Overexpression of IL-10 in Adipose Mesenchymal Stem Cells Promotes Wound Healing in Diabetic Mice

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

Abstract Background: Diabetic ulcer is a serious chronic non-healing wound, which often leads to amputation or even death, causing great damage to the patients and their families. In recent years, stem cells are increasingly studied for tissue repair. Adipose tissue-derived mesenchymal stem cells (Adipose-derived mesenchymal stem cells, ADSCs) have the advantages of wide source and easy access. ADSCs can accelerate wound healing and reduce scar hyperplasia, especially for chronic wounds, patients cannot heal with traditional treatments, and ADSCs bring hope to these patients. Our study intends to overexpress IL-L 10 in ADSCs by genetic engineering technology, transplant ADSC-IL 10 to diabetic mouse wounds, and use the role of IL-10 in promoting M2 macrophages transformation, combined with ADSCs to achieve rapid healing of diabetic ulcer wounds. Methods: The expression of IL-10 protein in the supernatant of ADSC-IL10 was assessed using an ELISA kit. Flow cytometry was employed to analyze the surface stem cell markers (CD44, CD73, CD90, CD105) of ADSC-IL10. Additionally, the migration and proliferation of ADSC-IL10 were evaluated through cell scratch assays and MTT assays. The lipogenic marker PPARγ and the osteogenic marker RUNX2 were detected using fluorescent real-time quantitative PCR. Conditioned media from ADSC-IL10 (ADSC-IL10-CM) and ADSC-PCDH (ADSC-CM) were employed to culture mouse peritoneal macrophages (Raw 264.7). Following a 12-hour incubation period, the Raw 264.7 cells were harvested for mRNA extraction. The cell types of Raw cells were identified through qPCR, with the M1 phenotype determined by CD86 expression and the M2 phenotype by Arg-1 and CD206. The expression levels of inflammatory factors, including IL-1β, IL-6, IL-10, MCP-1, and growth factors such as EGF, VEGF, and TGFβ-1, were quantified using qPCR. The transwell method was utilized to assess the impact of ADSC-IL10-CM and ADSC-CM on the migration of normal skin fibroblasts. The scribing method was applied to examine the effect of ADSC-CM on the migration of human immortalized epidermal cells. A diabetic mouse model was induced by a high-fat, high-sugar diet combined with streptozocin. In the ADSC-IL10 group, 1×10^6 ADSC-IL10 cells were transplanted onto a 1.5cm×1.5cm wound surface, and similarly, 1×10^6 ADSC-PCDH cells were transplanted in the ADSC-PCDH group. The control group received an equal volume of 0.9% normal saline. The wound healing process in mice was observed and documented at various time points. Tissue samples from the wounds on days 3 and 7 were subjected to histological staining and qPCR analysis. HE staining was used to monitor wound healing progress, while immunofluorescence (CD206, Arg-1) was utilized to quantify the presence of M2-type macrophages in mouse skin. The expression levels of CD206 and Arg-1 genes were measured by qPCR to ascertain the macrophage phenotypes within the wound tissues. Levels of inflammatory factors such as IL-1β, IL-6, IL-10, MCP-1 were determined to evaluate the inflammatory status of the wound tissues. Additionally, the expression of EGF, VEGF, and TGFβ-1 growth factors within the wound tissues was assessed. Conclusion: The overexpression of IL-10 does not alter the biological characteristics of ADSCs. When transplanted into diabetic mice, ADSC-IL10 can accelerate wound healing more effectively than ADSCs alone. The mechanism through which ADSC-IL10 enhances wound healing may encompass several aspects: it stimulates the expression of M2-type macrophages, suppresses the secretion of pro-inflammatory factors such as IL-1β, IL-6, and MCP-1, and promotes the production of growth factors like EGF, TGFβ-1, and VEGF. Additionally, it encourages the migration of skin fibroblasts and epidermal cells to the wound sites in diabetic mice.
Full text 159,414 characters · extracted from preprint-html · click to expand
Overexpression of IL-10 in Adipose Mesenchymal Stem Cells Promotes Wound Healing in Diabetic Mice | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Overexpression of IL-10 in Adipose Mesenchymal Stem Cells Promotes Wound Healing in Diabetic Mice Hui Zhao, Feng Song, Xiao Shi, Shuai Shang This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5567768/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background: Diabetic ulcer is a serious chronic non-healing wound, which often leads to amputation or even death, causing great damage to the patients and their families. In recent years, stem cells are increasingly studied for tissue repair. Adipose tissue-derived mesenchymal stem cells (Adipose-derived mesenchymal stem cells, ADSCs) have the advantages of wide source and easy access. ADSCs can accelerate wound healing and reduce scar hyperplasia, especially for chronic wounds, patients cannot heal with traditional treatments, and ADSCs bring hope to these patients. Our study intends to overexpress IL-L 10 in ADSCs by genetic engineering technology, transplant ADSC-IL 10 to diabetic mouse wounds, and use the role of IL-10 in promoting M2 macrophages transformation, combined with ADSCs to achieve rapid healing of diabetic ulcer wounds. Methods : The expression of IL-10 protein in the supernatant of ADSC-IL10 was assessed using an ELISA kit. Flow cytometry was employed to analyze the surface stem cell markers (CD44, CD73, CD90, CD105) of ADSC-IL10. Additionally, the migration and proliferation of ADSC-IL10 were evaluated through cell scratch assays and MTT assays. The lipogenic marker PPARγ and the osteogenic marker RUNX2 were detected using fluorescent real-time quantitative PCR. Conditioned media from ADSC-IL10 (ADSC-IL10-CM) and ADSC-PCDH (ADSC-CM) were employed to culture mouse peritoneal macrophages (Raw 264.7). Following a 12-hour incubation period, the Raw 264.7 cells were harvested for mRNA extraction. The cell types of Raw cells were identified through qPCR, with the M1 phenotype determined by CD86 expression and the M2 phenotype by Arg-1 and CD206. The expression levels of inflammatory factors, including IL-1β, IL-6, IL-10, MCP-1, and growth factors such as EGF, VEGF, and TGFβ-1, were quantified using qPCR. The transwell method was utilized to assess the impact of ADSC-IL10-CM and ADSC-CM on the migration of normal skin fibroblasts. The scribing method was applied to examine the effect of ADSC-CM on the migration of human immortalized epidermal cells. A diabetic mouse model was induced by a high-fat, high-sugar diet combined with streptozocin. In the ADSC-IL10 group, 1×10^6 ADSC-IL10 cells were transplanted onto a 1.5cm×1.5cm wound surface, and similarly, 1×10^6 ADSC-PCDH cells were transplanted in the ADSC-PCDH group. The control group received an equal volume of 0.9% normal saline. The wound healing process in mice was observed and documented at various time points. Tissue samples from the wounds on days 3 and 7 were subjected to histological staining and qPCR analysis. HE staining was used to monitor wound healing progress, while immunofluorescence (CD206, Arg-1) was utilized to quantify the presence of M2-type macrophages in mouse skin. The expression levels of CD206 and Arg-1 genes were measured by qPCR to ascertain the macrophage phenotypes within the wound tissues. Levels of inflammatory factors such as IL-1β, IL-6, IL-10, MCP-1 were determined to evaluate the inflammatory status of the wound tissues. Additionally, the expression of EGF, VEGF, and TGFβ-1 growth factors within the wound tissues was assessed. Conclusion : The overexpression of IL-10 does not alter the biological characteristics of ADSCs. When transplanted into diabetic mice, ADSC-IL10 can accelerate wound healing more effectively than ADSCs alone. The mechanism through which ADSC-IL10 enhances wound healing may encompass several aspects: it stimulates the expression of M2-type macrophages, suppresses the secretion of pro-inflammatory factors such as IL-1β, IL-6, and MCP-1, and promotes the production of growth factors like EGF, TGFβ-1, and VEGF. Additionally, it encourages the migration of skin fibroblasts and epidermal cells to the wound sites in diabetic mice. Adipose-derived mesenchymal stem cells interleukin-10 overexpression diabetic ulcer wound healing Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Diabetes Mellitus (DM), a chronic metabolic disorder, affects millions of individuals and is projected to affect 592 million people worldwide by 2035 [1]. Diabetic foot ulcers are a significant complication of diabetes, frequently resulting in amputation or even mortality [2,3] . As the global incidence of diabetes continues to escalate, the life expectancy of those with diabetes is also increasing, which in turn leads to a rising incidence and mortality rate of diabetic foot ulcers. This trend imposes an increasingly substantial economic burden on society and healthcare systems [4,5] . With the growing prevalence of diabetes mellitus, the issue of wounds that heal poorly or not at all is emerging as a serious global health concern, and it stands as a focal point and challenge within the field of wound repair research. The mechanism underlying chronic wounds is intricate and remains incompletely understood. Inflammation plays a crucial role in the healing process, with the orderly migration of neutrophils and macrophages being essential for effective wound repair. Within the wound environment, these cells secrete a variety of inflammatory mediators that orchestrate the healing cascade [6] . Consequently, for the successful completion of wound repair and tissue regeneration, the body's inflammatory response must be meticulously regulated. Interleukin-10 (IL-10) emerges as a key modulator in suppressing the inflammatory response [7] . Research has demonstrated that IL-10 can suppress the activation of pro-inflammatory cytokines, such as IL-1β, IL-6, and tumor necrosis factor-A (TNF-α), within macrophages [8-12] . Additionally, IL-10 curtails the migration of leukocytes to sites of inflammation by inhibiting the production of various chemokines [13, 14] . It also enhances the survival and proliferation of B cells and prevents the activation of NF-ĸB [15,16] . IL-10 is involved in modulating the JAK-STAT signaling pathway [17] and mitigates fibrosis by promoting interactions between the PI3K/AKT and STAT3 signaling pathways [18]. Thus, IL-10 is a pivotal regulator of tissue repair, being expressed in keratinocytes and infiltrating monocytes at the wound's periphery, peaking at 3 hours and 3 days post-injury, respectively [19] . Studies further indicate that IL-10 is instrumental in limiting and terminating inflammatory responses during tissue repair. When applied to wounds, IL-10 increases monocyte infiltration, chemokine, and pro-inflammatory cytokine expression. Infiltrated monocytes are adept at combating wound microorganisms, clearing debris, and secreting a range of growth factors that are conducive to wound healing [20] . Diabetic ulcer is a complication of diabetes and occurs mostly in the feet. Diabetic ulcer wounds cannot be cured with traditional medical or surgical treatment. According to the international diabetes federation, 70% of amputations occur in diabetic patients. The pathophysiological relationship between diabetes and poor wound healing is very complex. Keratinocytes and fibroblasts isolated from diabetic foot ulcers have low proliferation potential, and the activity of growth factors is weakened, which is the key reason for the impaired tissue repair function of diabetic ulcers [21] . Researchers have been looking for more effective ways to treat nonhealing diabetes. Stem cells have been extensively researched for their potential to accelerate wound healing. Patients suffering from advanced conditions, such as diabetic ulcers or deep chronic wounds, who face no alternative but amputation, may stand to benefit from stem cell therapy [22-27] . Mesenchymal Stem Cells (MSCs) can be derived from bone marrow, peripheral blood, or adipose tissue [28] . Through in vivo and in vitro experiments, it has been established that bone marrow mesenchymal stem cells (BMSCs) possess the capability to differentiate into a variety of cell types [29] and exhibit therapeutic potential for chronic wounds [30] .However, BMSC cells are derived from bone marrow and their availability is limited. Derived from adipose tissue, ADSCs have been proven to provide a basis for regeneration after tissue injury by regulating immune response, and to promote wound healing through paracrine action [27, 31-38] . ADSCs, due to their ease of procurement compared to BMSCs and their abundant supply, have increasingly become the cell type of choice for wound repair and regeneration, garnering significant interest from medical professionals and researchers alike. Over the past ten years, stem cell therapy has demonstrated significant potential in treating orthopedic conditions, inflammatory diseases, liver failure, and autoimmune disorders, among others. Looking ahead, it may emerge as a novel treatment alternative for individuals suffering from these ailments [39,40] . Mesenchymal stem cells (MSCs) combine the benefits of both allogeneic and autologous cells, presenting a wide array of therapeutic possibilities for diabetic wound care. MSCs exhibit a minimal level of immune rejection when used to treat diabetic ulcers and retain the capacity for proliferation without undergoing apoptosis [41,42] . Research indicates that MSCs preserve their original biological properties even after 20 or 30 cycles of cell culture [43] . The collagen, fibroblast growth factor (FGF), and vascular endothelial growth factor (VEGF) produced by MSCs in vitro exceed those of dermal fibroblasts, suggesting their potential to enhance wound repair. Furthermore, MSCs display heightened activity in vivo in granulation tissue formation, re-epithelialization, and angiogenesis, indicating their potential value in expediting the healing process [41,44-45] . Furthermore, macrophages are pivotal in orchestrating the inflammatory response during chronic wound inflammation. These cells present a spectrum of phenotypes, extending from "classical activation(M1)" to "alternative activation(M2)". M1 macrophages release pro-inflammatory cytokines, including IL-1β, TNF-α, IL-6, among others, as well as nitric oxide, proteases, and reactive oxygen species that are crucial for host defense. They also suppress tissue injury and repair processes. Conversely, M2 macrophages secrete anti-inflammatory cytokines, such as IL-10, ornithine, and polyamines, which facilitate the alleviation of inflammation and promote tissue repair [46] . In the context of normal healing, macrophages can transition from an M1 to an M2 phenotype. However, in chronic wounds, macrophages persist in the M1 state, resulting in extensive tissue damage. Consequently, to facilitate the shift from M1 to M2 macrophages, IL-10 has garnered significant interest from researchers and clinicians for its potent anti-inflammatory properties. Presently, there are ongoing studies investigating the therapeutic potential of IL-10 for chronic inflammation [47-50] , autoimmune disorders [51] , and even cancer [52] . Nevertheless, the conventional method of administering IL-10 via direct injection faces challenges due to its rapid dispersion and brief half-life [53] . The half-life of IL-10 injected directly into mice is merely 2 hours [54] . Therefore, the over-expression of IL-10 within ADSCs (adipose-derived stem cells) not only addresses the issue of IL-10's short half-life but also offers a sustained enhancement of the inflammatory response in chronic wounds. Main experimental materials 1.1 Experimental animals and experimental cells Experimental animal SPF grade, 8-week-old Balb/c mice, with weights ranging from 24 to 28 grams, were procured from Beijing Weitonglihua Experimental Animal Technology Co., Ltd. The use of these animals was reviewed and received approval from the Animal Ethics Committee. The experimental animals were housed in the standardized animal facility at the Orthopaedic Surgery Hospital of the Chinese Academy of Medical Sciences, where they were provided with a high-fat and high-sugar diet. The IVC animal room maintained a relative humidity between 40-70%, an indoor temperature ranging from 18-22 degrees Celsius, and ample lighting. Prior to the formal testing, the experimental animals were acclimated and fed for a duration of three days upon their arrival at the animal facility. Experimental cells ADSCs were derived from patients aged 20-35 years old who underwent liposuction at the Plastic Surgery Hospital of the Chinese Academy of Medical Sciences and subsequently cultured in mesenchymal stem cell medium. All samples collected were approved by the hospital's Medical Ethics Committee, and preoperative informed consent was obtained, with signed consent forms. HEK 293T cells were maintained at the Research Center of the Orthopedic Surgery Hospital, Chinese Academy of Medical Sciences, and were cultured using DMEM high-glucose medium supplemented with 10% serum and 1% double antibody. 