 0.5 Da for-fragment ions. The maximum false peptide and protein discovery rate was specified as 0.01. Seven amino acids were required as minimum peptide length. When precursor peptides were present in MS1 spectra but not selected for fragmentation and identification by MS2 in given runs, peptide identification were based on accurate mass and retention times across LC-MS runs using the matching between runs tool in MaxQuant. Only proteins identified in all three biological replicates in at least one group were considered for further analysis. Relative protein quantification in IP from CXCR4-expressing cells and Mock cells was performed using the label-free quantification (LFQ) algorithm \u0026ldquo;[https://maxquant.net/maxquant/]\u0026rdquo;. For statistical analysis, missing values were defined using the imputation tool of the Perseus software (v. 1.5.6.072) \u0026ldquo;[https://maxquant.net/perseus/]\u0026rdquo;.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWestern blotting\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eProteins were separated by SDS-PAGE using 10% polyacrylamide gels and transferred to nitrocellulose membranes (Bio-Rad, Ref 1704271). Membranes were incubated in blocking buffer (Tris-HCl, 50 mM, pH 7.5; NaCl, 200 mM; Tween-20, 0.1% and skimmed dried milk, 5%) for 1 h at room temperature and overnight with primary antibodies in incubating buffer (Tris-HCl, 50 mM, pH 7.5; NaCl, 200 mM; Tween-20, 0.1% and Bovine Serum Albumin (Merck, Ref A2153), 3%) at 4 \u0026deg;C. Then membranes were immunoblotted with either or anti-rat (Jackson ImmunoResearch, Ref 112-035-003) or anti-rabbit (Cell Signaling, Ref 7074) horseradish peroxidase (HRP)-conjugated secondary antibodies (1/5,000) in blocking buffer for 1 h at room temperature. Immunoreactivity was detected with an enhanced chemiluminescence method (Western lightning\u0026reg; Plus-ECL, Perkin Elmer, Ref NEL103E001EA) on a ChemiDoc\u0026trade; Touch Imaging System (Bio-Rad). Quantification was performed using the Image Lab software (Bio-Rad).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eProduction and purification of CXCR4 and Ephrin B1\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor production in insect cells, the full-length genes encoding human CXCR4 or Ephrin B1 was subcloned into pFastBac1 to enable infection of sf9 insect cells. The CXCR4 construct bore a hemagglutinin signal peptide followed by a Flag-tag preceding the receptor sequence. Mutations N11Q, S18A and N33Q residues were introduced to avoid N- or O-glycosylation for improved sample heterogeneity. The Ephrin B1 sequence was followed by a C-terminal 3C human rhinovirus 3C (HRV3C) protease cleavage site and a twin-Strep-tag (Strep-Ephrin B1).\u003c/p\u003e\n\u003cp\u003eFlag-CXCR4 and Strep-Ephrin B1 were expressed in Sf9 cells using the pFastBac baculovirus system (Thermo Fisher Scientific). Cells were grown in suspension in EX-CELL 420 medium (Sigma-Aldrich) and infected at a density of 4 x 10\u003csup\u003e6\u003c/sup\u003e cells/ml with the recombinant baculovirus. Flasks were shaken for 48 h at 28 \u0026deg;C, subsequently harvested by centrifugation (3,000 \u0026times; \u003cem\u003eg\u003c/em\u003e, 20 min) and stored at -80\u0026deg;C until usage. Cell pellets were first thawed and lysed by osmotic shock in a lysis buffer containing 10 mM Tris-HCl (pH 7.4), 1 mM EDTA, 2 mg/ml iodoacetamide, and protease inhibitors: 50 \u0026mu;g/ml Leupeptin (Euromedex), 0.1 mg/ml Bensamidine (Sigma-Aldrich) and 0.1 mg/ml Phenylmethylsulfonyl fluoride (PMSF; Euromedex). Lysates were centrifuged (38,400 \u0026times; \u003cem\u003eg\u003c/em\u003e, 10 min), and the resulting pellet was solubilized in buffer containing 50 mM Tris (pH 7.5), 150 mM NaCl, 2 mg/ml iodoacetamide, 0.5% (w/v) dodecyl maltoside (DDM, Anatrace), Cholesteryl hemisuccinate (CHS, 0.1% w/v) and protease inhibitors (50 \u0026mu;g/ml Leupeptin, 0.1 mg/ml Bensamidine and 0.1 mg/ml PMSF) using a Dounce homogenizer. Resulting homogenates were then stirred for 1 h, at 4 \u0026deg;C and centrifuged (38,400 \u0026times; \u003cem\u003eg\u003c/em\u003e, 30 min). CXCR4 supernatant was loaded onto M2 anti-Flag affinity resin (Sigma-Aldrich Ref A2220) using gravity flow. Ephrin B1 supernatant was supplemented with BioLock (0.75 ml/L) and incubated with Streptactin resin (IBA-Lifesciences, Ref 2-1206-025) for 1 h. Resins were each washed with 10 column volumes (CV) of wash buffer containing 50 mM Tris-HCl pH 7.4, 150 mM NaCl, 0.1% (w/v) DDM, and 0.02% (w/v) CHS. The resin was finally washed with a last wash buffer containing 50 mM Tris-HCl (pH 7.4), 150 mM NaCl, DDM 0.02% (w/v), CHS 0.002% (w/v) and eluted in last wash buffer supplemented with 0.4 mg/ml Flag peptide for elution of CXCR4 or 2.5mM desthiobiotin for elution of Ephrin B1. Each eluate was concentrated using a 50 kDa molecular weight cutoff (MWCO) concentrator (Millipore). CXCR4 was then purified by size exclusion chromatography (SEC) using a Superdex 200 Increase (10/300 GL column) connected to an \u0026Auml;KTA purifier system (GE Healthcare) and eluted in SEC buffer (50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 0.02% (w/v) DDM, 0.002% (w/v) CHS). Buffers used for CXCR4 purification were supplemented with the CXCR4 antagonist IT1t (1 \u0026micro;M in the lysis and solubilization buffers, 0.1 \u0026micro;M in the wash and elution buffers, Bio-Techne) to stabilize the receptor.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCo-immunoprecipitation of purified CXCR4 and Ephrin B1\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eComplexes of the two purified proteins were formed by mixing them at a 2:1 ratio and incubating the samples at 4\u0026deg;C overnight. The samples were then loaded onto M2 anti-Flag affinity resin, washed with 6 CV of SEC buffer, and eluted with SEC buffer supplemented with 0.4 mg/ml Flag peptide. The resulting eluate was loaded onto a column containing Streptactin resin, washed with 6 CV of SEC buffer, and eluted with SEC buffer supplemented with 2.5 mM Desthiobiotin.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBRET\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHEK293T cells were co-transfected with the indicated constructs and seeded (25,000 cells/well) in white polyornithine-coated 96-well plates (SPL Life Sciences). Twenty-four hours after transfection, cells were washed with PBS. Coelenterazine H (Nanolight Technology, Ref 50909-86-9) was added at a final concentration of 5 \u0026mu;M for 10 min at 37\u0026deg;C. Cells were then exposed to vehicle or CXCL12, and luminescence was measured using a Mithras LB 940 plate reader (Berthold Biotechnologies) that allows the sequential integration of light signals detected with two filter settings (Rluc/NLuc filter, 485 \u0026plusmn; 20 nm; and YFP filter, 530 \u0026plusmn; 25 nm). Data were collected using the MicroWin2000 software (Berthold Biotechnologies).