Hypomorphic Lig4 gene mutation in mice predisposes to Th1-skewing intestinal inflammation

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

Dysregulation of DNA double-strand break (DSB) repair leads to adaptive immunodeficiency, whereas the remaining lymphocytes are aberrantly activated and provoke inflammations. However, no model mice were available to consistently manifest inflammation under defective DSB repair. We generated mutant mice carrying a missense mutation p.W447C in the gene encoding DNA ligase IV (LIG4), critical for DSB repair. Lig4 W447C/W447C mice showed growth retardation and severe intestinal inflammations under adaptive immunodeficiency. The inflammations were featured by marked infiltration of T helper type 1 (Th1) cells and macrophages and was dependent on lymphocytes. When Ifng was deleted, Th2 and Th17 instead of Th1 cells drove the inflammations. Lig4 W447C/W447C mice showed expansion of oligoclonal T cells with T cell receptor α repertoire skewed towards more proximal 3’ V and 5’ J gene segments. Thus, our novel hypomorphic Lig4 mutant mice show that defective DSB repair leads to Th1-dependent intestinal inflammations under severe adaptive immunodeficiency.
Full text 94,470 characters · extracted from preprint-html · click to expand
Hypomorphic Lig4 gene mutation in mice predisposes to Th1-skewing intestinal inflammation | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Hypomorphic Lig4 gene mutation in mice predisposes to Th1-skewing intestinal inflammation Yusuke Yamashita , Hideki Kosako , Takashi Kato , Izumi Sasaki , Sadahiro Iwabuchi , Tadashi Okamura , Misato Tane , Shotaro Tabata , Kazutaka Nakashima , Ken Tanaka , Kazunori Shiraishi , Yuki Uchihara , Daisuke Okuzaki , Atsushi Shibata , Tsunehiro Mizushima , Hiroaki Hemmi , Nobuo Kanazawa , Seiji Kodama , Kouichi Ohshima , Shinichi Hashimoto , Yoshio Fujitani , Takashi Sonoki , View ORCID Profile Shinobu Tamura , Tsuneyasu Kaisho doi: https://doi.org/10.1101/2025.05.14.654009 Yusuke Yamashita 1 Department of Hematology/Oncology, Wakayama Medical University , Wakayama, Japan. MD, PhD Find this author on Google Scholar Find this author on PubMed Search for this author on this site Hideki Kosako 1 Department of Hematology/Oncology, Wakayama Medical University , Wakayama, Japan. MD, PhD Find this author on Google Scholar Find this author on PubMed Search for this author on this site Takashi Kato 2 Department of Immunology, Institute of Advanced Medicine, Wakayama Medical University , Wakayama, Japan 3 Department of Rheumatology and Clinical Immunology, Wakayama Medical University , Wakayama, Japan MD, PhD Find this author on Google Scholar Find this author on PubMed Search for this author on this site Izumi Sasaki 2 Department of Immunology, Institute of Advanced Medicine, Wakayama Medical University , Wakayama, Japan PhD Find this author on Google Scholar Find this author on PubMed Search for this author on this site Sadahiro Iwabuchi 4 Department of Molecular Pathophysiology, Institute of Advanced Medicine, Wakayama Medical University , Wakayama, Japan PhD Find this author on Google Scholar Find this author on PubMed Search for this author on this site Tadashi Okamura 1 Department of Hematology/Oncology, Wakayama Medical University , Wakayama, Japan. MD Find this author on Google Scholar Find this author on PubMed Search for this author on this site Misato Tane 1 Department of Hematology/Oncology, Wakayama Medical University , Wakayama, Japan. MD Find this author on Google Scholar Find this author on PubMed Search for this author on this site Shotaro Tabata 1 Department of Hematology/Oncology, Wakayama Medical University , Wakayama, Japan. MD Find this author on Google Scholar Find this author on PubMed Search for this author on this site Kazutaka Nakashima 5 Department of Pathology, Kurume University School of Medicine , Fukuoka, Japan MD, PhD Find this author on Google Scholar Find this author on PubMed Search for this author on this site Ken Tanaka 1 Department of Hematology/Oncology, Wakayama Medical University , Wakayama, Japan. 5 Department of Pathology, Kurume University School of Medicine , Fukuoka, Japan MD Find this author on Google Scholar Find this author on PubMed Search for this author on this site Kazunori Shiraishi 6 Laboratory of Radiation Biology, Department of Biological Chemistry, Graduate School of Science, Osaka Metropolitan University , Osaka, Japan PhD Find this author on Google Scholar Find this author on PubMed Search for this author on this site Yuki Uchihara 7 Division of Molecular Oncological Pharmacy, Faculty of Pharmacy, Keio University , Tokyo, Japan PhD Find this author on Google Scholar Find this author on PubMed Search for this author on this site Daisuke Okuzaki 8 Laboratory of Human Immunology (Single Cell Genomics), WPI Immunology Frontier Research Center, University of Osaka , Osaka, Japan , Osaka, Japan PhD Find this author on Google Scholar Find this author on PubMed Search for this author on this site Atsushi Shibata 7 Division of Molecular Oncological Pharmacy, Faculty of Pharmacy, Keio University , Tokyo, Japan PhD Find this author on Google Scholar Find this author on PubMed Search for this author on this site Tsunehiro Mizushima 9 Graduate School of Science, University of Hyogo , Hyogo, Japan PhD Find this author on Google Scholar Find this author on PubMed Search for this author on this site Hiroaki Hemmi 2 Department of Immunology, Institute of Advanced Medicine, Wakayama Medical University , Wakayama, Japan 10 Laboratory of Immunology, Faculty of Veterinary Medicine, Okayama University of Science , Ehime, Japan PhD Find this author on Google Scholar Find this author on PubMed Search for this author on this site Nobuo Kanazawa 11 Department of Dermatology, Hyogo Medical University , Hyogo, Japan MD, PhD Find this author on Google Scholar Find this author on PubMed Search for this author on this site Seiji Kodama 6 Laboratory of Radiation Biology, Department of Biological Chemistry, Graduate School of Science, Osaka Metropolitan University , Osaka, Japan PhD Find this author on Google Scholar Find this author on PubMed Search for this author on this site Kouichi Ohshima 5 Department of Pathology, Kurume University School of Medicine , Fukuoka, Japan MD, PhD Find this author on Google Scholar Find this author on PubMed Search for this author on this site Shinichi Hashimoto 4 Department of Molecular Pathophysiology, Institute of Advanced Medicine, Wakayama Medical University , Wakayama, Japan PhD Find this author on Google Scholar Find this author on PubMed Search for this author on this site Yoshio Fujitani 12 Laboratory of Developmental Biology & Metabolism, Institute for Molecular & Cellular Regulation, Gunma University , Gunma, Japan MD, PhD Find this author on Google Scholar Find this author on PubMed Search for this author on this site Takashi Sonoki 1 Department of Hematology/Oncology, Wakayama Medical University , Wakayama, Japan. MD, PhD Find this author on Google Scholar Find this author on PubMed Search for this author on this site Shinobu Tamura 1 Department of Hematology/Oncology, Wakayama Medical University , Wakayama, Japan. 13 First Department of Internal Medicine, Wakayama Medical University , Wakayama, Japan MD, PhD Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Shinobu Tamura For correspondence: stamura{at}wakayama-med.ac.jp tkaisho{at}wakayama-med.ac.jp Tsuneyasu Kaisho 2 Department of Immunology, Institute of Advanced Medicine, Wakayama Medical University , Wakayama, Japan MD, PhD Find this author on Google Scholar Find this author on PubMed Search for this author on this site For correspondence: stamura{at}wakayama-med.ac.jp tkaisho{at}wakayama-med.ac.jp Abstract Full Text Info/History Metrics Supplementary material Preview PDF Abstract Dysregulation of DNA double-strand break (DSB) repair leads to adaptive immunodeficiency, whereas the remaining lymphocytes are aberrantly activated and provoke inflammations. However, no model mice were available to consistently manifest inflammation under defective DSB repair. We generated mutant mice carrying a missense mutation p.W447C in the gene encoding DNA ligase IV (LIG4), critical for DSB repair. Lig4 W447C/W447C mice showed growth retardation and severe intestinal inflammations under adaptive immunodeficiency. The inflammations were featured by marked infiltration of T helper type 1 (Th1) cells and macrophages and was dependent on lymphocytes. When Ifng was deleted, Th2 and Th17 instead of Th1 cells drove the inflammations. Lig4 W447C/W447C mice showed expansion of oligoclonal T cells with T cell receptor α repertoire skewed towards more proximal 3’ V and 5’ J gene segments. Thus, our novel hypomorphic Lig4 mutant mice show that defective DSB repair leads to Th1-dependent intestinal inflammations under severe adaptive immunodeficiency. Introduction In mammals, DNAs are damaged to generate DNA double-strand breaks (DSBs) not only upon exposure to ionizing radiation or ultraviolet, but also in the physiological development of nervous and immune systems. Non-homologous end joining (NHEJ) is a critical pathway to repair the DSBs 1 , 2 , 3 . In lymphocytes, NHEJ is indispensable for productive V(D)J recombination of T cell receptor (TCR) and immunoglobulin (Ig) genes. NHEJ is mediated by a series of reactions, in which there is involvement of DNA-dependent protein kinase catalytic subunit (DNA-PKcs), the KU70/80 heterodimer, Artemis, Cernunnos (also known as Xrcc4-like factor, XLF), DNA ligase IV (LIGIV), and X-ray repair cross-complementing protein 4 (XRCC4) 1 , 2 , 3 . In humans, defects in any of these components can lead to profound acquired immunodeficiency by impairment of the V(D)J recombination, increased radiosensitivity and neurodevelopmental delay 4 . LIGIV binds to DSB ends and acts as the ligase with XRCC4 in the final end-joining step of NHEJ 5 , 6 . Hypomorphic variants in the human LIG4 gene underlie LIG4 syndrome, a rare autosomal recessive disorder characterized by growth disturbance, neurodevelopmental delay, increased radiosensitivity, and adaptive immunodeficiency 5 , 6 , 7 . Patients with LIG4 syndrome have also shown a predisposition to malignancies including leukemia and lymphoma 8 , 9 , 10 , 11 . Paradoxically, because of dysregulated activation of adaptive immunity, they occasionally exhibit inflammatory disorders such as inflammatory bowel disease and Bechet diseases 12 , 13 , 14 . Although LIG4 syndrome exhibits phenotypic heterogeneity, little is known about how the variants of the human LIG4 gene contribute to diverse manifestations such as inflammatory conditions. In mice, Lig4 deficiency causes embryonic lethality due to impaired neuronal development 15 , 16 . Two kinds of mutant mice carrying a hypomorphic Lig4 variant in the enzymatic domain have been generated to date, and homozygous mutant mice showed neurodevelopmental delay from birth as well as adaptive immunodeficiency 17 , 18 , 19 , 20 , 21 . In mice homozygous for a Lig4 R278H mutation ( Lig4 R278H/R278H mice) derived from a patient with LIG4 syndrome, thymic T-cell lymphoma was observed at high frequencies 19 . Moreover, Lig4 Y288C/Y288C mice, which were generated by N -ethyl- N -nitrosourea (ENU), also exhibited a high incidence of lymphoid neoplasms that originate from the thymus 20 . LIG4 syndrome manifestations were thus well recapitulated in the mutant