2 Real-time PCR primer sequence The table below presents the sequence, serial number, and coding DNA length of the genes and primers utilized in the experiment. Table 1.1: Sequence, Serial Number, and DNA Length Coding of Genes and Primers Employed in the Experiment Gene Serial number Primer sequence Length IL-10 NM_010548.2 F : CAGAGAAGCATGGCCCAGAA 129 bp R : GCTCCACTGCCTTGCTCTTA GAPDH NM_001289726.1 NM_008084.3 F: GCACCGTCAAGGCTGAGAAC R : TGGTGAAGACGCCAGTGGA 159 bp IL4 NM_021283.2 F : CGTCTGTAGGGCTTCCAAGG 123 bp R : AGGCATCGAAAAGCCCGAA IL4R NM_001008700.4 NM_001363983.1 F : CGAAGCCAGGAGTCAACCAA 126 bp R : GAGAGACTTGGTTGGGGCAG IL-1β NM_008361.4 F : ATGCCACCTTTTGACAGTGATG 136 bp R : TGTGCTGCTGCGAGATTTGA IL-6 NM_001314054.1 NM_031168.2 F : TCCGGAGAGGAGACTTCACA 167 bp R : TTCTGCAAGTGCATCATCGT MCP-1 NM_011333.3 F : ACCTGCTGCTACTCATTCACC 148 bp R : ATTCCTTCTTGGGGTCAGCA VEGF NM_001110268.1 NM_001110267.1etc. F : CTTCGAGGAGCACTTTGGGT 141 bp R : CCCTAATCTTCCGGGCTTGG EGF NM_001329594.1 NM_010113.4 etc F : CATGGAGACAGAAGCCCCAC 126 bp R : CCACAGGTCTGTAGGAGGGT TGFβ-1 NM_011577.2 F : CGTCAGACATTCGGGAAGCA 140 bp R : ACCAAGGTAACGCCAGGAAT iNOS NM_001313922.1 NM_001313921.1 etc F : GCGAAAGGTCATGGCTTCAC 136 bp R : CTGGTCCATGCAGACAACCT Arg-1 NM_007482.3 F : AATGAAGAGCTGGCTGGTGT 153 bp R : AGTGTGAGCATCCACCCAAA CD206 NM_008625.2 F : CACGGAGATCCACGAGCAAA 131 bp R : GATACCGGAATGGGCTTCCT CD86 NM_019388.3 F : GCAGGACCAGCAAAAGTTGG 151 bp R : CGAGCCCATGTCCTTGATCT 3 Experimental method 3.1 Detection of ADSCs supernatant IL-10 expression by ELISA kit (human IL-10 high sensitivity ELISA kit; Lianke Biology, item No. EK110S-96) (1)Preparation of the Standard Curve for Cell Culture Supernatant Samples: A 250µl aliquot of concentrated human IL-10 standard was obtained and combined with an equal volume of mesenchymal stem cell medium to create the highest point on the standard curve, corresponding to a concentration of 25 pg/ml. Subsequently, 250µl of mesenchymal stem cell medium was added to each test tube. Serial dilutions were then performed, starting from this highest concentration standard, in a 1:1 ratio. The mesenchymal stem cell medium alone served as the zero concentration point for the standard curve. The OD values at wavelengths of 450 nm and 570 nm were determined using an enzyme-labeled instrument. The OD value at 450 nm is then subtracted from the OD value at 570 nm, with the resultant value serving as the calibrated OD. Utilizing solely the OD value at 450 nm would result in an elevated OD value and diminish the precision of the measurement. (2) Calculation results To calculate the average optical density (OD) values for both the standard and the sample, subtract the OD value of the zero concentration standard. Plotting the concentration of the standard product on the horizontal axis and the OD values on the vertical axis, the standard curve is generated through regression fitting using computer software. Regression analysis is then employed to determine the optimal fitting curve. 3.2 Detection of Adipose-Derived Stem Cells (ADSCs) surface markers is performed using flow cytometry, employing the Human MSC Analysis Kit (BD Stemflow™, item No. 562245). (1) Add the following antibodies according to the following formula (Table 1.2) : Table 1.2 Proportion of Stem Cell Markers Identified by Flow Cytometry in ADSCs EP tube number Antibody name Adding volume 1 FITC Mouse Anti-Human CD90 5 ul 2 PE Mouse Anti-Human CD44 5 ul 3 PerCP-Cy™5.5 Mouse Anti-Human CD105 5 ul 4 APC Mouse Anti-Human CD73 5 ul 5 Nothing 6 hMSC Positive Isotype Control Cocktail PE hMSC Negative Isotype Control Cocktail 20 μl 20 μl 7 hMSC Positive Cocktail PE hMSC Negative Cocktail 20 μl 20 μl 8 hMSC Positive Isotype Control Cocktail Drop in isotype control (i.e. PE Mouse IgG2b, κ) 20 μl 5 μl 9 hMSC Positive Cocktail PE Drop in (i.e. PE Mouse Anti-Human CD44) 20 μl 5 μl The BD flow cytometer was employed for in-situ detection, and the resultant data were analyzed using FlowJo software, with isotype controls as the reference. In the migration experiment of ADSCs, Image J software was utilized to randomly draw 6 to 8 horizontal lines, from which the average distance between cells was calculated. 3.4 Proliferation Experiment of ADSCs Cells The cell proliferation rates of the ADSC-PCDH and ADSC-IL10 groups were assessed using the MTT assay. Subsequently, the proliferation curve for the ADSC-IL10 cells was generated using GraphPad Prism 7, based on the absorbance measurements. 3.5 The in vitro induction of adipogenic differentiation in ADSCs was achieved using the OriCellTM Adult Adipogenic Stromal Stem Cells Adipogenic Induction Differentiation Medium Kit (Item No. HUXMD-90031, Saiye Biotechnology Co., LTD.). Adipogenic differentiation was induced in P5 generation ADSC cells, ADSC-PCDH cells, and ADSC-IL10 cells, and the resulting adipogenic effects were observed and documented using an inverted microscope. 3.6 The in vitro osteogenic differentiation of ADSCs (OriCellTM adult adipose stromal stem cells osteogenic differentiation medium kit; Cyagen, item No. HUXMD-90021) was investigated using P5 generation ADSC cells, ADSC-PCDH cells, and ADSC-IL10 cells. The osteogenic effect was monitored and documented using an inverted microscope. 3.7 Balb/c mice with high blood glucose were fasting and water abstinence 12 h before surgery. Mice in the model group were injected intraperitoneally at the dose of STZ 150 mg/kg, while the control group was given the same dose of citric acid-sodium citrate buffer (0.1 mol/l, PH4.5). After the injection, the high-fat and high-sugar diet was resumed and remained on the high-fat and high-sugar diet until the end of the experiment. After 3 days of intraperitoneal injection of STZ, the random blood glucose of mice was measured for 14 days. After the blood glucose of mice was stabilized, mice with blood glucose higher than 16.7 mmol/L were selected to be included in the formal experiment, and those with blood glucose lower than 16.7 mmol/L were placed in carbon dioxide to sudden death. The weight of the mice was measured and recorded at the same time as the blood sugar was measured. Forty-five hyperglycemic mice, exhibiting blood glucose levels exceeding 16.7 mmol/L, were chosen for the formal experiment and subsequently randomized into three groups: the control group, the ADSC-PCDH group, and the ADSC-IL10 group, with 15 mice in each. In the ADSC-PCDH and ADSC-IL10 groups, subcutaneous transplantation of ADSC-PCDH cells and ADSC-IL10 cells, respectively, was performed on the back wounds of the mice, with approximately 1×10^6 cells transplanted into each mouse. The control group received an injection of 0.9% normal saline. The transplanted mice were housed in individual ventilated cages (IVC) for further care and were monitored on days 1, 3, 5, 7, and so forth, during which time photographs were taken of the back wounds of the mice. 3.8 On the seventh day post-wound, the granulation tissues of diabetic mice were subjected to double fluorescence staining for CD68 and Arg-1. CD68 serves as a marker for all macrophage subtypes, including both M1 and M2, while Arg-1 is a protein specifically secreted by M2 macrophages. Additionally, the RNA expression levels of two markers indicative of M2 macrophages, namely Arg-1 and CD206, were assessed using quantitative polymerase chain reaction (qPCR). 3.9 On the seventh day post-wound, granulation tissue from diabetic mice was harvested, and whole-genome RNA was subsequently extracted. The expression levels of inflammatory factors, including IL-1β, IL-4R, IL-10, EGF, TGFβ-1, and VEGF, were then assessed using reverse transcription and fluorescence-based real-time quantitative PCR. 3.10 Mouse peritoneal macrophages (Raw 264.7) were cultured in the presence of ADSC-IL10 conditioned medium (ADSC-IL10-CM) and ADSC-PCDH conditioned medium (ADSC-CM), with DMEM low-glucose medium serving as the control. Following a 12-hour culture period, Raw 264.7 cells were harvested for mRNA extraction, and the cell phenotypes were subsequently analyzed using qPCR. The M1 phenotype was identified by the expression of CD86, while the M2 phenotype was characterized by the presence of Arg-1 and CD206. The expression levels of various inflammatory factors, including IL-1β, IL-6, IL-10, MCP-1, and growth factors such as EGF, VEGF, and TGFβ-1, were also quantified using qPCR. 3.11ADSC-IL10-CM and ADSC-CM were used to stimulate RAW 264.7 cells, while LPS+IFN-γ and IL4 were employed to stimulate Raw 264.7 cells, from which RNA was subsequently extracted. The expression levels of CD86, CD206, and Arg-1 mRNA, as well as IL-1β, IL-6, and MCP-1 mRNA, were then assessed. Additionally, ADSC-IL10-CM and ADSC-CM were separately utilized to stimulate Raw 264.7 cells, and the RNA from these cells was extracted to determine the expression levels of EGF, TGFβ-1, and VEGF mRNA. 3.12 The impact of ADSC-IL10-CM and ADSC-CM on the migration of normal dermal fibroblasts was assessed using the transwell assay. Additionally, the influence of ADSC-CM on the migratory behavior of human immortalized epidermal cells was investigated employing the scratch assay. In this study, human immortalized epidermal cells, specifically HaCat cells, were cultivated in the presence of ADSC-CM and DMEM medium supplemented with 2% serum. Statistical analysis : All measurement data were expressed as (mean ± standard deviation), and t test was used to analyze whether there were statistical differences between groups. p<0.05 indicated that the differences between groups were statistically significant. The results were calculated using GraphPad Prism 7 and histogram was drawn. The wound area of mice was calculated by ImageJ. Photoshop CS6 was used to merge immunofluorescence images. The results of qPCR and flow were analyzed by FlowJo. Results 1.The overexpression of IL-10 did not impact the proliferation, migration, or differentiation of ADSCs. The culture media for ADSC-IL10, ADSC-PCDH, and ADSC cells were prepared, and the secretion of IL-10 in the supernatant was measured using ELISA. No significant variation in IL-10 expression was observed between the ADSC and ADSC-PCDH groups (p=0.6591), whereas a significant difference was noted between the ADSC-IL10 group and the ADSC-PCDH group (p<0.0001). (Fig. 1A) Cell surface markers, including CD44, CD73, CD90, and CD105, were analyzed on ADSC, ADSC-PCDH, and ADSC-IL10 cells via flow cytometry. The findings indicated that CD44, CD73, CD90, and CD105 were all positive in the ADSC, ADSC-PCDH, and ADSC-IL10 groups. (Fig. 1B) Employing the MTT assay to assess the cellular proliferation of both the ADSC-PCDH and ADSC-IL10 groups, the findings indicated that no significant disparities in cell proliferation were observed between the two groups, with their proliferation curves exhibiting a relatively consistent pattern (see Fig. 1C). The detection of cell migration within the ADSC-PCDH group and the ADSC-IL10 group revealed no significant difference in migratory activity between the two cohorts. Both groups exhibited completed cell migration by the 24-hour mark, with no statistically significant variance in the quantity of migrated cells (refer to Fig. 1D). Adipogenic differentiation was induced by P5 ADSCs, ADSC-PCDH cells, and ADSC-IL10 cells. A substantial accumulation of lipid droplets was observed under the microscope on the fifth day of lipid induction.Oil red O staining revealed that ADSC, ADSC-PCDH, and ADSC-IL10 cells all possessed equivalent adipogenic differentiation potential. Genomic RNA was isolated from ADSC, ADSC-PCDH, and ADSC-IL10 cells on the fifth day, and the expression of the lipid-producing marker gene PPARγ was assessed using quantitative polymerase chain reaction (qPCR). The findings revealed that: there was no statistically significant difference in the expression of the PPAR gamma gene among the three groups, as indicated by the following p-values: ADSC-IL10 versus ADSC-PCDH at p=0.6358, ADSC-PCDH versus the Control group at p=0.5828, and ADSC-IL10 versus the Control group at p=0.9013 (refer to figure 1E). Osteogenic differentiation was induced in P5 ADSC, ADSC-PCDH, and ADSC-IL10 cells. On the 21st day of osteogenic induction, these cells were stained with alizarin red. Microscopic examination revealed that ADSC, ADSC-PCDH, and ADSC-IL10 cells exhibited equivalent staining capabilities with alizarin red. Genomic RNA was extracted from ADSC, ADSC-PCDH, and ADSC-IL10 cells on day 14, and the expression of the osteogenic marker RUNX2 was quantified using qPCR. The outcomes indicated that there was no significant difference in RUNX2 expression between ADSC-IL10 and ADSC-PCDH cells (p=0.7638), nor between ADSC-PCDH cells and the control group (p=0.6072), or between ADSC-IL10 cells and the control group (p=0.7744) (see Fig. 1F). 2.The overexpression of IL-10 in ADSCs enhances the acceleration of chronic wound healing in diabetic mice. The diabetic mice were randomly assigned to one of three groups: Control, ADSC-PCDH, or ADSC-IL10. A wound measuring 1.5cm by 1.5cm was excised from the dorsum, and PBS, 1×10^6 ADSC-PCDH cells, and 1×10^6 ADSC-IL10 cells were subcutaneously transplanted into each group, respectively. It was observed that the healing rate of diabetic mice in the ADSC-IL10 group (with wounds healed by day 19) was significantly higher than that in the ADSC-PCDH group (healed by day 21) and the Control group (healed by day 25). Mice in the Control group exhibited nonhealing wounds (Fig. 2A). ImageJ was employed to assess the wound area in mice, and the findings indicated a significant disparity in wound size between the ADSC-IL10 group and the ADSC-PCDH group on the third day of healing (p=0.0026). By the seventh day of healing, a significant difference in wound size emerged between the ADSC-PCDH group and the control group (p=0.0097). Upon reaching the tenth day of healing, both the ADSC-IL10 group and the ADSC-PCDH group exhibited significant differences in wound size compared to each other (p=0.0457) and to the control group (p=0.0240). By the fourteenth day of healing, the ADSC-IL10 group showed a significant difference in wound size compared to the control group (p=0.0156). Finally, on the nineteenth day of healing, significant differences in wound size were observed between the ADSC-IL10 group and the ADSC-PCDH group (p=0.0013), the ADSC-IL10 group and the control group (p=0.0027), as well as between the ADSC-PCDH group and the control group (p=0.0364). (Fig. 2B) 3.The transplantation of adipose-derived stem cells (ADSCs) overexpressing interleukin-10 (IL-10) facilitated the polarization of macrophages towards the M2 phenotype. On the seventh day post-wounding, granulation tissues from diabetic mice were subjected to CD68 and Arg-1 dual fluorescence staining. CD68 served as a marker for all macrophages (both M1 and M2 types), while Arg-1 represented a secretory protein specific to M2 macrophages. The findings indicated that the expression of Arg-1 in the skin of diabetic mouse wound grafts treated with ADSC-IL10 was elevated compared to those treated with ADSC-PCDH and the Control group, exhibiting a statistically significant difference. Although there was an increase in Arg-1 expression in the ADSC-PCDH-transplanted group relative to the Control group, this difference was not statistically significant. These results suggest that ADSC-IL10 can enhance the population of M2-type macrophages within the wounds of diabetic mice. (Fig. 3A) On the seventh day post-wounding in diabetic mice, the RNA expression levels of two M2 macrophage markers, namely Arginase-1 (Arg-1) and CD206, were assessed using quantitative polymerase chain reaction (qPCR) in the newly formed granulation tissue. The investigation revealed that the RNA expression levels of both Arg-1 and CD206 were significantly elevated in the wounds of diabetic mice that received ADSC-IL10 transplants compared to those that received ADSC-PCDH transplants and the control group. Statistically significant differences were observed. Additionally, the expression of CD206 RNA in the wounds of diabetic mice from the ADSC-PCDH group was also found to be higher than that in the control group, indicating a statistical difference. These findings suggest that ADSC-IL10 transplantation can enhance the expression of M2-type macrophages at the RNA level within the wounds of diabetic mice. (Fig. 3B) 4.The transplantation of adipose-derived stem cells (ADSCs) overexpressing interleukin-10 (IL-10) enhanced the expression of anti-inflammatory and growth factors within the wound site. Granulation tissues from diabetic mice were collected on the seventh day post-wounding, and genomic RNA was subsequently extracted. The expression levels of inflammatory cytokines IL-1β, IL-4r, and IL-10 were assessed using reverse transcription and fluorescence-based real-time quantitative PCR. The findings indicated that in the wounds of diabetic mice that received ADSC-IL10 transplants, there was a reduction in the expression of the pro-inflammatory cytokine IL-1β RNA compared to the control group. Conversely, the expression of the anti-inflammatory cytokines IL-4r and IL-10 RNA was elevated, with statistically significant differences observed. In contrast, no marked variation in the expression of IL-1β and IL-4r was noted between the ADSC-PCDH-transplanted group and the control group. The data presented in (Fig. 4A) suggest that ADSC-IL10 transplantation may attenuate the inflammatory response on the wound surface more effectively than ADSC-PCDH transplantation. Granulation tissues from diabetic mice were collected on the seventh day post-wound, and genomic RNA was subsequently extracted. The expression levels of EGF, TGFβ-1, and VEGF RNA were assessed using reverse transcription and fluorescence-based real-time quantitative PCR. The findings indicated that the RNA expression levels of EGF, TGFβ-1, and VEGF in the wounds of diabetic mice within the ADSC-IL10 and ADSC-PCDH groups were comparable to those observed in the control group. No statistically significant differences were noted in the expression levels of TGFβ-1 and VEGF RNA between the ADSC-IL10 and ADSC-PCDH groups, suggesting a pivotal role for ADSC cells. (Fig. 4 b) 5.ADSC-IL10 CM induces the differentiation of Raw 264.7 cells into M2-type macrophages. ADSC-IL10 CM and ADSC CM were collected to stimulate the peritoneal macrophages of mice (Raw 264.7), and the RNA of Raw 264.7 cells was extracted to detect the expression levels of CD86, CD206, and Arg-1 mRNA. The results indicated that both ADSC-IL10 CM and ADSC CM induced a significant increase in the expression of M2-type macrophage markers CD206 and Arg-1 in Raw 264.7, while ADSC-IL10 CM also suppressed the expression of the M1-type macrophage marker CD86 in Raw 264.7. These findings suggest that ADSC-IL10 CM facilitates the differentiation of Raw 264.7 cells towards an M2 phenotype. (Fig. 5A) RAW 264.7 cells were induced into an inflammatory state by stimulation with LPS and IFNγ. Subsequently, conditioned media from ADSCs (ADSC CM) and ADSCs overexpressing IL-10 (ADSC-IL10 CM) were introduced. After 12 hours of stimulation, RNA was extracted from the RAW 264.7 cells to assess the expression levels of pro-inflammatory cytokines, including IL-1β, IL-6, and MCP-1 mRNA. The findings indicated that the addition of ADSC-IL10 CM led to a decrease in the expression of these pro-inflammatory cytokines. This implies that ADSC-IL10 CM has the potential to suppress the inflammatory response in RAW 264.7 cells. (Refer to Fig. 5B) ADSC-IL10 CM and ADSC CM were collected to stimulate Raw 264.7 cells, respectively. Subsequently, RNA was extracted from the Raw 264.7 cells to assess the expression levels of EGF, TGFβ-1, and VEGF mRNA. The findings indicated that following the culture of Raw 264.7 cells with both ADSC-IL10 CM and ADSC CM, there was an up-regulation in the expression of EGF, TGFβ-1, and VEGF mRNA. Notably, the up-regulation was more pronounced with ADSC-IL10 CM. (Fig. 5C) 6.ADSC CM facilitates the migration of fibroblasts and epidermal cells. The