Probiotic potentials of lactic acid bacteria isolated from fermented sorghum supernatant (omidun) under different fermentation periods | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Probiotic potentials of lactic acid bacteria isolated from fermented sorghum supernatant ( omidun ) under different fermentation periods Njoku, Eberechukwu, Oluwasola Abayomi Adelusi, Adewale Olusegun Obadina This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6104576/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Probiotic bacteria, primarily lactic acid bacteria (LAB), are known to improve gut health, enhance immune responses, and inhibit the growth of pathogenic microorganisms, making them valuable for functional foods. Naturally fermented sorghum is a rich source of these beneficial bacteria. Therefore, this study investigated the probiotic potentials of LAB isolated from the supernatant of fermenting sorghum ( omidun ). Five omidun samples were fermented for 12, 24, 48, 72, and 96 hours to recover LAB strains. The recovered LAB isolates were identified and characterized using morphological and molecular methods, while their antibiotic resistance profiles were also assessed. Furthermore, we examined the effects of different fermentation periods (12, 24, 48, 72, and 96 hours) on the probiotic potential of the isolated LAB, including temperature tolerance, acid resistance (pH), and bile salt tolerance. Our results showed that bacterial counts in omidun ranged from 2.78 × 10⁻³ − 4.1 × 10⁻³ CFU/ml, while coliform counts varied from 0.00–1 × 10⁻⁴ CFU/ml. The dominant LAB strains recovered from the omidun include Lactobacillus plantarum , Lactobacillus sp ., Limosilactobacillus fermentum , and Lactobacillus brevis . Interestingly, biochemical tests confirmed all isolates were oxidase- and catalase-negative, with cocci and bacillary morphologies. Antibiotic resistance tests revealed that LAB fermented for 72 and 96 hours were resistant to gentamicin, ceftazidime, cloxacillin, erythromycin, cefuroxime, ofloxacin, augmentin, and ceftriaxone. Notably, the LAB isolates exhibited different growth patterns at 25, 37, and 40°C over 1- and 3-hour intervals, with all isolates successfully growing at 40°C. All isolates maintained high viability after 3 hours at both pH 2.5 and 4.0, while those fermented for 12–48 hours showed no growth in both bile levels. The findings from this study suggest that omidun is a rich source of LABs, with fermentation duration, especially 72 hours, playing a crucial role in shaping their probiotic potential. Food Science & Technology omidun sorghum fermentation LAB probiotic potential antibiotic resistance intestinal capacity Figures Figure 1 Figure 2 1.0 Introduction Lactic acid bacteria (LAB) are a diverse group of Gram-positive, non-spore-forming, facultative anaerobic microorganisms that play a central role in the fermentation of various foods and beverages. Known for their ability to convert sugars into lactic acid, LAB are commonly found in the gastrointestinal tract (Endo et al., 2019 ), fermented dairy products (René, 2017), pickled vegetables (Pachla et al., 2018 ), and other fermented foods (Granato and Adriano, 2019). These bacteria are crucial in food preservation, as the lactic acid they produce lowers the pH, creating an environment that inhibits the growth of harmful pathogens (Anumudu et al., 2024 ). In addition to their preservation capabilities, LAB have gained significant attention due to their potential health benefits, classifying them as probiotics. Probiotics are live microorganisms that, when administered in adequate amounts, confer health benefits to the host, particularly in the gut. LAB, such as Lactobacillus , Bifidobacterium , Lactobacillus brevis , and Lactobacillus plantarum , are among the most widely studied and utilized probiotics (Skowron et al., 2022 ). Their health-promoting properties include improving gut health, enhancing immune function, alleviating symptoms of irritable bowel syndrome (IBS), preventing diarrhea (Castellone et al., 2021 ). It has also been documented that LAB can assist in the treatment and prevention of acute respiratory infections (Park et al., 2013 ; Waki et al., 2014 ; Yeo et al., 2014 ; Shibata et al., 2016 ). Furthermore, LAB possess antimicrobial properties, producing bacteriocins and other bioactive compounds that can inhibit the growth of harmful pathogens, making them valuable in controlling foodborne illnesses (Flores and Toldra, 2021). As interest in functional foods and natural health solutions grows, LAB continue to be explored for their diverse applications, including the development of functional foods (Lee et al., 2024 ), dietary supplements (Imade et al., 2021 ), and therapies for various health conditions (Das et al., 2021 ). Sorghum ( Sorghum bicolor L), a staple cereal grain widely cultivated in many regions of the world, plays a significant role in traditional diets and food systems. Its adaptability to diverse climatic conditions, particularly in arid and semi-arid areas, makes it a vital crop for ensuring food security (Jenfa et al., 2024a ). Sorghum is a nutrient-dense cereal grain rich in amino acids, carbohydrates, proteins, vitamins, and minerals (Pontieri et al., 2022 ; Rather, 2023 ; Jenfa et al., 2024b ). Its high protein content makes it valuable in addressing Protein Energy Malnutrition, particularly among children in developing nations like Nigeria (Viphonephom et al., 2024 ). Furthermore, sorghum is very rich in B-complex vitamins such as pyridoxine, riboflavin, and thiamine (Jenfa et al., 2024b ), as well as essential minerals like iron, magnesium, potassium, zinc, phosphorus, and copper (Jenfa et al., 2024a ; Jenfa et al., 2024b ). Additionally, its antioxidant properties contribute to reducing inflammation (Awika, 2017 ; Vanamala et al., 2018 ). However, sorghum is not only a source of essential nutrients but also serves as a substrate for fermentation in traditional food preparations (Şanlier et al., 2017 ). During food fermentation, the microbial activity transforms the grain into a nutrient-rich product while enhancing its digestibility and sensory attributes. Among the predominant microorganisms involved in this process are LAB, which have garnered significant attention for their potential probiotic properties (Sørensen et al., 2022 ). The fermentation of sorghum supernatant, often practiced in various cultures, provides a promising avenue for isolating LAB strains with probiotic potential (Rapoo et al., 2023 ). This process not only adds value to sorghum-based products but also offers a natural and affordable approach to improving health and nutrition, particularly in regions with limited access to commercial probiotics. One of the supernatants produced during the traditional fermentation of cereals is omidun (a Yoruba term commonly used in Nigeria to refer to the supernatant of fermenting cereal grains). The most frequently used cereals for producing omidun are maize, sorghum, and millet (Fafure et al., 2021; Yeo et al., 2014 ). Remarkably, the fermentation process of cereals to produce omidun fosters the proliferation of beneficial microorganisms like LAB known for their probiotic properties (Abdulssalam, 2024). These LAB strains enhance the nutritional profile of omidun and offer potential health benefits, making it a valuable functional food component (Shibata et al., 2016 ). This nutrient-rich liquid consumed in Nigeria and other parts of West Africa is valued for its culinary versatility and potential health benefits. For instance, in northern Nigeria, tamarind is commonly added to the residue of fermented cereals, locally known as pap or akamu, to enhance its tangy flavour. As an alternative, omidun is occasionally used to reconstitute the pap before it is prepared (Omeiza et al., 2020 ). Additionally, omidun functions as a natural coagulant in the production of tofu, a soybean-based meat substitute referred to as Awara in Hausa (Afolayan et al., 2017 ). Beyond Nigeria, similar uses of fermented sorghum supernatant are observed in other countries; for example, in Togo, omidun is infused with fruits and herbs to create a medicinal beverage known as Adoyo (Audu et al., 2019 ). LAB strains present a viable alternative to traditional probiotics, particularly in regions where sorghum is a dietary staple (Liu et al., 2018 ). Nevertheless, the probiotic efficacy of LAB is greatly influenced by key factors such as survival in the gastrointestinal tract (Ostergaard et al. , 2014), acid and bile tolerance (Atta et al., 2020 ), temperature tolerance (Ren et al., 2017 ), antimicrobial activity (Belhadj et al. , 2010), metabolic activity (Mamta et al., 2017 ), genetic stability (Wang et al., 2021 ), their capacity to adhere to intestinal epithelial cells (Atta et al., 2020 ), as well as growth conditions such as the presence of nutrients, oxygen levels (anaerobic or microaerophilic), and optimal pH (Ghodbane et al., 2014 ).The supernatant of fermented grain slurry (commonly known as ogi) has been widely studied and is known for its numerous health benefits, including its traditional use as a solvent in preparing herbal remedies for malaria (Falana et al., 2016 ; Audu et al., 2019 ). Afolayan and Ayeni (2017) conducted an in-depth study on maize-derived omidun , highlighting its high content of LAB, which have proven effectiveness in treating diarrhea. However, studies focusing on the isolation and characterization of LAB from sorghum-fermented supernatant ( omidun ) are scarce, let alone the probiotic potential of these LAB strains. Therefore, this study aims to: 1) isolate, identify, and characterize LAB recovered from the supernatant of fermenting sorghum, 2) examine the antimicrobial susceptibility profiles of the isolated LAB, and 3) investigate the impact of varying fermentation periods (12, 24, 48, 72 and 96h) on the probiotic potential of the isolated LABs. 2.0 Materials and method 2.1 Materials The sorghum used in this study was purchased from the Tungah market in Minna, Niger state. The thermos and muslin cloth were purchased at Mushin Market in Lagos state. Antibiotics- Gentamicin (10 µg), ceftazidime (30 µg), cloxacillin (5 µg), erythromycin (5 µg), cefuroxime (30 µg), ofloxacin (5 µg), augmentin (30 µg), and ceftriaxone (30 µg), Mueller-Hinton agar (MHA), MacConkey agar (MCA), and de Man Rogosa and Sharpe (MRS) agar, colony counter (Gallenkamp, UK), Jena Bioscience Bacteria DNA Preparation Kit (Jena Bioscience GmbH, Germany), Jena Bioscience PCR Preparation Kit (Jena Bioscience GmbH, Germany), Microscope (JEM Jeol 1010, Ltd., Tokyo, Japan), Gram’s iodine solution, hydrogen peroxide, anaerobic vessel (BBL GasPak Anaerobic Systems), MRS broth (Oxoid CM0359), oxgall bile (sigma-Aldrich, steinheim,Germany), diluent (oxoid CM0733, pH 7), MRS Agar (oxoid CM0361). 2.2 Methods 2.2.1 Preparation of Omidun Omidun was prepared following the standard protocol outlined by Falana et al. ( 2016 ). In summary, sorghum grains were first screened to remove debris, including stones, pebbles, and foreign seeds, and then thoroughly washed under running tap water. The cleaned grains were soaked in potable water at a 1:3 weight-to-volume ratio, covered, and left to ferment naturally at room temperature for 12, 24, 48, 72, and 96 hours, respectively. After fermentation, the water was decanted, transferred to a sterile mixing vessel, wet-milled, and strained using a clean muslin cloth. The filtrate was collected in a sterile container, while the residue was discarded. The filtrate was then allowed to undergo additional fermentation and settling. The resulting supernatants were carefully collected into sterile vacuum flasks, labelled and transported in iceboxes to the Department of Molecular Biology and Biotechnology at the Nigerian Institute of Medical Research, Yaba, Lagos, for analysis. A flowchart illustrating the process of producing the sorghum fermentation supernatant is presented in Fig. 1 . 2.2.2 Isolation and enumeration of LAB from Omidun This study adopted the bacterial isolation and enumeration method outlined by Ajala et al. ( 2024 ), with several modifications. In brief, one milliliter (1 mL) of each omidun sample was subjected to ten-fold serial dilution in 9 mL of peptone water under sterile conditions. Aliquots of 0.1 mL from dilutions ranging from 10⁻³ to 10⁻⁵ were inoculated onto three pre-prepared selective media: Mueller-Hinton agar (MHA), MacConkey agar (MCA), and de ManRogosa and Sharpe (MRS) agar, using the pour plate method. The inoculated plates were incubated anaerobically at 37°C for 48 hours using an anaerobic vessel (BBL GasPak Anaerobic Systems). Afterwards, the bacterial colonies were examined and counted using a colony counter (Gallenkamp, UK). The total and mean bacterial loads were calculated and expressed in colony-forming units per gram of sample (CFU/ml) using Eq. 1 . $$\:CFU/ml=\frac{Number\:of\:colonies\:\times\:reciprocal\:of\:the\:dilution\:factor}{Plating\:volume\:\left(0.1\:mL\right)}$$ 1 2.2.3 Morphological and biochemical characterization of bacterial isolates Following incubation, individual colonies were streaked repeatedly on MRS agar and incubated at 37°C for 24 hours to obtain pure isolates. The obtained pure isolates were sub-cultured on MRS agar, where they were identified based on their morphological and biochemical characteristics as outlined in Bergey's Manual (Nair and Surendran, 2005 ). The bacterial isolates’ colony morphology was assessed based on their colour, shape, size, surface texture (Ajala et al., 2024 ; Ogunoye et al., 2024 ). Furthermore, the cell morphology was observed under a microscope (JEM Jeol 1010, Ltd., Tokyo, Japan). Oxidase activity was assessed by smearing isolates onto oxidase test strips using a sterile loop, with a colour change indicating a positive reaction. A catalase test was conducted to evaluate the catalase response of the isolates. Overnight cultures of the isolates were grown anaerobically on MRS agar at 37°C for 24 hours. The test involved placing two drops of 3% hydrogen peroxide onto 24-hour-old cultures on glass slides, and the reaction was observed for the presence of bubbles, indicating catalase activity. The release of oxygen bubbles during the reaction was a key indicator of catalase activity. For Gram staining, isolates were swabbed onto clean, oil-free glass slides and heat-fixed. The smears were initially stained with crystal violet for one minute, followed by gentle rinsing with running tap water. Next, the slides were treated with diluted Gram’s iodine solution, rinsed again, and decolorised with 95% alcohol for 10 to 20 seconds until the blue colour ceased to run. Safranin was then applied as a counterstain for one minute. After staining, the slides were rinsed gently with tap water, air-dried, and examined under an oil immersion microscope. The cytomorphological features, including cell shape and arrangement, were carefully observed, following the method described by Heil ( 2009 ). For further characterization, colonies were sub-cultured on MRS slants and stored at 4°C. 2.2.4 Molecular characterization of bacterial isolates In order to ensure accurate identification of bacterial isolates, molecular identification was performed at the Nigerian Institute for Medical Research, Yaba, Lagos. This technique analyzes the genetic material of the bacteria, offering precise and definitive identification, particularly when traditional methods like morphological and biochemical tests are insufficient or inconclusive. Briefly, pure cultures of potential probiotic bacteria were grown to the log phase, and genomic Deoxyribonucleic Acid (DNA) was extracted from the bacterial biomass according to the method outlined by Bazzicalupo and Fani (1995). DNA extraction was carried out using the Jena Bioscience Bacteria DNA Preparation Kit (Jena Bioscience GmbH, Germany) following the manufacturer's guidelines. After DNA extraction, Polymerase Chain Reaction (PCR) was performed to amplify the target DNA fragment within the bacteria, utilizing the primer pair BSF-8 (AGAGTTTGATCCTGGCTCAG) and BSR-534 (ATTACCGCGGCTGGC) as described by Pandey et al. ( 2005 ). These primers produced an amplified size of 526 bp in all lactobacilli and all amplified PCR products (526 bp) were purified using the Jena Bioscience PCR Purification Kit. Sanger sequencing of the 16S rRNA gene was performed at Epoch Life Science (USA). Corresponding sequences were identified using an online BLAST search at http.//blast.ncbi.nlm.nih.gov/Blast.cgi . The sequenced data were submitted to the GenBank and subsequently assigned a GenBank accession number. 