mice. However, none of these mutant mice show any apparent signs of inflammation. We have previously described a patient with LIG4 syndrome that was carrying a compound heterozygous variant in the LIG4 gene. One variant was a nonsense variant, p.E413X, the other one was a missense variant, p.W447C, found in the well-conserved amino acid among species 22 . In the current study, we generated mutant mice carrying this missense variant. Lig4 W447C/W447C mice manifested not only neuronal and developmental defects, but also lymphocyte-dependent colitis with acquired immunodeficiency. The colitis was featured by infiltration of type 1 helper T (Th1) cells and macrophages and lack of B cells. Lig4 W447C/W447C mice are unique immunodeficient mice manifesting Th1 cell-driven inflammatory disorders. Results Lig4 W447C/W447C mice showed microcephaly, growth retardation, and radiosensitivity To clarify the pathological roles of a missense variant (p.W447C), we introduced the variant in mice by the CRISPR-Cas9 system. Lig4 W447C/+ mice were born and appeared healthy. After crossing between Lig4 W447C/+ mice, Lig4 W447C/W447C mice were born with expected Mendelian inheritance but showed short stature and low birth weight (Extended Data Fig. 1a) . The mice also exhibited growth retardation and microcephaly ( Fig. 1a ) . These manifestations are hallmarks of the LIG4 syndrome 5 , 6 , 7 . We have then investigated DSBs by γH2AX foci formation in mouse embryonic fibroblasts (MEFs). The formation was comparable between Lig4 +/+ and Lig4 W447C/+ MEFs. In Lig4 W447C/W447C MEFs, more γH2AX foci was detected not only before, but also upon irradiation than in Lig4 W447C/+ MEFs ( Fig. 1b and Extended Data Fig. 1b) . Thus, Lig4 W447C/W447C mice showed growth retardation, microcephaly, and defects in DNA damage repair. Download figure Open in new tab Figure 1. Lig4 W447C/W447C mice displayed typical LIG4 syndrome features. (a) The appearance and brain of six-week-old Lig4 +/+ and Lig4 W447C/W447C littermates. The graph (right) depicts the weight of six-week-old female mice ( Lig4 +/+ [ n = 6], Lig4 +/W447C [ n = 13] and Lig4 W447C/W447C [ n = 6]). P -values were calculated using one-way analysis of variance (ANOVA) followed by Tukey’s post hoc multiple comparison test. (b) Immunofluorescence of γH2AX foci in the nuclei of Lig4 +/W447C and Lig4 W447C/W447C mouse embryonic fibroblasts (MEFs) at each representative time after 1 Gy irradiation. (c) Western blots of LIGIV, XRCC4, XLF and β-actin protein expressions on Lig4 +/+ and Lig4 W447C/W447C MEFs. Numbers below the representative bands indicate the ratio of signal intensity relative to Lig4 +/+ after normalization to β-actin, as measured using Image J software. (d) Mouse LIGIV protein structures in wild-type and W447C-mutant mice (left panel). The overall LIG IV protein structure, with DNA-binding and enzymatic domains (residues 1–620), is depicted as a ribbon model (right panel). W447 and C447 binding to adenosine monophosphate (AMP) are shown in stick representation (cyan and green, respectively). (e) Structural comparison between W447 (left panel, cyan) and C447 (right panel, green). AlphaFold3-predicted side chains related to AMP-binding are substantially different between them. Consequently, W447C lead to the enlargement of AMP-binding pocket (dotted red circle in right panel), suggesting the destabilization of AMP-binding site during DNA repair processes (black region). The data are presented as the mean ± SEM. Expression of LIGIV protein in Lig4 W447C/W447C MEFs was at comparable levels to that in wild-type MEFs, indicating that the mutation does not affect the amounts of LIGIV protein ( Fig. 1c ) . In addition, the expression levels of XRCC4 and XLF, which assist LIGIV in its DNA repair function, were also unchanged between Lig4 W447C/W447C and wild-type MEFs ( Fig. 1c ) . We therefore performed in silico analysis on wild-type and W447C mutant of LIGIV. W447 was localized in face to adenosine monophosphate (AMP) in the enzymatic domain. The W447C mutant did not affect overall structures, but it resulted in a decrease of the AMP-binding interface area (wild-type 2.66 Å 2 , W447C mutant 1.98 Å 2 ) and enlargement of the AMP-binding pocket mainly due to lack of an indole ring ( Fig. 1d, e ) 23 . We also analyzed the R278H and Y288C mutants of LIGIV (Extended Data Fig. 2a, b) , but neither mutant altered overall structures of LIGIV. Y288 did not face to AMP, while R278 was in contact with AMP and the R278H mutant decreased the interface area (wild-type 27.84 Å 2 , W447C mutant 18.46 Å 2 ), but did not significantly affect the structure of the AMP-binding pocket. Lig4 W447C/W447C mice exhibited severe adaptive immunodeficiency We then analyzed the phenotype of lymphocytes in Lig4 +/+ and Lig4 W447C/W447C mice. Lig4 W447C/W447C mice had half the number of bone marrow (BM) cells of Lig4 +/+ mice ( Fig. 2a, b ) . In the BM of Lig4 W447C/W447C mice, B220 + CD43 + IgM − pro-B cells were decreased and there was marked reduction in B220 + CD43 − IgM − pre-B cells, B220 low CD43 − IgM + immature B cells and B220 high CD43 − IgM + mature B cells ( Fig. 2c, d ) . Meanwhile, the proportion of pro-B cells among B220 + cells was significantly increased, indicating incomplete block at the pro-B cell stage, which was consistent with impaired rearrangement of the IgH locus ( Fig. 2d ) . In the spleens of Lig4 W447C/W447C mice, follicular formation was severely impaired and the numbers of splenocytes and B220+ cells were severely decreased. ( Fig. 2e-h ) . Furthermore, in Lig4 W447C/W447C mice, serum IgM, IgG1, and IgA levels were severely decreased ( Fig. 2i ) . Notably, serum IgE levels remained low, in similar to Lig4 +/+ mice ( Fig. 2i ) . In addition, the serum levels of anti-dsDNA antibody in Lig4 W447C/W447C mice were lower than those of Lig4 +/+ mice (Extended Data Fig. 3). Thus, B cell generation was defective in Lig 4W447C/W447C mice. Download figure Open in new tab Download figure Open in new tab Figure 2. B– and T-cell differentiation was impaired in Lig4 W447C/W447C mice. (a) Hematoxylin and eosin (H&E) staining revealed hypocellular marrow in bone marrow of Lig4 W447C/W447C mouse compared with those of Lig4 W447C/W447C mouse. Scale bar represents 60 μm. (b) The number of bone marrow (BM) cells in Lig4 W447C/W447C mice was significantly lower than in Lig4 +/+ mice ( Lig4 +/+ [ n = 7] and in Lig4 W447C/W447C mice [ n = 7]; 7–23 weeks). (c) Dot plot analysis of BM cells labeled with B220, IgM, and CD43 antibodies. (d) The number and percentage of B cells in BM in Lig4 +/+ and Lig4 W447C/W447C mice (mean ± standard error of the mean [SEM], Lig4 +/+ [ n = 5] and Lig4 W447C/W447C [ n = 5]; 8–30 weeks) (e) H&E staining of spleen from Lig4 +/+ and Lig4 W447C/W447C mice. Scale bar represents 300 μm. (f) The graph depicts the number of splenocytes in Lig4 +/+ and Lig4 W447C/W447C mice ( Lig4 +/+ [ n = 15] and Lig4 W447C/W447C [ n = 15]; 7–20 weeks). (g) Fluorescence-activated cell sorting (FACS) analysis of splenocytes labeled with CD3 and B220 antibodies from Lig4 +/+ and Lig4 W447C/W447C mice. (h) The graphs depict the absolute number and percentage of B220+ splenocytes analyzed by FACS in Lig4 +/+ and Lig4 W447C/W447C mice ( Lig4 +/+ [n = 8] and Lig4 W447C/W447C [n = 8]; 7–20 weeks). (i) Serum immunoglobulin (IgM, IgG1, IgA, and IgE) levels in Lig4 +/+ and Lig4 W447C/W447C mice ( Lig4 +/+ [ n = 6] and Lig4 W447C/W447C [ n = 6]; 9–12 weeks). (j) Thymic hypoplasia in a six-week-old Lig4 W447C/W447C mouse. The graph (below) depicts the number of thymocytes in Lig4 +/+ and Lig4 W447C/W447C mice ( Lig4 +/+ [ n = 7] and Lig4 W447C/W447C [ n = 7]; 8–23 weeks). (k) H&E staining of thymus from Lig4 +/+ and Lig4 W447C/W447C mice. Scale bar represents 300 μm. (l) FACS analysis of thymocytes labeled with CD3, CD4, and CD8 antibodies from Lig4 +/+ and Lig4 W447C/W447C mice. (m) The numbers dynamics of thymic T cells at various developmental stages, including double negative, double positive, and single positive (SP) in Lig4 +/+ and Lig4 W447C/W447C mice ( Lig4 +/+ [n = 4] and Lig4 W447C/W447C [n = 4]; 7–16 weeks). (n) The graph depicts the number and percentage of CD3+ splenocytes in Lig4 +/+ and Lig4 W447C/W447C mice ( Lig4 +/+ [ n = 7] and Lig4 W447C/W447C [ n = 7]; 8–11 weeks). (o) FACS analysis of splenocytes labeled with CD3, CD4 and CD8 antibodies from Lig4 +/+ and Lig4 W447C/W447C mice. (p) The absolute number of CD4+ and CD8+ splenocytes in Lig4 +/+ and Lig4 W447C/W447C mice ( Lig4 +/+ [ n = 7] and Lig4 W447C/W447C [ n = 7]; 8–32 weeks). (q) The graph depicts the CD4/CD8 ratio of CD3+ spleen T cells in Lig4 +/+ mice versus Lig4 W447C/W447C mice ( Lig4 +/+ [ n = 7] and Lig4 W447C/W447C [ n = 7]; 8–32 weeks). (r) FACS analysis of CD44 and CD62L expression in CD4 + or CD8 + T cells from the spleens of Lig4 +/+ and Lig4 W447C/W447C mice. (s) T-cell subsets, naive, central memory (CMT), and effector memory (EMT) percentages in the spleens of Lig4 +/+ and Lig4 W447C/W447C mice ( Lig4 +/+ [ n = 5] and Lig4 W447C/W447C [ n = 5]; 9–10 weeks). The data are presented as the mean ± SEM. In Lig4 W447C/W447C mice, the thymus was very small ( Fig. 2j ) and histological analysis showed unclear corticomedullary boundary ( Fig. 2k ) . The proportion of CD3 + cells in thymocytes of Lig4 W447C/W447C mice were severely decreased compared with those of Lig4 +/+ mice (1.7% vs. 19%) ( Fig. 2l ) . Furthermore, there were very few T lineage cells, such as double-negative (DN) CD4 − CD8 − , double-positive (DP) CD4 + CD8 + , and single-positive (SP) CD4 + or CD8 + thymocytes ( Fig. 2m ) . The percentages of DN thymocytes in the Lig4 W447C/W447C mice were increased, whereas those of DP and SP CD4 + thymocytes were decreased ( Fig. 2l and Extended Data Fig. 4a) . In the spleen, CD3 + CD4 + and CD3 + CD8 + T cells were severely decreased in Lig4 W447C/W447C mice ( Fig. 2g, n -p) . Notably, CD4/CD8 ratio was higher in Lig4 W447C/W447C mice than in Lig4 +/+ mice ( Fig. 2q ). The majority of CD4 + and CD8 + T cells remaining in the mutant mice were effector memory T cells (CD44 high CD62L low ) and naive T cells (CD44 low CD62 high ) were hardly detected ( Fig. 2r, s ) . Concerning splenic Foxp3 + regulatory T cells (Tregs) in CD4 + T cells, the percentages were lower in Lig4 W447C/W447C than in Lig4 +/+ mice (Extended Data Fig. 4b, c) . Taken together, Lig4 W447C/W447C mice showed severe defects in both B and T cell generation, i.e. severe adaptive immunodeficiency. Lig4 W447C/W447C mice develop severe intestinal inflammation After weaning, Lig4 W447C/W447C mice exhibited varying degrees of wasting, diarrhea, and rectal prolapse and showed higher mortality than Lig4 +/+ and Lig4 W447C/+ mice when housed in specific pathogen-free conditions. Kaplan-Meier analysis revealed that Lig4 W447C/W447C mice had a median overall survival of 92 days ( Fig. 3a ) . In the macro-anatomical study, marked edema and shortening of the large intestine were found in almost all Lig4 W447C/W447C mice around 10 weeks of age ( Fig. 3b ) . Histological examination of the large intestines revealed epithelial hyperplasia, goblet cell disappearance, and infiltration of inflammatory cells in the lamina propria and submucosa in Lig4 W447C/W447C mice ( Fig. 3c ). Mouse colitis histology index (MCHI) of the Lig4 W447C/W447C mice was significantly higher than that of Lig4 +/+ mice ( Fig 3d ) . Moreover, crypt