New method for Phytophthora cactorum culturing using plant host as material to prepare agar medium

New method for Phytophthora cactorum culturing using plant host as material to prepare agar medium | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article New method for Phytophthora cactorum culturing using plant host as material to prepare agar medium Shengping Zhang, Ying Cheng, Jiaqiang Zhao, Kuijing Liang, Yupeng Pu, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5362421/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 18 Apr, 2025 Read the published version in Scientific Reports → Version 1 posted 12 You are reading this latest preprint version Abstract Phytophthora cactorum , which is the pathogen of apple Phytophthora rot, has a reported plant host range of more than two hundred species. Usually, Phytophthora cactorum is cultured on V8 juice agar medium in the laboratory. While V8 juice could not be got easily in most cities of China. In theory, hosts as materials can be used for screening agar mediums of plant pathogen. However, little work has been done on plant hosts as materials to screen agar mediums of Phytophthora cactorum . In this study, we used chamber assays to determine the host plant species of Phytophthora cactorum following artificial inoculation. Subsequently, some of these healthy host tissues were individually selected as materials to screen agar mediums of Phytophthora cactorum . The results indicated that host juice, such as Pepper fruit, Tomato leaves, Oakleaf goosefoot leaves, could be used to prepare agar mediums for Phytophthora cactorum culturing. In the laboratory, these host tissues could be selected to produce agar mediums respectively for Phytophthora cactorum culturing in place of V8 juice agar medium. Biological sciences/Microbiology Biological sciences/Plant sciences Apple Phytophthora rot Phytophthora cactorum Plant hosts Agar mediums Secondary infection sources. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction Apple Phytophthora rot is an important disease during apple trees planting in the world, with the characteristics of weakening the trees and leading to fruit yield losses and eventual tree death 1 – 4 . Phytophthora cactorum (Lebert & Cohn) J. Schröt ( Phytophthora cactorum ) is the pathogen of apple Phytophthora rot. As is known to all, the notorious Phytophthora cactorum is an soilborne and has a broad range of hosts 5 – 16 . Usually, there are many different kinds of plant species in the apple orchards of HeBei province in China. The hypothesis is that some of these plant species may be proper hosts of Phytophthora cactorum . In the laboratory, people usually culture Phytophthora cactorum on V8 juice agar medium or Carrot agar medium. It was only reported that Celery juice as material could used to produce liquid medium of Phytophthora cactorum in 2012 17 . Until now, there has been no reports about Phytophthora cactorum culturing on other agar mediums. In theory, using plant host as material to product agar medium for Phytophthora cactorum culturing is practicable alternative in the laboratory. However, plant host juice as material to produce agar medium of Phytophthora cactorum has not been reported. In this work, chamber assays were conducted to determine the diseased plant species caused by Phytophthora cactorum following artificial inoculation. We identified the hosts of Phytophthora cactorum by secondary infection on detached apple leaves, and also detection in diseased apple leaves for containing special genes of Phytophthora cactorum. Subsequently, some of these healthy host tissues were selected as materials to screen agar mediums of Phytophthora cactorum. The aim of this work is then to evaluate that proper agar mediums prepared by hosts of Phytophthora cactorum . Furthermore, plant hosts containing Phytophthora cactorum may be potential secondary infection sources of apple Phytophthora rot. Materials and methods The present study was carried out in Lab of Institute of Shingjiazhuang Fruit Trees, HeBei Academy of Agriculture and Forestry Sciences, Shingjiazhuang, China. Phytophthora cactorum strain in the experiment The strain of Phytophthora cactorum ( Phytophthora cactorum -SGS) is stored in 10°C (Shingjiazhuang Institute of Fruit Trees, HeBei Academy of Agriculture and Forestry Sciences). Phytophthora cactorum were routinely cultured on 10% V8 juice agar medium (V8 juice/water [1:10] with 2% agar, sterilized at 121°C for 20 min) at 26°C ± 1°C in the dark for 96 h (Fig S1). Mycelial plugs (7 mm×7 mm) were cultured in 10% V8 juice medium (V8 juice/water [1:10] with 2‰ CaCO 3 , sterilized at 121°C for 20 min) in the dark, 26°C ± 1°C, 160 rpm for 120 h. Then we would got the mycelial pellet of the Phytophthora cactorum (Fig S1). Mycelial pellet was washed with sterile water for three times. Subsequently, the mycelial pellet was transferred to Petri dishes containing 25 mL sterile water at 26°C for 2 d in darkness. In order to obtain Phytophthora cactorum suspension containing more lots of zoospores, the Petri dishes was placed in refrigerator at 4°C for 2 h. Total DNA was extracted from 10 mg of each mycelial pellet using Fungi Genomic DNA extract Kit D2300 (Beijing Solarbio Science and Technology Co,. Ltd.). Phytophthora cactorum were identified by PCR method for containing genes of ITS (internal transcribed spacer region of the ribosomal DNA of Phytophthora cactorum ), PC1 18 , PCA 19 and SCR96 20 . Primer sequences of these genes are as Table 1. Table 1 Primer ' s sequences in the experiment Gene Name Primer's sequences (5'-3') Length of fragment ITS ITS1-F TCCGTAGGTGAACCTGCGG 866 bp ITS4-R TCCTCCGCTTATTGATATGC PC1 PC1-F GAAACGGGTGTTGATATCGGAC 450 bp PC1-R GTTTCGGGTGCTGCCAAAAACT PCA PCA-F AGCAGACGTGGCGTGTTT 211 bp PCA-R TACACACGTTGGACGCACCT SCR96 SCR96-F CCCACCTCCGAACAGTACA 392 bp SCR96-R GGACAGAGGAGGGAGGAAAG To ITS gene amplification, each PCR reaction contained a 25 µL solution of 10 µL mix (Biotech Co., Ltd. Hangzhou, China), 1 µL (100 nmol/µL) each of the primers, 2 µL of template, and 11 µL of sterile distilled water. PCR cycling conditions were as follows: 94°C for 5 min; 35 cycles of 94°C for 30 s, 58°C for 30 s and 72°C for 1 min; followed by a final extension at 72°C for 10 min, and a 4°C hold. To PC1 gene amplification, each PCR reaction contained a 25 µL solution of 10 µL mix (Biotech Co., Ltd. Hangzhou, China), 1 µL (100 nmol/µL) each of the primers, 2 µL of template, and 11 µL of sterile distilled water. PCR cycling conditions were as follows: 94°C for 5 min; 35 cycles of 94°C for 30 s, 61°C for 30 s and 72°C for 1 min; followed by a final extension at 72°C for 10 min, and a 4°C hold. To PCA gene amplification, each PCR reaction contained a 25 µL solution of 12.5 µL mix (Biotech Co., Ltd. Hangzhou, China), 1 µL (100 nmol/µL) each of the primers, 1 µL of template, and 9.5 µL of sterile distilled water. PCR cycling conditions were as follows: 94°C for 5 min; 35 cycles of 94°C for 30 s, 60°C for 45 s and 72°C for 1 min; followed by a final extension at 72°C for 10 min, and a 4°C hold. To SCR96 gene amplification, each PCR reaction contained a 25 µL solution of 10 µL mix (Biotech Co., Ltd. Hangzhou, China), 1 µL (100 nmol/µL) each of the primers, 2 µL of template, and 11 µL of sterile distilled water. PCR cycling conditions were as follows: 94°C for 5 min; 35 cycles of 94°C for 30 s, 60°C for 30 s and 72°C for 1 min; followed by a final extension at 72°C for 10 min, and a 4°C hold. Phytophthora cactorum inoculation on different plant species Sixteen different kinds of plant species were used for Phytophthora cactorum inoculation (Table 2). Healthy plant tissues were individually disinfected for 2 min with 95% ethyl alcohol, and then removed the ethyl alcohol with sterile water. Sterilized absorbent cotton containing Phytophthora cactorum suspension (10 µL) was inoculated on disinfected healthy plant tissue. Negative controls were healthy plant tissues with sterile water (10 µL) treatment. Healthy apple leaves were inoculated with equal concentration of Phytophthora cactorum suspension (10 µL) as positive controls. All plant samples were placed into a incubator for 16 h at 26°C (day) and 8 h at 26°C (night). Relative humidity in the incubator was 100%. Lesion area on tissue was calculated by method of graph paper. The size of the lesion was measured and photographed at ten days post inoculation. All treatments were repeated three times with three biological replicates. Lesion differences were evaluated statistically with Student's t test. Table 2 Plant species in the experiment NO. Name Latin name Tissues 1 Japanese false bindweed Calystegia hederacea Wall. Leaves 2 Strawberry Fragaria × ananassa Duch. Leaves 3 Tomato Solanum lycopersicum L. Leaves 4 Cucumber Cucumis sativus L. Leaves 5 Shepherd's purse Capsella bursa-pastoris (L.) Medik. Leaves 6 Pear Pyrus bretschneideri Rehd. Leaves 7 Chinese rose Rosa chinensis var. chinensis Leaves 8 Oakleaf goosefoot Chenopodium album L. Leaves 9 Horseweed Erigeron canadensis L. Leaves 10 Wheat Triticum aestivum L. Leaves 11 Oriental cherry Cerasus serrulata var. lannesiana (Carr.) Makino Leaves 12 Herba lagopsis Lagopsis supina (Steph.ex Willd.) Ikonn.-Gal. Leaves 13 Pepper Capsicum annuum L. Fruit 14 Eggplant Solanum melongena L. Leaves 15 Apricot Armeniaca vulgaris Lam. Fruit 16 Bell pepper Capsicum annuum Linn. var. grossum (L.) Sendt. Fruit 17 Apple Malus pumila Mill. Leaves Phytophthora cactorum detection in diseased plant species Total DNA was extracted from 10 mg of each diseased plant sample using Super plant genomic DNA Kit DP360 (Tiangen Biotech Co,. Ltd.). Healthy plant tissue with sterile water treatment was as control. The diseased samples were detected by PCR method for containing three special genes ( PC1 , PCA and SCR96) of Phytophthora cactorum . The Phytophthora cactorum detection procedure was the same as 2.1. Sterile water was as negative control in agarose gel electrophoresis. Phytophthora cactorum isolation from diseased plant species Plant samples with obvious symptoms were for Phytophthora cactorum isolation. The operation procedures were listed as follows. Firstly, surface of diseased plant sample was washed by sterile water. Secondly, diseased plant sample was disinfected with 95% ethyl alcohol for 2 min. Thirdly, diseased plant sample (leaf tissue [25 mm 2 , 5 mm×5 mm], fruit tissue [125 mm 3 , 5 mm×5 mm×5 mm) was cut from lesion edge, and then was bleached with 0.3% NaClO solution for 2 min. Fourth, NaClO solution was removed from surface of plant sample by sterile water. Plant sample was transferred to Carrot juice agar medium (Carrot juice/water[1:5] with 2% agar, sterilized at 121°C for 20 min). Subsequently, all plant samples were placed into incubator at 26°C ± 1°C in the dark for 120 h, and then to isolate the pathogen using a capillary of 0.8 mm in diameter, single hyphal strands were selected from colony edges, yielding isolates. The isolate (mycelial plug, 7 mm×7 mm) was inoculated on Carrot juice agar medium for purification (96 h). Afterwards, mycelial plug (7 mm in diameter) from the edge of the colony was inoculated in 70 mL of V8 juice medium in 100 mL Erlenmeyer flasks. The flasks were incubated in darkness at 26°C ± 1°C, 160 rpm for 120 h. All isolates were identified as Phytophthora cactorum basing on sequences of genes ( ITS , PC1 , PCA and SCR96) and morphology 21–23 . Pathogenicity of Phytophthora cactorum isolation on apple leaves In order to verify the pathogenicity of isolated Phytophthora cactorum on apple leaves, all Phytophthora cactorum isolates (from diseased plant species respectively) were individually inoculated on healthy apple leaves using sterilized absorbent cotton (containing 10 µL Phytophthora cactorum suspension). Healthy apple leaves inoculation with 10 µL sterile water were as blank controls. All apple leaves were placed into another incubator for 16 h at 26°C (day) and 8 h at 26°C (night). Relative humidity in the incubator was 100%. Each treatment was repeated three times. The symptoms on apple leaves were observed at 10 days post inoculation. Apple leaves were detected by PCR method for containing three special genes ( PC1 , PCA and SCR96 ) of Phytophthora cactorum. Screening agar mediums of Phytophthora cactorum Some healthy host plant species, which could