2.2.5 Antibiotic resistance pattern of bacterial isolates Antibiotic resistance patterns of the bacterial isolates were assessed using the disk diffusion method, as described by Zhang et al. ( 2016 ). The resistance or sensitivity of the isolates to various antibiotics, including gentamicin (10 µg), ceftazidime (30 µg), cloxacillin (5 µg), erythromycin (5 µg), cefuroxime (30 µg), ofloxacin (5 µg), augmentin (30 µg), and ceftriaxone (30 µg), was determined by measuring the inhibition zone diameters. These measurements were interpreted according to the 2014 Clinical Laboratory Standards Institute (CLSI) guidelines. For the assay, 100 µl of actively growing cultures of acid-bile-tolerant and lactate-antagonist bacteria were evenly spread onto the surface of Mueller-Hinton agar plates using sterile cotton swabs. After the plates were dried, antibiotic discs were placed on the agar surface and left at 4°C for 30 minutes to allow diffusion. The plates were then incubated anaerobically at 37°C for 24–48 hours. Resistance was evaluated based on the inhibition zone diameter, with sensitivity defined as zones ≥ 21 mm and resistance as zones ≤ 15 mm. Measurements were taken using calipers to ensure accuracy. 2.2.6 Impacts of fermentation periods on the probiotic traits of LABs recovered from fermented sorghum supernatant The tolerance of the isolated LAB to acidic conditions, bile salts and sensitivity to temperature was assessed using standardized protocols from ICRISAT. Bile salt tolerance was tested in MRS broth (Oxoid CM0359) supplemented with 0.3% (w/v) oxgall bile (Sigma-Aldrich, Steinheim, Germany). LAB cell suspensions (approximately 10 7 CFU/ml), cultured for 18 hours, were added to bile-free MRS broth (pH 7) and MRS broth containing 0.3 and 0.6% (w/v) bile. The mixtures were incubated at 37°C, and samples were collected at 0 and 3 hours. These samples were serially diluted to 10-fold in diluent (Oxoid CM0733, pH 7) and plated in duplicate on MRS agar (Oxoid CM0361). Thereafter, the plates were incubated anaerobically at 37°C for 48 hours using the GasPak system (BBL Microbiology Systems, Cockeysville, Md.). The temperature and acid tolerance of LAB isolates were assessed by inoculating overnight bacterial cultures into MRS broth, adjusting the pH to 2.5 and 4.0 with 0.1 M HCl, and incubating at 37°C for 3 hours. After incubation, samples were plated on MRS agar to evaluate bacterial survival. After the incubation period, viable bacterial colonies were then counted, and LAB numbers were calculated in accordance with ISO 15214 (1998). Viability was expressed as the percentage of LAB colonies grown on MRS agar relative to the initial bacterial concentration using Eq. 2 . $$\:Bacterial\:survival\:rate\:\left(\%\right)=\frac{loglog\:CFUN1\:}{loglog\:CFUNo\:\:}\:\times\:100$$ 2 CFU: Colony forming unit N 1 = Total bacterial number after 3h in stimulated intestinal juice N 0 = Total bacterial number after 0h in stimulated intestinal juice 2.3 Statistical analysis The raw data for total bacterial load was processed in Microsoft Excel to calculate the mean and subsequently converted to CFU/ml using Eq. 1 . 3.0 Results and discussion 3.1 Total Bacteria Count Total bacteria count (TBC) is a microbiological method used to estimate the total number of viable bacteria in a given sample, such as food, water, or other biological materials. Expressed in colony-forming units per milliliter (CFU/ml) or gram (CFU/g), TBC provides an overall indication of microbial load, which is essential for assessing sample quality, safety, and hygiene (Sutarlie, 2023). In this study, the TBC of fermented sorghum supernatant was evaluated on three agar media: Mueller-Hinton Agar (MHA), MacConkey Agar (MCA), and De Man, Rogosa, and Sharpe Agar (MRS). The mean bacterial counts, expressed in CFU/mL, indicated that MHA recorded the highest values, ranging from 2.88 × 10 − 3 to 4.1 × 10 − 3 , followed by MRS agar with counts varying from 2.78 × 10 − ³ to 3.50 × 10 − ³, while MCA showed the lowest bacterial counts, ranging from 0.00 to 1.00 × 10 − ⁴. MHA agar exhibited the highest bacterial count likely due to its non-selective and non-differential nature, which allows it to support the growth of a wide range of organisms (Yang and Wei, 2021 ). In contrast, MCA and MRS are selective and specialized media designed for specific purposes. MCA selectively isolates Gram-negative (Zhu et al., 2019 ) and enteric bacteria (Hernandez-Raquet et al., 2020), typically found in the gut, while MRS supports the growth of LAB (Willis et al., 2022 ). This result is in line with the findings of Seyed et al. (2022) which reports that MRS agar gives good colony counts for lactobacilli and for other lactic acid bacteria. 3.2 Identification of LABs isolated from sorghum supernatant. The morphological and biochemical characterization of LAB isolates is a critical step in identifying strains with probiotic potential. Morphological evaluation typically reveals the shape, Gram reaction, and colony characteristics, which help differentiate LAB from other bacterial groups (Zhang et al., 2020 ). In the identification study, we used both morphological and biochemical techniques. The morphological characteristics of LAB isolates from sorghum supernatant ( omidun ) revealed predominantly bacillary morphology across all isolates except for the isolate from OMDN1, which exhibited a coccus morphology. Bacterial strains from OMDN 2, 3, 4, 5, 6, and 7 were identified as Gram-positive. Biochemical tests, including oxidase and catalase assays, further confirmed the LAB identity, as all isolates tested negative for these enzymes. As confirmed by Teame et al. ( 2020 ), biochemical tests, such as oxidase and catalase assays, are essential for confirming the identity of LAB. The negative results for oxidase and catalase in all isolates align with the characteristic traits of LAB, as they are anaerobic or facultatively anaerobic organisms that do not rely on oxidative respiration (A. Linares-Pasten, 2018). The absence of catalase activity reflects the inability of LAB to produce the catalase enzyme, which breaks down hydrogen peroxide, a by-product of aerobic metabolism (Morgan et al., 2017 ). These findings support the classification of the isolates as LAB and highlight their metabolic suitability for fermentation processes, where oxygen tolerance is minimal, and anaerobic pathways dominate. Such traits underline their probiotic potential and highlight the importance of further testing, such as acid and bile tolerance, for their functional validation. Given the complex and dynamic taxonomic history of bacteria, conventional identification methods should be supplemented with molecular techniques to ensure accurate and reliable identification (Nordberg et al., 2018). The molecular analysis of the bacteria isolates recovered from the omidun based on 16s rDNA gene showed five new bacterial strains, including L. plantarum , Limosilactobacillus fermentum , Lactobacillus brevis , Burkholderia cepacia , and Lactobacillus sp (Table 1 ). However, recombination and mutation have been identified as some of the key drivers of genetic diversity in bacterial species (Santiago et al., 2016 ). The molecular analysis also showed that most of the examine bacterial species from the fermented sorghum supernatant were closely related to their GenBank relatives. Identification of potential probiotic LABs by 16S rRNA has been described as a highly reliable method by multiple authors, including Kostinek et al. ( 2005 ) and Oguntoyinbo and Narbad ( 2012 ). More importantly, molecular techniques, especially polymerase chain reaction (PCR)-based methods, are important for the specific characterization of LAB strains (Mohania et al., 2008 ; Adiguzel and Atasever 2009 ; Lawalata et al., 2011 ). Many strains of these LABs have been described by many authors as probiotic bacteria and have been used in the manufacture of probiotic preparations for animal and human health benefits (Sanders et al., 2019 ). Table 1 Percentage identity and accession numbers of LAB strains recovered from omidun Organism Identified Percentage Identity (%) Accession Number Burkholderia cepacia (24h) 95.18 MG871245.1 Lactobacillus plantarum (72h) 98.24 AB601179.1 Lactobacillus sp. (72h) Limosilactobacillusfermentum (96h) Lactobacillus brevis (96h) 98.45 98.28 94.15 MH685412.1 ON117011.1 EU231605.1 3.3 Effects of fermentation period on the antimicrobial susceptibility pattern of LAB isolated from fermented sorghum supernatant Table 2 shows the effects of fermentation period on the antimicrobial susceptibility pattern of LAB isolated from fermented sorghum supernatant. One of the parameters that determines the safety of probiotic strains is their antibiotic resistance profile and the lack of genes responsible for antibiotic resistance (Markowiak and Slizewska, 2017). In food, antibiotic-resistant LABs pose a risk factor to consumer health as they can transfer antibiotic resistance genes to opportunistic human pathogens and cause complications to patient antibiotic treatment (Magiorakos et al., 2012 ). To prevent such adverse effects, it is essential to control all stages of the food production flow and eliminate lactobacilli, a source of genetic material that can induce resistance traits. These precautions can suppress the development of resistant pathogenic and multidrug-resistant strains (Guan et al., 2021 ; Zhang et al., 2016 ). In this study, multidrug resistance was observed in most bacterial isolates, with isolates from OMDN 4 and 5 showing the highest resistance to multiple drug classes of all isolates. They were resistant to all eight antibiotics used in this study. This has been found to be a great property of probiotics as they are 100% effective even in the presence of antibiotics as they cannot be killed by antibiotics. Many probiotics have natural resistance to certain antibiotics. For example, Lactobacillus spp. are often resistant to vancomycin due to intrinsic mechanisms that do not spread to other bacteria (Hovart et al, 2021). This may reduce the possibility of OMDN 1–3 as potential probiotics as they are only resistant to a few antibiotics. In a previous study by Kumar et al. ( 2017 ), LABs were isolated from ogi and screened for antimicrobial activity against pathogens such as Staphylococcus aureus , Pseudomonas aeruginosa , Candida albicans etc., the LAB showed inhibitory activity against majority of the pathogens. Table 2 Effects of fermentation periods on the antimicrobial susceptibility pattern of LABs’ sorghum supernatant Bacterial isolate Antimicrobials resisted by most isolates OMDN1 (12h) CAZ, CRX OMDN2 (24h) CAX, CXC, OFL, AUG OMDN3 (48h) CAZ, ERY, CXC, OFL, AUG OMDN4 (72h) CAZ, CRX, GEN, CTR, ERY, CXC, OFL, AUG (all antibiotics) OMDN5 (72h) CAZ, CRX, GEN, CTR, ERY, CXC, OFL, AUG (all antibiotics) OMDN6 (96h) CAZ, CRX, GEN, CTR, ERY, CXC, OFL, AUG (all antibiotics) OMDN7(96h) CAZ, CRX, GEN, CTR, ERY, CXC, OFL, AUG (all antibiotics) GEN: gentamicin; CAZ: ceftazidime; CXC: cloxacillin; ERY: erythromycin; CRX: cefuroxime; OFL: ofloxacin; AUG: augmentin; and CTR: ceftriaxone 3.4 Effects of fermentation periods on temperature sensitivity, acid and bile salts tolerance of LAB recovered from fermented sorghum supernatant. Fermentation periods significantly influenced the temperature sensitivity, acid tolerance, and the bile salt tolerance of LABs recovered from sorghum supernatant. 3.4.1 Effects of fermentation period on temperature sensitivity of LABs recovered from sorghum supernatant Fermentation periods have been confirmed to greatly influence the temperature sensitivity of LABs (Sionek et al., 2024 ; Liu et al., 2024 ). Table 2 shows the effect of fermentation period on the temperature sensitivity of lactic acid bacteria isolates from the supernatant of fermenting sorghum ( omidun ). The temperatures were adjusted to 25 o C, 37 o C and 40 o C and monitored for 3 hours. All strains grew at 40°C between 0 to 3 hours of incubation. This is in line with Ibourahema et al. 2012, who reported that the ability of the bacteria to grow at elevated temperatures is an excellent trait as it can be interpreted to indicate increased growth rates and lactic acid production. Furthermore, higher fermentation temperatures reduce contamination with other microorganisms (Ibourahema et al., 2012). The optimum growth temperature for probiotics in the stomach is 30–40 o C. This explains why one of the LABs from OMDN 4 recorded no growth at 25 o C and only showed growth at 37 o C, after 3hrs of incubation. Other strains grew across all the temperatures. Table 2 Effect of fermentation periods on the temperature sensitivity of LAB recovered from fermented sorghum supernatant Temperature 25 0 C 37 0 C 40 0 C Incubation Period 1h 3h 1h 3h 1h 3h Bacterial Strains OMDN1(12h) + + + + + + OMDN2(24h) + + + + + + OMDN3(48h) + + + + + + OMDN4(72h) - - - + + + OMDN5(72h) + + + + + + OMDN6(96h) + + + + + + OMDN7(96h) + + + + + + Symbols: +, Tolerant; -, Non-Tolerant 3.4.2 Effects of fermentation periods on the acid tolerance (pH) of LABs recovered from fermented sorghum supernatant The fermentation periods have been documented to significantly impact the acid tolerance (pH) of LABs (Fonseca et al., 2021 ; Kim et al., 2019 ). Extended fermentation periods often enhance LAB growth due to the accumulation of favorable metabolites like lactic acid, which create a competitive environment against non-LAB microorganisms (Jung et al., 2021 ). However, excessively long fermentation may lead to nutrient depletion, reducing LAB viability (Selvaraj and Gurumurthy, 2023 ; Taye et al., 2021 ; Shobharani and Halami, 2014 ). Similarly, acid tolerance is a crucial probiotic trait of LAB, allowing them to survive and remain active in low-pH environments such as fermented foods (Guan and Liu, 2020 ) and the gastrointestinal tract (Ansari and Yamaoka, 2017 ; Broadbent et al., 2010 ). Hence, the interplay between fermentation time and acid tolerance ensures the selection of robust LAB strains with desirable probiotic characteristics. Table 3 highlights the effect of fermentation period and acid tolerance (pH) of sorghum supernatant compared to the control. The pH was adjusted to 2.5 and 4.0 and monitored for 3 hours. All isolates maintained high viability after 3 hours. According to Bakari et al., 2011 , probiotic bacteria must survive through the stomach, where the pH can be as low as 1.5 to 2.0 and stay viable for 4 h before they enter the intestinal tract. This is consistent with Siragusa et al ., 2024, who reported that Lb. fermentum viability measured at pH 4.0 and 3.0 indicated strains that were most resistant to changes in pH values. Table 3 Effects of fermentation periods on the acid tolerance (pH) of LABs recovered from fermented sorghum supernatant Incubation time 0h 3h pH 2.5 4.0 2.5 4.0 Bacterial Isolate OMDN1(12h) 99 0 100 103 OMDN2(24h) 98 63 99 103 OMDN3(48h) 100 63 100 102 OMDN4(72h) 100 100 100 100 OMDN5(72h) 99 102 100 102 OMDN6(96h) 100 102 104 103 OMDN7(96h) 100 102 99 103 Control 100 100 3.4.3 Effects of fermentation period on the bile salt tolerance of LABs recovered from fermented sorghum supernatant The fermentation period significantly influences the bile acid tolerance of LAB. Prolonged fermentation often enhances the resilience of LAB by allowing them to adapt to environmental stresses, including bile salts (Chen et al., 2023 ). During this period, LAB may upregulate genes responsible for bile salt hydrolase (BSH) activity and strengthen their cell membranes, improving their ability to withstand bile salt concentrations (Swain et al., 2022 ). The effect of fermentation duration on the bile acid tolerance of LAB isolates recovered from sorghum supernatant is presented in Table 4 . The isolates were observed to grow at concentrations of 0.3 and 0.6%. All isolates grew at 0 h at the above bile concentrations. However, after 3 hours, none of the isolates from OMDN 1–3 survived. This disqualifies them as potential probiotics. Bile salts secreted in the small intestine reduce bacterial survival by affecting lipid- and fatty acid-based cell membranes, and these modifications affect not only cell permeability and viability, but also membrane and environment interaction (Papizadeh, 2017). Therefore, before probiotics can benefit human health, several criteria must be met, including the ability to tolerate acid and bile salts, and to grow in the lower intestinal tract (Shah, 2000 ). A previous study by Meljlholm and Dalgaard (2015), reported that small intestinal transit resistance of bile salt-tolerant lactobacilli was strain-dependent. The majority of the strains were inherently resistant to simulated pancreatic juice and showed no reduction in viability for up to 4 hrs. Table 4 Effect of fermentation period on the bile acid tolerance of LABs recovered from fermented sorghum supernatant Incubation time 0h 3h Bile acid concentration 0.3% 0.6% 0.3% 0.6% Bacterial Isolate OMDN1(12h) 97 98 0 0 OMDN2(24h) 96 97 0 0 OMDN3(48h) 96 98 0 0 OMDN4(72h) 98 99 85 0 OMDN5(72h) 98 98 85 85 OMDN6(96h) 98 98 78 80 OMDN7(96h) 95 96 0 0 Control 100 100 3.5 Conclusion Evaluating the probiotic potential of LAB isolated from fermented sorghum supernatant under different fermentation conditions highlights the adaptability and functional capabilities of these strains. The study demonstrates that fermentation conditions, such as duration and environmental factors, significantly influence the growth, acid tolerance, and bile salt resistance of LAB. Isolates from OMD 4 and 5 displayed all the characteristics of potential probiotics and proved to be Lactobacillus plantarum, Lactobacillus sp., Limosilactobacillus fermentum, and Lactobacillus brevis , respectively. This study also showed that fermentation time affects the type of predominant probiotic strain found in fermented products. The survival and proliferation of the LAB strains were proven to withstand the ‘harsh’ conditions of the stomach, being able to compete exclusively with enteric pathogens. Fermented foods are the most natural source of probiotics, while over-the-counter probiotic supplements are typically prescribed by doctors for specific medical conditions. Unlike natural sources, these supplements are not generally intended for daily consumption. The detection of Burkholderia cepacia after 24hs of incubation suggests that fermentation under 24hs is not safe for consumption. Hence proper fermentation must take at least 72hs to be considered safe for consumption. Burkholderia cepacia is a plant probiotic but has also been reported to be pathogenic to humans. Infection with these bacteria is associated with high mortality rate and may spread from one patient to another. All other bacterial isolates were probiotic. These findings suggest that sorghum supernatant serves as a viable source of probiotic LAB with potential applications in functional food development. 