abscesses, which are formed by active inflammation and are a hallmark of ulcerative colitis, were often present in the Lig4 W447C/W447C mice ( Fig. 3c , arrowheads) . Immunohistochemical analysis of the colons further showed that infiltrated cells in Lig4 W447C/W447C mice consisted mainly of T cells, especially CD4 + T cells, and F4/80 + macrophages ( Fig. 3e ). These pathological findings were also observed in the small intestines of Lig4 W447C/W447C mice (Extended Data Fig. 5a, b) . In Lig4 W447C/W447C mice, increased T cells were mainly TCRαβ + cells rather than TCRγδ + cells, although their ratio of CD4 to CD8 was similar to that of T cells in Lig4 +/+ mice (Extended Data Fig. 5c, d). Meanwhile, B220 + cells were hardly detected ( Fig. 3e and Extended Data Fig. 5a ). Lig4 W447C/W447C mice therefore showed severe inflammations in the small and large intestines with infiltration mainly of CD4+ T cells and macrophages into the mucosa and submucosa. We also analyzed the gut microbiota by fecal 16S rRNA gene sequencing. The composition of the gut microbiota was comparable between Lig4 +/+ and Lig4 W447C/W447C mice (Extended Data Fig. 6) . The results indicate that the cause of intestinal inflammations is unlikely due to the expansion of certain bacteria. Download figure Open in new tab Download figure Open in new tab Figure 3. Hematopoietic cells caused severe intestinal inflammation in Lig4 W447C/W447C mice. (a) Kaplan–Meier survival curves of Lig4 +/+ ( n = 13), Lig4 +/W447C ( n = 23), and Lig4 W447C/W447C ( n = 12) mice. Statistical analysis was performed using the log-rank test. (b) Macroscopic features of the Lig4 W447C/W447C mouse colon revealed an edematous, thickened, and shortened colon. (c) Representative H&E staining of colons from Lig4 +/+ and Lig4 W447C/W447C mice. White arrow indicates a crypt abscess. Scale bar represents 200 μm. (d) Mouse colitis histology index of Lig4 +/+ and Lig4 W447C/W447C mice ( Lig4 +/+ [ n = 15] and Lig4 W447C/W447C [ n = 15]; 7–13 weeks). (e) Immunohistochemistry of colons from Lig4 +/+ and Lig4 W447C/W447C mice with CD3, CD4, F4/80 and B220 antibodies. Scale bar represents 60 μm. (f) The scheme of BM transplantation experiment. BM cells from Lig4 +/+ or Lig4 W447C/W447C mice were transplanted into irradiated Rag2 −/− mice. (g) A shortened and edematous colon from a Lig4 +/+ → Rag2 −/− mouse and a Lig4 W447C/W447C → Rag2 −/− mouse. The graph (right) depicts the length of colons. ( Lig4 +/+ → Rag2 −/− [ n = 4] and Lig4 W447C/W447C → Rag2 −/− [ n = 5]). (h) H&E staining and immunohistochemistry with CD4, F4/80 and B220 antibodies of colons from a Lig4 +/+ → Rag2 −/− mouse and a Lig4 W447C/W447C → Rag2 −/− mouse. Scale bar represents 100 μm. (i) Mouse colitis histology index of Lig4 +/+ → Rag2 −/− and Lig4 W447C/W447C → Rag2 −/− mice. ( Lig4 +/+ → Rag2 −/− [ n = 5] and Lig4 W447C/W447C → Rag2 −/− [ n = 7]). (j) FACS analysis of CD19 and TCRβ expression in splenocytes from Lig4 +/+ Rag2 +/+ , Lig4 W447C/W447C Rag2 +/+ and Lig4 W447C/W447C Rag2 −/− mice. (k) The graph depicts the weight of female mice ( Lig4 +/+ Rag2 +/+ [ n = 3] and Lig4 W447C/W447C Rag2 −/− [ n = 4]; 14–16 weeks). (l) Kaplan–Meier survival curves of Lig4 +/+ Rag2 +/+ ( n =21), Lig4 W447C/W447C Rag2 +/+ ( n =13), and Lig4 W447C/W447C Rag2 −/− ( n =12) mice. Statistical analysis was performed using the log-rank test. (m) Representative H&E staining of colons from Lig4 W447C/W447C Rag2 +/+ and Lig4 W447C/W447C Rag2 −/− mice. Scale bar represents 200 μm. (n) Mouse colitis histology index of Lig4 W447C/W447C Rag2 +/+ and Lig4 W447C/W447C Rag2 −/− mice ( Lig4 W447C/W447C Rag2 +/+ [ n = 17] and Lig4 W447C/W447C Rag2 −/− [ n = 5]; 7– 18 weeks). The data are presented as the mean ± standard error of the mean (SEM). Intestinal inflammation in Lig4 W447C/W447C mice is dependent on lymphocytes Next, to determine whether hematopoietic cells were sufficient for the development of colitis in the Lig4 W447C/W447C mice, we generated BM chimeric mice, by transferring BM cells from Lig4 +/+ and Lig4 W447C/W447C mice into irradiated Rag2 −/− mice, which are hereafter referred as Lig4 +/+ → Rag2 −/− and Lig4 W447C/W447C → Rag2 −/− mice, respectively ( Fig. 3f ) . Compared with Lig4 +/+ → Rag2 −/− mice, Lig4 W447C/W447C → Rag2 −/− mice showed severe intestinal manifestations, including diarrhea, colonic shortness, and edema ( Fig. 3g ) . Furthermore, in the colons of Lig4 W447C/W447C → Rag2 −/− mice, CD4 + T cells and macrophages mainly infiltrated as observed in those of Lig4 W447C/W447C mice ( Fig. 3h, i ) . These results suggest that hematopoietic cells are responsible for the development of intestinal inflammations in Lig4 W447C/W447C mice. Meanwhile, Lig4 W447C/W447C mice were sensitive to and succumbed to irradiation. Therefore, we could not generate BM chimeric mice by using Lig4 W447C/W447C mice as recipients. Thus, we could not assess the roles of non-hematopoietic cells in intestinal inflammations in Lig4 W447C/W447C mice. To further investigate the involvement of lymphocytes in intestinal inflammations in the Lig4 W447C/W447C mice, Lig4 W447C/W447C Rag2 −/− mice were generated by crossing Lig4 W447C/W447C mice with Rag2 −/− mice. Splenic T cells were still detected in Lig4 W447C/W447C mice, but they were absent in Lig4 W447C/W447C Rag2 −/− mice ( Fig. 3j ) . The double mutant mice had growth disturbances and microcephaly but showed significantly longer survival than Lig4 W447C/W447C mice ( Fig. 3k, l ) . Notably, Lig4 W447C/W447C Rag2 −/− mice developed no signs of intestinal inflammations ( Fig. 3m, n ) . These results suggest that lymphocytes are required for the development of intestinal inflammations in Lig4 W447C/W447C mice. Expression of IFN-γ inducible genes were enhanced in the colon of Lig4 W447C/W447C mice To characterize intestinal inflammations in Lig4 W447C/W447C mice, RNA-sequence (RNA-Seq) analysis was performed on colonic tissues from Lig4 +/+ and Lig4 W447C/W447C mice. In total, 25,706 genes were differentially expressed between Lig4 +/+ and Lig4 W447C/W447C mice ( Supplementary Table 1 ). Expression of 2278 and 3728 genes was up– and down-regulated, respectively, more than 1.5-fold. Unbiased gene set enrichment analysis (GSEA) of these genes revealed up– and down-regulation of 24 and two gene sets, respectively (nominal p -value < 0.05, false discovery rate q-value < 0.25) ( Fig. 4b and Supplementary Table 2) . The most upregulated gene set was ‘interferon gamma response’ (normalized enrichment score=2.97; p -value < 0.001 ( Fig. 4a-c ) . Expression of 15 representative IFN-γ-inducible genes such as Ciita or Cxcl9 was more than five-fold higher in the colons of Lig4 W447C/W447C mice than in those of Lig4 +/+ mice ( Fig. 4a and Supplementary Table 1 ). Download figure Open in new tab Figure 4. Bulk RNA-sequencing analysis of the colon of Lig4 W447C/W447C mice. (a) Relative expression levels of the colon from eight 10-week-old mice ( Lig4 +/+ [ n = 4] and Lig4 W447C/W447C [ n = 4]) analyzed by bulk RNA-sequencing (RNA-seq) analysis. Visualization of bulk RNA-seq results with a volcano plot. The dotted lines indicate the value of fold changes (± 21.5 -fold, x-axis) and the significance p-value ( p <0.05, y-axis). (b) Normalized enrichment scores of excerpted top 25 up-regulated (upper) and top 4 down-regulated (bottom) gene sets in the colons from Lig4 W447C/W447C mice compared with the Lig4 +/+ mice analyzed by gene set enrichment analysis (GSEA). Gene sets associated interferon-gamma response, indicated by the red arrow, represent the focus of this study. “NOM p-val” represents the nominal p-value, and “FDR q-val” represents the false discovery rate q-value. (c) GSEA enrichment plot for “interferon-gamma response” with comparison of the colons from four Lig4 W447C/W447C mice and four Lig4 +/+ mice. “ p ” indicates nominal p -value. (d) The heatmap shows the changes in gene expression in the IFN-γ-inducible genes within the “interferon-gamma response” gene sets. Color ranges from dark red to dark blue representing the highest and lowest expression of a gene, respectively. Furthermore, expression of these genes was more prominently enhanced in the colons from Lig4 W447C/W447C mice with severe manifestations (MCHI: #3-score 17, #4-score 20) than those with relatively mild manifestations (MCHI: #1-score 9, #2-score 3) ( Fig. 4d ). Thus, intestinal inflammations in Lig4 W447C/W447C mice are featured by enhanced production of IFN-γ. Loss of IFN- γ expression in Lig4 W447C/W447C mice evoked Th2/Th17-mediated intestinal inflammation IFN-γ is a key cytokine expressed in Th1 cells among lymphocytes. We therefore compared the expression of various Th cell subset signature genes. Th1 cell signature genes including Ifng were expressed at significantly higher levels in Lig4 W447C/W447C colons than in Lig4 +/+ colons ( Fig. 5a ) . Expression of Th2 and Treg cell signature genes were also increased, whereas the expression of some Th17 cell signature genes was rather decreased in the mutant colons ( Fig. 5a ) . Download figure Open in new tab Download figure Open in new tab Figure 5. Analysis of Lig4 W447C/W447C Ifng −/− mice. (a) The heatmap shows the changes in gene expression of Th cell subset signature genes in the colon from four 10-week-old mice ( Lig4 +/+ [ n = 4] and Lig4 W447C/W447C [ n = 4]) analyzed by bulk RNA-sequencing (RNA-seq) analysis. Color ranges from dark red to dark blue representing the highest and lowest expression of a gene, respectively. (b) Intracellular cytokine staining (IFN-γ, interleukin (IL)-17A, and IL-4) of CD4 + T cells in splenocytes, mesenteric lymph nodes (MLN), and intestinal lamina propria (LP) from Lig4 +/+ and Lig4 W447C/W447C mice. Samples were stimulated with PMA (50 ng/mL), ionomycin (500 ng/mL) and Golgi plug for 5 hours. ( Lig4 +/+ [Spleen and MLN: n = 6, LP: n = 4] and Lig4 W447C/W447C [Spleen and MLN: n = 6, LP: n = 3]). (c) The percentages of IFN-γ-producing CD4 + T cells in the respective tissues. (d) The ratio of IFN-γ/IL-17A-producing CD4 + T cells in LP from each mouse. (e) Representative H&E staining of colons from Lig4 W447C/W447C Ifng +/+ (left panel) and Lig4 W447C/W447C Ifng −/− mice (middle and right panels). In middle panel, black square line denotes the areas that are presented magnified in the right panel. In the magnified image, infiltrated eosinophils (dotted circle line) and multinucleated giant cell (arrow) were found in Lig4 W447C/W447C Ifng −/− mice. Scale bar represents 200 μm (left and middle panels) and 50 μm (right panel). (f) The graph depicts the mouse colitis histology index of the representative mice ( Lig4 W447C/W447C Ifng +/+ [ n = 15], and Lig4 W447C/W447C Ifng −/− [ n = 13]; 7-13 weeks). (g) FACS analysis of CD19 and TCRβ expression in splenocytes from Lig4 +/+ Ifng +/+ , Lig4 W447C/W447C Ifng +/+ and Lig4 W447C/W447C Ifng −/− mice. (h) Relative expression levels of the colon from seven 10-week-old mice ( Lig4 W447C/W447C Ifng +/+ [ n = 4] and Lig4 W447C/W447C Ifng −/− [ n = 3]) analyzed by bulk RNA-seq analysis. Visualization of bulk RNA-seq results with a volcano plot. The dotted lines indicate the value of fold changes (± 21.5 -fold, x-axis) and the significance p -value ( p <0.05, y-axis). (i) The heatmap shows the changes in gene expression in the IFN-γ-inducible genes within the ‘interferon-gamma response’ gene sets among colons from Lig4 W447C/W447C Ifng +/+ and Lig4 