Disruption of the developmental programming of the gonad of the broad snouted caiman (Caiman latirostris) after in ovo exposure to atrazine.

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

Abstract Environmental exposure to agrochemicals during early stages of development can induce subtle alterations that could permanently affect normal physiology. Previously, we reported that in ovo exposure to atrazine (ATZ) disrupts testicular histoarchitecture in postnatal caimans (Caiman latirostris). To assess whether such alterations are the result of disruption of gonadal developmental programming, this study aimed to evaluate the expression of histofunctional biomarkers (VASA, ER, PR, PCNA, and aromatase) and genes involved in gonadal development and differentiation (amh, sox-9, sf-1 and cyp19-a1) in the gonads of male and female caiman embryos and to assess the effect of ATZ exposure on these biomarkers and genes in the gonads of male embryos. Our results suggest that amh, aromatase and sox-9 play a role in sex determination and gonadal differentiation. In male caiman embryos, ATZ exposure increased aromatase expression and altered the temporal expression pattern of amh and sox-9 evidencing an ATZ-induced disruption of gonadal developmental programming. Since the effects of ATZ are consistent across all vertebrate classes, the ATZ-mediated disruptive effects here observed could be present in other vertebrate species.
Full text 171,395 characters · extracted from preprint-html · click to expand
Disruption of the developmental programming of the gonad of the broad snouted caiman (Caiman latirostris) after in ovo exposure to atrazine. | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Disruption of the developmental programming of the gonad of the broad snouted caiman (Caiman latirostris) after in ovo exposure to atrazine. Guillermina Canesini, Germán Hugo Galoppo, Yamil Ezequiel Tavalieri, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-1942101/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 06 Jan, 2023 Read the published version in Environmental Science and Pollution Research → Version 1 posted 4 You are reading this latest preprint version Abstract Environmental exposure to agrochemicals during early stages of development can induce subtle alterations that could permanently affect normal physiology. Previously, we reported that in ovo exposure to atrazine (ATZ) disrupts testicular histoarchitecture in postnatal caimans ( Caiman latirostris ). To assess whether such alterations are the result of disruption of gonadal developmental programming, this study aimed to evaluate the expression of histofunctional biomarkers (VASA, ER, PR, PCNA, and aromatase) and genes involved in gonadal development and differentiation ( amh , sox-9 , sf-1 and cyp19-a1 ) in the gonads of male and female caiman embryos and to assess the effect of ATZ exposure on these biomarkers and genes in the gonads of male embryos. Our results suggest that amh , aromatase and sox-9 play a role in sex determination and gonadal differentiation. In male caiman embryos, ATZ exposure increased aromatase expression and altered the temporal expression pattern of amh and sox-9 evidencing an ATZ-induced disruption of gonadal developmental programming. Since the effects of ATZ are consistent across all vertebrate classes, the ATZ-mediated disruptive effects here observed could be present in other vertebrate species. Wildlife Male gonad development Endocrine disruptor amh sox-9 Aromatase Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Introduction Many environmental compounds have been classified as endocrine-disrupting chemicals (EDCs), as they have the potential to interfere with the endocrine system (WHO and UNEP, 2012). Over the last decades, endocrine disruption has been described as a matter of environmental health concern because EDC exposure alters development, reproduction, and endocrine physiology in almost all species studied (Luque et al., 2018 ; Luque and Muñoz-de-Toro, 2020 ). The herbicide atrazine (ATZ) is among the environmental substances classified as EDCs due to its estrogenic, anti-androgenic and thyroid-disrupting activity (Elkayar et al., 2022 ; Galoppo et al., 2020 ; Hayes et al., 2011 ). Although the half-life time of ATZ is relatively short when compared to pollutants classified as persistent, and its physicochemical properties do not favor bioaccumulation, the presence of ATZ in groundwater, freshwater, sea water, soil, and animal tissues (Tavalieri et al., 2020 ) evidences its wide and continuous environmental input as well as its large dispersal rate. Thus, wildlife species that are not target of herbicides can be exposed to ATZ. Since the sexual differentiation of the reproductive system depends upon precise exposure to sex steroid hormones at specific times during development, exposure to low doses of ATZ during these hormone-sensitive critical periods of development can alter the developmental programming and lead to long-term deleterious effects on the adult organism. The broad snouted caiman ( Caiman latirostris ) is a South American crocodilian species highly sensitive to EDC exposure, widely distributed in wetlands of Argentina, Brazil, Paraguay, and Uruguay. This species shows temperature-dependent sex determination (TSD): embryos developed at 33°C result in phenotypic males, whereas embryos developed at 30°C result in phenotypic females (Stoker et al., 2003 ). In TSD species, temperature is an environmental factor that initiates a cascade of molecular events that lead the undifferentiated gonad to acquire the female or male phenotype. This process is defined as sex determination (Warner, 2011 ). Once sex determination is initiated, sex differentiation (defined as the histomorphological changes that lead to the development of a specialized set of organs) takes place. Sex determination and differentiation involve hormones, hormone receptors, steroidogenic enzymes, and genes such as amh (the anti-Müllerian hormone-encoding gene), sox-9 (which encodes a transcription factor that controls the anti-Müllerian hormone gene), sf-1 (which encodes the steroidogenic factor 1, which regulates the transcription of key genes involved in sexual development and reproduction), and cyp19-a1 (which encodes the enzyme aromatase) (Durando et al., 2013 ; Warner, 2011 ). Moreover, the expression of proteins such as ATP-dependent RNA helicase (VASA) (to identify germ cells), estrogen receptor (ER) and progesterone receptor (PR) (biomarkers of hormone-dependence), Proliferating Cellular Nuclear Antigen (PCNA) (to assess proliferative activity), and the enzyme aromatase (steroidogenic enzyme) is useful to study gonadal histofunctional differentiation (Canesini et al., 2018 ). Noteworthy, in TSD species, there is a critical window of time, named thermosensitive period, in which the embryonic sex remains labile and can be modified by environmental cues (Warner, 2011 ). Such cues may include EDC exposure. In our previous studies in C. latirostris , we demonstrated that, when exposed to EDCs such as 17β-Estradiol or bisphenol A during the thermosensitive period, embryos developed at the male-producing temperature (MPT) produced phenotypic females (Stoker et al., 2003 ). We also found that exposure to ATZ did not affect phenotypic sex (Beldomenico et al., 2007 ), but induced gonadal alterations in 10-day-old postnatal male caimans (Rey et al., 2009 ). Considering these findings, in the present study, we hypothesized that ATZ exposure in embryos developed at the MPT induces early modifications in key developmental genes and/or molecules that lead to histomorphological alterations observed in the gonads, long after exposure ended. To test this hypothesis, we firstly studied the expression of key developmental molecules and genes in the gonads of unexposed embryos developed at the MPT or female-producing temperature (FPT) and secondly studied the effect of ATZ exposure on these molecules and genes in the gonads of embryos developed at the MPT. 2. Materials And Methods 2.1. Egg collection and experimental design Eggs were collected and incubated as described in Canesini et al., ( 2018 ). Briefly, C. latirostris eggs (n = 120) were collected shortly after oviposition from seven nests randomly selected in a protected area (Natural Reserve ‘‘El Cachapé’’) of Chaco Province, Argentina, and transported to the laboratory. Since the objectives of the present work were to study the molecules and genes involved in the processes of temperature-dependent sex determination and differentiation and to study the effects of ATZ exposure on sex-determination and differentiation-related molecules and genes, eggs were divided into three experimental groups, and embryos were obtained at different developmental stages (Fig. 1). The groups were as follows: Temperature-sex determined females (TSD-Females, embryos (n = 40) obtained from eggs incubated at 30°C, which is the FPT), temperature-sex-determined males (TSD-Males, embryos (n = 40) obtained from eggs incubated at 33°C, which is the MPT), and ATZ-Males (embryos (n = 40) obtained from eggs incubated at the MPT and exposed to ATZ immediately before sex differentiation). To avoid biased responses to treatment due to clutch-related differences, eggs from each clutch were equally distributed in all experimental groups. 2.2. Assessment of the embryo developmental stage (DS) and treatment Recently laid eggs allowed us to obtain sexually undifferentiated embryos plausible to be TSD, as well as to minimize environmental egg exposure that could affect experimental results. Before egg collection, recent oviposition was checked by determining the embryo DS by following the criteria previously described (Iungman et al., 2008 ). Only eggs from nests showing embryos at DS lower than 15 were collected. Once in the lab, the eggs were incubated at 30 or 33°C. Based on our experience in developmental timing at 30°C and 33°C, the DS was checked frequently until stages 20, 22, 24 or 27. Eggs were treated at DS 20 (prior to sex determination). Treatments were applied topically as previously described (Stoker et al., 2003 ). For ATZ exposure, a single dose of 0.2 ppm of ATZ (96% purity, Icona S.A., Argentina) diluted in absolute ethanol (purity ≥ 99.9%, Merck, Germany) was applied to the eggshell (ATZ-Males). To expose the egg to 0.2 µg of ATZ per kg of egg (0.2 ppm), the volume of the ethanol solution of ATZ was adjusted to the mass of the egg at the moment of treatment. For control groups (TSD-Males and TSD-Females), 50 µL of absolute ethanol (purity ≥ 99.9%, Merck) was applied topically. The dose of ATZ used is considered environmentally relevant since it corresponds with tissue levels of ATZ reported in environmentally exposed fishes (Basopo and Muzvidziwa, 2020 ; Brodeur et al., 2021 ; Zhang et al., 2022 ). Additionally, we have previously demonstrated that the use of ethanol as vehicle causes no effect on caimans (Stoker et al., 2003 ). After treatment, incubation continued until DS 22, 24 or 27 (Fig. 1). 2.3. Sampling and processing Twelve animals from each experimental group were euthanized at DS 22, 24 or 27. To obtain the Gonad-Adrenal-Mesonephric (GAM) complexes, different protocols were followed according to the experimental purpose. To study gene expression, immediately after euthanasia, the GAM complexes were dissected using a stereomicroscope (Stemi 305 Zeiss, Carl Zeiss Microscopy, Germany) in RNAse-free conditions. Immediately after dissection, the GAM complexes were placed ventral side up on a cold sterilized aluminium foil in close contact with dry ice to be flash frozen. After flash-freezing, the samples were wrapped in the sterile aluminium foil and stored at -80 ºC until gonad isolation and RNA extraction. For histomorphological and histofunctional studies, the GAM complexes were fixed in formalin-buffered solution (10% phosphate-buffered formalin, pH 7.4) for 6 h at room temperature, rinsed in phosphate buffer saline solution (PBS pH 7.5), dehydrated in an ascending ethanol series, cleared in xylene, and embedded in paraffin. 2.4. Histomorphological features of the gonad and biomarkers of histofunctional differentiation For histomorphological studies, 5-µm-thick histological sections of the embryo GAM complex were stained using the trichromic picrosirius/hematoxylin staining technique, as previously described (Canesini et al., 2018 ). Serial sections were studied to evaluate the presence of sex-defining structures (Ferguson and Chenier, 1983 ; Forbes, 1940 ). All histological evaluations were performed in at least three sections separated 300 µm from each other. The expression of proteins such as VASA, ER, PR, and PCNA and the enzyme aromatase, useful to study gonadal histofunctional differentiation, was assessed by immunohistochemistry (IHC) using immunoperoxidase staining. IHC was performed as previously described (Canesini et al., 2018 ; Galoppo et al., 2016 ; Varayoud et al., 2012 ). All the antibodies used (Table 1 ) were previously characterized and used in caiman tissues (Canesini et al., 2018 ; Galoppo et al., 2016 ; Varayoud et al., 2012 ). Table 1 Antibodies used for immunohistochemistry. Target protein Supplier Primary Antibodies Animal Source Dilutions used PCNA Novocastra, (Newcastle, UK) Anti-PCNA (Clone PC-10) Mouse 1:2000 VASA Santa Cruz Biotechnology (Santa Cruz, CA, USA) Anti-VASA H-80 (Code sc67185) Rabbit 1:200 ERα LETH-ISAL a (Santa Fe, Argentina) Anti-ER (LETH-ER 202Y) Rabbit 1:200 PR DAKO Corp. (Carpinteria, CA, USA) Anti-PR (Code A0098) Rabbit 1:300 Aromatase LETH-ISAL b (Santa Fe, Argentina) Anti-Aromatase (LETH-AROMy) Rabbit 1:2000 PCNA: Proliferating Cellular Nuclear Antigen; VASA: ATP-dependent RNA helicase; ERα: Estrogen Receptor alpha; PR: Progesterone Receptor. LETH-ISAL: Laboratorio de Endocrinología y Tumores Hormonodependientes- Instituto de Salud y Ambiente del Litoral. a Varayoud et al., 2012 . b Canesini et al., 2018 . 2.4.1. Image analysis and quantification of molecules revealed by IHC Image analysis was performed on digital images recorded using the ImageJ/Fiji 1.46 software as previously described. Briefly, the whole gonadal area and the immunostained area were determined (Varayoud et al., 2012 ). The expression levels of ERα, PR, aromatase and PCNA were quantified as the percentage of the gonadal area occupied by each marker (Canesini et al., 2018 ). A threshold based on the intensity of the immunostaining was set for the PCNA-positive area (Durando et al., 2016 ). VASA was assessed qualitatively to describe the spatial distribution of germ cells. 2.5. Expression of key developmental genes in the embryonic gonad 2.5.1. Isolation of gonadal tissue for RNA extraction and gene quantification Gonadal tissue was isolated from the GAM complex by using the microdissection technique previously described (Lazzarino et al., 2019 ), modified and adapted for caiman embryo samples. Briefly, GAM samples stored at -80°C were embedded in an OCT cryo-embedding matrix (CRYOPLAST® Biopack, Argentina) and 300-µm-thick GAM serial transverse sections were obtained using a cryostat (Leica CM 1860, Leica Biosystems, IL, USA) at an operating temperature of -20ºC. Once obtained, the GAM sections were placed on previously cooled glass sterile slides and observed using a dissecting microscope (Stemi 305, Zeiss, Oberkochen, Germany). The gonads were identified by histological and morphological criteria and then isolated from the rest of the structures of the GAM complex. Sterile stainless steel microdissection needles of 0.5 mm internal diameter were used for the isolation of the gonads of embryos at DS 22, while microdissection needles of 1.0 mm internal diameter were used for the isolation of the gonads of embryos at DS 24 and 27. Gonads were removed bilaterally, and microdissected sections were immersed in total RNA isolation reagent (TRIzol™ Invitrogen, Carlsbad, CA, USA) and stored at -80ºC until RNA extraction. To make sure that all the sections obtained by the microdissection technique belonged to the gonad, the remaining tissue was histologically inspected. The remaining GAM sections were thawed, and the microdissection holes were located. Since the gonadal tissue is surrounded by a layer of connective tissue and shows characteristics that make it perfectly distinguishable from the rest of the structures that constitute the GAM complex, we checked that no tissue outside of the gonad limits had been removed. Each microdissected gonad from each individual animal (between 10 and 20 punches, depending on the DS of the embryo) was processed and analysed as a single data point, as previously described (Lazzarino et al., 2017 , 2019 ). 2.5.2. RNA extraction, reverse transcription, and real-time quantitative polymerase chain reaction (PCR) analysis Total RNA was isolated from microdissected gonadal tissue stored at -80°C using TRizol reagent (Invitrogen, Carlsbad, CA, USA). The concentration and purity of RNA were determined by measuring the absorbance at λ = 260nm and λ = 280nm in a NanoDrop Lite Spectrophotometer (Thermo Scientific, Wilmington, DE, USA). Gene quantification was performed using a two-step quantitative reverse transcriptase PCR by the standard curve method (Čikoš et al., 2007 ). Firstly, equal quantities (0.5 µg) of total RNA from each sample were reverse-transcribed into copy DNA (cDNA) with Moloney Murine Leukemia Virus reverse transcriptase (200 units; Promega, Madison, WI, USA), by using 200 pmol of random primers (Promega, Madison, WI, USA), 20 units of the ribonuclease inhibitor RNAout (Invitrogen Argentina, Buenos Aires, Argentina) and 100 nmol of a deoxynucleotide triphosphate (dNTP) mixture. The final volume of each reverse transcription reaction tube was adjusted to 30 µL with 1X reverse transcriptase buffer. Reverse transcription PCR was performed at 37° C for 90 min and at 42° C for 15 min. Finally, the reaction was stopped by heating at 80° C for 5 min followed by rapid cooling on ice bath. Once the cDNA was obtained, the mRNA expression of four selected genes ( amh , sox-9 , sf-1 and cyp19-a1 ) was quantified by real-time PCR. For this purpose, each reverse-transcribed product was diluted with RNAse-free water to a final volume of 60 µL and amplified by the Real-Time DNA Step One Cycler (Applied Biosystems Inc., Foster City, CA, USA) using previously designed primers (Durando et al., 2013 ). L8 (60S ribosomal protein L8) from Alligator mississippiensis , a species related to C. latirostris , was used as housekeeping gene. The characteristic of the primers used are shown in Table 2 . For cDNA amplification, 5 µL of cDNA was combined with HOT FIREPol Eva Green qPCR Mix Plus (Solis BioDyne; Estonia) and 10 pmol of each primer (Invitrogen, Carlsbad, CA, USA) to a final volume of 20 µL using RNAse-free water. Negative DNA template controls were included in all the assays using 5 µL of sterile RNAse-free water instead of cDNA. After initial denaturation at 95°C for 15 min, the reaction mixture was subjected to successive cycles of denaturation at 95°C for 15 s, and annealing and extension at specific temperatures for each gene for 15 s. The relative expression levels of each target were calculated based on the cycle threshold (CT), which was calculated for each sample using the StepOne Software (Applied Biosystems Inc. Foster City, CA, USA) with an automatic threshold setting. Standard curves for each target gene as well as for the housekeeping gene were performed using eight serial dilutions of a pool cDNA containing equal amounts of cDNA from samples of different experimental groups. The optimal dilution of work for each gene tested was fixed based on the results obtained from the standard curves. Results are expressed as fold change in the expression of each target gene in relation to the housekeeping gene. Product purity was confirmed by dissociation curves provided by the StepOne Software and random samples were subjected to agarose gel