cause diseases obviously above, were selected as materials to prepare agar mediums for screening agar mediums of Phytophthora cactorum. Respectively, healthy leaves of Black nightshade (a kind of plant species are almost present in apple orchards of HeBei province in China), healthy Celery stems were also selected as material to produce agar medium for culturing Phytophthora cactorum. Carrot juice agar medium and V8 juice agar medium were for positive controls. Agar medium containing no juice was as negative control. Procedure was as follows. Step 1: Plant tissue was washed by sterile water, then disinfected with 95% ethyl alcohol for 2 min, then removed ethyl alcohol by sterile water for three times at last. Step 2: Disinfected plant tissue (55 ± 5g) was as material to got homogenate. The homogenate was filtered out residue through eight layers of gauze. Proper pH value (7.0-7.2) of filtrate was adjusted by HCl or NaOH solution. Step 3: Agar powder (10 g) was added into the filtrate, then the mixture (250 mL) was prepared by supplementary of sterile water. Mixture was for sterilization at 121°C, 20 min. Step 4: Respectively, mycelial plugs (7 mm in diameter) from V8 juice agar medium were individually cultured on these agar mediums in darkness, at 26°C ± 1°C, for 120 h. Colony diameter was of Phytophthora cactorum measured after 120 hours of incubation. Morphology of sporangia and hyphae of all colonies were individually observed by microscopic. Step 5: Mycelial plug (7 mm in diameter) from the edge of the colony was inoculated in 70 mL of Carrot juice medium (Carrot juice/water[1:5] with 2‰ CaCO 3 , sterilized at 121°C for 20 min) in 100 mL Erlenmeyer flasks. The flasks were incubated in darkness at 26°C ± 1°C, 160 rpm for 120 h. These mycelial pellets (got from colonies respectively) were identified as Phytophthora cactorum basing on sequences of genes ( ITS , PC1 , PCA and SCR96) . Step 6: Respectively, sterilized absorbent cotton containing Phytophthora cactorum suspension (10 µL) was inoculated on healthy apple leaves. Healthy apple leaves inoculation with the same volume of sterile water (10 µL) were used as blank controls. All apple leaves were placed into a incubator for 16 h at 26°C (day) and 8 h at 26°C (night). Relative humidity in the incubator was 100%. The symptoms on apple leaves were also observed at ten days post inoculation. Each treatment was with three biological replicates. Apple leaves were detected by PCR method for containing three special genes ( PC1 , PCA and SCR96 ) of Phytophthora cactorum. Data statistical analysis of colony areas for Phytophthora cactorum on different agar mediums Data were compared using a one-way analysis of variance (ANOVA) test followed by Least significance difference test (LSD). The average values from three samples were for the graphics. Results Phytophthora cactorum virulence on different kinds of plant species The typical symptoms of rotten (the same as to apple leaves) were appeared on ten kinds of plant species (Pear, Oriental cherry, Apricot, Strawberry, Chinese rose, Eggplant, Pepper, Tomato, Bell pepper and Oakleaf goosefoot) and Apple leaves. However, no obvious lesions were appeared in the same sites of the rest of six kinds of plant species (Japanese false bindweed, Cucumber, Shepherd's purse, Horseweed, Wheat and Herba lagopsis) (Fig. 1). Differences in lesion areas of sixteen kinds of plant species (and also apple leaves) were observed at ten days post inoculation (Fig S2). Three special genes of Phytophthora cactorum could be detected in these ten kinds of plant tissues ten days post inoculation using agarose gel electrophoresis, which had the same bands as to apple leaves. While, no bands were detected in the plant tissues with sterile water treatment and the negative control (Fig. 2). We deduced Phytophthora cactorum could cause diseases on these ten kinds of plant species. Phytophthora cactorum isolation from diseased plant species Microbes were individually isolated from diseased plant species (including diseased Apple leaves). Phenotype of ten colonies (isolation from Pear, Oriental cherry, Apricot, Strawberry, Chinese rose, Eggplant, Pepper, Tomato, Bell pepper and Oakleaf goosefoot, respectively) showed the same performance as to Phytophthora cactorum from diseased Apple leaves (Fig. 3). By culturing plugs in 10% V8 juice medium, we could get mycelial pelletsrespectively(Fig S3). These mycelial pellets had the same forms as to Phytophthora cactorum (Fig S1). Through PCR, the results showed that microbes from these different plates appeared the same bands as to Phytophthora cactorum from apple leaves (Fig S4). It proved Phytophthora cactorum were isolated from these diseased plant species respectively. Phytophthora cactorum from diseased hosts has virulence on apple leaves Phytophthora cactorum fromten kinds of plant species (Pear, Oriental cherry, Apricot, Strawberry, Chinese rose, Eggplant, Pepper, Tomato, Bell pepper and Oakleaf goosefoot) above respectively inoculated on healthy apple leaves. The inoculation healthy apple leaves showed typical symptoms of collar rot at ten days post inoculation, while the healthy apple leaves with sterile water treatment had no symptoms (Fig. 4). The diseased apple leaves were for special genes of Phytophthora cactorum detection. Results showed that bands of PC1 , PCA and SCR96 were appeared. However, healthy apple leaves with sterile water treatment had no bands (Fig S5). As we expected, Phytophthora cactorum from these hosts respectively could cause diseases on apple leaves. Screening agar mediums of Phytophthora cactorum According to host species of Phytophthora cactorum above, eight kinds of healthy host tissues (Bell pepper fruits, Pepper fruits, Tomato leaves, Oakleaf goosefoot leaves, Eggplant leaves, Strawberry leaves, Oriental cherry leaves, Apple leaves, Pear leaves) were individually selected as materials to produce juice agar mediums (Table 2) . Black nightshade leaves, Celery stems were also used as material for preparing agar mediums respectively. According to the results, we discovered Phytophthora cactorum (culturing on agar mediums of Bell pepper, Celery, Pepper, Tomato, Oakleaf goosefoot, Eggplant, Black nightshade respectively) had the same phenotype as to them on Carrot juice agar medium or V8 juice agar medium five days later. Phytophthora cactorum could not be cultured on other agar mediums normally, such as Pear, Apple, Strawberry, Oriental cherry and the Control plate containing no juice (Fig. 5). The colony areas of Phytophthora cactorum increased in the order of Carrot>Bell pepper>Celery>Pepper>Tomato>Oakleaf goosefoot>V8 juice>Eggplant>Black nightshade> Oriental cherry=Strawberry=Apple>Pear>CK (Fig S6). Comparing to V8 juice agar medium, some agar mediums (produced by Pepper fruit, Tomato leaves, Oakleaf goosefoot leaves respectively) and also Carrot juice agar medium had a better effect on Phytophthora cactorum culturing. Microscopic observationwas for detection of sporulation capacity of Phytophthora cactorum on agar mediums. Sporangia and hyphae could be observed on some of agar mediums, such as Carrot, Celery, Pepper, Tomato, Oakleaf goosefoot and V8 juice. Although hyphae of Phytophthora cactorum could be observed on agar medium of Bell pepper juice, no obvious sporangia was discovered (Fig. 6). It indicated Phytophthora cactorum had the sporulation capacity on these three kinds of agar mediums. Respectively, plant hosts (Pepper, Tomato, Oakleaf goosefoot ) as materials can be used to produce agar mediums for Phytophthora cactorum culturing in the laboratory. Evaluation of pathogenicity for Phytophthora cactorum isolation from newagarmedium By culturing Phytophthora cactorum plugs (from agar mediums of Carrot juice, Bell pepper juice, Celery juice, Pepper juice, Tomato, Oakleaf goosefoot juice, V8 juice, Eggplant, Black nightshade juice respectively) in Carrot juice mediums, we got mycelial pellets of the Phytophthora cactorum (Fig. 7). These mycelial pellets had the same forms as to Phytophthora cactorum culturing in V8 juice medium (Fig S1). Respectively, these nine mycelial pellets were identified by PCR method. Results showed that the same bands were appeared as to Phytophthora cactorum (Fig S7). To identify pathogenicity of Phytophthora cactorum onapple leaves (from agar mediums produced by Bell pepper, Pepper, Tomato, Oakleaf goosefoot, Eggplant, Black nightshade respectively), we individually inoculated Phytophthora cactorum suspension (culturing in Carrot juice mediums respectively) on healthy apple leaves. The results showed the same symptoms as to collar rot at ten days post inoculation (Fig. 8). By PCR, it indicated that all diseased apple leaves couldproduce the same bands as to three special genes ( PC1 , PCA and SCR96 ), which was consistent with the band of the positive control lane ( Phytophthora cactorum ) (Fig S8). In contrast, no Phytophthora cactorum was detected in the apple leaves with sterile water treatment. It proved that Phytophthora cactorum , culturing onsome new agar mediums (such asBell pepper, Pepper, Tomato, Oakleaf goosefoot, Eggplant respectively), could also be cultured in Carrot juice medium. Subsequently, these Phytophthora cactorum strains could still cause diseases on healthy apple leaves. According to the research results, Phytophthora cactorum culturing on agar mediums (produced by Pepper, Tomato, Oakleaf goosefoot respectively) have strong capacity of growth and reproduction. Collectively, the agar mediums preparing with plant hosts, such as Pepper, Tomato, Oakleaf goosefoot respectively, are suitable for Phytophthora cactorum culturing in the laboratory. Discussion Apple Phytophthora rot, incited by Phytophthora cactorum , is an important disease of apple trees worldwide 1 – 4 . In recent years, apple Phytophthora rot has been observed in so many apple orchards of China .along with the increasing of growing area of apple trees (with the characteristics of dwarfing stocks and close planting). Phytophthora cactorum is an soilborne and has a reported host range of more than 200 species, spanning at least 154 genera of vascular plants within 54 families 5 – 7 , 24 . In theory, hosts as materials can be used for screening agar mediums of plant pathogen. Although Celery juice as material can be used for produce liquid medium of Phytophthora cactorum 17 , little studies have been done about screening agar mediums of Phytophthora cactorum using plant host material. V8 juice has so far been the major material for Phytophthora cactorum culturing in laboratory. However, V8 juice can not be acquired at the local market easily in the most cities of China. It is meaningful to develop new agar mediums for Phytophthora cactorum culturing in the laboratory. In this work, we used chamber assays to determine the host plant species of Phytophthora cactorum following artificial inoculation. Respectively, some of these healthy hosts were selected as materials to produce agar mediums for Phytophthora cactorum culturing. According to the results, we found that some agar mediums (produced by Pepper fruits, Celery stems, Tomato leaves, Oakleaf goosefoot leaves respectively) had the better effect on Phytophthora cactorum culturing than V8 juice. More than that, Phytophthora cactorum also have the sporulation capacity on these four agar mediums above. Interestingly, leaves of Oakleaf goosefoot can be caused diseases by Phytophthora cactorum. Agar medium containing filtrate of Oakleaf goosefoot leaves juice could culture Phytophthora cactorum normally. In China, the weed of Oakleaf goose is widespread in most orchards from March to October a year. The cost of the experiment will be reduced greatly by using Oakleaf goose in place of V8 juice for Phytophthora cactorum culturing in the laboratory. Another phenomenon is others agar mediums (produced by Oriental cherry leaves, Strawberry leaves, Apple leaves, Pear leaves receptively) could not be for Phytophthora cactorum culturing normally. As the proper hosts of Phytophthora cactorum , these agar mediums containing host filtrate respectively could not culture Phytophthora cactorum normally. It is a new subject worthwhile to research. Unlike the United States, Phytophthora cactorum is not known to occur in irrigation water by canal irrigation for lack of