SLC26A11 is an atypical solute carrier with dual transport-channel function mediating lysosomal sulfate transport

16 Membrane transporters and channels are generally assumed to be based on distinct structural 17 and functional principles. SLC26A11, a solute carrier with high expression levels in the brain, 18 has been proposed to function as either an anion transporter or a channel. Here, we resolve 19 this apparent discrepancy by demonstrating that SLC26A11 is a dual-function protein capable 20 of operating as both a sulfate transporter and a chloride channel. By resolving its structure 21 and combining biochemical studies and molecular dynamics simulations, we show that 22 SLC26A11 exhibits all the hallmarks of a secondary transporter. The mechanistic basis for its 23 selective ion transport identifies the protein as the elusive lysosomal sulfate exporter. 24 Additionally, we demonstrate that S LC26A11 exhibits an uncoupled, channel -like chloride 25 conductance gated by proton:sulfate symport. Our finding that the chloride-conducting state 26 arises from the transport cycle may contribute to the development of novel therapeutic 27 strategies for treating brain edema, and the identification of its role in lysosome sulfate efflux 28 may provide new approaches to study and treat lysosomal storage diseases. 29 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted August 19, 2025. ; https://doi.org/10.1101/2025.08.17.670773doi: bioRxiv preprint 3 Main text 30

31 SLC26A11, or KBAT for kidney and brain anion transporter, is expressed in most tissues, with 32 the highest expression levels in the brain 1,2. SLC26A11 is a member of the solute carrier 33 family 26 (SLC26) of secondary transporters of small anions 3,4. Initially, SLC26A11 was 34 described as a pH-dependent transporter of sulfate, chloride, and oxalate 1,5,6, consistent with 35 its close phylogenetic relationship to plant and yeast sulfate transporters 6. However, 36 subsequent electrophysiological studies in HEK293 cells 7 and neurons 8,9 have suggested 37 that SLC26A11 functions as a chloride channel. This putative chloride channel activit y of 38 SLC26A11 has been implicated in pathological neuronal swelling 8 and its inhibition has been 39 proposed as a therapeutic strategy for ischemic stroke 9. 40 Membrane transporters and channels are generally assumed to be based on different 41 functional and structural principles 10,11. Based on their structure, SLC26 proteins are assumed 42 to function as transporters that operate according to an elevator-type transport mechanism 12. 43 Detailed functional studies have supported this claim by demonstrating that several SLC26 44 family members are secondary transporters that catalyze either anion symport 13,14 or 45 exchange 15. However, electrophysiological measurements have also demonstrated channel-46 like uncoupled chloride transport for other SLC26 proteins, i.e., SLC26A7 16-19, and SLC26A9 47 20-23. Thus far, it has not been possible to determine whether these uncoupled chloride fluxes 48 are caused by a chloride-selective channel or a fast chloride uniport transport-mode 24. 49 Until now, the function of SLC26A11 has only been studied in the plasma membrane. 50 However, proteomic 25,26 and transcriptomic 27-29 studies and confocal microscopy 30 have 51 identified SLC26A11 as a lysosomal membrane protein. Lysosomes are the primary 52 degradative compartments of the cell 31. Lysosomal recycling of macromolecules depends on 53 the concerted action of lysosomal hydrolases and transporters for catabolite export to the 54 cytosol 32-35. Functional defects in either lead to the accumulation of degradation products and 55

in lysosomal storage diseases (LSDs) 36,37. While lysosomal sulfatases and their 56 causative role in LSDs are well characterized 38, little is known about the efflux of the resulting 57 sulfate 39, a process critical for preventing competitive inhibition of sulfatases 40,41. Although 58 the existence of a lysosomal sulfate clearance pathway has been described 42, its molecular 59 identity has remained unknown. 60 Here we characterize the three-dimensional structure and function of human SLC26A11. Our 61 structures of nanobody -bound SLC26A11 reveal the most compact structure of any 62 mammalian SLC26 transporter. SLC26A11 further exhibits all the hallmarks of a secondary 63 transporter. By combining biochemical studies and molecular dynamics simulations, we show 64 that SLC26A11 is tailored to function as the elusive lysosomal sulfate exporter and provide 65 the mechanistic basis for its highly selective ion transport. We further demonstrate that 66 SLC26A11 is also capable of an uncoupled, channel-like chloride conductance, which is gated 67 by proton and sulfate transport. Taken together, our work identifies SLC26A11 as a protein 68 with a dual transport-channel function. The identification of its role in lysosome sulfate efflux 69 may pave the way to new approaches to study and treat lysosomal storage diseases. Our 70 finding that the chloride-conducting state emerges from a conformation part of the secondary 71 transport cycle may open a path to a therapeutic strategy for the treatment of brain edema. 72 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted August 19, 2025. ; https://doi.org/10.1101/2025.08.17.670773doi: bioRxiv preprint 4

73 SLC26A11 is a proton:sulfate/chloride exchanger 74 Thus far, functional characterization of SLC26A11 has been performed in cell -based assays 75 1,6,7,43. These assays exclusively study proteins inserted into the plasma membrane and permit 76 only limited control of ion gradients . Therefore, we performed a detailed in vitro 77 characterization of purified and membrane-reconstituted human SLC26A11 ΔC, a variant 78 lacking the C-terminal intrinsically disordered region of 23 amino acids [ Supplementary Fig. 79 1A-C]. Consistent with a similar truncation mutant of murine SLC26a9 24, SLC26A11 ΔC 80 showed higher expression levels than full -length SLC26A11 and excellent biochemical 81 behavior [Supplementary Fig. 1D-G]. 82 Since the related Arabidopsis transporter, AtSultr4;1, performs pH-dependent sulfate transport 83 14, we first studied SLC26A11ΔC under similar conditions (pHout 5.0; pHin 7.5). We observed a 84 time-dependent accumulation of 35S-sulfate in SLC26A11 ΔC proteoliposomes, in contrast to 85 liposomes without protein [Fig. 1A ]. We observed that sulfate accumulation was strongly 86 dependent on the presence of chloride ions in trans. Substitution of internal gluconate for 87 chloride increased the initial rate of sulfate transport and the final accumulation level 88 approximately fourfold. Therefore, we included 50 mM chloride in the lumen of the 89 proteoliposomes in subsequent measurements. 90 We further measured SLC26A11ΔC sulfate transport at different pH gradients. Sulfate uptake 91 showed a strong pH dependence, and the highest degree of sulfate accumulation was 92 observed for pH gradients of 2.0-2.5 units and with the acidic pH outside [Fig. 1B ]. Lower 93 levels of sulfate accumulation were observed in the presence of a symmetrical pH of 7.5 or 94 5.0. Since no change in sulfate accumulation was observed in the presence or absence of an 95 inward Na+-gradient, sulfate uptake does not appear to involve Na+ ions, in agreement with a 96 previous study 6 [Supplementary Fig. 2A]. These results suggest that sulfate transport is 97 obligatorily coupled to proton transport in the same direction. We determined an apparent K M 98 of 39.7 ± 5.5 µM for sulfate in the presence of a strong pH gradient (pHout 5.0; pHin 7.5) [Fig. 99 1C]. 100 Next, we systematically varied the chloride concentrations in both compartments to explain 101 the stimulatory effect of trans chloride on sulfate transport [ Fig. 1D]. While the presence of 102 chloride in the trans compartment led to strong sulfate accumulation, the presence of chloride 103 in both compartments showed similar reduced uptake levels as observed in the absence of 104 chloride. Sulfate uptake was further reduced in the presence of chloride in the cis compartment 105 only. Together, this indicates that chloride is not an allosteric modulator of SLC26A11, but 106 rather acts as a substrate competing with sulfate for the same binding site when present in 107 the cis compartment, and functions as a counter -substrate when present in the trans 108 compartment. 109 To determine whether SLC26A11 is an obligate exchanger, we first identified anions capable 110 of inhibiting 35S-sulfate uptake. We observed strong inhibition upon addition of a 100-fold 111 excess of thiosulfate, oxalate and selenate to the cis compartment [Fig. 1E ]. Molybdate, 112 iodide, acetate and chloride inhibited transport to a lesser extent, whereas phosphate and 113 bicarbonate had no effect on SLC26A11ΔC activity. Next, we loaded proteoliposomes with 35S-114 sulfate until steady state was reached before dissipating the proton gradient. In the absence 115 of external substrate, the proteoliposomes retained ~90% of the sulfate over the next 32 116 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted August 19, 2025. ; https://doi.org/10.1101/2025.08.17.670773doi: bioRxiv preprint 5 minutes [Fig. 1F]. However, upon addition of a 100-fold excess of unlabeled sulfate, oxalate, 117 or selenate, we did observe efflux of most of the 35S-sulfate from the proteoliposomes. The 118 limited degree of 35S-sulfate efflux in the absence of a counter -substrate suggests that the 119 energetic barrier for a conformational transition in the absence of substrate is very high. Thus, 120 SLC26A11 appears to function most efficiently as an exchanger. 121 Figure 1: Sulfate transport of SLC26A11 is pH and chloride dependent. (A) Time dependent sulfate uptake into SLC26A11 proteoliposomes in presence of a pH gradient (pH 7.5 inside, pH 5.0 outside) and 50 mM internal chloride (blue) or 50 mM gluconate as chloride substitute (dark grey) and empty liposome control (light grey). (B) pH dependence of sulfate transport in presence of 50 mM internal chloride and with internal and external pH as indicated below the individual bars. A Two- tailed Student’s t test was performed (*** indicates p < 0.001, p values are shown in the Source Data file). (C) Sulfate transport kinetics. Data represents background-corrected initial sulfate uptake after 20 seconds in presence of increasing sulfate concentrations. K m and Vmax were derived from non- linear curve fitting using the Michaelis -Menten function in OriginPro. (D) Chloride dependence of sulfate transport with internal and external 50 mM chloride or 50 mM gluconate as chloride substitute as indicated below the individual bars. (E) Inhibition of sulfate transport in presence of different anions as indicated below individual bars. Anions were added as sodium salt at 100- fold the concentration of external sulfate. A Two-tailed Student’s t test was performed (*** p < 0.001, ** p < 0.01, * p < 0.05, p values are shown in the Source Data file). (F) Sulfate efflux from proteoliposomes upon sulfate uptake as shown in panel A. Sulfate efflux was initiated by addition of 100 nM CCCP and different anions at 100- fold external sulfate concentration as indicated. For all experiments in Fig. 1, the individual datapoints as well as the mean ± SEM (n ≥ 3) are shown. Assay buffers and precise number of replicates are detailed in Supplementary Table 1. Bar graphs represent background- corrected sulfate accumulation levels reached after 16 min of transport. Combined these results suggest that SLC26A11 can transport protons and sulfate ions in one 122 direction and chloride ions in the opposite direction. To approximate the stoichiometry of 123 transported ions, we measured (cis) proton- and (trans) chloride-driven sulfate accumulation 124 in the presence of different membrane potentials [Supplementary Fig. 2B]. We observed 125 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted August 19, 2025. ; https://doi.org/10.1101/2025.08.17.670773doi: bioRxiv preprint 6 only modest changes when generating a membrane potential of 0 and +60 mV, but at -60 mV 126 sulfate accumulation was reduced by approximately 30%. For electrogenic transport, a more 127 pronounced reduction at -60 mV and a concomitant increase in sulfate accumulation at +60 128 mV would be expected, as shown for the proton:fumarate symporter SLC26Dg 13. These 129