electrophoresis. Table 2 Primers and PCR conditions Gene GenBank ID Sense Primer (5´-3´) Anti-sense Primer (5´-3´) Size (bp) amh AF180294 TCCACCCGTGCCGACTACTA CAGAGTATTGGACGGGCACG 106 Sox-9 AF106572 GGCTCGGAGCAAACCCACAT TGCCAGGCTGGACGTCTGTT 172 Sf-1 AF180296 GGCTCCATCCTGAACAACCT TTGAGGCAGACGAACTCCTG 95 Cyp19-a1 AY029233.1 CTGGAGATGATGATCGCTGC TGGCATGTCATCGCTCTGTA 152 L8 ES316580.1 CACGACCAGCCTTTAAGATA CTCACAATCCTGAAACCAAG 141 2.6. Statistical analysis Data are reported as the median and range or mean ± SEM. To determine normality, Shapiro-Wilk normality test followed by a Levene variance homogeneity test were performed. Statistical analyses were performed using Mann–Whitney U test and Kruskal–Wallis analysis of variance followed by Dunn’s test as a post hoc test to determine significant differences (Siegel, 1956 ). The Q-test was performed to evaluate the presence of outliers that characterize the ‘‘clutch effect”. In all cases, differences were considered significant at p < 0.05. For all the analyses, the IBM SPSS Statistics 19 software (IBM Inc.) was used. 3. Results 3.1. Temperature sex determination and embryonic gonadal differentiation 3.1.1. Gonadal histology and germ cell distribution As previously reported, all embryos from eggs incubated at 33°C were males (TSD-Males), whereas those from eggs incubated at 30°C were females (TSD-Females). At DS 22, the gonads of both TSD-Females and TSD-Males showed a well-defined compartmentalization characterized by a cortex and a medulla. The cortex is defined by an external cuboidal-to-flat epithelium composed of cells with homogeneously and intensely blue-stained nuclei. The medulla underlies the cortex and is formed by medullary cells arranged in groups or cords surrounded by loose connective tissue. The medullary cords are, in turn, formed by two morphologically different types of cells: cells with homogeneously dark blue-stained nuclei and few cytoplasm and cells with heterogeneously violet-stained nuclei with decreased nuclei/cytoplasm ratio. The latter type of cells may be isolated or grouped in clusters dispersed in the underlying stroma or at the coelomic border. The loose connective tissue shows zones with empty spaces (Fig. 1). No signs of gonadal sex differentiation were observed at this DS. In the present work, we confirmed the gonadal histological features previously described for TSD-Females at DSs 24 and 27 (Canesini et al., 2018 ). At DS 24, as shown in Fig. 1, the medulla of TSD-Males shows a more compact appearance with fewer empty spaces than that of TSD-Females. Both sexes showed an increased number of cells with heterogeneously violet-stained nuclei and a decreased nuclei/cytoplasm ratio either isolated among interstitial tissue or forming clusters. Besides, in the gonads of TSD-Males, the medullary cords acquire a tubular-like appearance with an empty lumen. At DS 27, the gonads of the TSD-Male embryos showed the presence of tubular structures, which were formed by an epithelium and a central lumen occupied by a substance of foamy appearance. The epithelium is composed of both types of cells previously described (cells with heterogeneously violet-stained nuclei with decreased nuclei/cytoplasm ratio and cells with homogeneously dark blue-stained nuclei and little cytoplasm). The tubular structures are, in turn, surrounded by interstitial tissue containing enlarged cells together with cells with rounded nuclei in the proximities of the tubules (Fig. 2). VASA-expressing cells were present at all the DSs studied both in TSD-Females and TSD-Males. At stage 22, immune-stained cells were observed both in the cortex and as clusters in the medulla. As development took place, both in TSD-Males and Females, the VASA-positive cells moved away from the external cortical epithelium and occupied more central positions in the developing gonad (Fig. 2). 3.1.2. Expression of hormonal receptors ERα expression levels in males and females were significantly different at all DSs studied. In TSD-Females, ERα expression showed no changes throughout the DSs evaluated, whereas in TSD-Males, ERα expression was high at DSs 22 and 24 and then decreased significantly at DS 27 (Table 3 ), thus exhibiting a sexually dimorphic pattern. Table 3 Expression of biomarkers of gonadal histofunctional differentiation DS 22 DS 24 DS 27 TSD-Females TSD-Males TSD-Females TSD-Males TSD-Females TSD-Males ERα 8.357 ± 1.048 a,α 15.94 ± 3.450 b,α 6.729 ± 0.957 a,α 17.87 ± 2.315 b,α, 6.799 ± 0.609 a,α 2.563 ± 0.528 b,β PR 0.402 ± 0.146 a,α 0.069 ± 0.035 b,α 0.511 ± 0.255 a,α 0.351 ± 0.162 a,αβ 0.864 ± 0.169 a,α 1.965 ± 0.785 b,β Aromatase 15.24 ± 1.321 a,α 2.428 ± 0.281 b,α 9.911 ± 1.012 a,αβ 2.209 ± 0.077 b,αβ 5.740 ± 0.673 a,β 1.466 ± 0.243 b,β PCNA 0.044 ± 0.005 a,α 2.239 ± 0.608 b,α 0.334 ± 0.112 a,β 0.541 ± 0.053 a,α 0.142 ± 0.056 a,αβ 1.787 ± 0.602 b,α The values represent the mean ± SEM. The different Latin letters indicate significant differences (p < 0.05) between TSD-Females and TSD-Males at each DS. Different Greek letters indicate significant differences (p < 0.05) between males and females along the three DSs studied. PR expression levels were low. Similar to that observed for ERα, in TSD-Females, PR expression remained at a relatively constant level throughout the DSs studied (Table 3 ), whereas in TSD-Males, PR expression showed a sustained increase as development took place (Table 3 ). 3.1.3. Aromatase expression A multi-dotted cytoplasmic pattern of immunostaining compatible with aromatase mitochondrial location was observed in the gonads of C. latirostris embryos at all the DSs studied. Both TSD-Females and TSD-Males exhibited a gradually decreasing pattern of aromatase expression as development advanced. However, when compared with TSD-Females, TSD-Males showed significantly lower levels of aromatase expression throughout all the DSs studied (Table 3 ). 3.1.4. Proliferative activity As shown in Table 3 , at DSs 22 and 27, proliferative activity, evaluated by PCNA expression, was significantly higher in male gonads than in female gonads. TSD-Female gonads showed an increase in the proliferative activity from DS 22 to 24, followed by a decrease at DS 27, whereas male gonads showed no differences in proliferative activity from DS 22 to DS 27. 3.1.5. Isolation of the embryonic gonad from the GAM complex and expression of key developmental genes The incorporation of the microdissection technique to isolate the gonad from the GAM complex allowed obtaining enough amount of gonad RNA from embryos even at DS 22. Additionally, the use of this technique prevents the presence of adrenal and mesonephric tissues that could mask differences between males and females at early DSs. Regarding the expression of the key developmental genes studied, results were as follows: The relative expression of amh in TSD-Females remained low and showed no changes throughout the DSs studied, whereas that in TSD-Males increased significantly from DS 22 to DS 24. In addition, the relative expression of amh in TSD-Males was higher than that in TSD-Females throughout the whole period studied (Table 4 ). Table 4 Expression of key developmental genes in the gonad of Caiman latirostris embryos. DS 22 DS 24 DS 27 TSD-Females TSD-Males TSD-Females TSD-Males TSD-Females TSD-Males amh 2.578 ± 0.525 a,α 22.04 ± 3.918 b,α 1.650 ± 0.322 a,α 291.5 ± 46.32 b,β 1.387 ± 0.15 a,α 335.7 ± 52.55 b,β Cyp19-a1 0.046 ± 0.007 a,α 0.0003 ± 6e-005 b,α 0.012 ± 0.001 a,α 0.001 ± 0.0002 b,α 1.373 ± 0.0004 a,β 0.0009 ± 4e-005 b,α Sf-1 9.230 ± 1.505 a,α 1.596 ± 0.170 b,α 2.334 ± 0.385 a,β 3.137 ± 0.546 a,α 4.663 ± 0.676 a,αβ 8.752 ± 1.118 b,β Sox-9 1.928 ± 0.088 a,αβ 2.191 ± 0.338 a,α 1.495 ± 0.479 a,α 10.52 ± 1.489 b,β 2.528 ± 0.341 a,β 17.52 ± 1.971 b,β The values represent the mean ± SEM. The different Latin letters indicate significant differences (p < 0.05) between TSD-Females and TSD-Males at each stage of embryonic development. Different Greek letters indicate significant differences (< 0.05) between males and females along the three stages studied. The relative expression of cyp19-a1 in TSD-Females was higher than that in TSD-Males throughout the three stages studied (Table 4 ). In addition, in TSD-Females, a significant increase in cyp19-a1 relative expression was observed from DS 24 to DS27. The relative expression of sf-1 in TSD-Females exhibited a U-shaped pattern with its highest level at DS 22 and the lowest at DS 24. Conversely, in TSD-Males, the expression of sf-1 exhibited a steady increase from DS 22 to DS 27. sf-1 expression in both TSD-Females and TSD-Males at DS 22 was significantly different from that at DS 27 (Table 4 ). Finally, the relative expression of sox-9 in TSD-Females remained unchanged throughout the stages studied, whereas that in TSD-Males sox-9 increased significantly as development progressed (Table 4 ). 3.2. Effects of ATZ on the development and differentiation of the male gonad 3.2.1. Gonadal histology and germ cell distribution In agreement with that previously reported (Beldomenico et al., 2007 ), all embryos from eggs incubated at 33°C were males both in the control group (TSD-Males) and in the ATZ-exposed group (ATZ-Males). At DSs 22 and 24, no differences at histological level were observed between ATZ-Males and TSD-Males, whereas at DS 27, the gonads of ATZ-Males exhibited a less organized histoarchitecture. This relative disorganization included poorly defined limits between the epithelium and the surrounding stroma, increased tortuosity of epithelium cords, and wider fluid-filled lumen. The germinal cell distribution in the gonad of ATZ-Males did not differ from that observed in TSD-Males. 3.2.2 Estrogen and progesterone receptors Exposure to ATZ induced a significant decrease in the expression of both ER and PR at DS 24. No differences were observed at DS 22 or DS 27 (Fig. 2). 3.2.3 Aromatase ATZ exposure dramatically increased the expression of aromatase in the ATZ-Males gonads. When compared with TSD-Males, ATZ-Males showed significantly higher levels of gonadal aromatase expression throughout the whole period studied (Fig. 4). 3.2.4 Proliferative activity Exposure to ATZ significantly induced cell proliferation in ATZ-Male gonads at DS 22 (Fig. 5). 3.2.5 Expression of key developmental genes Regarding the expression of the key developmental genes studied, results were as follows: ATZ exposure induced an up-regulation of amh expression at DSs 22 and 24. No significant differences in the expression of cyp19-a1 were observed between TSD-Males and ATZ-Males throughout the different DSs studied. However, ATZ-Males tended to show a slightly increased expression of cyp19-a1 . ATZ exposure did not alter the pattern of sf-1 expression found in TSD-Male gonads and no differences in sf-1 expression levels were found between ATZ-Males and TSD-Males throughout the period studied. While the relative expression of sox-9 in TSD-Males significantly increased as development progressed, that in ATZ-Males showed a significant increase at DS 24, which differed from that found in TSD-Males at the same DS but was similar to that found at DS 27 (Fig. 6). 4. Discussion Our findings demonstrate that, in C. latirostris embryos, sexually dimorphic expression of histofunctional biomarkers and key developmental genes precedes gonad histomorphological differences. They also show that in ovo exposure to ATZ at developmental stage of temperature sex determination induces changes in the expression of histofunctional biomarkers and genes. Although no changes were observed in testicular differentiation after in ovo ATZ exposure, disruption of testicular histoarchitecture was observed. 4.1. Temperature-induced gonadal development and differentiation The embryonic gonad of C. latirostris shows the same compartmentalization pattern and general histological characteristics as those described for Alligator mississippiensis (Smith and Joss, 1994 ). Although no differences were observed in the histoarchitecture of TSD-Males and TSD-Females at DS 22, at this early developmental stage most of the genes and proteins evaluated here showed sexually dimorphic expression. This suggests that, at DS 22, the gonads of C. latirostris overrode the bisexual period in which the developing gonad shows both characteristics of males and females. As caiman embryo development takes place, the histoarchitecture acquires different features in male and female gonads. At DS 24, TSD-Male gonads present tubular structures -seminiferous tubules precursors-. As demonstrated in Canesini et al. ( 2018 ), the VASA-expressing cells, present in tubular structures, correspond with medullar cells morphologically described as cells with heterogeneously violet-stained nuclei and decreased nuclei/cytoplasm ratio. Although this type of cells shows many similarities to those described as pre-Sertoli cells for A. mississippiensis (Smith and Joss, 1993 ), in C. latirostris the expression of VASA denotes their germinal lineage. At DS 27, the presence of seminiferous tubules that exhibit a characteristic lumen and the absence of the Müller ducts confirm the gonadal male phenotype. In TSD species, temperature-induced changes include changes in the expression of steroid hormone receptors. Thus, here we studied the effect of the incubation temperature on the expression of ERα and PR. In TSD-Female gonads, ERα expression remained unchanged throughout the DSs studied. In contrast, TSD-Male gonads showed a period of high ERα expression that spread over DSs 22 and 24, followed by a period of low ERα expression at DS 27. It has been reported that both increased and depleted levels of estrogen can upregulate ER levels (Hagenfeldt and Eriksson, 1988 ; Prins and Birch, 1997 ; Tran et al., 2016 ). Sex steroid levels in the developing embryo are unknown. The levels of steroid hormones in the chorioallantois fluid were reported to be a useful tool for estimating the circulating steroid levels in turtles (Gross et al., 1995 ). However, this approach was not useful to assess embryonic hormonal environment in alligators (Crain et al. 1997 ) and probably would not be for C. latirostris. As far as we know, no steroid synthesis has been reported in crocodilian gonads at morphologically undifferentiated developmental stages. Thus, we could speculate that, in C. latirostris , at the earliest DS, low estrogen levels rather than high estrogen levels may be involved in the regulation of gonadal ERα expression. Increased ERα expression could be a strategy to enhance tissue sensitivity to low estrogen levels. In mice, it has been found that estrogens, acting through highly expressed ERα, might promote normal development and function of the male reproductive tract (Hess and Cooke, 2018 ). Consequently, in male C. latirostris , the high ERα expression period here observed over DSs 22 and 24 would be critical for normal gonadal development and function. Additionally, our findings confirm that the earlier DSs of C. latirostris are highly sensitive to subtle changes in the levels of estrogens or xenoestrogens (Stoker et al., 2003 ). Conversely, during DS 27, when the gonad is morphologically differentiated, ERα expression decreased significantly. Male gonad development requires of both ERα and androgen receptors (AR), and the balance between androgen and estrogen (acting through their respective receptors) is of central importance in male reproductive development and function (Hess and Cooke, 2018 ). Thus, different DSs may be characterized by a different estrogen:androgen balance and a different ERα:AR expression ratio. At DS 27, androgen synthesis by the male-differentiated gonad may modify the estrogen:androgen balance and ERα expression. Regarding PR, this receptor is considered a target molecule of estrogenic action and its regulation differs between species (Boyd-Leinen et al., 1984 ; Giannoukos and Callard, 1996 ; Hora et al., 1986 ; Schultz et al., 2003 ). Our results showed that, as expected, in TSD-Females, PR expression follows the same pattern as ERα. Conversely, in TSD-Males, increased PR expression corresponds with the low ERα expression when estrogenic action is supposed to be decreased. This controversy could be explained by the complex PR regulation in reptiles. As it has been previously reported, PR levels could be regulated by other factors besides estrogen action (Gist, 2011 ; Jones, 2011 ). In TSD species, steroidogenic enzymes have been suggested to be temperature-regulated. The differential expression of aromatase between TSD-Females and TSD-Males confirmed this for C. latirostris . The high aromatase levels in TSD-Females were observed throughout the whole period studied. In Crocodylus porosus and A. mississippiensis , the aromatase levels observed in female embryos remain low up to the end of the thermosensitive period and, then, dramatically increases (Gabriel et al., 2001 ; Smith and Joss, 1994 ), suggesting a role in gonadal differentiation but not necessarily in sex determination. In C. latirostris , this role is supported by the female-related high aromatase expression levels observed during the DS characterized by a morphologically differentiated gonad. However, these female-related high levels of aromatase expression were observed even during the thermosensitive period. This result suggests that, in C. latirostris , aromatase expression could be a key factor not only for gonadal female determination but also for sex differentiation. Additionally, our findings suggest that, in C. latirostris , the levels of aromatase expression would be a reliable sign of gonadal determination towards the female phenotype. Developmental processes involve cell proliferation and differentiation. Regarding this, Zhu et al. ( 2009 ) stated that cell proliferation and differentiation often act as two mutually exclusive partners that are related but cannot coexist. In this context, the gonadal increased proliferative activity here observed in TSD-Females at DS 24 suggests that the gonad is in a phase more related to growth than to differentiation. Noteworthy, no differences in proliferative activity were found for TSD-Males during the DSs studied, suggesting that differentiation rather than proliferation govern this developmental period in males. In the present work, we also studied four key genes involved in sexual determination and gonad differentiation, amh , sox-9 , sf-1 and cyp19-a1 . To this aim, gonadal tissue was isolated from the GAM complex using the microdissection technique previously described by Lazzarino et al. ( 2019 ). The microdissection technique allows working with gonadal tissue, avoiding the use of adrenal or mesonephric tissue. Thus, results are representative of the gonad and differences between males and females, when present, are clearer. Noteworthy, amh showed clear sexual dimorphism throughout the whole developmental period studied, being several orders of magnitude higher in TSD-Males than in TSD-Females. The amh gene encodes for the anti-Müllerian hormone (AMH), which is involved in male gonad differentiation by causing degeneration of Müllerian ducts in the embryo bipotential gonad. This mechanism of gonadal differentiation highly conserved among vertebrates is also present in C. latirostris and seems to be the hallmark of sexual male determination. In addition, amh expression significantly increased from DS 22 (when the gonad is morphologically classified as bisexual) towards DS 24 (when sexual differentiation has begun). Noteworthy, at DS 24, we observed a significant increase in the sox-9 mRNA level in TSD-Male gonads. Sox9 is a gene that encodes for the transcription factor SOX9, which in turn, activates the transcription of amh and, consequently, promotes the development of testes in all vertebrates examined to date (Morrish and Sinclair, 2002 ). Additionally, in alligators, the increase in amh levels precedes that in sox-9 (Warner, 2011 ), suggesting that other genes besides sox-9 may regulate the increase in amh . In C. latirostris , we confirmed this finding. We propose that although sox-9 is not necessary for the increase in amh levels during the bisexual gonadal stage, it is involved in the further upregulation of amh during the gonadal differentiation into testis. Moreover, molecular cloning studies of amh in A. mississippiensis have confirmed that sox-9 up-regulates transcriptional activity through the amh promoter region (Urushitani et al., 2011 ). A similar mechanism could be operating in C. latirostris . In addition to sox-9 , sf-1 has been described as a positive regulator of amh (Warner, 2011 ). Our results support this role for sf-1 . We hypothesize that, during DS 27, sf-1 , together with sox-9 , upregulates amh expression, maintaining high levels of AMH, necessary for gonadal male differentiation. Nevertheless, sf-1 expression was also found increased in TSD-Female gonads at DS 22, suggesting that sf-1 could be related to other functions. In fact, sf-1 regulates the expression of gonadal steroidogenic enzymes, including aromatase (Parker and Schimmer, 1997 ). In TSD-Females, the highest level of sf-1 found coincided with increased cyp19-a1 expression levels and the highest aromatase expression levels. Taken together, our results support the idea that sf-1 has different functions at different DSs of embryos developed at the MPT or FPT. While, at the earlier DSs of embryos developed at the FPT, sf-1 is involved in the upregulation of aromatase expression, at the latest DSs of embryos developed at the MPT, sf-1 is involved in the upregulation of amh expression. 