irrigation system in most of orchards in China 11 , 4 . It is widely accepted that Phytophthora cactorum is mainly spread to the upper plant by splashing in China, then the proper environment is responsible for epidemic of apple Phytophthora rot 25 . In the study, some plant species were discovered as the proper hosts of Phytophthora cactorum . Although we can not prove that Phytophthora cactorum have the sporulation capacity on these host plants ( Phytophthora cactorum could not produce spores on agar medium of Bell pepper), the total of Phytophthora cactorum surely will infect these plant hosts. So plant hosts containing Phytophthora cactorum are the secondary sources of apple Phytophthora rot. With the help of wind, Phytophthora cactorum from the inoculation hosts will easily be dispersed onto apple tissues via splashed rainwater.These apple tissues (including leaves, fruit, new shoots) will be caused diseases by Phytophthora cactorum , and also as the sources of apple Phytophthora rot. Another view is that Phytophthora cactorum with the high detoxifcation and utilization ability accelerated adaptability of the pathogen to host plant defense compounds 26 . In the long run, it is a particularly disturbing event for fungicides controlling apple Phytophthora rot. So hosts of Phytophthora cactorum should be removed to avoid providing secondary source of apple Phytophthora rot. Conclusion Using plant host as material to produce agar medium for Phytophthora cactorum culturing is practicable alternative in the laboratory. Host (Pepper fruit, Tomato leaves, Oakleaf goosefoot leaves) juice can be used to produce agar mediums for Phytophthora cactorum culturing in place of V8 juice agar medium. Declarations Competing interests The authors declare no competing interests. Funding This work was supported by the Science and Technology Innovation Project of HeBei Agriculture Research System (HBCT2024150208) and the HeBei Academy of Agriculture and Forestry (2022KJCXZX-SGS-3). Author Contribution The project was conceived by G. X. and Z. Y. The experiments were primarily designed and conducted by S. Z. and Y. C., who also authored the manuscript. Throughout the experiment, data collection, interpretation, and analysis were carried out by S. Z., Y. C., J. Z., K. L., Y. P., G. X. and Z. Y. revised and edited the manuscript. The entire author team engaged in discussions and provided feedback on the manuscript. Acknowledgement We are extremely thankful to Dr. Songbai Zhang in HuNan Institute of Plant Protection, Changsha, China, for discussion and review of the manuscript. Data Availability Data sets generated during the current study are available from the corresponding authors on reasonable request. References Harris, D. C. The Phytophthora diseases of apple. Journal of Horticultural Science 66(5), 513-544 (1991). Latorre, B. A., Rioja, M. E. and Wilcox, W. F. Phytophthora species as sociated with crown and root rot of apple in Chile. Plant Dis. 85(6), 603-606 (2007). Farzaneh, M., Sharifi-Tehrani A., Ahmadzadeh. M. and Zad, J. Biocontrol of Phytophthora cactorum , the causal agent of root and crown rot on apple ( Malus domestica ) by formulated Pseudomonas fluorescens . Commun. Agric. Appl. Biol. Sci. 72(4), 891-900 (2007). Liu, F., Li, B. et al. Effects of temperature and moisture on the infection and development of apple fruit rot caused by Phytophthora cactorum . Plant Dis. 102(9), 1811-1819 (2018). Baines, R. C. Phytophthora trunk canker or collar rot of apple trees. JAR. 59, 159-184 (1939). Blackwell, E. The life history of Phytophthora cactorum (Leb. et Cohn) Schrot. ransactions of the British Mycological Society. 26, 71-89 (1943). Sneh, B., and McIntosh, D. Studies on the behavior and survival of Phytophthora cactorum in soil. Can. J. Bot. 52(4), 795-802 (1974). Hantula, J., Lilja, A., Nuorteva, H. and Werres, S. Pathogenicity, morphology and genetic variation of Phytophthora cactorum from strawberry, apple, rhododendron, and silver birch. Mycol. Res. 104(9), 1062-1068 (2000). Thomidis, T. Influence of temperature and bark injuries on the development of Phytophthora cactorum and P. Citrophthora on peach trees. Sci. Hortic-AMSTERDAM. 98(4), 347-355 (2003a). Thomidis, T. Variability in pathogenicity among Greek isolates of Phytophthora cactorum to four peach rootstocks. Aust. J. Exp. Agr. 43(1), 99-103 (2003b). Grove, G. G. and Boal, R. J. Influence of temperature and wetness duration on infection of immature apple and pear fruit by Phytophthora cactorum . Phytopathology 81(11):1465-1471 (1991). Mircetich, S. M., Schreader, W., Moller, W. J. and Micke, W. Root and crown rot of cherry trees. Calif. Agr. 30, 10-11 (1976). Pánek, M., Fér, T., Mráček, J. and Tomšovský, M. Evolutionary relationships within the Phytophthora cactorum species complex in Europe. Fun. Biol-UK. 120(6-7), 836-851 (2016). Thomidis, T. Testing variability in pathogenicity of Phytophthora cactorum , P. citrophthora and P. syringae to apple, pear, peach, cherry and plum rootstocks. Phytoparasitica 29(1), 47-49 (2001). Webster, T., Tobutt, K. and Evans, K.Breeding and evaluation of new rootstocks for apple, pear and sweet cherry. Compact Fruit Tree 33, 100-104 (2000). Wormald, H. A phytophthora of pears and apples. Annals Applied Biology. 6, 89-100 (1919).. Yang, M. et al. The Phytophthora cactorum genome provides insights into the adaptation to host defense compounds and fungicides. Sci. Rep. 8, 6534 (2018).. Causin, R., Scopel. C. and Montecchio, A. G. An important methods for the detection of Phyto phthora cactorum (L. C.) Schröt in infected plant tissues using SCAR markers. J. Plant Pathol. 87(1), 25-35 (2005). Lan, C., Wu, W., Ruan, H. and Yao, J. Specific primers and PCR detection methods for detecting Phytophthora cactorum . CN 106434991A. 02, 22 (2017). Chen, X.. et al. SCR96 , a small cysteine-rich secretory protein of Phytophthora cactorum , can trigger cell death in the Solanaceae and is important for pathogenicity and oxidative stress tolerance. MOL PLANT PATHOLMol. Plant Pathol. 17(4), 577-587 (2015). Harris, D. C. The occurrence of Phytophthora syringae in fallen apple leaves. Ann. Appl. Biol. 91(3), 309-312 (1979). Sewell, G. W. F. and Wilson, J. F. Death of maiden apple trees caused by Phytophthora syringae Kleb. and a comparison of the pathogen with Phytophthora cactorum (L. & C.) Schroet.Ann. Appl. Biol. 53(2), 275-280 (1964). Upstone, M. E. Phytophthora syringae fruit rot of apples. Plant Pathol. J. 27(1), 24-30 (1978). Waterhouse, G. M. and Waterston, J. Phytophthora cactorum . Descriptions of Fungi and Bacteria, 12, Wallingford: CABI (1966). Chen, X. et al. The devastating oomycete phytopathogen Phytophthora cactorum : Insights into its biology and molecular features. Mol. Plant Pathol. 24, 1017-1032 (2023). . Yang, M. et al. A liquid culture medium mixed by Celery stems as material suitable for producing sporangia of Phytophthora cactorum . CN 102839148A. (2012). Additional Declarations No competing interests reported. Supplementary Files SupplementaryMaterialScientificreports.doc Additional information Supplementary Information The online version contains supplementary material available at Cite Share Download PDF Status: Published Journal Publication published 18 Apr, 2025 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 09 Jan, 2025 Reviews received at journal 05 Jan, 2025 Reviewers agreed at journal 05 Jan, 2025 Reviews received at journal 07 Dec, 2024 Reviewers agreed at journal 26 Nov, 2024 Reviewers agreed at journal 26 Nov, 2024 Reviewers agreed at journal 26 Nov, 2024 Reviewers invited by journal 25 Nov, 2024 Editor assigned by journal 25 Nov, 2024 Editor invited by journal 18 Nov, 2024 Submission checks completed at journal 17 Nov, 2024 First submitted to journal 30 Oct, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5362421","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":387472155,"identity":"63e66aa8-b3f2-4618-b535-eefa2c4196b2","order_by":0,"name":"Shengping Zhang","email":"","orcid":"","institution":"HeBei Academy of Agriculture and Forestry Sciences","correspondingAuthor":false,"prefix":"","firstName":"Shengping","middleName":"","lastName":"Zhang","suffix":""},{"id":387472156,"identity":"6578c928-9bb5-470c-876a-07ff7a516353","order_by":1,"name":"Ying Cheng","email":"","orcid":"","institution":"Handan Agricultural and Rural Bureau","correspondingAuthor":false,"prefix":"","firstName":"Ying","middleName":"","lastName":"Cheng","suffix":""},{"id":387472157,"identity":"4e3fb750-aa51-43a8-9086-72547471d9e6","order_by":2,"name":"Jiaqiang Zhao","email":"","orcid":"","institution":"HeBei Academy of Agriculture and Forestry Sciences","correspondingAuthor":false,"prefix":"","firstName":"Jiaqiang","middleName":"","lastName":"Zhao","suffix":""},{"id":387472158,"identity":"5a050c29-2ad5-46d3-bcfe-16d8d720d7f3","order_by":3,"name":"Kuijing Liang","email":"","orcid":"","institution":"Hengshui University","correspondingAuthor":false,"prefix":"","firstName":"Kuijing","middleName":"","lastName":"Liang","suffix":""},{"id":387472159,"identity":"44c8bd02-7d32-488f-ade5-2e4caa3fb91d","order_by":4,"name":"Yupeng Pu","email":"","orcid":"","institution":"Handan Agricultural and Rural Bureau","correspondingAuthor":false,"prefix":"","firstName":"Yupeng","middleName":"","lastName":"Pu","suffix":""},{"id":387472161,"identity":"4383a7e4-011d-4003-a220-1be35b9af7a2","order_by":5,"name":"Guoliang Xu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAzElEQVRIiWNgGAWjYJACZgYGNgZ+ZubDD0jTItnOlmZAihYGBoPzPAoSRCmX71/++HNhG5+98WEeBgOGGptogloMbrwxMJ7Zxpa47TDvgQcMx9JyGwhqkTjDkMzbxpZgdpgvwYCx4TBhLfIzjj84DNRib9zMYyBBlBaG8w2GzUAtjBuYidVicIPHmHnGObbEGYeBgZxAjF/k+48//lxQdsyev//w4QcfamyIcJhEAgMDI9sxCCeBoHIQ4D8AJP7UEKV2FIyCUTAKRigAAB+1PaBE0vtLAAAAAElFTkSuQmCC","orcid":"","institution":"HeBei Academy of Agriculture and Forestry Sciences","correspondingAuthor":true,"prefix":"","firstName":"Guoliang","middleName":"","lastName":"Xu","suffix":""},{"id":387472163,"identity":"f052b0f4-8a15-49d8-bb7b-596f6a5c98b4","order_by":6,"name":"Zhaohui Yang","email":"","orcid":"","institution":"Agricultural Products Centre of Quality and Safety in HeBei province","correspondingAuthor":false,"prefix":"","firstName":"Zhaohui","middleName":"","lastName":"Yang","suffix":""}],"badges":[],"createdAt":"2024-10-30 16:23:29","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5362421/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5362421/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-025-98291-7","type":"published","date":"2025-04-18T15:56:55+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":71794233,"identity":"f8afc40a-3332-4c38-afe5-e12e837fc00c","added_by":"auto","created_at":"2024-12-18 15:51:27","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":3178918,"visible":true,"origin":"","legend":"\u003cp\u003ePlant species were individually inoculated with \u003cem\u003ePhytophthora cactorum\u003c/em\u003e suspension for ten days. 1: Japanese false bindweed, 2: Strawberry, 3: Tomato, 4: Cucumber, 5: Shepherd's purse, 6: Pear, 7: Chinese rose, 8: Oakleaf goosefoot, 9: Horseweed, 10: Wheat, 11: Oriental cherry, 12: Herba lagopsis, 13: Pepper, 14: Eggplant, 15: Apricot, 16: Bell pepper, 17: Apple. T: Plant species with \u003cem\u003ePhytophthora cactorum\u003c/em\u003e suspension treatment. CK: Control plant species with sterile water treatment.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-5362421/v1/97c38f68bd8ca20a2ad2aafd.png"},{"id":71794235,"identity":"887acf71-f6c9-4970-bcba-f5690413e2b0","added_by":"auto","created_at":"2024-12-18 15:51:27","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":185940,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003ePhytophthora cactorum \u003c/em\u003edetection for the eleven diseased plant tissues respectively. (A) The size of the amplicon of \u003cem\u003ePC1\u003c/em\u003e-band is 450 bp. (B) The size of the amplicon of \u003cem\u003ePCA\u003c/em\u003e-band is 211 bp. (C) The size of the amplicon of \u003cem\u003eSCR96\u003c/em\u003e-band is 392 bp. 1: Apple leaves, 2: Apricot fruit, 3: Strawberry leaves, 4: Oakleaf goosefoot leaves, 5: Eggplant leaves, 6: Bell pepper fruit, 7: Oriental cherry leaves, 8: Pear leaves, 9: Tomato leaves, 10: Chinese rose leaves, 11: Pepper fruit, CK: Plant tissues treated with sterile water, CK-: Negative control, M: DNA marker.