migration of normal skin fibroblasts was investigated using conditioned media from adipose-derived stem cells (ADSCs) with and without interleukin-10 (IL10) supplementation. The findings indicated that, in contrast to DMEM, both ADSC conditioned media and ADSC-IL10 conditioned media facilitated the migration of fibroblasts. The p-values for these effects were 0.0078 and 0.0314, respectively. Furthermore, the ADSC-IL10 conditioned media group exhibited a greater number of migrated cells than the ADSC conditioned media group; however, this difference was not statistically significant. (Refer to Fig. 6A) Furthermore, HaCat cells were cultured in the presence of ADSC CM and DMEM medium supplemented with 2% serum, and the migration of HaCat cells was assessed. The findings indicated that the migration of HaCat cells cultured with ADSC CM was essentially complete by 12 hours, whereas the migration rate of those cultured in DMEM medium with 2% serum was notably slower, exhibiting a significant difference compared to the ADSC CM group. (Fig. 6B) Discussion The regeneration of diabetic ulcer wound tissue is inhibited in the stage of inflammation, and the continuous stage of inflammation leads to the abnormal production of inflammatory cytokines [ 55 ] , and the long-term inflammatory response produces pathological inflammatory response, leading to the failure of endogenous repair response of skin tissue, and progresses to the late stage of wound healing. In this investigation, we observed the overexpression of IL-10 within adipose-derived stem cells (ADSCs), and for the first time, we harnessed the combined anti-inflammatory properties of both ADSCs and IL-10 to foster the healing of chronic wounds. Our findings revealed that the introduction of ADSC-IL10 cells onto the wounds of diabetic mice significantly expedited the healing process. The ADSC-IL10 group's wounds were observed to heal within 19 days, in contrast to the ADSC-PCDH group, which required 21 days, and the Control group, which took 25 days for complete wound closure. The equilibrium between various macrophage phenotypes is crucial for orchestrating the sequential phases of wound healing. M1 macrophages, known for secreting inflammatory cytokines, can impede the healing process. Conversely, M2 macrophages release anti-inflammatory agents that foster tissue repair. In the context of chronic ulcerative wounds, macrophages often shift from an M2 to an M1 phenotype. The pivotal challenge in treating chronic wounds lies in effectively converting M1 macrophages back into the M2 phenotype. Interleukin-10 (IL-10), produced by Th2 cells and certain regulatory T cells, has been demonstrated to suppress inflammatory responses and exhibits significant anti-inflammatory properties in chronic wounds, as evidenced by various studies. Moreover, IL-10 influences the synthesis and proliferation of the extracellular matrix (ECM), a process essential for healing. Nevertheless, the half-life of IL-10 in chronic wounds is relatively brief, presenting a challenge to prolong its therapeutic effects. Our research addressed this issue by overexpressing IL-10 in adipose-derived stem cells (ADSCs) and transplanting these cells into the wound site. This approach allowed for sustained IL-10 expression concurrent with ADSC proliferation, effectively overcoming the issue of IL-10's short half-life in wounds. We investigated the impact of ADSC-IL10 cells on wound inflammation in diabetic mice and observed an increase in M2 macrophages by the seventh day post-transplantation. Additionally, we noted a down-regulation of pro-inflammatory genes such as IL-1βand IL-6, and an up-regulation of the anti-inflammatory cytokine IL-10. In our research, alongside IL-10, which exerts a direct anti-inflammatory effect, ADSCs significantly contribute to the promotion of wound healing. Numerous studies have investigated the role of ADSCs in enhancing wound repair, primarily through their proliferation, differentiation, immune regulation, and paracrine functions. Our study revealed that the wound healing rate in diabetic mice treated with ADSC-PCDH was accelerated compared to the Control group (21 days versus 25 days). We observed that CD206 and IL-10 were highly expressed on the wound surface of mice receiving ADSC-PCDH transplants by day 7. Furthermore, the introduction of ADSC-PCDH into the wounds of diabetic mice also stimulated the gene expression of EGF, TGFβ-1, and VEGF within the wound area. Although both ADSC-IL10 and ADSCs can expedite the healing of chronic wounds in diabetic mice, our study identified certain distinctions between the two. Specifically, ADSC-IL10 facilitated wound healing more rapidly than ADSCs alone (19 days versus 21 days), which may be attributed to a greater number of M2-type macrophages, elevated expression of anti-inflammatory cytokines IL-4R and IL-10, and increased expression of EGF in the wound tissues of mice treated with ADSC-IL10 compared to those treated with ADSCs alone. Our research revealed a significant upregulation of gene expressions for EGF, TGFβ-1, and VEGF growth factors in the wound surfaces of mice that had received ADSC-IL10 transplants. The rate of wound healing is contingent upon the development of blood vessels, as well as the migration and proliferation of keratinocytes and fibroblasts. A further reason diabetic wounds are challenging to heal is due to inadequate blood supply, which hampers the wounds from acquiring the necessary nutrients for healing[58]. The expression of growth factors, including EGF, TGFβ-1, and VEGF, can facilitate the repair process of the wound surface. Specifically, elevated VEGF expression can stimulate the creation of new blood vessels and enhance the blood supply at the wound site. Moreover, increased expressions of EGF and TGFβ-1 can encourage the migration and proliferation of epidermal cells and fibroblasts, thereby expediting wound healing and re-epithelialization. Our research revealed that the overexpression of IL-10 in adipose-derived stem cells (ADSCs) did not impact their proliferation, migration, or differentiation. However, the transplantation of ADSCs engineered to express IL-10 (ADSC-IL10) into diabetic mouse wounds enhanced healing more effectively than the transplantation of unmodified ADSCs alone. The mechanism by which ADSC-IL10 accelerates wound healing appears to be associated with the combined suppression of the inflammatory response in diabetic ulcer wounds by both ADSCs and IL-10, the stimulation of vascular endothelial growth factor (VEGF) and other growth factors, and the facilitation of fibroblast migration. This discovery offers a novel approach for the treatment of diabetic ulcers in the future. Conclusion The overexpression of IL-10 does not alter the biological characteristics of ADSCs. When transplanted into diabetic mice, ADSC-IL10 can accelerate wound healing more effectively than ADSCs alone. The mechanism through which ADSC-IL10 enhances wound healing may encompass several aspects: it stimulates the expression of M2-type macrophages, suppresses the secretion of pro-inflammatory factors such as IL-1β, IL-6, and MCP-1, and promotes the production of growth factors like EGF, TGFβ-1, and VEGF. Additionally, it encourages the migration of skin fibroblasts and epidermal cells to the wound sites in diabetic mice. Declarations All authors certify that they have no affiliations with or involvement in any organization or entity with any financial interest or non-financial interest in the subject matter or materials discussed in the manuscript.The authors declare that they have not use AI-generated work in this manuscript. Ethics approval and consent to participate: Title of the approved project:Overexpression of IL-10 in Adipose Mesenchymal Stem Cells Promotes Wound Healing in Diabetic Mice; Name of the institutional approval committee or unit:Tai'an Municipal Hospital; Approval number:LW20170103; Date of approval:2017/01/03 The patient(s) or their guardian(s)/legally authorized representative(s)/next of kin provided written informed consent for participation in the study and/or the use of samples. Consent for publication: All authors approved the final manuscript and the submission to this journal. Availability of data and materials: Data sharing not applicable to this article as no datasets were generated or analyzed during the current study. Competing interests : The authors declare that they have no competing interests. Funding: This work was supported by Tai’an Science and technology development innovation Project,(Grant No.2021NS392) Authors' contributions : HuiZhao: Writing -review & editing, Writing -original draft, Visualization, Validatio, Supervision, Project administration, Methodology, Funding acquisition, Formal analysis, Data curation, Conceptualization. n.Feng Song: Writing-review & editing, Writing -original draft, Visualization, Validation.Xiao Shi: Writing-review & editing, Writing-original draft, Visualization, Validation.Shuai Shang: Writing-review & editing, Writing-original draft, Visualization, Validation. Acknowledgements : First of all, I would like to give my heartfelt thanks to all the people who have ever helped me in this paper.Secondly, I would like to thank Peking Union Medical College for its financial support。 Finally, I am really grateful to all those who devote much time to reading this thesis and give me much advice, Which will benefit me in my later study. References Balooch Hasankhani M, Mirzaei H, Karamoozian A. Global trend analysis of diabetes mellitus incidence, mortality, and mortality-to-incidence ratio from 1990 to 2019. Sci Rep. 2023;13:21908. https://doi.org/10.1038/s41598-023-49249-0 . McDermott KM, Fang M, Boulton AJM, et al. Etiology, epidemiology, and disparities in the burden of diabetic foot ulcers, diabetes care. Diabetes Care. 2023;46(1):209–21. Zhang JJ, Ni P, Song Y, Gao MJ, Guo XY, Zhao BQ. Effective protective mechanisms of HO-1 in diabetic complications: a narrative review. Cell Death Discov. 2024;10(1):433. 10.1038/s41420-024-02205-x . PMID: 39389941; PMCID: PMC11466965. Karakousis ND, Pyrgioti EE, Georgakopoulos PN, Apergi K, Popovic DS, Papanas N. Zinc levels and diabetic foot ulcers: a mini review. Int J Low Extrem Wounds. 2023. 10.1177/15347346231214209 . Taghizadeh A, et al. Mussel-inspired biomaterials: from chemistry to clinic. Bioeng Translational Med. 2022;7(3). 10.1002/btm2.10385 . Sabine A, Eming, Peter J, Murray EJ. Pearce,Metabolic orchestration of the wound healing response,Cell Metabolism,33, Issue 9,2021,Pages 1726–1743,ISSN 1550–4131, https://doi.org/10.1016/j.cmet.2021.07.017 Ouyang W, O'Garra A. IL-10 Family Cytokines IL-10 and IL-22: from Basic Science to Clinical Translation. Immunity. 2019;50(4):871–891. 10.1016/j.immuni.2019.03.020 . PMID: 30995504. Rodríguez SP, Herrera AL. J.E. Parra,Gene expression of pro-inflammatory (IL-8, IL-18, TNF-α, and IFN-γ) and anti-inflammatory (IL-10) cytokines in the duodenum of broiler chickens exposed to lipopolysaccharides from Escherichia coli and Bacillus subtilis,Vet. Volume 16. World; 2023. p. 564. Lu J, Liu J, Li L, Lan Y, Liang Y. Cytokines in type 1 diabetes: mechanisms of action and immunotherapeutic targets. Clin Transl Immunol. 2020;9(3):e1122. 10.1002/cti2.1122 . PMID: 32185024; PMCID: PMC7074462. Syed Khaja AS, Binsaleh NK, Beg MMA, Ashfaq F, Khan MI, Almutairi MG, Qanash H, Saleem M, Ginawi IAM. Clinical importance of cytokine (IL-6, IL-8, and IL-10) and vitamin D levels among patients with Type-1 diabetes. Sci Rep. 2024;14(1):24225. 10.1038/s41598-024-73737-6 . PMID: 39414864; PMCID: PMC11484771. Carlini V, Noonan DM, Abdalalem E, Goletti D, Sansone C, Calabrone L, Albini A. The multifaceted nature of IL-10: regulation, role in immunological homeostasis and its relevance to cancer, COVID-19 and post-COVID conditions. Front Immunol. 2023;14:1161067. 10.3389/fimmu.2023.1161067 . PMID: 37359549; PMCID: PMC10287165. York AG, Skadow MH, Oh J, et al. IL-10 constrains sphingolipid metabolism to limit inflammation. Nature. 2024;627:628–35. Khamaru S, Mukherjee T, Tung KS, Kumar PS, Bandyopadhyay S, Mahish C, Chattopadhyay S, Chattopadhyay S. Chikungunya virus infection inhibits B16 melanoma-induced immunosuppression of T cells and macrophages mediated by interleukin 10. Microb Pathog. 2024;197:107022. doi: 10.1016/j.micpath.2024.107022. Epub ahead of print. PMID: 39419458. Kwaśniak K, Czarnik-Kwaśniak J, Maziarz A, Aebisher D, Zielińska K, Karczmarek-Borowska B, Tabarkiewicz J. Scientific reports concerning the impact of interleukin 4, interleukin 10 and transforming growth factor β on cancer cells. Cent Eur J Immunol. 2019;44(2):190–200. Epub 2019 Jul 30. PMID: 31530989; PMCID: PMC6745546. Radomir L, Kramer MP, Perpinial M, et al. The survival and function of IL-10-producing regulatory B cells are negatively controlled by SLAMF5. Nat Commun. 2021;12:1893. Yu H, Lin L, Zhang Z, et al. Targeting NF-κB pathway for the therapy of diseases: mechanism and clinical study. Sig Transduct Target Ther. 2020;5:209. Hu X, li J, Fu M, et al. The JAK/STAT signaling pathway: from bench to clinic. Sig Transduct Target Ther. 2021;6:402. Glaviano A, Foo ASC, Lam HY, Yap KCH, Jacot W, Jones RH, Eng H, Nair MG, Makvandi P, Geoerger B, Kulke MH, Baird RD, Prabhu JS, Carbone D, Pecoraro C, Teh DBL, Sethi G, Cavalieri V, Lin KH, Javidi-Sharifi NR, Toska E, Davids MS, Brown JR, Diana P, Stebbing J, Fruman DA, Kumar AP. PI3K/AKT/mTOR signaling transduction pathway and targeted therapies in cancer. Mol Cancer. 2023;22(1):138. 10.1186/s12943-023-01827-6 . PMID: 37596643; PMCID: PMC10436543. Carlini V, Noonan DM, Abdalalem E, Goletti D, Sansone C, Calabrone L, Albini A. The multifaceted nature of IL-10: regulation, role in immunological homeostasis and its relevance to cancer, COVID-19 and post-COVID conditions. Front Immunol. 2023;14:1161067. 10.3389/fimmu.2023.1161067 . PMID: 37359549; PMCID: PMC10287165. Walker D, Short M, Rae T, Lu B, Padon TJ, Prajapati F, Faruk OO, Olutoye L, Yu P, Bollyky SG, Keswani. Swathi Balaji,Endogenous Interleukin-10 Contributes to Wound Healing and Regulates Tissue Repair,Journal of Surgical Research,285,2023,Pages 26–34,ISSN 0022-4804. Voza FA, Huerta CT, Le N, Shao H, Ribieras A, Ortiz Y, Atkinson C, Machuca T, Liu ZJ, Velazquez OC. Fibroblasts in Diabetic Foot Ulcers. Int J Mol Sci. 2024;25(4):2172. 10.3390/ijms25042172 . PMID: 38396848; PMCID: PMC10889208. Raghuram AC, Yu RP, Lo AY, Sung CJ, Bircan M, Thompson HJ, Wong AK. Role of stem cell therapies in treating chronic wounds: A systematic review. World J Stem Cells. 2020;12(7):659–75. 10.4252/wjsc.v12.i7.659 . PMID: 32843920; PMCID: PMC7415243. Sharma P, Kumar A, Dey AD. Cellular Therapeutics for Chronic Wound Healing: Future for Regenerative Medicine. Curr Drug Targets. 2022;23(16):1489–1504. 10.2174/138945012309220623144620 . PMID: 35748548. Farabi B, Roster K, Hirani R, Tepper K, Atak MF, Safai B. The Efficacy of Stem Cells in Wound Healing: A Systematic Review. Int J Mol Sci. 2024;25(5):3006. 10.3390/ijms25053006 . PMID: 38474251; PMCID: PMC10931571. Nourian Dehkordi A, Mirahmadi Babaheydari F, Chehelgerdi M, et al. Skin tissue engineering: wound healing based on stem-cell-based therapeutic strategies. Stem Cell Res Ther. 2019;10:111. Ayavoo T, Murugesan K, Gnanasekaran A. Roles and mechanisms of stem cell in wound healing. Stem Cell Investig. 2021;8:4. 10.21037/sci-2020-027 . PMID: 33829056; PMCID: PMC8022285. Khamaru S, Mukherjee T, Tung KS, Kumar PS, Bandyopadhyay S, Mahish C, Chattopadhyay S, Chattopadhyay S. Chikungunya virus infection inhibits B16 melanoma-induced immunosuppression of T cells and macrophages mediated by interleukin 10. Microb Pathog. 2024;197:107022. doi: 10.1016/j.micpath.2024.107022. Epub ahead of print. PMID: 39419458. Zhou J, Shi Y. Mesenchymal stem/stromal cells (MSCs): origin, immune regulation, and clinical applications. Cell Mol Immunol. 2023;20:555–7. Zhang P, Dong J, Fan X, et al. Characterization of mesenchymal stem cells in human fetal bone marrow by single-cell transcriptomic and functional analysis. Sig Transduct Target Ther. 2023;8:126. Robey PG, Kuznetsov SA, Bianco P, Riminucci M. Bone Marrow Stromal Cell Assays: In Vitro and In Vivo. Methods Mol Biol. 2021;2230:379–396. 10.1007/978-1-0716-1028-2_23 . PMID: 33197027. Qin Y, Ge G, Yang P, Wang L, Qiao Y, Pan G, Yang H, Bai J, Cui W, Geng D. An Update on Adipose-Derived Stem Cells for Regenerative Medicine: Where Challenge Meets Opportunity. Adv Sci (Weinh). 2023;10(20):e2207334. 10.1002/advs.202207334 . Epub 2023 May 10. PMID: 37162248; PMCID: PMC10369252. Luck J, Weil BD, Lowdell M, Mosahebi A. Adipose-Derived Stem Cells for Regenerative Wound Healing Applications: Understanding the Clinical and Regulatory Environment. Aesthet Surg J. 2020;40(7):784–799. 10.1093/asj/sjz214 . PMID: 31406975. Bhat S, Viswanathan P, Chandanala S, et al. Expansion and characterization of bone marrow derived human mesenchymal stromal cells in serum-free conditions. Sci Rep. 2021;11:3403. Xu C, Wang Z, Liu Y, Wei B, Liu X, Duan K, Zhou P, Xie Z, Wu M, Guan J. Extracellular vesicles derived from bone marrow mesenchymal stem cells loaded on magnetic nanoparticles delay the progression of diabetic osteoporosis via delivery of miR-150-5p. Cell Biol Toxicol. 2023;39(4):1257–74. Epub 2022 Sep 16. PMID: 36112264; PMCID: PMC10425527. Wu D, Kang L, Tian J, Wu Y, Liu J, Li Z, Wu X, Huang Y, Gao B, Wang H, Wu Z, Qiu G. Exosomes Derived from Bone Mesenchymal Stem Cells with the Stimulation of Fe3O4 Nanoparticles and Static Magnetic Field Enhance Wound Healing Through Upregulated miR-21-5p. Int J Nanomed. 2020;15:7979–93. 10.2147/IJN.S275650 . PMID: 33116513; PMCID: PMC7585514. Wang D, Guo Y, Heng BC, et al. Cell membrane vesicles derived from hBMSCs and hUVECs enhance bone regeneration. Bone Res. 2024;12:23. Adolfsson E, Helenius G, Friberg Ö, Samano N, Frøbert O, Johansson K. Bone marrow- and adipose tissue-derived mesenchymal stem cells from donors with coronary artery disease; growth, yield, gene expression and the effect of oxygen concentration. Scand J Clin Lab Investig. 2020;80(4):318–26. Sun Y, Yuan Y, Wu W, et al. The effects of locomotion on bone marrow mesenchymal stem cell fate: insight into mechanical regulation and bone formation. Cell Biosci. 2021;11:88. Zakrzewski W, Dobrzyński M, Szymonowicz M, Rybak Z. Stem cells: past, present, and future. Stem Cell Res Ther. 2019;10(1):68. 10.1186/s13287-019-1165-5 . PMID: 30808416; PMCID: PMC6390367. Brianna, Ling APK, Wong YP. Applying stem cell therapy in intractable diseases: a narrative review of decades of progress and challenges. Stem Cell Investig. 