therefore support an electroneutral transport mode for SLC26A11. In the most 130 parsimonious model, SLC26A11 is an exchanger that couples the symport of one proton and 131 one sulfate ion (net charge of -1) to the antiport of one chloride ion (net charge of -1). 132 Figure. 2: Structures of human SLC26A11 ΔC reveal three unique features. (A) Cryo-EM reconstruction of the dimeric SLC26A11 ΔC-Nb11 (blue) and SLC26A11ΔC-Nb4 (green) complexes embedded in an MSP1-E3D1 nanodisc. Nanobody densities are shown in grey and the MSP1-E3D1 density, indicative of the position of the lipid bilayer, is shown as transparent belt. (B) View on the extracellular side of SLC26A11 ΔC showing the transport (green) and scaffold domains (light green) connected by two interdomain linkers and the intracellular STAS domain. (C) Alternative N - glycosylation site in SLC26A11 in the β -hairpin loop TM7-8. The electron density corresponding to the NAG group attached to Asn -294 is shown as blue mesh. Inset: PNGase F treatment increases the electrophoretic mobility of SLC26A11 ΔC. (D) Helix kinking of TM7 at Ala -246 results in an extended conformation of loop TM6-7 containing the PxxPxxP SH3 binding motif. The position of the lipid bilayer, derived from the nanodisc density, is indicated as grey lines. Overall structure of human SLC26A11 133 We determined structures of SLC26A11 ΔC in MSP1 -E3D1 nanodiscs supplemented with 134 phosphatidylcholine to gain insight into the mechanistic basis of sulfate transport coupled to 135 the cis proton- and trans chloride-gradients. As fiducial markers for cryo-electron microscopy, 136 we selected two nanobodies, Nb4 and Nb11, from alpaca immune libraries based on their 137 opposite effects on the transporter’s thermal stability [Supplementary Fig. 3], resulting in two 138 highly similar structures (RMSD of 0.56 Å) with an overall resolution of 2.8 Å (Nb4) and 3.2 Å 139 (Nb11) [Fig. 2A, Supplementary Fig. 4-7]. Nb4 and Nb11 each bind SLC26A11ΔC on the side 140 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted August 19, 2025. ; https://doi.org/10.1101/2025.08.17.670773doi: bioRxiv preprint 7 of the membrane domain that faces the lysosomal lumen or the extracellular environment, but 141 they bind in different locations. 142 Both structures of nanobody -bound SLC26A11 ΔC show an SLC26A11 homodimer with 143 cytoplasmic STAS domains swapped between the protomers and two nanobodies binding the 144 membrane domain on the extracellular side. The SLC26A11 membrane domain is composed 145 of 14 transmembrane segments (TMs) arranged in two inverted repeats of seven TMs, a fold 146 shared by the SLC4, SLC23 and SLC26 families 44. The membrane domain can be further 147 subdivided into a compact transport domain flanked on one side by an elongated scaffold 148 domain [Fig. 2B]. On either side of the membrane, these subdomains are connected by α -149 helical interdomain-linkers that coordinate the relative reorientation of the transport domain 150 that underlies solute transport 45. The structure of SLC26A11, while conforming to the overall 151 design 12,15,24,46-52, deviates markedly from other mammalian SLC26 proteins in each of the 152 three subdomains [Supplementary Fig. 8]. 153 In the transport domain, all other human isoforms carry one or more glycosylation sites in the 154 elongated, extracellular loop bridging TM3-4. This loop is kept compact in SLC26A11 155 [Supplementary Fig. 8A ]. The SLC26A11 ΔC-Nb11 structure instead shows a β-hairpin 156 extension in loop TM7-8, immediately adjacent to TM3-4. This hairpin is in close contact with 157 Nb11. At its tip, this loop carries an additional density at the known glycosylation site Asn-294 158 53, where we modeled an N -acetylglucosamine (NAG) moiety [Fig. 2C]. We confirmed the 159 presence of N-glycosylation in our SLC26A11 sample by PNGase F treatment [Fig. 2C]. The 160 TM7-8 loop is not resolved in the SLC26A11ΔC-Nb4 structure. Given that Nb4 does not interact 161 with the hairpin, this suggests that it is highly mobile in the absence of a binding partner. 162 The second structural deviation in SLC26A11 involves TM7 in the scaffold domain [Fig. 2D ]. 163 Compared to other human SLC26 proteins, TM7 is comparably long and is kinked within the 164 membrane so that the intracellular half is at an angle of 107° to the extracellular half 165 [Supplementary Fig. 8A ]. The break in the helix occurs at Ala-246 and appears to be 166 stabilized by positioning the intracellular amphipathic half of TM7 at the membrane inter face 167 in the lipid bilayer . As a consequence of this arrangement, the intracellular loop TM6-7 is 168 extended, presenting a potential protein-protein interaction motif, a class VIII SH3 domain 169 binding sequence 54. 170 Finally, SLC26A11 contains the most compact STAS domain of all human SLC26 transporters 171 [Supplementary Fig. 8A ]. This is due to the absence of an internal intrinsically disordered 172 sequence, the so-called intervening sequence, and a comparatively short disordered C -173 terminus [ Supplementary Fig. 1]. In contrast to other human SLC26 proteins, the interface 174 between adjacent STAS domains is very small [Supplementary Fig. 9]. Instead, the dimer 175 interface is largely composed of interactions between the STAS domains and TM5, TM12, 176 TM13, and the intracellular interdomain linker, which are all part of the scaffold domain. 177 Molecular basis for proton coupling 178 The substrate binding site is located in the center of the transport domain and faces the 179 scaffold domain. It consists of a small cavity lined by TM1 and TM8 and the short α-helical 180 sections of TM3 and TM10 [Fig. 3A, B ]. Both structures capture SLC26A11 ΔC in the same 181 conformation with the substrate binding site accessible from the cytoplasm via a water -filled 182 cavity, suggesting an inward-open conformation [Fig. 3A]. We observed an additional density 183 in the substrate binding site, which we modelled as a putative buffer-derived chloride ion [Fig. 184 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted August 19, 2025. ; https://doi.org/10.1101/2025.08.17.670773doi: bioRxiv preprint 8 3B]. While the substrate binding site itself is stabilized by a network of hydrogen bonds, we 185 did not observe any specific interactions between the chloride ion and the residues lining the 186 substrate binding site. Averaged ion densities from extensive all -atom MD simulations (vide 187 infra) revealed that chloride and sulfate can bind at this site, allowing for the unambiguous 188 assignment of the observed density [Supplementary Fig. 10, 11]. Chloride binding thus 189 appears to be based on electrostatic interactions involving the positive dipoles of the α-helical 190 segments of TM3 and TM10 and the side chain of Arg-366 [Fig. 3B]. 191 To identify the molecular basis for proton-coupling, we performed all-atom molecular dynamics 192 (MD) simulations of SLC26A11 with standard aqueous protonation states at pH 7 193 [Supplementary Fig. 10, 11]. For each titratable residue, we determined its average pK a 194 value over the course of the entire set of initial simulations (6.52 µs) and compared it to the 195 corresponding standard pKa value in an aqueous environment [Fig. 3C]. While the pKa values 196 of all histidine residues fall within the physiologically relevant pH range, these residues are 197 located at the periphery of the protein [Supplementary Fig. 12]. Due to the comparatively 198 large basic shift of its pKa, Glu-320 also falls within the relevant pH range. Glu-320 is situated 199 Figure 3: Milieu of the SLC26A11 binding site depends on a titratable residue. (A) Surface representation of SLC26A11ΔC-Nb4 clipped through the substrate binding site, indicated by a green asterisk, showing the inward -facing cavity. (B) Substrate binding site of SLC26A11 with bound chloride ion (green sphere), water molecules (red spheres) and corresponding electron densit ies shown as blue mesh. Hydrogen bonds are shown as black dotted lines. (C) Experimental aqueous pKa values compared to simulated pK a values of aqueous -exposed and buried titratable residues. The grey rectangle denotes the physiologically relevant pH range for proton-coupled transport. (D) Multiple sequence alignment among the human SLC26 family members, depicting a segment of TM8. The position of Glu-320 in SLC26A11 is indicated by the grey box. (E-F) Substrate binding site full system electrostatics in a sphere of 7-Å radius surrounding the binding site’s center-of-geometry. The substrate binding site of SLC26A11 is shown with Glu-320 in the deprotonated (E) and protonated state (F). Glu-320 is shown in stick representation. .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted August 19, 2025. ; https://doi.org/10.1101/2025.08.17.670773doi: bioRxiv preprint 9 in TM8 and directly flanks the substrate binding site [Fig. 3B ]. This analysis highlights Glu-200 320 as the most suitable residue for proton-coupling. 201 Sequence alignment of the ten human family members shows that Glu-320 is unique to 202 SLC26A11 [Fig. 3D]. Although Glu-320 lines the substrate binding site, its carboxylate group 203 appears to be too distant to contribute directly to ion coordination [Fig. 3B]. However, the 204 protonation state of Glu-320 strongly affects the mean electrostatic potential in and around the 205 substrate binding site [ Fig. 3E, Fig. 3F], consistent with a potential long-range electrostatic 206 contribution to substrate binding. 