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-5362421/v1/66eb72737dc59f3d990468b3.png"},{"id":71794231,"identity":"72c80539-603f-423b-bd0e-d8511563c8ac","added_by":"auto","created_at":"2024-12-18 15:51:27","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1254072,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003ePhytophthora cactorum \u003c/em\u003eisolation culturing on Carrot juice agar medium for ninety-six hours. 1: \u003cem\u003ePhytophthora cactorum \u003c/em\u003eisolation from diseased Apple leaves, 2: \u003cem\u003ePhytophthora cactorum \u003c/em\u003eisolation from diseased Apricot fruits, 3: \u003cem\u003ePhytophthora cactorum \u003c/em\u003eisolation from diseased Strawberry leaves, 4: \u003cem\u003ePhytophthora cactorum \u003c/em\u003eisolation from diseased Oakleaf goosefoot leaves, 5: \u003cem\u003ePhytophthora cactorum \u003c/em\u003eisolation from diseased Eggplant leaves, 6: \u003cem\u003ePhytophthora cactorum \u003c/em\u003eisolation from diseased Bell pepper fruits, 7: \u003cem\u003ePhytophthora cactorum \u003c/em\u003eisolation from diseased Oriental cherry leaves, 8: \u003cem\u003ePhytophthora cactorum \u003c/em\u003eisolation from diseased Pear leaves, 9: \u003cem\u003ePhytophthora cactorum \u003c/em\u003eisolation from diseased Tomato leaves, 10: \u003cem\u003ePhytophthora cactorum \u003c/em\u003eisolation from diseased Chinese rose leaves,11: \u003cem\u003ePhytophthora cactorum \u003c/em\u003eisolation from diseased Pepper fruits, 12: No juice agar block culturing on Carrot juice agar medium for ninety-six hours as negative control.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-5362421/v1/16052789084807c3245f2713.png"},{"id":71794234,"identity":"4734fba4-fd22-4fa8-8653-64630b6d4acc","added_by":"auto","created_at":"2024-12-18 15:51:27","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1954371,"visible":true,"origin":"","legend":"\u003cp\u003eDifferent \u003cem\u003ePhytophthora cactorum \u003c/em\u003eisolation individually inoculated on healthy appleleaves for ten days\u003cem\u003e. \u003c/em\u003e1: \u003cem\u003ePhytophthora cactorum \u003c/em\u003eisolation from diseased leaves of Apple, 2: \u003cem\u003ePhytophthora cactorum \u003c/em\u003eisolation from diseased fruits of Apricot, 3: \u003cem\u003ePhytophthora cactorum \u003c/em\u003eisolation from diseased leaves of Strawberry, 4: \u003cem\u003ePhytophthora cactorum \u003c/em\u003eisolation from diseased leaves of Oakleaf goosefoot, 5: \u003cem\u003ePhytophthora cactorum \u003c/em\u003eisolation from diseased leaves of Eggplant, 6: \u003cem\u003ePhytophthora cactorum \u003c/em\u003eisolation from diseased fruits of Bell pepper, 7: \u003cem\u003ePhytophthora cactorum \u003c/em\u003eisolation from diseased leaves of Oriental cherry, 8: \u003cem\u003ePhytophthora cactorum \u003c/em\u003eisolation from diseased leaves of Pear, 9: \u003cem\u003ePhytophthora cactorum \u003c/em\u003eisolation from diseased leaves of Tomato, 10: \u003cem\u003ePhytophthora cactorum \u003c/em\u003eisolation from diseased leaves of Chinese rose, 11: \u003cem\u003ePhytophthora cactorum \u003c/em\u003eisolation from diseased fruits of Pepper,12: Control appleleaves with sterile water treatment.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-5362421/v1/c9fe7bc5234adb1a7054ffb9.png"},{"id":71794237,"identity":"d1ef3b9e-cba7-4f2d-924f-26d27e717833","added_by":"auto","created_at":"2024-12-18 15:51:28","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1635087,"visible":true,"origin":"","legend":"\u003cp\u003eAppearances of colonies for \u003cem\u003ePhytophthora cactorum \u003c/em\u003eindividually culturing on different agar mediums for120 h. 1: Carrot juice agar medium, 2: Bell pepper juice agar medium, 3: Celery juice agar medium, 4: Pepper juice agar medium, 5: Tomato juice agar medium, 6: Oakleaf goose juice agar medium, 7: V8 juice agar medium, 8: Eggplant juice of agar medium, 9: Black nightshade juice agar medium, 10: Strawberry juice agar medium, 11: Oriental cherry juice of agar medium, 12: Apple juice agar medium, 13: Pear juice agar medium, 14: Control agar medium containing no juice.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-5362421/v1/2d678806bfe9bcd1dfd14628.png"},{"id":71794240,"identity":"c6052afd-653e-40ef-8c8b-5959acb357ef","added_by":"auto","created_at":"2024-12-18 15:51:28","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":226799,"visible":true,"origin":"","legend":"\u003cp\u003eMicroscopic observation of \u003cem\u003ePhytophthora cactorum \u003c/em\u003eon different agar mediums respectively. 1: \u003cem\u003ePhytophthora cactorum \u003c/em\u003eculturing\u003cem\u003e \u003c/em\u003eon Carrot juice agar medium, 2: \u003cem\u003ePhytophthora cactorum \u003c/em\u003eculturing\u003cem\u003e \u003c/em\u003eon Bellpepper juice agarmedium, 3: \u003cem\u003ePhytophthora cactorum \u003c/em\u003eculturing\u003cem\u003e \u003c/em\u003eon Celery juice agar medium, 4: \u003cem\u003ePhytophthora cactorum \u003c/em\u003eculturing\u003cem\u003e \u003c/em\u003eon Pepper agar medium, 5: \u003cem\u003ePhytophthora cactorum \u003c/em\u003eculturing\u003cem\u003e \u003c/em\u003eon Tomato juice agar medium, 6: \u003cem\u003ePhytophthora cactorum \u003c/em\u003eculturing on Oakleaf goosefoot juice agar medium, 7: \u003cem\u003ePhytophthora cactorum \u003c/em\u003eculturing on V8 juice agar medium, 8: \u003cem\u003ePhytophthora cactorum \u003c/em\u003eculturing on Eggplant juice agar medium. Red arrow: Sporangia. Green arrow: Hyphae. Scale bars: 100 μm.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-5362421/v1/c1f53e1f35b37ad871642218.png"},{"id":71794236,"identity":"c0092d85-fe8e-4fe4-9eb0-25f8ed133cd0","added_by":"auto","created_at":"2024-12-18 15:51:27","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":1035543,"visible":true,"origin":"","legend":"\u003cp\u003eDifferent mycelial plugs individually culturing in\u003cem\u003e \u003c/em\u003eCarrotjuice medium for 120 h. 1: Mycelial plug from Carrot juice agar medium, 2: Mycelial plug from Bellpepper juice agar medium, 3: Mycelial plug from Oriental cherry juice agar medium, 4: Mycelial plug from Pepper juice agar medium, 5:Mycelial plug from Tomato juice agar medium, 6: Mycelial plug from Oakleaf goosefoot, 7: Mycelial plug from V8 juice agar medium, 8: Mycelial plug from Eggplant juice agar medium, 9: Mycelial plug from Black nightshade juice agar medium, 10: Mycelial plug culturing in sterile water as control.\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-5362421/v1/a4bf200d2071b88061dcbb79.png"},{"id":71794232,"identity":"32cd304b-a254-4fd1-80bc-df7aaa335d65","added_by":"auto","created_at":"2024-12-18 15:51:27","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":2401037,"visible":true,"origin":"","legend":"\u003cp\u003eDifferent \u003cem\u003ePhytophthora cactorum \u003c/em\u003eisolation individually inoculated on healthy apple leaves for ten days\u003cem\u003e.\u003c/em\u003e 1: \u003cem\u003ePhytophthora cactorum \u003c/em\u003efrom\u003cem\u003e \u003c/em\u003eCarrot juice agar medium, 2: \u003cem\u003ePhytophthora cactorum \u003c/em\u003efrom Bellpepper juice agar medium, 3: \u003cem\u003ePhytophthora cactorum \u003c/em\u003efrom Oriental cherry juice agar medium, 4: \u003cem\u003ePhytophthora cactorum \u003c/em\u003efrom Pepper juice agar medium, 5: \u003cem\u003ePhytophthora cactorum \u003c/em\u003efrom Tomato juice agar medium, 6: \u003cem\u003ePhytophthora cactorum \u003c/em\u003efrom Oakleaf goosefoot juice agar medium, 7: \u003cem\u003ePhytophthora cactorum \u003c/em\u003efrom V8 juice agar medium, 8: \u003cem\u003ePhytophthora cactorum \u003c/em\u003efrom Eggplant juice agar medium, 9: \u003cem\u003ePhytophthora cactorum \u003c/em\u003efrom Black nightshade juice agar medium, 10: Control apple leaves with sterile water treatment.\u003c/p\u003e","description":"","filename":"Figure8.png","url":"https://assets-eu.researchsquare.com/files/rs-5362421/v1/99ba170d88b6d959377bd402.png"},{"id":81050760,"identity":"84c53539-39ee-4e55-8a22-7c5fbda9817a","added_by":"auto","created_at":"2025-04-21 16:04:14","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":16933288,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5362421/v1/64af3890-4173-44a9-87f2-3d8d921d935d.pdf"},{"id":71795207,"identity":"fc13ffab-9a89-41f1-8aeb-707fa37b4147","added_by":"auto","created_at":"2024-12-18 15:59:28","extension":"doc","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":11917202,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAdditional information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSupplementary Information\u003c/strong\u003e The online version contains supplementary material available at\u003c/p\u003e","description":"","filename":"SupplementaryMaterialScientificreports.doc","url":"https://assets-eu.researchsquare.com/files/rs-5362421/v1/f322eb9e34f99a5e19998b07.doc"}],"financialInterests":"No competing interests reported.","formattedTitle":"New method for Phytophthora cactorum culturing using plant host as material to prepare agar medium","fulltext":[{"header":"Introduction","content":"\u003cp\u003eApple Phytophthora rot is an important disease during apple trees planting in the world, with the characteristics of weakening the trees and leading to fruit yield losses and eventual tree death\u003csup\u003e\u003cspan additionalcitationids=\"CR2 CR3\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. \u003cem\u003ePhytophthora cactorum\u003c/em\u003e (Lebert \u0026amp; Cohn) J. Schr\u0026ouml;t (\u003cem\u003ePhytophthora cactorum\u003c/em\u003e) is the pathogen of apple Phytophthora rot. As is known to all, the notorious \u003cem\u003ePhytophthora cactorum\u003c/em\u003e is an soilborne and has a broad range of hosts \u003csup\u003e\u003cspan additionalcitationids=\"CR6 CR7 CR8 CR9 CR10 CR11 CR12 CR13 CR14 CR15\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e. Usually, there are many different kinds of plant species in the apple orchards of HeBei province in China. The hypothesis is that some of these plant species may be proper hosts of \u003cem\u003ePhytophthora cactorum\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eIn the laboratory, people usually culture \u003cem\u003ePhytophthora cactorum\u003c/em\u003e on V8 juice agar medium or Carrot agar medium. It was only reported that Celery juice as material could used to produce liquid medium of \u003cem\u003ePhytophthora cactorum\u003c/em\u003e in 2012\u003csup\u003e17\u003c/sup\u003e. Until now, there has been no reports about \u003cem\u003ePhytophthora cactorum\u003c/em\u003e culturing on other agar mediums. In theory, using plant host as material to product agar medium for \u003cem\u003ePhytophthora cactorum\u003c/em\u003e culturing is practicable alternative in the laboratory. However, plant host juice as material to produce agar medium of \u003cem\u003ePhytophthora cactorum\u003c/em\u003e has not been reported.\u003c/p\u003e \u003cp\u003eIn this work, chamber assays were conducted to determine the diseased plant species caused by \u003cem\u003ePhytophthora cactorum\u003c/em\u003e following artificial inoculation. We identified the hosts of \u003cem\u003ePhytophthora cactorum\u003c/em\u003e by secondary infection on detached apple leaves, and also detection in diseased apple leaves for containing special genes of \u003cem\u003ePhytophthora cactorum.\u003c/em\u003e Subsequently, some of these healthy host tissues were selected as materials to screen agar mediums of \u003cem\u003ePhytophthora cactorum.\u003c/em\u003e The aim of this work is then to evaluate that proper agar mediums prepared by hosts of \u003cem\u003ePhytophthora cactorum\u003c/em\u003e. Furthermore, plant hosts containing \u003cem\u003ePhytophthora cactorum\u003c/em\u003e may be potential secondary infection sources of apple Phytophthora rot.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003eThe present study was carried out in Lab of Institute of Shingjiazhuang Fruit Trees, HeBei Academy of Agriculture and Forestry Sciences, Shingjiazhuang, China.