3.6 Recommendations The quality of a product is highly affected by the quality of raw materials since high quality probiotic products require high quality probiotic raw materials. As a result, sorghum-based omidun is recommended for more frequent consumption compared to corn-based omidun . Additionally, considering the challenges of reduced probiotic viability in supplements due to factors like storage, handling, packaging, and distribution, omidun emerges as a more reliable and preferable option. Further studies, accompanied by more clinical trials, should be carried out, to broaden or diversify the use of sorghum omidun. Just like omidun made from corn, sorghum omidun , infused with fruits should be taken as fermented beverages, as a cost-effective alternative, which will offer the pleasure of improved flavoured drinks with organoleptic changes. The technology of controlled fermentation should be employed, to reduce the pungent smell of the fermented product. Proper enlightenment of the public on the health and nutritional benefits of consuming omidun should be done as this will enhance its acceptability. Further research is recommended to validate these strains' in vivo probiotic effects and explore their role in promoting gut health. References Linares-Pasten A, Aronsson J, A., Nordberg Karlsson E (2018) Structural considerations on the use of endo-xylanases for the production of prebiotic xylooligosaccharides from biomass. Curr Protein Pept Sci 19(1):48–67 Abdulsasalam Sulaiman (2024) Lactic acid bacteria and fermented maize supernatant (Omidun) have anti-biofilm properties against staphylococci and enteroaggregative Escherichia coli strains. FUDMA J Sci. 10.33003/fjs-2023-0706-2134 Adiguzel G, Atasever M (2009) Phenotypic and genotypic characterization of lactic acid bacteria isolated from Turkish dry fermented sausage. Romanian Biotechnol Lett, 14(1) Afolayan AO, Ayeni FA, Ruppitsch W (2017) Antagonistic and quantitative assessment of indigenous lactic acid bacteria in different varieties of ogi against gastrointestinal pathogens. Pan Afr Med J, 27 Ajala O, Adelusi OA, Kajihausa OE, Onabanjo OO, Oyewole OB, Obadina AO (2024) Effect of storage temperature and time on the microbial quality and sensory properties of extrudates produced from pearl millet (Pennisetum glaucum (L) Leake) and Bambara groundnut (Vigna subterranea) flour blends. J Stored Prod Res 109:102442 Ansari S, Yamaoka Y (2017) Survival of Helicobacter pylori in gastric acidic territory. Helicobacter, 22(4), e12386 Anumudu CK, Miri T, Onyeaka H (2024) Multifunctional Applications of Lactic Acid Bacteria: Enhancing Safety, Quality, and Nutritional Value in Foods and Fermented Beverages. Foods 13(23):3714 Atta HI, Gimba A, Bamgbose T (2020) Antimicrobial activity of lactic acid bacteria isolated from garri on Escherichia coli strains isolated from clinical and environmental samples. Agricultural Sci Technol 12(4):357–363 Audu HJ, Abiodun OA, Ayeni FA (2019) Beneficial effects of a fermented maize product with its supernatant, Lactobacillus fermentum and Lactobacillus brevis in rat model of colitis. North Afr J Food Nutr Res 3(6):195–200 Awika JM (2017) Sorghum: Its unique nutritional and health-promoting attributes. Gluten-free ancient grains. Woodhead publishing, pp 21–54 Bakari D, Leopold TN, Augustin M, Moses MC (2011) Assessment of physiological properties of some lactic acid bacteria isolated from the intestine of chickens use as probiotics and antimicrobial agents against enteropathogenic bacteria. Innovative Romanian Food Biotechnol, (8), 33–40 Bazzicalupo M, Fani R (1996) The use of RAPD for generating specific DNA probes for microorganisms. PCR and other nucleic acid methods, Species diagnostics protocols, pp 155–175 Belhadj H, Harzallah D, Khennouf S, Dahamna S, Bouharati S, Baghiani A (2009) Isolation, identification and antimicrobial activity of lactic acid bacteria from Algerian honeybee collected pollen. In XIII International Conference on Medicinal and Aromatic Plants 854 (pp. 51–58) Broadbent JR, Larsen RL, Deibel V, Steele JL (2010) Physiological and transcriptional response of Lactobacillus casei ATCC 334 to acid stress. J Bacteriol 192(9):2445–2458 Castellone V, Bancalari E, Rubert J, Gatti M, Neviani E, Bottari B (2021) Eating fermented: Health benefits of LAB-fermented foods. Foods 10(11):2639 Chen Z, Leng X, Zhou F, Shen W, Zhang H, Yu, Qin M (2023) Screening and identification of probiotic lactobacilli from the infant gut microbiota to alleviate lead toxicity. Probiotics Antimicrob proteins 15(4):821–831 Das A, Chauhan G, Agrawal RK, Das AK, Tomar S, Uddin S, Lorenzo JM (2021) Characterization of crude extract prepared from Indian curd and its potential as a biopreservative. Food Sci Technol Int 27(4):313–325 Endo A, Tanizawa Y, Arita M (2019) Isolation and identification of lactic acid bacteria from environmental samples. Lactic Acid Bacteria: Methods Protocols, 3–13 Fafure AV, Bem DB, Kahuthu SW, Adediran AA, Bodunrin MO, Fabuyide AA, Ajanaku C (2024) Advances in Silicon-Carbon Composites Anodes Derived from Agro wastes for Applications in Lithium-ion battery: a review. Heliyon Falana MB, Bankole MO, Omemu AM (2016) Comparative antimicrobial potentials of omidun obtained from yellow and white maize varieties on some diarrhoea causing microorganisms. Afr J Microbiol Res 10(27):1018–1023 Flores Llovera M, Toldrá Vilardell F (2020) Chemistry, safety, and regulatory considerations in the use of nitrite and nitrate from natural origin in meat products Fonseca HC, de Sousa Melo D, Ramos CL, Dias DR, Schwan RF (2021) Probiotic properties of lactobacilli and their ability to inhibit the adhesion of enteropathogenic bacteria to Caco-2 and HT-29 cells. Probiotics Antimicrob proteins 13:102–112 Fontana L, Bermudez-Brito M, Plaza-Diaz J, Munoz-Quezada S, Gil A (2013) Sources, isolation, characterisation and evaluation of probiotics. Br J Nutr 109(S2):S35–S50 Ghodbane R, Raoult D, Drancourt M (2014) Dramatic reduction of culture time of Mycobacterium tuberculosis. Sci Rep 4:4236. 10.1038/srep04236 Granato D, Carocho M, Barros L, Zabetakis I, Mocan A, Tsoupras A, Pimentel TC (2022) Implementation of Sustainable Development Goals in the dairy sector: Perspectives on the use of agro-industrial side-streams to design functional foods. Trends Food Sci Technol 124:128–139 Guan N, Liu L (2020) Microbial response to acid stress: mechanisms and applications. Appl Microbiol Biotechnol 104(1):51–65 Guan Q, Xiong T, Xie M (2021) Influence of probiotic fermented fruit and vegetables on human health and the related industrial development trend. Engineering 7(2):212–218 Heil N (2009) National Wild Fish Health Survey-Laboratory Procedures Manual. US Fish and Wildlife Service. Warm Springs, Georgia, USA Horvat IB, Gobin I, Kresović A, Hauser G (2021) How can probiotic improve irritable bowel syndrome symptoms? World J Gastrointest Surg 13(9):923 Ibourahema C, Dauphin RD, Jacqueline D, Thonart P (2008) Characterization of lactic acid bacteria isolated from poultry farms in Senegal. Afr J Biotechnol, 7(12) Imade EE, Omonigho SE, Babalola OO, Enagbonma BJ (2021) Lactic acid bacterial bacteriocins and their bioactive properties against food-associated antibiotic-resistant bacteria. Ann Microbiol 71:1–14 International Organization for Standardization ISO 15214 (1998) Microbiology of food and animal feeding stuffs-horizontal method for the enumeration of mesophilic lactic acid bacteria-colony count technique at 30 OC Jenfa MD, Adelusi OA, Aderinoye A, Coker OJ, Martins IE, Oyewole OB, Njobeh PB, Obadina OA (2024a) Evaluation of the physicochemical, nutritional, textural, and sensory characteristics of extrudates from sorghum and orange-fleshed sweet potato flour blends. Journal of Food Processing and Preservation, 2024(1), p.2930130 Jenfa MD, Adelusi OA, Aderinoye A, Coker OJ, Martins IE, Obadina OA (2024b) Physicochemical compositions, nutritional and functional properties, and color qualities of sorghum–orange-fleshed sweet potato composite flour. Food Sci Nutr 12(4):2364–2378 Jung JY, Han SS, Kim ZH, Kim MH, Kang HK, Jin HM, Lee MH (2021) In-vitro characterization of growth inhibition against the gut pathogen of potentially probiotic lactic acid bacteria strains isolated from fermented products. Microorganisms 9(10):2141 Kim JA, Bayo J, Cha J, Choi YJ, Jung MY, Kim DH, Kim Y (2019) Investigating the probiotic characteristics of four microbial strains with potential application in feed industry. PLoS ONE, 14(6), e0218922 Kostinek M, Pukall R, Rooney AP, Schillinger U, Hertel C, Holzapfel WH, Franz CM (2005) Lactobacillus arizonensis is a later heterotypic synonym of Lactobacillus plantarum. Int J Syst Evol MicroBiol 55(6):2485–2489 Kumar CS, Reddy KK, Boobalan G, Reddy AG, Chowdhary CSR, Vinoth A, Rao GS (2017) Immunomodulatory effects of Bifidobacterium bifidum 231 on trinitrobenzenesulfonic acid-induced ulcerative colitis in rats. Res Vet Sci 110:40–46 Lawalata HJ, Sembiring L, Rahayu ES (2011) Molecular identifcation of lactic acid bacteria producing antimicrobial agents from bakasang, an Indonesian traditional fermented fish product. Indonesian J Biotechnol 16(2):93–99 Lee JH, Kim MJ, Kim CY (2024) The development of new functional foods and ingredients. Foods 13(19):3038 Liu Y, Tran DQ, Rhoads JM (2018) Probiotics in disease prevention and treatment. J Clin Pharmacol 58:S164–S179 Liu J, Zhao M, Hao J, Yan X, Fu Z, Zhu N, Ge G (2024) Effects of temperature and lactic acid Bacteria additives on the quality and microbial community of wilted alfalfa silage. BMC Plant Biol 24(1):844 Magiorakos AP, Srinivasan A, Carey RB, Carmeli Y, Falagas ME, Giske CG, Monnet DL (2012) Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect 18(3):268–281 Mamta T, Deshpande HW, Bhate MA (2017) Isolation and identification of lactic acid bacteria and their exploration in non-dairy probiotic drink. Int J Curr Microbiol Appl Sci 6:1023–1030 Markowiak P, Śliżewska K (2017) Effects of probiotics, prebiotics, and synbiotics on human health. Nutrients 9(9):1021 Mejlholm O, Dalgaard P (2015) Modelling and predicting the simultaneous growth of Listeria monocytogenes and psychrotolerant lactic acid bacteria in processed seafood and mayonnaise-based seafood salads. Food Microbiol 46:1–14 Mohania D, Nagpal R, Kumar M, Bhardwaj A, Yadav M, Jain S, Yadav H (2008) Molecular approaches for identification and characterization of lactic acid bacteria. J Dig Dis 9(4):190–198 Morgan NK, Wallace A, Bedford MR, Choct M (2017) Efficiency of xylanases from families 10 and 11 in production of xylo-oligosaccharides from wheat arabinoxylans. Carbohydr Polym 167:290–296 Nair PS, Surendran PK (2005) Biochemical characterization of lactic acid bacteria isolated from fish and prawn. J Cult Collections 4:2004–2005 Nordberg Karlsson E, Schmitz E, Linares-Pastén JA, Adlercreutz P (2018) Endo-xylanases as tools for production of substituted xylooligosaccharides with prebiotic properties. Appl Microbiol Biotechnol 102:9081–9088 Ogunoye OA, Adelusi OA, Chime AO, Apuu KV, Onisile BO (2024) Preliminary identification of bacterial species contaminating okra fruits in some selected markets in Owo, Nigeria. J Nutr Food Process, 7(3) Oguntoyinbo FA, Narbad A (2012) Molecular characterization of lactic acid bacteria and in situ amylase expression during traditional fermentation of cereal foods. Food Microbiol 31(2):254–262 Oikonomou G, Addis MF, Chassard C, Nader-Macias MEF, Grant I, Delbès C, Even S (2020) Milk microbiota: what are we exactly talking about? Front Microbiol 11:60 Omeiza FO, Ademowo GO, Ayeni FA (2020) Evaluation of in vivo anti-malarial potential of omidun obtained from fermented maize in Ibadan, Nigeria. Malar J 19:1–10 Østergaard NB, Eklöw A, Dalgaard P (2014) Modelling the effect of lactic acid bacteria from starter-and aroma culture on growth of Listeria monocytogenes in cottage cheese. Int J Food Microbiol 188:15–25 Pachla A, Wicha M, Ptaszyńska AA, Borsuk G, Trokenheim ŁŁ, Małek W (2018) The molecular and phenotypic characterization of fructophilic lactic acid bacteria isolated from the guts of Apis mellifera L. derived from a Polish apiary. J Appl Genet 59:503–514 Pandey P, Kang SC, Maheshwari DK (2005) Isolation of endophytic plant growth promoting Burkholderia sp. MSSP from root nodules of Mimosa pudica. Curr Sci, 177–180 Park MK, Ngo V, Kwon YM, Lee YT, Yoo S, Cho YH, Kang SM (2013) Lactobacillus plantarum DK119 as a probiotic confers protection against influenza virus by modulating innate immunity. PLoS ONE, 8(10), e75368 Pontieri P, Troisi J, Calcagnile M, Bean SR, Tilley M, Aramouni F, Del Giudice L (2022) Chemical composition, fatty acid and mineral content of food-grade white, red and black sorghum varieties grown in the mediterranean environment. Foods 11(3):436 Rapoo SM, Budeli P, Thaoge ML (2023) Recovery of Potential Starter Cultures and Probiotics from Fermented Sorghum (Ting) Slurries. Microorganisms 11(3):715. https://doi.org/10.3390/microorganisms11030715 Rather RA (2023) Metaverse marketing and consumer research: theoretical framework and future research agenda in tourism and hospitality industry. Tourism Recreation Res, 1–9 Ren C, Du H, Xu Y (2017) Advances in microbiome study of traditional Chinese fermented foods. Acta Microbiol Sin 57:885–898 Sanders ME, Merenstein DJ, Reid G, Gibson GR, Rastall RA (2019) Probiotics and prebiotics in intestinal health and disease: from biology to the clinic. Nat reviews Gastroenterol Hepatol 16(10):605–616 Şanlier N, Gökcen BB, Sezgin AC (2017) Health benefits of fermented foods. Crit Rev Food Sci Nutr 59(3):506–527 Santiago M, Ramírez-Sarmiento CA, Zamora RA, Parra LP (2016) Discovery, molecular mechanisms, and industrial applications of cold-active enzymes. Front Microbiol 7:1408 Selvaraj S, Gurumurthy K (2023) An overview of probiotic health booster-kombucha tea. Chin Herb Med 15(1):27–32 Seyed MA, Jantan I, Bukhari SNA, Vijayaraghavan K (2016) A comprehensive review on the chemotherapeutic potential of piceatannol for cancer treatment, with mechanistic insights. J Agric Food Chem 64(4):725–737 Shah NP (2000) Probiotic bacteria: selective enumeration and survival in dairy foods. J Dairy Sci 83(4):894–907 Shibata T, Kanayama M, Haida M, Fujimoto S, Oroguchi T, Sata K, Ishii N (2016) Lactococcus lactis JCM5805 activates anti-viral immunity and reduces symptoms of common cold and influenza in healthy adults in a randomized controlled trial. J Funct Foods 24:492–500 Shobharani P, Halami PM (2014) Cellular fatty acid profile and H+-ATPase activity to assess acid tolerance of Bacillus sp. for potential probiotic functional attributes. Appl Microbiol Biotechnol 98:9045–9058 Sionek B, Szydłowska A, Trząskowska M, Kołożyn-Krajewska D (2024) The Impact of Physicochemical Conditions on Lactic Acid