207 208 Figure 4: Sulfate binding to SLC26A11 is selectively controlled by the protonation state of Glu-320. (A) Thermal unfolding of SLC26A11ΔC at pH 5.0 (top) and pH 7.5 (bottom) in the presence of increasing sulfate concentrations (blue = 0 mM sulfate, red = 80 mM sulfate). Shown are mean and standard deviation (n = 3 ) of the first derivative of F 350/F330. The melting temperature T m is reported by the local minimum of d(F350/F330)/dT. (B) pH-dependence of the substrate binding affinity (KD) of SLC26A11ΔC and standard deviation derived from non-linear curve fitting using OriginPro of Tm/Tm-apo derived from panel A and [Supplementary Fig. 13]. (C) Binding affinity (KD) and binding rates (kon, koff), for sulfate and chloride, derived from all -atom equilibrium molecular dynamics simulations under different protonation states of Glu -320. E320p denotes the protonated species. Distributions of values come from six independent dimer simulations for each condition, with each subunit considered independent, resulting in 12 independent replicates per calculation. (D) Thermal unfolding of SLC26A11ΔC(E320Q) as in panel A. (E) pH-dependence of the KD and standard deviation of SLC26A11ΔC( E320Q) as shown in panel B. (F) Sulfate transport of SLC26A11 ΔC as shown in Figure 1B and SLC26A11 ΔC( E320Q) in presence or absence of a proton gradient as indicated. Shown are background corrected mean, SEM and individual data points (n = 3) after 16 minutes of transport. A Two-tailed Student’s t test was performed. 209 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted August 19, 2025. ; https://doi.org/10.1101/2025.08.17.670773doi: bioRxiv preprint 10 Glu-320 protonation controls substrate binding 210 The presence of a titratable residue in the substrate binding site prompted us to determine the 211 relationship between substrate binding and pH. We first measured the binding of chloride and 212 sulfate at pH 5.0 and pH 7.5 using differential scanning fluorimetry (DSF ) and derived 213 dissociation constants [Fig. 4A, B, Supplementary Fig. 13]. Chloride binding to SLC26A11ΔC 214 was independent of pH with apparent KD values of 6.0 ± 1.4 and 5.3 ± 0.7 mM at pH 5.0 and 215 pH 7.5, respectively. For sulfate we observed strong binding at pH 5.0 with an apparent KD of 216 57 ± 11 µM. However, at pH 7.5, sulfate binding was less favorable with an apparent KD of 2.9 217 ± 0.4 mM. Thus, while chloride binding remained constant, the affinity for sulfate changed by 218 almost two orders of magnitude as a function of pH. 219 Next, we used DSF to analyze the pH-dependent binding of other mono- and divalent anions 220 that act as SLC26A11 substrates [Fig. 1E, F]. As with chloride, we did not observe a strong 221 pH-dependent change in binding affinity for iodide and acetate, which are completely and 222 predominantly mono-anionic, respectively, under these conditions [Supplementary Fig. 14]. 223 In contrast, the divalent anions oxalate, thiosulfate, selenate and molybdate showed a strong 224 decrease in binding affinity, upon shifting from pH 5.0 to pH 7.5, similar to that observed for 225 sulfate. Taken together, this suggests that the charge of the anion is the major determinant of 226 pH modulation of binding affinity. 227 Given the impact of the protonation state of Glu-320 on the surface potential of the substrate 228 binding site [Fig. 3E, F], we determined the sulfate and chloride binding constants for 229 protonated and deprotonated Glu-320 using equilibrium MD simulations. Over a timespan of 230 ~15 µs, we captured hundreds of spontaneous binding and unbinding events, which we used 231 to evaluate the kinetic binding constants [Fig. 4C]. Protonation of Glu-320, which occurs under 232 acidic conditions, results in a slight increase in in silico association rates (kON) for chloride and 233 sulfate, and a slight decrease in the dissociation rates (k OFF) of both ions. However, both 234 changes are more pronounced for sulfate, resulting in a significant change in binding affinity 235 only for this ion. The dissociation constant for sulfate is reduced by almost an order of 236 magnitude upon protonation of Glu-320. These results are in good quantitative agreement with 237 the biochemical experiments, which also show an increased affinity for sulfate, but not for 238 chloride, upon protonation, and demonstrate that the protonation state of Glu-320 controls the 239 substrate-specific binding affinity. 240 As a mimic of the protonated state, we introduced the E320Q mutant, designated 241 SLC26A11ΔC(E320Q). The chloride dissociation constant of SLC26A11 ΔC(E320Q), as 242 determined by DSF, was comparable to that of the wild type protein at pH 5.0 (8.8 ± 1.4 mM) 243 and was increased six-fold at pH 7.5 (30 ± 4.0 mM) [Fig. 4D, E]. However, the most significant 244 c hange was observed for sulfate. While the binding affinity remained high at pH 5.0 (KD 19 ± 245 4.0 µM ), the E320Q mutant showed a similarly high affinity at pH 7.5 (K D 13 ± 3.0 µM ), 246 representing a more than 200-fold increase in binding affinity compared to the wild type 247 protein. This further supports a critical role of the Glu-320 protonation state in the sulfate but 248 not the chloride binding affinity, with the protonated and deprotonated species allowing sulfate 249 binding with micromolar and millimolar affinities, respectively. The agreement between the KD 250 for sulfate at pH 5.0 [Fig. 4B] and the apparent KM for sulfate transport [Fig. 1C] is consistent 251 with sulfate being transported with a proton. 252 Finally, we did not observe any (cis) proton- and (trans) chloride-driven sulfate accumulation 253 in SLC26A11ΔC(E320Q) proteoliposomes [Fig. 4F]. This is consistent with the very high, pH -254 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted August 19, 2025. ; https://doi.org/10.1101/2025.08.17.670773doi: bioRxiv preprint 11 independent sulfate binding affinity of the mutant and the slight decrease in chloride binding 255 affinity at high pH, which together are expected to result in a very low efficiency of sulfate-for-256 chloride exchange in the liposomal lumen. 257 258 259 260 Figure 5: SLC26A11 exhibits pH- and sulfate-dependent intrinsic chloride channel activity. (A) Representative current recordings from Sf9 cells expressing SLC26A11(WT) -eGFP with buffer conditions as shown in panel B. (B) Current-voltage relationships (means ± standard errors; n = 13/11/7) from transfected Sf9 cells in three different bath solutions as indicated (grey: 0 mM sulfate, pH 7; blue: 10 mM sulfate, pH 7; red: 10 mM sulfate, pH 6.0). (C) Current-voltage relationships (means ± standard errors; n = 9/10) from untransfected Sf9 cells in the same solutions as indicated in panel B. (D, E) Representative whole- cell current traces (D) and current -voltage relationships (mean ± standard errors; WT: n = 29/6, E320Q: n = 25/11) (E) for SLC26A11(WT) and SLC26A11(E320Q) in absence or presence of a pH gradient (blue: symmetrical pH 7.33; red: pH out 6.00, pHin 7.33). (F) upper panel: Reversal potentials (Urev) for SLC26A11(WT) at different external pH values presented as whisker -box plots. Boxes indicate upper and lower 75/25% quartiles with medians. Whiskers span 95% confidence limits. Data points are derived from experiments shown in panel D and E and Supplementary Fig. 19. lower panel: Current amplitudes of SLC26A11(WT) and SLC26A11(E320Q) at -120 mV at experimental conditions as shown in panel E at various external pH conditions (pH 7.33/7.00/6.66/6.33/6.00; WT: n =29/20/12/7/6, E320Q: n = 25/15/12/12/11). .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted August 19, 2025. ; https://doi.org/10.1101/2025.08.17.670773doi: bioRxiv preprint 12 SLC26A11 is a chloride channel 261 Since previous electrophysiological studies have suggested that SLC26A11 can function as 262 an anion channel 7-9, we next studied the electrophysiological properties of SLC26A11 via 263 whole-cell patch clamp. For these experiments we used Spodoptera frugiperda (Sf9) insect 264 cells: whereas SLC26A11 exclusively localizes to lysosomes in various mammalian cell lines 265 30, a fraction of the SLC26A11 protein localizes to the plasma membrane in Sf9 cells 266 [Supplementary Fig. 15]. 267 At neutral pH and in the absence of sulfate, we did not observe any SLC26A11- mediated 268 current above background [Supplementary Fig. 16]. However, in the presence of 0.5 mM 269 sulfate in the internal solution, we detected small SLC26A11 currents (-114 ± 18 pA at -120 270 mV) at symmetrical chloride concentrations [Fig. 5A -B]. These currents exceeded the 271

currents in non-transduced cells (-56 ± 14 pA at -120 mV) [Fig. 5C], suggesting 272 that the observed current is conducted by SLC26A11. 273 SLC26A11-specific current amplitudes further increased in the presence of 10 mM external 274 sulfate (-463 ± 140 pA at -120 mV) and upon subsequent acidification of the bath solution from 275 pH 7.0 to 6.0 (-833 ± 374 pA at -120 mV) [Fig. 5A-C]. While the latter conditions are in principle 276 compatible with sulfate binding and transport into cells, currents of similar magnitude were 277 also detected under conditions with opposite ion distributions compatible with sulfate binding 278 on the cytoplasmic side and subsequent export [Supplementary Fig. 17]. Under conditions 279 with high internal sulfate concentrations, currents further increased with a stronger outward 280 pH gradient (pHin 6.0; pHout 8.5). Thus, conditions that favor proton:sulfate transport enhance 281 SLC26A11 currents. Under all conditions the current reversal potential remained close to the 282 Nernst equilibrium potential for chloride, indicating that the observed current is chloride-283 selective. This is further supported by the altered reversal potential observed upon depletion 284 or substitution of external chloride [Supplementary Fig. 18]. 285 Given the impact of Glu-320 protonation on substrate selectivity and transport, we examined 286 the consequences of the E320Q mutation on SLC26A11-specific whole-cell currents. 287 SLC26A11(E320Q) showed similar expression levels and intracellular distribution as the wild 288 type protein [Supplementary Fig. 15]. However, whereas SLC26A11(WT )-specific currents 289 w ere activated by external acidification at high external sulfate, SLC26A11(E320Q ) anion 290 currents instead remained low but exceeded background currents [Fig. 5D-F, Supplementary 291 Fig. 19]. The lack of pH -dependence observed for SLC26A11(E320Q ) chloride currents 292 suggests that activation of the chloride channel requires the protein to cycle through different 293 Glu-320 protonation states, as previously observed for the electroneutral 294 proton:sulfate/chloride exchange mode of transport [Fig. 4F]. 295 Taken together, our findings indicate that SLC26A11 exhibits two distinct transport functions: 296 electroneutral proton:sulfate/chloride exchange and chloride channel activity. In conjunction 297 with the sulfate dependency of chloride channel activation, the distinct pH dependence of the 298 currents recorded with internal [Supplementary Fig. 17] or external sulfate [Fig. 5A -C] 299 demonstrate that SLC26A11 chloride channels are gated by SLC26A11 sulfate transport. 300 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted August 19, 2025. ; https://doi.org/10.1101/2025.08.17.670773doi: bioRxiv preprint 13