4.2 Effects of ATZ exposure on gonadal development and differentiation The histomorphological alterations observed in ATZ-Male gonads at DS 27 are similar to those previously reported in 10-day-old caimans with the same protocol of exposure (Rey et al., 2009 ). This suggests that the altered testicular histoarchitecture observed postnatally is a consequence of the gonadal disruptive effect of ATZ initiated during embryo development. The dramatic increase in aromatase expression here observed in ATZ-Males throughout the DSs studied is in concordance with the reported role of ATZ as a xenoestrogen in different species, acting through increased aromatase induction (Hayes et al., 2011 , 2006 ). In alligator male hatchlings, for example, ATZ has been found to induce GAM aromatase activity that was characteristic neither of males nor of females, but did not alter testicular differentiation (Crain et al., 1997 ). In our model, increased aromatase expression would increase androgen-to-estrogen conversion, creating an estrogenic gonadal microenvironment in ATZ-Males that would be responsible for downregulating ERα expression, as observed at DS 24. The reduced period of high ERα expression, previously defined as critical for normal gonadal development and function in male C. latirostris , could affect estrogen-depending developmental processes involved in the sexual differentiation of the gonad. The decreased PR expression levels here observed at DS 24 in ATZ-Males may be interpreted as a consequence of the altered estrogen signaling pathway. Thus, changes in PR could suggest that other estrogen-induced molecules which have a role in proper gonad differentiation could be affected. ATZ exposure also increased the expression of amh (at DSs 22 and 24) and sox-9 (at DS 24). These genes are part of a highly conserved pattern of gonadal development in vertebrate species known as the male pathway (Hirst et al., 2018). Surprisingly, regarding the expression of amh and sox- 9, ATZ exposure seems to support the male phenotypic pathway rather than the female one. Although these findings may lead to hypothesize that the increased expression of amh and sox-9 could result in a protective response against the feminizing effect of ATZ, different studies on developmental processes highlight the importance of the temporal and spatial expression pattern of key molecules. In chicken, for example, AMH overexpression has been found to lead to alterations in the number of Sertoli cells and steroidogenesis (Lambeth et al., 2016 ). In this sense, for developmental processes, it is critical that “the right molecule is expressed at the right level at the right time” (Ferraro et al., 2016 ). Thus, subtle alterations in the developmental programming could lead to impaired reproductive function. In the present work, ATZ exposure altered the temporal pattern of expression of both amh and sox-9 . Thus, histofunctional alterations as a consequence of ATZ-induced changes in the levels of expression of amh in ATZ-Male caimans cannot be ruled out. Finally, it is important to highlight that ATZ could cause greater endocrine disruption in caimans hatched in the wild than in those hatched in controlled laboratory conditions. This is because, in the wild, eggs are also incubated at intermediate temperatures that produce both males and females (Parachú Marcó et al., 2017 ; Simoncini et al., 2019 ). Thus, our results highlight the vulnerability of developing organisms and alert about ATZ-mediated developmental disruption in wildlife. 5. Conclusions Exposure of non-target organisms to substances classified as EDCs used in productive processes -such as ATZ in weed control- during critical periods of development might cause subtle changes at gene and/or protein expression level that might lead to impairments of physiological processes in later stages of life. Studying those physiological processes and the effects of EDCs exposure in organisms that behave as sentinel species, like C. latirostris , allow us to identify potential early targets of endocrine disruption and to alert about the deleterious effects that developmental exposure to EDCs might induce both in wildlife and humans. Declarations Acknowledgments We thank Juan Grant for technical assistance and animal care. Field work was done in collaboration with ‘‘Reserva Natural El Cachapé”, Chaco. http://www.elcachape.com.ar. This study was supported by grants from the Argentine National Agency for the Promotion of Science and Technology (ANPCyT; PICT-2011-2031 and PICT 2016-0656), the Universidad Nacional del Litoral (CAI + D Program Cod. 50420150100088LI) and the National Scientific and Technical Research Council of Argentina (CONICET; PIP 2021-2023 Cod. 1220200101387CO) Ethical Approval The protocols used in this work were previously authorized by the Institutional Committee of Bioethics in Animal Care and Use of the Universidad Nacional del Litoral, Santa Fe, Argentina. Consent to participate Not applicable. Consent to publish Not applicable. Author´s contribution statement All authors contributed to the study conception and design. Conceptualization: Guillermina Canesini, Germán H. Galoppo, Jorge G. Ramos and Mónica Muñoz-de-Toro; Methodology:[Guillermina Canesini, Gisela P. Lazzarino and Cora Stoker; Formal analysis and investigation: Guillermina Canesini, and Germán H. Galoppo; Writing - original draft preparation: Guillermina Canesini, Germán H. Galoppo, Yamil E. Tavalieri; Visualization: Guillermina Canesini and Yamil E. Tavalieri; Writing - review and editing: Germán H. Galoppo, Yamil E. Tavalieri, Mónica Muñoz-de-Toro; Funding acquisition: Enrique H. Luque and Mónica Muñoz-de-Toro; Resources: Mónica Muñoz-de-Toro; Supervision: Cora Stoker, Enrique H. Hugo, Jorge G. Ramos and Mónica Muñoz-de-Toro. All authors read and approved the final manuscript. Funding This work was supported by the Argentine National Agency for the Promotion of Science and Technology (ANPCyT; PICT-2011-2031 and PICT 2016-0656), Universidad Nacional del Litoral (CAI + D Program). Cod: 50420150100088LI, the National Scientific and Technical Research Council of Argentina (CONICET; PIP 2021-2023 Cod. 1220200101387CO). Competing interests The authors have no relevant financial or non-financial interests to disclose. Availability of data and materials The datasets compiled and analyzed in the present study are available from the corresponding author on reasonable request. Compliance with ethical standards All procedures and techniques used for egg collection, embryo handling and sampling were performed according to the guidelines of the American Society of Ichthyologists and Herpetologists (ASIH, 2004). All animal experiments were carried out in accordance with the Guide for the Care and Use of Laboratory Animals of the National Research Council (USA) (IPCS, 2002). References ASIH, A.S. of I. and H., 2004. Guidelines for Use of Live Amphibians and Reptiles in Field and laboratory research 1–43. Basopo, N., Muzvidziwa, A., 2020. Assessment of the effects of atrazine, dichlorodiphenyltrichloroethane, and dimethoate on freshwater fish (Oreochromis mossambicus): a case study of the A2 farmlands in Chiredzi, in the southeastern part of Zimbabwe. Environ. Sci. Pollut. Res. 27, 579–586. https://doi.org/10.1007/s11356-019-06569-x Beldomenico, P.M., Rey, F., Prado, W.S., Villarreal, J.C., Muñoz-de-Toro, M., Luque, E.H., 2007. In ovum exposure to pesticides increases the egg weight loss and decreases hatchlings weight of Caiman latirostris (Crocodylia: Alligatoridae). Ecotoxicol. Environ. Saf. 68, 246–251. https://doi.org/10.1016/j.ecoenv.2006.12.018 Boyd-Leinen, P., Gosse, B., Rasmussen, K., Martin-Dani, G., Spelsberg, T.C., 1984. Regulation of nuclear binding of the avian oviduct progesterone receptor. Changes during estrogen-induced oviduct development, withdrawal, and secondary stimulation. J. Biol. Chem. 259, 2411–2421. Brodeur, J.C., Poletta, G.L., Simoniello, M.F., Carriquiriborde, P., Cristos, D.S., Pautasso, N., Paravani, E., Poliserpi, M.B., D’Andrea, M.F., Gonzalez, P. V., Aca, V.L., Curto, A.E., 2021. The problem with implementing fish farms in agricultural regions: A trial in a pampean pond highlights potential risks to both human and fish health. Chemosphere 262, 128408. https://doi.org/10.1016/j.chemosphere.2020.128408 Canesini, G., Stoker, C., Galoppo, G.H., Durando, M.L., Tschopp, M. V., Luque, E.H., Muñoz-de-Toro, M.M., Ramos, J.G., 2018. Temperature- vs. estrogen-induced sex determination in Caiman latirostris embryos: Both females, but with different expression patterns of key molecules involved in ovarian development. Gen. Comp. Endocrinol. 259, 176–188. https://doi.org/10.1016/j.ygcen.2017.11.024 Čikoš, Š., Bukovská, A., Koppel, J., 2007. Relative quantification of mRNA: Comparison of methods currently used for real-time PCR data analysis. BMC Mol. Biol. 8. https://doi.org/10.1186/1471-2199-8-113 Crain, D.A., Guillette, L.J., Rooney, A.A., Pickford, D.B., 1997. Alterations in steroidogenesis in alligators (Alligator mississippiensis) exposed naturally and experimentally to environmental contaminants. Environ. Health Perspect. 105, 528–533. https://doi.org/10.1289/ehp.97105528 Durando, M., Canesini, G., Cocito, L.L., Galoppo, G.H., Zayas, M.A., Luque, E.H., Muñoz-de-Toro, M., 2016. Histomorphological changes in testes of broad-snouted caimans (Caiman latirostris) associated with in ovo exposure to endocrine-disrupting chemicals. J. Exp. Zool. Part A Ecol. Genet. Physiol. 325. https://doi.org/10.1002/jez.1999 Durando, M., Cocito, L., Rodríguez, H.A., Varayoud, J., Ramos, J.G., Luque, E.H., Muñoz-de-Toro, M., 2013. Neonatal expression of amh, sox9 and sf-1 mRNA in Caiman latirostris and effects of in ovo exposure to endocrine disrupting chemicals. Gen. Comp. Endocrinol. 191, 31–38. https://doi.org/10.1016/j.ygcen.2013.05.013 Elkayar, K., Park, J.A., Pineda, M., Westlund, P., Yargeau, V., 2022. Passive sampling and in vitro assays to monitor antiandrogens in a river affected by wastewater discharge. Sci. Total Environ. 804, 150067. https://doi.org/10.1016/j.scitotenv.2021.150067 Ferguson, W.J., Chenier, G., 1983. Introduction for many embryological , teratological , conservation and farming studies ; but to date reliable 143–177. Ferraro, T., Lucas, T., Clémot, M., De Las Heras Chanes, J., Desponds, J., Coppey, M., Walczak, A.M., Dostatni, N., 2016. New methods to image transcription in living fly embryos: the insights so far, and the prospects. WIREs Dev. Biol. 5, 296–310. https://doi.org/10.1002/wdev.221 Forbes, T., 1940. Studies on the reproductive system of the alligator. IV. Observations on the development of the gonad, the adrenal cortex and the Müllerian duct. Embryol, Contrib. Gabriel, W.N., Blumberg, B., Sutton, S., Place, A.R., Lance, V.A., 2001. Alligator aromatase cDNA sequence and its expression in embryos at male and female incubation temperatures. J. Exp. Zool. 290, 439–448. https://doi.org/10.1002/jez.1087 Galoppo, G.H., Stoker, C., Canesini, G., Schierano-Marotti, G., Durando, M., Luque, E.H., Muñoz-de-Toro, M., 2016. Postnatal development and histofunctional differentiation of the oviduct in the broad-snouted caiman (Caiman latirostris). Gen. Comp. Endocrinol. 236. https://doi.org/10.1016/j.ygcen.2016.07.001 Galoppo, G.H., Tavalieri, Y.E., Schierano-Marotti, G., Osti, M.R., Luque, E.H., Muñoz-de-Toro, M.M., 2020. Long-term effects of in ovo exposure to an environmentally relevant dose of atrazine on the thyroid gland of Caiman latirostris. Environ. Res. 186, 109410. https://doi.org/10.1016/j.envres.2020.109410 Giannoukos, G., Callard, I.P., 1996. Radioligand and immunochemical studies of turtle oviduct progesterone and estrogen receptors: Correlations with hormone treatment and oviduct contractility. Gen. Comp. Endocrinol. 101, 63–75. https://doi.org/10.1006/gcen.1996.0008 Gist, D.H., 2011. Hormones and sex ducts and accessory structures of reptiles., in: Hormones and Reproduction in Vertebrates Volume 3: Reptiles. USA, pp. 117–139. Gross, T.S., Crain, D.A., Bjorndal, K.A., Bolten, A.B., Carthy, R.R., 1995. Identification of Sex in Hatchling Loggerhead Turtles (Caretta caretta) by Analysis of Steroid Concentrations in Chorioallantoic/Amniotic Fluid. Gen. Comp. Endocrinol. 99, 204–210. https://doi.org/10.1006/gcen.1995.1103 Hagenfeldt, Y., Eriksson, H.A., 1988. The estrogen receptor in the rat kidney. Ontogeny, properties and effects of gonadectomy on its concentration. J. Steroid Biochem. 31, 49–56. https://doi.org/10.1016/0022-4731(88)90204-X Hayes, T.B., Anderson, L.L., Beasley, V.R., de Solla, S.R., Iguchi, T., Ingraham, H., Kestemont, P., Kniewald, J., Kniewald, Z., Langlois, V.S., Luque, E.H., McCoy, K.A., Muñoz-de-Toro, M., Oka, T., Oliveira, C.A., Orton, F., Ruby, S., Suzawa, M., Tavera-Mendoza, L.E., Trudeau, V.L., Victor-Costa, A.B., Willingham, E., 2011. Demasculinization and feminization of male gonads by atrazine: Consistent effects across vertebrate classes. J. Steroid Biochem. Mol. Biol. 127, 64–73. https://doi.org/10.1016/j.jsbmb.2011.03.015 Hayes, T.B., Stuart, A.A., Mendoza, M., Collins, A., Noriega, N., Vonk, A., Johnston, G., Liu, R., Kpodzo, D., 2006. Characterization of Atrazine-Induced Gonadal Malformations in African Clawed Frogs ( Xenopus laevis ) and Comparisons with Effects of an Androgen Antagonist (Cyproterone Acetate) and Exogenous Estrogen (17β-Estradiol): Support for the Demasculinization/Fe. Environ. Health Perspect. 114, 134–141. https://doi.org/10.1289/ehp.8067 Hess, R.A., Cooke, P.S., 2018. Estrogen in the male: a historical perspective. Biol. Reprod. 99, 27–44. https://doi.org/10.1093/biolre/ioy043 Hora, J., Gosse, B., Rasmussen, K., Spelsberg, T.C., 1986. Estrogen Regulation of the Biological Activity of the Avian Oviduct Progesterone Receptor and Its Ability to Induce Avidin*. Endocrinology 119, 1118–1125. https://doi.org/10.1210/endo-119-3-1118 IPCS, I.P. on C.S., 2002. Global assessment on the state of the science of endocrine disruptors. [WWW Document]. World Heal. Organ. URL https://apps.who.int/iris/handle/10665/67357 Iungman, J., Piña, C.I., Siroski, P., 2008. Embryological development of Caiman latirostris ( Crocodylia : Alligatoridae ). genesis 46, 401–417. https://doi.org/10.1002/dvg.20413 Jones, S., 2011. Hormonal regulation of ovarian function in reptiles, in: Hormones and Reproduction of Vertebrates. Elsevier, Academic Press, Boulder, Colorado, p. 414. Lambeth, L.S., Morris, K.R., Wise, T.G., Cummins, D.M., O’Neil, T.E., Cao, Y., Sinclair, A.H., Doran, T.J., Smith, C.A., 2016. Transgenic Chickens Overexpressing Aromatase Have High Estrogen Levels but Maintain a Predominantly Male Phenotype. Endocrinology 157, 83–90. https://doi.org/10.1210/en.2015-1697 Lazzarino, G.P., Acutain, M.F., Canesini, G., Andreoli, M.F., Ramos, J.G., 2019. Cafeteria diet induces progressive changes in hypothalamic mechanisms involved in food intake control at different feeding periods in female rats. Mol. Cell. Endocrinol. 498, 110542. https://doi.org/10.1016/j.mce.2019.110542 Lazzarino, G.P., Andreoli, M.F., Rossetti, M.F., Stoker, C., Tschopp, M.V., Luque, E.H., Ramos, J.G., 2017. Cafeteria diet differentially alters the expression of feeding-related genes through DNA methylation mechanisms in individual hypothalamic nuclei. Mol. Cell. Endocrinol. 450, 113–125. https://doi.org/10.1016/j.mce.2017.05.005 Luque, E.H., Muñoz-de-Toro, M., 2020. Special issue “Health effects of agrochemicals as Endocrine Disruptors.” Mol. Cell. Endocrinol. 517, 110982. https://doi.org/10.1016/j.mce.2020.110982 Luque, E.H., Muñoz-de-Toro, M., Ramos, J.G., 2018. Estrogenic Agonist, in: Encyclopedia of Reproduction. Elsevier, pp. 753–759. https://doi.org/10.1016/B978-0-12-801238-3.64416-1 Morrish, B.C., Sinclair, A.H., 2002. Vertebrate sex determination: Many means to an end. Reproduction 124, 447–457. https://doi.org/10.1530/rep.0.1240447 Parachú Marcó, M.V., Leiva, P., Iungman, J.L., Simoncini, M.S., Piña, C.I., 2017. New evidence characterizing temperature-dependent sex determination in Broad-snouted Caiman, Caiman latirostris. Herpetol. Conserv. Biol. 12, 78–84. Parker, K.L., Schimmer, B.P., 1997. Steroidogenic Factor 1: A Key Determinant of Endocrine Development and Function. Endocr. Rev. 18, 361–377. https://doi.org/10.1210/edrv.18.3.0301 Prins, G.S., Birch, L., 1997. Neonatal Estrogen Exposure Up-Regulates Estrogen Receptor Expression in the Developing and Adult Rat Prostate Lobes*. Endocrinology 138, 1801–1809. https://doi.org/10.1210/endo.138.5.5106 Rey, F., González, M., Zayas, M.A., Stoker, C., Durando, M., Luque, E.H., Muñoz-de-Toro, M., 2009. Prenatal exposure to pesticides disrupts testicular histoarchitecture and alters testosterone levels in male Caiman latirostris. Gen. Comp. Endocrinol. 162, 286–292. https://doi.org/10.1016/j.ygcen.2009.03.032 Schultz, J.R., Petz, L.N., Nardulli, A.M., 2003. Estrogen receptor α and Sp1 regulate progesterone receptor gene expression. Mol. Cell. Endocrinol. 201, 165–175. https://doi.org/10.1016/S0303-7207(02)00415-X Siegel, S., 1956. Nonparametric Statistics for the Behavioral Sciences. New York. Simoncini, M.S., Leiva, P.M.L., Piña, C.I., Cruz, F.B., 2019. Influence of temperature variation on incubation period, hatching success, sex ratio, and phenotypes in Caiman latirostris. J. Exp. Zool. Part A Ecol. Integr. Physiol. 331, 299–307. https://doi.org/10.1002/jez.2265 Smith, C.A., Joss, J.M.P., 1994. Sertoli cell differentiation and gonadogenesis in Alligator mississippiensis. J. Exp. Zool. 270, 57–70. https://doi.org/10.1002/jez.1402700107 Smith, C.A., Joss, J.M.P., 1993. Gonadal sex differentiation in Alligator mississippiensis, a species with temperature-dependent sex determination. 149–162. Stoker, C., Rey, F., Rodriguez, H., Ramos, J.G., Sirosky, P., Larriera, A., Luque, E.H., Muñoz-De-Toro, M., 2003. Sex reversal effects on Caiman latirostris exposed to environmentally relevant doses of the xenoestrogen bisphenol A. Gen. Comp. Endocrinol. 133, 287–296. https://doi.org/10.1016/S0016-6480(03)00199-0 Tavalieri, Y.E., Galoppo, G.H., Canesini, G., Luque, E.H., Muñoz-de-Toro, M.M., 2020. Effects of agricultural pesticides on the reproductive system of aquatic wildlife species, with crocodilians as sentinel species. Mol. Cell. Endocrinol. 518, 110918. https://doi.org/10.1016/j.mce.2020.110918 Tran, T.K.A., MacFarlane, G.R., Kong, R.Y.C., O’Connor, W.A., Yu, R.M.K., 2016. Potential mechanisms underlying estrogen-induced expression of the molluscan estrogen receptor (ER) gene. Aquat. Toxicol. 