2022;9:4. 10.21037/sci-2022-021 . PMID: 36238449; PMCID: PMC9552054. Yang G, Fan X, Liu Y, et al. Immunomodulatory Mechanisms and Therapeutic Potential of Mesenchymal Stem Cells. Stem Cell Rev Rep. 2023;19:1214–31. Wu X, Jiang J, Gu Z, et al. Mesenchymal stromal cell therapies: immunomodulatory properties and clinical progress. Stem Cell Res Ther. 2020;11:345. Naji A, Eitoku M, Favier B, Deschaseaux F, Rouas-Freiss N, Suganuma N. Biological functions of mesenchymal stem cells and clinical implications. Cell Mol Life Sci. 2019;76(17):3323–48. 10.1007/s00018-019-03125-1 . Epub 2019 May 4. PMID: 31055643; PMCID: PMC11105258. Guillamat-Prats R. The Role of MSC in Wound Healing, Scarring and Regeneration. Cells. 2021;10(7):1729. 10.3390/cells10071729 . PMID: 34359898; PMCID: PMC8305394. Li S, Li Y, Zhu K, He W, Guo X, Wang T, Gong S, Zhu Z. Exosomes from mesenchymal stem cells: Potential applications in wound healing. Life Sci. 2024;357:123066. 10.1016/j.lfs.2024.123066 . Epub 2024 Sep 19. PMID: 39306326. Arabpour M, Saghazadeh A, Rezaei N, Anti-inflammatory. and M2 macrophage polarization-promoting effect of mesenchymal stem cell-derived exosomes. Int Immunopharmacol. 2021;97:107823. 10.1016/j.intimp.2021.107823 . Epub 2021 Jun 5. PMID: 34102486. Wang X, Wong K, Ouyang W, Rutz S, Targeting. Cold Spring Harb Perspect Biol. 2019;11(2):a028548. 10.1101/cshperspect.a028548 . PMID: 29038121; PMCID: PMC6360861. IL-10 Family Cytokines for the Treatment of Human Diseases. Tabares-Guevara JH, Jaramillo JC, Ospina-Quintero L, Piedrahíta-Ochoa CA, García-Valencia N, Bautista-Erazo DE, Caro-Gómez E, Covián C, Retamal-Díaz A, Duarte LF, González PA, Bueno SM, Riedel CA, Kalergis AM, Ramírez-Pineda JR. IL-10-Dependent Amelioration of Chronic Inflammatory Disease by Microdose Subcutaneous Delivery of a Prototypic Immunoregulatory Small Molecule. Front Immunol. 2021;12:708955. 10.3389/fimmu.2021.708955 . PMID: 34305950; PMCID: PMC8297659.66. Steen EH, Wang X, Balaji S, Butte MJ, Bollyky PL, Keswani SG. The Role of the Anti-Inflammatory Cytokine Interleukin-10 in Tissue Fibrosis. Adv Wound Care (New Rochelle). 2020;9(4):184–98. 10.1089/wound.2019.1032 . Epub 2020 Feb 7. PMID: 32117582; PMCID: PMC7047112. York AG, Skadow MH, Oh J, Qu R, Zhou QD, Hsieh WY, Mowel WK, Brewer JR, Kaffe E, Williams KJ, Kluger Y, Smale ST, Crawford JM, Bensinger SJ, Flavell RA. IL-10 constrains sphingolipid metabolism to limit inflammation. Nature. 2024;627(8004):628–35. 10.1038/s41586-024-07098-5 . Epub 2024 Feb 21. PMID: 38383790; PMCID: PMC10954550. Liu C, Wang X, Cao X. IL-10: A Key Regulator and potential therapeutic target in uveitis. Cell Immunol. 2024;405–406:104885. 10.1016/j.cellimm.2024.104885 . Epub ahead of print. PMID: 39447525. Saraiva M, Vieira P, O'Garra A. Biology and therapeutic potential of interleukin-10. J Exp Med. 2020;217(1):e20190418. 10.1084/jem.20190418 . PMID: 31611251; PMCID: PMC7037253. Minshawi F, Lanvermann S, McKenzie E, Jeffery R, Couper K, Papoutsopoulou S, Roers A, Muller W. The Generation of an Engineered Interleukin-10 Protein With Improved Stability and Biological Function. Front Immunol. 2020;11:1794. 10.3389/fimmu.2020.01794 . PMID: 32849644; PMCID: PMC7431522. Qiao J, Liu Z, Dong C, Luan Y, Zhang A, Moore C, Fu K, Peng J, Wang Y, Ren Z, Han C, Xu T, Fu YX. Targeting Tumors with IL-10 Prevents Dendritic Cell-Mediated CD8 + T Cell Apoptosis. Cancer Cell. 2019;35(6):901–915.e4. 10.1016/j.ccell.2019.05.005 . PMID: 31185213. Pastar I, Balukoff NC, Sawaya AP, Vecin NM, Tomic-Canic M. Physiology and Pathophysiology of Wound Healing in Diabetes. In: Veves A, Giurini JM, Schermerhorn ML, editors. The Diabetic Foot. Cham: Contemporary Diabetes. Humana; 2024. Steen EH, Wang X, Balaji S, Butte MJ, Bollyky PL, Keswani SG. The Role of the Anti-Inflammatory Cytokine Interleukin-10 in Tissue Fibrosis. Adv Wound Care (New Rochelle). 2020;9(4):184–98. 10.1089/wound.2019.1032 . Epub 2020 Feb 7. PMID: 32117582; PMCID: PMC7047112. Qiao J, Liu Z, Dong C, Luan Y, Zhang A, Moore C, Fu K, Peng J, Wang Y, Ren Z, Han C, Xu T, Fu YX. Targeting Tumors with IL-10 Prevents Dendritic Cell-Mediated CD8 + T Cell Apoptosis. Cancer Cell. 2019;35(6):901–915.e4. 10.1016/j.ccell.2019.05.005 . PMID: 31185213. Clyne AM. Endothelial response to glucose: dysfunction, metabolism, and transport. Biochem Soc Trans. 2021;49(1):313–25. 10.1042/BST20200611 . PMID: 33522573; PMCID: PMC7920920. Supplementary Files ADSCIL10ELISA.xlsx ADSCIL4ELISA.xlsx AuthorChecklistFull.pdf qPCR264.7.xlsx renamed76480.xlsx renamede875f.xlsx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5567768","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":399918066,"identity":"f6dbd040-5d55-4bab-bb30-138a84642e2d","order_by":0,"name":"Hui Zhao","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAvUlEQVRIiWNgGAWjYDACCQYGZiApx8/MfPABSVqMJdvZkg1I0cKQaHCex0yAKB3ys5sfPi5ss0gwPsxgxsBQYxNNUAvjnGPGxjPbJPLMDjOkPWA4lpbbQEgLs0SCmTRvm0QxUMtxA8aGw4S1sEmkfwNpSdzczNgmQZQWHokcsC2JG5iZ2YjTIiGRU2zMc07CWOIwG7NBAjF+kZ+RvvExT1mdHH//+Y8PPtTYENaCChJIUz4KRsEoGAWjABcAAFy7NaVHY00jAAAAAElFTkSuQmCC","orcid":"","institution":"Taian City Central Hospital","correspondingAuthor":true,"prefix":"","firstName":"Hui","middleName":"","lastName":"Zhao","suffix":""},{"id":399918067,"identity":"13b424c1-5d17-4538-9a4e-d1b9984c7dd2","order_by":1,"name":"Feng Song","email":"","orcid":"","institution":"Shandong Provincial Hospital Affiliated to Shandong First Medical University: Shandong Provincial Hospital","correspondingAuthor":false,"prefix":"","firstName":"Feng","middleName":"","lastName":"Song","suffix":""},{"id":399918068,"identity":"ef78ab3c-047e-43c1-94a2-a0c173493a76","order_by":2,"name":"Xiao Shi","email":"","orcid":"","institution":"Taian City Central Hospital","correspondingAuthor":false,"prefix":"","firstName":"Xiao","middleName":"","lastName":"Shi","suffix":""},{"id":399918069,"identity":"ced81821-1e44-4113-9769-4d6350a617ab","order_by":3,"name":"Shuai Shang","email":"","orcid":"","institution":"Taian 88 Hospital","correspondingAuthor":false,"prefix":"","firstName":"Shuai","middleName":"","lastName":"Shang","suffix":""}],"badges":[],"createdAt":"2024-12-03 01:20:28","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5567768/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5567768/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":73702236,"identity":"64f682ca-846b-477d-94e5-5a8acc25a41e","added_by":"auto","created_at":"2025-01-13 17:33:28","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":261567,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-5567768/v1/39fc665444315e3bf5b9f94a.png"},{"id":73702237,"identity":"9c54a175-afd2-4f97-9a3d-9164d285c732","added_by":"auto","created_at":"2025-01-13 17:33:28","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":313914,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-5567768/v1/6360d3f73f04ff3c06e5ede9.png"},{"id":73703604,"identity":"a041064c-2380-4b7e-8612-14550486c7bc","added_by":"auto","created_at":"2025-01-13 17:41:28","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":168197,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-5567768/v1/a3fbcbd829c7a01484cfc558.png"},{"id":73702240,"identity":"552b188b-a759-4873-9aa7-a2519426e692","added_by":"auto","created_at":"2025-01-13 17:33:28","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":83664,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-5567768/v1/8318a18a54f461b0b35d1335.png"},{"id":73703605,"identity":"199c7984-e197-4ee6-881e-61aed77c528e","added_by":"auto","created_at":"2025-01-13 17:41:28","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":108390,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-5567768/v1/26e488671d4567f3b8605ed6.png"},{"id":73702258,"identity":"897f236b-fe81-40eb-b248-9f690a8ab355","added_by":"auto","created_at":"2025-01-13 17:33:30","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":584544,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-5567768/v1/3dfe5c7af81d97b4cf0e8807.png"},{"id":74339191,"identity":"16e1cd63-94c3-4563-b118-2d16d69e85b4","added_by":"auto","created_at":"2025-01-21 08:21:10","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2684246,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5567768/v1/8d8c088e-ae9d-4640-8afe-7f94c44acf24.pdf"},{"id":73702234,"identity":"ee748c22-7e4d-407b-af92-c0f26ea60589","added_by":"auto","created_at":"2025-01-13 17:33:27","extension":"xlsx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":15848,"visible":true,"origin":"","legend":"","description":"","filename":"ADSCIL10ELISA.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-5567768/v1/79e2fca74c9fa63235bcdb32.xlsx"},{"id":73702260,"identity":"30e75d3d-3f6f-4682-921f-c0a8b2d2b836","added_by":"auto","created_at":"2025-01-13 17:33:30","extension":"xlsx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":15822,"visible":true,"origin":"","legend":"","description":"","filename":"ADSCIL4ELISA.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-5567768/v1/f88138a154a3d8a876c6fc90.xlsx"},{"id":73702250,"identity":"a2010444-9f1d-4786-b8ec-62a45a22515d","added_by":"auto","created_at":"2025-01-13 17:33:29","extension":"pdf","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":245074,"visible":true,"origin":"","legend":"","description":"","filename":"AuthorChecklistFull.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5567768/v1/d70cd3aed2a246a325b721dd.pdf"},{"id":73702238,"identity":"b812ddec-45c5-48a7-87fc-622c31d80611","added_by":"auto","created_at":"2025-01-13 17:33:28","extension":"xlsx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":11296,"visible":true,"origin":"","legend":"","description":"","filename":"qPCR264.7.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-5567768/v1/8a989eed3583016e98fef824.xlsx"},{"id":73702249,"identity":"7f04c352-1218-45cc-a724-860d7017de5f","added_by":"auto","created_at":"2025-01-13 17:33:29","extension":"xlsx","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":9444,"visible":true,"origin":"","legend":"","description":"","filename":"renamed76480.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-5567768/v1/59f08cea52c950eb15583289.xlsx"},{"id":73702262,"identity":"a22748b2-813c-468b-988c-1be974ee78bf","added_by":"auto","created_at":"2025-01-13 17:33:30","extension":"xlsx","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":11494,"visible":true,"origin":"","legend":"","description":"","filename":"renamede875f.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-5567768/v1/b6c99ee23e4394baee3347c1.xlsx"}],"financialInterests":"","formattedTitle":"Overexpression of IL-10 in Adipose Mesenchymal Stem Cells Promotes Wound Healing in Diabetic Mice","fulltext":[{"header":"Introduction","content":"\u003cp\u003eDiabetes Mellitus (DM), a chronic metabolic disorder, affects millions of individuals and is projected to affect 592 million people worldwide by 2035\u003csup\u003e\u0026nbsp;[1].\u003c/sup\u003e Diabetic foot ulcers are a significant complication of diabetes, frequently resulting in amputation or even mortality \u003csup\u003e[2,3]\u003c/sup\u003e. As the global incidence of diabetes continues to escalate, the life expectancy of those with diabetes is also increasing, which in turn leads to a rising incidence and mortality rate of diabetic foot ulcers. This trend imposes an increasingly substantial economic burden on society and healthcare systems \u003csup\u003e[4,5]\u003c/sup\u003e. With the growing prevalence of diabetes mellitus, the issue of wounds that heal poorly or not at all is emerging as a serious global health concern, and it stands as a focal point and challenge within the field of wound repair research.\u003c/p\u003e\n\u003cp\u003eThe mechanism underlying chronic wounds is intricate and remains incompletely understood. Inflammation plays a crucial role in the healing process, with the orderly migration of neutrophils and macrophages being essential for effective wound repair. Within the wound environment, these cells secrete a variety of inflammatory mediators that orchestrate the healing cascade\u003csup\u003e[6]\u003c/sup\u003e. Consequently, for the successful completion of wound repair and tissue regeneration, the body\u0026apos;s inflammatory response must be meticulously regulated. Interleukin-10 (IL-10) emerges as a key modulator in suppressing the inflammatory response\u003csup\u003e[7]\u003c/sup\u003e. Research has demonstrated that IL-10 can suppress the activation of pro-inflammatory cytokines, such as IL-1\u0026beta;, IL-6, and tumor necrosis factor-A (TNF-\u0026alpha;), within macrophages\u003csup\u003e[8-12]\u003c/sup\u003e. Additionally, IL-10 curtails the migration of leukocytes to sites of inflammation by inhibiting the production of various chemokines\u003csup\u003e[13, 14]\u003c/sup\u003e. It also enhances the survival and proliferation of B cells and prevents the activation of NF-ĸB\u003csup\u003e[15,16]\u003c/sup\u003e. IL-10 is involved in modulating the JAK-STAT signaling pathway\u003csup\u003e[17]\u0026nbsp;\u003c/sup\u003eand mitigates fibrosis by promoting interactions between the PI3K/AKT and STAT3 signaling pathways\u003csup\u003e[18].\u003c/sup\u003e Thus, IL-10 is a pivotal regulator of tissue repair, being expressed in keratinocytes and infiltrating monocytes at the wound\u0026apos;s periphery, peaking at 3 hours and 3 days post-injury, respectively\u003csup\u003e[19]\u003c/sup\u003e. Studies further indicate that IL-10 is instrumental in limiting and terminating inflammatory responses during tissue repair. When applied to wounds, IL-10 increases monocyte infiltration, chemokine, and pro-inflammatory cytokine expression. Infiltrated monocytes are adept at combating wound microorganisms, clearing debris, and secreting a range of growth factors that are conducive to wound healing\u003csup\u003e[20]\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eDiabetic ulcer is a complication of diabetes and occurs mostly in the feet. Diabetic ulcer wounds cannot be cured with traditional medical or surgical treatment. According to the international diabetes federation, 70% of amputations occur in diabetic patients. The pathophysiological relationship between diabetes and poor wound healing is very complex. Keratinocytes and fibroblasts isolated from diabetic foot ulcers have low proliferation potential, and the activity of growth factors is weakened, which is the key reason for the impaired tissue repair function of diabetic ulcers\u003csup\u003e[21]\u003c/sup\u003e. Researchers have been looking for more effective ways to treat nonhealing diabetes.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eStem cells have been extensively researched for their potential to accelerate wound healing. Patients suffering from advanced conditions, such as diabetic ulcers or deep chronic wounds, who face no alternative but amputation, may stand to benefit from stem cell therapy\u003csup\u003e[22-27]\u003c/sup\u003e.\u0026nbsp;Mesenchymal Stem Cells (MSCs) can be derived from bone marrow, peripheral blood, or adipose tissue\u003csup\u003e[28]\u003c/sup\u003e. Through in vivo and in vitro experiments, it has been established that bone marrow mesenchymal stem cells (BMSCs) possess the capability to differentiate into a variety of cell types\u003csup\u003e[29]\u003c/sup\u003e and exhibit therapeutic potential for chronic wounds\u003csup\u003e[30]\u003c/sup\u003e.However, BMSC cells are derived from bone marrow and their availability is limited. Derived from adipose tissue, ADSCs have been proven to provide a basis for regeneration after tissue injury by regulating immune response, and to promote wound healing through paracrine action\u003csup\u003e[27, 31-38]\u003c/sup\u003e. ADSCs, due to their ease of procurement compared to BMSCs and their abundant supply, have increasingly become the cell type of choice for wound repair and regeneration, garnering significant interest from medical professionals and researchers alike.\u003c/p\u003e\n\u003cp\u003eOver the past ten years, stem cell therapy has demonstrated significant potential in treating orthopedic conditions, inflammatory diseases, liver failure, and autoimmune disorders, among others. Looking ahead, it may emerge as a novel treatment alternative for individuals suffering from these ailments\u003csup\u003e[39,40]\u003c/sup\u003e. Mesenchymal stem cells (MSCs) combine the benefits of both allogeneic and autologous cells, presenting a wide array of therapeutic possibilities for diabetic wound care. MSCs exhibit a minimal level of immune rejection when used to treat diabetic ulcers and retain the capacity for proliferation without undergoing apoptosis\u003csup\u003e[41,42]\u003c/sup\u003e. Research indicates that MSCs preserve their original biological properties even after 20 or 30 cycles of cell culture\u003csup\u003e[43]\u003c/sup\u003e. The collagen, fibroblast growth factor (FGF), and vascular endothelial growth factor (VEGF) produced by MSCs in vitro exceed those of dermal fibroblasts, suggesting their potential to enhance wound repair. Furthermore, MSCs display heightened activity in vivo in granulation tissue formation, re-epithelialization, and angiogenesis, indicating their potential value in expediting the healing process\u003csup\u003e[41,44-45]\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eFurthermore, macrophages are pivotal in orchestrating the inflammatory response during chronic wound inflammation. These cells present a spectrum of phenotypes, extending from \u0026quot;classical activation(M1)\u0026quot; to \u0026quot;alternative activation(M2)\u0026quot;. M1 macrophages release pro-inflammatory cytokines, including IL-1\u0026beta;, TNF-\u0026alpha;, IL-6, among others, as well as nitric oxide, proteases, and reactive oxygen species that are crucial for host defense. They also suppress tissue injury and repair processes. Conversely, M2 macrophages secrete anti-inflammatory cytokines, such as IL-10, ornithine, and polyamines, which facilitate the alleviation of inflammation and promote tissue repair\u003csup\u003e[46]\u003c/sup\u003e. In the context of normal healing, macrophages can transition from an M1 to an M2 phenotype. However, in chronic wounds, macrophages persist in the M1 state, resulting in extensive tissue damage. Consequently, to facilitate the shift from M1 to M2 macrophages, IL-10 has garnered significant interest from researchers and clinicians for its potent anti-inflammatory properties. Presently, there are ongoing studies investigating the therapeutic potential of IL-10 for chronic inflammation\u003csup\u003e[47-50]\u003c/sup\u003e, autoimmune disorders\u003csup\u003e[51]\u003c/sup\u003e, and even cancer\u003csup\u003e[52]\u003c/sup\u003e. Nevertheless, the conventional method of administering IL-10 via direct injection faces challenges due to its rapid dispersion and brief half-life\u003csup\u003e[53]\u003c/sup\u003e. The half-life of IL-10 injected directly into mice is merely 2 hours\u003csup\u003e[54]\u003c/sup\u003e. Therefore, the over-expression of IL-10 within ADSCs (adipose-derived stem cells) not only addresses the issue of IL-10\u0026apos;s short half-life but also offers a sustained enhancement of the inflammatory response in chronic wounds.