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eNanoBRET assay assessing plasma membrane localization of CXCR4\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHEK293T cells were co-transfected with vectors encoding human CXCR4 C-terminally fused with Nano-Luciferase (N-Luc) and the first 11 residues of the human Lyn-kinase sequence, fused with Neon-Greem, respectively, in the absence or presence of a vector encoding Ephrin B1. Twenty-four hours after transfection, cells were harvested, incubated for 20 min at 37\u0026deg;C with coelenterazine H in Opti-MEM, and distributed into white 96-well plates (150,000 cells/well). The luminescence generated was measured with a GloMax Discover plate reader (Promega), equipped with 450/10 filter for donor luminescence emission and 530 LP filter for acceptor fluorescence emission [20].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCXCR4 cellular distribution monitoring using Nano-luciferase complementation (HiBiT)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eReceptor cellular distribution in basal conditions and upon ligand stimulation was monitored by using a nanoluciferase complementation assay based on the NanoGlo HiBiT extracellular and Nano-Glo HiBiT lytic detection systems (Promega). HEK293T cells were co-transfected with pHiBiT vector encoding CXCR4 N-terminally fused to HiBiT and a vector encoding Ephrin B1. Forty-eight hours after transfection, cells were distributed in white 96-well plates (50,000 cells per well) and stimulated with CXCL12 (10 or 50 nM) for 30 min at 37\u0026deg;C. After the addition of Nano-Glo\u0026reg; HiBiT reagent, containing soluble LgBiT protein, in ratio of 1:100 of the final volume, luminescence was recorded for 30 min with a GloMax Discover plate reader (Promega). In unstimulated conditions, surface and total receptor expression were determined using the Nano-Glo HiBiT extracellular detection system (Promega) and Nano-Glo HiBiT lytic detection system (Promega), respectively.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026beta;-arrestin\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;recruitment assay based on Nano-luciferase complementation (NanoBiT)\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026beta;-arrestin-1 and \u0026beta;-arrestin-2 recruitment to CXCR4, was monitored using a Nano-luciferase complementation-based assay (NanoBiT, Promega). HEK293T cells were co-transfected with vectors encoding human \u0026beta;-arrestins N-terminally fused with LgBiT, CXCR4 C-terminally fused with SmBiT in the absence or presence of a vector encoding Ephrin B1. Twenty-four hours after transfection, cells were harvested, incubated for 20 min at 37\u0026deg;C with coelenterazine H in Opti-MEM, and distributed into white 96-well plates (150,000 cells/well). CXCL12 was then added at the indicated concentration, and the luminescence generated upon Nano-luciferase complementation was measured with a GloMax Discover plate reader (Promega).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmunocytochemistry and confocal microscopy\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHEK293T cells grown on glass coverslips were fixed with a 4% solution of PFA in PBS for 10 min. Excess of PFA was quenched by washing cells in a 0.1 M solution of glycine in PBS for 10 min. Cells were permeabilized with a PBS solution containing 0.5% heat-inactivated bovine serum and 0.1% Triton X-100 for 15 min. Cells were washed three times and incubated with primary antibodies (anti-LAMP1 (rabbit or mouse) or anti-GM130 (mouse), or anti-Calnexin (rabbit)) in PBS containing 0.5% heat-inactivated bovine serum and 0.1% Triton X-100. After three washes in PBS, cells were incubated for 1 h at room temperature in PBS containing 0.5% bovine serum, 0.1% Triton X-100, the appropriate secondary antibody (Alexa Fluor\u0026reg; 633-conjugated anti-mouse antibody (1/250, Invitrogen, Ref 210052), Alexa Fluor\u0026reg; 633-conjugated anti-rabbit antibody (1/250, Invitrogen Ref 210071)) and DAPI (1 \u0026micro;g/ml). Cells were then washed three times with PBS and coverslips were mounted on Superfrost ultra plus glass slides using fluorescent mounting medium. Pictures were acquired with a LSM980 confocal microscope (Zeiss) equipped with a 40X oil-immersed lens, with a 2791 \u0026times; 2791 resolution, and 1 \u0026micro;m between focus points.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistics\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eStatistical analysis of the CXCR4 interactome was performed using the Perseus software (v 1.5.6.072). Proteins were considered statistically significant using a t-test by setting the randomization number at 250, the False Discovery Rate at 0.01, and the S0 at 0.1. All other statistical analyses were performed using Prism (v.8.0, GraphPad Software Inc), and the statistical tests used are indicated in each legend. Dose-response curves (\u003cstrong\u003eFig.s 3D,E\u0026nbsp;\u003c/strong\u003eand\u003cstrong\u003e\u0026nbsp;4B\u003c/strong\u003e) were fitted by the log (agonist) vs. response (four parameters) non-linear regression using Prism. Saturation BRET experiments were analyzed using Prism. The one-site specific binding model was used to obtain the curve fit. All data are presented as means \u0026plusmn; SEM. Significance levels were defined as p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 (*), p\u0026thinsp;\u0026lt;\u0026thinsp;0.01 (**), p\u0026thinsp;\u0026lt;\u0026thinsp;0.001 (***), and p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001 (****).\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cb\u003eCharacterization of the CXCR4 interactome reveals a physical interaction between CXCR4 and Ephrin B1\u003c/b\u003e\u003c/p\u003e\u003cp\u003eWe analyzed the CXCR4 interactome in human embryonic kidney (HEK-293T) cells that endogenously express CXCR4 and where CXCR4-dependent signaling has been extensively investigated [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Due to the lack of a CXCR4 antibody providing receptor immunoprecipitation yields compatible with mass spectrometry analysis, we expressed hemagglutinin (HA)-tagged CXCR4 in the cells and CXCR4-interacting proteins were immunoprecipitated using an anti-HA monoclonal antibody immobilized onto agarose beads. Control immunoprecipitations were performed using cells transfected with an empty plasmid (Mock condition). Systematic analysis by LC-MS/MS of proteins in immunoprecipitates from both conditions in three biological replicates identified 1,203 proteins. Label-free quantification of their relative abundance in both conditions showed that 19 of them exhibited significant enrichment in immunoprecipitates from CXCR4-expressing cells, compared with immunoprecipitates from control cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA and \u003cb\u003eTable \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e\u003c/b\u003e). As expected, CXCR4 (bait protein) was the most enriched one (log\u003csub\u003e2\u003c/sub\u003eLFQ\u003csub\u003eCXCR4\u003c/sub\u003e/LFQ\u003csub\u003eMock\u003c/sub\u003e = 8.13, -log\u003csub\u003e10\u003c/sub\u003e p-value\u0026thinsp;=\u0026thinsp;4.82), while the second ranked protein was Ephrin B1 (log\u003csub\u003e2\u003c/sub\u003eLFQ\u003csub\u003eCXCR4\u003c/sub\u003e/LFQ\u003csub\u003eMock\u003c/sub\u003e = 7.29, -log\u003csub\u003e10\u003c/sub\u003e p-value\u0026thinsp;=\u0026thinsp;4.96, Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA and \u003cb\u003eTable \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e\u003c/b\u003e). Ephrin B1 is a member of the Ephrin-B family comprising three proteins (Ephrin B1-3) that act as ligands of the tyrosine kinase Eph receptors involved in numerous biological processes, including axon guidance and cell migration during neurodevelopment, and the proliferation of various cancer cell types [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Notably, Ephrin B1 was the only member of the Ephrin ligand family identified in the CXCR4 interactome.