179, 82–94. https://doi.org/10.1016/j.aquatox.2016.08.015 Urushitani, H., Katsu, Y., Miyagawa, S., Kohno, S., Ohta, Y., Guillette, L.J., Iguchi, T., 2011. Molecular cloning of anti-Müllerian hormone from the American alligator, Alligator mississippiensis. Mol. Cell. Endocrinol. 333, 190–199. https://doi.org/10.1016/j.mce.2010.12.025 Varayoud, J., Monje, L., Moreno-Piovano, G.S., Galoppo, G.H., Luque, E.H., Muñoz-de-Toro, M., Ramos, J.G., 2012. Sexually dimorphic expression of receptor-alpha in the cerebral cortex of neonatal Caiman latirostris (Crocodylia: Alligatoridae). Gen. Comp. Endocrinol. 179, 205–213. https://doi.org/10.1016/j.ygcen.2012.08.019 Warner, D.A., 2011. Sex Determination in Reptiles, in: Hormones and Reproduction of Vertebrates - Volume 3. Elsevier Inc., pp. 1–38. https://doi.org/10.1016/B978-0-12-374930-7.10001-9 WHO, W.O.H., UNEP, U.N.E., 2012. State-of-the-science of endocrine disrupting chemicals, United Nations Environment Programme and the World Health Organization., Toxicology Letters. Geneva, Switzerland. Zhang, C., Wang, Z., Liu, S., Tan, H., Zeng, D., Li, X., 2022. Analytical method for sequential determination of persistent herbicides and their metabolites in fish tissues by UPLC–MS/MS. Chemosphere 288, 132591. https://doi.org/10.1016/j.chemosphere.2021.132591 Zhu, D., Shi, S., Wang, H., Liao, K., 2009. Growth arrest induces primary-cilium formation and sensitizes IGF-1-receptor signaling during differentiation induction of 3T3-L1 preadipocytes. J. Cell Sci. 122, 2760–2768. https://doi.org/10.1242/jcs.046276 Cite Share Download PDF Status: Published Journal Publication published 06 Jan, 2023 Read the published version in Environmental Science and Pollution Research → Version 1 posted Reviewers agreed at journal 15 Sep, 2022 Reviewers invited by journal 05 Sep, 2022 Editor assigned by journal 12 Aug, 2022 First submitted to journal 08 Aug, 2022 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-1942101","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":134270587,"identity":"c7125373-a928-4fd3-bde6-630660c4cfce","order_by":0,"name":"Guillermina Canesini","email":"","orcid":"","institution":"Universidad Nacional del Litoral Facultad de Bioquimica y Ciencias Biologicas","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Guillermina","middleName":"","lastName":"Canesini","suffix":""},{"id":134270588,"identity":"a727cceb-fc48-48a4-adfe-d9a38caa7220","order_by":1,"name":"Germán Hugo Galoppo","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA+ElEQVRIiWNgGAWjYHACxgMgkp/5DAMziMEHxBKE9IC1SLblQLSwEa3F4BixWuT9Fz848HHHHTnjY7wHPxcwHM5jY2A+eJuHwS4flxbDG88MDs4888zY7BhfsvQMhsPFbAxsydY8DMmWDbi0zDhgcJi37XDitvs9Zsw8DIcT2xh4zKR5GJgNcNoy4/gHsJbNbTwwLfzfgFrqcWqR5++B2LKBDa6Fhw2o5TBOLQYSPAVgv0iA/WKQntjGzGZsOcfgOG5b+o9vfAAKMf42UIhVWCf2szc/vPGmohq3LTcSgPHfcADGBWJmGAOnLQeQtYyCUTAKRsEowAIAIklUjnT6baAAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0002-6249-9690","institution":"Universidad Nacional del Litoral","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Germán","middleName":"Hugo","lastName":"Galoppo","suffix":""},{"id":134270589,"identity":"bbfb39a9-918e-4aef-abed-14634f17f7cc","order_by":2,"name":"Yamil Ezequiel Tavalieri","email":"","orcid":"","institution":"Universidad Nacional del Litoral Facultad de Bioquimica y Ciencias Biologicas","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yamil","middleName":"Ezequiel","lastName":"Tavalieri","suffix":""},{"id":134270590,"identity":"6f9773d1-1c27-45a3-aa89-6ed070f987a9","order_by":3,"name":"Gisela Paola Lazzarino","email":"","orcid":"","institution":"Universidad Nacional del Litoral Facultad de Bioquimica y Ciencias Biologicas","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Gisela","middleName":"Paola","lastName":"Lazzarino","suffix":""},{"id":134270591,"identity":"2bcb8ce5-aa97-4de2-8a18-5e269941b728","order_by":4,"name":"Cora Stoker","email":"","orcid":"","institution":"Universidad Nacional del Litoral Facultad de Bioquimica y Ciencias Biologicas","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Cora","middleName":"","lastName":"Stoker","suffix":""},{"id":134270592,"identity":"26f1ae31-2b3d-468b-9f53-86fe5d05e0df","order_by":5,"name":"Enrique Hugo Luque","email":"","orcid":"","institution":"Universidad Nacional del Litoral Facultad de Bioquimica y Ciencias Biologicas","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Enrique","middleName":"Hugo","lastName":"Luque","suffix":""},{"id":134270593,"identity":"c2a2cd8a-3381-40f5-8977-b879c2b0f2e3","order_by":6,"name":"Jorge Guillermo Ramos","email":"","orcid":"","institution":"Universidad Nacional del Litoral Facultad de Bioquimica y Ciencias Biologicas","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jorge","middleName":"Guillermo","lastName":"Ramos","suffix":""},{"id":134270595,"identity":"8c6ef753-6c09-47b3-9fbc-65eaddea301c","order_by":7,"name":"Mónica Milagros Muñoz-de-Toro","email":"","orcid":"","institution":"Universidad Nacional del Litoral Facultad de Bioquimica y Ciencias Biologicas","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Mónica","middleName":"Milagros","lastName":"Muñoz-de-Toro","suffix":""}],"badges":[],"createdAt":"2022-08-08 16:26:07","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-1942101/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-1942101/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s11356-022-25104-z","type":"published","date":"2023-01-06T18:14:50+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":26213350,"identity":"50f861ae-e0b3-484b-9596-53423a40b55a","added_by":"auto","created_at":"2022-09-08 14:56:22","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":257195,"visible":true,"origin":"","legend":"\u003cp\u003eScheme of experimental design and treatments.\u003c/p\u003e","description":"","filename":"Fig1.doublecolumn.png","url":"https://assets-eu.researchsquare.com/files/rs-1942101/v1/d62cd8bf0d450645c67d54ee.png"},{"id":26213343,"identity":"10700e62-1890-4f42-9aa1-d759f633da93","added_by":"auto","created_at":"2022-09-08 14:56:21","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1002728,"visible":true,"origin":"","legend":"\u003cp\u003eHistological features of the caiman of the developing caiman (Left panel) and germ cell distribution (VASA-positive) (Right panel).\u003c/p\u003e","description":"","filename":"Fig2doublecolumn.png","url":"https://assets-eu.researchsquare.com/files/rs-1942101/v1/da59e02305a9ef0f6f90079f.png"},{"id":26213346,"identity":"88014dd7-ab84-49be-8113-b7139b11de16","added_by":"auto","created_at":"2022-09-08 14:56:21","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":78097,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of ATZ exposure on the expression of ERα and PR in the embryonic male gonads of \u003cem\u003eC. latirostris.\u003c/em\u003e Bars represent mean ± SEM. Greek letters show statistical differences (p\u0026lt;0.05) between TSD-Males. Latin letters show statistical differences between ATZ-Males. Asterisks above the brackets represent statistical differences between TSD-Males and ATZ-Males at the same developmental stage.\u003c/p\u003e","description":"","filename":"Fig3singlecolumn.png","url":"https://assets-eu.researchsquare.com/files/rs-1942101/v1/fef479243843d8f2cf5f1101.png"},{"id":26213404,"identity":"6668b68b-eee0-4ead-adcb-afa050703cba","added_by":"auto","created_at":"2022-09-08 14:56:29","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":127996,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of ATZ exposure on aromatase expression in the developing gonads of \u003cem\u003eC. latirostris\u003c/em\u003e. The bars represent mean ± SEM. The letters above the bars represent statistical differences (p\u0026lt;0.05) between animals belonging to the same experimental group at different developmental stages. Greek letters show statistical differences between TSD-Males. Latin letters show statistical differences between ATZ-Males. Asterisks above the brackets represent statistical differences between TSD-Males and ATZ-Males.\u003c/p\u003e","description":"","filename":"Fig4singlecolumn.png","url":"https://assets-eu.researchsquare.com/files/rs-1942101/v1/ea8dbba729e62ba675ecf013.png"},{"id":26213347,"identity":"7a35a50f-45ee-461b-bdd6-55630217cad2","added_by":"auto","created_at":"2022-09-08 14:56:22","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":70448,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of ATZ exposure on proliferative activity in the developing gonads of \u003cem\u003eC. latirostris\u003c/em\u003e. Bars represent the mean ± SEM. Different Greek letters above the bars represent statistical differences (p\u0026lt;0.05) between TSD-Males at different developmental stages. Different Latin letters above the bars show statistical differences between ATZ-Males at different developmental stages. The asterisk above the brackets represents significant differences between DST-Males and ATZ-Males at the same stage of development.\u003c/p\u003e","description":"","filename":"Fig5singlecolumn.png","url":"https://assets-eu.researchsquare.com/files/rs-1942101/v1/6ffd59fb669d34f880401310.png"},{"id":26213351,"identity":"bd282213-958a-45c4-a6e2-a8421fa9ddde","added_by":"auto","created_at":"2022-09-08 14:56:22","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":541892,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of ATZ exposure on the expression of key genes involved in \u003cem\u003eC. latirostris\u003c/em\u003e embryo sex differentiation. \u003cstrong\u003eA:\u003c/strong\u003e \u003cem\u003eamh\u003c/em\u003e, \u003cstrong\u003eB:\u003c/strong\u003e \u003cem\u003eCyp19-a1\u003c/em\u003e \u003cstrong\u003eC:\u003c/strong\u003e \u003cem\u003eSf-1\u003c/em\u003e \u003cstrong\u003eD:\u003c/strong\u003e \u003cem\u003eSox-9\u003c/em\u003e. Values represent the mean ± SEM. Asterisks indicate significant differences (p\u0026lt;0.05) between TSD-males and ATZ-males at each stage of embryonic development. Greek letters show differences between TSD-Males. Latin letters show differences between ATZ-Males.\u003c/p\u003e","description":"","filename":"Fig6doublecolumn.png","url":"https://assets-eu.researchsquare.com/files/rs-1942101/v1/e1cfa76c9801472d353587e4.png"},{"id":44716106,"identity":"51fb420c-6278-4ee0-bdfa-ec492148a624","added_by":"auto","created_at":"2023-10-16 18:23:18","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2531082,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1942101/v1/3374f166-35b4-492d-b35b-b8a5e43bdc40.pdf"}],"financialInterests":"","formattedTitle":"Disruption of the developmental programming of the gonad of the broad snouted caiman (Caiman latirostris) after in ovo exposure to atrazine.","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eMany environmental compounds have been classified as endocrine-disrupting chemicals (EDCs), as they have the potential to interfere with the endocrine system (WHO and UNEP, 2012). Over the last decades, endocrine disruption has been described as a matter of environmental health concern because EDC exposure alters development, reproduction, and endocrine physiology in almost all species studied (Luque et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Luque and Mu\u0026ntilde;oz-de-Toro, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The herbicide atrazine (ATZ) is among the environmental substances classified as EDCs due to its estrogenic, anti-androgenic and thyroid-disrupting activity (Elkayar et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Galoppo et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Hayes et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Although the half-life time of ATZ is relatively short when compared to pollutants classified as persistent, and its physicochemical properties do not favor bioaccumulation, the presence of ATZ in groundwater, freshwater, sea water, soil, and animal tissues (Tavalieri et al., \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) evidences its wide and continuous environmental input as well as its large dispersal rate. Thus, wildlife species that are not target of herbicides can be exposed to ATZ. Since the sexual differentiation of the reproductive system depends upon precise exposure to sex steroid hormones at specific times during development, exposure to low doses of ATZ during these hormone-sensitive critical periods of development can alter the developmental programming and lead to long-term deleterious effects on the adult organism.\u003c/p\u003e \u003cp\u003eThe broad snouted caiman (\u003cem\u003eCaiman latirostris\u003c/em\u003e) is a South American crocodilian species highly sensitive to EDC exposure, widely distributed in wetlands of Argentina, Brazil, Paraguay, and Uruguay. This species shows temperature-dependent sex determination (TSD): embryos developed at 33\u0026deg;C result in phenotypic males, whereas embryos developed at 30\u0026deg;C result in phenotypic females (Stoker et al., \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2003\u003c/span\u003e). In TSD species, temperature is an environmental factor that initiates a cascade of molecular events that lead the undifferentiated gonad to acquire the female or male phenotype. This process is defined as sex determination (Warner, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Once sex determination is initiated, sex differentiation (defined as the histomorphological changes that lead to the development of a specialized set of organs) takes place. Sex determination and differentiation involve hormones, hormone receptors, steroidogenic enzymes, and genes such as \u003cem\u003eamh\u003c/em\u003e (the anti-M\u0026uuml;llerian hormone-encoding gene), \u003cem\u003esox-9\u003c/em\u003e (which encodes a transcription factor that controls the anti-M\u0026uuml;llerian hormone gene), \u003cem\u003esf-1\u003c/em\u003e (which encodes the steroidogenic factor 1, which regulates the transcription of key genes involved in sexual development and reproduction), and \u003cem\u003ecyp19-a1\u003c/em\u003e (which encodes the enzyme aromatase) (Durando et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Warner, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Moreover, the expression of proteins such as ATP-dependent RNA helicase (VASA) (to identify germ cells), estrogen receptor (ER) and progesterone receptor (PR) (biomarkers of hormone-dependence), Proliferating Cellular Nuclear Antigen (PCNA) (to assess proliferative activity), and the enzyme aromatase (steroidogenic enzyme) is useful to study gonadal histofunctional differentiation (Canesini et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Noteworthy, in TSD species, there is a critical window of time, named thermosensitive period, in which the embryonic sex remains labile and can be modified by environmental cues (Warner, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Such cues may include EDC exposure. In our previous studies in \u003cem\u003eC. latirostris\u003c/em\u003e, we demonstrated that, when exposed to EDCs such as 17β-Estradiol or bisphenol A during the thermosensitive period, embryos developed at the male-producing temperature (MPT) produced phenotypic females (Stoker et al., \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2003\u003c/span\u003e). We also found that exposure to ATZ did not affect phenotypic sex (Beldomenico et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2007\u003c/span\u003e), but induced gonadal alterations in 10-day-old postnatal male caimans (Rey et al., \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). Considering these findings, in the present study, we hypothesized that ATZ exposure in embryos developed at the MPT induces early modifications in key developmental genes and/or molecules that lead to histomorphological alterations observed in the gonads, long after exposure ended. To test this hypothesis, we firstly studied the expression of key developmental molecules and genes in the gonads of unexposed embryos developed at the MPT or female-producing temperature (FPT) and secondly studied the effect of ATZ exposure on these molecules and genes in the gonads of embryos developed at the MPT.\u003c/p\u003e"},{"header":"2. Materials And Methods","content":"\u003cdiv class=\"Section2\" id=\"Sec3\"\u003e\n \u003ch2\u003e2.1. Egg collection and experimental design\u003c/h2\u003e\n \u003cp\u003eEggs were collected and incubated as described in Canesini et al., (\u003cspan class=\"CitationRef\"\u003e2018\u003c/span\u003e). Briefly, \u003cem\u003eC. latirostris\u003c/em\u003e eggs (n\u0026thinsp;=\u0026thinsp;120) were collected shortly after oviposition from seven nests randomly selected in a protected area (Natural Reserve \u0026lsquo;\u0026lsquo;El Cachap\u0026eacute;\u0026rsquo;\u0026rsquo;) of Chaco Province, Argentina, and transported to the laboratory. Since the objectives of the present work were to study the molecules and genes involved in the processes of temperature-dependent sex determination and differentiation and to study the effects of ATZ exposure on sex-determination and differentiation-related molecules and genes, eggs were divided into three experimental groups, and embryos were obtained at different developmental stages (Fig. 1). The groups were as follows: Temperature-sex determined females (TSD-Females, embryos (n\u0026thinsp;=\u0026thinsp;40) obtained from eggs incubated at 30\u0026deg;C, which is the FPT), temperature-sex-determined males (TSD-Males, embryos (n\u0026thinsp;=\u0026thinsp;40) obtained from eggs incubated at 33\u0026deg;C, which is the MPT), and ATZ-Males (embryos (n\u0026thinsp;=\u0026thinsp;40) obtained from eggs incubated at the MPT and exposed to ATZ immediately before sex differentiation). To avoid biased responses to treatment due to clutch-related differences, eggs from each clutch were equally distributed in all experimental groups.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec4\"\u003e\n \u003ch2\u003e2.2. Assessment of the embryo developmental stage (DS) and treatment\u003c/h2\u003e\n \u003cp\u003eRecently laid eggs allowed us to obtain sexually undifferentiated embryos plausible to be TSD, as well as to minimize environmental egg exposure that could affect experimental results. Before egg collection, recent oviposition was checked by determining the embryo DS by following the criteria previously described (Iungman et al., \u003cspan class=\"CitationRef\"\u003e2008\u003c/span\u003e). Only eggs from nests showing embryos at DS lower than 15 were collected. Once in the lab, the eggs were incubated at 30 or 33\u0026deg;C. Based on our experience in developmental timing at 30\u0026deg;C and 33\u0026deg;C, the DS was checked frequently until stages 20, 22, 24 or 27. Eggs were treated at DS 20 (prior to sex determination). Treatments were applied topically as previously described (Stoker et al., \u003cspan class=\"CitationRef\"\u003e2003\u003c/span\u003e). For ATZ exposure, a single dose of 0.2 ppm of ATZ (96% purity, Icona S.A., Argentina) diluted in absolute ethanol (purity\u0026thinsp;\u0026ge;\u0026thinsp;99.9%, Merck, Germany) was applied to the eggshell (ATZ-Males). To expose the egg to 0.2 \u0026micro;g of ATZ per kg of egg (0.2 ppm), the volume of the ethanol solution of ATZ was adjusted to the mass of the egg at the moment of treatment. For control groups (TSD-Males and TSD-Females), 50 \u0026micro;L of absolute ethanol (purity\u0026thinsp;\u0026ge;\u0026thinsp;99.9%, Merck) was applied topically. The dose of ATZ used is considered environmentally relevant since it corresponds with tissue levels of ATZ reported in environmentally exposed fishes (Basopo and Muzvidziwa, \u003cspan class=\"CitationRef\"\u003e2020\u003c/span\u003e; Brodeur et al., \u003cspan class=\"CitationRef\"\u003e2021\u003c/span\u003e; Zhang et al., \u003cspan class=\"CitationRef\"\u003e2022\u003c/span\u003e). Additionally, we have previously demonstrated that the use of ethanol as vehicle causes no effect on caimans (Stoker et al., \u003cspan class=\"CitationRef\"\u003e2003\u003c/span\u003e). After treatment, incubation continued until DS 22, 24 or 27 (Fig. 1).