\u003c/p\u003e"},{"header":"Main experimental materials","content":"\u003cp\u003e\u003cstrong\u003e1.1 Experimental animals and experimental cells\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eExperimental animal\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSPF grade, 8-week-old Balb/c mice, with weights ranging from 24 to 28 grams, were procured from Beijing Weitonglihua Experimental Animal Technology Co., Ltd. The use of these animals was reviewed and received approval from the Animal Ethics Committee. The experimental animals were housed in the standardized animal facility at the Orthopaedic Surgery Hospital of the Chinese Academy of Medical Sciences, where they were provided with a high-fat and high-sugar diet. The IVC animal room maintained a relative humidity between 40-70%, an indoor temperature ranging from 18-22 degrees Celsius, and ample lighting. Prior to the formal testing, the experimental animals were acclimated and fed for a duration of three days upon their arrival at the animal facility.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eExperimental cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eADSCs were derived from patients aged 20-35 years old who underwent liposuction at the Plastic Surgery Hospital of the Chinese Academy of Medical Sciences and subsequently cultured in mesenchymal stem cell medium. All samples collected were approved by the hospital\u0026apos;s Medical Ethics Committee, and preoperative informed consent was obtained, with signed consent forms.\u003c/p\u003e\n\u003cp\u003eHEK 293T cells were maintained at the Research Center of the Orthopedic Surgery Hospital, Chinese Academy of Medical Sciences, and were cultured using DMEM high-glucose medium supplemented with 10% serum and 1% double antibody.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2 Real-time PCR primer sequence\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe table below presents the sequence, serial number, and coding DNA length of the genes and primers utilized in the experiment.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 1.1: Sequence, Serial Number, and DNA Length Coding of Genes and Primers Employed in the Experiment\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"541\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 74px;\"\u003e\n \u003cp\u003eGene\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 140px;\"\u003e\n \u003cp\u003eSerial number\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 267px;\"\u003e\n \u003cp\u003ePrimer sequence\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 60px;\"\u003e\n \u003cp\u003eLength\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 74px;\"\u003e\n \u003cp\u003e\u003cem\u003eIL-10\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 140px;\"\u003e\n \u003cp\u003e\u003cem\u003eNM_010548.2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 267px;\"\u003e\n \u003cp\u003e\u003cem\u003eF\u003c/em\u003e\u003cem\u003e:\u003c/em\u003e\u003cem\u003eCAGAGAAGCATGGCCCAGAA\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 60px;\"\u003e\n \u003cp\u003e\u003cem\u003e129 bp\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 267px;\"\u003e\n \u003cp\u003e\u003cem\u003eR\u003c/em\u003e\u003cem\u003e:\u003c/em\u003e\u003cem\u003eGCTCCACTGCCTTGCTCTTA\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 74px;\"\u003e\n \u003cp\u003e\u003cem\u003eGAPDH\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 140px;\"\u003e\n \u003cp\u003e\u003cem\u003eNM_001289726.1\u003cbr\u003e\u0026nbsp;NM_008084.3\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 267px;\"\u003e\n \u003cp\u003e\u003cem\u003eF: GCACCGTCAAGGCTGAGAAC\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eR\u003c/em\u003e\u003cem\u003e:\u003c/em\u003e\u003cem\u003eTGGTGAAGACGCCAGTGGA\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 60px;\"\u003e\n \u003cp\u003e\u003cem\u003e159 bp\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 74px;\"\u003e\n \u003cp\u003e\u003cem\u003eIL4\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 140px;\"\u003e\n \u003cp\u003e\u003cem\u003eNM_021283.2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 267px;\"\u003e\n \u003cp\u003e\u003cem\u003eF\u003c/em\u003e\u003cem\u003e:\u003c/em\u003e\u003cem\u003eCGTCTGTAGGGCTTCCAAGG\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 60px;\"\u003e\n \u003cp\u003e\u003cem\u003e123 bp\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 267px;\"\u003e\n \u003cp\u003e\u003cem\u003eR\u003c/em\u003e\u003cem\u003e:\u003c/em\u003e\u003cem\u003eAGGCATCGAAAAGCCCGAA\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 74px;\"\u003e\n \u003cp\u003e\u003cem\u003eIL4R\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 140px;\"\u003e\n \u003cp\u003e\u003cem\u003eNM_001008700.4\u003cbr\u003e\u0026nbsp;NM_001363983.1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 267px;\"\u003e\n \u003cp\u003e\u003cem\u003eF\u003c/em\u003e\u003cem\u003e:\u003c/em\u003e\u003cem\u003eCGAAGCCAGGAGTCAACCAA\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 60px;\"\u003e\n \u003cp\u003e\u003cem\u003e126 bp\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 267px;\"\u003e\n \u003cp\u003e\u003cem\u003eR\u003c/em\u003e\u003cem\u003e:\u003c/em\u003e\u003cem\u003eGAGAGACTTGGTTGGGGCAG\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 74px;\"\u003e\n \u003cp\u003e\u003cem\u003eIL-1\u0026beta;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 140px;\"\u003e\n \u003cp\u003e\u003cem\u003eNM_008361.4\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 267px;\"\u003e\n \u003cp\u003e\u003cem\u003eF\u003c/em\u003e\u003cem\u003e:\u003c/em\u003e\u003cem\u003eATGCCACCTTTTGACAGTGATG\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 60px;\"\u003e\n \u003cp\u003e\u003cem\u003e136 bp\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 267px;\"\u003e\n \u003cp\u003e\u003cem\u003eR\u003c/em\u003e\u003cem\u003e:\u003c/em\u003e\u003cem\u003eTGTGCTGCTGCGAGATTTGA\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 74px;\"\u003e\n \u003cp\u003e\u003cem\u003eIL-6\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 140px;\"\u003e\n \u003cp\u003e\u003cem\u003eNM_001314054.1\u003cbr\u003e\u0026nbsp;NM_031168.2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 267px;\"\u003e\n \u003cp\u003e\u003cem\u003eF\u003c/em\u003e\u003cem\u003e:\u003c/em\u003e\u003cem\u003eTCCGGAGAGGAGACTTCACA\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 60px;\"\u003e\n \u003cp\u003e\u003cem\u003e167 bp\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 267px;\"\u003e\n \u003cp\u003e\u003cem\u003eR\u003c/em\u003e\u003cem\u003e:\u003c/em\u003e\u003cem\u003eTTCTGCAAGTGCATCATCGT\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 74px;\"\u003e\n \u003cp\u003e\u003cem\u003eMCP-1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 140px;\"\u003e\n \u003cp\u003e\u003cem\u003eNM_011333.3\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 267px;\"\u003e\n \u003cp\u003e\u003cem\u003eF\u003c/em\u003e\u003cem\u003e:\u003c/em\u003e\u003cem\u003eACCTGCTGCTACTCATTCACC\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 60px;\"\u003e\n \u003cp\u003e\u003cem\u003e148 bp\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 267px;\"\u003e\n \u003cp\u003e\u003cem\u003eR\u003c/em\u003e\u003cem\u003e:\u003c/em\u003e\u003cem\u003eATTCCTTCTTGGGGTCAGCA\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 74px;\"\u003e\n \u003cp\u003e\u003cem\u003eVEGF\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 140px;\"\u003e\n \u003cp\u003e\u003cem\u003eNM_001110268.1\u003cbr\u003e\u0026nbsp;NM_001110267.1etc.\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 267px;\"\u003e\n \u003cp\u003e\u003cem\u003eF\u003c/em\u003e\u003cem\u003e:\u003c/em\u003e\u003cem\u003eCTTCGAGGAGCACTTTGGGT\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 60px;\"\u003e\n \u003cp\u003e\u003cem\u003e141 bp\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 267px;\"\u003e\n \u003cp\u003e\u003cem\u003eR\u003c/em\u003e\u003cem\u003e:\u003c/em\u003e\u003cem\u003eCCCTAATCTTCCGGGCTTGG\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 74px;\"\u003e\n \u003cp\u003e\u003cem\u003eEGF\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 140px;\"\u003e\n \u003cp\u003e\u003cem\u003eNM_001329594.1\u003cbr\u003e\u0026nbsp;NM_010113.4 etc\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 267px;\"\u003e\n \u003cp\u003e\u003cem\u003eF\u003c/em\u003e\u003cem\u003e:\u003c/em\u003e\u003cem\u003eCATGGAGACAGAAGCCCCAC\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 60px;\"\u003e\n \u003cp\u003e\u003cem\u003e126 bp\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 267px;\"\u003e\n \u003cp\u003e\u003cem\u003eR\u003c/em\u003e\u003cem\u003e:\u003c/em\u003e\u003cem\u003eCCACAGGTCTGTAGGAGGGT\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 74px;\"\u003e\n \u003cp\u003e\u003cem\u003eTGF\u0026beta;-1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 140px;\"\u003e\n \u003cp\u003e\u003cem\u003eNM_011577.2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 267px;\"\u003e\n \u003cp\u003e\u003cem\u003eF\u003c/em\u003e\u003cem\u003e:\u003c/em\u003e\u003cem\u003eCGTCAGACATTCGGGAAGCA\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 60px;\"\u003e\n \u003cp\u003e\u003cem\u003e140 bp\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 267px;\"\u003e\n \u003cp\u003e\u003cem\u003eR\u003c/em\u003e\u003cem\u003e:\u003c/em\u003e\u003cem\u003eACCAAGGTAACGCCAGGAAT\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 74px;\"\u003e\n \u003cp\u003e\u003cem\u003eiNOS\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 140px;\"\u003e\n \u003cp\u003e\u003cem\u003eNM_001313922.1\u003cbr\u003e\u0026nbsp;NM_001313921.1 etc\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 267px;\"\u003e\n \u003cp\u003e\u003cem\u003eF\u003c/em\u003e\u003cem\u003e:\u003c/em\u003e\u003cem\u003eGCGAAAGGTCATGGCTTCAC\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 60px;\"\u003e\n \u003cp\u003e\u003cem\u003e136 bp\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 267px;\"\u003e\n \u003cp\u003e\u003cem\u003eR\u003c/em\u003e\u003cem\u003e:\u003c/em\u003e\u003cem\u003eCTGGTCCATGCAGACAACCT\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 74px;\"\u003e\n \u003cp\u003e\u003cem\u003eArg-1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 140px;\"\u003e\n \u003cp\u003e\u003cem\u003eNM_007482.3\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 267px;\"\u003e\n \u003cp\u003e\u003cem\u003eF\u003c/em\u003e\u003cem\u003e:\u003c/em\u003e\u003cem\u003eAATGAAGAGCTGGCTGGTGT\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 60px;\"\u003e\n \u003cp\u003e\u003cem\u003e153 bp\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 267px;\"\u003e\n \u003cp\u003e\u003cem\u003eR\u003c/em\u003e\u003cem\u003e:\u003c/em\u003e\u003cem\u003eAGTGTGAGCATCCACCCAAA\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 74px;\"\u003e\n \u003cp\u003e\u003cem\u003eCD206\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 140px;\"\u003e\n \u003cp\u003e\u003cem\u003eNM_008625.2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 267px;\"\u003e\n \u003cp\u003e\u003cem\u003eF\u003c/em\u003e\u003cem\u003e:\u003c/em\u003e\u003cem\u003eCACGGAGATCCACGAGCAAA\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 60px;\"\u003e\n \u003cp\u003e\u003cem\u003e131 bp\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 267px;\"\u003e\n \u003cp\u003e\u003cem\u003eR\u003c/em\u003e\u003cem\u003e:\u003c/em\u003e\u003cem\u003eGATACCGGAATGGGCTTCCT\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 74px;\"\u003e\n \u003cp\u003e\u003cem\u003eCD86\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 140px;\"\u003e\n \u003cp\u003e\u003cem\u003eNM_019388.3\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 267px;\"\u003e\n \u003cp\u003e\u003cem\u003eF\u003c/em\u003e\u003cem\u003e:\u003c/em\u003e\u003cem\u003eGCAGGACCAGCAAAAGTTGG\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 60px;\"\u003e\n \u003cp\u003e\u003cem\u003e151 bp\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 267px;\"\u003e\n \u003cp\u003e\u003cem\u003eR\u003c/em\u003e\u003cem\u003e:\u003c/em\u003e\u003cem\u003eCGAGCCCATGTCCTTGATCT\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003e3 Experimental method\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e3.1 Detection of ADSCs supernatant IL-10 expression by ELISA kit (human IL-10 high sensitivity ELISA kit; Lianke Biology, item No. EK110S-96)\u003c/p\u003e\n\u003cp\u003e(1)Preparation of the Standard Curve for Cell Culture Supernatant Samples:\u003c/p\u003e\n\u003cp\u003eA 250\u0026micro;l aliquot of concentrated human IL-10 standard was obtained and combined with an equal volume of mesenchymal stem cell medium to create the highest point on the standard curve, corresponding to a concentration of 25 pg/ml. Subsequently, 250\u0026micro;l of mesenchymal stem cell medium was added to each test tube. Serial dilutions were then performed, starting from this highest concentration standard, in a 1:1 ratio. The mesenchymal stem cell medium alone served as the zero concentration point for the standard curve.\u003c/p\u003e\n\u003cp\u003eThe OD values at wavelengths of 450 nm and 570 nm were determined using an enzyme-labeled instrument. The OD value at 450 nm is then subtracted from the OD value at 570 nm, with the resultant value serving as the calibrated OD. Utilizing solely the OD value at 450 nm would result in an elevated OD value and diminish the precision of the measurement.\u003c/p\u003e\n\u003cp\u003e(2) Calculation results\u003c/p\u003e\n\u003cp\u003eTo calculate the average optical density (OD) values for both the standard and the sample, subtract the OD value of the zero concentration standard. Plotting the concentration of the standard product on the horizontal axis and the OD values on the vertical axis, the standard curve is generated through regression fitting using computer software. Regression analysis is then employed to determine the optimal fitting curve.\u003c/p\u003e\n\u003cp\u003e3.2 Detection of Adipose-Derived Stem Cells (ADSCs) surface markers is performed using flow cytometry, employing the Human MSC Analysis Kit (BD Stemflow\u0026trade;, item No. 562245).\u003c/p\u003e\n\u003cp\u003e(1) Add the following antibodies according to the following formula (Table 1.2) :\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 1.2 Proportion of Stem Cell Markers Identified by Flow Cytometry in ADSCs\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"536\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 97px;\"\u003e\n \u003cp\u003eEP tube number\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 349px;\"\u003e\n \u003cp\u003eAntibody name\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003eAdding volume\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 97px;\"\u003e\n \u003cp\u003e\u003cem\u003e1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 349px;\"\u003e\n \u003cp\u003e\u003cem\u003eFITC Mouse Anti-Human CD90\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003e\u003cem\u003e5 ul\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 97px;\"\u003e\n \u003cp\u003e\u003cem\u003e2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 349px;\"\u003e\n \u003cp\u003e\u003cem\u003ePE Mouse Anti-Human CD44\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003e\u003cem\u003e5 ul\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 97px;\"\u003e\n \u003cp\u003e\u003cem\u003e3\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 349px;\"\u003e\n \u003cp\u003e\u003cem\u003ePerCP-Cy\u0026trade;5.5 Mouse Anti-Human CD105\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003e\u003cem\u003e5 ul\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 97px;\"\u003e\n \u003cp\u003e\u003cem\u003e4\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 349px;\"\u003e\n \u003cp\u003e\u003cem\u003eAPC Mouse Anti-Human CD73\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003e\u003cem\u003e5 ul\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 97px;\"\u003e\n \u003cp\u003e\u003cem\u003e5\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 349px;\"\u003e\n \u003cp\u003e\u003cem\u003eNothing\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 97px;\"\u003e\n \u003cp\u003e\u003cem\u003e6\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 349px;\"\u003e\n \u003cp\u003e\u003cem\u003ehMSC Positive Isotype Control Cocktail\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003ePE hMSC Negative Isotype Control Cocktail\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003e\u003cem\u003e20 \u0026mu;l\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003e20 \u0026mu;l\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 97px;\"\u003e\n \u003cp\u003e\u003cem\u003e7\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 349px;\"\u003e\n \u003cp\u003e\u003cem\u003ehMSC Positive Cocktail\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003ePE hMSC Negative Cocktail\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003e\u003cem\u003e20 \u0026mu;l\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003e20 \u0026mu;l\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 97px;\"\u003e\n \u003cp\u003e\u003cem\u003e8\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 349px;\"\u003e\n \u003cp\u003e\u003cem\u003ehMSC Positive Isotype Control Cocktail\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eDrop in isotype control (i.e. PE Mouse IgG2b, \u0026kappa;)\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003e\u003cem\u003e20 \u0026mu;l\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003e5 \u0026mu;l\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 97px;\"\u003e\n \u003cp\u003e\u003cem\u003e9\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 349px;\"\u003e\n \u003cp\u003e\u003cem\u003ehMSC Positive Cocktail\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003ePE Drop in (i.e. PE Mouse Anti-Human CD44)\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003e\u003cem\u003e20 \u0026mu;l\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003e5 \u0026mu;l\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eThe BD flow cytometer was employed for in-situ detection, and the resultant data were analyzed using FlowJo software, with isotype controls as the reference.