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePhytophthora cactorum\u003c/strong\u003e \u003cstrong\u003estrain in the experiment\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe strain of \u003cem\u003ePhytophthora cactorum\u003c/em\u003e (\u003cem\u003ePhytophthora cactorum\u003c/em\u003e-SGS) is stored in 10\u0026deg;C (Shingjiazhuang Institute of Fruit Trees, HeBei Academy of Agriculture and Forestry Sciences). \u003cem\u003ePhytophthora cactorum\u003c/em\u003e were routinely cultured on 10% V8 juice agar medium (V8 juice/water [1:10] with 2% agar, sterilized at 121\u0026deg;C for 20 min) at 26\u0026deg;C\u0026thinsp;\u0026plusmn;\u0026thinsp;1\u0026deg;C in the dark for 96 h (Fig S1). Mycelial plugs (7 mm\u0026times;7 mm) were cultured in 10% V8 juice medium (V8 juice/water [1:10] with 2\u0026permil; CaCO\u003csub\u003e3\u003c/sub\u003e, sterilized at 121\u0026deg;C for 20 min) in the dark, 26\u0026deg;C\u0026thinsp;\u0026plusmn;\u0026thinsp;1\u0026deg;C, 160 rpm for 120 h. Then we would got the mycelial pellet of the \u003cem\u003ePhytophthora cactorum\u003c/em\u003e (Fig S1). Mycelial pellet was washed with sterile water for three times. Subsequently, the mycelial pellet was transferred to Petri dishes containing 25 mL sterile water at 26\u0026deg;C for 2 d in darkness. In order to obtain \u003cem\u003ePhytophthora cactorum\u003c/em\u003e suspension containing more lots of zoospores, the Petri dishes was placed in refrigerator at 4\u0026deg;C for 2 h.\u003c/p\u003e\n\u003cp\u003eTotal DNA was extracted from 10 mg of each mycelial pellet using Fungi Genomic DNA extract Kit D2300 (Beijing Solarbio Science and Technology Co,. Ltd.). \u003cem\u003ePhytophthora cactorum\u003c/em\u003e were identified by PCR method for containing genes of \u003cem\u003eITS\u003c/em\u003e (internal transcribed spacer region of the ribosomal DNA of \u003cem\u003ePhytophthora cactorum\u003c/em\u003e), \u003cem\u003ePC1\u003c/em\u003e\u003csup\u003e18\u003c/sup\u003e, \u003cem\u003ePCA\u003c/em\u003e\u003csup\u003e19\u003c/sup\u003e and \u003cem\u003eSCR96\u003c/em\u003e\u003csup\u003e20\u003c/sup\u003e. Primer sequences of these genes are as Table\u0026nbsp;1.\u003c/p\u003e\n\u003cp\u003e\u003c/p\u003e\n\u003ctable id=\"Tab1\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv\u003eTable 1\u003c/div\u003e\n \u003cdiv\u003e\n \u003cp\u003e\u003cstrong\u003ePrimer\u003c/strong\u003e\u0026apos;\u003cstrong\u003es sequences in the experiment\u003c/strong\u003e\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\" colspan=\"2\"\u003eGene Name\u003cbr\u003e\u003c/th\u003e\n \u003cth align=\"left\"\u003ePrimer\u0026apos;s sequences (5\u0026apos;-3\u0026apos;)\u003cbr\u003e\u003c/th\u003e\n \u003cth align=\"left\"\u003eLength of fragment\u003cbr\u003e\u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\u003cem\u003eITS\u003c/em\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u003cem\u003eITS1-F\u003c/em\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eTCCGTAGGTGAACCTGCGG\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e866 bp\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\u003cem\u003eITS4-R\u003c/em\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eTCCTCCGCTTATTGATATGC\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\u003cem\u003ePC1\u003c/em\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u003cem\u003ePC1-F\u003c/em\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eGAAACGGGTGTTGATATCGGAC\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e450 bp\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\u003cem\u003ePC1-R\u003c/em\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eGTTTCGGGTGCTGCCAAAAACT\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\u003cem\u003ePCA\u003c/em\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u003cem\u003ePCA-F\u003c/em\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eAGCAGACGTGGCGTGTTT\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e211 bp\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\u003cem\u003ePCA-R\u003c/em\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eTACACACGTTGGACGCACCT\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\u003cem\u003eSCR96\u003c/em\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u003cem\u003eSCR96-F\u003c/em\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eCCCACCTCCGAACAGTACA\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e392 bp\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\u003cem\u003eSCR96-R\u003c/em\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eGGACAGAGGAGGGAGGAAAG\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003c/p\u003e\n\u003cp\u003eTo \u003cem\u003eITS\u003c/em\u003e gene amplification, each PCR reaction contained a 25 \u0026micro;L solution of 10 \u0026micro;L mix (Biotech Co., Ltd. Hangzhou, China), 1 \u0026micro;L (100 nmol/\u0026micro;L) each of the primers, 2 \u0026micro;L of template, and 11 \u0026micro;L of sterile distilled water. PCR cycling conditions were as follows: 94\u0026deg;C for 5 min; 35 cycles of 94\u0026deg;C for 30 s, 58\u0026deg;C for 30 s and 72\u0026deg;C for 1 min; followed by a final extension at 72\u0026deg;C for 10 min, and a 4\u0026deg;C hold.\u003c/p\u003e\n\u003cp\u003eTo \u003cem\u003ePC1\u003c/em\u003e gene amplification, each PCR reaction contained a 25 \u0026micro;L solution of 10 \u0026micro;L mix (Biotech Co., Ltd. Hangzhou, China), 1 \u0026micro;L (100 nmol/\u0026micro;L) each of the primers, 2 \u0026micro;L of template, and 11 \u0026micro;L of sterile distilled water. PCR cycling conditions were as follows: 94\u0026deg;C for 5 min; 35 cycles of 94\u0026deg;C for 30 s, 61\u0026deg;C for 30 s and 72\u0026deg;C for 1 min; followed by a final extension at 72\u0026deg;C for 10 min, and a 4\u0026deg;C hold.\u003c/p\u003e\n\u003cp\u003eTo \u003cem\u003ePCA\u003c/em\u003e gene amplification, each PCR reaction contained a 25 \u0026micro;L solution of 12.5 \u0026micro;L mix (Biotech Co., Ltd. Hangzhou, China), 1 \u0026micro;L (100 nmol/\u0026micro;L) each of the primers, 1 \u0026micro;L of template, and 9.5 \u0026micro;L of sterile distilled water. PCR cycling conditions were as follows: 94\u0026deg;C for 5 min; 35 cycles of 94\u0026deg;C for 30 s, 60\u0026deg;C for 45 s and 72\u0026deg;C for 1 min; followed by a final extension at 72\u0026deg;C for 10 min, and a 4\u0026deg;C hold.\u003c/p\u003e\n\u003cp\u003eTo \u003cem\u003eSCR96\u003c/em\u003e gene amplification, each PCR reaction contained a 25 \u0026micro;L solution of 10 \u0026micro;L mix (Biotech Co., Ltd. Hangzhou, China), 1 \u0026micro;L (100 nmol/\u0026micro;L) each of the primers, 2 \u0026micro;L of template, and 11 \u0026micro;L of sterile distilled water. PCR cycling conditions were as follows: 94\u0026deg;C for 5 min; 35 cycles of 94\u0026deg;C for 30 s, 60\u0026deg;C for 30 s and 72\u0026deg;C for 1 min; followed by a final extension at 72\u0026deg;C for 10 min, and a 4\u0026deg;C hold.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePhytophthora cactorum\u003c/strong\u003e \u003cstrong\u003einoculation on different plant species\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSixteen different kinds of plant species were used for \u003cem\u003ePhytophthora cactorum\u003c/em\u003e inoculation (Table 2). Healthy plant tissues were individually disinfected for 2 min with 95% ethyl alcohol, and then removed the ethyl alcohol with sterile water. Sterilized absorbent cotton containing \u003cem\u003ePhytophthora cactorum\u003c/em\u003e suspension (10 \u0026micro;L) was inoculated on disinfected healthy plant tissue. Negative controls were healthy plant tissues with sterile water (10 \u0026micro;L) treatment. Healthy apple leaves were inoculated with equal concentration of \u003cem\u003ePhytophthora cactorum\u003c/em\u003e suspension (10 \u0026micro;L) as positive controls. All plant samples were placed into a incubator for 16 h at 26\u0026deg;C (day) and 8 h at 26\u0026deg;C (night). Relative humidity in the incubator was 100%. Lesion area on tissue was calculated by method of graph paper. The size of the lesion was measured and photographed at ten days post inoculation. All treatments were repeated three times with three biological replicates. Lesion differences were evaluated statistically with Student\u0026apos;s \u003cem\u003et\u003c/em\u003e test.\u003c/p\u003e\n\u003cdiv\u003e\n \u003ctable id=\"Tab2\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv\u003eTable 2\u003c/div\u003e\n \u003cdiv\u003e\n \u003cp\u003ePlant species in the experiment\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003eNO.\u003cbr\u003e\u003c/th\u003e\n \u003cth align=\"left\"\u003eName\u003cbr\u003e\u003c/th\u003e\n \u003cth align=\"left\"\u003eLatin name\u003cbr\u003e\u003c/th\u003e\n \u003cth align=\"left\"\u003eTissues\u003cbr\u003e\u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e1\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eJapanese false bindweed\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u003cem\u003eCalystegia hederacea\u003c/em\u003e Wall.\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eLeaves\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e2\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eStrawberry\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u003cem\u003eFragaria \u0026times; ananassa\u003c/em\u003e Duch.\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eLeaves\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e3\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eTomato\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u003cem\u003eSolanum lycopersicum\u003c/em\u003e L.\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eLeaves\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e4\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eCucumber\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u003cem\u003eCucumis sativus\u003c/em\u003e L.\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eLeaves\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e5\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eShepherd\u0026apos;s purse\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u003cem\u003eCapsella bursa-pastoris\u003c/em\u003e (L.) Medik.\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eLeaves\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e6\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003ePear\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u003cem\u003ePyrus bretschneideri\u003c/em\u003e Rehd.\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eLeaves\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e7\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eChinese rose\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u003cem\u003eRosa chinensis\u003c/em\u003e var. \u003cem\u003echinensis\u003c/em\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eLeaves\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e8\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eOakleaf goosefoot\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u003cem\u003eChenopodium album\u003c/em\u003e L.\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eLeaves\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e9\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eHorseweed\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u003cem\u003eErigeron canadensis\u003c/em\u003e L.\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eLeaves\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e10\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eWheat\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u003cem\u003eTriticum aestivum\u003c/em\u003e L.\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eLeaves\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e11\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eOriental cherry\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u003cem\u003eCerasus serrulata\u003c/em\u003e var.\u0026nbsp;\u003cem\u003elannesiana\u003c/em\u003e (Carr.) Makino\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eLeaves\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e12\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eHerba lagopsis\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u003cem\u003eLagopsis supina\u003c/em\u003e (Steph.ex Willd.) Ikonn.-Gal.\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eLeaves\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e13\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003ePepper\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u003cem\u003eCapsicum annuum\u003c/em\u003e L.