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec5\"\u003e\n \u003ch2\u003e2.3. Sampling and processing\u003c/h2\u003e\n \u003cp\u003eTwelve animals from each experimental group were euthanized at DS 22, 24 or 27. To obtain the Gonad-Adrenal-Mesonephric (GAM) complexes, different protocols were followed according to the experimental purpose. To study gene expression, immediately after euthanasia, the GAM complexes were dissected using a stereomicroscope (Stemi 305 Zeiss, Carl Zeiss Microscopy, Germany) in RNAse-free conditions. Immediately after dissection, the GAM complexes were placed ventral side up on a cold sterilized aluminium foil in close contact with dry ice to be flash frozen. After flash-freezing, the samples were wrapped in the sterile aluminium foil and stored at -80 \u0026ordm;C until gonad isolation and RNA extraction.\u003c/p\u003e\n \u003cp\u003eFor histomorphological and histofunctional studies, the GAM complexes were fixed in formalin-buffered solution (10% phosphate-buffered formalin, pH 7.4) for 6 h at room temperature, rinsed in phosphate buffer saline solution (PBS pH 7.5), dehydrated in an ascending ethanol series, cleared in xylene, and embedded in paraffin.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec6\"\u003e\n \u003ch2\u003e2.4. Histomorphological features of the gonad and biomarkers of histofunctional differentiation\u003c/h2\u003e\n \u003cp\u003eFor histomorphological studies, 5-\u0026micro;m-thick histological sections of the embryo GAM complex were stained using the trichromic picrosirius/hematoxylin staining technique, as previously described (Canesini et al., \u003cspan class=\"CitationRef\"\u003e2018\u003c/span\u003e). Serial sections were studied to evaluate the presence of sex-defining structures (Ferguson and Chenier, \u003cspan class=\"CitationRef\"\u003e1983\u003c/span\u003e; Forbes, \u003cspan class=\"CitationRef\"\u003e1940\u003c/span\u003e). All histological evaluations were performed in at least three sections separated 300 \u0026micro;m from each other.\u003c/p\u003e\n \u003cp\u003eThe expression of proteins such as VASA, ER, PR, and PCNA and the enzyme aromatase, useful to study gonadal histofunctional differentiation, was assessed by immunohistochemistry (IHC) using immunoperoxidase staining. IHC was performed as previously described (Canesini et al., \u003cspan class=\"CitationRef\"\u003e2018\u003c/span\u003e; Galoppo et al., \u003cspan class=\"CitationRef\"\u003e2016\u003c/span\u003e; Varayoud et al., \u003cspan class=\"CitationRef\"\u003e2012\u003c/span\u003e). All the antibodies used (Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e) were previously characterized and used in caiman tissues (Canesini et al., \u003cspan class=\"CitationRef\"\u003e2018\u003c/span\u003e; Galoppo et al., \u003cspan class=\"CitationRef\"\u003e2016\u003c/span\u003e; Varayoud et al., \u003cspan class=\"CitationRef\"\u003e2012\u003c/span\u003e).\u003c/p\u003e\u0026nbsp;\u003ctable border=\"1\" id=\"Tab1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eAntibodies used for immunohistochemistry.\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eTarget protein\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSupplier\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003ePrimary Antibodies\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eAnimal Source\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eDilutions used\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ePCNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNovocastra,\u003c/p\u003e\n \u003cp\u003e(Newcastle, UK)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAnti-PCNA\u003c/p\u003e\n \u003cp\u003e(Clone PC-10)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eMouse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:2000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eVASA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSanta Cruz Biotechnology (Santa Cruz, CA, USA)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAnti-VASA H-80 (Code sc67185)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eRabbit\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:200\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eER\u0026alpha;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLETH-ISAL\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003cp\u003e(Santa Fe, Argentina)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAnti-ER\u003c/p\u003e\n \u003cp\u003e(LETH-ER 202Y)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eRabbit\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:200\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ePR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDAKO Corp.\u003c/p\u003e\n \u003cp\u003e(Carpinteria, CA, USA)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAnti-PR\u003c/p\u003e\n \u003cp\u003e(Code A0098)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eRabbit\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:300\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAromatase\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLETH-ISAL\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003cp\u003e(Santa Fe, Argentina)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAnti-Aromatase\u003c/p\u003e\n \u003cp\u003e(LETH-AROMy)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eRabbit\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:2000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003ctfoot\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"5\"\u003ePCNA: Proliferating Cellular Nuclear Antigen; VASA: ATP-dependent RNA helicase; ER\u0026alpha;: Estrogen Receptor alpha; PR: Progesterone Receptor. LETH-ISAL: Laboratorio de Endocrinolog\u0026iacute;a y Tumores Hormonodependientes- Instituto de Salud y Ambiente del Litoral. \u003csup\u003ea\u003c/sup\u003e Varayoud et al., \u003cspan class=\"CitationRef\"\u003e2012\u003c/span\u003e. \u003csup\u003eb\u003c/sup\u003e Canesini et al., \u003cspan class=\"CitationRef\"\u003e2018\u003c/span\u003e.\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tfoot\u003e\n \u003c/table\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cdiv class=\"Section3\" id=\"Sec7\"\u003e\n \u003ch2\u003e2.4.1. Image analysis and quantification of molecules revealed by IHC\u003c/h2\u003e\n \u003cp\u003eImage analysis was performed on digital images recorded using the ImageJ/Fiji 1.46 software as previously described. Briefly, the whole gonadal area and the immunostained area were determined (Varayoud et al., \u003cspan class=\"CitationRef\"\u003e2012\u003c/span\u003e). The expression levels of ER\u0026alpha;, PR, aromatase and PCNA were quantified as the percentage of the gonadal area occupied by each marker (Canesini et al., \u003cspan class=\"CitationRef\"\u003e2018\u003c/span\u003e). A threshold based on the intensity of the immunostaining was set for the PCNA-positive area (Durando et al., \u003cspan class=\"CitationRef\"\u003e2016\u003c/span\u003e). VASA was assessed qualitatively to describe the spatial distribution of germ cells.\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec8\"\u003e\n \u003ch2\u003e2.5. Expression of key developmental genes in the embryonic gonad\u003c/h2\u003e\n \u003cdiv class=\"Section3\" id=\"Sec9\"\u003e\n \u003ch2\u003e2.5.1. Isolation of gonadal tissue for RNA extraction and gene quantification\u003c/h2\u003e\n \u003cp\u003eGonadal tissue was isolated from the GAM complex by using the microdissection technique previously described (Lazzarino et al., \u003cspan class=\"CitationRef\"\u003e2019\u003c/span\u003e), modified and adapted for caiman embryo samples. Briefly, GAM samples stored at -80\u0026deg;C were embedded in an OCT cryo-embedding matrix (CRYOPLAST\u0026reg; Biopack, Argentina) and 300-\u0026micro;m-thick GAM serial transverse sections were obtained using a cryostat (Leica CM 1860, Leica Biosystems, IL, USA) at an operating temperature of -20\u0026ordm;C. Once obtained, the GAM sections were placed on previously cooled glass sterile slides and observed using a dissecting microscope (Stemi 305, Zeiss, Oberkochen, Germany). The gonads were identified by histological and morphological criteria and then isolated from the rest of the structures of the GAM complex. Sterile stainless steel microdissection needles of 0.5 mm internal diameter were used for the isolation of the gonads of embryos at DS 22, while microdissection needles of 1.0 mm internal diameter were used for the isolation of the gonads of embryos at DS 24 and 27. Gonads were removed bilaterally, and microdissected sections were immersed in total RNA isolation reagent (TRIzol\u0026trade; Invitrogen, Carlsbad, CA, USA) and stored at -80\u0026ordm;C until RNA extraction.\u003c/p\u003e\n \u003cp\u003eTo make sure that all the sections obtained by the microdissection technique belonged to the gonad, the remaining tissue was histologically inspected. The remaining GAM sections were thawed, and the microdissection holes were located. Since the gonadal tissue is surrounded by a layer of connective tissue and shows characteristics that make it perfectly distinguishable from the rest of the structures that constitute the GAM complex, we checked that no tissue outside of the gonad limits had been removed.\u003c/p\u003e\n \u003cp\u003eEach microdissected gonad from each individual animal (between 10 and 20 punches, depending on the DS of the embryo) was processed and analysed as a single data point, as previously described (Lazzarino et al., \u003cspan class=\"CitationRef\"\u003e2017\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv class=\"Section3\" id=\"Sec10\"\u003e\n \u003ch2\u003e2.5.2. RNA extraction, reverse transcription, and real-time quantitative polymerase chain reaction (PCR) analysis\u003c/h2\u003e\n \u003cp\u003eTotal RNA was isolated from microdissected gonadal tissue stored at -80\u0026deg;C using TRizol reagent (Invitrogen, Carlsbad, CA, USA). The concentration and purity of RNA were determined by measuring the absorbance at \u0026lambda;\u0026thinsp;=\u0026thinsp;260nm and \u0026lambda;\u0026thinsp;=\u0026thinsp;280nm in a NanoDrop Lite Spectrophotometer (Thermo Scientific, Wilmington, DE, USA).\u003c/p\u003e\n \u003cp\u003eGene quantification was performed using a two-step quantitative reverse transcriptase PCR by the standard curve method (Čiko\u0026scaron; et al., \u003cspan class=\"CitationRef\"\u003e2007\u003c/span\u003e). Firstly, equal quantities (0.5 \u0026micro;g) of total RNA from each sample were reverse-transcribed into copy DNA (cDNA) with Moloney Murine Leukemia Virus reverse transcriptase (200 units; Promega, Madison, WI, USA), by using 200 pmol of random primers (Promega, Madison, WI, USA), 20 units of the ribonuclease inhibitor RNAout (Invitrogen Argentina, Buenos Aires, Argentina) and 100 nmol of a deoxynucleotide triphosphate (dNTP) mixture. The final volume of each reverse transcription reaction tube was adjusted to 30 \u0026micro;L with 1X reverse transcriptase buffer. Reverse transcription PCR was performed at 37\u0026deg; C for 90 min and at 42\u0026deg; C for 15 min. Finally, the reaction was stopped by heating at 80\u0026deg; C for 5 min followed by rapid cooling on ice bath.\u003c/p\u003e\n \u003cp\u003eOnce the cDNA was obtained, the mRNA expression of four selected genes (\u003cem\u003eamh\u003c/em\u003e, \u003cem\u003esox-9\u003c/em\u003e, \u003cem\u003esf-1\u003c/em\u003e and \u003cem\u003ecyp19-a1\u003c/em\u003e) was quantified by real-time PCR. For this purpose, each reverse-transcribed product was diluted with RNAse-free water to a final volume of 60 \u0026micro;L and amplified by the Real-Time DNA Step One Cycler (Applied Biosystems Inc., Foster City, CA, USA) using previously designed primers (Durando et al., \u003cspan class=\"CitationRef\"\u003e2013\u003c/span\u003e). L8 (60S ribosomal protein L8) from \u003cem\u003eAlligator mississippiensis\u003c/em\u003e, a species related to \u003cem\u003eC. latirostris\u003c/em\u003e, was used as housekeeping gene. The characteristic of the primers used are shown in Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e. For cDNA amplification, 5 \u0026micro;L of cDNA was combined with HOT FIREPol Eva Green qPCR Mix Plus (Solis BioDyne; Estonia) and 10 pmol of each primer (Invitrogen, Carlsbad, CA, USA) to a final volume of 20 \u0026micro;L using RNAse-free water. Negative DNA template controls were included in all the assays using 5 \u0026micro;L of sterile RNAse-free water instead of cDNA. After initial denaturation at 95\u0026deg;C for 15 min, the reaction mixture was subjected to successive cycles of denaturation at 95\u0026deg;C for 15 s, and annealing and extension at specific temperatures for each gene for 15 s. The relative expression levels of each target were calculated based on the cycle threshold (CT), which was calculated for each sample using the StepOne Software (Applied Biosystems Inc. Foster City, CA, USA) with an automatic threshold setting. Standard curves for each target gene as well as for the housekeeping gene were performed using eight serial dilutions of a pool cDNA containing equal amounts of cDNA from samples of different experimental groups. The optimal dilution of work for each gene tested was fixed based on the results obtained from the standard curves. Results are expressed as fold change in the expression of each target gene in relation to the housekeeping gene. Product purity was confirmed by dissociation curves provided by the StepOne Software and random samples were subjected to agarose gel electrophoresis.\u003c/p\u003e\u0026nbsp;\u003ctable border=\"1\" id=\"Tab2\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003ePrimers and PCR conditions\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eGene\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eGenBank\u003c/p\u003e\n \u003cp\u003eID\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSense Primer (5\u0026acute;-3\u0026acute;)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eAnti-sense Primer (5\u0026acute;-3\u0026acute;)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSize (bp)\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eamh\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAF180294\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTCCACCCGTGCCGACTACTA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCAGAGTATTGGACGGGCACG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e106\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSox-9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAF106572\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGCTCGGAGCAAACCCACAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTGCCAGGCTGGACGTCTGTT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e172\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSf-1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAF180296\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGCTCCATCCTGAACAACCT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTTGAGGCAGACGAACTCCTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e95\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCyp19-a1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAY029233.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTGGAGATGATGATCGCTGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTGGCATGTCATCGCTCTGTA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e152\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eL8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eES316580.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCACGACCAGCCTTTAAGATA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTCACAATCCTGAAACCAAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e141\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec11\"\u003e\n \u003ch2\u003e2.6. Statistical analysis\u003c/h2\u003e\n \u003cp\u003eData are reported as the median and range or mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM. To determine normality, Shapiro-Wilk normality test followed by a Levene variance homogeneity test were performed. Statistical analyses were performed using Mann\u0026ndash;Whitney U test and Kruskal\u0026ndash;Wallis analysis of variance followed by Dunn\u0026rsquo;s test as a \u003cem\u003epost hoc\u003c/em\u003e test to determine significant differences (Siegel, \u003cspan class=\"CitationRef\"\u003e1956\u003c/span\u003e). The Q-test was performed to evaluate the presence of outliers that characterize the \u0026lsquo;\u0026lsquo;clutch effect\u0026rdquo;. In all cases, differences were considered significant at p\u0026thinsp;\u0026lt;\u0026thinsp;0.05. For all the analyses, the IBM SPSS Statistics 19 software (IBM Inc.) was used.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv class=\"Section2\" id=\"Sec13\"\u003e\n \u003ch2\u003e3.1. Temperature sex determination and embryonic gonadal differentiation\u003c/h2\u003e\n \u003cdiv class=\"Section3\" id=\"Sec14\"\u003e\n \u003ch2\u003e3.1.1. Gonadal histology and germ cell distribution\u003c/h2\u003e\n \u003cp\u003eAs previously reported, all embryos from eggs incubated at 33\u0026deg;C were males (TSD-Males), whereas those from eggs incubated at 30\u0026deg;C were females (TSD-Females). At DS 22, the gonads of both TSD-Females and TSD-Males showed a well-defined compartmentalization characterized by a cortex and a medulla. The cortex is defined by an external cuboidal-to-flat epithelium composed of cells with homogeneously and intensely blue-stained nuclei. The medulla underlies the cortex and is formed by medullary cells arranged in groups or cords surrounded by loose connective tissue. The medullary cords are, in turn, formed by two morphologically different types of cells: cells with homogeneously dark blue-stained nuclei and few cytoplasm and cells with heterogeneously violet-stained nuclei with decreased nuclei/cytoplasm ratio. The latter type of cells may be isolated or grouped in clusters dispersed in the underlying stroma or at the coelomic border. The loose connective tissue shows zones with empty spaces (Fig.\u0026nbsp;1). No signs of gonadal sex differentiation were observed at this DS.\u003c/p\u003e\n \u003cp\u003eIn the present work, we confirmed the gonadal histological features previously described for TSD-Females at DSs 24 and 27 (Canesini et al., \u003cspan class=\"CitationRef\"\u003e2018\u003c/span\u003e). At DS 24, as shown in Fig.\u0026nbsp;1, the medulla of TSD-Males shows a more compact appearance with fewer empty spaces than that of TSD-Females. Both sexes showed an increased number of cells with heterogeneously violet-stained nuclei and a decreased nuclei/cytoplasm ratio either isolated among interstitial tissue or forming clusters. Besides, in the gonads of TSD-Males, the medullary cords acquire a tubular-like appearance with an empty lumen.\u003c/p\u003e\n \u003cp\u003eAt DS 27, the gonads of the TSD-Male embryos showed the presence of tubular structures, which were formed by an epithelium and a central lumen occupied by a substance of foamy appearance. The epithelium is composed of both types of cells previously described (cells with heterogeneously violet-stained nuclei with decreased nuclei/cytoplasm ratio and cells with homogeneously dark blue-stained nuclei and little cytoplasm). The tubular structures are, in turn, surrounded by interstitial tissue containing enlarged cells together with cells with rounded nuclei in the proximities of the tubules (Fig.\u0026nbsp;2).\u003c/p\u003e\n \u003cp\u003eVASA-expressing cells were present at all the DSs studied both in TSD-Females and TSD-Males. At stage 22, immune-stained cells were observed both in the cortex and as clusters in the medulla. As development took place, both in TSD-Males and Females, the VASA-positive cells moved away from the external cortical epithelium and occupied more central positions in the developing gonad (Fig. 2).