\u003c/p\u003e\n\u003cp\u003eIn the migration experiment of ADSCs, Image J software was utilized to randomly draw 6 to 8 horizontal lines, from which the average distance between cells was calculated.\u003c/p\u003e\n\u003cp\u003e3.4 Proliferation Experiment of ADSCs Cells\u003c/p\u003e\n\u003cp\u003eThe cell proliferation rates of the ADSC-PCDH and ADSC-IL10 groups were assessed using the MTT assay. Subsequently, the proliferation curve for the ADSC-IL10 cells was generated using GraphPad Prism 7, based on the absorbance measurements.\u003c/p\u003e\n\u003cp\u003e3.5 The in vitro induction of adipogenic differentiation in ADSCs was achieved using the OriCellTM Adult Adipogenic Stromal Stem Cells Adipogenic Induction Differentiation Medium Kit (Item No. HUXMD-90031, Saiye Biotechnology Co., LTD.). Adipogenic differentiation was induced in P5 generation ADSC cells, ADSC-PCDH cells, and ADSC-IL10 cells, and the resulting adipogenic effects were observed and documented using an inverted microscope.\u003c/p\u003e\n\u003cp\u003e3.6 The in vitro osteogenic differentiation of ADSCs (OriCellTM adult adipose stromal stem cells osteogenic differentiation medium kit; Cyagen, item No. HUXMD-90021) was investigated using P5 generation ADSC cells, ADSC-PCDH cells, and ADSC-IL10 cells. The osteogenic effect was monitored and documented using an inverted microscope.\u003c/p\u003e\n\u003cp\u003e3.7 Balb/c mice with high blood glucose were fasting and water abstinence 12 h before surgery. Mice in the model group were injected intraperitoneally at the dose of STZ 150 mg/kg, while the control group was given the same dose of citric acid-sodium citrate buffer (0.1 mol/l, PH4.5). After the injection, the high-fat and high-sugar diet was resumed and remained on the high-fat and high-sugar diet until the end of the experiment. After 3 days of intraperitoneal injection of STZ, the random blood glucose of mice was measured for 14 days. After the blood glucose of mice was stabilized, mice with blood glucose higher than 16.7 mmol/L were selected to be included in the formal experiment, and those with blood glucose lower than 16.7 mmol/L were placed in carbon dioxide to sudden death. The weight of the mice was measured and recorded at the same time as the blood sugar was measured.\u003c/p\u003e\n\u003cp\u003eForty-five hyperglycemic mice, exhibiting blood glucose levels exceeding 16.7 mmol/L, were chosen for the formal experiment and subsequently randomized into three groups: the control group, the ADSC-PCDH group, and the ADSC-IL10 group, with 15 mice in each. In the ADSC-PCDH and ADSC-IL10 groups, subcutaneous transplantation of ADSC-PCDH cells and ADSC-IL10 cells, respectively, was performed on the back wounds of the mice, with approximately 1\u0026times;10^6 cells transplanted into each mouse. The control group received an injection of 0.9% normal saline. The transplanted mice were housed in individual ventilated cages (IVC) for further care and were monitored on days 1, 3, 5, 7, and so forth, during which time photographs were taken of the back wounds of the mice.\u003c/p\u003e\n\u003cp\u003e3.8 On the seventh day post-wound, the granulation tissues of diabetic mice were subjected to double fluorescence staining for CD68 and Arg-1. CD68 serves as a marker for all macrophage subtypes, including both M1 and M2, while Arg-1 is a protein specifically secreted by M2 macrophages. Additionally, the RNA expression levels of two markers indicative of M2 macrophages, namely Arg-1 and CD206, were assessed using quantitative polymerase chain reaction (qPCR).\u003c/p\u003e\n\u003cp\u003e3.9 On the seventh day post-wound, granulation tissue from diabetic mice was harvested, and whole-genome RNA was subsequently extracted. The expression levels of inflammatory factors, including IL-1\u0026beta;, IL-4R, IL-10, EGF, TGF\u0026beta;-1, and VEGF, were then assessed using reverse transcription and fluorescence-based real-time quantitative PCR.\u003c/p\u003e\n\u003cp\u003e3.10 Mouse peritoneal macrophages (Raw 264.7) were cultured in the presence of ADSC-IL10 conditioned medium (ADSC-IL10-CM) and ADSC-PCDH conditioned medium (ADSC-CM), with DMEM low-glucose medium serving as the control. Following a 12-hour culture period, Raw 264.7 cells were harvested for mRNA extraction, and the cell phenotypes were subsequently analyzed using qPCR. The M1 phenotype was identified by the expression of CD86, while the M2 phenotype was characterized by the presence of Arg-1 and CD206. The expression levels of various inflammatory factors, including IL-1\u0026beta;, IL-6, IL-10, MCP-1, and growth factors such as EGF, VEGF, and TGF\u0026beta;-1, were also quantified using qPCR.\u003c/p\u003e\n\u003cp\u003e3.11ADSC-IL10-CM and ADSC-CM were used to stimulate RAW 264.7 cells, while LPS+IFN-\u0026gamma; and IL4 were employed to stimulate Raw 264.7 cells, from which RNA was subsequently extracted. The expression levels of CD86, CD206, and Arg-1 mRNA, as well as IL-1\u0026beta;, IL-6, and MCP-1 mRNA, were then assessed. Additionally, ADSC-IL10-CM and ADSC-CM were separately utilized to stimulate Raw 264.7 cells, and the RNA from these cells was extracted to determine the expression levels of EGF, TGF\u0026beta;-1, and VEGF mRNA.\u003c/p\u003e\n\u003cp\u003e3.12 The impact of ADSC-IL10-CM and ADSC-CM on the migration of normal dermal fibroblasts was assessed using the transwell assay. Additionally, the influence of ADSC-CM on the migratory behavior of human immortalized epidermal cells was investigated employing the scratch assay. In this study, human immortalized epidermal cells, specifically HaCat cells, were cultivated in the presence of ADSC-CM and DMEM medium supplemented with 2% serum.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003cstrong\u003e:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll measurement data were expressed as (mean \u0026plusmn; standard deviation), and t test was used to analyze whether there were statistical differences between groups. p\u0026lt;0.05 indicated that the differences between groups were statistically significant. The results were calculated using GraphPad Prism 7 and histogram was drawn. The wound area of mice was calculated by ImageJ. Photoshop CS6 was used to merge immunofluorescence images. The results of qPCR and flow were analyzed by FlowJo.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003e1.The overexpression of IL-10 did not impact the proliferation, migration, or differentiation of ADSCs.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe culture media for ADSC-IL10, ADSC-PCDH, and ADSC cells were prepared, and the secretion of IL-10 in the supernatant was measured using ELISA. No significant variation in IL-10 expression was observed between the ADSC and ADSC-PCDH groups (p=0.6591), whereas a significant difference was noted between the ADSC-IL10 group and the ADSC-PCDH group (p\u0026lt;0.0001). (Fig. 1A) Cell surface markers, including CD44, CD73, CD90, and CD105, were analyzed on ADSC, ADSC-PCDH, and ADSC-IL10 cells via flow cytometry. The findings indicated that CD44, CD73, CD90, and CD105 were all positive in the ADSC, ADSC-PCDH, and ADSC-IL10 groups. (Fig. 1B)\u003c/p\u003e\n\u003cp\u003eEmploying the MTT assay to assess the cellular proliferation of both the ADSC-PCDH and ADSC-IL10 groups, the findings indicated that no significant disparities in cell proliferation were observed between the two groups, with their proliferation curves exhibiting a relatively consistent pattern (see Fig. 1C).\u003c/p\u003e\n\u003cp\u003eThe detection of cell migration within the ADSC-PCDH group and the ADSC-IL10 group revealed no significant difference in migratory activity between the two cohorts. Both groups exhibited completed cell migration by the 24-hour mark, with no statistically significant variance in the quantity of migrated cells (refer to Fig. 1D).\u003c/p\u003e\n\u003cp\u003eAdipogenic differentiation was induced by P5 ADSCs, ADSC-PCDH cells, and ADSC-IL10 cells. A substantial accumulation of lipid droplets was observed under the microscope on the fifth day of lipid induction.Oil red O staining revealed that ADSC, ADSC-PCDH, and ADSC-IL10 cells all possessed equivalent adipogenic differentiation potential. Genomic RNA was isolated from ADSC, ADSC-PCDH, and ADSC-IL10 cells on the fifth day, and the expression of the lipid-producing marker gene PPAR\u0026gamma; was assessed using quantitative polymerase chain reaction (qPCR).\u0026nbsp;The findings revealed that: there was no statistically significant difference in the expression of the PPAR gamma gene among the three groups, as indicated by the following p-values: ADSC-IL10 versus ADSC-PCDH at p=0.6358, ADSC-PCDH versus the Control group at p=0.5828, and ADSC-IL10 versus the Control group at p=0.9013 (refer to figure 1E).\u003c/p\u003e\n\u003cp\u003eOsteogenic differentiation was induced in P5 ADSC, ADSC-PCDH, and ADSC-IL10 cells. On the 21st day of osteogenic induction, these cells were stained with alizarin red. Microscopic examination revealed that ADSC, ADSC-PCDH, and ADSC-IL10 cells exhibited equivalent staining capabilities with alizarin red. Genomic RNA was extracted from ADSC, ADSC-PCDH, and ADSC-IL10 cells on day 14, and the expression of the osteogenic marker RUNX2 was quantified using qPCR. The outcomes indicated that there was no significant difference in RUNX2 expression between ADSC-IL10 and ADSC-PCDH cells (p=0.7638), nor between ADSC-PCDH cells and the control group (p=0.6072), or between ADSC-IL10 cells and the control group (p=0.7744) (see Fig. 1F).\u003cstrong\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.The overexpression of IL-10 in ADSCs enhances the acceleration of chronic wound healing in diabetic mice.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe diabetic mice were randomly assigned to one of three groups: Control, ADSC-PCDH, or ADSC-IL10.\u0026nbsp;A wound measuring 1.5cm by 1.5cm was excised from the dorsum, and PBS, 1\u0026times;10^6 ADSC-PCDH cells, and 1\u0026times;10^6 ADSC-IL10 cells were subcutaneously transplanted into each group, respectively. It was observed that the healing rate of diabetic mice in the ADSC-IL10 group (with wounds healed by day 19) was significantly higher than that in the ADSC-PCDH group (healed by day 21) and the Control group (healed by day 25). Mice in the Control group exhibited nonhealing wounds (Fig. 2A).\u003c/p\u003e\n\u003cp\u003eImageJ was employed to assess the wound area in mice, and the findings indicated a significant disparity in wound size between the ADSC-IL10 group and the ADSC-PCDH group on the third day of healing (p=0.0026). By the seventh day of healing, a significant difference in wound size emerged between the ADSC-PCDH group and the control group (p=0.0097). Upon reaching the tenth day of healing, both the ADSC-IL10 group and the ADSC-PCDH group exhibited significant differences in wound size compared to each other (p=0.0457) and to the control group (p=0.0240). By the fourteenth day of healing, the ADSC-IL10 group showed a significant difference in wound size compared to the control group (p=0.0156). Finally, on the nineteenth day of healing, significant differences in wound size were observed between the ADSC-IL10 group and the ADSC-PCDH group (p=0.0013), the ADSC-IL10 group and the control group (p=0.0027), as well as between the ADSC-PCDH group and the control group (p=0.0364). (Fig. 2B)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.The transplantation of adipose-derived stem cells (ADSCs) overexpressing interleukin-10 (IL-10) facilitated the polarization of macrophages towards the M2 phenotype.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOn the seventh day post-wounding, granulation tissues from diabetic mice were subjected to CD68 and Arg-1 dual fluorescence staining. CD68 served as a marker for all macrophages (both M1 and M2 types), while Arg-1 represented a secretory protein specific to M2 macrophages. The findings indicated that the expression of Arg-1 in the skin of diabetic mouse wound grafts treated with ADSC-IL10 was elevated compared to those treated with ADSC-PCDH and the Control group, exhibiting a statistically significant difference. Although there was an increase in Arg-1 expression in the ADSC-PCDH-transplanted group relative to the Control group, this difference was not statistically significant. These results suggest that ADSC-IL10 can enhance the population of M2-type macrophages within the wounds of diabetic mice. (Fig. 3A)\u003c/p\u003e\n\u003cp\u003eOn the seventh day post-wounding in diabetic mice, the RNA expression levels of two M2 macrophage markers, namely Arginase-1 (Arg-1) and CD206, were assessed using quantitative polymerase chain reaction (qPCR) in the newly formed granulation tissue. The investigation revealed that the RNA expression levels of both Arg-1 and CD206 were significantly elevated in the wounds of diabetic mice that received ADSC-IL10 transplants compared to those that received ADSC-PCDH transplants and the control group. Statistically significant differences were observed. Additionally, the expression of CD206 RNA in the wounds of diabetic mice from the ADSC-PCDH group was also found to be higher than that in the control group, indicating a statistical difference. These findings suggest that ADSC-IL10 transplantation can enhance the expression of M2-type macrophages at the RNA level within the wounds of diabetic mice. (Fig. 3B)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e4.The transplantation of adipose-derived stem cells (ADSCs) overexpressing interleukin-10 (IL-10) enhanced the expression of anti-inflammatory and growth factors within the wound site.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGranulation tissues from diabetic mice were collected on the seventh day post-wounding, and genomic RNA was subsequently extracted. The expression levels of inflammatory cytokines IL-1\u0026beta;, IL-4r, and IL-10 were assessed using reverse transcription and fluorescence-based real-time quantitative PCR. The findings indicated that in the wounds of diabetic mice that received ADSC-IL10 transplants, there was a reduction in the expression of the pro-inflammatory cytokine IL-1\u0026beta; RNA compared to the control group. Conversely, the expression of the anti-inflammatory cytokines IL-4r and IL-10 RNA was elevated, with statistically significant differences observed. In contrast, no marked variation in the expression of IL-1\u0026beta; and IL-4r was noted between the ADSC-PCDH-transplanted group and the control group. The data presented in (Fig. 4A) suggest that ADSC-IL10 transplantation may attenuate the inflammatory response on the wound surface more effectively than ADSC-PCDH transplantation.\u003c/p\u003e\n\u003cp\u003eGranulation tissues from diabetic mice were collected on the seventh day post-wound, and genomic RNA was subsequently extracted. The expression levels of EGF, TGF\u0026beta;-1, and VEGF RNA were assessed using reverse transcription and fluorescence-based real-time quantitative PCR. The findings indicated that the RNA expression levels of EGF, TGF\u0026beta;-1, and VEGF in the wounds of diabetic mice within the ADSC-IL10 and ADSC-PCDH groups were comparable to those observed in the control group. No statistically significant differences were noted in the expression levels of TGF\u0026beta;-1 and VEGF RNA between the ADSC-IL10 and ADSC-PCDH groups, suggesting a pivotal role for ADSC cells. (Fig. 4 b)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e5.ADSC-IL10 CM induces the differentiation of Raw 264.7 cells into M2-type macrophages.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eADSC-IL10 CM and ADSC CM were collected to stimulate the peritoneal macrophages of mice (Raw 264.7), and the RNA of Raw 264.7 cells was extracted to detect the expression levels of CD86, CD206, and Arg-1 mRNA. The results indicated that both ADSC-IL10 CM and ADSC CM induced a significant increase in the expression of M2-type macrophage markers CD206 and Arg-1 in Raw 264.7, while ADSC-IL10 CM also suppressed the expression of the M1-type macrophage marker CD86 in Raw 264.7. These findings suggest that ADSC-IL10 CM facilitates the differentiation of Raw 264.7 cells towards an M2 phenotype. (Fig. 5A)\u003c/p\u003e\n\u003cp\u003eRAW 264.7 cells were induced into an inflammatory state by stimulation with LPS and IFN\u0026gamma;. Subsequently, conditioned media from ADSCs (ADSC CM) and ADSCs overexpressing IL-10 (ADSC-IL10 CM) were introduced. After 12 hours of stimulation, RNA was extracted from the RAW 264.7 cells to assess the expression levels of pro-inflammatory cytokines, including IL-1\u0026beta;, IL-6, and MCP-1 mRNA. The findings indicated that the addition of ADSC-IL10 CM led to a decrease in the expression of these pro-inflammatory cytokines. This implies that ADSC-IL10 CM has the potential to suppress the inflammatory response in RAW 264.7 cells. (Refer to Fig. 5B)\u003c/p\u003e\n\u003cp\u003eADSC-IL10 CM and ADSC CM were collected to stimulate Raw 264.7 cells, respectively. Subsequently, RNA was extracted from the Raw 264.7 cells to assess the expression levels of EGF, TGF\u0026beta;-1, and VEGF mRNA. The findings indicated that following the culture of Raw 264.7 cells with both ADSC-IL10 CM and ADSC CM, there was an up-regulation in the expression of EGF, TGF\u0026beta;-1, and VEGF mRNA. Notably, the up-regulation was more pronounced with ADSC-IL10 CM. (Fig. 5C)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e6.ADSC CM facilitates the migration of fibroblasts and epidermal cells.