W447C/W447C Ifng −/− mice. Color ranges from dark red to dark blue representing the highest and lowest expression of a gene, respectively. (j) Normalized enrichment scores of excerpted tops 24 down-regulated (upper) and seven up-regulated (bottom) gene sets in the colons from the Lig4 W447C/W447C Ifng −/− mice [ n = 3] compared with Lig4 W447C/W447C Ifng +/+ mice [ n = 4] analyzed by gene set enrichment analysis (GSEA). Gene sets associated ‘interferon-gamma response’, indicated by the blue arrow, represent the focus of this study. ‘NOM p -val’ represents the nominal p-value, and ‘FDR q-val’ represents the false discovery rate q-value. (k) GSEA enrichment plot for ‘interferon-gamma response’ with comparison of the colons from four Lig4 W447C/W447C Ifng +/+ mice and three Lig4 W447C/W447C Ifng −/− mice. ‘ p ’ indicates nominal p -value. (l) The heatmap shows the changes in representative gene expressions of Th cell subset signature genes among colons from Lig4 W447C/W447C Ifng +/+ and Lig4 W447C/W447C Ifng −/− mice. (m) The reads per kilobase per million (RPKM) levels of the Il17a, Cxcl1, Ccl17 and Ccl24 genes in the colon from Lig4 +/+ Ifng +/+ , Lig4 W447C/W447C Ifng +/+ and Lig4 W447C/W447C Ifng −/− mice analyzed by bulk RNA-seq analysis. The data are presented as the mean ± standard error of the mean (SEM). We have also performed intracellular cytokine staining analysis in CD4 + T cells from Lig4 +/+ and Lig4 W447C/W447C mice. IFN-γ-expressing CD4 + T cells was higher in frequency in the spleen, mesenteric lymph nodes (MLNs), and lamina propria (LP) of Lig4 W447C/W447C mice than in those of Lig4 +/+ mice ( Fig. 5b, c ) . Notably, almost half of CD4 + T cells expressed IFN-γ in Lig4 W447C/W447C mice. Meanwhile, IL-4-expressing CD4 + T cells were comparable ( Fig. 5b ) . IL-17A-expressing CD4 + T cells were increased in the mutant MLN and LP lymphocytes than in the Lig4 +/+ lymphocytes, but their proportions were less than 10% ( Fig. 5b ) . Among LP CD4 + T cells, IL-17A-expressing cells were dominant in Lig4 +/+ mice, whereas IFN-γ-expressing cells were dominant in the mutant mice ( Fig. 5d ) . Dominance of IFN-γ-expressing cells were more prominent in the spleen and MLN CD4 + T cells in Lig4 W447C/W447C mice. These results suggest that Th1 cells producing IFN-γ are mainly activated in Lig4 W447C/W447C mice. To determine whether and how IFN-γ is involved in the development of intestinal inflammations in Lig4 W447C/W447C mice, we generated Lig4 W447C/W447C Ifng −/− mice. The double mutant mice showed developmental defect and microcephaly, in similar to Lig4 W447C/W447C mice. The double mutant mice had inflammatory cell infiltration in the intestine, with a similar inflammatory score to that of the Lig4 W447C/W447C mice ( Fig. 5e, f ). These inflammatory cells were mainly neutrophils in the LP and crypt abscesses were not found ( Fig. 5e ) . Furthermore, eosinophils were often found in the lesions ( Fig. 5e , dotted circle ) and multinucleated giant cells, which could be potentially derived from activated macrophages, were occasionally found ( Fig. 5e , arrow ). Flow cytometric analysis revealed residual T cells in the splenocytes of Lig4 W447C/W447C Ifng −/− mice ( Fig. 5g ). Intracellular staining analysis of the residual T cells lacked expression of IFN-γ, but increased expression of IL-4 and IL-17A ( Extended Data Fig. 7 ). The transcriptome analysis also revealed that expression of IFN-γ inducible genes was profoundly decreased in the colons of Lig4 W447C/W447C Ifng −/− mice compared with Lig4 W447C/W447C mice ( Fig. 5h, i and Supplementary Table 1 ). GSEA comparing Lig4 W447C/W447C Ifng −/− and Lig4 W447C/W447C mice showed upregulation and downregulation of 18 and 5 gene sets (nominal p-value < 0.05, false discovery rate q-value < 0.25), respectively, and confirmed the most downregulated gene set was ‘interferon-gamma response’ ( Fig. 5j, k and Supplementary Table 2 ). Furthermore, we compared the expression of various Th cell subset signature genes. Expression of Th1 cell signature genes in the Lig4 W447C/W447C Ifng −/− colons was returned to comparable levels to that in the Lig4 +/+ Ifng +/+ colons (Supplementary Table 1) . Meanwhile, expression of Th17 ( Il17a, Cxcl1 ) and Th2 ( Ccl17 and Cc124 ) cell signature genes were upregulated in Lig4 W447C/W447C Ifng −/− colons, compared with Lig4 +/+ Ifng +/+ and Lig4 W447C/W447C Ifng −/− colons ( Fig. 5l, m and Supplementary Table 1 ). Expression of Treg signature genes was comparable among these mice ( Fig. 5l and Supplementary Table 1 ). Taken together, IFN-γ deficiency ameliorated Th1-skewed intestinal inflammations, but instead deteriorated Th17-skewed intestinal inflammations in Lig4 W447C/W447C mice. Lig4 W447C/W447C mice exhibit a biased TCR repertoire in the spleen We then performed a comprehensive bulk-based analysis of a diverse repertoire of T cell receptors in the spleen and the MLN to investigate whether T cell repertoire shows some skewing in Lig4 W447C/W447C mice. The T cell repertoire was quite heterogeneous in Lig4 +/+ mice, while certain T cell receptors were abundantly expressed in Lig4 W447C/W447C mice (Extended Data Fig. 8a-d and Supplementary Table 3, 4) . A close examination of the 3’ (proximal) Vα segments revealed a striking difference in their usages among Lig4 +/+ and Lig4 W447C/W447C mice (Extended Data Fig. 8a, b) . TCR Vα usage in the spleen and the MLN of Lig4 W447C/W447C mice was strongly skewed to the 3’ (proximal) end. Meanwhile, as for Vβ, a slight bias in the utilization frequency of segments was observed in Lig4 W447C/W447C mice, regardless of their position ( Extended Data Fig. 8c, d ). Next, we performed single-cell RNA-Seq (scRNA-seq) analysis to investigate which pairs of T cell receptors are expressed in the spleens of Lig4 +/+ and Lig4 W447C/W447C mice. Consistent with flow cytometry analysis, T cells were severely decreased, and the residual T cells mainly consisted of Th1 cells in the spleens of the mutant mice ( Fig. 6a, b ) . Lig4 +/+ T cells from 2015 barcodes included 2002 clonotypes, which contained the clones limited to two at most, and all but the top six clonotypes were represented by one cell. Meanwhile, 667 Lig4 W447C/W447C T cells consisted of 235 clonotypes and the top 10 clonotypes each occupied more than 10 T cells, 1.5% of the total T cells (experiment [exp] #1 in Fig. 6c ) . Those 10 clones contained four CD4 + cells, five CD8 + cells, and one CD4 − CD8 − T cell. Seven out of 10 clones did not express Sell , indicating that most of them are activated. Two CD4 + T cell clonotypes, which are activated and express Trbv3/Trbj1-1 or Trbv16/Trbj2-3 , showed high expression of Ifng (exp #1 in Fig. 6d, e ). Meanwhile, neither of these 10 T cell clonotypes expressed Il4 or Il17a (exp #1 in Fig. 6d ) . Furthermore, we analyzed the T cell repertoire diversity in additional two Lig4 W447C/W447C spleens (exp #2 and #3) by scRNA-seq analysis. In exp #2 and #3 mutant mice, 1,265 and 1,610 T cells consisted of 366 and 416 clonotypes, respectively ( Fig. 6c ). These top 10 clonotypes each occupied 1.26% and 1.30% of the total T cells (exp #2 and #3 in Fig. 6c ) . In #2 mutant mouse, two CD4 + T cell clonotypes expressing Ifng represented Trbv3/Trbj2-3/Trav14-3/Traj56 or Trbv15/Trbj2-5//Trav13-1/Traj58 transcripts (exp #2 in Fig. 6d, e ) . Meanwhile, #3 mutant mouse predicted all effector memory CD4 + T cell among top 9 clonotypes; however, none of them expressed Ifng , Il4 or Il17a (exp #3 in Fig. 6d, e ) . Therefore, several T cell clonotypes, which might include pathogenic ones, were skewed and expanded in Lig4 W447C/W447C mice. Download figure Open in new tab Download figure Open in new tab Figure 6. Single-cell RNA-sequencing of splenocytes samples. (a) The t-SNE plots of splenocytes from Lig4 +/+ and Lig4 W447C/W447C mice based on 17,377 cells ( Lig4 +/+ : 5,289 cells, Lig4 W447C/W447C : 12,088 cells). It was classified into 24 clusters. t-SNE plots show the data of total (left), Lig4 +/+ (middle) and Lig4 W447C/W447C (right). (b) Feature plots of Cd3e , Cd4 , Tbx21 and Ifng . The color bar, from yellow to brown, reveals gradual expression intensity differences from low to high. (c) The clonotype frequencies of splenocytes from Lig4 +/+ mice and Lig4 W447C/W447C mice [n=3; exp #1, #2 and #3]. (d) The violin plots of the expression of the listed gene in the respective clonotype of each Lig4 W447C/W447C mice [n=3; exp #1, #2 and #3]. (e) The clonotype summary of each Lig4 W447C/W447C mice [n=3; exp #1, #2 and #3]. Moreover, we quantitated usage of TCR V and J gene segments (Vα, Jα, Vβ, and Jβ) in CDR3 sequences by scRNA-Seq analysis in splenic T cells of one Lig4 +/+ and three Lig4 W447C/W447C mice ( Figure 7a-d and Extended Data Fig 9a, b ) . Vα repertoire in T cells from three mutant mice was dominated by the most 3’ (proximal) segments from Trav16 to Trav21-dv12 segments ( Fig 7a and Extended Data Fig. 9a ). Conversely, the Jα repertoire in the mutant T cells were dominated by the most 5’ (distal) segments from Traj58 to Traj49 ( Fig 7b and Extended Data Fig. 9a) . Moreover, Vβ and Jβ segments in the mutant T cells were evenly distributed, although usage of some segments, including Trbv1 , Trbv3 , and Trbj1-1 . was increased ( Fig 7c, d and Extended Data Fig. 9b ). Download figure Open in new tab Figure 7. TCR repertoire analysis by single-cell RNA-sequencing of splenocytes samples. The bar graphs depict the utilization frequencies of TCR gene segments in Lig4 +/+ mice [n=1] and Lig4 W447C/W447C mice [n=3; exp #1, #2 and #3]. (a) Trav segments, arranged in chromosomal order from the 5’ end (left) to the 3’ end (right) of the Trav locus. (b) Traj segments, arranged in chromosomal order from the 5’ end (left) to the 3’ end (right) of the Traj locus. (c) Trbv segments, arranged in chromosomal order from the 5’ end (left) to the 3’ end (right) of the Trbv locus. (d) Trbj segments, arranged in chromosomal order from the 5’ end (left) to the 3’ end (right) of the Trbj locus. Discussion We introduced a novel hypomorphic gene variant, p.W447C, derived from a patient with LIG4 syndrome into mice. The homozygous mutant mice showed not only developmental and neuronal defects but also severe adaptive immunodeficiency. They further showed severe intestinal inflammations with intestinal epithelial hyperplasia, marked infiltration of Th cells and macrophages, and cryptic abscesses, which are characteristic of ulcerative colitis. The inflammations were developed in Lig4 W447C/W447C → Rag2 −/− mice and abolished in Lig4 W447C/W447C Rag2 −/− mice. Furthermore, the lesions showed high expression of IFN-γ and IFN-γ-induced genes and were skewed towards Th2/Th17-type inflammations by IFN-γ deficiency. These results indicate that intestinal inflammations in Lig4 W447C/W447C mice are driven by Th1 cells. LIGIV-deficient mice are embryonic lethal. Meanwhile, so far two kinds of hypomorphic Lig4 homozygous mutant mice, Y288C and R278H, were generated and found to be born with growth retardation 16 , 17 , 18 , 19 , 20 , 21 . Both Lig4 Y288C/Y288C and Lig4 R278H/R278H mice manifested defective DSB repair and adaptive immunodeficiency, as observed also in Lig4 W447C/W447C mice 17 , 19 , 20 . However, the immunodeficiency in these two mutant mice was milder than that in Lig4 W447C/W447C mice. Although protein expression of LIGIV is decreased in Lig4 Y288C/Y288C and Lig4 R278H/R278H