\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eFruit\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e14\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eEggplant\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u003cem\u003eSolanum melongena\u003c/em\u003e L.\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eLeaves\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e15\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eApricot\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u003cem\u003eArmeniaca vulgaris\u003c/em\u003e Lam.\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eFruit\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e16\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eBell pepper\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u003cem\u003eCapsicum annuum\u003c/em\u003e Linn.\u0026nbsp;\u003cem\u003evar. grossum\u003c/em\u003e (L.) Sendt.\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eFruit\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e17\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eApple\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u003cem\u003eMalus pumila\u003c/em\u003e Mill.\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eLeaves\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003cem\u003ePhytophthora cactorum\u003c/em\u003e \u003cstrong\u003edetection in diseased plant species\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal DNA was extracted from 10 mg of each diseased plant sample using Super plant genomic DNA Kit DP360 (Tiangen Biotech Co,. Ltd.). Healthy plant tissue with sterile water treatment was as control. The diseased samples were detected by PCR method for containing three special genes (\u003cem\u003ePC1\u003c/em\u003e, \u003cem\u003ePCA\u003c/em\u003e and \u003cem\u003eSCR96)\u003c/em\u003e of \u003cem\u003ePhytophthora cactorum\u003c/em\u003e. The \u003cem\u003ePhytophthora cactorum\u003c/em\u003e detection procedure was the same as 2.1. Sterile water was as negative control in agarose gel electrophoresis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePhytophthora cactorum\u003c/strong\u003e \u003cstrong\u003eisolation from diseased plant species\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePlant samples with obvious symptoms were for \u003cem\u003ePhytophthora cactorum\u003c/em\u003e isolation. The operation procedures were listed as follows.\u003c/p\u003e\n\u003cp\u003eFirstly, surface of diseased plant sample was washed by sterile water.\u003c/p\u003e\n\u003cp\u003eSecondly, diseased plant sample was disinfected with 95% ethyl alcohol for 2 min.\u003c/p\u003e\n\u003cp\u003eThirdly, diseased plant sample (leaf tissue [25 mm\u003csup\u003e2\u003c/sup\u003e, 5 mm\u0026times;5 mm], fruit tissue [125 mm\u003csup\u003e3\u003c/sup\u003e, 5 mm\u0026times;5 mm\u0026times;5 mm) was cut from lesion edge, and then was bleached with 0.3% NaClO solution for 2 min.\u003c/p\u003e\n\u003cp\u003eFourth, NaClO solution was removed from surface of plant sample by sterile water.\u003c/p\u003e\n\u003cp\u003ePlant sample was transferred to Carrot juice agar medium (Carrot juice/water[1:5] with 2% agar, sterilized at 121\u0026deg;C for 20 min). Subsequently, all plant samples were placed into incubator at 26\u0026deg;C\u0026thinsp;\u0026plusmn;\u0026thinsp;1\u0026deg;C in the dark for 120 h, and then to isolate the pathogen using a capillary of 0.8 mm in diameter, single hyphal strands were selected from colony edges, yielding isolates.\u003c/p\u003e\n\u003cp\u003eThe isolate (mycelial plug, 7 mm\u0026times;7 mm) was inoculated on Carrot juice agar medium for purification (96 h). Afterwards, mycelial plug (7 mm in diameter) from the edge of the colony was inoculated in 70 mL of V8 juice medium in 100 mL Erlenmeyer flasks. The flasks were incubated in darkness at 26\u0026deg;C\u0026thinsp;\u0026plusmn;\u0026thinsp;1\u0026deg;C, 160 rpm for 120 h. All isolates were identified as \u003cem\u003ePhytophthora cactorum\u003c/em\u003e basing on sequences of genes (\u003cem\u003eITS\u003c/em\u003e, \u003cem\u003ePC1\u003c/em\u003e, \u003cem\u003ePCA\u003c/em\u003e and \u003cem\u003eSCR96)\u003c/em\u003e and morphology\u003csup\u003e21\u0026ndash;23\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePathogenicity of\u003c/strong\u003e \u003cstrong\u003ePhytophthora cactorum\u003c/strong\u003e \u003cstrong\u003eisolation on apple leaves\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn order to verify the pathogenicity of isolated \u003cem\u003ePhytophthora cactorum\u003c/em\u003e on apple leaves, all \u003cem\u003ePhytophthora cactorum\u003c/em\u003e isolates (from diseased plant species respectively) were individually inoculated on healthy apple leaves using sterilized absorbent cotton (containing 10 \u0026micro;L \u003cem\u003ePhytophthora cactorum\u003c/em\u003e suspension). Healthy apple leaves inoculation with 10 \u0026micro;L sterile water were as blank controls. All apple leaves were placed into another incubator for 16 h at 26\u0026deg;C (day) and 8 h at 26\u0026deg;C (night). Relative humidity in the incubator was 100%. Each treatment was repeated three times. The symptoms on apple leaves were observed at 10 days post inoculation. Apple leaves were detected by PCR method for containing three special genes (\u003cem\u003ePC1\u003c/em\u003e, \u003cem\u003ePCA\u003c/em\u003e and \u003cem\u003eSCR96\u003c/em\u003e) of \u003cem\u003ePhytophthora cactorum.\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eScreening agar mediums of\u003c/strong\u003e \u003cstrong\u003ePhytophthora cactorum\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSome healthy host plant species, which could cause diseases obviously above, were selected as materials to prepare agar mediums for screening agar mediums of \u003cem\u003ePhytophthora cactorum.\u003c/em\u003e Respectively, healthy leaves of Black nightshade (a kind of plant species are almost present in apple orchards of HeBei province in China), healthy Celery stems were also selected as material to produce agar medium for culturing \u003cem\u003ePhytophthora cactorum.\u003c/em\u003e Carrot juice agar medium and V8 juice agar medium were for positive controls. Agar medium containing no juice was as negative control. Procedure was as follows.\u003c/p\u003e\n\u003cp\u003eStep 1: Plant tissue was washed by sterile water, then disinfected with 95% ethyl alcohol for 2 min, then removed ethyl alcohol by sterile water for three times at last.\u003c/p\u003e\n\u003cp\u003eStep 2: Disinfected plant tissue (55\u0026thinsp;\u0026plusmn;\u0026thinsp;5g) was as material to got homogenate. The homogenate was filtered out residue through eight layers of gauze. Proper pH value (7.0-7.2) of filtrate was adjusted by HCl or NaOH solution.\u003c/p\u003e\n\u003cp\u003eStep 3: Agar powder (10 g) was added into the filtrate, then the mixture (250 mL) was prepared by supplementary of sterile water. Mixture was for sterilization at 121\u0026deg;C, 20 min.\u003c/p\u003e\n\u003cp\u003eStep 4: Respectively, mycelial plugs (7 mm in diameter) from V8 juice agar medium were individually cultured on these agar mediums in darkness, at 26\u0026deg;C\u0026thinsp;\u0026plusmn;\u0026thinsp;1\u0026deg;C, for 120 h. Colony diameter was of \u003cem\u003ePhytophthora cactorum\u003c/em\u003e measured after 120 hours of incubation. Morphology of sporangia and hyphae of all colonies were individually observed by microscopic.\u003c/p\u003e\n\u003cp\u003eStep 5: Mycelial plug (7 mm in diameter) from the edge of the colony was inoculated in 70 mL of Carrot juice medium (Carrot juice/water[1:5] with 2\u0026permil; CaCO\u003csub\u003e3\u003c/sub\u003e, sterilized at 121\u0026deg;C for 20 min) in 100 mL Erlenmeyer flasks. The flasks were incubated in darkness at 26\u0026deg;C\u0026thinsp;\u0026plusmn;\u0026thinsp;1\u0026deg;C, 160 rpm for 120 h. These mycelial pellets (got from colonies respectively) were identified as \u003cem\u003ePhytophthora cactorum\u003c/em\u003e basing on sequences of genes (\u003cem\u003eITS\u003c/em\u003e, \u003cem\u003ePC1\u003c/em\u003e, \u003cem\u003ePCA\u003c/em\u003e and \u003cem\u003eSCR96)\u003c/em\u003e.\u003c/p\u003e\n\u003cp\u003eStep 6: Respectively, sterilized absorbent cotton containing \u003cem\u003ePhytophthora cactorum\u003c/em\u003e suspension (10 \u0026micro;L) was inoculated on healthy apple leaves. Healthy apple leaves inoculation with the same volume of sterile water (10 \u0026micro;L) were used as blank controls. All apple leaves were placed into a incubator for 16 h at 26\u0026deg;C (day) and 8 h at 26\u0026deg;C (night). Relative humidity in the incubator was 100%. The symptoms on apple leaves were also observed at ten days post inoculation. Each treatment was with three biological replicates.\u003c/p\u003e\n\u003cp\u003eApple leaves were detected by PCR method for containing three special genes (\u003cem\u003ePC1\u003c/em\u003e, \u003cem\u003ePCA\u003c/em\u003e and \u003cem\u003eSCR96\u003c/em\u003e) of \u003cem\u003ePhytophthora cactorum.\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData statistical analysis of colony areas for\u003c/strong\u003e \u003cstrong\u003ePhytophthora cactorum\u003c/strong\u003e \u003cstrong\u003eon different agar mediums\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData were compared using a one-way analysis of variance (ANOVA) test followed by Least significance difference test (LSD). The average values from three samples were for the graphics.\u003c/p\u003e"},{"header":"Results","content":"\u003ch2\u003e\u003cem\u003ePhytophthora cactorum\u0026nbsp;\u003c/em\u003evirulence on different kinds of\u0026nbsp;plant\u0026nbsp;species\u003c/h2\u003e\n\u003cp\u003eThe typical symptoms of rotten (the same as to apple leaves) were appeared on ten kinds of plant species (Pear, Oriental cherry, Apricot, Strawberry, Chinese rose, Eggplant, Pepper, Tomato, Bell pepper and\u0026nbsp;Oakleaf goosefoot)\u0026nbsp;and Apple leaves.\u0026nbsp;However,\u0026nbsp;no obvious\u0026nbsp;lesions were\u0026nbsp;appeared\u0026nbsp;in the same sites of the rest of six kinds of plant species (Japanese false bindweed,\u0026nbsp;Cucumber,\u0026nbsp;Shepherd's purse,\u0026nbsp;Horseweed,\u0026nbsp;Wheat and\u0026nbsp;Herba lagopsis) (Fig. 1). Differences in lesion areas of\u0026nbsp;sixteen\u0026nbsp;kinds of plant species (and also\u0026nbsp;apple\u0026nbsp;leaves) were observed\u0026nbsp;at\u0026nbsp;ten days\u0026nbsp;post\u0026nbsp;inoculation\u0026nbsp;(Fig S2).\u0026nbsp;Three special genes of \u003cem\u003ePhytophthora cactorum\u003c/em\u003ecould be\u0026nbsp;detected in these\u0026nbsp;ten kinds of plant tissues\u0026nbsp;ten days post inoculation using agarose gel electrophoresis, which had the same bands as to\u0026nbsp;apple\u0026nbsp;leaves. While, no bands were detected in the plant tissues with sterile water treatment and the negative control (Fig.\u0026nbsp;2). We deduced\u0026nbsp;\u003cem\u003ePhytophthora cactorum\u003c/em\u003ecould cause diseases on these ten kinds of plant species.\u003c/p\u003e\n\u003ch2\u003e\u003cem\u003ePhytophthora cactorum\u003c/em\u003eisolation from diseased plant species\u003c/h2\u003e\n\u003cp\u003eMicrobes were individually isolated from diseased plant species (including diseased Apple leaves). Phenotype of ten colonies\u0026nbsp;(isolation from\u0026nbsp;Pear,\u0026nbsp;Oriental cherry,\u0026nbsp;Apricot,\u0026nbsp;Strawberry,\u0026nbsp;Chinese rose,\u0026nbsp;Eggplant,\u0026nbsp;Pepper,\u0026nbsp;Tomato,\u0026nbsp;Bell\u0026nbsp;pepper\u0026nbsp;and\u0026nbsp;Oakleaf goosefoot, respectively)\u0026nbsp;showed the same performance as to\u0026nbsp;\u003cem\u003ePhytophthora cactorum\u003c/em\u003efrom\u0026nbsp;diseased Apple\u0026nbsp;leaves (Fig.\u0026nbsp;3).\u0026nbsp;By culturing plugs in 10% V8 juice medium, we\u0026nbsp;could\u0026nbsp;get\u0026nbsp;mycelial\u0026nbsp;pelletsrespectively(Fig S3). These\u0026nbsp;mycelial\u0026nbsp;pellets had the same forms as to\u0026nbsp;\u003cem\u003ePhytophthora cactorum\u003c/em\u003e (Fig S1).\u0026nbsp;Through PCR, the results showed\u0026nbsp;that\u0026nbsp;microbes from\u0026nbsp;these different plates appeared the same bands as to \u003cem\u003ePhytophthora cactorum\u003c/em\u003efrom apple leaves (Fig S4). It proved\u0026nbsp;\u003cem\u003ePhytophthora cactorum\u003c/em\u003ewere\u0026nbsp;isolated from these diseased plant species\u0026nbsp;respectively.