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eConsidering the strong enrichment of Ephrin B1 in the CXCR4 interactome, their role in common cellular and pathological processes and the existence of functional interactions between both proteins [\u003cspan additionalcitationids=\"CR23\" citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e], we then focused on the CXCR4-Ephrin B1 interaction. Co-immunoprecipitation followed by Western blotting from cells co-expressing HA-CXCR4 and Flag-Ephrin B1 confirmed that Ephrin B1 co-immunoprecipitated with CXCR4 and vice versa (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). The C-terminal domain of GPCRs has been identified as a major site involved in their interaction with their protein partners [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Nevertheless, the co-immunoprecipitation of Ephrin B1 with CXCR4 was not affected by the deletion of CXCR4\u0026rsquo;s 15 C-terminal residues (major mutation responsible for the WHIM syndrome, CXCR4-WHIM [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]) nor of its entire C-terminal domain (CXCR4ΔCter, \u003cb\u003eFigure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e\u003c/b\u003e), indicating that the CXCR4 C-terminal domain is not involved in the recruitment of Ephrin B1. In contrast, the C-terminal domain of Ephrin B1 seems to be essential to the formation of the CXCR4-Ephrin B1 complex, as its deletion abolished the co-immunoprecipitation of Ephrin B1 with CXCR4 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC).\u003c/p\u003e\u003cp\u003eWe next analyzed CXCR4-Ephrin B1 interaction in living HEK-293T cells using bioluminescence resonance energy transfer (BRET). Under conditions of constant Ephrin B1-NLuc expression, the BRET signal increased hyperbolically as a function of the CXCR4-Neon Green expression level (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). Further, the BRET signal was significantly increased upon CXCR4 activation by CXCL12 (Bmax\u0026thinsp;=\u0026thinsp;802\u0026thinsp;\u0026plusmn;\u0026thinsp;54.3 \u003cem\u003evs.\u003c/em\u003e 974\u0026thinsp;\u0026plusmn;\u0026thinsp;29 mBRET in the absence and presence of CXCL12, respectively, p\u0026thinsp;=\u0026thinsp;0.011, one-way ANOVA followed by Bonferroni\u0026rsquo;s multiple comparisons test), indicating that the interaction with Ephrin B1 is promoted by agonist stimulation of CXCR4. Corroborating previous interactomics studies that did not identify Ephrin B1 as a protein partner of ACKR3 [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e], an atypical chemokine receptor known to form heteromers and to be functionally linked with CXCR4 [\u003cspan additionalcitationids=\"CR29\" citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e], the BRET signal was much lower in cells co-expressing Ephrin B1-NLuc and increasing amounts of ACKR3-Neon Green than that measured in cells co-expressing Ephrin B1 and CXCR4 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). Furthermore, no CXCL12-induced effect was observed. Collectively, these observations indicate a close and specific interaction between CXCR4 and Ephrin B1. To establish whether the interaction between both proteins is direct, purified recombinant Flag-CXCR4 and Strep-Ephrin B1 were obtained from Sf9 cells, mixed at 2:1 protein ratio and subjected to sequential affinity purification on M2 anti-Flag affinity resin and, after elution of the retained material, on Streptactin resin. We found that Strep-Ephrin B1 was co-purified with Flag-CXCR4 on Flag resin while Flag-CXCR4 was co-copurified with Strep-Ephrin B1 on Streptactin resin, indicative of a direct physical interaction between both proteins (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE).\u003c/p\u003e\u003cp\u003e\u003cb\u003eImpact of Ephrin B1 on CXCR4 glycosylation and phosphorylation\u003c/b\u003e\u003c/p\u003e\u003cp\u003eCo-expression of Ephrin B1 with CXCR4 modified the pattern of CXCR4 migration in SDS-PAGE, leading to a single immunoreactive band at around 40 kDa, instead of two bands (the 40 kDa band and another band of higher apparent molecular weight) when the receptor was expressed alone (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB), suggesting that Ephrin association with CXCR4 might affect CXCR4 post-translational modifications (see Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Treatment of protein extracts from cells expressing the receptor alone with N-glycosidase F, but not O-glycosidase, led to the disappearance of the higher molecular weight band and to a receptor migration pattern on SDS-PAGE identical to that observed in the presence of Ephrin B1 (single band of apparent molecular weight of 40 kDa, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Moreover, N-glycosidase F treatment did not affect the receptor migration pattern in cells co-expressing Ephrin B1. Collectively, these results suggest that the co-expression of Ephrin B1 prevents CXCR4 N-glycosylation. Further supporting this hypothesis, Ephrin B1 expression did not affect the migration of a mutant CXCR4 where residues known to be N-glycosylated (positions 11 and 176) or O-glycosylated (position 18) were mutated into alanine (CXCR4ΔGlyc, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eWe also examined the impact of Ephrin B1 expression on CXCR4 phosphorylation. CXCR4 is known to be sequentially phosphorylated on multiple residues located in its C-terminal domain, first on Ser\u003csup\u003e346/347\u003c/sup\u003e by GRK2/3 and then on Ser\u003csup\u003e330\u003c/sup\u003e, Ser\u003csup\u003e324/325\u003c/sup\u003e and Ser\u003csup\u003e338/339\u003c/sup\u003e by GRK6 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA) [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Studies also suggested that PKC can phosphorylate Ser\u003csup\u003e324/325\u003c/sup\u003e [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Using phosphosite specific antibodies, we found that Ephrin B1 expression differentially affected the phosphorylation of Ser\u003csup\u003e346/347\u003c/sup\u003e, Ser\u003csup\u003e330\u003c/sup\u003e and Ser\u003csup\u003e324/325\u003c/sup\u003e: while it enhanced Ser\u003csup\u003e346/347\u003c/sup\u003e phosphorylation in cells exposed or not to CXCL12 for 5 min, it abolished the phosphorylation of both Ser\u003csup\u003e330\u003c/sup\u003e and Ser\u003csup\u003e324/325\u003c/sup\u003e in cells stimulated or not with CXCL12 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC).\u003c/p\u003e\u003cp\u003e\u003cb\u003eImpact of Ephrin B1 on CXCR4 subcellular localization\u003c/b\u003e\u003c/p\u003e\u003cp\u003eGiven the role of CXCR4 post-translational modifications in its trafficking, we investigated the effect of Ephrin B1 expression on the subcellular localization of YFP-tagged CXCR4 in HEK-293 cells by confocal fluorescent microscopy. While an important fraction of CXCR4-YFP was detected at the plasma membrane when it was expressed alone, it showed in cells co-expressing Ephrin B1-RFP a more pronounced distribution in intracellular compartments, where both proteins were colocalized (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, see also \u003cb\u003eFigure S2\u003c/b\u003e). Co-immunostaining of cells co-expressing CXCR4-YFP and Ephrin B1-RFP with a calnexin (endoplasmic reticulum) or GM130 (Golgi apparatus) antibody showed an important fraction of the receptor in the endoplasmic reticulum and Golgi apparatus specifically in cells co-expressing CXCR4-YFP or Ephrin B1-RFP (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Likewise, a fraction of the receptor was detected in the lysosomal compartment of cells co-expressing both proteins, as shown by co-immunostaining with a LAMP1 antibody (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eWe next examined the effect of Ephrin B1 expression on plasma membrane localization of CXCR4-NLuc receptor using a Nano-BRET assay and LYN-NeonGreen as an acceptor anchored at the plasma membrane [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Confirming our confocal microscopy observations, the BRET signal decreased as a function of the amount of Ephrin B1 co-expressed with the receptor (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Note that the co-expression of Ephrin B1 did not modify the total expression of CXCR4, as assessed by the total CXCR4-NLuc signal (\u003cb\u003eFigure S3\u003c/b\u003e).\u003c/p\u003e\u003cp\u003eGiven the limited level of CXCR4 internalization measured upon stimulation by CXCL12 for 60 min in our Nano-BRET assay using Neon-Green-LYN (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB), we assessed the impact of Ephrin B1 on CXCL12-induced CXCR4 internalization using a more sensitive cell surface detection approach based on the HiBiT Nano-luciferase complementation technology. Cells expressing N-terminally HiBiT-tagged CXCR4 were stimulated with CXCL12 and the remaining receptors at the plasma membrane were quantified by adding soluble LgBiT fragment. As expected, treatment of cells expressing CXCR4 alone with CXCL12 (10 nM, 30 min) already induced a significant internalization of the receptor that was further enhanced in cells exposed to 50 nM CXCL12, while co-expression of Ephrin B1 prevented CXCL12-induced receptor internalization (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). Consistent with these observations and with the well-described β-arrestin-dependent CXCR4 internalization elicited by its activation by CXCL12 [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e], co-expression of Ephrin B1 with CXCR4 inhibited the recruitment of both β-arrestin 1 and β-arrestin 2 by the receptor, as assessed using a Nano-luciferase complementation-based assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD,E).\u003c/p\u003e\u003cp\u003e\u003cb\u003eImpact of Ephrin B1 on CXCR4 signaling\u003c/b\u003e\u003c/p\u003e\u003cp\u003eConsistent with previous findings demonstrating that CXCR4 is canonically coupled with Gi proteins [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e], saturation BRET analysis under conditions of constant RLuc-Gα\u003csub\u003ei1\u003c/sub\u003e or RLuc-Gα\u003csub\u003ei3\u003c/sub\u003e expression and increasing CXCR4-YFP expression level showed that CXCR4 recruits both Gα\u003csub\u003ei1 and\u003c/sub\u003e Gα\u003csub\u003ei3\u003c/sub\u003e proteins in HEK-293T cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Treatment of cells with CXCL12 did not markedly modify the recruitment of both G proteins by the receptor, whereas it was strongly reduced by the co-expression of Ephrin B1. Corroborating these observations, Ephrin B1 expression also decreased the ability of CXCL12 stimulation of CXCR4 to promote dissociation Gα\u003csub\u003ei1\u003c/sub\u003e and Gα\u003csub\u003ei3\u003c/sub\u003e from Gβγ, as assessed by the decrease in the BRET signal between venus-Gγ\u003csub\u003e2\u003c/sub\u003e and Gα\u003csub\u003ei1\u003c/sub\u003e-RLuc or Gα\u003csub\u003ei3\u003c/sub\u003e-RLuc (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eWe next investigated the effect of Ephrin B1 expression on the ability of CXCR4 to activate the Erk1/2 pathway, a key signaling cascade underlying tumor progression elicited by the CXCL12-CXCR4 axis. As previously shown [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e], stimulation of CXCR4 endogenously expressed in HEK-293T cells with CXCL12 (10 nM, 5 min) induced an increase in Erk1/2 phosphorylation that was slightly but not significantly enhanced in cells transfected with a CXCR4 construct (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). In contrast, the CXCL12 response was strongly enhanced in cells transfected with an Ephrin B1 construct alone or co-transfected with the CXCR4 and Ephrin B1 constructs. The strong Erk1/2 activation induced by CXCL12 in cells overexpressing Ephrin B1 did involve CXCR4 activation, as it was abolished by pretreating cells with the CXCR4 antagonist AMD3100 (1 \u0026micro;M, 30 min, Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). The activation of the Erk1/2 signaling cascade by GPCR ligands is often a complex process that involves G protein-dependent and β-arrestin-dependent mechanisms [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. As shown on Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD,E, expression of Ephrin B1 inhibits β-arrestin 1 and β-arrestin 2 recruitment by CXCR4, making unlikely a role of β-arrestins in the enhanced CXCR4-operated Erk1/2 signaling observed in the presence of Ephrin B1. A previous study has demonstrated a role Gβγ and its translocation to the Golgi apparatus in Erk1/2 activation induced by CXCR4 stimulation in several cancer cell lines and HEK-293 cells [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Consistent with these findings and the presence of CXCR4 and Ephrin B1 in Golgi apparatus in cells expressing both protein partners (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA), the activation of Erk1/2 induced by CXCL12 in cells expressing both protein partners (or overexpressing Ephrin B1 alone) was abolished by pretreating cells with the Gβγ pharmacological inhibitor Gallein (25 \u0026micro;M, 30 min, Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC).\u003c/p\u003e\u003cp\u003e\u003cb\u003eRole of Ephrin B1 in the regulation of Death Receptor 5 expression by CXCR4 in breast cancer cells\u003c/b\u003e\u003c/p\u003e\u003cp\u003ePrevious studies have shown that intracellular CXCR4 constitutively promotes the downregulation of Death Receptor 5 (DR5) independently of agonist stimulation of receptor signaling [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. In light of these findings and the ability of Ephrin B1 to promote intracellular localization of the receptor, we next examined its influence on CXCR4-dependent regulation of DR5 expression level in MCF7 breast cancer cells. Expression of CXCR4 in MCF7 cells significantly reduced DR5 levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA), consistent with the predominant intracellular localization of the receptor (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). This reduction in DR5 level was not prevented by treating cells with the CXCR4 antagonist AMD3100 (1 \u0026micro;M, added to the cells immediately after their transfection with the CXCR4 plasmid, Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA), confirming that it is independent of agonist receptor stimulation. In contrast, silencing Ephrin B1 expression in MCF7 cells using a shRNA, which reduced Ephrin B1 level by 61.90\u0026thinsp;\u0026plusmn;\u0026thinsp;4.75% (n\u0026thinsp;=\u0026thinsp;5, p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001, ANOVA followed by Dunnett\u0026rsquo;s test, \u003cb\u003eFigure S4\u003c/b\u003e), prevented the decrease in DR5 level elicited by CXCR4 overexpression (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). As expected, silencing Ephrin B1 expression also induced plasma membrane relocalization of a fraction of CXCR4 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). These results suggest a key role of Ephrin B1 in the regulation of DR5 expression by CXCR4 in breast cancer cells.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eTo identify mechanisms underlying tumorigenic effects of intracellular CXCR4 that are independent of CXCL12-induced signaling, we characterized the CXCR4 interactome and identified Ephrin B1 as a novel receptor-interacting protein. To our knowledge, this is the first demonstration of a physical interaction between a GPCR and a member of the Ephrin ligand family that comprises five glycosylphosphatidylinositol-anchored Ephrin-A ligands (Ephrins A1-5) and three transmembrane Ephrin-B ligands (Ephrins B1-3). Strikingly, Ephrin B1 was the most highly enriched protein identified in the CXCR4 interactome, suggesting a robust interaction between both partners. Corroborating this observation, we found that purified CXCR4 and Ephrin B1 can form a complex \u003cem\u003ein vitro\u003c/em\u003e, indicative of a direct interaction between both proteins. The ability of Ephrin B1 to associate with CXCR4 in living cells was validated by BRET experiments, which also demonstrated that agonist stimulation of CXCR4 promotes the recruitment of Ephrin B1 by the receptor, indicating that CXCR4-Ephrin B1 interaction is a dynamic process regulated by the receptor\u0026rsquo;s conformational state. Furthermore, BRET experiments showed a low ability of Ephrin B1 to interact with ACKR3, an atypical chemokine receptor sharing with CXCR4 the chemokine CXCL12 as ligand, reminiscent of a previous interactomic screen performed in the same cellular background (HEK-293T cells) that did not identify Ephrin B1 as an ACKR3 partner [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. As ACKR3 and CXCR4 are known to form heteromers in HEK-293T cells [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e], the low BRET signal measured in cells co-expressing ACKR3 and Ephrin B1 might reflect an indirect recruitment of Ephrin B1 through the heteromerization of ACKR3 with endogenously expressed CXCR4. Further supporting the specificity of CXCR4-Ephrin B1 interaction, Ephrin B1 was the only member of the Ephrin ligand family identified in our interactomic screen.\u003c/p\u003e\u003cp\u003eThe common roles of CXCR4 and Ephrin ligands and their receptors in cancer progression and resistance to chemotherapies prompted us to further investigate the reciprocal impact of Ephrin B1 and CXCR4 on their cellular localization and signaling. Using both confocal fluorescence microscopy and a Nano-BRET assay assessing plasma membrane localization of CXCR4, we provide converging evidence that Ephrin B1 promotes intracellular localization of the receptor in HEK-293T cells stimulated or not with CXCL12. Likewise, while Ephrin B1 was mainly detected at the plasma membrane of cells expressing RFP-Ephrin B1 alone, it was predominantly found in intracellular compartments of cells co-expressing CXCR4-YFP. These include the endoplasmic reticulum and the Golgi apparatus as well as lysosomes, where both proteins were colocalized.\u003c/p\u003e\u003cp\u003eThe increase in CXCR4 intracellular localization induced by Ephrin B1 expression might result from the retention of receptor in intracellular compartment and/or the increase in its internalization. Using HiBiT surface Nano-luciferase complementation, we found that Ephrin B1 prevents rather than enhances CXCL12-induced CXCR4 internalization, an effect that correlates with the ability of Ephrin B1 to inhibit β-arrestin1 and β-arrestin2 recruitment to the receptor. This suggests that Ephrin B1 promotes CXCR4 intracellular localization through the inhibition of its targeting to the plasma membrane. Consistent with this hypothesis, the ability of Ephrin B1 to associate with non-glycosylated CXCR4 \u003cem\u003ein vitro\u003c/em\u003e and to abolish its glycosylation suggests that CXCR4 and Ephrin B1 can associate early in the biosynthetic pathway, an effect leading to the inhibition of the forward trafficking and the intracellular sequestration of an important fraction of both proteins.\u003c/p\u003e\u003cp\u003eThe decreased CXCR4 plasma membrane localization in cells co-expressing Ephrin B1 might also be one of the mechanisms contributing to the inhibitory effect of Ephrin-B1 on CXCL12-induced β-arrestin1 and β-arrestin2 recruitment to CXCR4. β-arrestin recruitment to GPCRs is known to depend on their phosphorylation on residues located in their C-terminal domain by GRKs and other protein kinases. Our results show that Ephrin B1 expression enhances CXCR4 phosphorylation on Ser\u003csup\u003e346\u0026ndash;347\u003c/sup\u003e, two residues phosphorylated by GRK2/3 located in the cytoplasm [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. In contrast, Ephrin B1 expression abolishes the phosphorylation of residues (Ser\u003csup\u003e324/325\u003c/sup\u003e and Ser\u003csup\u003e330\u003c/sup\u003e) phosphorylated by GRK6, which is constitutively localized at the plasma membrane [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Collectively, these findings are consistent with the predominant intracellular localization of the receptor in cells expressing Ephrin B1. CXCR4 phosphorylation at these sites also induce contrasting effects on β-arrestin recruitment and receptor internalization [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Whereas the phosphorylation of Ser\u003csup\u003e346\u0026ndash;347\u003c/sup\u003e seems to be prerequisite to β-arrestin recruitment, inhibition of Ser\u003csup\u003e324/325\u003c/sup\u003e, Ser\u003csup\u003e330\u003c/sup\u003e and Ser\u003csup\u003e339\u003c/sup\u003e phosphorylation by their mutation into alanine favors β-arrestin recruitment [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Our results demonstrating that Ephrin B1 expression increases Ser\u003csup\u003e346\u0026ndash;347\u003c/sup\u003e phosphorylation while it abolishes Ser\u003csup\u003e324/325\u003c/sup\u003e and Ser\u003csup\u003e330\u003c/sup\u003e phosphorylation suggest that its inhibitory effect on β-arrestin recruitment to CXCR4 (and receptor internalization) is independent of its modulation of the receptor phosphorylation state. This inhibitory effect might rather result from the decreased plasma membrane localization of CXCR4 and/or steric hindrance by Ephrin B1 bound to the receptor. A recent study has shown an interaction between CXCR4 and receptor activity-modifying protein3 (RAMP3), which inhibits both constitutive and agonist-dependent β-arrestin recruitment to the receptor [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. This suggests that β-arrestin recruitment to CXCR4 and β-arrestin-dependent CXCR4 signalling are finely regulated by its association with various protein partners.