mice, it is preserved in Lig4 W447C/W447C mice 19 , 21 . This indicates that protein stability or synthesis is impaired by Y288C and R278H, but not by W447C mutations, and it indicates that defective protein expression caused by Y288C and R278H mutations should contribute to functional defects of LIGIV. It remains unknown why W447C mutation, which does not reduce LIGIV expression, caused more severe adaptive immunodeficiency than the two other mutations. Y288, R278 and W447 are all localized in the middle of the enzymatic domain. According to in silico analysis, neither Y288C, R278H, or W447C mutations disturb the overall structure of LIGIV. In order to repair DSB, LIGIV should first bind to AMP 23 . W447 faces to AMP and W447C mutation is supposed to cause decrease of the interface area and enlargement of the AMP-binding pocket, which should then lead to destabilization of the interaction of LIGIV and AMP. Although R278 also faces to AMP and R278H mutation leads to decrease of the interface area, the mutation minimally affects the AMP-binding pocket. Y288 is located on the surface of LIGIV and is not directly involved in the interaction of LIGIV with AMP. The AMP-binding pocket should therefore be structurally kept by Y288C mutation. Based on these findings, it can be assumed that W447C mutation should disturb the interaction of LIGIV with AMP more severely than the other two mutations, thereby leading to more severe defects in adaptive immunity. Among three hypomorphic Lig4 homozygous mutants, Lig4 W447C/W447C mice are featured by their inflammatory phenotype. Meanwhile, Lig4 R278H/R278H and Lig4 Y288C/Y288C mice showed increased morbidity and high incidence of thymic tumors, indicating that these two mutations led to increased susceptibility to malignancy 19 , 20 . In this study, we could not formally assess whether Lig4 W447C/W447C mice manifest the lymphoid malignancies, because most of them do not survive long enough to be analyzed. No apparent inflammatory conditions have been found in these previously reported mice, although only a modest infiltration of T lymphocytes and neutrophils was observed in the guts and livers of Lig4 R278H/R278H mice 17 , 19 . Furthermore, splenic T cells in the Lig4 R278H/R278H mice did not show any prominent skewing in their cytokine expression profiles 19 . Thus, Th1 cell-driven intestinal inflammation with macrophages in the Lig4 W447C/W447C mice is a unique phenotype. The RAG proteins, involved in V(D)J recombination of BCRs and TCRs, are essential for lymphocyte development. Several hypomorphic mutations in Rag genes also lead to inflammatory manifestations driven by lymphocytes with adaptive immunodeficiency, which are called as Omenn syndrome 24 , 25 , 26 , 27 , 28 . Among several Rag mutant mice, Rag2 R229Q/R229Q mice have manifested inflammatory conditions, including colitis, which are similar to intestinal inflammations in Lig4 W447C/W447C mice in terms of dominant infiltration of Th cells 29 . However, Rag2 R229Q/R229Q mice show not only Th1-, but also Th17– and Th2-driven inflammations, which are characterized by skin lesions with erythroderma and eosinophilia 29 , 30 , 31 . Meanwhile, in Lig4 W447C/W447C mice, the intestinal inflammations were driven mainly by Th1 cells and skin lesions were not observed. Furthermore, B lineage cells were hardly detected in the intestines or spleen and serum Ig levels including IgE and anti-dsDNA Abs were low, while levels of serum IgM and IgGs were kept and the levels of serum IgE and anti-dsDNA Abs were increased in Rag R229Q/R229Q mice. Thus, Inflammations in Lig4 W447C/W447C mice are pathologically distinct from those in Rag R229Q/R229Q mice. The difference should come from broader expression of LIGIV than RAG. Non-lymphocytes with defective LIGIV, which are prone to DSB-induced effects such as cell death, should be involved in generation of inflammations. Characterizing CD4 + TCR clonality has been used to monitor the progression of disease states in cases of autoimmunity 32 , 33 . TCR repertoires from Lig4 W447C/W447C mice displayed increased clonality and decreased diversity compared with those from Lig4 +/+ mice. Among expanded T cell clones, activated Th1 cells were dominant, whereas Il4 -or Il17a -expressing T cells were not observed. Further clarification of these T cell clones, which should be pathogenic, should contribute to effective treatment for the inflammations under acquired immunodeficiency. In Rag R229Q/R229Q and Lig4 R278H/R278H mice, splenic T cells showed oligoclonal expression of TCR Vβ gene-segments, but their usage of Vα was unclear 19 , 31 . In Lig4 W447C/W447C mice, scRNA-seq analysis revealed that Vα and Jα gene-segments are used mainly towards the proximal locus, respectively. This skewed usage was not observed in Vβ and Jβ segments. This is consistent with usage pattern of TCRα gene segments not only from Omenn or Omenn-like syndrome patients 34 , 35 , but also from the mutant mice lacking XLF, which stimulates the DNA-joining activity of the XRCC4-LIGIV complex 36 . It is interesting whether these skewed TCRαs are involved in intestinal inflammations. In this study, mutant mice carrying a hypomorphic Lig4 mutation derived from a LIG4 syndrome patient showed T cell-dependent intestinal inflammation under severe adaptive immunodeficiency. The inflammation depends on activation and/or selection of Th cells, especially Th1 cells. The phenotype is based on the monogenic mutation and can account for the inflammation accompanied with LIG4 syndrome, but the underlying pathological mechanisms should have some common aspects with polygenic intestinal bowel diseases, which are still intractable. Our mutant mice should be useful model mice to analyze and treat not only LIG4 syndrome itself, but also some common inflammatory conditions based on T cell activation and/or selection under adaptive immune deficiency. Methods Lig4 W447C/W447C mice generation and genotyping These Lig4 W447C/W447C mice were generated using the CRISPR-Cas9 method 37 . Briefly, guide RNA (gRNA; guide sequence: 5’-CAGACAAAAGAGGTGAAGGG-3’) and Cas9 endonuclease mRNA were generated in vitro using the MEGAshortscript T7 (Life Technologies) and mMESSAGE mMACHINE T7 ULTRA (Life Technologies) transcription kits, respectively. The synthesized gRNA and Cas9 mRNA were purified using the MEGAclear kit (Life Technologies). Single-stranded oligodeoxynucleotides containing the Lig4 c.1341G>T mutation (5’-CCCCCCACAATTAGGACGTCTAATTCATCCATTAGTCCACTGACGTACTCTGGTTTAATCTT TAGACACCCTTCACCTCTTTTGTCTGGCTTGTAAATGGACAGAGGGTGTTTAACCATGATC CCCTCTTC-3’) were synthesized by Integrated DNA Technologies, Inc. To generate mutant mice, female B6C3F1 mice were super-ovulated and mated with C57BL/6 N males (CLEA Japan Inc.). Fertilized one-cell-stage embryos were injected with gRNA, Cas9 mRNA, and single-stranded oligodeoxynucleotides. The c.1341G>T mutation was confirmed by Sanger sequencing, and the mutant mice were further backcrossed to C57BL/6 N mice for more than six generations. We studied 8–16-week-old mutant mice and their littermates unless otherwise noted. Genotyping was performed via polymerase chain reaction (PCR) amplification of tail DNAs using high-single nucleotide discrimination DNA polymerase (HiDi DNA polymerase; myPOLS Biotech GmbH). The following primers were used: control forward primer (CFP), 5’-AAGCCAGACAAAAGAGGTGAAGGGTGG-3’; mutation forward primer (MFP), 5’-AAGCCAGACAAAAGAGGTGAAGGGTGT-3’; and common reverse primer (CRP), 5’-TTTCATGGTGTAACCAGACCCAACACG-3’. PCR was performed with an initial denaturation at 95°C for 2 min, followed by 35 cycles of denaturation at 95°C for 15 seconds, annealing at 69°C for 10 seconds, extension at 72°C for 30 seconds, and then a final extension at 72°C for 1 min. The wild-type and mutant alleles were detected as a 225 bp band using PCR with CFP-CRP and MFP-CRP primer pairs, respectively. Generation of Ifng −/− , Lig4 W447C/W447C Rag2 −/− , and Lig4 W447C/W447C Ifng −/− mice Ifng −/− mice were generated using the Alt-R CRISPR-Cas9 System (Integrated DNA Technologies, Inc.). CRISPR RNAs (crRNAs) including the target sequence, gRNA1 (Exon 2; 5’-GTCTCTTCTTGGATATCTGGAGG-3’) or gRNA2 (between Exons 2 and 3; 5’-CATCAGCTGATAAAGCTAGGAGG-3’) were designed, annealed with tracrRNA, and then incubated with Cas9 protein to generate the gRNA-Cas9 complex according to the manufacturer’s instructions. The gRNA-Cas9 complex (the final 5 μM crRNA, 5 μM tracrRNA, and 1 μM Cas9) was injected into single-cell-stage fertilized eggs from C56BL/6N via electroporation (NEPA21 electroporator; Nepa Gene Co., Ltd). Approximately 350 injected eggs were transferred to the oviducts of pseudo-pregnant ICR females. After sequencing the PCR products of the targeted locus, six of the eight founders were found to be the Ifng variant. After that, one founder animal was selected to generate Ifng knockout mice. Genotyping was performed via PCR amplification of tail DNAs using PrimeSTAR ® Max DNA Polymerase (TaKaRa). The following primers were used: forward primer, 5’-CTACGGTCAATCCTCTCCTCAC-3’; and reverse primer, 5’-TTTGGATTCTCACGGCCATAC-3’. PCR was performed with an initial denaturation at 98°C for 5 min, followed by 35 cycles of denaturation at 98°C for 10 seconds, annealing at 68°C for 5 seconds, extension at 72°C for 1 min, and then a final extension at 72°C for 1 min. The wild type was detected as a 1,620 bp band, while mutant alleles were detected as a 1224 bp band using PCR with a combination of primer pairs. Heterozygous Lig4 W447C/+ mice were mated to Rag2 −/− or Ifng −/− mice to generate Lig4 W447C/W447C Rag2 −/− and Lig4 W447C/W447C Ifng −/− mice. C57BL/6N mice were used, and Rag2 was genotyped using PCR, as previously described 38 . We thank Dr. Frederick W. Alt for the Rag2 −/− mice 38 . Mice C57BL/6N mice were purchased from CLEA Japan. All mice were housed in specific pathogen-free conditions with 12-hour light/dark cycles at an ambient temperature of 20-24°C and a humidity range of 40-60%. Experimental and control animals were co-housed and used at 8-16 weeks old unless otherwise noted. Both males and females were used in the study. Mice were euthanized by cervical dislocation before tissue dissection. All animal experiments were approved by the Animal Research Committee of Wakayama Medical University (Approval number 855 and 1140) and conducted in accordance with the Guidelines for the Care and Use of Laboratory Animals at Wakayama Medical University, as well as the relevant national guidelines and regulations. Preparation of MEFs E14.5 embryos were removed, one by one, from the uterine, and the head-removed bodies were cut into small pieces with scissors. Then, they were cultured in a T-25 (25 cm 2 ) culture flask (Falcon; Corning Inc.) per embryo with 2 ml of αMEM (Nacalai Tesque) supplemented with 10% fetal bovine serum (Gibco; Thermo Fisher Scientific) at 37[ under humidified 5% CO 2 conditions. After two-day culture, the cells were fed with 2 ml of the medium, and then the medium was changed at another two-day culture. When growing cells became confluent, they were suspended in the medium supplemented with 10% dimethyl sulfoxide (Nacalai Tesque) and frozen in liquid nitrogen for stock. The frozen stock of MEFs were thawed and allowed to grow for subsequent experiments. γ H2AX foci assay MEFs were plated at a density of 1×10 5 on coverslips and incubated overnight. Then, the