301 The function of SLC26A11 has remained disputed. Cell -based assays have suggested that 302 the protein is either a pH-dependent secondary transporter for sulfate, chloride, and oxalate 303 1,5,6, or a channel for chloride 7-9. Here, by combining functional studies performed under well-304 defined conditions with single-particle cryo-EM and molecular dynamics simulations, we 305 demonstrate that human SLC26A11 can function as both a secondary -active transporter and 306 an anion channel. This dual -function behavior resolves the remaining controversy over the 307 function of SLC26A11 and provides the first insights into the mechanism of passive transport 308 in this family. 309 Our in vitro transport studies using membrane-rec onstituted protein indicate that SLC26A11 310 operates as an electroneutral proton:sulfate/chloride exchanger [Fig.1]. SLC26A11 thus 311 closely resembles the function of the rat lysosomal sulfate transporter reported three decades 312 ago 42. Together with its lysosomal localization 26,30 and its upregulation during lysosomal 313 biogenesis 27, our functional characterization suggests that SLC26A11 represents the elusive 314 lysosomal transporter for sulfate. Its use of the proton gradient as driving force to export sulfate 315 from the lysosome is consistent with other lysosomal transporters 37, e.g., SLC17A5 55, 316 SLC36A1 56, SLC46A3 57, SLC63A1 58, and SLC66A4 59. In agreement with its role as a 317 housekeeping protein, SLC26A11 shows a broad tissue distribution in the human body 6. 318 To function efficiently as a sulfate exporter, SLC26A11 must preferentially bind sulfate over 319 chloride. This is not trivial, as the lysosomal chloride concentrations are high (80 – 120 mM) 320 60,61 and exceed the lysosomal sulfate concentrations 40,41 by orders of magnitude. Our results 321 suggest that the molecular basis for this preferential binding of sulfate in the lysosomal lumen 322 is Glu-320. Glu-320 is the only amino acid in the membrane domain of SLC26A11 that is 323 predicted to have a pKa in the physiologically relevant range [Fig. 3C]. Within the mammalian 324 SLC26 family, SLC26A11 is the sole member with an acidic residue at this position [Fig. 3D]. 325 Glu-320 flanks the substrate binding site [Fig. 2], allowing it to contribute directly to the 326 electrochemical milieu of the binding site [Fig. 3E -F]. Protonation of Glu-320 increases the 327 binding affinity for sulfate from an apparent KD of 2.9 mM to 57 µM, whereas chloride binding 328 is essentially unaffected and remains at a comparably low affinity (apparent KD values of 6.0 329 mM and 5.3 mM at pH 7.5 and 5.0, respectively ) [Fig. 4]. Thus, Glu-320 acts as a signal 330 integration node that determines whether sulfate or chloride will be favored for transport [Fig. 331 4, Supplementary Fig. 13]. 332 Taken together, the following molecular mechanism for transport over the lysosomal 333 membrane emerges [Fig. 6]. At a lysosomal pH of approximately 4.6 33, Glu -320 is 334 predominantly protonated [Fig. 3C]. This selectively increases the binding affinity for sulfate 335 [Fig. 4B] and allows the formation of sulfate-bound SLC26A11 [Supplementary Fig. 20A] 336 despite the high lysosomal chloride concentration. While sulfate binding puts the protonated 337 carrier in a translocation -competent state that reorients efficiently [Fig. 1A, 1F], it is unclear 338 whether the chloride-bound protonated state is mobile. Efficient reorientation of this state 339 seems unlikely because the resulting proton leak would dissipate both the pH gradient and 340 the membrane potential, thereby disrupting lysosomal lumen homeostasis. After reorientation 341 of the sulfate-bound protonated binding site toward the cytoplasm, the neutral pH leads to 342 deprotonation of Glu-320 . This reduces the sulfate binding affinity and promotes sulfate 343 unbinding [Fig. 4B]. Sulfate rebinding is less favorable than chloride binding at this stage 344 [Supplementary Fig. 20B]. At low cytoplasmic chloride concentrations, a significant fraction 345 of the carrier remains in the apo state. Although deprotonated apo SLC26A11 appears to be 346 translocation competent, its reorientation seems much slower than that of the chloride-bound 347 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted August 19, 2025. ; https://doi.org/10.1101/2025.08.17.670773doi: bioRxiv preprint 14 state [Fig. 1A]. Finally, upon subsequent arrival in the lysosomal lumen, chloride is released 348 and Glu-320 is rapidly protonated, which may lock the carrier until a new sulfate ion is bound. 349 In addition to proton:sulfate/chloride exchange, heterologous expression and whole-cell patch 350 clamp assays assigned passive chloride currents to SLC26A11 [Fig. 5]. In principle, passive 351 currents can be conducted by ion channels, but also by transporters, i.e., by chloride 352 uniporters. Since SLC26A11 functions as a proton:sulfate/chloride exchanger, a 353 straightforward explanation for conductive chloride transport is a variation of the transport 354 cycle resulting in chloride uniport. For example, after chloride translocation, the transporter 355 could return to its initial conformation in the apo state instead of the proton- and sulfate-bound 356 state. However, the experimentally observed enhancement of chloride currents by conditions 357 favoring sulfate transport [Fig. 5; Supplementary Fig. 17] is incompatible with this uniport 358 mode of chloride transport. The co-existence of secondary active proton:sulfate/chloride 359 exchange and passive chloride currents activated by sulfate transport leaves little alternatives 360 to a channel-like conducting state in SLC26A11. 361 Figure 6: Model of the SLC26A11 dual-function mechanism. The SLC26A11 transport cycle can be broken down in five steps. (Step 1) Protonation of Glu-320 in the lysosomal lumen allows (Step 2) selective binding of sulfate despite an excess of competing chloride. Upon reorientation of the binding site to the cytoplasm, (Step 3) Glu-320 is deprotonated and (Step 4) sulfate unbinds. (Step 5) Subsequent binding of chloride accelerates the return of the substrate binding site to the lumen. In the lysosomal lumen, ( Step 1’) chloride unbinds and Glu- 320 is rapidly protonated, thereby completing the transport cycle. The formation of the channel -like, chloride-conducting state (Step *) requires the binding of a proton (Step 1) and sulfate (Step 2) first. It may be reached following (Step 3) the subsequent release of the proton, thereby explaining the strong reduction in conductance of the E320Q mutant, which permanently mimics the protonated state of Glu-320. Values for lysosomal and cytoplasmic sulfate and chloride concentrations, pH, and membrane potential are based on estimates 40,41 and published values 33,60-62. Representations of SLC26A11 with the substrate binding site open to the lysosomal lumen or with a channel-like configuration are toy models. Although membrane channels and transporters are traditionally considered to operate based 362 on fundamentally different structural and mechanistic principles 10,11, a few other transporter 363 families, i.e., SLC1 63-66, SLC6 67,68, and ClC-type transporters 69-71, have been shown to exhibit 364 a similar dual -function phenotype. Among these, members of the SLC1 family of excitatory 365 amino acid transporters have been studied in the most detail. Like SLC26 proteins, SLC1 366 proteins operate according to an elev ator-type transport mechanism, wherein a mobile 367 transport domain traverses the membrane relative to an immobile scaffold domain 72,73. In 368 SLC1 proteins, the anion-selective conduction pore is transiently formed at the interface 369 between the transport and scaffold domain 74,75. We presume that a similar mechanism 370 underlies channel formation in SLC26A11 [Fig. 6]. In SLC26A11, conductive states are 371 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted August 19, 2025. ; https://doi.org/10.1101/2025.08.17.670773doi: bioRxiv preprint 15 activated by conditions compatible with sulfate binding and transport [Fig. 5; Supplementary 372 Fig. 17]. The impaired chloride currents observed for the SLC26A11(E320Q) mutant, which 373 permanently mimics the protonated state and consequently binds sulfate with high affinity 374 regardless of the pH, suggest that the conductive state is formed after deprotonation but 375 before sulfate release [Fig. 6]. 376 While the relevance of sulfate export from the lysosome is apparent, the necessity of the 377 SLC26A11 chloride channel is not. In lysosomes, the Nernst potential for chloride is likely 378 close to the membrane potential 33. Thus, chloride fluxes over the SLC26A11 channel are 379 expected to be limited. However, if the luminal chloride concentration exceeds the range that 380 can be maintained by the membrane potential, the chloride conductance of SLC26A11 may 381 serve to decrease its value. Given the importance of chloride in accelerating the transport 382 mode, this feedback would ensure high transport rates. 383 Compared to its lysosomal counterpart, SLC26A11 residing in the plasma membrane is less 384 likely to reach the chloride-conductive state under physiological conditions. The neutral pH 385 and sub-millimolar sulfate concentrations on either side of the membrane 62,76 will suppress 386 the formation of the protonated and sulfate-bound state that precedes the chloride-conductive 387 conformation. However, consistent with its proposed role in pathological neuronal swelling in 388 brain edema 8, high SLC26A11 chloride currents are likely to occur during brain trauma and 389 ischemia due to the concomitant tissue acidification with external and internal pH values falling 390 below 6.5 77,78. 391 The subcellular localization of SLC26A11 is key to assess its impact on cellular physiology, 392 but how SLC26A11 trafficking is orchestrated remains unclear. SLC26A11 lacks typical 393 tyrosine or dileucine based lysosomal targeting s equences 79. Its appearance at the cell 394 surface suggests that it is first trafficked from the trans-Golgi network to the plasma membrane 395 and subsequently delivered to the lysos ome following internalization 80. However, the 396 efficiency of this process appears to vary between cell types, as SLC26A11 is not consistently 397 observed in the plasma membrane 30. Glycosylation does not affect the plasma membrane 398 localization of SLC26A11 53, in contrast to other lysosomal membrane proteins 81. 