\u003c/p\u003e\n\u003ch2\u003e\u003cem\u003ePhytophthora cactorum\u003c/em\u003e from diseased hosts has\u0026nbsp;virulence on apple leaves\u003c/h2\u003e\n\u003cp\u003e\u003cem\u003ePhytophthora cactorum\u003c/em\u003efromten kinds of plant species (Pear, Oriental cherry, Apricot, Strawberry, Chinese rose, Eggplant, Pepper, Tomato, Bell pepper and\u0026nbsp;Oakleaf goosefoot) above\u0026nbsp;respectively\u0026nbsp;inoculated\u0026nbsp;on\u0026nbsp;healthy apple leaves. The inoculation healthy apple leaves showed typical symptoms of collar rot\u0026nbsp;at ten days\u0026nbsp;post\u0026nbsp;inoculation, while the healthy apple leaves with sterile water treatment had no symptoms (Fig.\u0026nbsp;4). The diseased apple leaves were for special genes of\u0026nbsp;\u003cem\u003ePhytophthora cactorum\u003c/em\u003edetection. Results showed that bands of \u003cem\u003ePC1\u003c/em\u003e, \u003cem\u003ePCA\u0026nbsp;\u003c/em\u003eand \u003cem\u003eSCR96\u003c/em\u003e were appeared. However, healthy apple leaves with sterile water treatment had no bands (Fig S5). As we expected,\u0026nbsp;\u003cem\u003ePhytophthora cactorum\u003c/em\u003efrom these hosts\u0026nbsp;respectively\u0026nbsp;could cause diseases on apple leaves.\u003c/p\u003e\n\u003ch2\u003eScreening agar mediums of\u0026nbsp;\u003cem\u003ePhytophthora cactorum\u003c/em\u003e\u003c/h2\u003e\n\u003cp\u003eAccording to host species of\u0026nbsp;\u003cem\u003ePhytophthora cactorum\u003c/em\u003eabove, eight kinds of healthy host tissues (Bell pepper\u0026nbsp;fruits, Pepper fruits, Tomato leaves, Oakleaf goosefoot leaves, Eggplant leaves, Strawberry leaves, Oriental cherry leaves, Apple\u0026nbsp;leaves,\u0026nbsp;Pear\u0026nbsp;leaves) were individually\u0026nbsp;selected as materials to\u0026nbsp;produce\u0026nbsp;juice agar mediums\u0026nbsp;(Table 2)\u003cem\u003e.\u003c/em\u003e Black nightshade\u0026nbsp;leaves,\u0026nbsp;Celery\u0026nbsp;stems\u0026nbsp;were\u0026nbsp;also\u0026nbsp;used as material for preparing\u0026nbsp;agar mediums respectively.\u0026nbsp;According to the results, we discovered\u0026nbsp;\u003cem\u003ePhytophthora cactorum\u003c/em\u003e (culturing on\u0026nbsp;agar mediums of Bell pepper, Celery, Pepper, Tomato, Oakleaf goosefoot, Eggplant, Black nightshade respectively)\u0026nbsp;had the same\u0026nbsp;phenotype as to them on Carrot juice\u0026nbsp;agar medium or V8 juice agar medium\u0026nbsp;five days\u0026nbsp;later.\u0026nbsp;\u003cem\u003ePhytophthora cactorum\u0026nbsp;\u003c/em\u003ecould not be cultured on other agar mediums normally, such as Pear, Apple, Strawberry, Oriental cherry and the Control plate containing no juice (Fig.\u0026nbsp;5). The colony areas of \u003cem\u003ePhytophthora cactorum\u003c/em\u003eincreased in the order of\u0026nbsp;Carrot\u0026gt;Bell pepper\u0026gt;Celery\u0026gt;Pepper\u0026gt;Tomato\u0026gt;Oakleaf goosefoot\u0026gt;V8 juice\u0026gt;Eggplant\u0026gt;Black nightshade\u0026gt;\u0026nbsp;Oriental cherry=Strawberry=Apple\u0026gt;Pear\u0026gt;CK\u0026nbsp;(Fig S6). Comparing to V8 juice\u0026nbsp;agar medium, some\u0026nbsp;agar mediums (produced by Pepper fruit,\u0026nbsp;Tomato leaves,\u0026nbsp;Oakleaf goosefoot leaves respectively)\u0026nbsp;and also\u0026nbsp;Carrot\u0026nbsp;juice\u0026nbsp;agar medium had a better effect on\u0026nbsp;\u003cem\u003ePhytophthora cactorum\u003c/em\u003eculturing.\u003c/p\u003e\n\u003cp\u003eMicroscopic observationwas for detection of sporulation capacity of\u0026nbsp;\u003cem\u003ePhytophthora cactorum\u003c/em\u003eon agar mediums.\u0026nbsp;Sporangia and hyphae could be observed on some of agar mediums,\u0026nbsp;such as\u0026nbsp;Carrot,\u0026nbsp;Celery,\u0026nbsp;Pepper,\u0026nbsp;Tomato,\u0026nbsp;Oakleaf goosefoot\u0026nbsp;and V8 juice. Although hyphae of \u003cem\u003ePhytophthora cactorum\u0026nbsp;\u003c/em\u003ecould be observed on agar medium\u0026nbsp;of Bell\u0026nbsp;pepper juice, no obvious sporangia was discovered (Fig.\u0026nbsp;6).\u0026nbsp;It\u0026nbsp;indicated\u0026nbsp;\u003cem\u003ePhytophthora cactorum\u003c/em\u003ehad the sporulation capacity on\u0026nbsp;these three kinds of\u0026nbsp;agar mediums. Respectively, plant hosts (Pepper,\u0026nbsp;Tomato,\u0026nbsp;Oakleaf goosefoot )\u0026nbsp;as materials\u0026nbsp;can be used to produce\u0026nbsp;agar mediums\u0026nbsp;for\u0026nbsp;\u003cem\u003ePhytophthora cactorum\u0026nbsp;\u003c/em\u003eculturing in the laboratory.\u003c/p\u003e\n\u003ch2\u003eEvaluation of pathogenicity for\u0026nbsp;\u003cem\u003ePhytophthora cactorum\u0026nbsp;\u003c/em\u003eisolation from newagarmedium\u003c/h2\u003e\n\u003cp\u003eBy culturing\u0026nbsp;\u003cem\u003ePhytophthora cactorum\u003c/em\u003eplugs (from agar mediums of\u0026nbsp;Carrot\u0026nbsp;juice,\u0026nbsp;Bell pepper\u0026nbsp;juice,\u0026nbsp;Celery juice,\u0026nbsp;Pepper\u0026nbsp;juice, Tomato,\u0026nbsp;Oakleaf goosefoot\u0026nbsp;juice, V8 juice,\u0026nbsp;Eggplant,\u0026nbsp;Black nightshade\u0026nbsp;juice respectively) in\u0026nbsp;Carrot\u0026nbsp;juice\u0026nbsp;mediums, we got\u0026nbsp;mycelial\u0026nbsp;pellets of the\u0026nbsp;\u003cem\u003ePhytophthora cactorum\u0026nbsp;\u003c/em\u003e(Fig.\u0026nbsp;7). These\u0026nbsp;mycelial\u0026nbsp;pellets had the same forms as to\u0026nbsp;\u003cem\u003ePhytophthora cactorum\u003c/em\u003eculturing in V8 juice\u0026nbsp;medium (Fig S1).\u0026nbsp;Respectively, these nine\u0026nbsp;mycelial\u0026nbsp;pellets\u0026nbsp;were identified\u0026nbsp;by PCR method. Results showed that the same bands were appeared\u0026nbsp;as to \u003cem\u003ePhytophthora cactorum\u0026nbsp;\u003c/em\u003e(Fig S7).\u003c/p\u003e\n\u003cp\u003eTo identify\u0026nbsp;pathogenicity of\u0026nbsp;\u003cem\u003ePhytophthora cactorum\u003c/em\u003e onapple leaves\u0026nbsp;(from agar mediums produced by\u0026nbsp;Bell pepper,\u0026nbsp;Pepper, Tomato,\u0026nbsp;Oakleaf goosefoot,\u0026nbsp;Eggplant,\u0026nbsp;Black nightshade\u0026nbsp;respectively),\u0026nbsp;we individually\u0026nbsp;inoculated \u003cem\u003ePhytophthora cactorum\u0026nbsp;\u003c/em\u003esuspension (culturing in\u0026nbsp;Carrot\u0026nbsp;juice\u0026nbsp;mediums respectively) on healthy apple leaves. The results showed the same symptoms as to collar rot\u0026nbsp;at ten days\u0026nbsp;post\u0026nbsp;inoculation\u0026nbsp;(Fig.\u0026nbsp;8). By PCR, it indicated that all diseased apple leaves\u0026nbsp;couldproduce the same bands as to three special genes (\u003cem\u003ePC1\u003c/em\u003e,\u003cem\u003e\u0026nbsp;PCA\u003c/em\u003e and\u003cem\u003e\u0026nbsp;SCR96\u003c/em\u003e), which was consistent with the band of the positive control lane (\u003cem\u003ePhytophthora cactorum\u003c/em\u003e) (Fig S8). In contrast, no\u0026nbsp;\u003cem\u003ePhytophthora cactorum\u003c/em\u003ewas detected in the apple leaves with sterile water\u0026nbsp;treatment. It proved that\u0026nbsp;\u003cem\u003ePhytophthora cactorum\u003c/em\u003e, culturing onsome\u0026nbsp;new\u0026nbsp;agar mediums (such asBell\u0026nbsp;pepper,\u0026nbsp;Pepper,\u0026nbsp;Tomato,\u0026nbsp;Oakleaf goosefoot,\u0026nbsp;Eggplant respectively), could also be cultured in Carrot\u0026nbsp;juice\u0026nbsp;medium. Subsequently, these\u0026nbsp;\u003cem\u003ePhytophthora cactorum\u0026nbsp;\u003c/em\u003estrains could still cause diseases on healthy apple leaves.\u003c/p\u003e\n\u003cp\u003eAccording to the research results, \u003cem\u003ePhytophthora cactorum\u0026nbsp;\u003c/em\u003eculturing on agar mediums (produced by\u0026nbsp;Pepper, Tomato,\u0026nbsp;Oakleaf goosefoot respectively) have\u0026nbsp;strong capacity\u0026nbsp;of\u0026nbsp;growth\u0026nbsp;and\u0026nbsp;reproduction.\u0026nbsp;Collectively, the agar mediums preparing with plant hosts,\u0026nbsp;such as Pepper, Tomato, Oakleaf goosefoot respectively,\u0026nbsp;are suitable for\u0026nbsp;\u003cem\u003ePhytophthora cactorum\u003c/em\u003e culturing in the laboratory.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eApple Phytophthora rot, incited by \u003cem\u003ePhytophthora cactorum\u003c/em\u003e, is an important disease of apple trees worldwide \u003csup\u003e\u003cspan additionalcitationids=\"CR2 CR3\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. In recent years, apple Phytophthora rot has been observed in so many apple orchards of China .along with the increasing of growing area of apple trees (with the characteristics of dwarfing stocks and close planting).\u003c/p\u003e \u003cp\u003e \u003cem\u003ePhytophthora cactorum\u003c/em\u003e is an soilborne and has a reported host range of more than 200 species, spanning at least 154 genera of vascular plants within 54 families \u003csup\u003e\u003cspan additionalcitationids=\"CR6\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. In theory, hosts as materials can be used for screening agar mediums of plant pathogen. Although Celery juice as material can be used for produce liquid medium of \u003cem\u003ePhytophthora cactorum\u003c/em\u003e\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e, little studies have been done about screening agar mediums of \u003cem\u003ePhytophthora cactorum\u003c/em\u003e using plant host material. V8 juice has so far been the major material for \u003cem\u003ePhytophthora cactorum\u003c/em\u003e culturing in laboratory. However, V8 juice can not be acquired at the local market easily in the most cities of China. It is meaningful to develop new agar mediums for \u003cem\u003ePhytophthora cactorum\u003c/em\u003e culturing in the laboratory. In this work, we used chamber assays to determine the host plant species of \u003cem\u003ePhytophthora cactorum\u003c/em\u003e following artificial inoculation. Respectively, some of these healthy hosts were selected as materials to produce agar mediums for \u003cem\u003ePhytophthora cactorum\u003c/em\u003e culturing. According to the results, we found that some agar mediums (produced by Pepper fruits, Celery stems, Tomato leaves, Oakleaf goosefoot leaves respectively) had the better effect on \u003cem\u003ePhytophthora cactorum\u003c/em\u003e culturing than V8 juice. More than that, \u003cem\u003ePhytophthora cactorum\u003c/em\u003e also have the sporulation capacity on these four agar mediums above. Interestingly, leaves of Oakleaf goosefoot can be caused diseases by \u003cem\u003ePhytophthora cactorum.\u003c/em\u003e Agar medium containing filtrate of Oakleaf goosefoot leaves juice could culture \u003cem\u003ePhytophthora cactorum\u003c/em\u003e normally. In China, the weed of Oakleaf goose is widespread in most orchards from March to October a year. The cost of the experiment will be reduced greatly by using Oakleaf goose in place of V8 juice for \u003cem\u003ePhytophthora cactorum\u003c/em\u003e culturing in the laboratory. Another phenomenon is others agar mediums (produced by Oriental cherry leaves, Strawberry leaves, Apple leaves, Pear leaves receptively) could not be for \u003cem\u003ePhytophthora cactorum\u003c/em\u003e culturing normally. As the proper hosts of \u003cem\u003ePhytophthora cactorum\u003c/em\u003e, these agar mediums containing host filtrate respectively could not culture \u003cem\u003ePhytophthora cactorum\u003c/em\u003e normally. It is a new subject worthwhile to research.\u003c/p\u003e \u003cp\u003eUnlike the United States, \u003cem\u003ePhytophthora cactorum\u003c/em\u003e is not known to occur in irrigation water by canal irrigation for lack of irrigation system in most of orchards in China\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. It is widely accepted that \u003cem\u003ePhytophthora cactorum\u003c/em\u003e is mainly spread to the upper plant by splashing in China, then the proper environment is responsible for epidemic of apple Phytophthora rot\u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e. In the study, some plant species were discovered as the proper hosts of \u003cem\u003ePhytophthora cactorum\u003c/em\u003e. Although we can not prove that \u003cem\u003ePhytophthora cactorum\u003c/em\u003e have the sporulation capacity on these host plants (\u003cem\u003ePhytophthora cactorum\u003c/em\u003e could not produce spores on agar medium of Bell pepper), the total of \u003cem\u003ePhytophthora cactorum\u003c/em\u003e surely will infect these plant hosts. So plant hosts containing \u003cem\u003ePhytophthora cactorum\u003c/em\u003e are the secondary sources of apple Phytophthora rot. With the help of wind, \u003cem\u003ePhytophthora cactorum\u003c/em\u003e from the inoculation hosts will easily be dispersed onto apple tissues via splashed rainwater.These apple tissues (including leaves, fruit, new shoots) will be caused diseases by \u003cem\u003ePhytophthora cactorum\u003c/em\u003e, and also as the sources of apple Phytophthora rot. Another view is that \u003cem\u003ePhytophthora cactorum\u003c/em\u003e with the high detoxifcation and utilization ability accelerated adaptability of the pathogen to host plant defense compounds\u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. In the long run, it is a particularly disturbing event for fungicides controlling apple Phytophthora rot. So hosts of \u003cem\u003ePhytophthora cactorum\u003c/em\u003e should be removed to avoid providing secondary source of apple Phytophthora rot.