Bacteria Survival in Food Products. Fermentation 10(6):298. https://doi.org/10.3390/fermentation10060298 Siragusa S, De Angelis M, Calasso M, Campanella D, Minervini F, Di Cagno R, Gobbetti M (2014) Fermentation and proteome profiles of Lactobacillus plantarum strains during growth under food-like conditions. J Proteom 96:366–380 Skowron K, Budzyńska A, Grudlewska-Buda K, Wiktorczyk-Kapischke N, Andrzejewska M, Wałecka-Zacharska E, Gospodarek-Komkowska E (2022) Two faces of fermented foods—the benefits and threats of its consumption. Front Microbiol 13:845166 Sørensen HM, Rochfort KD, Maye S, MacLeod G, Brabazon D, Loscher C, Freeland B (2022) Exopolysaccharides of lactic acid bacteria: production, purification and health benefits towards functional food. Nutrients 14(14):2938 Sutarlie L, Chee HL, Ow SY, Aabdin Z, Tjiu WW, Su X (2023) A rapid total bacterial count method using gold nanoparticles conjugated with an aptamer for water quality assessment. Nanoscale 15(41):16675–16686 Swain G, Maurya KL, Sonwani RK, Singh RS, Jaiswal RP, Rai BN (2022) Effect of mixing intensity on biodegradation of phenol in a moving bed biofilm reactor: Process optimization and external mass transfer study. Bioresour Technol 351:126921 Taye Y, Degu T, Fesseha H, Mathewos M (2021) Isolation and identification of lactic acid bacteria from cow milk and milk products. The Scientific World Journal, 2021(1), 4697445 Teame T, Wang A, Xie M, Zhang Z, Yang Y, Ding Q, Zhou Z (2020) Paraprobiotics and postbiotics of probiotic Lactobacilli, their positive effects on the host and action mechanisms: A review. Front Nutr 7:570344 Vanamala JK, Massey AR, Pinnamaneni SR, Reddivari L, Reardon KF (2018) Grain and sweet sorghum (Sorghum bicolor L. Moench) serves as a novel source of bioactive compounds for human health. Crit Rev Food Sci Nutr 58(17):2867–2881 Viphonephom P, Kounnavong S, Reinharz D (2024) The state of decentralization of the healthcare system and nutrition programs in the Lao People’s Democratic Republic: an organizational study. BMC Health Serv Res 24(1):1037 Waki N, Yajima N, Suganuma H, Buddle BM, Luo D, Heiser A, Zheng T (2014) Oral administration of Lactobacillus brevis KB290 to mice alleviates clinical symptoms following influenza virus infection. Lett Appl Microbiol 58(1):87–93 Wang Y, Wu J, Lv M, Shao Z, Hungwe M, Wang J, Geng W (2021) Metabolism characteristics of lactic acid bacteria and the expanding applications in food industry. Front Bioeng Biotechnol 9:612285 Willis C, McLauchlin J, Aird H, Jørgensen F, Lai S, Sadler-Reeves L (2022) Assessment of the microbiological quality and safety of unpasteurized milk cheese for sale in England between 2019 and 2020. J Food Prot 85(2):278–286 Yang Y, Wei L (2021) Application of E-nose technology combined with artificial neural network to predict total bacterial count in milk. J Dairy Sci 104(10):10558–10565 Yeo JM, Lee HJ, Kim JW, Lee JB, Park SY, Choi IS, Song CS (2014) Lactobacillus fermentum CJL-112 protects mice against influenza virus infection by activating T-helper 1 and eliciting a protective immune response. Int Immunopharmacol 18(1):50–54 Zhang B, Wang Y, Tan Z, Li Z, Jiao Z, Huang Q (2016) Screening of probiotic activities of lactobacilli strains isolated from traditional Tibetan Qula, a raw yak milk cheese. Asian-Australasian J Anim Sci 29(10):1490 Zhang SJ, Wang LL, Lu SY, Hu P, Li YS, Zhang Y&, Ren HL (2020) A novel, rapid, and simple PMA-qPCR method for detection and counting of viable Brucella organisms. J Veterinary Res 64(2):253 Zhu Z, Zhu X, Kong F, Guo W (2019) Quantitatively determining the total bacterial count of raw goat milk using dielectric spectra. J Dairy Sci 102(9):7895–7903 Additional Declarations The authors declare no competing interests. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6104576","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":420675499,"identity":"acb93f2b-75d0-4208-a078-89831fc073f9","order_by":0,"name":"Njoku, Eberechukwu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABJUlEQVRIiWNgGAWjYDACCTB5AELzQMQYH4DYfKRoYTYAsdlI0cIG5uDSwi/dfOzDh5o7iTNn5Bh+eFNxJ3HDtcPPKr/m2MmwMTA/fHQDU4vknGPJM2cce5Y4WyLHWHLOmWeJG26nmd2W3ZYMdBibsXEOphaDGznGzLwNhxPnSecYSPO2HQZqSTC7LbmNGaiFh00aixb7G/mfmf9CtBj/5v0H0pL+rVhyWz1OLQYSOczMjEAts6VzzKRB1m24nWPG+HHbYZxaJO4cM2bsOXbYeOb8Z2WWc0CM2znF0ozbjvOwMWP3C//s5scMP2oOy844c3jzjTdARt/t9I0ff26rtudnb374GIsWDODYACSYwRHETIRycHiACMYfRKoeBaNgFIyCEQEAJaVtGHtYZIoAAAAASUVORK5CYII=","orcid":"","institution":"Federal University of Agriculture, Abeokuta, Nigeria","correspondingAuthor":true,"prefix":"","firstName":"Eberechukwu","middleName":"","lastName":"Njoku","suffix":""},{"id":420675500,"identity":"fe8d05e9-3cac-4f1c-a7ec-a382a264ca02","order_by":1,"name":"Oluwasola Abayomi Adelusi","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABGUlEQVRIiWNgGAWjYFAC5gYwxccMJD4YSMjxg3gJBfi0MEK0sAG1MM6osDGWBPETDIjRArKQ50xa4oYDIC4eLfLtjY0fflTY5LGx8x58wNt2OHHz+dWJHx4YMMjzix3AqsXgzMFmyZ4zacVszHzJBpJth4233Xi7WQLoMMOZsxOwa5FIbJBmBBrexsxjJmHYdlh2242zG0BaEgxuY9ciPyOx+TfjP7AW8x+JbYcZN884u/kHPi0MNxLbpBkbILYwHDiTpriBv3cbXluAfmmz7DmWBtICDF9gIEvc4N1mkWAggdMv8u3Nh2/8qLFJ7Oc/Y/j5Dygq+89uvgkMQ3l+aRwOwwQSYJUSxCoHAf4DpKgeBaNgFIyCEQAAzXtihHyRy2MAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0002-5125-4380","institution":"University of Johannesburg, South Africa","correspondingAuthor":true,"prefix":"","firstName":"Oluwasola","middleName":"Abayomi","lastName":"Adelusi","suffix":""},{"id":420675501,"identity":"5a15f458-28f6-48be-be6f-2fe31026df53","order_by":2,"name":"Adewale Olusegun Obadina","email":"","orcid":"","institution":"Federal University of Agriculture, Abeokuta, Nigeria","correspondingAuthor":false,"prefix":"","firstName":"Adewale","middleName":"Olusegun","lastName":"Obadina","suffix":""}],"badges":[],"createdAt":"2025-02-25 11:12:44","currentVersionCode":1,"declarations":{"humanSubjects":false,"vertebrateSubjects":false,"conflictsOfInterestStatement":false,"humanSubjectEthicalGuidelines":false,"humanSubjectConsent":false,"humanSubjectClinicalTrial":false,"humanSubjectCaseReport":false,"vertebrateSubjectEthicalGuidelines":false},"doi":"10.21203/rs.3.rs-6104576/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6104576/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":77346606,"identity":"7e690cd6-b03f-4a99-bd4f-28eeac6575a1","added_by":"auto","created_at":"2025-02-27 15:49:21","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":112447,"visible":true,"origin":"","legend":"\u003cp\u003eFlow chart for the production of fermented sorghum supernatant (Falana et al, 2016).\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-6104576/v1/60604c70a6fadf773a052717.png"},{"id":77346222,"identity":"65aa54f5-baee-4cbf-a420-ded3134da364","added_by":"auto","created_at":"2025-02-27 15:41:21","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":23585,"visible":true,"origin":"","legend":"\u003cp\u003eMicrobial ecology of the fermenting sorghum supernatant using three different agars. Values are average of three replicates. MHA-mueller-hinton agar; MCA-maconkey agar; MRS- De Man Rogosa and Sharpe Agar.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-6104576/v1/484a7ad1d4fda4dfdc562ea3.png"},{"id":77347715,"identity":"1328d51e-9834-41a4-9922-33291a742e97","added_by":"auto","created_at":"2025-02-27 15:57:22","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1339232,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6104576/v1/5581b66d-85e6-499d-8a7e-5c2ad6080ddd.pdf"}],"financialInterests":"The authors declare no competing interests.","formattedTitle":"\u003cp\u003e\u003cstrong\u003eProbiotic potentials of lactic acid bacteria isolated from fermented sorghum supernatant (\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eomidun\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e) under different fermentation periods\u003c/strong\u003e\u003c/p\u003e","fulltext":[{"header":"1.0 Introduction","content":"\u003cp\u003eLactic acid bacteria (LAB) are a diverse group of Gram-positive, non-spore-forming, facultative anaerobic microorganisms that play a central role in the fermentation of various foods and beverages. Known for their ability to convert sugars into lactic acid, LAB are commonly found in the gastrointestinal tract (Endo et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2019\u003c/span\u003e), fermented dairy products (Ren\u0026eacute;, 2017), pickled vegetables (Pachla et al., \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), and other fermented foods (Granato and Adriano, 2019). These bacteria are crucial in food preservation, as the lactic acid they produce lowers the pH, creating an environment that inhibits the growth of harmful pathogens (Anumudu et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). In addition to their preservation capabilities, LAB have gained significant attention due to their potential health benefits, classifying them as probiotics. Probiotics are live microorganisms that, when administered in adequate amounts, confer health benefits to the host, particularly in the gut. LAB, such as \u003cem\u003eLactobacillus\u003c/em\u003e, \u003cem\u003eBifidobacterium\u003c/em\u003e, \u003cem\u003eLactobacillus brevis\u003c/em\u003e, and \u003cem\u003eLactobacillus plantarum\u003c/em\u003e, are among the most widely studied and utilized probiotics (Skowron et al., \u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Their health-promoting properties include improving gut health, enhancing immune function, alleviating symptoms of irritable bowel syndrome (IBS), preventing diarrhea (Castellone et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). It has also been documented that LAB can assist in the treatment and prevention of acute respiratory infections (Park et al., \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Waki et al., \u003cspan citationid=\"CR81\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Yeo et al., \u003cspan citationid=\"CR85\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Shibata et al., \u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Furthermore, LAB possess antimicrobial properties, producing bacteriocins and other bioactive compounds that can inhibit the growth of harmful pathogens, making them valuable in controlling foodborne illnesses (Flores and Toldra, 2021). As interest in functional foods and natural health solutions grows, LAB continue to be explored for their diverse applications, including the development of functional foods (Lee et al., \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2024\u003c/span\u003e), dietary supplements (Imade et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), and therapies for various health conditions (Das et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eSorghum (\u003cem\u003eSorghum bicolor\u003c/em\u003e L), a staple cereal grain widely cultivated in many regions of the world, plays a significant role in traditional diets and food systems. Its adaptability to diverse climatic conditions, particularly in arid and semi-arid areas, makes it a vital crop for ensuring food security (Jenfa et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2024a\u003c/span\u003e). Sorghum is a nutrient-dense cereal grain rich in amino acids, carbohydrates, proteins, vitamins, and minerals (Pontieri et al., \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Rather, \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Jenfa et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2024b\u003c/span\u003e). Its high protein content makes it valuable in addressing Protein Energy Malnutrition, particularly among children in developing nations like Nigeria (Viphonephom et al., \u003cspan citationid=\"CR80\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Furthermore, sorghum is very rich in B-complex vitamins such as pyridoxine, riboflavin, and thiamine (Jenfa et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2024b\u003c/span\u003e), as well as essential minerals like iron, magnesium, potassium, zinc, phosphorus, and copper (Jenfa et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2024a\u003c/span\u003e; Jenfa et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2024b\u003c/span\u003e). Additionally, its antioxidant properties contribute to reducing inflammation (Awika, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Vanamala et al., \u003cspan citationid=\"CR79\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). However, sorghum is not only a source of essential nutrients but also serves as a substrate for fermentation in traditional food preparations (Şanlier et al., \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). During food fermentation, the microbial activity transforms the grain into a nutrient-rich product while enhancing its digestibility and sensory attributes. Among the predominant microorganisms involved in this process are LAB, which have garnered significant attention for their potential probiotic properties (S\u0026oslash;rensen et al., \u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The fermentation of sorghum supernatant, often practiced in various cultures, provides a promising avenue for isolating LAB strains with probiotic potential (Rapoo et al., \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). This process not only adds value to sorghum-based products but also offers a natural and affordable approach to improving health and nutrition, particularly in regions with limited access to commercial probiotics.\u003c/p\u003e \u003cp\u003eOne of the supernatants produced during the traditional fermentation of cereals is \u003cem\u003eomidun\u003c/em\u003e (a Yoruba term commonly used in Nigeria to refer to the supernatant of fermenting cereal grains). The most frequently used cereals for producing \u003cem\u003eomidun\u003c/em\u003e are maize, sorghum, and millet (Fafure et al., 2021; Yeo et al., \u003cspan citationid=\"CR85\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Remarkably, the fermentation process of cereals to produce \u003cem\u003eomidun\u003c/em\u003e fosters the proliferation of beneficial microorganisms like LAB known for their probiotic properties (Abdulssalam, 2024). These LAB strains enhance the nutritional profile of \u003cem\u003eomidun\u003c/em\u003e and offer potential health benefits, making it a valuable functional food component (Shibata et al., \u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). This nutrient-rich liquid consumed in Nigeria and other parts of West Africa is valued for its culinary versatility and potential health benefits. For instance, in northern Nigeria, tamarind is commonly added to the residue of fermented cereals, locally known as pap or akamu, to enhance its tangy flavour. As an alternative, \u003cem\u003eomidun\u003c/em\u003e is occasionally used to reconstitute the pap before it is prepared (Omeiza et al., \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Additionally, \u003cem\u003eomidun\u003c/em\u003e functions as a natural coagulant in the production of tofu, a soybean-based meat substitute referred to as Awara in Hausa (Afolayan et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Beyond Nigeria, similar uses of fermented sorghum supernatant are observed in other countries; for example, in Togo, \u003cem\u003eomidun\u003c/em\u003e is infused with fruits and herbs to create a medicinal beverage known as \u003cem\u003eAdoyo\u003c/em\u003e (Audu et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eLAB strains present a viable alternative to traditional probiotics, particularly in regions where sorghum is a dietary staple (Liu et al., \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Nevertheless, the probiotic efficacy of LAB is greatly influenced by key factors such as survival in the gastrointestinal tract (Ostergaard \u003cem\u003eet al.\u003c/em\u003e, 2014), acid and bile tolerance (Atta et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), temperature tolerance (Ren et al., \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e2017\u003c/span\u003e), antimicrobial activity (Belhadj \u003cem\u003eet al.