cells were irradiated with 1 Gy of X-rays by an X-ray machine (OM-B205; Ohmic) operated at 70 kVp and 5 mA using a 0.5 mm Al filter at room temperature. The dose rate was 0.64 Gy/min. After X-irradiation, the cells were incubated at 37[ for 10 min, 0.5, 1, 3, 6, and 24 h, then fixed with 4% paraformaldehyde phosphate buffer (Nacalai Tesque) for 15 min, and permeabilized with 0.5% triton X-100 (FUJIFILM Wako) in PBS (Gibco, Thermo Fisher Scientific) (-) on ice for 5 min. The fixed cells were soaked with blocking buffer containing 5% Blocking One (Nacalai Tesque) and 0.1 % Tween 20 (Sigma-Aldrich) in PBS (-) for 1 h. The blocked cells were incubated with an anti-phospho-histone H2AX (Ser139) mouse monoclonal antibody conjugated with Alexa Flour 488 (BioLegend) for 1 h at room temperature. After washing with 0.1 % Tween 20, the cells were counterstained with 4’,6-diamidino-2-phenylindole (DAPI; Sigma-Aldrich) and coverslips were placed on slide glasses followed by sealing with clear nail polish. For counting the number of γ-H2AX foci accurately and reproducibly, a newly developed Image J-based computer program was used as previously described 39 . Flow cytometric analysis A single-cell suspension was prepared from the thymus, spleen, BM, MLNs, and LP cells and analyzed using flow cytometry according to standard protocols. The LIVE/DEAD Fixable Aqua Dead Cell Stain Kit (Invitrogen) was used to exclude dead cells. The anti-CD16/32 antibody (2.4G2; Tonbo Biosciences) was used to block Fc receptors, and the cells were then stained with fluorochrome-conjugated or biotinylated antibodies (Supplementary Table 5) . For intracellular staining of IFN-γ, IL-17A and 1L-4, splenocytes, MLN cells, and LP cells were stimulated with PMA (50 ng/mL, Nacalai Tesque), ionomycin (500 ng/mL, Nacalai Tesque) and Golgi plug (BD Biosciences) for 5 hours. Cells were stained with monoclonal antibodies for CD3ε, CD4, and CD8α, then fixed with fixation/permeabilization solution (Cytofix/Cytoperm Kit, BD Biosciences), and stained with anti-IFN-γ, anti-IL-17A or anti-IL-4 monoclonal antibodies (Supplementary Table 5) . Foxp3 Staining Buffer Set (eBioscience) was used to stain Foxp3. Stained cells were analyzed using a FACSVerse flow cytometer (BD Biosciences), and data were analyzed using the FlowJo software Version 10.8.0 (BD Biosciences). Histological examination The thymus, spleen, small intestine, and colon were formalin-fixed, paraffin-embedded, processed, and sectioned into 5-μm-thick sections. In addition, the BM was pre-decalcified. The sections were stained with hematoxylin and eosin. Colitis and enteritis were histo-morphologically assessed. Colitis was assessed using the Mouse Colitis Histology Index (MCHI) rating scale, as previously described by Koelink et al. 40 . The total MCHI score ranged from 0 (no disease) to 22 (severe disease) and was calculated using four categories (goblet cell loss, crypt density, hyperplasia, and submucosal invasion) as follows: MCHI = 1 × goblet cell loss (0 to 3) + 2 × goblet density (0 to 2) + 2 × hyperplasia (0 to 3) + 3 × submucosal invasion (0 to 3). Enteritis was assessed using different criteria, as described in Supplementary Methods. Furthermore, we performed immunohistochemical analysis as previously described 41 . Briefly, the thymus, spleen, small intestine, and colon were formalin-fixed, paraffin-embedded, and processed to obtain 5-μm-thick sections. In addition, we performed antigen retrieval using a microwave and a citrate buffer (pH 6.0; Sigma-Aldrich). Then, tissue samples were incubated at room temperature for 60[min with primary antibodies. The following primary antibodies were used: anti-mouse CD3 antibody (CD3-12; abcam), mouse anti-mouse CD4 antibody (EPR19514; abcam), anti-mouse F4/80 antibody (D2S9R; Cell Signaling Technology), and anti-mouse B220 antibody (RA3-6B2; BD). Next, DAB (3,3’-diaminobenzidine; Sigma-Aldrich) staining was performed using the two-step EnVision+ System-HRP methodology (Dako, Tokyo, Japan). For visualization, light microscopy was performed using an Olympus BX43 microscope (Olympus). Virtual slides were generated using the NanoZoomer S60 C13210 (Hamamatsu Photonics), and digitized whole-slide images (WSIs) were acquired. Images for analysis were subsequently extracted using NDP.view2Plus software (Hamamatsu Photonics). Western blot analysis In brief, MEFs from Lig4 -mutated mice were lysed with radio-immunoprecipitation assay lysis buffer (Nacalai Tesque) and cOmplete™ Mini Protease Inhibitor Cocktail (Roche Diagnostics). The protein extracts were mixed with Laemmli sample buffer containing 2-mercaptoethanol (Wako) and heated in a heat block at 100°C for 5 min. The samples were separated using sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred onto polyvinylidene fluoride membranes (GE Healthcare). The membranes were washed and blocked with the DIG Wash and Block Buffer Set (Roche Diagnostics) according to the manufacturer’s instructions. The membranes were then incubated overnight at 4°C with primary antibodies. The following primary antibodies were used: rabbit anti-LIG4 (cat# ab26039; Abcam), mouse anti-XRCC4 (cat# MA5-24383; Thermo Fisher Scientific), rabbit anti-XLF (cat# ab33499; Abcam) and mouse anti-β-actin antibodies (cat# 3700, Cell Signaling Technology). The following day, after three washes, the membranes were incubated with secondary antibodies at room temperature for one hour. The following secondary antibodies were used: horseradish peroxidase-conjugated goat anti-rabbit IgG polyclonal antibody (cat# 170-6515, 1:1000 dilution; Bio-Rad) or horseradish peroxidase-conjugated rabbit anti-mouse IgG antibody (cat# 1080-05, 1:1000 dilution; SouthernBiotech). The protein bands were visualized with SuperSignal ® West Dura Substrate (Thermo Fisher Scientific) and detected using a LuminoGraph I Chemiluminescent Imaging System (ATTO). We measured the band intensities using Image J software version 1.51k (National Institutes of Health). The β-actin level was used as an internal control to ensure equal amounts of loading proteins. Measurement of serum Ig levels in mice Serum Ig levels of Lig4 W447C/W447C mice and wild-type C57BL/6N littermates were measured using an enzyme-linked immunosorbent assay (ELISA), as previously described 37 . In brief, serum samples were incubated in an ELISA plate (Thermo Fisher Scientific) coated with anti-mouse IgM, IgG1, IgA or IgE antibodies and detected with biotinylated antibodies against each class and streptavidin-conjugated alkaline phosphatase (Southern Biotech). The plate was then developed using an alkaline phosphatase buffer (NaHCO 3 [50 mM], MgCl2 [10 mM], pH 9.8) containing a phosphatase substrate tablet (Sigma-Aldrich). Purified mouse IgM, IgG1, IgA or IgE were used as standards. Details of all antibodies and standards are listed (Supplementary Table 6) . Mouse BM transplantation BM cells were isolated from the femurs and tibias of Lig4 W447C/W447C mice and wild-type C57BL/6N littermates (9–22 weeks of age). BM cells (0.5 to 1.0 × 10 7 ) were injected via the tail vein into Rag2 −/− recipient mice (10–30 weeks of age) that had received a lethal total-body γ-irradiation dose of 10 Gy. Mice were monitored daily for survival and weighed twice a week. Euthanasia was performed seven weeks after transplantation for analysis. Bulk RNA-Sequencing analysis For RNA-sequencing (RNA-Seq) analysis, total RNA was extracted using the RNeasy Micro Kit (QIAGEN) or the Sepasol-RNA I Super G (Nacalai Tesque), as previously described 42 , 43 . The samples were collected from the colon, MLNs and spleen of Lig4 +/+ and Lig4 W447C/W44 7 and from the colon of Lig4 W447C/W447C Ifng −/− mice. The RNA quality was assessed using an Agilent 4200 TapeStation (Agilent Technologies), and the RNA concentration was measured using a Qubit Fluorometer (Thermo Fisher Scientific). A total of 4,000 ng RNA in colon, 228–1,552 ng RNA in MLN and 921.6–3,000 ng RNA in spleen was used, and libraries for sequencing were constructed using TruSeq Stranded mRNA (Illumina Inc.) according to the manufacturer’s protocol. The concentration of libraries was estimated using the KAPA Library Quantification Kit (Roche Diagnostics). The range of average library size was 324–359 bp. The libraries were sequenced by high-throughput sequencing using a NextSeq 500/550 High Output Kit v2.5 (Illumina, 75 cycles pair-end, 40/40 cycles). The average number of sequence reads per sample was 22,855,222.1. The bulk RNA-seq results were analyzed using the CLC Genomics Workbench Version 12.0.2 (Filgen Inc.), and the abundance of gene expression was expressed using the reads per kilobase per million values. In addition, gene expression analysis, including gene set enrichment analysis (GSEA), was conducted using GSEA v4.2.3 software and the Molecular Signature Database v7.5.1. 44 , 45 . Moreover, the web tool ClustVis and BioJupies were used to draw a heatmap and a volcano plot, respectively 46 , 47 . The raw fastq data of RNA-seq analysis was deposited in DDBJ and BioProject number is PRJDB19195, Run number is DRR615557-DRR615579. Single-cell RNA-sequencing and TCR repertoire analysis Single-cell transcriptome and TCR repertoire analysis were performed using Chromium Single Cell 5’ Reagent Kits v2 and Chromium Single Cell Human TCR Amplification Kits with Chromium Controller (10x Genomics) according to the manufacturer’s instructions as previously described 48 . Libraries were sequenced on NovaSeq X Plus (Illumina) as paired-end mode (read 1: 151 bp; read 2: 151 bp). The raw reads were processed by Cell Ranger v7.1.0 (10x Genomics). Gene expression– based clustering was performed using the Seurat R package (v3.1). Cells with a mitochondrial content >10% and cells with 4,000 genes detected were considered outliers (dying cells and empty droplets and doublets, respectively) and filtered out. The Seurat SCTransform function was used for normalization, and data were integrated without performing batch-effect correction as all samples were processed simultaneously. Hashtag oligo demultiplexing was performed on centered log ratio-normalized hashtag unique molecular identifier counts, and clonotypes were matched to the gene expression data through their droplet barcodes, using Python scripts. The cluster analysis based on t-SNE plot and differential expression analysis were performed by Loupe Browser v8.0.0 (10x Genomics). The TCR repertoire analysis was performed by Loupe V(D)J Browser v5.2.0(10x Genomics). The single-cell RNA-seq data generated in this study have been deposited in GEO under accession number GSE294169. LIGIV protein structure predictive analysis Atomic models of wild-type and mutated LIGIV proteins were predicted with AlphaFold3 webserver with default settings 49 . The amino acid sequence of mouse LIGIV was used as the input. Five models were generated and the relaxed model with the highest confidence score was selected for analysis. The molecular graphics were made using PYMOL ( http://www.pymol.org/ ). Cell preparations Thymocyte, splenocyte, and MLN suspensions were prepared by grinding the appropriate organs through mesh filters. In addition, BM cells were extracted from the femur and tibia and passed through mesh filters. Furthermore, intestinal immune cells were prepared from the small intestine. In brief, fat and Peyer’s patches were dissected away before the small intestine was opened