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eUsing plant host as material to produce agar medium for \u003cem\u003ePhytophthora cactorum\u003c/em\u003e culturing is practicable alternative in the laboratory. Host (Pepper fruit, Tomato leaves, Oakleaf goosefoot leaves) juice can be used to produce agar mediums for \u003cem\u003ePhytophthora cactorum\u003c/em\u003e culturing in place of V8 juice agar medium.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003cstrong\u003eCompeting interests\u003c/strong\u003e \u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis work was supported by the Science and Technology Innovation Project of HeBei Agriculture Research System (HBCT2024150208) and the HeBei Academy of Agriculture and Forestry (2022KJCXZX-SGS-3).\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eThe project was conceived by G. X. and Z. Y. The experiments were primarily designed and conducted by S. Z. and Y. C., who also authored the manuscript. Throughout the experiment, data collection, interpretation, and analysis were carried out by S. Z., Y. C., J. Z., K. L., Y. P., G. X. and Z. Y. revised and edited the manuscript. The entire author team engaged in discussions and provided feedback on the manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eWe are extremely thankful to Dr. Songbai Zhang in HuNan Institute of Plant Protection, Changsha, China, for discussion and review of the manuscript.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eData sets generated during the current study are available from the corresponding authors on reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eHarris, D. C. The \u003cem\u003ePhytophthora\u003c/em\u003e diseases of apple. Journal of Horticultural Science 66(5), 513-544 (1991).\u003c/li\u003e\n\u003cli\u003eLatorre, B. A., Rioja, M. E. and Wilcox, W. F. \u003cem\u003ePhytophthora\u003c/em\u003e species as sociated with crown and root rot of apple in Chile. Plant Dis. 85(6), 603-606 (2007).\u003c/li\u003e\n\u003cli\u003eFarzaneh, M., Sharifi-Tehrani A., Ahmadzadeh. M. and Zad, J. Biocontrol of \u003cem\u003ePhytophthora cactorum\u003c/em\u003e, the causal agent of root and crown rot on apple (\u003cem\u003eMalus domestica\u003c/em\u003e) by formulated \u003cem\u003ePseudomonas fluorescens\u003c/em\u003e. Commun. Agric. Appl. Biol. Sci. 72(4), 891-900 (2007).\u003c/li\u003e\n\u003cli\u003eLiu, F., Li, B. et al. Effects of temperature and moisture on the infection and development of apple fruit rot caused by \u003cem\u003ePhytophthora cactorum\u003c/em\u003e. Plant Dis. 102(9), 1811-1819 (2018).\u003c/li\u003e\n\u003cli\u003eBaines, R. C. Phytophthora trunk canker or collar rot of apple trees. JAR. 59, 159-184 (1939).\u003c/li\u003e\n\u003cli\u003eBlackwell, E. The life history of \u003cem\u003ePhytophthora cactorum \u003c/em\u003e(Leb. et Cohn) Schrot. ransactions of the British Mycological Society. 26, 71-89 (1943).\u003c/li\u003e\n\u003cli\u003eSneh, B., and McIntosh, D. Studies on the behavior and survival of \u003cem\u003ePhytophthora cactorum\u003c/em\u003e in soil. Can. J. Bot. 52(4), 795-802 (1974).\u003c/li\u003e\n\u003cli\u003eHantula, J., Lilja, A., Nuorteva, H. and Werres, S. Pathogenicity, morphology and genetic variation of \u003cem\u003ePhytophthora cactorum\u003c/em\u003e from strawberry, apple, rhododendron, and silver birch. Mycol. Res. 104(9), 1062-1068 (2000).\u003c/li\u003e\n\u003cli\u003eThomidis, T. Influence of temperature and bark injuries on the development of \u003cem\u003ePhytophthora cactorum\u003c/em\u003e and \u003cem\u003eP. Citrophthora\u003c/em\u003e on peach trees. Sci. Hortic-AMSTERDAM. 98(4), 347-355 (2003a).\u003c/li\u003e\n\u003cli\u003eThomidis, T. Variability in pathogenicity among Greek isolates of \u003cem\u003ePhytophthora cactorum\u003c/em\u003e to four peach rootstocks. Aust. J. Exp. Agr. 43(1), 99-103 (2003b).\u003c/li\u003e\n\u003cli\u003eGrove, G. G. and Boal, R. J. Influence of temperature and wetness duration on infection of immature apple and pear fruit by \u003cem\u003ePhytophthora cactorum\u003c/em\u003e. Phytopathology 81(11):1465-1471 (1991).\u003c/li\u003e\n\u003cli\u003eMircetich, S. M., Schreader, W., Moller, W. J. and Micke, W. Root and crown rot of cherry trees. Calif. Agr. 30, 10-11 (1976).\u003c/li\u003e\n\u003cli\u003eP\u0026aacute;nek, M., F\u0026eacute;r, T., Mr\u0026aacute;ček, J. and Tom\u0026scaron;ovsk\u0026yacute;, M. Evolutionary relationships within the \u003cem\u003ePhytophthora cactorum\u003c/em\u003e species complex in Europe. Fun. Biol-UK. 120(6-7), 836-851 (2016).\u003c/li\u003e\n\u003cli\u003eThomidis, T. Testing variability in pathogenicity of Phytophthora \u003cem\u003ecactorum\u003c/em\u003e, \u003cem\u003eP. citrophthora\u003c/em\u003e and \u003cem\u003eP. syringae\u003c/em\u003e to apple, pear, peach, cherry and plum rootstocks. Phytoparasitica 29(1), 47-49 (2001).\u003c/li\u003e\n\u003cli\u003eWebster, T., Tobutt, K. and Evans, K.Breeding and evaluation of new rootstocks for apple, pear and sweet cherry. Compact Fruit Tree 33, 100-104 (2000).\u003c/li\u003e\n\u003cli\u003eWormald, H. A phytophthora of pears and apples. Annals Applied Biology. 6, 89-100 (1919)..\u003c/li\u003e\n\u003cli\u003eYang, M. et al. The \u003cem\u003ePhytophthora cactorum\u003c/em\u003e genome provides insights into the adaptation to host defense compounds and fungicides. Sci. Rep. 8, 6534 (2018)..\u003c/li\u003e\n\u003cli\u003eCausin, R., Scopel. C. and Montecchio, A. G. An important methods for the detection of \u003cem\u003ePhyto\u003c/em\u003e\u003cem\u003ephthora cactorum\u003c/em\u003e\u003cem\u003e \u003c/em\u003e(L. C.) Schr\u0026ouml;t in infected plant tissues using SCAR markers. J. Plant Pathol. 87(1), 25-35 (2005).\u003c/li\u003e\n\u003cli\u003eLan, C., Wu, W., Ruan, H. and Yao, J. Specific primers and PCR detection methods for detecting \u003cem\u003ePhytophthora cactorum\u003c/em\u003e. CN 106434991A. 02, 22 (2017).\u003c/li\u003e\n\u003cli\u003eChen, X.. et al. \u003cem\u003eSCR96\u003c/em\u003e, a small cysteine-rich secretory protein of \u003cem\u003ePhytophthora cactorum\u003c/em\u003e, can trigger cell death in the Solanaceae and is important for pathogenicity and oxidative stress tolerance. MOL PLANT PATHOLMol. Plant Pathol. 17(4), 577-587 (2015).\u003c/li\u003e\n\u003cli\u003eHarris, D. C. The occurrence of \u003cem\u003ePhytophthora syringae\u003c/em\u003e in fallen apple leaves. Ann. Appl. Biol. 91(3), 309-312 (1979).\u003c/li\u003e\n\u003cli\u003eSewell, G. W. F. and Wilson, J. F. Death of maiden apple trees caused by \u003cem\u003ePhytophthora syringae\u003c/em\u003e Kleb. and a comparison of the pathogen with \u003cem\u003ePhytophthora cactorum \u003c/em\u003e(L. \u0026amp; C.) Schroet.Ann. Appl. Biol. 53(2), 275-280 (1964).\u003c/li\u003e\n\u003cli\u003eUpstone, M. E. \u003cem\u003ePhytophthora syringae\u003c/em\u003e fruit rot of apples. Plant Pathol. J. 27(1), 24-30 (1978).\u003c/li\u003e\n\u003cli\u003eWaterhouse, G. M. and Waterston, J. \u003cem\u003ePhytophthora cactorum\u003c/em\u003e. Descriptions of Fungi and Bacteria, 12, Wallingford: CABI (1966).\u003c/li\u003e\n\u003cli\u003eChen, X. et al. The devastating oomycete phytopathogen \u003cem\u003ePhytophthora cactorum\u003c/em\u003e: Insights into its biology and molecular features. Mol. Plant Pathol. 24, 1017-1032 (2023). .\u003c/li\u003e\n\u003cli\u003eYang, M. et al. A liquid culture medium mixed by Celery stems as material suitable for producing sporangia of \u003cem\u003ePhytophthora cactorum\u003c/em\u003e. CN 102839148A. (2012).\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Apple Phytophthora rot, Phytophthora cactorum, Plant hosts, Agar mediums, Secondary infection sources.","lastPublishedDoi":"10.21203/rs.3.rs-5362421/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5362421/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cem\u003ePhytophthora cactorum\u003c/em\u003e, which is the pathogen of apple Phytophthora rot, has a reported plant host range of more than two hundred species. Usually, \u003cem\u003ePhytophthora cactorum\u003c/em\u003e is cultured on V8 juice agar medium in the laboratory. While V8 juice could not be got easily in most cities of China. In theory, hosts as materials can be used for screening agar mediums of plant pathogen. However, little work has been done on plant hosts as materials to screen agar mediums of \u003cem\u003ePhytophthora cactorum\u003c/em\u003e. In this study, we used chamber assays to determine the host plant species of \u003cem\u003ePhytophthora cactorum\u003c/em\u003e following artificial inoculation. Subsequently, some of these healthy host tissues were individually selected as materials to screen agar mediums of \u003cem\u003ePhytophthora cactorum\u003c/em\u003e. The results indicated that host juice, such as Pepper fruit, Tomato leaves, Oakleaf goosefoot leaves, could be used to prepare agar mediums for \u003cem\u003ePhytophthora cactorum\u003c/em\u003e culturing. In the laboratory, these host tissues could be selected to produce agar mediums respectively for \u003cem\u003ePhytophthora cactorum \u003c/em\u003eculturing in place of V8 juice agar medium.\u003c/p\u003e","manuscriptTitle":"New method for Phytophthora cactorum culturing using plant host as material to prepare agar medium","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-12-18 15:51:21","doi":"10.21203/rs.3.rs-5362421/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-01-09T10:19:59+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-01-05T17:43:21+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"32566481183572671091234266987565325541","date":"2025-01-05T11:07:41+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-12-07T17:09:56+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"335981874264692237608034760490443561056","date":"2024-11-26T13:52:25+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"311689981260679903793313894478181686749","date":"2024-11-26T06:34:55+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"204408311070767339282619877250297680332","date":"2024-11-26T06:07:52+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-11-26T04:44:42+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-11-25T15:29:41+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2024-11-18T16:11:01+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-11-18T04:15:22+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2024-10-30T16:08:59+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"b9ae8da4-25da-4e30-ba0a-872c488a38f3","owner":[],"postedDate":"December 18th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":41294202,"name":"Biological sciences/Microbiology"},{"id":41294203,"name":"Biological sciences/Plant sciences"}],"tags":[],"updatedAt":"2025-04-21T15:59:09+00:00","versionOfRecord":{"articleIdentity":"rs-5362421","link":"https://doi.org/10.1038/s41598-025-98291-7","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2025-04-18 15:56:55","publishedOnDateReadable":"April 18th, 2025"},"versionCreatedAt":"2024-12-18 15:51:21","video":"","vorDoi":"10.1038/s41598-025-98291-7","vorDoiUrl":"https://doi.org/10.1038/s41598-025-98291-7","workflowStages":[]},"version":"v1","identity":"rs-5362421","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5362421","identity":"rs-5362421","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}