\u003c/p\u003e\u003cp\u003eThe decrease in CXCR4 plasma membrane localization in cells co-expressing Ephrin B1 might also be one of the mechanisms underlying the inhibitory effect of Ephrin-B1 on CXCL12-induced Gα\u003csub\u003ei\u003c/sub\u003e protein activation. A previous study has demonstrated that Ephrin B1 interacts with Regulator of G protein signaling 3 (RGS3), a member of the RGS protein family that negatively regulate G protein activation by GPCRs \u003cem\u003evia\u003c/em\u003e the GTPase activating protein activity of their RGS domain. This results in the inhibition of the migration of cerebellar granule neurons induced by CXCL12-induced activation of CXCR4 [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. It is likely that RGS3 linked to Ephrin B1 also contributes to the inhibition of Gα\u003csub\u003ei\u003c/sub\u003e activation observed under expression of Ephrin B1, a process which could be favored by the physical interaction of Ephrin B1 with CXCR4.\u003c/p\u003e\u003cp\u003eEphrin forward and reverse signaling involve extensive crosstalk with major cytosolic signaling pathways known to be engaged by tyrosine kinase receptors that control cell survival, migration, and differentiation, such as Erk1/2 signaling [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Here, we show that Ephrin B1 expression, which already increases Erk1/2 activation in the absence of a CXCR4 agonist, strongly potentiates the CXCL12 response, while treatment of cells with the CXCR4 antagonist AMD3100 abolishes Ephrin B1-dependent Erk1/2 activation. These findings indicate that Ephrin B1 engages Erk1/2 signaling through active CXCR4. CXCR4-dependent Erk1/2 activation is known to strongly depend on Gβγ proteins [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Further supporting the implication of CXCR4 in Ephrin B1 stimulation of Erk1/2 signalling, the inhibition of Gβγ proteins also abolished the strong Erk1/2 activation measured in cells expressing Ephrin B1. Collectively, these observations are reminiscent of recent findings indicating that the EGF receptor and the HER3/HER2 receptors signal to Erk1/2 through activated CXCR4/ACKR3 [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e] and suggest that components of the Ephrin/Eph systems can likewise hijack the CXCR4 signaling machinery to activate the Erk1/2 pathway.\u003c/p\u003e\u003cp\u003eThe synergistic effects of CXCR4 and Ephrin B1 on Erk1/2 signaling might be one of the mechanisms underlying their common deleterious influence on cancer cell growth, invasion and metastasis. Besides CXCR4-operated Erk signaling, it has recently been proposed that the intracellular localization of CXCR4 in cancer cells plays a critical role in the receptor\u0026rsquo;s tumorigenic effects \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e through the downregulation of DR5 expression [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. This prompted us to explore the influence of Ephrin B1 on DR5 expression in breast cancer cells. We found that silencing Ephrin B1 expression in MCF7 cells abolished the reduction of DR5 level induced by overexpressing CXCR4, while promoting relocalization of a fraction of CXCR4 to the plasma membrane, suggesting that Ephrin B1 regulates DR5 expression by promoting intracellular localization of CXCR4. Collectively, these findings indicate that Ephrin B1 can contribute to the tumorigenic potential of CXCR4 through the enhancement of its oncogenic signaling and its retention in intracellular compartments where it inhibits cell apoptosis and thus renders cancer cells resistant to chemotherapeutic drugs. Together with agonist-independent tumorigenic signaling elicited by CXCR4 oligomers [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e], these observations may also explain the limited clinical efficacy of CXCR4 antagonists such as AMD3100. Although the role of the physical CXCR4-Ephrin B1 interaction could not be fully established in the absence of identification of binding motifs within the sequences of both partners, they suggest that targeting Ephrin B1 reverse signaling and/or its interaction with CXCR4 might be a relevant strategy in complement to CXCR4 antagonists to dampen the tumorigenic effects of this receptor.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eCompeting interests\u003c/h2\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003ch2\u003eConsent for publication\u003c/h2\u003e\n\u003cp\u003eAll authors have approved the content of this manuscript and provided consent for publication.\u003c/p\u003e\n\u003ch2\u003eFunding\u003c/h2\u003e\n\u003cp\u003eThis research was funded by the European Union\u0026rsquo;s Horizon2020 MSCA Program (H2020-MSCA Program, Grant agreement 860229-ONCORNET 2.0). A.C. was supported by the Luxembourg Institute of Health (LIH) through the NanoLux Platform, the Cancer Foundation Luxembourg, Luxembourg National Research Fund (INTER/FNRS CXCL12 20/15084569, CORE IMPACTT C23/BM/18068832). P.M. and S.C.D. were also supported by fundings from CNRS, INSERM and the University of Montpellier.\u003c/p\u003e\n\u003ch2\u003eAuthor contributions\u003c/h2\u003e\n\u003cp\u003eA.R. designed, performed, and analyze most of the experiments, and wrote the manuscript; O.O. produced purified recombinant CXCR4 and Ephrin B1; A.F. performed the interactomic screen; M. Seveno performed LC-MS/MS experiments and analyzed MS/MS data; S.G. performed confocal microscopy image acquisition and supervised image analysis; M.C. performed \u0026beta;-arrestins recruitment experiments; T.D. contributed to the design of experiments and manuscript revision; M.J.S. participated in the project design and funding and revised the manuscript, M. Szpakowska designed and supervised Nano-BRET and Nano-luciferase Complementation experiments, and revised the manuscript; A.C. designed nano-BRET and nanoluciferase complementation experiments, and revised the manuscript, S.C.D. supervised the project, designed experiments and revised the manuscript; P.M. conceived and supervised the study, and wrote the manuscript.\u003c/p\u003e\n\u003ch2\u003eAcknowledgements\u003c/h2\u003e\n\u003cp\u003eWe thank all our colleagues from the ONCORNET 2.0 consortium for continuous scientific discussions and support. Mass spectrometry experiments were carried out using the facilities of the Montpellier Proteomics Platform (PPM, BioCampus Montpellier), a member of the national Proteomics French Infrastructure (ProFI UAR 2048) supported by the French National Research Agency (ANR-24-INBS-0015, Investments for the future F2030). BRET experiments were performed using the facilities of the Arpege pharmacological screening platform (Biocampus Montpellier) and confocal microscopy image acquisition using the facilities of the Montpellier Ressources Imagerie (MRI) platform (BioCampus Montpellier).