\u003c/em\u003e, 2010), metabolic activity (Mamta et al., \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2017\u003c/span\u003e), genetic stability (Wang et al., \u003cspan citationid=\"CR82\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), their capacity to adhere to intestinal epithelial cells (Atta et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), as well as growth conditions such as the presence of nutrients, oxygen levels (anaerobic or microaerophilic), and optimal pH (Ghodbane et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2014\u003c/span\u003e).The supernatant of fermented grain slurry (commonly known as ogi) has been widely studied and is known for its numerous health benefits, including its traditional use as a solvent in preparing herbal remedies for malaria (Falana et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Audu et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2019\u003c/span\u003e ). Afolayan and Ayeni (2017) conducted an in-depth study on maize-derived \u003cem\u003eomidun\u003c/em\u003e, highlighting its high content of LAB, which have proven effectiveness in treating diarrhea. However, studies focusing on the isolation and characterization of LAB from sorghum-fermented supernatant (\u003cem\u003eomidun\u003c/em\u003e) are scarce, let alone the probiotic potential of these LAB strains. Therefore, this study aims to: 1) isolate, identify, and characterize LAB recovered from the supernatant of fermenting sorghum, 2) examine the antimicrobial susceptibility profiles of the isolated LAB, and 3) investigate the impact of varying fermentation periods (12, 24, 48, 72 and 96h) on the probiotic potential of the isolated LABs.\u003c/p\u003e"},{"header":"2.0 Materials and method","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Materials\u003c/h2\u003e \u003cp\u003eThe sorghum used in this study was purchased from the Tungah market in Minna, Niger state. The thermos and muslin cloth were purchased at Mushin Market in Lagos state. Antibiotics- Gentamicin (10 \u0026micro;g), ceftazidime (30 \u0026micro;g), cloxacillin (5 \u0026micro;g), erythromycin (5 \u0026micro;g), cefuroxime (30 \u0026micro;g), ofloxacin (5 \u0026micro;g), augmentin (30 \u0026micro;g), and ceftriaxone (30 \u0026micro;g), Mueller-Hinton agar (MHA), MacConkey agar (MCA), and de Man Rogosa and Sharpe (MRS) agar, colony counter (Gallenkamp, UK), Jena Bioscience Bacteria DNA Preparation Kit (Jena Bioscience GmbH, Germany), Jena Bioscience PCR Preparation Kit (Jena Bioscience GmbH, Germany), Microscope (JEM Jeol 1010, Ltd., Tokyo, Japan), Gram\u0026rsquo;s iodine solution, hydrogen peroxide, anaerobic vessel (BBL GasPak Anaerobic Systems), MRS broth (Oxoid CM0359), oxgall bile (sigma-Aldrich, steinheim,Germany), diluent (oxoid CM0733, pH 7), MRS Agar (oxoid CM0361).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Methods\u003c/h2\u003e \u003cdiv id=\"Sec5\" class=\"Section3\"\u003e \u003ch2\u003e2.2.1 Preparation of \u003cem\u003eOmidun\u003c/em\u003e\u003c/h2\u003e \u003cp\u003e \u003cem\u003eOmidun\u003c/em\u003e was prepared following the standard protocol outlined by Falana et al. (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). In summary, sorghum grains were first screened to remove debris, including stones, pebbles, and foreign seeds, and then thoroughly washed under running tap water. The cleaned grains were soaked in potable water at a 1:3 weight-to-volume ratio, covered, and left to ferment naturally at room temperature for 12, 24, 48, 72, and 96 hours, respectively. After fermentation, the water was decanted, transferred to a sterile mixing vessel, wet-milled, and strained using a clean muslin cloth. The filtrate was collected in a sterile container, while the residue was discarded. The filtrate was then allowed to undergo additional fermentation and settling. The resulting supernatants were carefully collected into sterile vacuum flasks, labelled and transported in iceboxes to the Department of Molecular Biology and Biotechnology at the Nigerian Institute of Medical Research, Yaba, Lagos, for analysis. A flowchart illustrating the process of producing the sorghum fermentation supernatant is presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section3\"\u003e \u003ch2\u003e2.2.2 Isolation and enumeration of LAB from \u003cem\u003eOmidun\u003c/em\u003e\u003c/h2\u003e \u003cp\u003eThis study adopted the bacterial isolation and enumeration method outlined by Ajala et al. (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2024\u003c/span\u003e), with several modifications. In brief, one milliliter (1 mL) of each \u003cem\u003eomidun\u003c/em\u003e sample was subjected to ten-fold serial dilution in 9 mL of peptone water under sterile conditions. Aliquots of 0.1 mL from dilutions ranging from 10⁻\u0026sup3; to 10⁻⁵ were inoculated onto three pre-prepared selective media: Mueller-Hinton agar (MHA), MacConkey agar (MCA), and de ManRogosa and Sharpe (MRS) agar, using the pour plate method. The inoculated plates were incubated anaerobically at 37\u0026deg;C for 48 hours using an anaerobic vessel (BBL GasPak Anaerobic Systems). Afterwards, the bacterial colonies were examined and counted using a colony counter (Gallenkamp, UK). The total and mean bacterial loads were calculated and expressed in colony-forming units per gram of sample (CFU/ml) using Eq.\u0026nbsp;\u003cspan refid=\"Equ1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003cdiv id=\"Equ1\" class=\"Equation\"\u003e\u003cdiv format=\"TEX\" class=\"mathdisplay\" id=\"FileID_Equ1\" name=\"EquationSource\"\u003e\n$$\\:CFU/ml=\\frac{Number\\:of\\:colonies\\:\\times\\:reciprocal\\:of\\:the\\:dilution\\:factor}{Plating\\:volume\\:\\left(0.1\\:mL\\right)}$$\u003c/div\u003e\u003cdiv class=\"EquationNumber\"\u003e1\u003c/div\u003e\u003c/div\u003e\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section3\"\u003e \u003ch2\u003e2.2.3 Morphological and biochemical characterization of bacterial isolates\u003c/h2\u003e \u003cp\u003eFollowing incubation, individual colonies were streaked repeatedly on MRS agar and incubated at 37\u0026deg;C for 24 hours to obtain pure isolates. The obtained pure isolates were sub-cultured on MRS agar, where they were identified based on their morphological and biochemical characteristics as outlined in Bergey's Manual (Nair and Surendran, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). The bacterial isolates\u0026rsquo; colony morphology was assessed based on their colour, shape, size, surface texture (Ajala et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Ogunoye et al., \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Furthermore, the cell morphology was observed under a microscope (JEM Jeol 1010, Ltd., Tokyo, Japan).\u003c/p\u003e \u003cp\u003eOxidase activity was assessed by smearing isolates onto oxidase test strips using a sterile loop, with a colour change indicating a positive reaction. A catalase test was conducted to evaluate the catalase response of the isolates. Overnight cultures of the isolates were grown anaerobically on MRS agar at 37\u0026deg;C for 24 hours. The test involved placing two drops of 3% hydrogen peroxide onto 24-hour-old cultures on glass slides, and the reaction was observed for the presence of bubbles, indicating catalase activity. The release of oxygen bubbles during the reaction was a key indicator of catalase activity. For Gram staining, isolates were swabbed onto clean, oil-free glass slides and heat-fixed. The smears were initially stained with crystal violet for one minute, followed by gentle rinsing with running tap water. Next, the slides were treated with diluted Gram\u0026rsquo;s iodine solution, rinsed again, and decolorised with 95% alcohol for 10 to 20 seconds until the blue colour ceased to run. Safranin was then applied as a counterstain for one minute. After staining, the slides were rinsed gently with tap water, air-dried, and examined under an oil immersion microscope. The cytomorphological features, including cell shape and arrangement, were carefully observed, following the method described by Heil (\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). For further characterization, colonies were sub-cultured on MRS slants and stored at 4\u0026deg;C.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section3\"\u003e \u003ch2\u003e\u003cb\u003e2.2.4 Molecular characterization of bacterial isolates\u003c/b\u003e\u003c/h2\u003e \u003cp\u003eIn order to ensure accurate identification of bacterial isolates, molecular identification was performed at the Nigerian Institute for Medical Research, Yaba, Lagos. This technique analyzes the genetic material of the bacteria, offering precise and definitive identification, particularly when traditional methods like morphological and biochemical tests are insufficient or inconclusive. Briefly, pure cultures of potential probiotic bacteria were grown to the log phase, and genomic Deoxyribonucleic Acid (DNA) was extracted from the bacterial biomass according to the method outlined by Bazzicalupo and Fani (1995). DNA extraction was carried out using the Jena Bioscience Bacteria DNA Preparation Kit (Jena Bioscience GmbH, Germany) following the manufacturer's guidelines. After DNA extraction, Polymerase Chain Reaction (PCR) was performed to amplify the target DNA fragment within the bacteria, utilizing the primer pair BSF-8 (AGAGTTTGATCCTGGCTCAG) and BSR-534 (ATTACCGCGGCTGGC) as described by Pandey et al. (\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). These primers produced an amplified size of 526 bp in all lactobacilli and all amplified PCR products (526 bp) were purified using the Jena Bioscience PCR Purification Kit. Sanger sequencing of the 16S rRNA gene was performed at Epoch Life Science (USA). Corresponding sequences were identified using an online BLAST search at \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp.//blast.ncbi.nlm.nih.gov/Blast.cgi\u003c/span\u003e\u003cspan address=\"http.//blast.ncbi.nlm.nih.gov/Blast.cgi\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. The sequenced data were submitted to the GenBank and subsequently assigned a GenBank accession number.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section3\"\u003e \u003ch2\u003e2.2.5 Antibiotic resistance pattern of bacterial isolates\u003c/h2\u003e \u003cp\u003eAntibiotic resistance patterns of the bacterial isolates were assessed using the disk diffusion method, as described by Zhang et al. (\u003cspan citationid=\"CR86\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). The resistance or sensitivity of the isolates to various antibiotics, including gentamicin (10 \u0026micro;g), ceftazidime (30 \u0026micro;g), cloxacillin (5 \u0026micro;g), erythromycin (5 \u0026micro;g), cefuroxime (30 \u0026micro;g), ofloxacin (5 \u0026micro;g), augmentin (30 \u0026micro;g), and ceftriaxone (30 \u0026micro;g), was determined by measuring the inhibition zone diameters. These measurements were interpreted according to the 2014 Clinical Laboratory Standards Institute (CLSI) guidelines. For the assay, 100 \u0026micro;l of actively growing cultures of acid-bile-tolerant and lactate-antagonist bacteria were evenly spread onto the surface of Mueller-Hinton agar plates using sterile cotton swabs. After the plates were dried, antibiotic discs were placed on the agar surface and left at 4\u0026deg;C for 30 minutes to allow diffusion. The plates were then incubated anaerobically at 37\u0026deg;C for 24\u0026ndash;48 hours. Resistance was evaluated based on the inhibition zone diameter, with sensitivity defined as zones\u0026thinsp;\u0026ge;\u0026thinsp;21 mm and resistance as zones\u0026thinsp;\u0026le;\u0026thinsp;15 mm. Measurements were taken using calipers to ensure accuracy.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section3\"\u003e \u003ch2\u003e2.2.6 Impacts of fermentation periods on the probiotic traits of LABs recovered from fermented sorghum supernatant\u003c/h2\u003e \u003cp\u003eThe tolerance of the isolated LAB to acidic conditions, bile salts and sensitivity to temperature was assessed using standardized protocols from ICRISAT. Bile salt tolerance was tested in MRS broth (Oxoid CM0359) supplemented with 0.3% (w/v) oxgall bile (Sigma-Aldrich, Steinheim, Germany). LAB cell suspensions (approximately 10\u003csup\u003e7\u003c/sup\u003e CFU/ml), cultured for 18 hours, were added to bile-free MRS broth (pH 7) and MRS broth containing 0.3 and 0.6% (w/v) bile. The mixtures were incubated at 37\u0026deg;C, and samples were collected at 0 and 3 hours. These samples were serially diluted to 10-fold in diluent (Oxoid CM0733, pH 7) and plated in duplicate on MRS agar (Oxoid CM0361). Thereafter, the plates were incubated anaerobically at 37\u0026deg;C for 48 hours using the GasPak system (BBL Microbiology Systems, Cockeysville, Md.). The temperature and acid tolerance of LAB isolates were assessed by inoculating overnight bacterial cultures into MRS broth, adjusting the pH to 2.5 and 4.0 with 0.1 M HCl, and incubating at 37\u0026deg;C for 3 hours. After incubation, samples were plated on MRS agar to evaluate bacterial survival. After the incubation period, viable bacterial colonies were then counted, and LAB numbers were calculated in accordance with ISO 15214 (1998). Viability was expressed as the percentage of LAB colonies grown on MRS agar relative to the initial bacterial concentration using Eq.\u0026nbsp;\u003cspan refid=\"Equ2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003cdiv id=\"Equ2\" class=\"Equation\"\u003e\u003cdiv format=\"TEX\" class=\"mathdisplay\" id=\"FileID_Equ2\" name=\"EquationSource\"\u003e\n$$\\:Bacterial\\:survival\\:rate\\:\\left(\\%\\right)=\\frac{loglog\\:CFUN1\\:}{loglog\\:CFUNo\\:\\:}\\:\\times\\:100$$\u003c/div\u003e\u003cdiv class=\"EquationNumber\"\u003e2\u003c/div\u003e\u003c/div\u003e\u003c/p\u003e \u003cp\u003eCFU: Colony forming unit\u003c/p\u003e \u003cp\u003eN\u003csub\u003e1\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;Total bacterial number after 3h in stimulated intestinal juice\u003c/p\u003e \u003cp\u003eN\u003csub\u003e0\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;Total bacterial number after 0h in stimulated intestinal juice\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Statistical analysis\u003c/h2\u003e \u003cp\u003eThe raw data for total bacterial load was processed in Microsoft Excel to calculate the mean and subsequently converted to CFU/ml using Eq.\u0026nbsp;\u003cspan refid=\"Equ1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003c/div\u003e"},{"header":"3.0 Results and discussion","content":"\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e3.1 Total Bacteria Count\u003c/h2\u003e \u003cp\u003eTotal bacteria count (TBC) is a microbiological method used to estimate the total number of viable bacteria in a given sample, such as food, water, or other biological materials. Expressed in colony-forming units per milliliter (CFU/ml) or gram (CFU/g), TBC provides an overall indication of microbial load, which is essential for assessing sample quality, safety, and hygiene (Sutarlie, 2023). In this study, the TBC of fermented sorghum supernatant was evaluated on three agar media: Mueller-Hinton Agar (MHA), MacConkey Agar (MCA), and De Man, Rogosa, and Sharpe Agar (MRS). The mean bacterial counts, expressed in CFU/mL, indicated that MHA recorded the highest values, ranging from 2.88 \u0026times; 10\u003csup\u003e\u0026minus;\u0026thinsp;3\u003c/sup\u003e to 4.1 \u0026times; 10\u003csup\u003e\u0026minus;\u0026thinsp;3\u003c/sup\u003e, followed by MRS agar with counts varying from 2.78 \u0026times; 10\u003csup\u003e\u0026minus;\u003c/sup\u003e\u0026sup3; to 3.50 \u0026times; 10\u003csup\u003e\u0026minus;\u003c/sup\u003e\u0026sup3;, while MCA showed the lowest bacterial counts, ranging from 0.00 to 1.00 \u0026times; 10\u003csup\u003e\u0026minus;\u003c/sup\u003e⁴. MHA agar exhibited the highest bacterial count likely due to its non-selective and non-differential nature, which allows it to support the growth of a wide range of organisms (Yang and Wei, \u003cspan citationid=\"CR84\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In contrast, MCA and MRS are selective and specialized media designed for specific purposes. MCA selectively isolates Gram-negative (Zhu et al., \u003cspan citationid=\"CR88\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) and enteric bacteria (Hernandez-Raquet et al., 2020), typically found in the gut, while MRS supports the growth of LAB (Willis et al., \u003cspan citationid=\"CR83\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). This result is in line with the findings of Seyed et al. (2022) which reports that MRS agar gives good colony counts for lactobacilli and for other lactic acid bacteria.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e3.2 Identification of LABs isolated from sorghum supernatant.