longitudinally and stirred in RPMI 1640 media (Nacalai Tesque) containing 2% fetal bovine serum (JR Scientific, Inc.) and 2 mM EDTA (Nacalai Tesque) for 20 min at 37°C. IELs were isolated from the supernatant using a 40%–75% Percoll density gradient (GE Healthcare) by collecting cells that layered between the 40% and 75% fractions. Following supernatant collection, the intestinal tissue was stirred for 20 min at 37°C in RPMI 1640 media (Nacalai Tasque) containing 2% fetal bovine serum before mincing and further stirring in 400 units/mL of collagenase D (Roche Diagnostics) and 10 μg/mL of DNase I (Sigma-Aldrich) for 20 min at 37°C. Floating cells were collected, and the collagenase digestion was repeated twice more. The pooled cell suspensions were then centrifuged on a 40%–70% Percoll density gradient, and cells that layered between the 40%–75% fractions were collected as LP cells. Statistical analysis Statistical analysis was performed using GraphPad Prism 9 (GraphPad Software). The data were compared using an unpaired student’s t -test, unless otherwise specified, and presented as the mean and standard error of the mean (SEM). P -values < 0.05 were considered statistically significant. Unless otherwise noted, * p < 0.05, ** p < 0.01, and *** p < 0.001. N.S., non-significant differences. Supplementary Methods Measurement of serum anti-dsDNA antibodies levels in mice Serum anti-dsDNA antibodies levels of Lig4 W447C/W447C mice and wild-type C57BL/6N were measured by enzyme-linked immunosorbent assay (ELISA) using LBIS Mouse anti-dsDNA ELISA Kit (Cat# 637-02691, FUJIFILM), following the manufacturer’s instructions. Histopathological evaluation of enteritis Enteritis was assessed using the inflammatory score reported by Erben et al. 1 . The inflammation score ranged from 0 (no disease) to 5 (severe disease) and was determined based on the severity and extent of inflammatory cell infiltration, epithelial changes, and mucosal architecture. Gut microbiota analyzed by 16S rRNA gene sequencing Stool samples were collected and sent to ICLAS Monitoring Center, Central Institute for Experimental Animals for gut microbiota analysis. The samples were homogenized, and part of the homogenate was suspended in a stool collection kit (TechnoSuruga Lab). DNA was extracted from the samples using the beads-phenol method. The extracted DNA was then used for terminal restriction fragment length polymorphism analysis targeting bacterial 16S rDNA. For fragment analysis, an ABI PRISM 310 Genetic Analyzer (Applied Biosystems) and GeneScan software (Applied Biosystems) were used. The length of each fragment was determined based on operational taxonomic unit, and the major bacterial taxa were roughly estimated using an in-house mouse gut microbiota database constructed by the laboratory. Author contributions Y.Y., S. Tamura and T. Kaisho designed the research. Y.Y., H.K., T. Kato, I.S., T.O., M.T., S. Tabata, K.N., K.T., K.S., Y.U., A.S., S.K., K.O. and Y.F. performed biochemical and histochemical experiments. T.M. performed in silico analyses on the LIGIV protein structures. Y.Y., H.H., T. Kaisho and S. Tamura generated and analyzed murine models. Y.Y., H.K., S.I., D.O. and S.H. performed genomic analyses. Y.Y., N.K., T.S., T. Kaisho and S. Tamura wrote and edited the manuscript. Competing interests The authors declare no competing interests. Supplementary information The online version contains Supplementary material available at…. Correspondence and requests for materials should be addressed to Yusuke Yamashita, Tsuneyasu Kaisho, and Shinobu Tamura. Extended Data Figures Extended Data Figure 1. Appearance and body weight of newborn mice, and γ H2AX foci assay in MEFs. (a) The appearance of one-day-old Lig4 +/W447C mice and Lig4 W447C/W447C littermates. The number indicates units of centimeters. The graph (right) depicts the weight of one-day-old littermate mice. ( Lig4 +/ W447C [ n = 4] and Lig4 W447C/W447C [ n = 3]) (b) γH2AX foci analysis in plateau-phase Lig4 +/+ , Lig4 +/W447C and Lig4 W447C/W447C MEFs after a 1 Gy irradiation. The data are presented as the mean ± standard error of the mean (SEM). P -values were calculated as follows: Within each MEF genotype, one-way analysis of variance (ANOVA) was conducted, followed by Tukey’s multiple comparison test. The Mann-Whitney U test was used to compare baseline measurements among different genotypes. Extended Data Figure 2. LIGIV protein structure predictive analysis . Structural insights into R278H (a) and Y288C (b) mutations. (a) R278 (LIGIV wild-type) indicated cyan ribbon and LIGIV H278 did magenta ribbon. (b) Y288 (LIGIV wild type) indicated cyan ribbon and LIGIV C288 indicated yellow ribbon. (a and b, left panels) Neither mutation caused overall structural change. (a, right panel) R278 and H278 binding to AMP are shown in stick representation (cyan and magenta, respectively). R278H mutation decreased the interface area of AMP-binding. (b, right panel) R278 and H278 binding to AMP are shown in stick representation (cyan and yellow, respectively). Neither Y288 nor C288 interacted with AMP-binding. Extended Data Figure 3. Anti-dsDNA antibody levels in serum measured by ELISA . Serum anti-dsDNA antibody levels in Lig4 +/+ and Lig4 W447C/W447C mice ( Lig4 +/+ [ n = 12] and Lig4 W447C/W447C [ n = 12]; 9–23 weeks). Extended Data Figure 4. FACS analysis of thymic T cells and splenic regulatory T cells . (a) The percentages dynamics of thymic T cells at various developmental stages, including double negative, double positive, and single positive (SP) in Lig4 +/+ and Lig4 W447C/W447C mice ( Lig4 +/+ [n = 4] and Lig4 W447C/W447C [n = 4]; 7–16 weeks). (b) FACS analysis of splenocytes labeled with CD4, CD25 and Foxp3 antibodies from Lig4 +/+ and Lig4 W447C/W447C mice. (c) Percentage of regulatory T cells in CD4+ splenocytes of Lig4 +/+ and Lig4 W447C/W447C mice ( Lig4 +/+ [ n = 5] and Lig4 W447C/W447C [ n = 5]; 18–24 weeks) using FACS analysis. Extended Data Figure 5. Inflammation of the small intestine in Lig4 W447C/W447C mice . (a) Hematoxylin and eosin (H&E) staining and immunohistochemical staining with CD4, F4/80 and B220 antibodies of the small intestine from Lig4 +/+ and Lig4 W447C/W447C mice. Scale bar represents 60 μm. (b) A small intestine inflammatory score of each mouse ( Lig4 +/+ [ n = 11] and Lig4 W447C/W447C [ n = 11]; 7–18 weeks). (c) FACS analysis of T cells labeled with T-cell receptor (TCR)β, TCRγδ, CD4, and CD8 antibodies in the lamina propria of Lig4 +/+ and Lig4 W447C/W447C mice. (d) The percentages of TCRβ + , TCRγδ + , and CD4 + T cells in the lamina propria of each mouse ( Lig4 +/+ [ n = 7] and Lig4 W447C/W447C [ n = 6]; 9–12 weeks). Extended Data Figure 6. Gut microbiota analyzed by 16S rRNA gene sequencing on the feces of Lig4 +/+ and Lig4 W447C/W447C mice . The proportion of intestinal flora did not differ significantly between Lig4 +/+ ( n = 8) and Lig4 W447C/W447C mice ( n = 8). The data are presented as the mean ± standard error of the mean (SEM). P -values were calculated using the unpaired student’s t -test. Extended Data Figure 7. Intracellular cytokine staining I ntracellular cytokine staining (IFN-γ, IL-17A, and IL-4) of CD4 + T cells in splenocytes from Lig4 +/+ Ifng +/+ , Lig4 W447C/W447 C Ifng +/+ and Lig4 W447C/W447C Ifng −/− mice. Extended Data Figure 8. TCR repertoire analysis using bulk RNA-sequencing (a-d) The bar graphs show the relative expression levels of each Trav and Trbv gene segment analyzed by bulk RNA-sequencing. Data are presented as a percentage of the total Trav and Trbv gene expression in individual Lig4 +/+ mice [n=3; White bars] and Lig4 W447C/W447C mice [n=3; red bars]. Gene segments are arranged in chromosomal order, from the 5’ end (left) to the 3’ end (right) of the Trav and Trbv loci. (a) Trav expression in the spleen. (b) Trav expression in the MLN. (c) Trbv expression in the spleen. (d) Trbv expression in the MLN. Extended Data Figure 9. TCR repertoire heatmaps of splenocytes samples analyzed by single-cell RNA-sequencing . Heatmaps showing the usage of Trav – Traj (a) and Trbv – Trbj (b) combinations. Splenocytes were prepared from individual mice ( Lig4 +/+ [n=1] and Lig4 W447C/W447C [n=3; exp #1, #2 and #3]) and analyzed by single-cell RNA-sequencing. (a) The x– and y-axis represents Trav and Traj segments, respectively, arranged from 5′ to 3′ end of the locus. The color gradient ranges from red to white, indicating high to low frequency of each Trav – Traj pair, respectively. The scale is shown on the right. (b) the x– and y-axis shows Trbv and Trbj segments, respectively, arranged from 5′ to 3′ end of the locus. The same color gradient as shown in (a) is used, with the scale shown on the right. Acknowledgments This work was supported by Grant-in-Aid for Transformative Research Areas (JP22H05182 and JP22H05187 to T. Kaisho. and JP22H05187 to I.S.), for Scientific Research (B) (JP26293106, JP17H04088, JP20H03505 and JP24K02298 to T. Kaisho), for Scientific Research (C) (JP19K07628 and JP22K07006 to I.S., JP21K12243 to S.K., JP19K08821 to T.S., JP20K08718 and JP23K07865 to S.T.), for Scientific Research on Innovative Areas (JP17H05799 and JP19H04813 to T. Kaisho), for Early-Career Scientists (JP20K17405 and JP22K16308 to Y.Y., JP25K19582 to H.K.), for Research Activity Start-up JP23K19487 to T.Kato), for JSPS Fellows (JP21J22615 to T. Kato), for Exploratory Research (JP17K19568 and JP21K19384 and JP23K18222 to T. Kaisho) from the Japan Society for the Promotion of Science, Takeda Science Foundation (to Y.Y., I.S. H.H. and T. Kaisho), GSK Japan Research Grant 2021 (to I.S.), Kowa Life Science Foundation (to I.S.). This work was also supported in part by the Wakayama Medical University Special Grant-in-Aid for Research Projects (K23TS03 to S.T.). We acknowledge proofreading and editing by Benjamin Phillis at the Clinical Study Support Center at Wakayama Medical University. We thank the Laboratory Animal Center at Wakayama Medical University for their technical support in generating the Ifng knockout mice and Yukako Hirato at Osaka Metropolitan University for technical assistance of γH2AX foci assay. Funder Information Declared Grant-in-Aid for Transformative Research Areas , JP22H05182 , JP22H05187 , JP22H05187 Grant-in-Aid for Scientific Research (B) Grant-in-Aid for Scientific Research (C) Grant-in-Aid for Scientific Research on Innovative Areas Grant-in-Aid for Early-Career Scientists Grant-in-Aid for Research Activity Start-up , JP23K19487 Grant-in-Aid for JSPS Fellows Grant-in-Aid for Exploratory Research , JP17K19568 , JP21K19384 , JP23K18222 Wakayama Medical University Special Grant-in-Aid for Research Projects , K23TS03 Footnotes Disclosure of potential conflict of interest: The authors declare that they have no relevant conflicts of interest. References 1. ↵ Ali , A. , Xiao , W. , Babar , M.E. & Bi , Y. Double-Stranded Break Repair in Mammalian Cells and Precise Genome Editing . Genes (Basel ) 13 ( 2022 ). 