\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv class=\"Section3\" id=\"Sec15\"\u003e\n \u003ch2\u003e3.1.2. Expression of hormonal receptors\u003c/h2\u003e\n \u003cp\u003eER\u0026alpha; expression levels in males and females were significantly different at all DSs studied. In TSD-Females, ER\u0026alpha; expression showed no changes throughout the DSs evaluated, whereas in TSD-Males, ER\u0026alpha; expression was high at DSs 22 and 24 and then decreased significantly at DS 27 (Table \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e), thus exhibiting a sexually dimorphic pattern.\u003c/p\u003e\u0026nbsp;\u003ctable border=\"1\" id=\"Tab3\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eExpression of biomarkers of gonadal histofunctional differentiation\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\u0026nbsp;\u003c/th\u003e\n \u003cth align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003eDS 22\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003eDS 24\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003eDS 27\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTSD-Females\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTSD-Males\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTSD-Females\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTSD-Males\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTSD-Females\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTSD-Males\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eER\u0026alpha;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e8.357\u0026thinsp;\u0026plusmn;\u0026thinsp;1.048\u003csup\u003ea,\u0026alpha;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e15.94\u0026thinsp;\u0026plusmn;\u0026thinsp;3.450\u003csup\u003eb,\u0026alpha;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6.729\u0026thinsp;\u0026plusmn;\u0026thinsp;0.957\u003csup\u003ea,\u0026alpha;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e17.87\u0026thinsp;\u0026plusmn;\u0026thinsp;2.315\u003csup\u003eb,\u0026alpha;,\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6.799\u0026thinsp;\u0026plusmn;\u0026thinsp;0.609\u003csup\u003ea,\u0026alpha;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.563\u0026thinsp;\u0026plusmn;\u0026thinsp;0.528\u003csup\u003eb,\u0026beta;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ePR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.402\u0026thinsp;\u0026plusmn;\u0026thinsp;0.146\u003csup\u003ea,\u0026alpha;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.069\u0026thinsp;\u0026plusmn;\u0026thinsp;0.035\u003csup\u003eb,\u0026alpha;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.511\u0026thinsp;\u0026plusmn;\u0026thinsp;0.255\u003csup\u003ea,\u0026alpha;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.351\u0026thinsp;\u0026plusmn;\u0026thinsp;0.162\u003csup\u003ea,\u0026alpha;\u0026beta;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.864\u0026thinsp;\u0026plusmn;\u0026thinsp;0.169\u003csup\u003ea,\u0026alpha;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.965\u0026thinsp;\u0026plusmn;\u0026thinsp;0.785\u003csup\u003eb,\u0026beta;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAromatase\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e15.24\u0026thinsp;\u0026plusmn;\u0026thinsp;1.321\u003csup\u003ea,\u0026alpha;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.428\u0026thinsp;\u0026plusmn;\u0026thinsp;0.281\u003csup\u003eb,\u0026alpha;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9.911\u0026thinsp;\u0026plusmn;\u0026thinsp;1.012\u003csup\u003ea,\u0026alpha;\u0026beta;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.209\u0026thinsp;\u0026plusmn;\u0026thinsp;0.077\u003csup\u003eb,\u0026alpha;\u0026beta;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5.740\u0026thinsp;\u0026plusmn;\u0026thinsp;0.673\u003csup\u003ea,\u0026beta;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.466\u0026thinsp;\u0026plusmn;\u0026thinsp;0.243\u003csup\u003eb,\u0026beta;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ePCNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.044\u0026thinsp;\u0026plusmn;\u0026thinsp;0.005\u003csup\u003ea,\u0026alpha;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.239\u0026thinsp;\u0026plusmn;\u0026thinsp;0.608\u003csup\u003eb,\u0026alpha;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.334\u0026thinsp;\u0026plusmn;\u0026thinsp;0.112\u003csup\u003ea,\u0026beta;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.541\u0026thinsp;\u0026plusmn;\u0026thinsp;0.053\u003csup\u003ea,\u0026alpha;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.142\u0026thinsp;\u0026plusmn;\u0026thinsp;0.056\u003csup\u003ea,\u0026alpha;\u0026beta;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.787\u0026thinsp;\u0026plusmn;\u0026thinsp;0.602\u003csup\u003eb,\u0026alpha;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003ctfoot\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"7\"\u003eThe values represent the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM. The different Latin letters indicate significant differences (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) between TSD-Females and TSD-Males at each DS. Different Greek letters indicate significant differences (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) between males and females along the three DSs studied.\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tfoot\u003e\n \u003c/table\u003e\n \u003cp\u003e\u003c/p\u003e\n \u003cp\u003ePR expression levels were low. Similar to that observed for ER\u0026alpha;, in TSD-Females, PR expression remained at a relatively constant level throughout the DSs studied (Table \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e), whereas in TSD-Males, PR expression showed a sustained increase as development took place (Table \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv class=\"Section3\" id=\"Sec16\"\u003e\n \u003ch2\u003e3.1.3. Aromatase expression\u003c/h2\u003e\n \u003cp\u003eA multi-dotted cytoplasmic pattern of immunostaining compatible with aromatase mitochondrial location was observed in the gonads of \u003cem\u003eC. latirostris\u003c/em\u003e embryos at all the DSs studied. Both TSD-Females and TSD-Males exhibited a gradually decreasing pattern of aromatase expression as development advanced. However, when compared with TSD-Females, TSD-Males showed significantly lower levels of aromatase expression throughout all the DSs studied (Table \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv class=\"Section3\" id=\"Sec17\"\u003e\n \u003ch2\u003e3.1.4. Proliferative activity\u003c/h2\u003e\n \u003cp\u003eAs shown in Table \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e, at DSs 22 and 27, proliferative activity, evaluated by PCNA expression, was significantly higher in male gonads than in female gonads. TSD-Female gonads showed an increase in the proliferative activity from DS 22 to 24, followed by a decrease at DS 27, whereas male gonads showed no differences in proliferative activity from DS 22 to DS 27.\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv class=\"Section3\" id=\"Sec18\"\u003e\n \u003ch2\u003e3.1.5. Isolation of the embryonic gonad from the GAM complex and expression of key developmental genes\u003c/h2\u003e\n \u003cp\u003eThe incorporation of the microdissection technique to isolate the gonad from the GAM complex allowed obtaining enough amount of gonad RNA from embryos even at DS 22. Additionally, the use of this technique prevents the presence of adrenal and mesonephric tissues that could mask differences between males and females at early DSs.\u003c/p\u003e\n \u003cp\u003eRegarding the expression of the key developmental genes studied, results were as follows:\u003c/p\u003e\n \u003cp\u003eThe relative expression of \u003cem\u003eamh\u003c/em\u003e in TSD-Females remained low and showed no changes throughout the DSs studied, whereas that in TSD-Males increased significantly from DS 22 to DS 24. In addition, the relative expression of \u003cem\u003eamh\u003c/em\u003e in TSD-Males was higher than that in TSD-Females throughout the whole period studied (Table \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e\u0026nbsp;\u003ctable border=\"1\" id=\"Tab4\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eExpression of key developmental genes in the gonad of \u003cem\u003eCaiman latirostris\u003c/em\u003e embryos.\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\u0026nbsp;\u003c/th\u003e\n \u003cth align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003eDS 22\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003eDS 24\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003eDS 27\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTSD-Females\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTSD-Males\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTSD-Females\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTSD-Males\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTSD-Females\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTSD-Males\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eamh\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.578\u0026thinsp;\u0026plusmn;\u0026thinsp;0.525\u003csup\u003ea,\u0026alpha;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e22.04\u0026thinsp;\u0026plusmn;\u0026thinsp;3.918\u003csup\u003eb,\u0026alpha;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.650\u0026thinsp;\u0026plusmn;\u0026thinsp;0.322\u003csup\u003ea,\u0026alpha;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e291.5\u0026thinsp;\u0026plusmn;\u0026thinsp;46.32\u003csup\u003eb,\u0026beta;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.387\u0026thinsp;\u0026plusmn;\u0026thinsp;0.15\u003csup\u003ea,\u0026alpha;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e335.7\u0026thinsp;\u0026plusmn;\u0026thinsp;52.55\u003csup\u003eb,\u0026beta;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eCyp19-a1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.046\u0026thinsp;\u0026plusmn;\u0026thinsp;0.007\u003csup\u003ea,\u0026alpha;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0003\u0026thinsp;\u0026plusmn;\u0026thinsp;6e-005\u003csup\u003eb,\u0026alpha;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.012\u0026thinsp;\u0026plusmn;\u0026thinsp;0.001\u003csup\u003ea,\u0026alpha;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.001\u0026thinsp;\u0026plusmn;\u0026thinsp;0.0002\u003csup\u003eb,\u0026alpha;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.373\u0026thinsp;\u0026plusmn;\u0026thinsp;0.0004\u003csup\u003ea,\u0026beta;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0009\u0026thinsp;\u0026plusmn;\u0026thinsp;4e-005\u003csup\u003eb,\u0026alpha;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eSf-1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9.230\u0026thinsp;\u0026plusmn;\u0026thinsp;1.505\u003csup\u003ea,\u0026alpha;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.596\u0026thinsp;\u0026plusmn;\u0026thinsp;0.170\u003csup\u003eb,\u0026alpha;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.334\u0026thinsp;\u0026plusmn;\u0026thinsp;0.385\u003csup\u003ea,\u0026beta;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3.137\u0026thinsp;\u0026plusmn;\u0026thinsp;0.546\u003csup\u003ea,\u0026alpha;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4.663\u0026thinsp;\u0026plusmn;\u0026thinsp;0.676\u003csup\u003ea,\u0026alpha;\u0026beta;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e8.752\u0026thinsp;\u0026plusmn;\u0026thinsp;1.118\u003csup\u003eb,\u0026beta;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eSox-9\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.928\u0026thinsp;\u0026plusmn;\u0026thinsp;0.088\u003csup\u003ea,\u0026alpha;\u0026beta;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.191\u0026thinsp;\u0026plusmn;\u0026thinsp;0.338\u003csup\u003ea,\u0026alpha;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.495\u0026thinsp;\u0026plusmn;\u0026thinsp;0.479\u003csup\u003ea,\u0026alpha;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e10.52\u0026thinsp;\u0026plusmn;\u0026thinsp;1.489\u003csup\u003eb,\u0026beta;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.528\u0026thinsp;\u0026plusmn;\u0026thinsp;0.341\u003csup\u003ea,\u0026beta;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e17.52\u0026thinsp;\u0026plusmn;\u0026thinsp;1.971\u003csup\u003eb,\u0026beta;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003ctfoot\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"7\"\u003eThe values represent the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM. The different Latin letters indicate significant differences (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) between TSD-Females and TSD-Males at each stage of embryonic development. Different Greek letters indicate significant differences (\u0026lt;\u0026thinsp;0.05) between males and females along the three stages studied.\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tfoot\u003e\n \u003c/table\u003e\n \u003cp\u003e\u003c/p\u003e\n \u003cp\u003eThe relative expression of \u003cem\u003ecyp19-a1\u003c/em\u003e in TSD-Females was higher than that in TSD-Males throughout the three stages studied (Table \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e). In addition, in TSD-Females, a significant increase in \u003cem\u003ecyp19-a1\u003c/em\u003e relative expression was observed from DS 24 to DS27.\u003c/p\u003e\n \u003cp\u003eThe relative expression of \u003cem\u003esf-1\u003c/em\u003e in TSD-Females exhibited a U-shaped pattern with its highest level at DS 22 and the lowest at DS 24. Conversely, in TSD-Males, the expression of \u003cem\u003esf-1\u003c/em\u003e exhibited a steady increase from DS 22 to DS 27. \u003cem\u003esf-1\u003c/em\u003e expression in both TSD-Females and TSD-Males at DS 22 was significantly different from that at DS 27 (Table \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e\n \u003cp\u003eFinally, the relative expression of \u003cem\u003esox-9\u003c/em\u003e in TSD-Females remained unchanged throughout the stages studied, whereas that in TSD-Males \u003cem\u003esox-9\u003c/em\u003e increased significantly as development progressed (Table \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec19\"\u003e\n \u003ch2\u003e3.2. Effects of ATZ on the development and differentiation of the male gonad\u003c/h2\u003e\n \u003cdiv class=\"Section3\" id=\"Sec20\"\u003e\n \u003ch2\u003e3.2.1. Gonadal histology and germ cell distribution\u003c/h2\u003e\n \u003cp\u003eIn agreement with that previously reported (Beldomenico et al., \u003cspan class=\"CitationRef\"\u003e2007\u003c/span\u003e), all embryos from eggs incubated at 33\u0026deg;C were males both in the control group (TSD-Males) and in the ATZ-exposed group (ATZ-Males). At DSs 22 and 24, no differences at histological level were observed between ATZ-Males and TSD-Males, whereas at DS 27, the gonads of ATZ-Males exhibited a less organized histoarchitecture. This relative disorganization included poorly defined limits between the epithelium and the surrounding stroma, increased tortuosity of epithelium cords, and wider fluid-filled lumen. The germinal cell distribution in the gonad of ATZ-Males did not differ from that observed in TSD-Males.\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv class=\"Section3\" id=\"Sec21\"\u003e\n \u003ch2\u003e3.2.2 Estrogen and progesterone receptors\u003c/h2\u003e\n \u003cp\u003eExposure to ATZ induced a significant decrease in the expression of both ER and PR at DS 24. No differences were observed at DS 22 or DS 27 (Fig. 2).\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv class=\"Section3\" id=\"Sec22\"\u003e\n \u003ch2\u003e3.2.3 Aromatase\u003c/h2\u003e\n \u003cp\u003eATZ exposure dramatically increased the expression of aromatase in the ATZ-Males gonads. When compared with TSD-Males, ATZ-Males showed significantly higher levels of gonadal aromatase expression throughout the whole period studied (Fig. 4).\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv class=\"Section3\" id=\"Sec23\"\u003e\n \u003ch2\u003e3.2.4 Proliferative activity\u003c/h2\u003e\n \u003cp\u003eExposure to ATZ significantly induced cell proliferation in ATZ-Male gonads at DS 22 (Fig. 5).\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv class=\"Section3\" id=\"Sec24\"\u003e\n \u003ch2\u003e3.2.5 Expression of key developmental genes\u003c/h2\u003e\n \u003cp\u003eRegarding the expression of the key developmental genes studied, results were as follows: ATZ exposure induced an up-regulation of \u003cem\u003eamh\u003c/em\u003e expression at DSs 22 and 24. No significant differences in the expression of \u003cem\u003ecyp19-a1\u003c/em\u003e were observed between TSD-Males and ATZ-Males throughout the different DSs studied. However, ATZ-Males tended to show a slightly increased expression of \u003cem\u003ecyp19-a1\u003c/em\u003e.\u003c/p\u003e\n \u003cp\u003eATZ exposure did not alter the pattern of \u003cem\u003esf-1\u003c/em\u003e expression found in TSD-Male gonads and no differences in \u003cem\u003esf-1\u003c/em\u003e expression levels were found between ATZ-Males and TSD-Males throughout the period studied.\u003c/p\u003e\n \u003cp\u003eWhile the relative expression of \u003cem\u003esox-9\u003c/em\u003e in TSD-Males significantly increased as development progressed, that in ATZ-Males showed a significant increase at DS 24, which differed from that found in TSD-Males at the same DS but was similar to that found at DS 27 (Fig. 6).\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eOur findings demonstrate that, in \u003cem\u003eC. latirostris\u003c/em\u003e embryos, sexually dimorphic expression of histofunctional biomarkers and key developmental genes precedes gonad histomorphological differences. They also show that \u003cem\u003ein ovo\u003c/em\u003e exposure to ATZ at developmental stage of temperature sex determination induces changes in the expression of histofunctional biomarkers and genes. Although no changes were observed in testicular differentiation after \u003cem\u003ein ovo\u003c/em\u003e ATZ exposure, disruption of testicular histoarchitecture was observed.\u003c/p\u003e \u003cdiv id=\"Sec26\" class=\"Section2\"\u003e \u003ch2\u003e4.1. Temperature-induced gonadal development and differentiation\u003c/h2\u003e \u003cp\u003eThe embryonic gonad of \u003cem\u003eC. latirostris\u003c/em\u003e shows the same compartmentalization pattern and general histological characteristics as those described for \u003cem\u003eAlligator mississippiensis\u003c/em\u003e (Smith and Joss, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e1994\u003c/span\u003e). Although no differences were observed in the histoarchitecture of TSD-Males and TSD-Females at DS 22, at this early developmental stage most of the genes and proteins evaluated here showed sexually dimorphic expression. This suggests that, at DS 22, the gonads of \u003cem\u003eC. latirostris\u003c/em\u003e overrode the bisexual period in which the developing gonad shows both characteristics of males and females. As caiman embryo development takes place, the histoarchitecture acquires different features in male and female gonads. At DS 24, TSD-Male gonads present tubular structures -seminiferous tubules precursors-. As demonstrated in Canesini et al. (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), the VASA-expressing cells, present in tubular structures, correspond with medullar cells morphologically described as cells with heterogeneously violet-stained nuclei and decreased nuclei/cytoplasm ratio. Although this type of cells shows many similarities to those described as pre-Sertoli cells for \u003cem\u003eA. mississippiensis\u003c/em\u003e (Smith and Joss, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e1993\u003c/span\u003e), in \u003cem\u003eC. latirostris\u003c/em\u003e the expression of VASA denotes their germinal lineage. At DS 27, the presence of seminiferous tubules that exhibit a characteristic lumen and the absence of the M\u0026uuml;ller ducts confirm the gonadal male phenotype.