\u003c/h2\u003e \u003cp\u003eThe morphological and biochemical characterization of LAB isolates is a critical step in identifying strains with probiotic potential. Morphological evaluation typically reveals the shape, Gram reaction, and colony characteristics, which help differentiate LAB from other bacterial groups (Zhang et al., \u003cspan citationid=\"CR87\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). In the identification study, we used both morphological and biochemical techniques. The morphological characteristics of LAB isolates from sorghum supernatant (\u003cem\u003eomidun\u003c/em\u003e) revealed predominantly bacillary morphology across all isolates except for the isolate from OMDN1, which exhibited a coccus morphology. Bacterial strains from OMDN 2, 3, 4, 5, 6, and 7 were identified as Gram-positive. Biochemical tests, including oxidase and catalase assays, further confirmed the LAB identity, as all isolates tested negative for these enzymes. As confirmed by Teame et al. (\u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), biochemical tests, such as oxidase and catalase assays, are essential for confirming the identity of LAB. The negative results for oxidase and catalase in all isolates align with the characteristic traits of LAB, as they are anaerobic or facultatively anaerobic organisms that do not rely on oxidative respiration (A. Linares-Pasten, 2018). The absence of catalase activity reflects the inability of LAB to produce the catalase enzyme, which breaks down hydrogen peroxide, a by-product of aerobic metabolism (Morgan et al., \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). These findings support the classification of the isolates as LAB and highlight their metabolic suitability for fermentation processes, where oxygen tolerance is minimal, and anaerobic pathways dominate. Such traits underline their probiotic potential and highlight the importance of further testing, such as acid and bile tolerance, for their functional validation.\u003c/p\u003e \u003cp\u003eGiven the complex and dynamic taxonomic history of bacteria, conventional identification methods should be supplemented with molecular techniques to ensure accurate and reliable identification (Nordberg et al., 2018). The molecular analysis of the bacteria isolates recovered from the \u003cem\u003eomidun\u003c/em\u003e based on 16s rDNA gene showed five new bacterial strains, including \u003cem\u003eL. plantarum\u003c/em\u003e, \u003cem\u003eLimosilactobacillus fermentum\u003c/em\u003e, \u003cem\u003eLactobacillus brevis\u003c/em\u003e, \u003cem\u003eBurkholderia cepacia\u003c/em\u003e, and \u003cem\u003eLactobacillus\u003c/em\u003e sp (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). However, recombination and mutation have been identified as some of the key drivers of genetic diversity in bacterial species (Santiago et al., \u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). The molecular analysis also showed that most of the examine bacterial species from the fermented sorghum supernatant were closely related to their GenBank relatives. Identification of potential probiotic LABs by 16S rRNA has been described as a highly reliable method by multiple authors, including Kostinek et al. (\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2005\u003c/span\u003e) and Oguntoyinbo and Narbad (\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). More importantly, molecular techniques, especially polymerase chain reaction (PCR)-based methods, are important for the specific characterization of LAB strains (Mohania et al., \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Adiguzel and Atasever \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Lawalata et al., \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Many strains of these LABs have been described by many authors as probiotic bacteria and have been used in the manufacture of probiotic preparations for animal and human health benefits (Sanders et al., \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePercentage identity and accession numbers of LAB strains recovered from \u003cem\u003eomidun\u003c/em\u003e\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOrganism Identified\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePercentage Identity (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAccession Number\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eBurkholderia cepacia\u003c/em\u003e (24h)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e95.18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMG871245.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eLactobacillus plantarum\u003c/em\u003e (72h)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e98.24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAB601179.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eLactobacillus sp.\u003c/em\u003e(72h)\u003c/p\u003e \u003cp\u003e\u003cem\u003eLimosilactobacillusfermentum\u003c/em\u003e (96h)\u003c/p\u003e \u003cp\u003e\u003cem\u003eLactobacillus brevis\u003c/em\u003e (96h)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e98.45\u003c/p\u003e \u003cp\u003e98.28\u003c/p\u003e \u003cp\u003e94.15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMH685412.1\u003c/p\u003e \u003cp\u003eON117011.1\u003c/p\u003e \u003cp\u003eEU231605.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003e3.3 Effects of fermentation period on the antimicrobial susceptibility pattern of LAB isolated from fermented sorghum supernatant\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTable\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e2\u003c/span\u003e shows the effects of fermentation period on the antimicrobial susceptibility pattern of LAB isolated from fermented sorghum supernatant. One of the parameters that determines the safety of probiotic strains is their antibiotic resistance profile and the lack of genes responsible for antibiotic resistance (Markowiak and Slizewska, 2017). In food, antibiotic-resistant LABs pose a risk factor to consumer health as they can transfer antibiotic resistance genes to opportunistic human pathogens and cause complications to patient antibiotic treatment (Magiorakos et al., \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). To prevent such adverse effects, it is essential to control all stages of the food production flow and eliminate lactobacilli, a source of genetic material that can induce resistance traits. These precautions can suppress the development of resistant pathogenic and multidrug-resistant strains (Guan et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Zhang et al., \u003cspan citationid=\"CR86\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). In this study, multidrug resistance was observed in most bacterial isolates, with isolates from OMDN 4 and 5 showing the highest resistance to multiple drug classes of all isolates. They were resistant to all eight antibiotics used in this study. This has been found to be a great property of probiotics as they are 100% effective even in the presence of antibiotics as they cannot be killed by antibiotics. Many probiotics have natural resistance to certain antibiotics. For example, \u003cem\u003eLactobacillus\u003c/em\u003e spp. are often resistant to vancomycin due to intrinsic mechanisms that do not spread to other bacteria (Hovart et al, 2021). This may reduce the possibility of OMDN 1\u0026ndash;3 as potential probiotics as they are only resistant to a few antibiotics. In a previous study by Kumar et al. (\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2017\u003c/span\u003e), LABs were isolated from ogi and screened for antimicrobial activity against pathogens such as \u003cem\u003eStaphylococcus aureus\u003c/em\u003e, \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e, \u003cem\u003eCandida albicans\u003c/em\u003e etc., the LAB showed inhibitory activity against majority of the pathogens.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eEffects of fermentation periods on the antimicrobial susceptibility pattern of LABs\u0026rsquo; sorghum supernatant\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBacterial isolate\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAntimicrobials resisted by most isolates\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOMDN1 (12h)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAZ, CRX\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOMDN2 (24h)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAX, CXC, OFL, AUG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOMDN3 (48h)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAZ, ERY, CXC, OFL, AUG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOMDN4 (72h)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAZ, CRX, GEN, CTR, ERY, CXC, OFL, AUG (all antibiotics)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOMDN5 (72h)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAZ, CRX, GEN, CTR, ERY, CXC, OFL, AUG (all antibiotics)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOMDN6 (96h)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAZ, CRX, GEN, CTR, ERY, CXC, OFL, AUG (all antibiotics)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOMDN7(96h)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAZ, CRX, GEN, CTR, ERY, CXC, OFL, AUG (all antibiotics)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"2\"\u003eGEN: gentamicin; CAZ: ceftazidime; CXC: cloxacillin; ERY: erythromycin; CRX: cefuroxime; OFL: ofloxacin; AUG: augmentin; and CTR: ceftriaxone\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003e3.4 Effects of fermentation periods on temperature sensitivity, acid and bile salts tolerance of LAB recovered from fermented sorghum supernatant.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eFermentation periods significantly influenced the temperature sensitivity, acid tolerance, and the bile salt tolerance of LABs recovered from sorghum supernatant.\u003c/p\u003e \u003cdiv id=\"Sec15\" class=\"Section3\"\u003e \u003ch2\u003e3.4.1 Effects of fermentation period on temperature sensitivity of LABs recovered from sorghum supernatant\u003c/h2\u003e \u003cp\u003eFermentation periods have been confirmed to greatly influence the temperature sensitivity of LABs (Sionek et al., \u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Liu et al., \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e2\u003c/span\u003e shows the effect of fermentation period on the temperature sensitivity of lactic acid bacteria isolates from the supernatant of fermenting sorghum (\u003cem\u003eomidun\u003c/em\u003e). The temperatures were adjusted to 25 \u003csup\u003eo\u003c/sup\u003e C, 37 \u003csup\u003eo\u003c/sup\u003e C and 40 \u003csup\u003eo\u003c/sup\u003eC and monitored for 3 hours. All strains grew at 40\u0026deg;C between 0 to 3 hours of incubation. This is in line with Ibourahema et al. 2012, who reported that the ability of the bacteria to grow at elevated temperatures is an excellent trait as it can be interpreted to indicate increased growth rates and lactic acid production. Furthermore, higher fermentation temperatures reduce contamination with other microorganisms (Ibourahema et al., 2012). The optimum growth temperature for probiotics in the stomach is 30\u0026ndash;40 \u003csup\u003eo\u003c/sup\u003eC. This explains why one of the LABs from OMDN 4 recorded no growth at 25 \u003csup\u003eo\u003c/sup\u003eC and only showed growth at 37 \u003csup\u003eo\u003c/sup\u003eC, after 3hrs of incubation. Other strains grew across all the temperatures.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eEffect of fermentation periods on the temperature sensitivity of LAB recovered from fermented sorghum supernatant\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTemperature\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e25 \u003csup\u003e0\u003c/sup\u003e C\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003e37\u003csup\u003e0\u003c/sup\u003eC\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e \u003cp\u003e40\u003csup\u003e0\u003c/sup\u003eC\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIncubation Period\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e3h\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBacterial Strains\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOMDN1(12h)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOMDN2(24h)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOMDN3(48h)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOMDN4(72h)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOMDN5(72h)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOMDN6(96h)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOMDN7(96h)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"7\"\u003eSymbols: +, Tolerant; -, Non-Tolerant\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003e3.4.2 Effects of fermentation periods on the acid tolerance (pH) of LABs recovered from fermented sorghum supernatant\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe fermentation periods have been documented to significantly impact the acid tolerance (pH) of LABs (Fonseca et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Kim et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Extended fermentation periods often enhance LAB growth due to the accumulation of favorable metabolites like lactic acid, which create a competitive environment against non-LAB microorganisms (Jung et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). However, excessively long fermentation may lead to nutrient depletion, reducing LAB viability (Selvaraj and Gurumurthy, \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Taye et al., \u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Shobharani and Halami, \u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Similarly, acid tolerance is a crucial probiotic trait of LAB, allowing them to survive and remain active in low-pH environments such as fermented foods (Guan and Liu, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) and the gastrointestinal tract (Ansari and Yamaoka, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Broadbent et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Hence, the interplay between fermentation time and acid tolerance ensures the selection of robust LAB strains with desirable probiotic characteristics. Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e3\u003c/span\u003e highlights the effect of fermentation period and acid tolerance (pH) of sorghum supernatant compared to the control. The pH was adjusted to 2.5 and 4.0 and monitored for 3 hours. All isolates maintained high viability after 3 hours. According to Bakari et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2011\u003c/span\u003e, probiotic bacteria must survive through the stomach, where the pH can be as low as 1.5 to 2.0 and stay viable for 4 h before they enter the intestinal tract. This is consistent with Siragusa \u003cem\u003eet al\u003c/em\u003e., 2024, who reported that \u003cem\u003eLb. fermentum\u003c/em\u003e viability measured at pH 4.0 and 3.0 indicated strains that were most resistant to changes in pH values.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eEffects of fermentation periods on the acid tolerance (pH) of LABs recovered from fermented sorghum supernatant\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIncubation time\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e0h\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003e3h\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4.0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBacterial Isolate\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOMDN1(12h)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e103\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOMDN2(24h)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e63\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e103\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOMDN3(48h)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e63\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e102\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOMDN4(72h)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOMDN5(72h)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e102\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e102\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOMDN6(96h)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e102\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e104\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e103\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOMDN7(96h)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e102\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e103\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eControl\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003e3.4.3 Effects of fermentation period on the bile salt tolerance of LABs recovered from fermented sorghum supernatant\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe fermentation period significantly influences the bile acid tolerance of LAB. Prolonged fermentation often enhances the resilience of LAB by allowing them to adapt to environmental stresses, including bile salts (Chen et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). During this period, LAB may upregulate genes responsible for bile salt hydrolase (BSH) activity and strengthen their cell membranes, improving their ability to withstand bile salt concentrations (Swain et al., \u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The effect of fermentation duration on the bile acid tolerance of LAB isolates recovered from sorghum supernatant is presented in Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e4\u003c/span\u003e. The isolates were observed to grow at concentrations of 0.3 and 0.6%. All isolates grew at 0 h at the above bile concentrations. However, after 3 hours, none of the isolates from OMDN 1\u0026ndash;3 survived. This disqualifies them as potential probiotics. Bile salts secreted in the small intestine reduce bacterial survival by affecting lipid- and fatty acid-based cell membranes, and these modifications affect not only cell permeability and viability, but also membrane and environment interaction (Papizadeh, 2017). Therefore, before probiotics can benefit human health, several criteria must be met, including the ability to tolerate acid and bile salts, and to grow in the lower intestinal tract (Shah, \u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e2000\u003c/span\u003e). A previous study by Meljlholm and Dalgaard (2015), reported that small intestinal transit resistance of bile salt-tolerant lactobacilli was strain-dependent. The majority of the strains were inherently resistant to simulated pancreatic juice and showed no reduction in viability for up to 4 hrs.