399 Alternatively, association with other membrane proteins may modulate transport between 400 compartments 82. While heterodimerization with other SLC26 proteins has been ruled out 30, 401 SLC26A11 has been shown to co- localize with the vacuolar -type H+-ATPase (V-ATPase) 1 402 and modulate its activity 7. Since the SLC26A11-STAS domain is remarkably compact and 403 lacks the disordered sequences typically used for protein -protein interactions in SLC26 404 proteins 4, the unique SH3 domain binding motif [Fig. 2D] between TM6 and the elongated 405 kinked TM7 may contribute to such an association with a lysosomal membrane protein. 406 In conclusion, our structural and functional characterization demonstrate that human 407 SLC26A11 is a dual -function protein that operates as both a coupled secondary transporter 408 for small anions and a chloride channel. The physiological relevance of these two modes 409 depend s on the subcellular localization of the protein. SLC26A11 in lysosomes is the elusive 410 sulfate export system and its chloride conductance contributes to lysosomal chloride 411 homeostasis thereby ensuring high proton:sulfate/chloride exchange rates. Under 412 physiological conditions, the activity of plasmalemmal SLC26A11 is limited. Only upon tissue 413 acidification caused by, e.g., ischemia, SLC26A11 is activated as a chloride channel that 414 mediates anion influx and contributes to neuronal swelling 8. The proposed coupling of 415 SLC26A11 transport and anion channel opening implies that specific transport inhibitors, such 416 as a nanobody that binds to the extracellular face of SLC26A11, may contribute to a 417 therapeutic strategy to block chloride influx through SLC26A11 and prevent cytotoxic brain 418 edema caused by neuronal swelling. 419 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted August 19, 2025. ; https://doi.org/10.1101/2025.08.17.670773doi: bioRxiv preprint 16 Material/Methods 420 Molecular cloning of SLC26A11( ΔC) – The open reading frame of SLC26A11 was PCR 421 amplified from the pDONR221_SLC26A11 plasmid (Addgene: #131996) using FX-cloning 422 primers (https://www.fxcloning.org; for primer (5'-3'): 423 atatatgctcttctagtcccagctccgtgaccgccctgggacag, rev primer (5'-3'): 424 atatatgctcttctagtccaagctccgtgaccgccctggga). The column purified PCR product was cloned 425 into pINIT_cat (Addgene: #46858) u sing FX cloning 83. The Insert was sequence -verified, 426 subcloned into the pHXC3GS or pHXCA3GS vector and transformed into E. coli MC1061 for 427 plasmid production. 428 SLC26A11(ΔC, E320Q) mutagenesis – The open reading frame of SLC26A11 was PCR 429 amplified from the pDONR221_SLC26A11 plasmid (Addgene: #131996) in 2 separate PCR 430 reactions using the following primers: reaction 1 for primer (5' -3'): 431 atatatgctcttctagtcccagctccgtgaccgccctgggacag, reaction 1 rev primer (5'-3'): 432 atatatgctcttcattgcagcaggcccatcaggggcaccactgc, reaction 2 for primer (5'-3'): 433 atatatgctcttctcaatctatcgccgtggccaaggcctttgcc, reaction 2 rev primer (5'-3') : 434 atatatgctcttctagtccaagctccgtgaccgccctggga. PCR products of reaction 1 and 2 were column 435 purified, combined to equal molar ratio and cloned into pINIT_cat (Addgene: #46858) using 436 FX cloning. The insert was sequence-verified, subcloned into the pHXC3GS vector and 437 transformed into E. coli MC1061 for plasmid production. 438 SLC26A11 expression and purification – Baculovirus was prepared as described elsewhere 439 84 using the pHXC3GS or pHXCA3GS vectors harboring the SLC26A11(Δ C) open reading 440 frame. Trichoplusia ni cells at a concentration of 1x10 6 cells/mL were infected with 1% (v/v ) 441 baculovirus and cultivated in suspension for 72 h at 27 °C in ESF 921 serum -free medium. 442 Cells were collected by centrifugation at 300 x g and 4 °C for 10 minutes and resuspended in 443 20 mM Hepes pH 7.25, 150 mM NaCl, 10% glycerol, 1 mM PMSF, 1 mM MgCl 2, 2% DDM, 444 0.2% CHS and stirred for 1 h at 4 °C in presence of Benzonase. Cell debris was removed by 445 centrifugation at 140000 x g and 4 °C for 30 minutes. The supernatant was submitted to batch 446 binding with washed and pre-equilibrated Strep-Tactin® Superflow® resin (IBA) f or 1 h. The 447 sample was loaded on a gravity flow column, the column drained by gravity and the resin 448 washed with 20 column volumes wash buffer (20 mM Hepes pH 7.25, 150 mM NaCl, 10% 449 glycerol, 0.05% DDM, 0.005% CHS). SLC26A11 was eluted from the column by addition of 3 450 column volumes wash buffer supplemented with 2.5 mM D-desthiobiotin and subsequently 451 incubated for 1 h at 4 °C in presence of 1 mg HRV-3C protease. The sample was concentrated 452 at 2000 x g and 4 °C using an Amicon Ultra 50 kDa MWCO concentrator, centrifuged for 5 min 453 at 25,000 x g to remove large aggregates and subsequently loaded on a Superdex 200 454 increase 10/300 GL size exclusion column equilibrated with buffer containing 20 mM Hepes 455 pH 7.25, 150 mM NaCl, 0.05% DDM, 0.005% CHS. Peak fractions corresponding to dimeric 456 and monomeric SLC26A11 were pooled and diluted to 1 mg/ml concentration in 20 mM Hepes 457 pH 7.25, 150 mM NaCl, 10% glycerol, 0.05% DDM, 0.005% CHS, snap frozen in liquid 458 nitrogen and stored at -80°C until further use. 459 SLC26A11 for alpaca immunization was prepared in buffer containing a 10-fold higher CHS 460 concentration (20 mM Hepes pH 7.25, 150 mM NaCl, 10% glycerol, 0.05% DDM and 0.05% 461 CHS). For nanobody selection, SLC26A11 was expressed with a C -terminal AVI-tag and 462 enzymatically biotinylated as described elsewhere 85. Biotinylation efficiency was quantified 463 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted August 19, 2025. ; https://doi.org/10.1101/2025.08.17.670773doi: bioRxiv preprint 17 using the mobility shift of biotinylated protein in SDS -PAGE upon the addition of Streptavidin 464 and exceeded 90%. 465 Nanobody selection – Nb11 was selected against SLC26A11(ΔC) following the described 466 procedure 86,87. Two alpacas were immunized 4 times over a time course of 6 weeks. Four 467 days after the final antigen injection, peripheral blood lymphocytes were isolated. The RNA 468 was purified and converted to cDNA by reverse-transcription, the repertoire amplified by PCR 469 and nanobody genes were cloned into the phage display compatible pDX_init phagemid 88 470 (Addgene: #110101). Two rounds of phage display were performed, binders selected bas ed 471 on their ELISA-signal intensity and sequence analyzed. 472 MSP1E3D1 nanodisc reconstitution and cryoEM sample preparation – SLC26A11(ΔC) 473 was expressed and purified as described above but in the absence of CHS. Glycerol was 474 excluded from the wash and elution buffers. Affinity chromatography pure protein was mixed 475 with DDM solubilized SoyPC lipids in a 1:50 molar ratio and incubated for 1 h at 4 °C with 476 gentle agitation. MSP1E3D1 protein was added to a final molar ratio of 1:1:50 477 (SLC26A11(ΔC):MSP1E3D1:SoyPC) and the sample incubated for 5 h at 4 °C with gentle 478 agitation. Dried Bio-Beads SM -2 were added to a final amount of 50 mg beads/1 mg DDM. 479 The sample was incubated overnight at 4 °C with gentle agitation. Bio-Beads were removed 480 using a gravity column and the sample collected from the eluate. The SLC26A11(ΔC)-GFP 481 fusion protein was cleaved off for 1 h at 4 °C upon addition of 500 μg HRV-3C protease. The 482 sample was concentrated at 3000 x g and 4 °C using an Amicon Ultra 100 kDa MWCO 483 concentrator. The concentrated sample was centrifuged for 10 min at 13,000 x g to remove 484 large aggregates and subsequently loaded on a Superose 6 increase 10/300 GL size 485 exclusion column equilibrated with 20 mM Hepes pH 7.25, 150 mM NaCl. The main peak 486 fraction was applied to a second size exclusion run using the same column and buffer. The 487 main peak fraction was concentrated at 7000 x g and 4 °C using an Amicon Ultra 0.5 mL 50 488 kDa MWCO concentrator. Purified Nb11 was added to the size exclusion chromatography 489 pure SLC26A11(ΔC) nanodiscs in a 1:1.2 molar ratio and allowed to bind for 1 h at 4 °C before 490 freezing. 491 Proteoliposome preparation – Purified SLC26A11(ΔC) was mixed with preformed, Triton X-492 100 destabilized large unilamellar vesicles from SoyPC and DDM solubilized BMP lipid to a 493 ratio of 1:50:0.5 (wt/wt/wt) SLC26A11:SoyPC:BMP (LPR 50) and incubated 15 min at room 494 temperature. Detergent was removed from the sample by stepwise addition of Bio Beads SM-495 2 as described previously 89. Bio Beads were removed from the sample using a gravity column. 496 Proteoliposomes were collected by centrifugation for 1 h at 140000 x g and resuspended to 497 20 mg lipid/mL concentration in 50 mM KPi pH 7.5 using a 25-gauge needle and snap frozen 498 and stored in liquid nitrogen until further use. 499 Radioisotope transport assays – Proteoliposomes were thawed, centrifuged at 250000 x g 500 and 15 °C for 20 minutes and resuspended in buffer containing 20 mM Hepes, 20 mM Mes 501 pH 7.5, 2 mM Mg-gluconate and 50 mM KCl. Proteoliposomes were snap frozen in liquid 502 nitrogen and thawed at room temperature three times before 11x extrusion using a 400 nm 503 polycarbonate filter. Proteoliposomes were centrifuged at 250000 x g and 15 °C for 20 504 minutes, the supernatant discarded and the pellet resuspended to 100 mg/ml concentration in 505 buffer containing 20 mM Hepes, 20 mM Mes pH 7.5, 2 mM Mg-gluconate and 50 mM KCl and 506 homogenized with a 25-gauge needle. To initiate transport, proteoliposomes were diluted to 507 2.5 mg/ml concentration in 30 °C warm buffer containing 20 mM Hepes, 20 mM Mes pH 5, 50 508 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted August 19, 2025. ; https://doi.org/10.1101/2025.08.17.670773doi: bioRxiv preprint 18 mM K-gluconate, 2 mM Mg-gluconate and 50 μ M K2SO4 with 2 μCi/ml activity. The transport 509 reaction was performed in a water bath at 30 °C and stopped at regular intervals by 20-fold 510 dilution of a 100 µl aliquot in ice-cold uptake buffer followed by rapid filtration on 0.45 µm 511 nitrocellulose filters. Filters were washed with additional 2 ml buffer, d issolved overnight in 512 4 ml Ultima Gold TM LSC cocktail (SigmaAldrich) and analyzed using a Tri-carb 2900TR 513 (PerkinElmer) liquid scintillation counter. 514 Cryo-EM methods – Samples were vitrified on UltrAuFoil grids (R0.6/1.0, Quantifoil, 515 Germany) after glow discharge for 150 sec in air at a pressure of 3.0x10 -1 Torr at medium 516 power with a Harrick Plasma Cleaner (PDC-002). A Vitrobot IV (ThermoFisher ) was used for 517 vitrification in liquid ethane with 5 s blot time and +20 blot force. Movie data was acquired at 518 the cryo-EM facility in Würzburg on a Krios G3 electron microscope (ThermoFisher) with 519 different cameras and settings for the two samples: For SLC26A11 with Nb11 a Falcon III 520 direct detector was used in counting mode, collecting 47 fractions in 75 sec. At a magnification 521 of 75,000x a calibrated pixel size of 1.0635 Å was obtained and a total exposure of 522 79 electrons/Å2 was used. The target defocus range was between 1.0 to 1.4 µm under focus. 