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe migration of normal skin fibroblasts was investigated using conditioned media from adipose-derived stem cells (ADSCs) with and without interleukin-10 (IL10) supplementation. The findings indicated that, in contrast to DMEM, both ADSC conditioned media and ADSC-IL10 conditioned media facilitated the migration of fibroblasts. The p-values for these effects were 0.0078 and 0.0314, respectively. Furthermore, the ADSC-IL10 conditioned media group exhibited a greater number of migrated cells than the ADSC conditioned media group; however, this difference was not statistically significant. (Refer to Fig. 6A)\u003c/p\u003e\n\u003cp\u003eFurthermore, HaCat cells were cultured in the presence of ADSC CM and DMEM medium supplemented with 2% serum, and the migration of HaCat cells was assessed. The findings indicated that the migration of HaCat cells cultured with ADSC CM was essentially complete by 12 hours, whereas the migration rate of those cultured in DMEM medium with 2% serum was notably slower, exhibiting a significant difference compared to the ADSC CM group. (Fig. 6B)\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe regeneration of diabetic ulcer wound tissue is inhibited in the stage of inflammation, and the continuous stage of inflammation leads to the abnormal production of inflammatory cytokines\u003csup\u003e[\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]\u003c/sup\u003e, and the long-term inflammatory response produces pathological inflammatory response, leading to the failure of endogenous repair response of skin tissue, and progresses to the late stage of wound healing. In this investigation, we observed the overexpression of IL-10 within adipose-derived stem cells (ADSCs), and for the first time, we harnessed the combined anti-inflammatory properties of both ADSCs and IL-10 to foster the healing of chronic wounds. Our findings revealed that the introduction of ADSC-IL10 cells onto the wounds of diabetic mice significantly expedited the healing process. The ADSC-IL10 group's wounds were observed to heal within 19 days, in contrast to the ADSC-PCDH group, which required 21 days, and the Control group, which took 25 days for complete wound closure.\u003c/p\u003e \u003cp\u003eThe equilibrium between various macrophage phenotypes is crucial for orchestrating the sequential phases of wound healing. M1 macrophages, known for secreting inflammatory cytokines, can impede the healing process. Conversely, M2 macrophages release anti-inflammatory agents that foster tissue repair. In the context of chronic ulcerative wounds, macrophages often shift from an M2 to an M1 phenotype. The pivotal challenge in treating chronic wounds lies in effectively converting M1 macrophages back into the M2 phenotype. Interleukin-10 (IL-10), produced by Th2 cells and certain regulatory T cells, has been demonstrated to suppress inflammatory responses and exhibits significant anti-inflammatory properties in chronic wounds, as evidenced by various studies. Moreover, IL-10 influences the synthesis and proliferation of the extracellular matrix (ECM), a process essential for healing. Nevertheless, the half-life of IL-10 in chronic wounds is relatively brief, presenting a challenge to prolong its therapeutic effects. Our research addressed this issue by overexpressing IL-10 in adipose-derived stem cells (ADSCs) and transplanting these cells into the wound site. This approach allowed for sustained IL-10 expression concurrent with ADSC proliferation, effectively overcoming the issue of IL-10's short half-life in wounds. We investigated the impact of ADSC-IL10 cells on wound inflammation in diabetic mice and observed an increase in M2 macrophages by the seventh day post-transplantation. Additionally, we noted a down-regulation of pro-inflammatory genes such as IL-1βand IL-6, and an up-regulation of the anti-inflammatory cytokine IL-10.\u003c/p\u003e \u003cp\u003eIn our research, alongside IL-10, which exerts a direct anti-inflammatory effect, ADSCs significantly contribute to the promotion of wound healing. Numerous studies have investigated the role of ADSCs in enhancing wound repair, primarily through their proliferation, differentiation, immune regulation, and paracrine functions. Our study revealed that the wound healing rate in diabetic mice treated with ADSC-PCDH was accelerated compared to the Control group (21 days versus 25 days). We observed that CD206 and IL-10 were highly expressed on the wound surface of mice receiving ADSC-PCDH transplants by day 7. Furthermore, the introduction of ADSC-PCDH into the wounds of diabetic mice also stimulated the gene expression of EGF, TGFβ-1, and VEGF within the wound area. Although both ADSC-IL10 and ADSCs can expedite the healing of chronic wounds in diabetic mice, our study identified certain distinctions between the two. Specifically, ADSC-IL10 facilitated wound healing more rapidly than ADSCs alone (19 days versus 21 days), which may be attributed to a greater number of M2-type macrophages, elevated expression of anti-inflammatory cytokines IL-4R and IL-10, and increased expression of EGF in the wound tissues of mice treated with ADSC-IL10 compared to those treated with ADSCs alone.\u003c/p\u003e \u003cp\u003eOur research revealed a significant upregulation of gene expressions for EGF, TGFβ-1, and VEGF growth factors in the wound surfaces of mice that had received ADSC-IL10 transplants. The rate of wound healing is contingent upon the development of blood vessels, as well as the migration and proliferation of keratinocytes and fibroblasts. A further reason diabetic wounds are challenging to heal is due to inadequate blood supply, which hampers the wounds from acquiring the necessary nutrients for healing[58]. The expression of growth factors, including EGF, TGFβ-1, and VEGF, can facilitate the repair process of the wound surface. Specifically, elevated VEGF expression can stimulate the creation of new blood vessels and enhance the blood supply at the wound site. Moreover, increased expressions of EGF and TGFβ-1 can encourage the migration and proliferation of epidermal cells and fibroblasts, thereby expediting wound healing and re-epithelialization.\u003c/p\u003e \u003cp\u003eOur research revealed that the overexpression of IL-10 in adipose-derived stem cells (ADSCs) did not impact their proliferation, migration, or differentiation. However, the transplantation of ADSCs engineered to express IL-10 (ADSC-IL10) into diabetic mouse wounds enhanced healing more effectively than the transplantation of unmodified ADSCs alone. The mechanism by which ADSC-IL10 accelerates wound healing appears to be associated with the combined suppression of the inflammatory response in diabetic ulcer wounds by both ADSCs and IL-10, the stimulation of vascular endothelial growth factor (VEGF) and other growth factors, and the facilitation of fibroblast migration. This discovery offers a novel approach for the treatment of diabetic ulcers in the future.\u003c/p\u003e "},{"header":"Conclusion","content":"\u003cp\u003eThe overexpression of IL-10 does not alter the biological characteristics of ADSCs. When transplanted into diabetic mice, ADSC-IL10 can accelerate wound healing more effectively than ADSCs alone. The mechanism through which ADSC-IL10 enhances wound healing may encompass several aspects: it stimulates the expression of M2-type macrophages, suppresses the secretion of pro-inflammatory factors such as IL-1\u0026beta;, IL-6, and MCP-1, and promotes the production of growth factors like EGF, TGF\u0026beta;-1, and VEGF. Additionally, it encourages the migration of skin fibroblasts and epidermal cells to the wound sites in diabetic mice.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp skip=\"true\"\u003eAll authors certify that they have no affiliations with or involvement in any organization or entity with any financial interest or non-financial interest in the subject matter or materials discussed in the manuscript.The authors declare that they have not use AI-generated work in this manuscript.\u003c/p\u003e\n\u003cp skip=\"true\"\u003e\u003cstrong\u003eEthics approval and consent to participate:\u003c/strong\u003e\u003c/p\u003e\n\u003col\u003e\n \u003cli\u003eTitle of the approved project:Overexpression of IL-10 in Adipose Mesenchymal Stem Cells Promotes Wound Healing in Diabetic Mice;\u003c/li\u003e\n \u003cli\u003eName of the institutional approval committee or unit:Tai\u0026apos;an Municipal Hospital;\u003c/li\u003e\n \u003cli\u003eApproval number:LW20170103;\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eDate of approval:2017/01/03\u003c/li\u003e\n\u003c/ol\u003e\n\u003cp skip=\"true\"\u003eThe patient(s) or their guardian(s)/legally authorized representative(s)/next of kin provided written informed consent for participation in the study and/or the use of samples.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors approved the final manuscript and the submission to this journal.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData sharing not applicable to this article as no datasets were generated or analyzed during the current study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003cstrong\u003e:\u003c/strong\u003e\u003c/p\u003e\n\u003cp skip=\"true\"\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by Tai\u0026rsquo;an Science and technology development innovation Project,(Grant No.2021NS392)\u003c/p\u003e\n\u003cp skip=\"true\"\u003e\u003cstrong\u003eAuthors\u0026apos; contributions\u003c/strong\u003e\u003cstrong\u003e:\u003c/strong\u003e\u003c/p\u003e\n\u003cp skip=\"true\"\u003eHuiZhao: Writing -review \u0026amp; editing, Writing -original draft, Visualization, Validatio, Supervision, Project administration, Methodology, Funding acquisition, Formal analysis, Data curation, Conceptualization. n.Feng Song: Writing-review \u0026amp; editing, Writing -original draft, Visualization, Validation.Xiao Shi: Writing-review \u0026amp; editing, Writing-original draft, Visualization, Validation.Shuai Shang: Writing-review \u0026amp; editing, Writing-original draft, Visualization, Validation.\u003c/p\u003e\n\u003cp skip=\"true\"\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003cstrong\u003e:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFirst of all, I would like to give my heartfelt thanks to all the people who have ever helped me in this paper.Secondly, I would like to thank Peking Union Medical College for its financial support。\u003c/p\u003e\n\u003cp\u003eFinally, I am really grateful to all those who devote much time to reading this thesis and give me much advice, Which will benefit me in my later study.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eBalooch Hasankhani M, Mirzaei H, Karamoozian A. Global trend analysis of diabetes mellitus incidence, mortality, and mortality-to-incidence ratio from 1990 to 2019. Sci Rep. 2023;13:21908. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41598-023-49249-0\u003c/span\u003e\u003cspan address=\"10.1038/s41598-023-49249-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcDermott KM, Fang M, Boulton AJM, et al. Etiology, epidemiology, and disparities in the burden of diabetic foot ulcers, diabetes care. Diabetes Care. 2023;46(1):209\u0026ndash;21.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang JJ, Ni P, Song Y, Gao MJ, Guo XY, Zhao BQ. Effective protective mechanisms of HO-1 in diabetic complications: a narrative review. Cell Death Discov. 2024;10(1):433. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41420-024-02205-x\u003c/span\u003e\u003cspan address=\"10.1038/s41420-024-02205-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 39389941; PMCID: PMC11466965.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKarakousis ND, Pyrgioti EE, Georgakopoulos PN, Apergi K, Popovic DS, Papanas N. Zinc levels and diabetic foot ulcers: a mini review. Int J Low Extrem Wounds. 2023. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1177/15347346231214209\u003c/span\u003e\u003cspan address=\"10.1177/15347346231214209\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTaghizadeh A, et al. Mussel-inspired biomaterials: from chemistry to clinic. Bioeng Translational Med. 2022;7(3). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/btm2.10385\u003c/span\u003e\u003cspan address=\"10.1002/btm2.10385\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSabine A, Eming, Peter J, Murray EJ. Pearce,Metabolic orchestration of the wound healing response,Cell Metabolism,33, Issue 9,2021,Pages 1726\u0026ndash;1743,ISSN 1550\u0026ndash;4131,\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cmet.2021.07.017\u003c/span\u003e\u003cspan address=\"10.1016/j.cmet.2021.07.017\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOuyang W, O'Garra A. IL-10 Family Cytokines IL-10 and IL-22: from Basic Science to Clinical Translation. Immunity. 2019;50(4):871\u0026ndash;891. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.immuni.2019.03.020\u003c/span\u003e\u003cspan address=\"10.1016/j.immuni.2019.03.020\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 30995504.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRodr\u0026iacute;guez SP, Herrera AL. J.E. Parra,Gene expression of pro-inflammatory (IL-8, IL-18, TNF-α, and IFN-γ) and anti-inflammatory (IL-10) cytokines in the duodenum of broiler chickens exposed to lipopolysaccharides from Escherichia coli and Bacillus subtilis,Vet. Volume 16. World; 2023. p. 564.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLu J, Liu J, Li L, Lan Y, Liang Y. Cytokines in type 1 diabetes: mechanisms of action and immunotherapeutic targets. Clin Transl Immunol. 2020;9(3):e1122. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/cti2.1122\u003c/span\u003e\u003cspan address=\"10.1002/cti2.1122\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 32185024; PMCID: PMC7074462.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSyed Khaja AS, Binsaleh NK, Beg MMA, Ashfaq F, Khan MI, Almutairi MG, Qanash H, Saleem M, Ginawi IAM. Clinical importance of cytokine (IL-6, IL-8, and IL-10) and vitamin D levels among patients with Type-1 diabetes. Sci Rep. 2024;14(1):24225. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41598-024-73737-6\u003c/span\u003e\u003cspan address=\"10.1038/s41598-024-73737-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 39414864; PMCID: PMC11484771.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCarlini V, Noonan DM, Abdalalem E, Goletti D, Sansone C, Calabrone L, Albini A. The multifaceted nature of IL-10: regulation, role in immunological homeostasis and its relevance to cancer, COVID-19 and post-COVID conditions. Front Immunol. 2023;14:1161067. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fimmu.2023.1161067\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2023.1161067\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 37359549; PMCID: PMC10287165.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYork AG, Skadow MH, Oh J, et al. IL-10 constrains sphingolipid metabolism to limit inflammation. Nature. 2024;627:628\u0026ndash;35.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhamaru S, Mukherjee T, Tung KS, Kumar PS, Bandyopadhyay S, Mahish C, Chattopadhyay S, Chattopadhyay S. Chikungunya virus infection inhibits B16 melanoma-induced immunosuppression of T cells and macrophages mediated by interleukin 10. Microb Pathog. 2024;197:107022. doi: 10.1016/j.micpath.2024.107022. Epub ahead of print. PMID: 39419458.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKwaśniak K, Czarnik-Kwaśniak J, Maziarz A, Aebisher D, Zielińska K, Karczmarek-Borowska B, Tabarkiewicz J. Scientific reports concerning the impact of interleukin 4, interleukin 10 and transforming growth factor β on cancer cells. Cent Eur J Immunol. 2019;44(2):190\u0026ndash;200. Epub 2019 Jul 30. PMID: 31530989; PMCID: PMC6745546.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRadomir L, Kramer MP, Perpinial M, et al. The survival and function of IL-10-producing regulatory B cells are negatively controlled by SLAMF5. Nat Commun. 2021;12:1893.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu H, Lin L, Zhang Z, et al. Targeting NF-κB pathway for the therapy of diseases: mechanism and clinical study. Sig Transduct Target Ther. 2020;5:209.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu X, li J, Fu M, et al. The JAK/STAT signaling pathway: from bench to clinic. Sig Transduct Target Ther. 2021;6:402.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGlaviano A, Foo ASC, Lam HY, Yap KCH, Jacot W, Jones RH, Eng H, Nair MG, Makvandi P, Geoerger B, Kulke MH, Baird RD, Prabhu JS, Carbone D, Pecoraro C, Teh DBL, Sethi G, Cavalieri V, Lin KH, Javidi-Sharifi NR, Toska E, Davids MS, Brown JR, Diana P, Stebbing J, Fruman DA, Kumar AP. PI3K/AKT/mTOR signaling transduction pathway and targeted therapies in cancer. Mol Cancer. 2023;22(1):138. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12943-023-01827-6\u003c/span\u003e\u003cspan address=\"10.1186/s12943-023-01827-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 37596643; PMCID: PMC10436543.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCarlini V, Noonan DM, Abdalalem E, Goletti D, Sansone C, Calabrone L, Albini A. The multifaceted nature of IL-10: regulation, role in immunological homeostasis and its relevance to cancer, COVID-19 and post-COVID conditions. Front Immunol. 2023;14:1161067. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fimmu.2023.1161067\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2023.1161067\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 37359549; PMCID: PMC10287165.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWalker D, Short M, Rae T, Lu B, Padon TJ, Prajapati F, Faruk OO, Olutoye L, Yu P, Bollyky SG, Keswani. Swathi Balaji,Endogenous Interleukin-10 Contributes to Wound Healing and Regulates Tissue Repair,Journal of Surgical Research,285,2023,Pages 26\u0026ndash;34,ISSN 0022-4804.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVoza FA, Huerta CT, Le N, Shao H, Ribieras A, Ortiz Y, Atkinson C, Machuca T, Liu ZJ, Velazquez OC. Fibroblasts in Diabetic Foot Ulcers. Int J Mol Sci. 2024;25(4):2172. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms25042172\u003c/span\u003e\u003cspan address=\"10.3390/ijms25042172\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 38396848; PMCID: PMC10889208.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRaghuram AC, Yu RP, Lo AY, Sung CJ, Bircan M, Thompson HJ, Wong AK. Role of stem cell therapies in treating chronic wounds: A systematic review. World J Stem Cells. 2020;12(7):659\u0026ndash;75. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.4252/wjsc.v12.i7.659\u003c/span\u003e\u003cspan address=\"10.4252/wjsc.v12.i7.659\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 32843920; PMCID: PMC7415243.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSharma P, Kumar A, Dey AD. Cellular Therapeutics for Chronic Wound Healing: Future for Regenerative Medicine. Curr Drug Targets. 2022;23(16):1489\u0026ndash;1504. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.2174/138945012309220623144620\u003c/span\u003e\u003cspan address=\"10.2174/138945012309220623144620\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 35748548.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFarabi B, Roster K, Hirani R, Tepper K, Atak MF, Safai B. The Efficacy of Stem Cells in Wound Healing: A Systematic Review. Int J Mol Sci. 2024;25(5):3006. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms25053006\u003c/span\u003e\u003cspan address=\"10.3390/ijms25053006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 38474251; PMCID: PMC10931571.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNourian Dehkordi A, Mirahmadi Babaheydari F, Chehelgerdi M, et al. Skin tissue engineering: wound healing based on stem-cell-based therapeutic strategies. Stem Cell Res Ther. 2019;10:111.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAyavoo T, Murugesan K, Gnanasekaran A. Roles and mechanisms of stem cell in wound healing. Stem Cell Investig. 2021;8:4. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.21037/sci-2020-027\u003c/span\u003e\u003cspan address=\"10.21037/sci-2020-027\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 33829056; PMCID: PMC8022285.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhamaru S, Mukherjee T, Tung KS, Kumar PS, Bandyopadhyay S, Mahish C, Chattopadhyay S, Chattopadhyay S. Chikungunya virus infection inhibits B16 melanoma-induced immunosuppression of T cells and macrophages mediated by interleukin 10. Microb Pathog. 2024;197:107022. doi: 10.1016/j.micpath.2024.107022. Epub ahead of print. PMID: 39419458.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou J, Shi Y. Mesenchymal stem/stromal cells (MSCs): origin, immune regulation, and clinical applications. Cell Mol Immunol. 2023;20:555\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang P, Dong J, Fan X, et al. Characterization of mesenchymal stem cells in human fetal bone marrow by single-cell transcriptomic and functional analysis. Sig Transduct Target Ther. 2023;8:126.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRobey PG, Kuznetsov SA, Bianco P, Riminucci M. Bone Marrow Stromal Cell Assays: In Vitro and In Vivo. Methods Mol Biol. 2021;2230:379\u0026ndash;396. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/978-1-0716-1028-2_23\u003c/span\u003e\u003cspan address=\"10.1007/978-1-0716-1028-2_23\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 33197027.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQin Y, Ge G, Yang P, Wang L, Qiao Y, Pan G, Yang H, Bai J, Cui W, Geng D. An Update on Adipose-Derived Stem Cells for Regenerative Medicine: Where Challenge Meets Opportunity. Adv Sci (Weinh). 2023;10(20):e2207334. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/advs.202207334\u003c/span\u003e\u003cspan address=\"10.1002/advs.202207334\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2023 May 10. PMID: 37162248; PMCID: PMC10369252.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLuck J, Weil BD, Lowdell M, Mosahebi A. Adipose-Derived Stem Cells for Regenerative Wound Healing Applications: Understanding the Clinical and Regulatory Environment. Aesthet Surg J. 2020;40(7):784\u0026ndash;799. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/asj/sjz214\u003c/span\u003e\u003cspan address=\"10.1093/asj/sjz214\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 31406975.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBhat S, Viswanathan P, Chandanala S, et al. Expansion and characterization of bone marrow derived human mesenchymal stromal cells in serum-free conditions. Sci Rep. 2021;11:3403.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu C, Wang Z, Liu Y, Wei B, Liu X, Duan K, Zhou P, Xie Z, Wu M, Guan J. Extracellular vesicles derived from bone marrow mesenchymal stem cells loaded on magnetic nanoparticles delay the progression of diabetic osteoporosis via delivery of miR-150-5p. Cell Biol Toxicol. 2023;39(4):1257\u0026ndash;74. Epub 2022 Sep 16. PMID: 36112264; PMCID: PMC10425527.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu D, Kang L, Tian J, Wu Y, Liu J, Li Z, Wu X, Huang Y, Gao B, Wang H, Wu Z, Qiu G. Exosomes Derived from Bone Mesenchymal Stem Cells with the Stimulation of Fe3O4 Nanoparticles and Static Magnetic Field Enhance Wound Healing Through Upregulated miR-21-5p. Int J Nanomed. 2020;15:7979\u0026ndash;93. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.2147/IJN.S275650\u003c/span\u003e\u003cspan address=\"10.2147/IJN.S275650\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 33116513; PMCID: PMC7585514.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang D, Guo Y, Heng BC, et al. Cell membrane vesicles derived from hBMSCs and hUVECs enhance bone regeneration. Bone Res. 2024;12:23.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAdolfsson E, Helenius G, Friberg \u0026Ouml;, Samano N, Fr\u0026oslash;bert O, Johansson K. Bone marrow- and adipose tissue-derived mesenchymal stem cells from donors with coronary artery disease; growth, yield, gene expression and the effect of oxygen concentration. Scand J Clin Lab Investig. 2020;80(4):318\u0026ndash;26.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun Y, Yuan Y, Wu W, et al. The effects of locomotion on bone marrow mesenchymal stem cell fate: insight into mechanical regulation and bone formation. Cell Biosci. 2021;11:88.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZakrzewski W, Dobrzyński M, Szymonowicz M, Rybak Z. Stem cells: past, present, and future. Stem Cell Res Ther. 2019;10(1):68. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s13287-019-1165-5\u003c/span\u003e\u003cspan address=\"10.1186/s13287-019-1165-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 30808416; PMCID: PMC6390367.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrianna, Ling APK, Wong YP. Applying stem cell therapy in intractable diseases: a narrative review of decades of progress and challenges. Stem Cell Investig. 2022;9:4. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.21037/sci-2022-021\u003c/span\u003e\u003cspan address=\"10.21037/sci-2022-021\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 36238449; PMCID: PMC9552054.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang G, Fan X, Liu Y, et al. Immunomodulatory Mechanisms and Therapeutic Potential of Mesenchymal Stem Cells. Stem Cell Rev Rep. 2023;19:1214\u0026ndash;31.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu X, Jiang J, Gu Z, et al. Mesenchymal stromal cell therapies: immunomodulatory properties and clinical progress. Stem Cell Res Ther. 2020;11:345.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNaji A, Eitoku M, Favier B, Deschaseaux F, Rouas-Freiss N, Suganuma N. Biological functions of mesenchymal stem cells and clinical implications. Cell Mol Life Sci. 2019;76(17):3323\u0026ndash;48. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00018-019-03125-1\u003c/span\u003e\u003cspan address=\"10.1007/s00018-019-03125-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2019 May 4. PMID: 31055643; PMCID: PMC11105258.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuillamat-Prats R. The Role of MSC in Wound Healing, Scarring and Regeneration. Cells. 2021;10(7):1729. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/cells10071729\u003c/span\u003e\u003cspan address=\"10.3390/cells10071729\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 34359898; PMCID: PMC8305394.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi S, Li Y, Zhu K, He W, Guo X, Wang T, Gong S, Zhu Z. Exosomes from mesenchymal stem cells: Potential applications in wound healing. Life Sci. 2024;357:123066. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.lfs.2024.123066\u003c/span\u003e\u003cspan address=\"10.1016/j.lfs.2024.123066\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2024 Sep 19. PMID: 39306326.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eArabpour M, Saghazadeh A, Rezaei N, Anti-inflammatory. and M2 macrophage polarization-promoting effect of mesenchymal stem cell-derived exosomes. Int Immunopharmacol. 2021;97:107823. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.intimp.2021.107823\u003c/span\u003e\u003cspan address=\"10.1016/j.intimp.2021.107823\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2021 Jun 5. PMID: 34102486.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang X, Wong K, Ouyang W, Rutz S, Targeting. Cold Spring Harb Perspect Biol. 2019;11(2):a028548. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1101/cshperspect.a028548\u003c/span\u003e\u003cspan address=\"10.1101/cshperspect.a028548\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 29038121; PMCID: PMC6360861. IL-10 Family Cytokines for the Treatment of Human Diseases.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTabares-Guevara JH, Jaramillo JC, Ospina-Quintero L, Piedrah\u0026iacute;ta-Ochoa CA, Garc\u0026iacute;a-Valencia N, Bautista-Erazo DE, Caro-G\u0026oacute;mez E, Covi\u0026aacute;n C, Retamal-D\u0026iacute;az A, Duarte LF, Gonz\u0026aacute;lez PA, Bueno SM, Riedel CA, Kalergis AM, Ram\u0026iacute;rez-Pineda JR. IL-10-Dependent Amelioration of Chronic Inflammatory Disease by Microdose Subcutaneous Delivery of a Prototypic Immunoregulatory Small Molecule. Front Immunol. 2021;12:708955. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fimmu.2021.708955\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2021.708955\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 34305950; PMCID: PMC8297659.66.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSteen EH, Wang X, Balaji S, Butte MJ, Bollyky PL, Keswani SG. The Role of the Anti-Inflammatory Cytokine Interleukin-10 in Tissue Fibrosis. Adv Wound Care (New Rochelle). 2020;9(4):184\u0026ndash;98. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1089/wound.2019.1032\u003c/span\u003e\u003cspan address=\"10.1089/wound.2019.1032\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2020 Feb 7. PMID: 32117582; PMCID: PMC7047112.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYork AG, Skadow MH, Oh J, Qu R, Zhou QD, Hsieh WY, Mowel WK, Brewer JR, Kaffe E, Williams KJ, Kluger Y, Smale ST, Crawford JM, Bensinger SJ, Flavell RA. IL-10 constrains sphingolipid metabolism to limit inflammation. Nature. 2024;627(8004):628\u0026ndash;35. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41586-024-07098-5\u003c/span\u003e\u003cspan address=\"10.1038/s41586-024-07098-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2024 Feb 21. PMID: 38383790; PMCID: PMC10954550.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu C, Wang X, Cao X. IL-10: A Key Regulator and potential therapeutic target in uveitis. Cell Immunol. 2024;405\u0026ndash;406:104885. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cellimm.2024.104885\u003c/span\u003e\u003cspan address=\"10.1016/j.cellimm.2024.104885\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub ahead of print. PMID: 39447525.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaraiva M, Vieira P, O'Garra A. Biology and therapeutic potential of interleukin-10. J Exp Med. 2020;217(1):e20190418. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1084/jem.20190418\u003c/span\u003e\u003cspan address=\"10.1084/jem.20190418\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 31611251; PMCID: PMC7037253.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMinshawi F, Lanvermann S, McKenzie E, Jeffery R, Couper K, Papoutsopoulou S, Roers A, Muller W. The Generation of an Engineered Interleukin-10 Protein With Improved Stability and Biological Function. Front Immunol. 2020;11:1794. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fimmu.2020.01794\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2020.01794\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 32849644; PMCID: PMC7431522.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQiao J, Liu Z, Dong C, Luan Y, Zhang A, Moore C, Fu K, Peng J, Wang Y, Ren Z, Han C, Xu T, Fu YX. Targeting Tumors with IL-10 Prevents Dendritic Cell-Mediated CD8\u0026thinsp;+\u0026thinsp;T Cell Apoptosis. Cancer Cell. 2019;35(6):901\u0026ndash;915.e4. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ccell.2019.05.005\u003c/span\u003e\u003cspan address=\"10.1016/j.ccell.2019.05.005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 31185213.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePastar I, Balukoff NC, Sawaya AP, Vecin NM, Tomic-Canic M. Physiology and Pathophysiology of Wound Healing in Diabetes. In: Veves A, Giurini JM, Schermerhorn ML, editors. The Diabetic Foot. Cham: Contemporary Diabetes. Humana; 2024.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSteen EH, Wang X, Balaji S, Butte MJ, Bollyky PL, Keswani SG. The Role of the Anti-Inflammatory Cytokine Interleukin-10 in Tissue Fibrosis. Adv Wound Care (New Rochelle). 2020;9(4):184\u0026ndash;98. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1089/wound.2019.1032\u003c/span\u003e\u003cspan address=\"10.1089/wound.2019.1032\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2020 Feb 7. PMID: 32117582; PMCID: PMC7047112.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQiao J, Liu Z, Dong C, Luan Y, Zhang A, Moore C, Fu K, Peng J, Wang Y, Ren Z, Han C, Xu T, Fu YX. Targeting Tumors with IL-10 Prevents Dendritic Cell-Mediated CD8\u0026thinsp;+\u0026thinsp;T Cell Apoptosis. Cancer Cell. 2019;35(6):901\u0026ndash;915.e4. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ccell.2019.05.005\u003c/span\u003e\u003cspan address=\"10.1016/j.ccell.2019.05.005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 31185213.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eClyne AM. Endothelial response to glucose: dysfunction, metabolism, and transport. Biochem Soc Trans. 2021;49(1):313\u0026ndash;25. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1042/BST20200611\u003c/span\u003e\u003cspan address=\"10.1042/BST20200611\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 33522573; PMCID: PMC7920920.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Adipose-derived mesenchymal stem cells, interleukin-10, overexpression, diabetic ulcer, wound healing","lastPublishedDoi":"10.21203/rs.3.rs-5567768/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5567768/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground: \u003c/strong\u003eDiabetic ulcer is a serious chronic non-healing wound, which often leads to amputation or even death, causing great damage to the patients and their families. In recent years, stem cells are increasingly studied for tissue repair. Adipose tissue-derived mesenchymal stem cells (Adipose-derived mesenchymal stem cells, ADSCs) have the advantages of wide source and easy access. ADSCs can accelerate wound healing and reduce scar hyperplasia, especially for chronic wounds, patients cannot heal with traditional treatments, and ADSCs bring hope to these patients. Our study intends to overexpress IL-L 10 in ADSCs by genetic engineering technology, transplant ADSC-IL 10 to diabetic mouse wounds, and use the role of IL-10 in promoting M2 macrophages transformation, combined with ADSCs to achieve rapid healing of diabetic ulcer wounds.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods\u003c/strong\u003e: The expression of IL-10 protein in the supernatant of ADSC-IL10 was assessed using an ELISA kit. Flow cytometry was employed to analyze the surface stem cell markers (CD44, CD73, CD90, CD105) of ADSC-IL10. Additionally, the migration and proliferation of ADSC-IL10 were evaluated through cell scratch assays and MTT assays.\u003c/p\u003e\n\u003cp\u003eThe lipogenic marker PPARγ and the osteogenic marker RUNX2 were detected using fluorescent real-time quantitative PCR. Conditioned media from ADSC-IL10 (ADSC-IL10-CM) and ADSC-PCDH (ADSC-CM) were employed to culture mouse peritoneal macrophages (Raw 264.7). Following a 12-hour incubation period, the Raw 264.7 cells were harvested for mRNA extraction. The cell types of Raw cells were identified through qPCR, with the M1 phenotype determined by CD86 expression and the M2 phenotype by Arg-1 and CD206. The expression levels of inflammatory factors, including IL-1β, IL-6, IL-10, MCP-1, and growth factors such as EGF, VEGF, and TGFβ-1, were quantified using qPCR. The transwell method was utilized to assess the impact of ADSC-IL10-CM and ADSC-CM on the migration of normal skin fibroblasts. The scribing method was applied to examine the effect of ADSC-CM on the migration of human immortalized epidermal cells. A diabetic mouse model was induced by a high-fat, high-sugar diet combined with streptozocin. In the ADSC-IL10 group, 1×10^6 ADSC-IL10 cells were transplanted onto a 1.5cm×1.5cm wound surface, and similarly, 1×10^6 ADSC-PCDH cells were transplanted in the ADSC-PCDH group. The control group received an equal volume of 0.9% normal saline. The wound healing process in mice was observed and documented at various time points. Tissue samples from the wounds on days 3 and 7 were subjected to histological staining and qPCR analysis. HE staining was used to monitor wound healing progress, while immunofluorescence (CD206, Arg-1) was utilized to quantify the presence of M2-type macrophages in mouse skin. The expression levels of CD206 and Arg-1 genes were measured by qPCR to ascertain the macrophage phenotypes within the wound tissues. Levels of inflammatory factors such as IL-1β, IL-6, IL-10, MCP-1 were determined to evaluate the inflammatory status of the wound tissues. Additionally, the expression of EGF, VEGF, and TGFβ-1 growth factors within the wound tissues was assessed.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion\u003c/strong\u003e: The overexpression of IL-10 does not alter the biological characteristics of ADSCs. When transplanted into diabetic mice, ADSC-IL10 can accelerate wound healing more effectively than ADSCs alone. The mechanism through which ADSC-IL10 enhances wound healing may encompass several aspects: it stimulates the expression of M2-type macrophages, suppresses the secretion of pro-inflammatory factors such as IL-1β, IL-6, and MCP-1, and promotes the production of growth factors like EGF, TGFβ-1, and VEGF. Additionally, it encourages the migration of skin fibroblasts and epidermal cells to the wound sites in diabetic mice.\u003c/p\u003e","manuscriptTitle":"Overexpression of IL-10 in Adipose Mesenchymal Stem Cells Promotes Wound Healing in Diabetic Mice","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-01-13 17:33:23","doi":"10.21203/rs.3.rs-5567768/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"a447f8b6-7c87-448c-bdbe-7cf534e9a3de","owner":[],"postedDate":"January 13th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-03-12T08:53:28+00:00","versionOfRecord":[],"versionCreatedAt":"2025-01-13 17:33:23","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5567768","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5567768","identity":"rs-5567768","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-22T02:00:06.705733+00:00
License: CC-BY-4.0