\u003c/p\u003e \u003cp\u003eIn TSD species, temperature-induced changes include changes in the expression of steroid hormone receptors. Thus, here we studied the effect of the incubation temperature on the expression of ERα and PR. In TSD-Female gonads, ERα expression remained unchanged throughout the DSs studied. In contrast, TSD-Male gonads showed a period of high ERα expression that spread over DSs 22 and 24, followed by a period of low ERα expression at DS 27. It has been reported that both increased and depleted levels of estrogen can upregulate ER levels (Hagenfeldt and Eriksson, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e1988\u003c/span\u003e; Prins and Birch, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e1997\u003c/span\u003e; Tran et al., \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Sex steroid levels in the developing embryo are unknown. The levels of steroid hormones in the chorioallantois fluid were reported to be a useful tool for estimating the circulating steroid levels in turtles (Gross et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e1995\u003c/span\u003e). However, this approach was not useful to assess embryonic hormonal environment in alligators (Crain et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e1997\u003c/span\u003e) and probably would not be for \u003cem\u003eC. latirostris.\u003c/em\u003e As far as we know, no steroid synthesis has been reported in crocodilian gonads at morphologically undifferentiated developmental stages. Thus, we could speculate that, in \u003cem\u003eC. latirostris\u003c/em\u003e, at the earliest DS, low estrogen levels rather than high estrogen levels may be involved in the regulation of gonadal ERα expression. Increased ERα expression could be a strategy to enhance tissue sensitivity to low estrogen levels. In mice, it has been found that estrogens, acting through highly expressed ERα, might promote normal development and function of the male reproductive tract (Hess and Cooke, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Consequently, in male \u003cem\u003eC. latirostris\u003c/em\u003e, the high ERα expression period here observed over DSs 22 and 24 would be critical for normal gonadal development and function. Additionally, our findings confirm that the earlier DSs of \u003cem\u003eC. latirostris\u003c/em\u003e are highly sensitive to subtle changes in the levels of estrogens or xenoestrogens (Stoker et al., \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2003\u003c/span\u003e). Conversely, during DS 27, when the gonad is morphologically differentiated, ERα expression decreased significantly. Male gonad development requires of both ERα and androgen receptors (AR), and the balance between androgen and estrogen (acting through their respective receptors) is of central importance in male reproductive development and function (Hess and Cooke, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Thus, different DSs may be characterized by a different estrogen:androgen balance and a different ERα:AR expression ratio. At DS 27, androgen synthesis by the male-differentiated gonad may modify the estrogen:androgen balance and ERα expression.\u003c/p\u003e \u003cp\u003eRegarding PR, this receptor is considered a target molecule of estrogenic action and its regulation differs between species (Boyd-Leinen et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e1984\u003c/span\u003e; Giannoukos and Callard, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e1996\u003c/span\u003e; Hora et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e1986\u003c/span\u003e; Schultz et al., \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2003\u003c/span\u003e). Our results showed that, as expected, in TSD-Females, PR expression follows the same pattern as ERα. Conversely, in TSD-Males, increased PR expression corresponds with the low ERα expression when estrogenic action is supposed to be decreased. This controversy could be explained by the complex PR regulation in reptiles. As it has been previously reported, PR levels could be regulated by other factors besides estrogen action (Gist, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Jones, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2011\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn TSD species, steroidogenic enzymes have been suggested to be temperature-regulated. The differential expression of aromatase between TSD-Females and TSD-Males confirmed this for \u003cem\u003eC. latirostris\u003c/em\u003e. The high aromatase levels in TSD-Females were observed throughout the whole period studied. In \u003cem\u003eCrocodylus porosus\u003c/em\u003e and \u003cem\u003eA. mississippiensis\u003c/em\u003e, the aromatase levels observed in female embryos remain low up to the end of the thermosensitive period and, then, dramatically increases (Gabriel et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Smith and Joss, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e1994\u003c/span\u003e), suggesting a role in gonadal differentiation but not necessarily in sex determination. In \u003cem\u003eC. latirostris\u003c/em\u003e, this role is supported by the female-related high aromatase expression levels observed during the DS characterized by a morphologically differentiated gonad. However, these female-related high levels of aromatase expression were observed even during the thermosensitive period. This result suggests that, in \u003cem\u003eC. latirostris\u003c/em\u003e, aromatase expression could be a key factor not only for gonadal female determination but also for sex differentiation. Additionally, our findings suggest that, in \u003cem\u003eC. latirostris\u003c/em\u003e, the levels of aromatase expression would be a reliable sign of gonadal determination towards the female phenotype.\u003c/p\u003e \u003cp\u003eDevelopmental processes involve cell proliferation and differentiation. Regarding this, Zhu et al. (\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2009\u003c/span\u003e) stated that cell proliferation and differentiation often act as two mutually exclusive partners that are related but cannot coexist. In this context, the gonadal increased proliferative activity here observed in TSD-Females at DS 24 suggests that the gonad is in a phase more related to growth than to differentiation. Noteworthy, no differences in proliferative activity were found for TSD-Males during the DSs studied, suggesting that differentiation rather than proliferation govern this developmental period in males.\u003c/p\u003e \u003cp\u003eIn the present work, we also studied four key genes involved in sexual determination and gonad differentiation, \u003cem\u003eamh\u003c/em\u003e, \u003cem\u003esox-9\u003c/em\u003e, \u003cem\u003esf-1\u003c/em\u003e and \u003cem\u003ecyp19-a1\u003c/em\u003e. To this aim, gonadal tissue was isolated from the GAM complex using the microdissection technique previously described by Lazzarino et al. (\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). The microdissection technique allows working with gonadal tissue, avoiding the use of adrenal or mesonephric tissue. Thus, results are representative of the gonad and differences between males and females, when present, are clearer. Noteworthy, \u003cem\u003eamh\u003c/em\u003e showed clear sexual dimorphism throughout the whole developmental period studied, being several orders of magnitude higher in TSD-Males than in TSD-Females. The \u003cem\u003eamh\u003c/em\u003e gene encodes for the anti-M\u0026uuml;llerian hormone (AMH), which is involved in male gonad differentiation by causing degeneration of M\u0026uuml;llerian ducts in the embryo bipotential gonad. This mechanism of gonadal differentiation highly conserved among vertebrates is also present in \u003cem\u003eC. latirostris\u003c/em\u003e and seems to be the hallmark of sexual male determination. In addition, \u003cem\u003eamh\u003c/em\u003e expression significantly increased from DS 22 (when the gonad is morphologically classified as bisexual) towards DS 24 (when sexual differentiation has begun). Noteworthy, at DS 24, we observed a significant increase in the \u003cem\u003esox-9\u003c/em\u003e mRNA level in TSD-Male gonads. \u003cem\u003eSox9\u003c/em\u003e is a gene that encodes for the transcription factor SOX9, which in turn, activates the transcription of \u003cem\u003eamh\u003c/em\u003e and, consequently, promotes the development of testes in all vertebrates examined to date (Morrish and Sinclair, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2002\u003c/span\u003e). Additionally, in alligators, the increase in \u003cem\u003eamh\u003c/em\u003e levels precedes that in \u003cem\u003esox-9\u003c/em\u003e (Warner, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2011\u003c/span\u003e), suggesting that other genes besides \u003cem\u003esox-9\u003c/em\u003e may regulate the increase in \u003cem\u003eamh\u003c/em\u003e. In \u003cem\u003eC. latirostris\u003c/em\u003e, we confirmed this finding. We propose that although \u003cem\u003esox-9\u003c/em\u003e is not necessary for the increase in \u003cem\u003eamh\u003c/em\u003e levels during the bisexual gonadal stage, it is involved in the further upregulation of \u003cem\u003eamh\u003c/em\u003e during the gonadal differentiation into testis. Moreover, molecular cloning studies of \u003cem\u003eamh\u003c/em\u003e in \u003cem\u003eA. mississippiensis\u003c/em\u003e have confirmed that \u003cem\u003esox-9\u003c/em\u003e up-regulates transcriptional activity through the \u003cem\u003eamh\u003c/em\u003e promoter region (Urushitani et al., \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). A similar mechanism could be operating in \u003cem\u003eC. latirostris\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eIn addition to \u003cem\u003esox-9\u003c/em\u003e, \u003cem\u003esf-1\u003c/em\u003e has been described as a positive regulator of \u003cem\u003eamh\u003c/em\u003e (Warner, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Our results support this role for \u003cem\u003esf-1\u003c/em\u003e. We hypothesize that, during DS 27, \u003cem\u003esf-1\u003c/em\u003e, together with \u003cem\u003esox-9\u003c/em\u003e, upregulates \u003cem\u003eamh\u003c/em\u003e expression, maintaining high levels of AMH, necessary for gonadal male differentiation. Nevertheless, \u003cem\u003esf-1\u003c/em\u003e expression was also found increased in TSD-Female gonads at DS 22, suggesting that \u003cem\u003esf-1\u003c/em\u003e could be related to other functions. In fact, \u003cem\u003esf-1\u003c/em\u003e regulates the expression of gonadal steroidogenic enzymes, including aromatase (Parker and Schimmer, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e1997\u003c/span\u003e). In TSD-Females, the highest level of \u003cem\u003esf-1\u003c/em\u003e found coincided with increased \u003cem\u003ecyp19-a1\u003c/em\u003e expression levels and the highest aromatase expression levels. Taken together, our results support the idea that \u003cem\u003esf-1\u003c/em\u003e has different functions at different DSs of embryos developed at the MPT or FPT. While, at the earlier DSs of embryos developed at the FPT, \u003cem\u003esf-1\u003c/em\u003e is involved in the upregulation of aromatase expression, at the latest DSs of embryos developed at the MPT, \u003cem\u003esf-1\u003c/em\u003e is involved in the upregulation of \u003cem\u003eamh\u003c/em\u003e expression.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec27\" class=\"Section2\"\u003e \u003ch2\u003e4.2 Effects of ATZ exposure on gonadal development and differentiation\u003c/h2\u003e \u003cp\u003eThe histomorphological alterations observed in ATZ-Male gonads at DS 27 are similar to those previously reported in 10-day-old caimans with the same protocol of exposure (Rey et al., \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). This suggests that the altered testicular histoarchitecture observed postnatally is a consequence of the gonadal disruptive effect of ATZ initiated during embryo development.\u003c/p\u003e \u003cp\u003eThe dramatic increase in aromatase expression here observed in ATZ-Males throughout the DSs studied is in concordance with the reported role of ATZ as a xenoestrogen in different species, acting through increased aromatase induction (Hayes et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2011\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). In alligator male hatchlings, for example, ATZ has been found to induce GAM aromatase activity that was characteristic neither of males nor of females, but did not alter testicular differentiation (Crain et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e1997\u003c/span\u003e). In our model, increased aromatase expression would increase androgen-to-estrogen conversion, creating an estrogenic gonadal microenvironment in ATZ-Males that would be responsible for downregulating ERα expression, as observed at DS 24. The reduced period of high ERα expression, previously defined as critical for normal gonadal development and function in male \u003cem\u003eC. latirostris\u003c/em\u003e, could affect estrogen-depending developmental processes involved in the sexual differentiation of the gonad. The decreased PR expression levels here observed at DS 24 in ATZ-Males may be interpreted as a consequence of the altered estrogen signaling pathway. Thus, changes in PR could suggest that other estrogen-induced molecules which have a role in proper gonad differentiation could be affected.\u003c/p\u003e \u003cp\u003eATZ exposure also increased the expression of \u003cem\u003eamh\u003c/em\u003e (at DSs 22 and 24) and \u003cem\u003esox-9\u003c/em\u003e (at DS 24). These genes are part of a highly conserved pattern of gonadal development in vertebrate species known as the male pathway (Hirst et al., 2018). Surprisingly, regarding the expression of \u003cem\u003eamh\u003c/em\u003e and \u003cem\u003esox-\u003c/em\u003e9, ATZ exposure seems to support the male phenotypic pathway rather than the female one. Although these findings may lead to hypothesize that the increased expression of \u003cem\u003eamh\u003c/em\u003e and \u003cem\u003esox-9\u003c/em\u003e could result in a protective response against the feminizing effect of ATZ, different studies on developmental processes highlight the importance of the temporal and spatial expression pattern of key molecules. In chicken, for example, AMH overexpression has been found to lead to alterations in the number of Sertoli cells and steroidogenesis (Lambeth et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). In this sense, for developmental processes, it is critical that \u0026ldquo;the right molecule is expressed at the right level at the right time\u0026rdquo; (Ferraro et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Thus, subtle alterations in the developmental programming could lead to impaired reproductive function. In the present work, ATZ exposure altered the temporal pattern of expression of both \u003cem\u003eamh\u003c/em\u003e and \u003cem\u003esox-9\u003c/em\u003e. Thus, histofunctional alterations as a consequence of ATZ-induced changes in the levels of expression of \u003cem\u003eamh\u003c/em\u003e in ATZ-Male caimans cannot be ruled out.\u003c/p\u003e \u003cp\u003eFinally, it is important to highlight that ATZ could cause greater endocrine disruption in caimans hatched in the wild than in those hatched in controlled laboratory conditions. This is because, in the wild, eggs are also incubated at intermediate temperatures that produce both males and females (Parach\u0026uacute; Marc\u0026oacute; et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Simoncini et al., \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Thus, our results highlight the vulnerability of developing organisms and alert about ATZ-mediated developmental disruption in wildlife.\u003c/p\u003e \u003c/div\u003e"},{"header":"5. Conclusions","content":"\u003cp\u003eExposure of non-target organisms to substances classified as EDCs used in productive processes -such as ATZ in weed control- during critical periods of development might cause subtle changes at gene and/or protein expression level that might lead to impairments of physiological processes in later stages of life. Studying those physiological processes and the effects of EDCs exposure in organisms that behave as sentinel species, like \u003cem\u003eC. latirostris\u003c/em\u003e, allow us to identify potential early targets of endocrine disruption and to alert about the deleterious effects that developmental exposure to EDCs might induce both in wildlife and humans.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank Juan Grant for technical assistance and animal care. Field work was done in collaboration with \u0026lsquo;\u0026lsquo;Reserva Natural El Cachap\u0026eacute;\u0026rdquo;, Chaco. http://www.elcachape.com.ar. This study was supported by grants from the Argentine National Agency for the Promotion of Science and Technology (ANPCyT; PICT-2011-2031 and PICT 2016-0656), the Universidad Nacional del Litoral (CAI + D Program Cod. 50420150100088LI) and the National Scientific and Technical Research Council of Argentina (CONICET; PIP 2021-2023 Cod. 1220200101387CO)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical Approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe protocols used in this work were previously authorized by the Institutional Committee of Bioethics in Animal Care and Use of the Universidad Nacional del Litoral, Santa Fe, Argentina.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to publish\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor\u0026acute;s contribution statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors contributed to the study conception and design. Conceptualization: Guillermina Canesini, Germ\u0026aacute;n H. Galoppo, Jorge G. Ramos and M\u0026oacute;nica Mu\u0026ntilde;oz-de-Toro; Methodology:[Guillermina Canesini, Gisela P. Lazzarino and Cora Stoker; Formal analysis and investigation: Guillermina Canesini, and Germ\u0026aacute;n H. Galoppo; Writing - original draft preparation: Guillermina Canesini, Germ\u0026aacute;n H. Galoppo, Yamil E. Tavalieri; Visualization: Guillermina Canesini and Yamil E. Tavalieri; Writing - review and editing: Germ\u0026aacute;n H. Galoppo, Yamil E. Tavalieri, M\u0026oacute;nica Mu\u0026ntilde;oz-de-Toro; Funding acquisition: Enrique H. Luque and M\u0026oacute;nica Mu\u0026ntilde;oz-de-Toro; Resources: M\u0026oacute;nica Mu\u0026ntilde;oz-de-Toro; Supervision: Cora Stoker, Enrique H. Hugo, Jorge G. Ramos and M\u0026oacute;nica Mu\u0026ntilde;oz-de-Toro. All authors read and approved the final manuscript.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Argentine National Agency for the Promotion of Science and Technology (ANPCyT; PICT-2011-2031 and PICT 2016-0656),\u0026nbsp;Universidad Nacional del Litoral (CAI + D Program).\u0026nbsp;Cod: 50420150100088LI, the National Scientific and Technical Research Council of Argentina (CONICET; PIP 2021-2023 Cod. 1220200101387CO).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no relevant financial or non-financial interests to disclose.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets compiled and analyzed in the present study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompliance with ethical standards\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll procedures and techniques used for egg collection, embryo handling and sampling were performed according to the guidelines of the American Society of Ichthyologists and Herpetologists (ASIH, 2004). All animal experiments were carried out in accordance with the Guide for the Care and Use of Laboratory Animals of the National Research Council (USA) (IPCS, 2002).