523 2553 movies were recorded and then motion corrected and dose weighted in a live session of 524 the program package cryoSPARC version 4.4 90 followed by patch based CTF estimation. All 525 subsequent steps of image processing were also performed in cryoSPARC . The initial set of 526 1,325,543 particles were obtained with a blob picker and cleaned up by 2D classification to 527 570,899 particles. Three initial volumes were obtained by an ab-initio reconstruction. The initial 528 volumes were used in a heterogeneous refinement as starting references. One of the resulting 529 classes with 276,124 particles was further refined in a non-uniform refinement with C1 530 symmetry and used as input for a variability analysis with three principal components 531 subdividing the data set into three clusters. One of three clusters with 48,803 particles was 532 then analysed in another non-uniform refinement with applied C2 symmetry and reached a 533 resolution of 3.2 Å. 534 For SLC26A11 with Nb4, a Falcon IVi direct detector attached to a Selectris energy filter was 535 used. Movies were recorded as zero-loss images with a slit width of 5 eV. A magnification of 536 130,000x resulted in a calibrated pixel size of 0.946 Å and a total exposure of 70 electrons/Å2 537 was used with an exposure time of 6.2 s. The target defocus range was between 0.6 and 538 1.6 µm under focus. 11086 movies were recorded in EER format. Further image analysis was 539 performed with cryoSPARC. The EER movies were converted into 40 fractions, followed by 540 motion correction, dose weighting and averaging of the fractions. The CTF of the averaged 541 fractions was estimated with patch ctf. Initially, 2,147,241 particles were picked with a blob 542 picker and reduced to 115,117 particles by 2D classification keeping particles in classes with 543 the best-defined class averages. Three initial volumes were determined in an ab-initio 544 reconstruction. These volumes were used as starting references in a heterogeneous 545 refinement. The classes were further refined by non-uniform refinement. One of the classes 546 provided a 3D-map, which was projected equally in space to create templates for template 547 picking. Template picking identified 3,616,816 particles which were reduced to 457,309 548 particles by 2D-classification and selection of the best 2D-classes. The selected particles were 549 analysed by another round of heterogeneous refinement. One of the classes of the 550 heterogeneous refinement with 210,771 particles was subjected to non-uniform refinement 551 with imposed C2-symmetry. This resulted in a map with 2.8 Å resolution, which was then 552 filtered according to the local resolution. 553 An initial atomic model of the map was obtained with the program Modelangelo 91. The 554 model was manually optimised using Coot version 0.9.8.93 92,93 and ChimeraX/ISOLDE 94 555 and refined with the real-space refinement tool of Phenix version 1.21.1 95. 556 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted August 19, 2025. ; https://doi.org/10.1101/2025.08.17.670773doi: bioRxiv preprint 19 Differential scanning fluorometry – SLC26A11(ΔC) was dialyzed 3 times 30 minutes at 4 °C 557 against buffer containing 20 mM Hepes pH 7.25, 0.05% DDM to remove chloride ions from 558 the sample. The protein was diluted to 0.1 mg/ml final concentration in buffer containing 559 100 mM Hepes, 100 mM MES, pH 7.5 or pH 5.0, respectively, with 80 mM of the tested anion 560 as sodium salt and 70 mM sodium gluconate. For affinity determination of sulfate or chloride, 561 respectively, titration of the tested anion starting from 80 mM was performed and the total 562 anion concentration kept constant at 150 mM by addition of additional sodium gluconate. 563 Samples were equilibrated for 30 minutes on ice, 15 minutes at room temperature and 564 subjected to thermal melting in triplicates from 20 to 70 °C with a ramp of 1 °C/min using a 565 Prometheus NT.48 (Nanotemper) at 100% gain and Prometheus standard capillaries. The 566 melting curves were analyzed and Tm values calculated with the PR. StabilityAnalysis 567 software (Nanotemper). For affinity determination, ΔTm/Tm Apo was plotted against the anion 568 concentration and a non-linear curve fit performed in OriginPro using equation 1 as described 569 elsewhere 96,97: 570 equation 1) 𝛥𝛥𝛥𝛥𝛥𝛥 𝛥𝛥 𝛥𝛥𝐴𝐴𝐴𝐴𝐴𝐴 (𝐿𝐿) = −𝑅𝑅𝛥𝛥𝑠𝑠𝑠𝑠𝑠𝑠 𝐸𝐸𝑎𝑎1 ∗ ln � 𝐾𝐾𝐷𝐷 𝐾𝐾𝐷𝐷+𝐿𝐿 � 571 where L is the total ligand concentration; R is the universal gas constant; T std is the standard 572 temperature (298.15 K); Ea1 the activation energy of apo state unfolding. 573 For affinity determination of anions other than chloride or sulfate, ΔTm/TmApo was derived from 574 thermal melting in presence of 80 mM substrate concentration and the dissociation constant 575 calculated using equation 2 with E a1 derived from sulfate/chloride titration as descr ibed 576 elsewhere 97: 577 equation 2) 𝐾𝐾𝐷𝐷= 𝐿𝐿 𝑒𝑒 � 𝛥𝛥𝛥𝛥𝛥𝛥 𝛥𝛥 𝛥𝛥𝐴𝐴 𝐴𝐴𝐴𝐴 ∗𝐸𝐸𝑎𝑎1 𝑅𝑅 𝛥𝛥� −1 578 579 Molecular dynamics simulations – The final coordinates of the SLC26A11 structure were 580 used for all -atom molecular dynamics (MD) simulations. We modelled residues 26– 583, 581 neutralizing the artificial N- and C -termini using acetylation and n-methylamidation 582 respectively using VMD 98. MD simulations and analysis were performed using GROMACS 583 2022 99. An additional system was generated with glutamate 320 protonated (E320p); the 584 protonation, remaining hydrogen atoms, and topologies were generated using gmx pdb2gmx. 585 The protein was embedded in a membrane containing 1-palmitoyl -2-oleoyl-glycero-3-586 phosphocholine (POPC) using gmx membed. The initial system was solvated (TIP3P) and 587 ionized with 200 mM NaCl, with subsequent neutralization. The protein was modelled using 588 the CHARMM36m force-field, lipids, water, and Na+/Cl- ions were modelled with CHARMM36. 589 For sulfate, we took the initial parameters from Cannon et al. 100, with the addition of a non-590 bonded coefficient alteration (CUFIX) 101 to account for sulfate-protein interactions. To 591 increase the possibility of sulfate binding we removed all chlorides, and added 15 molecules 592 of SO42–, resulting in a final concentration of ~ 10 mM Na 2SO4 after neutralization. We used 593 the following minimization/equilibration protocol for the E320 (deprotonated system) with 200 594 mM NaCl: After embedding, the protein was minimized using the steepest descent algorithm 595 (step 1), followed by 50 ns of simulation with position restraints on all atoms except for lipid 596 heavy atoms in the XY plane (step 2.0). The next 50 ns step had position restraints only on 597 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted August 19, 2025. ; https://doi.org/10.1101/2025.08.17.670773doi: bioRxiv preprint 20 the protein (step 2.1), and finally 50 ns with only protein backbone restraints (step 2.2). 598 Equilibration was monitored via the number of protein-lipid contacts. All simulations are 599 performed under the NPT ensemble, with v-rescale 102, and c-rescale 103 for temperature and 600 pressure coupling respectively. Protonated systems (E320p), and systems containing Na2SO4 601 were constructed from the final frame of step 2.1, i.e., added proton and/or replaced 200 mM 602 NaCl with 10 mM Na2SO4, followed by step 2.2 for each additional system – equilibration was 603 monitored for each system separately. The final 10 ns of step 2.2 were used to initiate three 604 replicates for the Na 2SO4 containing systems, and six replicates for the NaCl systems, each 605 replicate being run for a minimum of 700 ns totalling roughly 15 µs. 606 Computational predictions of pK a – To approximate the pK a values for titratable residues, 607 propkatraj 104 was used. Due to the heuristic approach of PROPKA 3.1 105, the underlying 608 algorithm in propkatraj, pKa predictions from individual conformations are subject to significant 609 variance, and lack accuracy – propkatraj helps to ameliorate this issue by estimating the pK a 610 for many frames (1frame/ns for ~6500 ns), resulting in distributions of pK a, centred around a 611 mean-value. These average pKa values were reported in Figure 3B. 612 Biophysical characterization of the anion binding pocket (ABP ) – To dissect the 613 molecular interactions between chloride, sulfate, and the ABP, electrostatics of the ABP, and 614 kinetics/thermodynamics of the anion– ABP interactions were evaluated 106. Full system 615 electrostatics were calculated using g_elpot 107, which evaluates the electrostatic potential felt 616 by water molecules. To this end, a sphere with a radius of 7 Å, centred at the ABP was 617 coloured according to the electrostatic potential at the surface of the sphere [Fig. 3E, F]. 618 To evaluate the kinetics of binding, we define the inner- and outer-boundary of 14 Å and 15 Å 619 respectively, as the boundaries of a Schmitt- Trigger which filters out noise at the ABP 620 entrance. We define anion binding according to a single- ion radial distribution function to the 621 ABP center of geometry. The distance of 14 Å represents the first contact that the anion makes 622 within the intracellular vestibule of SLC26A11. When an anion was within 14 Å of the ABP 623 center of geometry, it was considered bound (1), whereas distances greater than 15 Å were 624 considered unbound (0). When the distance is the range 14-15 Å, the bound state (1 or 0) is 625 determined by the previous bound state. The state-trajectories are separated into 𝑁𝑁𝐵𝐵𝐵𝐵𝐵𝐵𝐵𝐵𝐵𝐵 626 groups of consecutive 1’s, where 𝑁𝑁𝐵𝐵𝐵𝐵𝐵𝐵𝐵𝐵𝐵𝐵 is the number of binding events. 627 equation 3) 628 equation 4) 629 equation 5) 630 equation 6) 631 equation 7) 𝐾𝐾𝐷𝐷= 𝑘𝑘𝑂𝑂𝑂𝑂𝑂𝑂 𝑘𝑘𝑂𝑂𝑂𝑂 632 Here, is the average dwell-time, 𝐿𝐿 is the length of a consecutive group of 1’s, and is 633 the time-step of the state-trajectory, which is 0.1 ns for all systems. Similarly, , and 634 consequently 𝑘𝑘𝐵𝐵𝐵𝐵 can be calculated similarly by evaluating 𝑁𝑁𝐵𝐵𝐵𝐵𝑢𝑢𝐵𝐵𝐵𝐵 𝐵𝐵𝐵𝐵 consecutive groups of 0’s 635 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted August 19, 2025. ; https://doi.org/10.1101/2025.08.17.670773doi: bioRxiv preprint 21 from the state-trajectory. Since 𝑘𝑘𝐵𝐵𝐵𝐵 is a second order rate-constant, we normalized it to the 636 bulk concentration of chloride (0.2 M) and sulfate (0.009 M) respectively. 