\u003c/p\u003e\n\u003ch2\u003eData availability\u003c/h2\u003e\n\u003cp\u003eAll data generated in this study are included in this article and its supplementary information file. The raw data are available upon request from the corresponding authors. The mass spectrometry proteomics data have been deposited at the ProteomeXchange Consortium via the PRIDE partner repository [\u003cspan class=\"CitationRef\"\u003e42\u003c/span\u003e] with the dataset identifier PXD054221.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eTeixido J, Martinez-Moreno M, Diaz-Martinez M and Sevilla-Movilla S (2018) The good and bad faces of the CXCR4 chemokine receptor. Int J Biochem Cell Biol 95:121-131 doi:10.1016/j.biocel.2017.12.018\u003c/li\u003e\n\u003cli\u003eLiu Q et al. (2016) WHIM Syndrome Caused by Waldenstrom\u0026apos;s Macroglobulinemia-Associated Mutation CXCR4 (L329fs). J Clin Immunol 36(4):397-405 doi:10.1007/s10875-016-0276-3\u003c/li\u003e\n\u003cli\u003eMoore JP, Kitchen SG, Pugach P and Zack JA (2004) The CCR5 and CXCR4 coreceptors--central to understanding the transmission and pathogenesis of human immunodeficiency virus type 1 infection. AIDS Res Hum Retroviruses 20(1):111-126 doi:10.1089/088922204322749567\u003c/li\u003e\n\u003cli\u003eMuller A et al. (2001) Involvement of chemokine receptors in breast cancer metastasis. Nature 410(6824):50-56 doi:10.1038/35065016\u003c/li\u003e\n\u003cli\u003eBusillo JM et al. (2010) Site-specific phosphorylation of CXCR4 is dynamically regulated by multiple kinases and results in differential modulation of CXCR4 signaling. J Biol Chem 285(10):7805-7817 doi:10.1074/jbc.M109.091173\u003c/li\u003e\n\u003cli\u003eKhater M et al. (2021) G protein betagamma translocation to the Golgi apparatus activates MAPK via p110gamma-p101 heterodimers. J Biol Chem 296:100325 doi:10.1016/j.jbc.2021.100325\u003c/li\u003e\n\u003cli\u003eDe Clercq E (2019) Mozobil(R) (Plerixafor, AMD3100), 10 years after its approval by the US Food and Drug Administration. Antivir Chem Chemother 27:2040206619829382 doi:10.1177/2040206619829382\u003c/li\u003e\n\u003cli\u003eMobach S et al. (2025) Disruption of constitutive CXCR4 oligomers impairs oncogenic properties in lymphoid neoplasms. Proc Natl Acad Sci U S A 122(24):e2424186122 doi:10.1073/pnas.2424186122\u003c/li\u003e\n\u003cli\u003eNengroo MA et al. (2021) CXCR4 intracellular protein promotes drug resistance and tumorigenic potential by inversely regulating the expression of Death Receptor 5. Cell Death Dis 12(5):464 doi:10.1038/s41419-021-03730-8\u003c/li\u003e\n\u003cli\u003eGomez-Mouton C et al. (2015) Filamin A interaction with the CXCR4 third intracellular loop regulates endocytosis and signaling of WT and WHIM-like receptors. Blood 125(7):1116-1125 doi:10.1182/blood-2014-09-601807\u003c/li\u003e\n\u003cli\u003eLi H et al. (2016) RTN3 Regulates the Expression Level of Chemokine Receptor CXCR4 and is Required for Migration of Primordial Germ Cells. Int J Mol Sci 17(4):382 doi:10.3390/ijms17040382\u003c/li\u003e\n\u003cli\u003eLee JT et al. (2009) Over-expression of Reticulon 3 (RTN3) enhances TRAIL-mediated apoptosis via up-regulation of death receptor 5 (DR5) and down-regulation of c-FLIP. Cancer Lett 279(2):185-192 doi:10.1016/j.canlet.2009.01.035\u003c/li\u003e\n\u003cli\u003ePasquale EB (2024) Eph receptors and ephrins in cancer progression. Nat Rev Cancer 24(1):5-27 doi:10.1038/s41568-023-00634-x\u003c/li\u003e\n\u003cli\u003eLu Q, Sun EE, Klein RS and Flanagan JG (2001) Ephrin-B reverse signaling is mediated by a novel PDZ-RGS protein and selectively inhibits G protein-coupled chemoattraction. Cell 105(1):69-79 doi:10.1016/s0092-8674(01)00297-5\u003c/li\u003e\n\u003cli\u003eMeyrath M et al. (2021) Proadrenomedullin N-Terminal 20 Peptides (PAMPs) Are Agonists of the Chemokine Scavenger Receptor ACKR3/CXCR7. ACS Pharmacol Transl Sci 4(2):813-823 doi:10.1021/acsptsci.1c00006\u003c/li\u003e\n\u003cli\u003eKumar R et al. (2023) Reduced G protein signaling despite impaired internalization and beta-arrestin recruitment in patients carrying a CXCR4Leu317fsX3 mutation causing WHIM syndrome. JCI Insight 8(5) doi:10.1172/jci.insight.145688\u003c/li\u003e\n\u003cli\u003ePalmer CB et al. (2022) Nanoluciferase-based complementation assay for systematic profiling of GPCR-GRK interactions. Methods Cell Biol 169:309-321 doi:10.1016/bs.mcb.2022.04.001\u003c/li\u003e\n\u003cli\u003eLuis R et al. (2022) Nanoluciferase-based methods to monitor activation, modulation and trafficking of atypical chemokine receptors. Methods Cell Biol 169:279-294 doi:10.1016/bs.mcb.2022.03.002\u003c/li\u003e\n\u003cli\u003eCox J et al. (2011) Andromeda: a peptide search engine integrated into the MaxQuant environment. J Proteome Res 10(4):1794-1805 doi:10.1021/pr101065j\u003c/li\u003e\n\u003cli\u003eNamkung Y et al. (2016) Monitoring G protein-coupled receptor and beta-arrestin trafficking in live cells using enhanced bystander BRET. Nat Commun 7:12178 doi:10.1038/ncomms12178\u003c/li\u003e\n\u003cli\u003eMueller W et al. (2013) Hierarchical organization of multi-site phosphorylation at the CXCR4 C terminus. PLoS One 8(5):e64975 doi:10.1371/journal.pone.0064975\u003c/li\u003e\n\u003cli\u003eHolm NT et al. (2007) Elevated levels of chemokine receptor CXCR4 in HER-2 negative breast cancer specimens predict recurrence. J Surg Res 141(1):53-59 doi:10.1016/j.jss.2007.03.015\u003c/li\u003e\n\u003cli\u003eKonoplev S et al. (2007) Overexpression of CXCR4 predicts adverse overall and event-free survival in patients with unmutated FLT3 acute myeloid leukemia with normal karyotype. Cancer 109(6):1152-1156 doi:10.1002/cncr.22510\u003c/li\u003e\n\u003cli\u003eMcKinney N et al. (2015) EphrinB1 expression is dysregulated and promotes oncogenic signaling in medulloblastoma. J Neurooncol 121(1):109-118 doi:10.1007/s11060-014-1618-8\u003c/li\u003e\n\u003cli\u003eBockaert J, Marin P, Dumuis A and Fagni L (2003) The \u0026apos;magic tail\u0026apos; of G protein-coupled receptors: an anchorage for functional protein networks. FEBS Lett 546(1):65-72 doi:10.1016/s0014-5793(03)00453-8\u003c/li\u003e\n\u003cli\u003eLagane B et al. (2008) CXCR4 dimerization and beta-arrestin-mediated signaling account for the enhanced chemotaxis to CXCL12 in WHIM syndrome. Blood 112(1):34-44 doi:10.1182/blood-2007-07-102103\u003c/li\u003e\n\u003cli\u003eFumagalli A et al. (2020) The atypical chemokine receptor 3 interacts with Connexin 43 inhibiting astrocytic gap junctional intercellular communication. Nat Commun 11(1):4855 doi:10.1038/s41467-020-18634-y\u003c/li\u003e\n\u003cli\u003eLevoye A et al. (2009) CXCR7 heterodimerizes with CXCR4 and regulates CXCL12-mediated G protein signaling. Blood 113(24):6085-6093 doi:10.1182/blood-2008-12-196618\u003c/li\u003e\n\u003cli\u003eFumagalli A et al. (2019) CXCR4/ACKR3 Phosphorylation and Recruitment of Interacting Proteins: Key Mechanisms Regulating Their Functional Status. Mol Pharmacol 96(6):794-808 doi:10.1124/mol.118.115360\u003c/li\u003e\n\u003cli\u003eGustavsson M et al. (2017) Structural basis of ligand interaction with atypical chemokine receptor 3. Nat Commun 8:14135 doi:10.1038/ncomms14135\u003c/li\u003e\n\u003cli\u003eZhuo Y, Crecelius JM and Marchese A (2022) G protein-coupled receptor kinase phosphorylation of distal C-tail sites specifies betaarrestin1-mediated signaling by chemokine receptor CXCR4. J Biol