\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eASIH, A.S. of I. and H., 2004. Guidelines for Use of Live Amphibians and Reptiles in Field and laboratory research 1\u0026ndash;43.\u003c/li\u003e\n\u003cli\u003eBasopo, N., Muzvidziwa, A., 2020. Assessment of the effects of atrazine, dichlorodiphenyltrichloroethane, and dimethoate on freshwater fish (Oreochromis mossambicus): a case study of the A2 farmlands in Chiredzi, in the southeastern part of Zimbabwe. Environ. Sci. Pollut. Res. 27, 579\u0026ndash;586. https://doi.org/10.1007/s11356-019-06569-x\u003c/li\u003e\n\u003cli\u003eBeldomenico, P.M., Rey, F., Prado, W.S., Villarreal, J.C., Mu\u0026ntilde;oz-de-Toro, M., Luque, E.H., 2007. In ovum exposure to pesticides increases the egg weight loss and decreases hatchlings weight of Caiman latirostris (Crocodylia: Alligatoridae). Ecotoxicol. Environ. Saf. 68, 246\u0026ndash;251. https://doi.org/10.1016/j.ecoenv.2006.12.018\u003c/li\u003e\n\u003cli\u003eBoyd-Leinen, P., Gosse, B., Rasmussen, K., Martin-Dani, G., Spelsberg, T.C., 1984. Regulation of nuclear binding of the avian oviduct progesterone receptor. Changes during estrogen-induced oviduct development, withdrawal, and secondary stimulation. J. Biol. Chem. 259, 2411\u0026ndash;2421.\u003c/li\u003e\n\u003cli\u003eBrodeur, J.C., Poletta, G.L., Simoniello, M.F., Carriquiriborde, P., Cristos, D.S., Pautasso, N., Paravani, E., Poliserpi, M.B., D\u0026rsquo;Andrea, M.F., Gonzalez, P. V., Aca, V.L., Curto, A.E., 2021. The problem with implementing fish farms in agricultural regions: A trial in a pampean pond highlights potential risks to both human and fish health. Chemosphere 262, 128408. https://doi.org/10.1016/j.chemosphere.2020.128408\u003c/li\u003e\n\u003cli\u003eCanesini, G., Stoker, C., Galoppo, G.H., Durando, M.L., Tschopp, M. V., Luque, E.H., Mu\u0026ntilde;oz-de-Toro, M.M., Ramos, J.G., 2018. Temperature- vs. estrogen-induced sex determination in Caiman latirostris embryos: Both females, but with different expression patterns of key molecules involved in ovarian development. Gen. Comp. Endocrinol. 259, 176\u0026ndash;188. https://doi.org/10.1016/j.ygcen.2017.11.024\u003c/li\u003e\n\u003cli\u003eČiko\u0026scaron;, \u0026Scaron;., Bukovsk\u0026aacute;, A., Koppel, J., 2007. Relative quantification of mRNA: Comparison of methods currently used for real-time PCR data analysis. BMC Mol. Biol. 8. https://doi.org/10.1186/1471-2199-8-113\u003c/li\u003e\n\u003cli\u003eCrain, D.A., Guillette, L.J., Rooney, A.A., Pickford, D.B., 1997. Alterations in steroidogenesis in alligators (Alligator mississippiensis) exposed naturally and experimentally to environmental contaminants. Environ. Health Perspect. 105, 528\u0026ndash;533. https://doi.org/10.1289/ehp.97105528\u003c/li\u003e\n\u003cli\u003eDurando, M., Canesini, G., Cocito, L.L., Galoppo, G.H., Zayas, M.A., Luque, E.H., Mu\u0026ntilde;oz-de-Toro, M., 2016. Histomorphological changes in testes of broad-snouted caimans (Caiman latirostris) associated with in ovo exposure to endocrine-disrupting chemicals. J. Exp. Zool. Part A Ecol. Genet. Physiol. 325. https://doi.org/10.1002/jez.1999\u003c/li\u003e\n\u003cli\u003eDurando, M., Cocito, L., Rodr\u0026iacute;guez, H.A., Varayoud, J., Ramos, J.G., Luque, E.H., Mu\u0026ntilde;oz-de-Toro, M., 2013. Neonatal expression of amh, sox9 and sf-1 mRNA in Caiman latirostris and effects of in ovo exposure to endocrine disrupting chemicals. Gen. Comp. Endocrinol. 191, 31\u0026ndash;38. https://doi.org/10.1016/j.ygcen.2013.05.013\u003c/li\u003e\n\u003cli\u003eElkayar, K., Park, J.A., Pineda, M., Westlund, P., Yargeau, V., 2022. Passive sampling and in vitro assays to monitor antiandrogens in a river affected by wastewater discharge. Sci. Total Environ. 804, 150067. https://doi.org/10.1016/j.scitotenv.2021.150067\u003c/li\u003e\n\u003cli\u003eFerguson, W.J., Chenier, G., 1983. Introduction for many embryological , teratological , conservation and farming studies ; but to date reliable 143\u0026ndash;177.\u003c/li\u003e\n\u003cli\u003eFerraro, T., Lucas, T., Cl\u0026eacute;mot, M., De Las Heras Chanes, J., Desponds, J., Coppey, M., Walczak, A.M., Dostatni, N., 2016. New methods to image transcription in living fly embryos: the insights so far, and the prospects. WIREs Dev. Biol. 5, 296\u0026ndash;310. https://doi.org/10.1002/wdev.221\u003c/li\u003e\n\u003cli\u003eForbes, T., 1940. Studies on the reproductive system of the alligator. IV. Observations on the development of the gonad, the adrenal cortex and the M\u0026uuml;llerian duct. Embryol, Contrib.\u003c/li\u003e\n\u003cli\u003eGabriel, W.N., Blumberg, B., Sutton, S., Place, A.R., Lance, V.A., 2001. Alligator aromatase cDNA sequence and its expression in embryos at male and female incubation temperatures. J. Exp. Zool. 290, 439\u0026ndash;448. https://doi.org/10.1002/jez.1087\u003c/li\u003e\n\u003cli\u003eGaloppo, G.H., Stoker, C., Canesini, G., Schierano-Marotti, G., Durando, M., Luque, E.H., Mu\u0026ntilde;oz-de-Toro, M., 2016. Postnatal development and histofunctional differentiation of the oviduct in the broad-snouted caiman (Caiman latirostris). Gen. Comp. Endocrinol. 236. https://doi.org/10.1016/j.ygcen.2016.07.001\u003c/li\u003e\n\u003cli\u003eGaloppo, G.H., Tavalieri, Y.E., Schierano-Marotti, G., Osti, M.R., Luque, E.H., Mu\u0026ntilde;oz-de-Toro, M.M., 2020. Long-term effects of in ovo exposure to an environmentally relevant dose of atrazine on the thyroid gland of Caiman latirostris. Environ. Res. 186, 109410. https://doi.org/10.1016/j.envres.2020.109410\u003c/li\u003e\n\u003cli\u003eGiannoukos, G., Callard, I.P., 1996. Radioligand and immunochemical studies of turtle oviduct progesterone and estrogen receptors: Correlations with hormone treatment and oviduct contractility. Gen. Comp. Endocrinol. 101, 63\u0026ndash;75. https://doi.org/10.1006/gcen.1996.0008\u003c/li\u003e\n\u003cli\u003eGist, D.H., 2011. Hormones and sex ducts and accessory structures of reptiles., in: Hormones and Reproduction in Vertebrates Volume 3: Reptiles. USA, pp. 117\u0026ndash;139.\u003c/li\u003e\n\u003cli\u003eGross, T.S., Crain, D.A., Bjorndal, K.A., Bolten, A.B., Carthy, R.R., 1995. Identification of Sex in Hatchling Loggerhead Turtles (Caretta caretta) by Analysis of Steroid Concentrations in Chorioallantoic/Amniotic Fluid. Gen. Comp. Endocrinol. 99, 204\u0026ndash;210. https://doi.org/10.1006/gcen.1995.1103\u003c/li\u003e\n\u003cli\u003eHagenfeldt, Y., Eriksson, H.A., 1988. The estrogen receptor in the rat kidney. Ontogeny, properties and effects of gonadectomy on its concentration. J. Steroid Biochem. 31, 49\u0026ndash;56. https://doi.org/10.1016/0022-4731(88)90204-X\u003c/li\u003e\n\u003cli\u003eHayes, T.B., Anderson, L.L., Beasley, V.R., de Solla, S.R., Iguchi, T., Ingraham, H., Kestemont, P., Kniewald, J., Kniewald, Z., Langlois, V.S., Luque, E.H., McCoy, K.A., Mu\u0026ntilde;oz-de-Toro, M., Oka, T., Oliveira, C.A., Orton, F., Ruby, S., Suzawa, M., Tavera-Mendoza, L.E., Trudeau, V.L., Victor-Costa, A.B., Willingham, E., 2011. Demasculinization and feminization of male gonads by atrazine: Consistent effects across vertebrate classes. J. Steroid Biochem. Mol. Biol. 127, 64\u0026ndash;73. https://doi.org/10.1016/j.jsbmb.2011.03.015\u003c/li\u003e\n\u003cli\u003eHayes, T.B., Stuart, A.A., Mendoza, M., Collins, A., Noriega, N., Vonk, A., Johnston, G., Liu, R., Kpodzo, D., 2006. Characterization of Atrazine-Induced Gonadal Malformations in African Clawed Frogs ( Xenopus laevis ) and Comparisons with Effects of an Androgen Antagonist (Cyproterone Acetate) and Exogenous Estrogen (17\u0026beta;-Estradiol): Support for the Demasculinization/Fe. Environ. Health Perspect. 114, 134\u0026ndash;141. https://doi.org/10.1289/ehp.8067\u003c/li\u003e\n\u003cli\u003eHess, R.A., Cooke, P.S., 2018. Estrogen in the male: a historical perspective. Biol. Reprod. 99, 27\u0026ndash;44. https://doi.org/10.1093/biolre/ioy043\u003c/li\u003e\n\u003cli\u003eHora, J., Gosse, B., Rasmussen, K., Spelsberg, T.C., 1986. Estrogen Regulation of the Biological Activity of the Avian Oviduct Progesterone Receptor and Its Ability to Induce Avidin*. Endocrinology 119, 1118\u0026ndash;1125. https://doi.org/10.1210/endo-119-3-1118\u003c/li\u003e\n\u003cli\u003eIPCS, I.P. on C.S., 2002. Global assessment on the state of the science of endocrine disruptors. [WWW Document]. World Heal. Organ. URL https://apps.who.int/iris/handle/10665/67357\u003c/li\u003e\n\u003cli\u003eIungman, J., Pi\u0026ntilde;a, C.I., Siroski, P., 2008. Embryological development of \u003cem\u003eCaiman latirostris\u003c/em\u003e ( \u003cem\u003eCrocodylia\u003c/em\u003e : \u003cem\u003eAlligatoridae\u003c/em\u003e ). genesis 46, 401\u0026ndash;417. https://doi.org/10.1002/dvg.20413\u003c/li\u003e\n\u003cli\u003eJones, S., 2011. Hormonal regulation of ovarian function in reptiles, in: Hormones and Reproduction of Vertebrates. Elsevier, Academic Press, Boulder, Colorado, p. 414.\u003c/li\u003e\n\u003cli\u003eLambeth, L.S., Morris, K.R., Wise, T.G., Cummins, D.M., O\u0026rsquo;Neil, T.E., Cao, Y., Sinclair, A.H., Doran, T.J., Smith, C.A., 2016. Transgenic Chickens Overexpressing Aromatase Have High Estrogen Levels but Maintain a Predominantly Male Phenotype. Endocrinology 157, 83\u0026ndash;90. https://doi.org/10.1210/en.2015-1697\u003c/li\u003e\n\u003cli\u003eLazzarino, G.P., Acutain, M.F., Canesini, G., Andreoli, M.F., Ramos, J.G., 2019. Cafeteria diet induces progressive changes in hypothalamic mechanisms involved in food intake control at different feeding periods in female rats. Mol. Cell. Endocrinol. 498, 110542. https://doi.org/10.1016/j.mce.2019.110542\u003c/li\u003e\n\u003cli\u003eLazzarino, G.P., Andreoli, M.F., Rossetti, M.F., Stoker, C., Tschopp, M.V., Luque, E.H., Ramos, J.G., 2017. Cafeteria diet differentially alters the expression of feeding-related genes through DNA methylation mechanisms in individual hypothalamic nuclei. Mol. Cell. Endocrinol. 450, 113\u0026ndash;125. https://doi.org/10.1016/j.mce.2017.05.005\u003c/li\u003e\n\u003cli\u003eLuque, E.H., Mu\u0026ntilde;oz-de-Toro, M., 2020. Special issue \u0026ldquo;Health effects of agrochemicals as Endocrine Disruptors.\u0026rdquo; Mol. Cell. Endocrinol. 517, 110982. https://doi.org/10.1016/j.mce.2020.110982\u003c/li\u003e\n\u003cli\u003eLuque, E.H., Mu\u0026ntilde;oz-de-Toro, M., Ramos, J.G., 2018. Estrogenic Agonist, in: Encyclopedia of Reproduction. Elsevier, pp. 753\u0026ndash;759. https://doi.org/10.1016/B978-0-12-801238-3.64416-1\u003c/li\u003e\n\u003cli\u003eMorrish, B.C., Sinclair, A.H., 2002. Vertebrate sex determination: Many means to an end. Reproduction 124, 447\u0026ndash;457. https://doi.org/10.1530/rep.0.1240447\u003c/li\u003e\n\u003cli\u003eParach\u0026uacute; Marc\u0026oacute;, M.V., Leiva, P., Iungman, J.L., Simoncini, M.S., Pi\u0026ntilde;a, C.I., 2017. New evidence characterizing temperature-dependent sex determination in Broad-snouted Caiman, Caiman latirostris. Herpetol. Conserv. Biol. 12, 78\u0026ndash;84.\u003c/li\u003e\n\u003cli\u003eParker, K.L., Schimmer, B.P., 1997. Steroidogenic Factor 1: A Key Determinant of Endocrine Development and Function. Endocr. Rev. 18, 361\u0026ndash;377. https://doi.org/10.1210/edrv.18.3.0301\u003c/li\u003e\n\u003cli\u003ePrins, G.S., Birch, L., 1997. Neonatal Estrogen Exposure Up-Regulates Estrogen Receptor Expression in the Developing and Adult Rat Prostate Lobes*. Endocrinology 138, 1801\u0026ndash;1809. https://doi.org/10.1210/endo.138.5.5106\u003c/li\u003e\n\u003cli\u003eRey, F., Gonz\u0026aacute;lez, M., Zayas, M.A., Stoker, C., Durando, M., Luque, E.H., Mu\u0026ntilde;oz-de-Toro, M., 2009. Prenatal exposure to pesticides disrupts testicular histoarchitecture and alters testosterone levels in male Caiman latirostris. Gen. Comp. Endocrinol. 162, 286\u0026ndash;292. https://doi.org/10.1016/j.ygcen.2009.03.032\u003c/li\u003e\n\u003cli\u003eSchultz, J.R., Petz, L.N., Nardulli, A.M., 2003. Estrogen receptor \u0026alpha; and Sp1 regulate progesterone receptor gene expression. Mol. Cell. Endocrinol. 201, 165\u0026ndash;175. https://doi.org/10.1016/S0303-7207(02)00415-X\u003c/li\u003e\n\u003cli\u003eSiegel, S., 1956. Nonparametric Statistics for the Behavioral Sciences. New York.\u003c/li\u003e\n\u003cli\u003eSimoncini, M.S., Leiva, P.M.L., Pi\u0026ntilde;a, C.I., Cruz, F.B., 2019. Influence of temperature variation on incubation period, hatching success, sex ratio, and phenotypes in Caiman latirostris. J. Exp. Zool. Part A Ecol. Integr. Physiol. 331, 299\u0026ndash;307. https://doi.org/10.1002/jez.2265\u003c/li\u003e\n\u003cli\u003eSmith, C.A., Joss, J.M.P., 1994. Sertoli cell differentiation and gonadogenesis in Alligator mississippiensis. J. Exp. Zool. 270, 57\u0026ndash;70. https://doi.org/10.1002/jez.1402700107\u003c/li\u003e\n\u003cli\u003eSmith, C.A., Joss, J.M.P., 1993. Gonadal sex differentiation in Alligator mississippiensis, a species with temperature-dependent sex determination. 149\u0026ndash;162.\u003c/li\u003e\n\u003cli\u003eStoker, C., Rey, F., Rodriguez, H., Ramos, J.G., Sirosky, P., Larriera, A., Luque, E.H., Mu\u0026ntilde;oz-De-Toro, M., 2003. Sex reversal effects on Caiman latirostris exposed to environmentally relevant doses of the xenoestrogen bisphenol A. Gen. Comp. Endocrinol. 133, 287\u0026ndash;296. https://doi.org/10.1016/S0016-6480(03)00199-0\u003c/li\u003e\n\u003cli\u003eTavalieri, Y.E., Galoppo, G.H., Canesini, G., Luque, E.H., Mu\u0026ntilde;oz-de-Toro, M.M., 2020. Effects of agricultural pesticides on the reproductive system of aquatic wildlife species, with crocodilians as sentinel species. Mol. Cell. Endocrinol. 518, 110918. https://doi.org/10.1016/j.mce.2020.110918\u003c/li\u003e\n\u003cli\u003eTran, T.K.A., MacFarlane, G.R., Kong, R.Y.C., O\u0026rsquo;Connor, W.A., Yu, R.M.K., 2016. Potential mechanisms underlying estrogen-induced expression of the molluscan estrogen receptor (ER) gene. Aquat. Toxicol. 179, 82\u0026ndash;94. https://doi.org/10.1016/j.aquatox.2016.08.015\u003c/li\u003e\n\u003cli\u003eUrushitani, H., Katsu, Y., Miyagawa, S., Kohno, S., Ohta, Y., Guillette, L.J., Iguchi, T., 2011. Molecular cloning of anti-M\u0026uuml;llerian hormone from the American alligator, Alligator mississippiensis. Mol. Cell. Endocrinol. 333, 190\u0026ndash;199. https://doi.org/10.1016/j.mce.2010.12.025\u003c/li\u003e\n\u003cli\u003eVarayoud, J., Monje, L., Moreno-Piovano, G.S., Galoppo, G.H., Luque, E.H., Mu\u0026ntilde;oz-de-Toro, M., Ramos, J.G., 2012. Sexually dimorphic expression of receptor-alpha in the cerebral cortex of neonatal Caiman latirostris (Crocodylia: Alligatoridae). Gen. Comp. Endocrinol. 179, 205\u0026ndash;213. https://doi.org/10.1016/j.ygcen.2012.08.019\u003c/li\u003e\n\u003cli\u003eWarner, D.A., 2011. Sex Determination in Reptiles, in: Hormones and Reproduction of Vertebrates - Volume 3. Elsevier Inc., pp. 1\u0026ndash;38. https://doi.org/10.1016/B978-0-12-374930-7.10001-9\u003c/li\u003e\n\u003cli\u003eWHO, W.O.H., UNEP, U.N.E., 2012. State-of-the-science of endocrine disrupting chemicals, United Nations Environment Programme and the World Health Organization., Toxicology Letters. Geneva, Switzerland.\u003c/li\u003e\n\u003cli\u003eZhang, C., Wang, Z., Liu, S., Tan, H., Zeng, D., Li, X., 2022. Analytical method for sequential determination of persistent herbicides and their metabolites in fish tissues by UPLC\u0026ndash;MS/MS. Chemosphere 288, 132591. https://doi.org/10.1016/j.chemosphere.2021.132591\u003c/li\u003e\n\u003cli\u003eZhu, D., Shi, S., Wang, H., Liao, K., 2009. Growth arrest induces primary-cilium formation and sensitizes IGF-1-receptor signaling during differentiation induction of 3T3-L1 preadipocytes. J. Cell Sci. 122, 2760\u0026ndash;2768. https://doi.org/10.1242/jcs.046276\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"environmental-science-and-pollution-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"espr","sideBox":"Learn more about [Environmental Science and Pollution Research](https://www.springer.com/journal/11356)","snPcode":"11356","submissionUrl":"https://submission.nature.com/new-submission/11356/3","title":"Environmental Science and Pollution Research","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Wildlife, Male gonad development, Endocrine disruptor, amh, sox-9, Aromatase","lastPublishedDoi":"10.21203/rs.3.rs-1942101/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-1942101/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eEnvironmental exposure to agrochemicals during early stages of development can induce subtle alterations that could permanently affect normal physiology. Previously, we reported that \u003cem\u003ein ovo\u003c/em\u003e exposure to atrazine (ATZ) disrupts testicular histoarchitecture in postnatal caimans (\u003cem\u003eCaiman latirostris\u003c/em\u003e). To assess whether such alterations are the result of disruption of gonadal developmental programming, this study aimed to evaluate the expression of histofunctional biomarkers (VASA, ER, PR, PCNA, and aromatase) and genes involved in gonadal development and differentiation (\u003cem\u003eamh\u003c/em\u003e, \u003cem\u003esox-9\u003c/em\u003e, \u003cem\u003esf-1\u003c/em\u003e and \u003cem\u003ecyp19-a1\u003c/em\u003e) in the gonads of male and female caiman embryos and to assess the effect of ATZ exposure on these biomarkers and genes in the gonads of male embryos. Our results suggest that \u003cem\u003eamh\u003c/em\u003e, aromatase and \u003cem\u003esox-9\u003c/em\u003e play a role in sex determination and gonadal differentiation. In male caiman embryos, ATZ exposure increased aromatase expression and altered the temporal expression pattern of \u003cem\u003eamh\u003c/em\u003e and \u003cem\u003esox-9\u003c/em\u003e evidencing an ATZ-induced disruption of gonadal developmental programming. Since the effects of ATZ are consistent across all vertebrate classes, the ATZ-mediated disruptive effects here observed could be present in other vertebrate species.\u003c/p\u003e","manuscriptTitle":"Disruption of the developmental programming of the gonad of the broad snouted caiman (Caiman latirostris) after in ovo exposure to atrazine.","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-09-08 14:55:55","doi":"10.21203/rs.3.rs-1942101/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"","date":"2022-09-15T19:07:57+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2022-09-05T14:03:58+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2022-08-12T05:45:13+00:00","index":"","fulltext":""},{"type":"submitted","content":"Environmental Science and Pollution Research","date":"2022-08-08T12:24:45+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"environmental-science-and-pollution-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"espr","sideBox":"Learn more about [Environmental Science and Pollution Research](https://www.springer.com/journal/11356)","snPcode":"11356","submissionUrl":"https://submission.nature.com/new-submission/11356/3","title":"Environmental Science and Pollution Research","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"d2ca975a-7ede-484e-8680-c12528dbebb7","owner":[],"postedDate":"September 8th, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2023-10-16T18:19:08+00:00","versionOfRecord":{"articleIdentity":"rs-1942101","link":"https://doi.org/10.1007/s11356-022-25104-z","journal":{"identity":"environmental-science-and-pollution-research","isVorOnly":false,"title":"Environmental Science and Pollution Research"},"publishedOn":"2023-01-06 18:14:50","publishedOnDateReadable":"January 6th, 2023"},"versionCreatedAt":"2022-09-08 14:55:55","video":"","vorDoi":"10.1007/s11356-022-25104-z","vorDoiUrl":"https://doi.org/10.1007/s11356-022-25104-z","workflowStages":[]},"version":"v1","identity":"rs-1942101","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-1942101","identity":"rs-1942101","version":["v1"]},"buildId":"WrCJVZZCHTDjtuVLN7oU0","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00
unpaywall
last seen: 2026-05-22T02:00:06.705733+00:00
License: CC-BY-4.0