637 Electrophysiology – For electrophysiological characterization, wild type and mutant 638 hSLC26A11 fused to GFP was expressed in Sf 9 insect cells (Spodoptera frugiperda) and 639 tested 2-5 days after infection with 1% (v/v) baculovirus . Standard whole-cell patch cl amp 640 recordings were performed with an EPC-10 USB amplifier (HEKA Elektronik, Göttingen) with 641 pipette resistances between 3-5 MΩ as described 108,109. Cells were clamped to 0 mV for at 642 least 5 s between test sweeps, and voltage pulses were applied for 150 ms from -120 mV to 643 +60 mV in 15 mV steps. Junction potentials were corrected a priori. For the recordings shown 644 in [Fig. 5b], external solutions contained 128.5 mM NaCl, 7.5 mM Na-gluconate, 1 mM MgCl2, 645 5 mM CaCl2, 5 mM TEA-Cl, 10 mM HEPES/Tris, pH 7, or 5 mM HEPES/5 mM MES, pH 6. 646 The pipette internal solution contained 150 mM KCl, 0.5 mM K2SO4, 2 mM MgCl2, 5 mM EGTA 647 and 10 mM HEPES/KOH, pH 8.5. Anion selectivity [Supplementary Fig. 18] was tested by 648 external perfusion of cells with solutions containing 0.5 mM Na2SO4 in combination with 145 649 mM Cl- (128 mM NaCl, 0.5 mM Na2SO4, 1 mM MgCl2, 5 mM CaCl2, 5 mM TEA-Cl, 10 mM 650 HEPES/Tris pH 8.5), 5 mM Cl- (128 mM Na-gluconate, 0.5 mM Na2SO4, 1 mM Mg-gluconate, 651 5 mM Ca-gluconate, 5 mM TEA-Cl, 10 mM HEPES/Tris, pH 8.5) or 147 mM SCN- (147 mM 652 NaSCN, 0.5 mM Na2SO4, 1 mM MgCl2, 5 mM CaCl2, 5 mM TEA-Cl, 10 mM HEPES/Tris, pH 653 8.5) at pH 7, with an internal solution containing 120 mM KCl, 10 mM K2SO4 , 2 mM MgCl2, 5 654 mM EGTA, 5 mM MES/5 mM HEPES/KOH, pH 6.0. For the pH dependences 655 [Supplementary Fig. 19] the external solutions contained 128 mM NaCl, 10 mM Na2SO4, 1 656 mM MgCl 2, 5 mM CaCl2, 5 mM TEA-Cl, buffered with 10 mM HEPES/Tris and MES/Tris 657 mixtures to pH 7.33/pH 7.0/pH 6.66/pH 6.33/pH 6.0. The internal solution contained 150 mM 658 KCl, 0.5 mM K2SO4, 2 mM MgCl2, 5 mM EGTA, 10 mM HEPES/Tris, pH 7.33). 659 Data availability – All raw data are available upon request. The python script used in the 660 calculation of kinetic constants from MD simulations is available at h ttps://jugit.fz-661 juelich.de/computational-neurophysiology/SLC26A11-ion-binding. 662 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted August 19, 2025. ; https://doi.org/10.1101/2025.08.17.670773doi: bioRxiv preprint 22

663 We would like to thank Barbara Borgonovo, Aliona Bogdanova, and Régis Lemaitre from the 664 Protein Biochemistry facility of the MPI-CBG for their support. We further thank Sasa Stefanic 665 from the Nanobody Service facility of the University of Zurich for his ongoing support. We 666 acknowledge past and present members of FOR5046 for stimulating discussions and critical 667 feedback. We further acknowledge Michele Marass for corrections to the manuscript. This 668 work was funded by the Deutsche Forschungsgemeinschaft (DFG, German Research 669 Foundation) as part of Research Unit 5046 (FOR5046; project 426950122) to E.R.G. 670 (subproject P1), J.-P.M. (subproject P2), as well as to ChF (subproject P4), and projects 671 359471283, 456578072, 525040890 (EM facility Würzburg; BB ). The authors gratefully 672 acknowledge computing time on the supercomputer JURECA at Forschungszentrum Jülich 673 under grant jara0177. All members of the Geertsma lab are acknowledged for help in all stages 674 of the project. 675 Author contributions 676 B.T.K., J.-P.M., Ch.F., and E.R.G. conceived the project. B.T.K. performed all protein 677 biochemistry, carried out reconstitutions in proteoliposomes and nanodiscs, performed in vitro 678 transport studies and binding assays, and selected nanobodies under the supervision of 679 E.R.G. P.K. performed electrophysiological characterization of SLC26A11 in insect cells with 680 the help of S.B.-G., using baculovirus provided by B.T.K, and under the supervision of Ch.F. 681 B.G.H. performed molecular dynamics simulations, pKa predictions, electrostatic 682 characterization, and kinetic analysis of ion binding under the supervision of J.-P.M. T.R. 683 prepared grids, recorded, and processed cryo-EM data with the help of T.H. and under the 684 supervision of B.B. T.R., T.H. and B.T.K. built and validated cryo-EM stru ctures. All authors 685 discussed and analyzed the results. B.T.K. and E.R.G. wrote the first draft of the manuscript 686 with contributions from all authors. All authors participated in the revision of the manuscript. 687 688 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted August 19, 2025. ; https://doi.org/10.1101/2025.08.17.670773doi: bioRxiv preprint 23

689 1. Xu, J. et al. Slc26a11, a chloride transporter, localizes with the vacuolar H(+)-ATPase 690 of A-intercalated cells of the kidney. Kidney Int 80, 926-937 (2011). 691 2. Karlsson, M. et al. A single-cell type transcriptomics map of human tissues. Sci Adv 692 7(2021). 693 3. Alper, S.L. & Sharma, A.K. The SLC26 gene family of anion transporters and channels. 694 Mol Aspects Med 34, 494-515 (2013). 695 4. Geertsma, E.R. & Oliver, D. SLC26 Anion Transporters. Handb Exp Pharmacol 283, 696 319-360 (2024). 697 5. Stewart, A.K. et al. SLC26 anion exchangers of guinea pig pancreatic duct: molecular 698 cloning and functional characterization. Am J Physiol Cell Physiol 301, C289-303 699 (2011). 700 6. Vincourt, J.B., Jullien, D., Amalric, F. & Girard, J.P. Molecular and functional 701 characterization of SLC26A11, a sodium -independent sulfate transporter from high 702 endothelial venules. Faseb j 17, 890-2 (2003). 703 7. Rahmati, N. et al. Slc26a11 is prominently expressed in the brain and functions as a 704 chloride channel: expression in Purkinje cells and stimulation of V H⁺-ATPase. Pflugers 705 Arch 465, 1583-97 (2013). 706 8. Rungta, R.L. et al. The cellular mechanisms of neuronal swelling underlying cytotoxic 707 edema. Cell 161, 610-621 (2015). 708 9. Wei, S. et al. SLC26A11 Inhibition Reduces Oncotic Neuronal Death and Attenuates 709 Stroke Reperfusion Injury. Molecular Neurobiology (2023). 710 10. Gadsby, D.C. Ion channels versus ion pumps: the principal difference, in principle. Nat 711 Rev Mol Cell Biol 10, 344-52 (2009). 712 11. Drew, D. & Boudker, O. Shared Molecular Mechanisms of Membrane Transporters. 713 Annual Review of Biochemistry 85, 543-572 (2016). 714 12. Liu, Q. et al. Asymmetric pendrin homodimer reveals its molecular mechanism as 715 anion exchanger. Nat Commun 14, 3012 (2023). 716 13. Geertsma, E.R. et al. Structure of a prokaryotic fumarate transporter reveals the 717 architecture of the SLC26 family. Nat Struct Mol Biol 22, 803-8 (2015). 718 14. Wang, L., Chen, K. & Zhou, M. Structure and function of an Arabidopsis thaliana sulfate 719 transporter. Nat Commun 12, 4455 (2021). 720 15. Tippett, D.N., Breen, C., Butler, S.J., Sawicka, M. & Dutzler, R. Structural and 721 functional properties of the transporter SLC26A6 reveal mechanism of coupled anion 722 exchange. Elife 12(2023). 723 16. Ishii, J. et al. Congenital goitrous hypothyroidism is caused by dysfunction of the iodide 724 transporter SLC26A7. C ommun Biol 2, 270 (2019). 725 17. Kim, K.H., Shcheynikov, N., Wang, Y. & Muallem, S. SLC26A7 is a Cl - channel 726 regulated by intracellular pH. J Biol Chem 280, 6463-70 (2005). 727 18. Kosiek, O. et al. SLC26A7 can function as a chloride-loading mechanism in parietal 728 cells. Pflugers Arch 454, 989-98 (2007). 729 19. Schanzler, M. & Fahlke, C. Anion transport by the cochlear motor protein prestin. J 730 Physiol 590, 259-72 (2012). 731 20. Chang, M.H. et al. Slc26a9--anion exchanger, channel and Na+ transporter. J Membr 732 Biol 228, 125-40 (2009). 733 21. Dorwart, M.R., Shcheynikov, N., Wang, Y., Stippec, S. & Muallem, S. SLC26A9 is a 734 Cl(-) channel regulated by the WNK kinases. J Physiol 584, 333-45 (2007). 735 22. Loriol, C. et al. Characterization of SLC26A9, facilitation of Cl( -) transport by 736 bicarbonate. Cell Physiol Biochem 22, 15-30 (2008). 737 23. Bertrand, C.A., Zhang, R., Pilewski, J.M. & Frizzell, R.A. SLC26A9 is a constitutively 738 active, CFTR -regulated anion conductance in human bronchial epithelia. J Gen 739 Physiol 133, 421-38 (2009). 740 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted August 19, 2025. ; https://doi.org/10.1101/2025.08.17.670773doi: bioRxiv preprint 24 24. Walter, J.D., Sawicka, M. & Dutzler, R. Cryo-EM structures and functional 741 characterization of murine Slc26a9 reveal mechanism of uncoupled chloride transport. 742 eLife 8, e46986 (2019). 743 25. Chapel, A. et al. An extended proteome map of the lysosomal membrane reveals novel 744 potential transporters. Mol Cell Proteomics 12, 1572-88 (2013). 745 26. Schroder, B.A., Wrocklage, C., Hasilik, A. & Saftig, P. The proteome of lysosomes. 746 Proteomics 10, 4053-76 (2010). 747 27. Sardiello, M. et al. A gene network regulating lysosomal biogenesis and function. 748 Science 325, 473-7 (2009). 749 28. Palmieri, M. et al. Characterization of the CLEAR network reveals an integrated control 750 of cellular clearance pathways. Hum Mol Genet 20, 3852-66 (2011). 751 29. Settembre, C. et al. TFEB links autophagy to lysosomal biogenesis. Science 332, 752 1429-33 (2011). 753 30. Bungert-Plümke, S., Guzman, R.E. & Fahlke, C. Oligomerization and cellular 754 localization of SLC26A11. bioRxiv, 2024.04.29.591613 (2024). 755 31. Saftig, P. & Klumperman, J. Lysosome biogenesis and lysosomal membrane proteins: 756 trafficking meets function. Nat Rev Mol Cell Biol 10, 623-35 (2009). 757 32. Parenti, G., Medina, D.L. & Ballabio, A. The rapidly evolving view of lysosomal storage 758 diseases. EMBO Mol Med 13, e12836 (2021). 759 33. Xu, H. & Ren, D. Lysosomal physiology. Annu Rev Physiol 77, 57-80 (2015). 760 34. Huizing, M. & Gahl, W.A. Inherited disorders of lysosomal membrane transporters. 761 Biochim Biophys Acta Biomembr 1862, 183336 (2020). 762 35. Sagne, C. & Gasnier, B. Molecular physiology and pathophysiology of lysosomal 763 membrane transporters. J Inherit Metab Dis 31, 258-66 (2008). 764 36. Platt, F.M., d'Azzo, A., Davidson, B.L., Neufeld, E.F. & Tifft, C.J. Lysosomal storage 765 diseases. Nat Rev Dis Primers 4, 27 (2018). 766 37. Ruivo, R., Anne, C., Sagne, C. & Gasnier, B. Molecular and cellular basis of lysosomal 767 transmembrane protein dysfunction. Biochim Biophys Acta 1793, 636-49 (2009). 768 38. Diez-Roux, G. & Ballabio, A. Sulfatases and human disease. Annu Rev Genomics 769 Hum Genet 6, 355-79 (2005). 770 39. Rome, L.H. & Hill, D.F. Lysosomal degradation of glycoproteins and 771 glycosaminoglycans. Efflux and recycling of sulphate and N -acetylhexosamines. 772 Biochem J 235, 707-13 (1986). 773 40. Frese, M.A., Schulz, S. & Dierks, T. Arylsulfatase G, a novel lysosomal sulfatase. J 774 Biol Chem 283, 11388-95 (2008). 775 41. Wi egmann, E.M. et al. Arylsulfatase K, a novel lysosomal sulfatase. J Biol Chem 288, 776 30019-30028 (2013). 777 42. Jonas, A.J. & Jobe, H. Sulfate transport by rat liver lysosomes. J Biol Chem 265, 778 17545-9 (1990). 779 43. Rahmati, N. et al. SLC26A11 (KBAT) in Purkinje Cells Is Critical for Inhibitory 780 Transmission and Contributes to Locomotor Coordination. eNeuro 3(2016). 781 44. Chang, Y.N. & Geertsma, E.R. The novel class of seven transmembrane segment 782 inverted repeat carriers. Biol Chem 398, 165-174 (2017). 783 45. Kuhn, B.T. et al. Interdomain-linkers control conformational transitions in the SLC23 784 elevator transporter UraA. Nat Commun 15, 7518 (2024). 