Chem 298(9):102351 doi:10.1016/j.jbc.2022.102351\u003c/li\u003e\n\u003cli\u003eCheng ZJ et al. (2000) beta-arrestin differentially regulates the chemokine receptor CXCR4-mediated signaling and receptor internalization, and this implicates multiple interaction sites between beta-arrestin and CXCR4. J Biol Chem 275(4):2479-2485 doi:10.1074/jbc.275.4.2479\u003c/li\u003e\n\u003cli\u003eRobleto VL et al. (2024) SNX9 family mediates betaarrestin-independent GPCR endocytosis. Commun Biol 7(1):1455 doi:10.1038/s42003-024-07157-7\u003c/li\u003e\n\u003cli\u003eBusillo JM and Benovic JL (2007) Regulation of CXCR4 signaling. Biochim Biophys Acta 1768(4):952-963 doi:10.1016/j.bbamem.2006.11.002\u003c/li\u003e\n\u003cli\u003eCassier E et al. (2017) Phosphorylation of beta-arrestin2 at Thr(383) by MEK underlies beta-arrestin-dependent activation of Erk1/2 by GPCRs. Elife 6 doi:10.7554/eLife.23777\u003c/li\u003e\n\u003cli\u003eGardner J et al. (2024) GPCR kinases differentially modulate biased signaling downstream of CXCR3 depending on their subcellular localization. Sci Signal 17(823):eadd9139 doi:10.1126/scisignal.add9139\u003c/li\u003e\n\u003cli\u003eTouhara K et al. (1994) Binding of G protein beta gamma-subunits to pleckstrin homology domains. J Biol Chem 269(14):10217-10220 \u003c/li\u003e\n\u003cli\u003eJiang X, Benovic JL and Wedegaertner PB (2007) Plasma membrane and nuclear localization of G protein coupled receptor kinase 6A. Mol Biol Cell 18(8):2960-2969 doi:10.1091/mbc.e07-01-0013\u003c/li\u003e\n\u003cli\u003ePfersdorf F, Romanazzi L, Rosenkilde MM and Gustavsson M (2025) Regulation of the chemokine receptors CXCR4 and ACKR3 by receptor activity-modifying proteins. J Biol Chem 301(1):108055 doi:10.1016/j.jbc.2024.108055\u003c/li\u003e\n\u003cli\u003eBoyd AW, Bartlett PF and Lackmann M (2014) Therapeutic targeting of EPH receptors and their ligands. Nat Rev Drug Discov 13(1):39-62 doi:10.1038/nrd4175\u003c/li\u003e\n\u003cli\u003eNeves M, Marolda V, Mayor F, Jr. and Penela P (2022) Crosstalk between CXCR4/ACKR3 and EGFR Signaling in Breast Cancer Cells. Int J Mol Sci 23(19) doi:10.3390/ijms231911887\u003c/li\u003e\n\u003cli\u003ePerez-Riverol Y et al. (2019) The PRIDE database and related tools and resources in 2019: improving support for quantification data. Nucleic Acids Res 47(D1):D442-D450 doi:10.1093/nar/gky1106\u003c/li\u003e\n\u003cli\u003eFarzan M et al. (2002) The role of post-translational modifications of the CXCR4 amino terminus in stromal-derived factor 1 alpha association and HIV-1 entry. J Biol Chem 277(33):29484-29489 doi:10.1074/jbc.M203361200\u003c/li\u003e\n\u003cli\u003eChabot DJ, Chen H, Dimitrov DS and Broder CC (2000) N-linked glycosylation of CXCR4 masks coreceptor function for CCR5-dependent human immunodeficiency virus type 1 isolates. J Virol 74(9):4404-4413 doi:10.1128/jvi.74.9.4404-4413.2000\u003c/li\u003e\n\u003cli\u003eBhandari D, Robia SL and Marchese A (2009) The E3 ubiquitin ligase atrophin interacting protein 4 binds directly to the chemokine receptor CXCR4 via a novel WW domain-mediated interaction. Mol Biol Cell 20(5):1324-1339 doi:10.1091/mbc.e08-03-0308\u003c/li\u003e\n\u003cli\u003eLuo J, Busillo JM, Stumm R and Benovic JL (2017) G Protein-Coupled Receptor Kinase 3 and Protein Kinase C Phosphorylate the Distal C-Terminal Tail of the Chemokine Receptor CXCR4 and Mediate Recruitment of beta-Arrestin. Mol Pharmacol 91(6):554-566 doi:10.1124/mol.116.106468\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"cellular-and-molecular-life-sciences","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"life","sideBox":"Learn more about [Cellular and Molecular Life Sciences](https://link.springer.com/journal/18)","snPcode":"18","submissionUrl":"https://www.editorialmanager.com/life/default2.aspx","title":"Cellular and Molecular Life Sciences","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Open","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"G protein-coupled receptor, chemokine, signal transduction, interactome, Ephrin, cancer","lastPublishedDoi":"10.21203/rs.3.rs-7145754/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7145754/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eChemokine receptor 4 (CXCR4) is a member of the chemokine receptor family, exclusively activated by the chemokine CXCL12. While CXCR4 regulates numerous physiological processes associated with cell migration and embryogenesis, its overexpression has been involved in various cancer types. Studies suggest that intracellular CXCR4 rather than CXCL12-induced signaling at the plasma membrane contributes to its pro-tumorigenic functions. Given the role of GPCR-interacting proteins in their trafficking and subcellular localization, we characterized the CXCR4 interactome using an affinity purification coupled to mass spectrometry (AP-MS) strategy. The most abundant protein identified in the CXCR4 interactome is Ephrin B1, a member of the Ephrin protein family that shares several functions with CXCR4, such as the regulation of cell migration and proliferation. Further studies showed that the interaction between CXCR4 and Ephrin B1 is direct and enhanced upon CXCR4 activation by CXCL12. They also indicated that Ephrin B1 prevents CXCR4 N-glycosylation, decreases CXCR4 cell surface expression, and consistently inhibits CXCL12-induced CXCR4 coupling to G\u003csub\u003eαi1\u0026minus;3\u003c/sub\u003e and recruitment of β-arrestins 1 and 2. Conversely, Ephrin B1 signals to Erk1/2 through CXCR4 activation and mediates the decrease in Death Receptor 5 expression elicited by intracellular CXCR4. Collectively, these findings identify Ephrin B1 as a potential mediator of CXCR4-driven tumorigenic signaling.\u003c/p\u003e","manuscriptTitle":"Physical interaction with Ephrin B1 promotes CXCR4 intracellular localization and oncogenic potential","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-08-25 11:58:15","doi":"10.21203/rs.3.rs-7145754/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major Revision","date":"2025-12-27T16:33:13+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"","date":"2025-12-03T21:50:29+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-08-16T01:40:20+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-07-18T05:17:05+00:00","index":"","fulltext":""},{"type":"submitted","content":"Cellular and Molecular Life Sciences","date":"2025-07-17T02:59:33+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"cellular-and-molecular-life-sciences","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"life","sideBox":"Learn more about [Cellular and Molecular Life Sciences](https://link.springer.com/journal/18)","snPcode":"18","submissionUrl":"https://www.editorialmanager.com/life/default2.aspx","title":"Cellular and Molecular Life Sciences","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Open","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"e36a61e6-ce68-4e65-bc0e-703acb656dcc","owner":[],"postedDate":"August 25th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-04-10T09:50:51+00:00","versionOfRecord":[],"versionCreatedAt":"2025-08-25 11:58:15","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7145754","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7145754","identity":"rs-7145754","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}