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eEffect of fermentation period on the bile acid tolerance of LABs recovered from fermented sorghum supernatant\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIncubation time\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e0h\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003e3h\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBile acid concentration\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.3%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.6%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.3%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.6%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBacterial Isolate\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOMDN1(12h)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOMDN2(24h)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e96\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOMDN3(48h)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e96\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOMDN4(72h)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e85\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOMDN5(72h)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e85\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e85\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOMDN6(96h)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e78\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e80\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOMDN7(96h)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e95\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e96\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eControl\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e3.5 Conclusion\u003c/h2\u003e \u003cp\u003eEvaluating the probiotic potential of LAB isolated from fermented sorghum supernatant under different fermentation conditions highlights the adaptability and functional capabilities of these strains. The study demonstrates that fermentation conditions, such as duration and environmental factors, significantly influence the growth, acid tolerance, and bile salt resistance of LAB. Isolates from OMD 4 and 5 displayed all the characteristics of potential probiotics and proved to be \u003cem\u003eLactobacillus plantarum, Lactobacillus sp., Limosilactobacillus fermentum, and Lactobacillus brevis\u003c/em\u003e, respectively. This study also showed that fermentation time affects the type of predominant probiotic strain found in fermented products. The survival and proliferation of the LAB strains were proven to withstand the \u0026lsquo;harsh\u0026rsquo; conditions of the stomach, being able to compete exclusively with enteric pathogens. Fermented foods are the most natural source of probiotics, while over-the-counter probiotic supplements are typically prescribed by doctors for specific medical conditions. Unlike natural sources, these supplements are not generally intended for daily consumption. The detection of \u003cem\u003eBurkholderia cepacia\u003c/em\u003e after 24hs of incubation suggests that fermentation under 24hs is not safe for consumption. Hence proper fermentation must take at least 72hs to be considered safe for consumption. Burkholderia cepacia is a plant probiotic but has also been reported to be pathogenic to humans. Infection with these bacteria is associated with high mortality rate and may spread from one patient to another. All other bacterial isolates were probiotic. These findings suggest that sorghum supernatant serves as a viable source of probiotic LAB with potential applications in functional food development.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e3.6 Recommendations\u003c/h2\u003e \u003cp\u003eThe quality of a product is highly affected by the quality of raw materials since high quality probiotic products require high quality probiotic raw materials. As a result, sorghum-based \u003cem\u003eomidun\u003c/em\u003e is recommended for more frequent consumption compared to corn-based \u003cem\u003eomidun\u003c/em\u003e. Additionally, considering the challenges of reduced probiotic viability in supplements due to factors like storage, handling, packaging, and distribution, \u003cem\u003eomidun\u003c/em\u003e emerges as a more reliable and preferable option.\u003c/p\u003e\n\u003col start=\"1\" type=\"i\" style=\"list-style-type: lower-roman;\"\u003e\n \u003cli\u003eFurther studies, accompanied by more clinical trials, should be carried out, to broaden or diversify the use of sorghum \u003cem\u003eomidun.\u003c/em\u003e\u003c/li\u003e\n \u003cli\u003eJust like \u003cem\u003eomidun\u003c/em\u003e made from corn, sorghum \u003cem\u003eomidun\u003c/em\u003e, infused with fruits should be taken as fermented beverages, as a cost-effective alternative, which will offer the pleasure of improved flavoured drinks with organoleptic changes.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eThe technology of controlled fermentation should be employed, to reduce the pungent smell of the fermented product.\u003c/li\u003e\n \u003cli\u003eProper enlightenment of the public on the health and nutritional benefits of consuming \u003cem\u003eomidun\u003c/em\u003e should be done as this will enhance its acceptability.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eFurther research is recommended to validate these strains\u0026apos; in vivo probiotic effects and explore their role in promoting gut health.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eLinares-Pasten A, Aronsson J, A., Nordberg Karlsson E (2018) Structural considerations on the use of endo-xylanases for the production of prebiotic xylooligosaccharides from biomass. Curr Protein Pept Sci 19(1):48\u0026ndash;67\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbdulsasalam Sulaiman (2024) Lactic acid bacteria and fermented maize supernatant (Omidun) have anti-biofilm properties against staphylococci and enteroaggregative Escherichia coli strains. FUDMA J Sci. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.33003/fjs-2023-0706-2134\u003c/span\u003e\u003cspan address=\"10.33003/fjs-2023-0706-2134\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAdiguzel G, Atasever M (2009) Phenotypic and genotypic characterization of lactic acid bacteria isolated from Turkish dry fermented sausage. Romanian Biotechnol Lett, 14(1)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAfolayan AO, Ayeni FA, Ruppitsch W (2017) Antagonistic and quantitative assessment of indigenous lactic acid bacteria in different varieties of ogi against gastrointestinal pathogens. Pan Afr Med J, 27\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAjala O, Adelusi OA, Kajihausa OE, Onabanjo OO, Oyewole OB, Obadina AO (2024) Effect of storage temperature and time on the microbial quality and sensory properties of extrudates produced from pearl millet (Pennisetum glaucum (L) Leake) and Bambara groundnut (Vigna subterranea) flour blends. J Stored Prod Res 109:102442\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAnsari S, Yamaoka Y (2017) Survival of Helicobacter pylori in gastric acidic territory. Helicobacter, 22(4), e12386\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAnumudu CK, Miri T, Onyeaka H (2024) Multifunctional Applications of Lactic Acid Bacteria: Enhancing Safety, Quality, and Nutritional Value in Foods and Fermented Beverages. Foods 13(23):3714\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAtta HI, Gimba A, Bamgbose T (2020) Antimicrobial activity of lactic acid bacteria isolated from garri on Escherichia coli strains isolated from clinical and environmental samples. Agricultural Sci Technol 12(4):357\u0026ndash;363\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAudu HJ, Abiodun OA, Ayeni FA (2019) Beneficial effects of a fermented maize product with its supernatant, Lactobacillus fermentum and Lactobacillus brevis in rat model of colitis. North Afr J Food Nutr Res 3(6):195\u0026ndash;200\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAwika JM (2017) Sorghum: Its unique nutritional and health-promoting attributes. Gluten-free ancient grains. Woodhead publishing, pp 21\u0026ndash;54\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBakari D, Leopold TN, Augustin M, Moses MC (2011) Assessment of physiological properties of some lactic acid bacteria isolated from the intestine of chickens use as probiotics and antimicrobial agents against enteropathogenic bacteria. Innovative Romanian Food Biotechnol, (8), 33\u0026ndash;40\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBazzicalupo M, Fani R (1996) The use of RAPD for generating specific DNA probes for microorganisms. PCR and other nucleic acid methods, Species diagnostics protocols, pp 155\u0026ndash;175\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBelhadj H, Harzallah D, Khennouf S, Dahamna S, Bouharati S, Baghiani A (2009) Isolation, identification and antimicrobial activity of lactic acid bacteria from Algerian honeybee collected pollen. In XIII International Conference on Medicinal and Aromatic Plants 854 (pp. 51\u0026ndash;58)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBroadbent JR, Larsen RL, Deibel V, Steele JL (2010) Physiological and transcriptional response of Lactobacillus casei ATCC 334 to acid stress. J Bacteriol 192(9):2445\u0026ndash;2458\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCastellone V, Bancalari E, Rubert J, Gatti M, Neviani E, Bottari B (2021) Eating fermented: Health benefits of LAB-fermented foods. Foods 10(11):2639\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen Z, Leng X, Zhou F, Shen W, Zhang H, Yu, Qin M (2023) Screening and identification of probiotic lactobacilli from the infant gut microbiota to alleviate lead toxicity. Probiotics Antimicrob proteins 15(4):821\u0026ndash;831\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDas A, Chauhan G, Agrawal RK, Das AK, Tomar S, Uddin S, Lorenzo JM (2021) Characterization of crude extract prepared from Indian curd and its potential as a biopreservative. Food Sci Technol Int 27(4):313\u0026ndash;325\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEndo A, Tanizawa Y, Arita M (2019) Isolation and identification of lactic acid bacteria from environmental samples. Lactic Acid Bacteria: Methods Protocols, 3\u0026ndash;13\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFafure AV, Bem DB, Kahuthu SW, Adediran AA, Bodunrin MO, Fabuyide AA, Ajanaku C (2024) Advances in Silicon-Carbon Composites Anodes Derived from Agro wastes for Applications in Lithium-ion battery: a review. Heliyon\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFalana MB, Bankole MO, Omemu AM (2016) Comparative antimicrobial potentials of omidun obtained from yellow and white maize varieties on some diarrhoea causing microorganisms. Afr J Microbiol Res 10(27):1018\u0026ndash;1023\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFlores Llovera M, Toldr\u0026aacute; Vilardell F (2020) Chemistry, safety, and regulatory considerations in the use of nitrite and nitrate from natural origin in meat products\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFonseca HC, de Sousa Melo D, Ramos CL, Dias DR, Schwan RF (2021) Probiotic properties of lactobacilli and their ability to inhibit the adhesion of enteropathogenic bacteria to Caco-2 and HT-29 cells. Probiotics Antimicrob proteins 13:102\u0026ndash;112\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFontana L, Bermudez-Brito M, Plaza-Diaz J, Munoz-Quezada S, Gil A (2013) Sources, isolation, characterisation and evaluation of probiotics. Br J Nutr 109(S2):S35\u0026ndash;S50\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGhodbane R, Raoult D, Drancourt M (2014) Dramatic reduction of culture time of Mycobacterium tuberculosis. Sci Rep 4:4236. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/srep04236\u003c/span\u003e\u003cspan address=\"10.1038/srep04236\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGranato D, Carocho M, Barros L, Zabetakis I, Mocan A, Tsoupras A, Pimentel TC (2022) Implementation of Sustainable Development Goals in the dairy sector: Perspectives on the use of agro-industrial side-streams to design functional foods. Trends Food Sci Technol 124:128\u0026ndash;139\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuan N, Liu L (2020) Microbial response to acid stress: mechanisms and applications. Appl Microbiol Biotechnol 104(1):51\u0026ndash;65\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuan Q, Xiong T, Xie M (2021) Influence of probiotic fermented fruit and vegetables on human health and the related industrial development trend. Engineering 7(2):212\u0026ndash;218\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHeil N (2009) National Wild Fish Health Survey-Laboratory Procedures Manual. US Fish and Wildlife Service. Warm Springs, Georgia, USA\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHorvat IB, Gobin I, Kresović A, Hauser G (2021) How can probiotic improve irritable bowel syndrome symptoms? World J Gastrointest Surg 13(9):923\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIbourahema C, Dauphin RD, Jacqueline D, Thonart P (2008) Characterization of lactic acid bacteria isolated from poultry farms in Senegal. Afr J Biotechnol, 7(12)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eImade EE, Omonigho SE, Babalola OO, Enagbonma BJ (2021) Lactic acid bacterial bacteriocins and their bioactive properties against food-associated antibiotic-resistant bacteria. Ann Microbiol 71:1\u0026ndash;14\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eInternational Organization for Standardization ISO 15214 (1998) Microbiology of food and animal feeding stuffs-horizontal method for the enumeration of mesophilic lactic acid bacteria-colony count technique at 30 OC\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJenfa MD, Adelusi OA, Aderinoye A, Coker OJ, Martins IE, Oyewole OB, Njobeh PB, Obadina OA (2024a) Evaluation of the physicochemical, nutritional, textural, and sensory characteristics of extrudates from sorghum and orange-fleshed sweet potato flour blends. Journal of Food Processing and Preservation, 2024(1), p.2930130\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJenfa MD, Adelusi OA, Aderinoye A, Coker OJ, Martins IE, Obadina OA (2024b) Physicochemical compositions, nutritional and functional properties, and color qualities of sorghum\u0026ndash;orange-fleshed sweet potato composite flour. Food Sci Nutr 12(4):2364\u0026ndash;2378\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJung JY, Han SS, Kim ZH, Kim MH, Kang HK, Jin HM, Lee MH (2021) In-vitro characterization of growth inhibition against the gut pathogen of potentially probiotic lactic acid bacteria strains isolated from fermented products. Microorganisms 9(10):2141\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim JA, Bayo J, Cha J, Choi YJ, Jung MY, Kim DH, Kim Y (2019) Investigating the probiotic characteristics of four microbial strains with potential application in feed industry. PLoS ONE, 14(6), e0218922\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKostinek M, Pukall R, Rooney AP, Schillinger U, Hertel C, Holzapfel WH, Franz CM (2005) Lactobacillus arizonensis is a later heterotypic synonym of Lactobacillus plantarum. Int J Syst Evol MicroBiol 55(6):2485\u0026ndash;2489\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumar CS, Reddy KK, Boobalan G, Reddy AG, Chowdhary CSR, Vinoth A, Rao GS (2017) Immunomodulatory effects of Bifidobacterium bifidum 231 on trinitrobenzenesulfonic acid-induced ulcerative colitis in rats. Res Vet Sci 110:40\u0026ndash;46\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLawalata HJ, Sembiring L, Rahayu ES (2011) Molecular identifcation of lactic acid bacteria producing antimicrobial agents from bakasang, an Indonesian traditional fermented fish product. Indonesian J Biotechnol 16(2):93\u0026ndash;99\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee JH, Kim MJ, Kim CY (2024) The development of new functional foods and ingredients. Foods 13(19):3038\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu Y, Tran DQ, Rhoads JM (2018) Probiotics in disease prevention and treatment. J Clin Pharmacol 58:S164\u0026ndash;S179\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu J, Zhao M, Hao J, Yan X, Fu Z, Zhu N, Ge G (2024) Effects of temperature and lactic acid Bacteria additives on the quality and microbial community of wilted alfalfa silage. BMC Plant Biol 24(1):844\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMagiorakos AP, Srinivasan A, Carey RB, Carmeli Y, Falagas ME, Giske CG, Monnet DL (2012) Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect 18(3):268\u0026ndash;281\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMamta T, Deshpande HW, Bhate MA (2017) Isolation and identification of lactic acid bacteria and their exploration in non-dairy probiotic drink. Int J Curr Microbiol Appl Sci 6:1023\u0026ndash;1030\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarkowiak P, Śliżewska K (2017) Effects of probiotics, prebiotics, and synbiotics on human health. Nutrients 9(9):1021\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMejlholm O, Dalgaard P (2015) Modelling and predicting the simultaneous growth of Listeria monocytogenes and psychrotolerant lactic acid bacteria in processed seafood and mayonnaise-based seafood salads. Food Microbiol 46:1\u0026ndash;14\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMohania D, Nagpal R, Kumar M, Bhardwaj A, Yadav M, Jain S, Yadav H (2008) Molecular approaches for identification and characterization of lactic acid bacteria. J Dig Dis 9(4):190\u0026ndash;198\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMorgan NK, Wallace A, Bedford MR, Choct M (2017) Efficiency of xylanases from families 10 and 11 in production of xylo-oligosaccharides from wheat arabinoxylans. Carbohydr Polym 167:290\u0026ndash;296\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNair PS, Surendran PK (2005) Biochemical characterization of lactic acid bacteria isolated from fish and prawn. J Cult Collections 4:2004\u0026ndash;2005\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNordberg Karlsson E, Schmitz E, Linares-Past\u0026eacute;n JA, Adlercreutz P (2018) Endo-xylanases as tools for production of substituted xylooligosaccharides with prebiotic properties. Appl Microbiol Biotechnol 102:9081\u0026ndash;9088\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOgunoye OA, Adelusi OA, Chime AO, Apuu KV, Onisile BO (2024) Preliminary identification of bacterial species contaminating okra fruits in some selected markets in Owo, Nigeria. J Nutr Food Process, 7(3)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOguntoyinbo FA, Narbad A (2012) Molecular characterization of lactic acid bacteria and in situ amylase expression during traditional fermentation of cereal foods. Food Microbiol 31(2):254\u0026ndash;262\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOikonomou G, Addis MF, Chassard C, Nader-Macias MEF, Grant I, Delb\u0026egrave;s C, Even S (2020) Milk microbiota: what are we exactly talking about? Front Microbiol 11:60\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOmeiza FO, Ademowo GO, Ayeni FA (2020) Evaluation of in vivo anti-malarial potential of omidun obtained from fermented maize in Ibadan, Nigeria. Malar J 19:1\u0026ndash;10\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e\u0026Oslash;stergaard NB, Ekl\u0026ouml;w A, Dalgaard P (2014) Modelling the effect of lactic acid bacteria from starter-and aroma culture on growth of Listeria monocytogenes in cottage cheese. Int J Food Microbiol 188:15\u0026ndash;25\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePachla A, Wicha M, Ptaszyńska AA, Borsuk G, Trokenheim ŁŁ, Małek W (2018) The molecular and phenotypic characterization of fructophilic lactic acid bacteria isolated from the guts of Apis mellifera L. derived from a Polish apiary. J Appl Genet 59:503\u0026ndash;514\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePandey P, Kang SC, Maheshwari DK (2005) Isolation of endophytic plant growth promoting Burkholderia sp. MSSP from root nodules of Mimosa pudica. Curr Sci, 177\u0026ndash;180\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePark MK, Ngo V, Kwon YM, Lee YT, Yoo S, Cho YH, Kang SM (2013) Lactobacillus plantarum DK119 as a probiotic confers protection against influenza virus by modulating innate immunity. PLoS ONE, 8(10), e75368\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePontieri P, Troisi J, Calcagnile M, Bean SR, Tilley M, Aramouni F, Del Giudice L (2022) Chemical composition, fatty acid and mineral content of food-grade white, red and black sorghum varieties grown in the mediterranean environment. Foods 11(3):436\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRapoo SM, Budeli P, Thaoge ML (2023) Recovery of Potential Starter Cultures and Probiotics from Fermented Sorghum (Ting) Slurries. Microorganisms 11(3):715. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/microorganisms11030715\u003c/span\u003e\u003cspan address=\"10.3390/microorganisms11030715\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRather RA (2023) Metaverse marketing and consumer research: theoretical framework and future research agenda in tourism and hospitality industry. Tourism Recreation Res, 1\u0026ndash;9\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRen C, Du H, Xu Y (2017) Advances in microbiome study of traditional Chinese fermented foods. Acta Microbiol Sin 57:885\u0026ndash;898\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSanders ME, Merenstein DJ, Reid G, Gibson GR, Rastall RA (2019) Probiotics and prebiotics in intestinal health and disease: from biology to the clinic. Nat reviews Gastroenterol Hepatol 16(10):605\u0026ndash;616\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eŞanlier N, G\u0026ouml;kcen BB, Sezgin AC (2017) Health benefits of fermented foods. Crit Rev Food Sci Nutr 59(3):506\u0026ndash;527\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSantiago M, Ram\u0026iacute;rez-Sarmiento CA, Zamora RA, Parra LP (2016) Discovery, molecular mechanisms, and industrial applications of cold-active enzymes. Front Microbiol 7:1408\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSelvaraj S, Gurumurthy K (2023) An overview of probiotic health booster-kombucha tea. Chin Herb Med 15(1):27\u0026ndash;32\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSeyed MA, Jantan I, Bukhari SNA, Vijayaraghavan K (2016) A comprehensive review on the chemotherapeutic potential of piceatannol for cancer treatment, with mechanistic insights. J Agric Food Chem 64(4):725\u0026ndash;737\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShah NP (2000) Probiotic bacteria: selective enumeration and survival in dairy foods. J Dairy Sci 83(4):894\u0026ndash;907\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShibata T, Kanayama M, Haida M, Fujimoto S, Oroguchi T, Sata K, Ishii N (2016) Lactococcus lactis JCM5805 activates anti-viral immunity and reduces symptoms of common cold and influenza in healthy adults in a randomized controlled trial. J Funct Foods 24:492\u0026ndash;500\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShobharani P, Halami PM (2014) Cellular fatty acid profile and H+-ATPase activity to assess acid tolerance of Bacillus sp. for potential probiotic functional attributes. Appl Microbiol Biotechnol 98:9045\u0026ndash;9058\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSionek B, Szydłowska A, Trząskowska M, Kołożyn-Krajewska D (2024) The Impact of Physicochemical Conditions on Lactic Acid Bacteria Survival in Food Products. Fermentation 10(6):298. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/fermentation10060298\u003c/span\u003e\u003cspan address=\"10.3390/fermentation10060298\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSiragusa S, De Angelis M, Calasso M, Campanella D, Minervini F, Di Cagno R, Gobbetti M (2014) Fermentation and proteome profiles of Lactobacillus plantarum strains during growth under food-like conditions. J Proteom 96:366\u0026ndash;380\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSkowron K, Budzyńska A, Grudlewska-Buda K, Wiktorczyk-Kapischke N, Andrzejewska M, Wałecka-Zacharska E, Gospodarek-Komkowska E (2022) Two faces of fermented foods\u0026mdash;the benefits and threats of its consumption. Front Microbiol 13:845166\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eS\u0026oslash;rensen HM, Rochfort KD, Maye S, MacLeod G, Brabazon D, Loscher C, Freeland B (2022) Exopolysaccharides of lactic acid bacteria: production, purification and health benefits towards functional food. Nutrients 14(14):2938\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSutarlie L, Chee HL, Ow SY, Aabdin Z, Tjiu WW, Su X (2023) A rapid total bacterial count method using gold nanoparticles conjugated with an aptamer for water quality assessment. Nanoscale 15(41):16675\u0026ndash;16686\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSwain G, Maurya KL, Sonwani RK, Singh RS, Jaiswal RP, Rai BN (2022) Effect of mixing intensity on biodegradation of phenol in a moving bed biofilm reactor: Process optimization and external mass transfer study. Bioresour Technol 351:126921\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTaye Y, Degu T, Fesseha H, Mathewos M (2021) Isolation and identification of lactic acid bacteria from cow milk and milk products. The Scientific World Journal, 2021(1), 4697445\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTeame T, Wang A, Xie M, Zhang Z, Yang Y, Ding Q, Zhou Z (2020) Paraprobiotics and postbiotics of probiotic Lactobacilli, their positive effects on the host and action mechanisms: A review. Front Nutr 7:570344\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVanamala JK, Massey AR, Pinnamaneni SR, Reddivari L, Reardon KF (2018) Grain and sweet sorghum (Sorghum bicolor L. Moench) serves as a novel source of bioactive compounds for human health. Crit Rev Food Sci Nutr 58(17):2867\u0026ndash;2881\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eViphonephom P, Kounnavong S, Reinharz D (2024) The state of decentralization of the healthcare system and nutrition programs in the Lao People\u0026rsquo;s Democratic Republic: an organizational study. BMC Health Serv Res 24(1):1037\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWaki N, Yajima N, Suganuma H, Buddle BM, Luo D, Heiser A, Zheng T (2014) Oral administration of Lactobacillus brevis KB290 to mice alleviates clinical symptoms following influenza virus infection. Lett Appl Microbiol 58(1):87\u0026ndash;93\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Y, Wu J, Lv M, Shao Z, Hungwe M, Wang J, Geng W (2021) Metabolism characteristics of lactic acid bacteria and the expanding applications in food industry. Front Bioeng Biotechnol 9:612285\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWillis C, McLauchlin J, Aird H, J\u0026oslash;rgensen F, Lai S, Sadler-Reeves L (2022) Assessment of the microbiological quality and safety of unpasteurized milk cheese for sale in England between 2019 and 2020. J Food Prot 85(2):278\u0026ndash;286\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang Y, Wei L (2021) Application of E-nose technology combined with artificial neural network to predict total bacterial count in milk. J Dairy Sci 104(10):10558\u0026ndash;10565\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYeo JM, Lee HJ, Kim JW, Lee JB, Park SY, Choi IS, Song CS (2014) Lactobacillus fermentum CJL-112 protects mice against influenza virus infection by activating T-helper 1 and eliciting a protective immune response. Int Immunopharmacol 18(1):50\u0026ndash;54\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang B, Wang Y, Tan Z, Li Z, Jiao Z, Huang Q (2016) Screening of probiotic activities of lactobacilli strains isolated from traditional Tibetan Qula, a raw yak milk cheese. Asian-Australasian J Anim Sci 29(10):1490\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang SJ, Wang LL, Lu SY, Hu P, Li YS, Zhang Y\u0026amp;, Ren HL (2020) A novel, rapid, and simple PMA-qPCR method for detection and counting of viable Brucella organisms. J Veterinary Res 64(2):253\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu Z, Zhu X, Kong F, Guo W (2019) Quantitatively determining the total bacterial count of raw goat milk using dielectric spectra. J Dairy Sci 102(9):7895\u0026ndash;7903\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"omidun, sorghum fermentation, LAB, probiotic potential, antibiotic resistance, intestinal capacity","lastPublishedDoi":"10.21203/rs.3.rs-6104576/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6104576/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eProbiotic bacteria, primarily lactic acid bacteria (LAB), are known to improve gut health, enhance immune responses, and inhibit the growth of pathogenic microorganisms, making them valuable for functional foods. Naturally fermented sorghum is a rich source of these beneficial bacteria. Therefore, this study investigated the probiotic potentials of LAB isolated from the supernatant of fermenting sorghum (\u003cem\u003eomidun\u003c/em\u003e). Five \u003cem\u003eomidun\u003c/em\u003e samples were fermented for 12, 24, 48, 72, and 96 hours to recover LAB strains. The recovered LAB isolates were identified and characterized using morphological and molecular methods, while their antibiotic resistance profiles were also assessed. Furthermore, we examined the effects of different fermentation periods (12, 24, 48, 72, and 96 hours) on the probiotic potential of the isolated LAB, including temperature tolerance, acid resistance (pH), and bile salt tolerance. Our results showed that bacterial counts in \u003cem\u003eomidun\u003c/em\u003e ranged from 2.78 \u0026times; 10⁻\u0026sup3; \u0026minus;\u0026thinsp;4.1 \u0026times; 10⁻\u0026sup3; CFU/ml, while coliform counts varied from 0.00\u0026ndash;1 \u0026times; 10⁻⁴ CFU/ml. The dominant LAB strains recovered from the \u003cem\u003eomidun\u003c/em\u003e include \u003cem\u003eLactobacillus plantarum\u003c/em\u003e, \u003cem\u003eLactobacillus sp\u003c/em\u003e., \u003cem\u003eLimosilactobacillus fermentum\u003c/em\u003e, and \u003cem\u003eLactobacillus brevis\u003c/em\u003e. Interestingly, biochemical tests confirmed all isolates were oxidase- and catalase-negative, with cocci and bacillary morphologies. Antibiotic resistance tests revealed that LAB fermented for 72 and 96 hours were resistant to gentamicin, ceftazidime, cloxacillin, erythromycin, cefuroxime, ofloxacin, augmentin, and ceftriaxone. Notably, the LAB isolates exhibited different growth patterns at 25, 37, and 40\u0026deg;C over 1- and 3-hour intervals, with all isolates successfully growing at 40\u0026deg;C. All isolates maintained high viability after 3 hours at both pH 2.5 and 4.0, while those fermented for 12\u0026ndash;48 hours showed no growth in both bile levels. The findings from this study suggest that \u003cem\u003eomidun\u003c/em\u003e is a rich source of LABs, with fermentation duration, especially 72 hours, playing a crucial role in shaping their probiotic potential.\u003c/p\u003e","manuscriptTitle":"Probiotic potentials of lactic acid bacteria isolated from fermented sorghum supernatant (omidun) under different fermentation periods","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-02-27 15:41:16","doi":"10.21203/rs.3.rs-6104576/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"42f2ac43-8b0c-42ae-846c-03cef04b5af4","owner":[],"postedDate":"February 27th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":44843604,"name":"Food Science \u0026 Technology"}],"tags":[],"updatedAt":"2025-02-27T15:41:16+00:00","versionOfRecord":[],"versionCreatedAt":"2025-02-27 15:41:16","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6104576","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6104576","identity":"rs-6104576","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.