2. ↵ Stinson , B.M. & Loparo , J.J. Repair of DNA Double-Strand Breaks by the Nonhomologous End Joining Pathway . Annu Rev Biochem 90 , 137 – 164 ( 2021 ). OpenUrl CrossRef PubMed 3. ↵ Pannunzio , N.R. , Watanabe , G. & Lieber , M.R. Nonhomologous DNA end-joining for repair of DNA double-strand breaks . J Biol Chem 293 , 10512 – 10523 ( 2018 ). OpenUrl Abstract / FREE Full Text 4. ↵ Sekiguchi , J.M. et al. Nonhomologous end-joining proteins are required for V(D)J recombination, normal growth, and neurogenesis . Cold Spring Harb Symp Quant Biol 64 , 169 – 181 ( 1999 ). OpenUrl Abstract / FREE Full Text 5. ↵ Altmann , T. & Gennery , A.R. DNA ligase IV syndrome; a review . Orphanet J Rare Dis 11 , 137 ( 2016 ). OpenUrl CrossRef PubMed 6. ↵ Chistiakov , D.A. , Voronova , N.V. & Chistiakov , A.P. Ligase IV syndrome . Eur J Med Genet 52 , 373 – 378 ( 2009 ). OpenUrl CrossRef PubMed 7. ↵ Murray , J.E. et al. Extreme growth failure is a common presentation of ligase IV deficiency . Hum Mutat 35 , 76 – 85 ( 2014 ). OpenUrl CrossRef PubMed 8. ↵ Staines Boone , A.T., et al. Failing to Make Ends Meet: The Broad Clinical Spectrum of DNA Ligase IV Deficiency. Case Series and Review of the Literature . Front Pediatr 6 , 426 ( 2018 ). OpenUrl PubMed 9. ↵ Toita , N. et al. Epstein-Barr virus-associated B-cell lymphoma in a patient with DNA ligase IV (LIG4) syndrome . Am J Med Genet A 143a , 742 – 745 ( 2007 ). OpenUrl PubMed 10. ↵ van der Burg , M. et al. A new type of radiosensitive T-B-NK+ severe combined immunodeficiency caused by a LIG4 mutation . J Clin Invest 116 , 137 – 145 ( 2006 ). OpenUrl CrossRef PubMed Web of Science 11. ↵ Ben-Omran , T.I. , Cerosaletti , K. , Concannon , P. , Weitzman , S. & Nezarati , M.M. A patient with mutations in DNA Ligase IV: clinical features and overlap with Nijmegen breakage syndrome . Am J Med Genet A 137a , 283 – 287 ( 2005 ). OpenUrl 12. ↵ Jauch , A.J. et al. Autoimmunity and immunodeficiency associated with monoallelic LIG4 mutations via haploinsufficiency . J Allergy Clin Immunol 152 , 500 – 516 ( 2023 ). OpenUrl CrossRef 13. ↵ Sun , B. et al. LIG4 syndrome: clinical and molecular characterization in a Chinese cohort . Orphanet J Rare Dis 15 , 131 ( 2020 ). OpenUrl CrossRef PubMed 14. ↵ Taskiran , E.Z. et al. A Novel Missense LIG4 Mutation in a Patient With a Phenotype Mimicking Behçet’s Disease . J Clin Immunol 39 , 99 – 105 ( 2019 ). OpenUrl CrossRef PubMed 15. ↵ Gao , Y. et al. A critical role for DNA end-joining proteins in both lymphogenesis and neurogenesis . Cell 95 , 891 – 902 ( 1998 ). OpenUrl CrossRef PubMed Web of Science 16. ↵ Frank , K.M. et al. Late embryonic lethality and impaired V(D)J recombination in mice lacking DNA ligase IV . Nature 396 , 173 – 177 ( 1998 ). OpenUrl CrossRef PubMed Web of Science 17. ↵ Park , J. et al. The DNA Ligase IV Syndrome R278H Mutation Impairs B Lymphopoiesis via Error-Prone Nonhomologous End-Joining . J Immunol 196 , 244 – 255 ( 2016 ). OpenUrl Abstract / FREE Full Text 18. ↵ Gatz , S.A. et al. Requirement for DNA ligase IV during embryonic neuronal development . J Neurosci 31 , 10088 – 10100 ( 2011 ). OpenUrl Abstract / FREE Full Text 19. ↵ Rucci , F. et al. Homozygous DNA ligase IV R278H mutation in mice leads to leaky SCID and represents a model for human LIG4 syndrome . Proc Natl Acad Sci U S A 107 , 3024 – 3029 ( 2010 ). OpenUrl Abstract / FREE Full Text 20. ↵ Nijnik , A. et al. Impaired lymphocyte development and antibody class switching and increased malignancy in a murine model of DNA ligase IV syndrome . J Clin Invest 119 , 1696 – 1705 ( 2009 ). OpenUrl CrossRef PubMed Web of Science 21. ↵ Nijnik , A. et al. DNA repair is limiting for haematopoietic stem cells during ageing . Nature 447 , 686 – 690 ( 2007 ). OpenUrl CrossRef PubMed Web of Science 22. ↵ Tamura , S. et al. Novel compound heterozygous DNA ligase IV mutations in an adolescent with a slowly-progressing radiosensitive-severe combined immunodeficiency . Clin Immunol 160 , 255 – 260 ( 2015 ). OpenUrl CrossRef PubMed 23. ↵ Kaminski , A.M. et al. Structures of DNA-bound human ligase IV catalytic core reveal insights into substrate binding and catalysis . Nat Commun 9 , 2642 ( 2018 ). OpenUrl CrossRef PubMed 24. ↵ Braams , M. , Pike-Overzet , K. & Staal , F.J.T. The recombinase activating genes: architects of immune diversity during lymphocyte development . Front Immunol 14 , 1210818 ( 2023 ). OpenUrl CrossRef PubMed 25. ↵ Bosticardo , M. , Pala , F. & Notarangelo , L.D. RAG deficiencies: Recent advances in disease pathogenesis and novel therapeutic approaches . Eur J Immunol 51 , 1028 – 1038 ( 2021 ). OpenUrl CrossRef PubMed 26. ↵ Delmonte , O.M. , Villa , A. & Notarangelo , L.D. Immune dysregulation in patients with RAG deficiency and other forms of combined immune deficiency . Blood 135 , 610 – 619 ( 2020 ). OpenUrl CrossRef PubMed 27. ↵ Villa , A. & Notarangelo , L.D. RAG gene defects at the verge of immunodeficiency and immune dysregulation . Immunol Rev 287 , 73 – 90 ( 2019 ). OpenUrl CrossRef PubMed 28. ↵ Notarangelo , L.D. , Kim , M.S. , Walter , J.E. & Lee , Y.N. Human RAG mutations: biochemistry and clinical implications . Nat Rev Immunol 16 , 234 – 246 ( 2016 ). OpenUrl CrossRef PubMed 29. ↵ Rigoni , R. et al. Intestinal microbiota sustains inflammation and autoimmunity induced by hypomorphic RAG defects . J Exp Med 213 , 355 – 375 ( 2016 ). OpenUrl Abstract / FREE Full Text 30. ↵ Cassani , B. et al. Homeostatic expansion of autoreactive immunoglobulin-secreting cells in the Rag2 mouse model of Omenn syndrome . J Exp Med 207 , 1525 – 1540 ( 2010 ). OpenUrl Abstract / FREE Full Text 31. ↵ Marrella , V. et al. A hypomorphic R229Q Rag2 mouse mutant recapitulates human Omenn syndrome . J Clin Invest 117 , 1260 – 1269 ( 2007 ). OpenUrl CrossRef PubMed Web of Science 32. ↵ Risnes , L.F. et al. Disease-driving CD4+ T cell clonotypes persist for decades in celiac disease . J Clin Invest 128 , 2642 – 2650 ( 2018 ). OpenUrl CrossRef PubMed 33. ↵ Gomez-Tourino , I. , Kamra , Y. , Baptista , R. , Lorenc , A. & Peakman , M. T cell receptor β-chains display abnormal shortening and repertoire sharing in type 1 diabetes . Nat Commun 8 , 1792 ( 2017 ). OpenUrl CrossRef PubMed 34. ↵ Chen , R. , et al. NUDCD3 deficiency disrupts V(D)J recombination to cause SCID and Omenn syndrome . Sci Immunol 9 , eade5705 ( 2024 ). OpenUrl CrossRef PubMed 35. ↵ Berland , A. et al. PROMIDISα: A T-cell receptor α signature associated with immunodeficiencies caused by V(D)J recombination defects . J Allergy Clin Immunol 143 , 325 – 334 .e322 ( 2019 ). OpenUrl CrossRef 36. ↵ Vera , G. et al. Cernunnos deficiency reduces thymocyte life span and alters the T cell repertoire in mice and humans . Mol Cell Biol 33 , 701 – 711 ( 2013 ). OpenUrl Abstract / FREE Full Text 37. ↵ Kanazawa , N. et al. Heterozygous missense variant of the proteasome subunit β-type 9 causes neonatal-onset autoinflammation and immunodeficiency . Nat Commun 12 , 6819 ( 2021 ). OpenUrl CrossRef PubMed 38. ↵ Shinkai , Y. et al. RAG-2-deficient mice lack mature lymphocytes owing to inability to initiate V(D)J rearrangement . Cell 68 , 855 – 867 ( 1992 ). OpenUrl CrossRef PubMed Web of Science 39. ↵ Sakaguchi , K. , Shiraishi , K. & Kodama , S. High susceptibility of mouse newborns to delayed appearance of DNA double-strand breaks in neural stem/progenitor cells exposed to ionizing radiation . J Radiat Res 59 , 685 – 691 ( 2018 ). OpenUrl PubMed 40. ↵ Koelink , P.J. et al. Development of Reliable, Valid and Responsive Scoring Systems for Endoscopy and Histology in Animal Models for Inflammatory Bowel Disease . J Crohns Colitis 12 , 794 – 803 ( 2018 ). OpenUrl CrossRef PubMed 41. ↵ Yamashita , Y. et al. Targeting Adaptive IRE1alpha Signaling and PLK2 in Multiple Myeloma: Possible Anti-Tumor Mechanisms of KIRA8 and Nilotinib . Int J Mol Sci 21 ( 2020 ). 42. ↵ Orimo , T. et al. Cholera toxin B induces interleukin-1β production from resident peritoneal macrophages through the pyrin inflammasome as well as the NLRP3 inflammasome . Int Immunol 31 , 657 – 668 ( 2019 ). OpenUrl CrossRef PubMed 43. ↵ Ohta , T. et al. Crucial roles of XCR1-expressing dendritic cells and the XCR1-XCL1 chemokine axis in intestinal immune homeostasis . Sci Rep 6 , 23505 ( 2016 ). OpenUrl CrossRef PubMed 44. ↵ Subramanian , A. et al. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles . Proc Natl Acad Sci U S A 102 , 15545 – 15550 ( 2005 ). OpenUrl Abstract / FREE Full Text 45. ↵ Mootha , V.K. et al. PGC-1alpha-responsive genes involved in oxidative phosphorylation are coordinately downregulated in human diabetes . Nat Genet 34 , 267 – 273 ( 2003 ). OpenUrl CrossRef PubMed Web of Science 46. ↵ Torre , D. , Lachmann , A. & Ma’ayan , A. BioJupies: Automated Generation of Interactive Notebooks for RNA-Seq Data Analysis in the Cloud . Cell Syst 7 , 556 – 561 .e553 ( 2018 ). OpenUrl CrossRef PubMed 47. ↵ Metsalu , T. & Vilo , J. ClustVis: a web tool for visualizing clustering of multivariate data using Principal Component Analysis and heatmap . Nucleic Acids Res 43 , W566 – 570 ( 2015 ). OpenUrl CrossRef PubMed 48. ↵ Lu , X. et al. Identification of conserved SARS-CoV-2 spike epitopes that expand public cTfh clonotypes in mild COVID-19 patients . J Exp Med 218 ( 2021 ). 49. ↵ Abramson , J. et al. Accurate structure prediction of biomolecular interactions with AlphaFold 3 . Nature 630 , 493 – 500 ( 2024 ). OpenUrl CrossRef PubMed Supplementary Reference 1. Erben , U. et al. A guide to histomorphological evaluation of intestinal inflammation in mouse models . Int J Clin Exp Pathol 7 , 4557 – 4576 ( 2014 ). OpenUrl PubMed View the discussion thread. Back to top Previous Next Posted May 17, 2025. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Hypomorphic Lig4 gene mutation in mice predisposes to Th1-skewing intestinal inflammation Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Hypomorphic Lig4 gene mutation in mice predisposes to Th1-skewing intestinal inflammation Yusuke Yamashita , Hideki Kosako , Takashi Kato , Izumi Sasaki , Sadahiro Iwabuchi , Tadashi Okamura , Misato Tane , Shotaro Tabata , Kazutaka Nakashima , Ken Tanaka , Kazunori Shiraishi , Yuki Uchihara , Daisuke Okuzaki , Atsushi Shibata , Tsunehiro Mizushima , Hiroaki Hemmi , Nobuo Kanazawa , Seiji Kodama , Kouichi Ohshima , Shinichi Hashimoto , Yoshio Fujitani , Takashi Sonoki , Shinobu Tamura , Tsuneyasu Kaisho bioRxiv 2025.05.14.654009; doi: https://doi.org/10.1101/2025.05.14.654009 Share This Article: Copy Citation Tools Hypomorphic Lig4 gene mutation in mice predisposes to Th1-skewing intestinal inflammation Yusuke Yamashita , Hideki Kosako , Takashi Kato , Izumi Sasaki , Sadahiro Iwabuchi , Tadashi Okamura , Misato Tane , Shotaro Tabata , Kazutaka Nakashima , Ken Tanaka , Kazunori Shiraishi , Yuki Uchihara , Daisuke Okuzaki , Atsushi Shibata , Tsunehiro Mizushima , Hiroaki Hemmi , Nobuo Kanazawa , Seiji Kodama , Kouichi Ohshima , Shinichi Hashimoto , Yoshio Fujitani , Takashi Sonoki , Shinobu Tamura , Tsuneyasu Kaisho bioRxiv 2025.05.14.654009; doi: https://doi.org/10.1101/2025.05.14.654009 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Immunology Subject Areas All Articles Animal Behavior and Cognition (7624) Biochemistry (17651) Bioengineering (13871) Bioinformatics (41882) Biophysics (21424) Cancer Biology (18566) Cell Biology (25461) Clinical Trials (138) Developmental Biology (13365) Ecology (19867) Epidemiology (2067) Evolutionary Biology (24290) Genetics (15590) Genomics (22476) Immunology (17714) Microbiology (40331) Molecular Biology (17148) Neuroscience (88483) Paleontology (666) Pathology (2828) Pharmacology and Toxicology (4817) Physiology (7635) Plant Biology (15114) Scientific Communication and Education (2044) Synthetic Biology (4286) Systems Biology (9815) Zoology (2268)

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-22T02:00:06.705733+00:00
License: CC-BY-4.0