785 46. Hu, W., Song, A. & Zheng, H. Substrate binding plasticity revealed by Cryo-EM 786 structures of SLC26A2. Nat Commun 15, 3616 (2024). 787 47. Wang, L. et al. Mechanism of anion exchange and small-molecule inhibition of pendrin. 788 Nat Commun 15, 346 (2024). 789 48. Butan, C. et al. Single particle cryo- EM structure of the outer hair cell motor protein 790 prestin. Nat Commun 13, 290 (2022). 791 49. Futamata, H. et al. Cryo-EM structures of thermostabilized prestin provide mechanistic 792 insights underlying outer hair cell electromotility. Nat Commun 13, 6208 (2022). 793 50. Ge, J. et al. Molecular mechanism of prestin electromotive signal amplification. Cell 794 184, 4669-4679 e13 (2021). 795 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted August 19, 2025. ; https://doi.org/10.1101/2025.08.17.670773doi: bioRxiv preprint 25 51. Chi, X. et al. Structural insights into the gating mechanism of human SLC26A9 796 mediated by its C-terminal sequence. Cell Discovery 6, 55 (2020). 797 52. Li, X.R., Chi, X.M., Zhang, Y.Y., Zhou, Q. 8IET. (2024). 798 53. Li, J., Xia, F. & Reithmeier, R.A. N -glycosylation and topology of the human SLC2 6 799 family of anion transport membrane proteins. Am J Physiol Cell Physiol 306, C943-60 800 (2014). 801 54. Teyra, J. et al. Comprehensive Analysis of the Human SH3 Domain Family Reveals a 802 Wide Variety of Non-canonical Specificities. Structure 25, 1598-1610 e3 (2017). 803 55. Schmiege, P., Donnelly, L., Elghobashi-Meinhardt, N., Lee, C.H. & Li, X. Structure and 804 inhibition of the human lysosomal transporter Sialin. Nat Commun 15, 4386 (2024). 805 56. Sagne, C. et al. Identification and characterization of a lysosomal transporter for small 806 neutral amino acids. Proc Natl Acad Sci U S A 98, 7206-11 (2001). 807 57. Tomabechi, R. et al. SLC46A3 is a lysosomal proton-coupled steroid conjugate and 808 bile acid transporter involved in transport of active catabolites of T-DM1. PNAS Nexus 809 1, pgac063 (2022). 810 58. He, M. et al. Spns1 is a lysophospholipid transporter mediating lysosomal phospholipid 811 salvage. Proc Natl Acad Sci U S A 119, e2210353119 (2022). 812 59. Lobel, M. et al. Structural basis for proton coupled cystine transport by cystinosin. Nat 813 Commun 13, 4845 (2022). 814 60. Stauber, T. & Jentsch, T.J. Chloride in vesicular trafficking and function. Annu Rev 815 Physiol 75, 453-77 (2013). 816 61. Chakraborty, K., Leung, K. & Krishnan, Y. High lumenal chloride in the lysosome is 817 critical for lysosome function. Elife 6(2017). 818 62. Mohapatra, N.K. et al. Sulfate concentrations and transport in human bronchial 819 epithelial cells. Am J Physiol 264, C1231-7 (1993). 820 63. Fairman, W.A., Vandenberg, R.J., Arriza, J.L., Kavanaugh, M.P. & Amara, S.G. An 821 excitatory amino-acid transporter with properties of a ligand-gated chloride channel. 822 Nature 375, 599-603 (1995). 823 64. Wadiche, J.I., Amara, S.G. & Kavanaugh, M.P. Ion fluxes associated with excitatory 824 amino acid transport. Neuron 15, 721-8 (1995). 825 65. Ryan, R.M. & Mindell, J.A. The uncoupled chloride conductance of a bacterial 826 glutamate transporter homolog. Nat Struct Mol Biol 14, 365-71 (2007). 827 66. Kolen, B. et al. Vesicular glutamate transporters are H(+) -anion exchangers that 828 operate at variable stoichiometry. Nat Commun 14, 2723 (2023). 829 67. Mager, S. et al. Conducting states of a mammalian serotonin transporter. Neuron 12, 830 845 -59 (1994). 831 68. Schicker, K. et al. Unifying concept of serotonin transporter-associated currents. J Biol 832 Chem 287, 438-445 (2012). 833 69. Accardi, A. & Miller, C. Secondary active transport mediated by a prokaryotic 834 homologue of ClC Cl- channels. Nature 427, 803-7 (2004). 835 70. Zdebik, A.A. et al. Determinants of anion-proton coupling in mammalian endosomal 836 CLC proteins. J Biol Chem 283, 4219-27 (2008). 837 71. Alekov, A.K. & Fahlke, C. Channel -like slippage modes in the human anion/proton 838 exchanger ClC-4. J Gen Physiol 133, 485-96 (2009). 839 72. Crisman, T.J., Qu, S., Kanner, B.I. & Forrest, L.R. Inward-facing conformation of 840 glutamate transporters as revealed by their inverted-topology structural repeats. Proc 841 Natl Acad Sci U S A 106, 20752-7 (2009). 842 73. Reyes, N., Ginter, C. & Boudker, O. Transport mechanism of a bacterial homologue of 843 glutamate transporters. Nature 462, 880-5 (2009). 844 74. Machtens, J.P. et al. Mechanisms of anion conduction by coupled glutamate 845 transporters. Cell 160, 542-53 (2015). 846 75. Chen, I. et al. Glutamate transporters have a chloride channel with two hydrophobic 847 gates. Nature 591, 327-331 (2021). 848 76. Cole, D.E. & Evrovski, J. Quantitation of sulfate and thiosulfate in clinical samples by 849 ion chromatography. J Chromatogr A 789, 221-32 (1997). 850 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted August 19, 2025. ; https://doi.org/10.1101/2025.08.17.670773doi: bioRxiv preprint 26 77. Farkas, E. & Rose, C.R. A dangerous liaison: Spreading depolarization and tissue 851 acidification in cerebral ischemia. J Cereb Blood Flow Metab 45, 201-218 (2025). 852 78. Maruki, Y., Koehler, R.C., Eleff, S.M. & Traystman, R.J. Intracellular pH during 853 reperfusion influences evoked potential recovery after complete cerebral ischemia. 854 Stroke 24, 697-703; discussion 704 (1993). 855 79. Bonifacino, J.S. & Traub, L.M. Signals for sorting of transmembrane proteins to 856 endosomes and lysosomes. Annu Rev Biochem 72, 395-447 (2003). 857 80. Braulke, T. & Bonifacino, J.S. Sorting of lysosomal proteins. Biochim Biophys Acta 858 1793, 605-14 (2009). 859 81. Lang, C.M. et al. Membrane orientation and subcellular localization of transmembrane 860 protein 106B (TMEM106B), a major risk factor for frontotemporal lobar degeneration. 861 J Biol Chem 287, 19355-65 (2012). 862 82. Staudt, C., Puissant, E. & Boonen, M. Subcellular Trafficking of Mammalian Lysosomal 863 Proteins: An Extended View. Int J Mol Sci 18(2016). 864 83. Geertsma, E.R. & Dutzler, R. A versatile and efficient high-throughput cloning tool for 865 structural biology. Biochemistry 50, 3272-8 (2011). 866 84. Lemaitre, R.P., Bogdanova, A., Borgonovo, B., Woodruff, J.B. & Drechsel, D.N. 867 FlexiBAC: a versatile, open-source baculovirus vector system for protein expression, 868 secretion, and proteolytic processing. BMC Biotechnol 19, 20 (2019). 869 85. Kuhn, B.T. et al. Biotinylation of Membrane Proteins for Binder Selections. Methods 870 Mol Biol 2127, 151-165 (2020). 871 86. Pardon, E. et al. A general protocol for the generation of Nanobodies for structural 872 biology. Nat Protoc 9, 674-93 (2014). 873 87. Zimmermann, I. et al. Synthetic single domain antibodies for the conformational 874 trapping of membrane proteins. Elife 7(2018). 875 88. Zimmermann, I. et al. Generation of synthetic nanobodies against delicate proteins. 876 Nat Protoc 15, 1707-1741 (2020). 877 89. Geertsma, E.R., Nik Mahmood, N.A., Schuurman-Wolters, G.K. & Poolman, B. 878 Membrane reconstitution of ABC transporters and assays of translocator function. Nat 879 Protoc 3, 256-66 (2008). 880 90. Punjani, A., Rubinstein, J.L., Fleet, D.J. & Brubaker, M.A. cryoSPARC: algorithms for 881 rapid unsupervised cryo-EM structure determination. Nat Methods 14, 290-296 (2017). 882 91. Jamali, K. et al. Automated model building and protein identification in cryo-EM maps. 883 Nature 628, 450-457 (2024). 884 92. Brown, A. et al. Tools for macromolecular model building and refinement into electron 885 cryo-microscopy reconstructions. Acta Crystallogr D Biol Crystallogr 71, 136-53 886 ( 2015). 887 93. Emsley, P., Lohkamp, B., Scott, W.G. & Cowtan, K. Features and development of 888 Coot. Acta Crystallogr D Biol Crystallogr 66, 486-501 (2010). 889 94. Croll, T.I. ISOLDE: a physically realistic environment for model building into low -890 resolution electron-density maps. Acta Crystallogr D Struct Biol 74, 519-530 (2018). 891 95. Liebschner, D. et al. Macromolecular structure determination using X -rays, neutrons 892 and electrons: recent developments in Phenix. Acta Crystallogr D Struct Biol 75, 861-893 877 (2019). 894 96. Hall, J. A simple model for determining affinity from irreversible thermal shifts. Protein 895 Sci 28, 1880-1887 (2019). 896 97. Kotov, V. et al. Plasticity of the binding pocket in peptide transporters underpins 897 promiscuous substrate recognition. Cell Rep 42, 112831 (2023). 898 98. Humphrey, W., Dalke, A. & Schulten, K. VMD: visual molecular dynamics. J Mol Graph 899 14, 33-8, 27-8 (1996). 900 99. Abraham, M.J. et al. GROMACS: High performance molecular simulations through 901 multi-level parallelism from laptops to supercomputers. SoftwareX 1, 19-25 (2015). 902 100. Cannon, W.R., Pettitt, B.M. & McCammon, J.A. Sulfate anion in water: model 903 structural, thermodynamic, and dynamic properties. The Journal of Physical Chemistry 904 98, 6225-6230 (1994). 905 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted August 19, 2025. ; https://doi.org/10.1101/2025.08.17.670773doi: bioRxiv preprint 27 101. Yoo, J. & Aksimentiev, A. Improved parameterization of amine– carboxylate and 906 amine–phosphate interactions for molecular dynamics simulations using the CHARMM 907 and AMBER force fields. Journal of chemical theory and computation 12, 430-443 908 (2016). 909 102. Bussi, G., Donadio, D. & Parrinello, M. Canonical sampling through velocity rescaling. 910 The Journal of chemical physics 126(2007). 911 103. Bernetti, M. & Bussi, G. Pressure control using stochastic cell rescaling. The Journal 912 of Chemical Physics 153(2020). 913 104. Lee, C. et al. Crystal structure of the sodium -proton antiporter NhaA dimer and new 914 mechanistic insights. J Gen Physiol 144, 529-44 (2014). 915 105. Sondergaard, C.R., Olsson, M.H., Rostkowski, M. & Jensen, J.H. Improved Treatment 916 of Ligands and Coupling Effects in Empirical Calculation and Rationalization of pKa 917 Values. J Chem Theory Comput 7, 2284-95 (2011). 918 106. Kortzak, D. et al. Allosteric gate modulation confers K(+) coupling in glutamate 919 transporters. EMBO J 38, e101468 (2019). 920 107. Kostritskii, A.Y., Alleva, C., Conen, S. & Machtens, J.P. g_elpot: A Tool for Quantifying 921 Biomolecular Electrostatics from Molecular Dynamics Trajectories. J Chem Theory 922 Comput 17, 3157-3167 (2021). 923 108. Kovermann, P., Machtens, J.P., Ewers, D. & Fahlke, C. A conserved aspartate 924 determines pore properties of anion channels associated with excitatory amino acid 925 transporter 4 (EAAT4). J Biol Chem 285, 23676-86 (2010). 926 109. Kovermann, P., Kolobkova, Y., Franzen, A. & Fahlke, C. Mutations associated with 927 epileptic encephalopathy modify EAAT2 anion channel function. Epilepsia 63, 388-401 928 (2022). 929 930 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted August 19, 2025. ; https://doi.org/10.1101/2025.08.17.670773doi: bioRxiv preprint