Cytosolic mtDNA and associated EYA-mediated pro-inflammatory signaling modulate healthspan in Drosophila | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Cytosolic mtDNA and associated EYA-mediated pro-inflammatory signaling modulate healthspan in Drosophila David Walker, Ricardo Aparicio, Roberta Alessi, Agathe Solans, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7634140/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted You are reading this latest preprint version Abstract Mitochondrial dysfunction and pro-inflammatory signaling are each key drivers of aging. However, a clear understanding of the connections between mitochondrial homeostasis, inflammation and lifespan determination remains elusive. Upon mitochondrial stress or damage, mtDNA can be released into the cytosol thus encountering cytosolic DNA sensors and activating pro-inflammatory responses. Here, we report a striking age-related increase in cytosolic mtDNA, which can be counteracted by mitophagy, in Drosophila brain and muscle tissue. We find that upregulation of DNase II, an acid DNase which digests DNA in the autophagy–lysosome system, reduces cytosolic mtDNA levels in aged flies and prolongs healthspan. Reducing the abundance of cytosolic DNA in aged flies also dampens Rel/NF-κB pro-inflammatory signaling. Furthermore, we show that inhibition of EYA, a Rel/NF-κB-binding protein involved in immune sensing of DNA, in aging neurons counteracts brain aging and prolongs healthspan. Our findings identify DNase II and EYA as therapeutic targets to prolong healthspan. Biological sciences/Physiology/Ageing Biological sciences/Immunology/Inflammation cognitive function Nuclease activity DNautophagy Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction The accumulation of dysfunctional mitochondria and persistent pro-inflammatory responses are each key hallmarks of aging 1 . Indeed, it is widely accepted that chronic inflammation, which has been called ‘inflammaging’ 2 , contributes to the pathogenesis of age-related diseases limiting healthspan 3 , 4 . Potential mechanisms of inflammaging include changes to gut microbiota composition, intestinal barrier dysfunction, and chronic infections 5 , 6 . In addition, it is now apparent that sterile inflammation occurs in the absence of microorganisms and is typically associated with the recognition of intracellular debris released from damaged cells or organelles (also known as damage-associated molecular patterns; DAMPs) 7 , 8 . As mitochondrial dysfunction and inflammation are shared features of aging, it is interesting to speculate that mitochondrial-derived DAMPs may play a prominent role in inflammaging 9 , 10 . In support of this model, it is well-established that mitochondrial damage or dysfunction can lead to the release of mitochondrial DNA (mtDNA) which can activate innate immunity 11 – 17 . While the release of mtDNA from mitochondria is well established, the mechanisms allowing transfer to the cytosol are less clear 18 . There is an emerging understanding, however, that decreased mitochondrial membrane potential and increased mitochondrial permeability regulate the release of mtDNA into the cytosol 19 . On entering the cytoplasm, mtDNA can activate a plethora of different cytoplasmic DNA sensors and innate immune responses, including the cGAS/STING pathway, to trigger pro-inflammatory responses contributing to inflammatory pathology 17 . Autophagy is a catabolic process in which cytoplasmic contents, including nucleic acids and organelles, are delivered to lysosomes for degradation 20 . A number of studies have reported that autophagy and/or mitochondrial autophagy (mitophagy) can restrain the innate immune response 9 , 21 , 22 . Mechanistically, there have been several reports that reveal an important role for autophagy/mitophagy in preventing the accumulation of cytosolic mtDNA-mediated inflammation 21 – 24 . A key concept that emerges from these studies is that mitophagy ensures the removal of damaged mitochondria and can, therefore, counteract the release of mtDNA into the cytosol and resulting inflammatory responses 22 – 24 . Furthermore, it has been shown that deletion of DNase II, which degrades mtDNA in the autophagy-lysosome system, predisposes to heart failure and cardiac inflammation in rodents 21 . Cytosolic mtDNA escaping from lysosomal degradation has also been shown to induce cytotoxicity in cultured cells and Parkinson’s disease phenotypes in vivo 25 . Recent studies have found that aging corresponds with the buildup of cytosolic mtDNA in certain cell types, such as rodent retinal cells, microglia, and Drosophila flight muscle 22 , 26 . Although the accumulation of cytosolic mtDNA has been linked to brain aging, retinal aging, and neurodegeneration 22 , 27 , a causal role for cytosolic mtDNA in organismal aging and lifespan determination is not well established. More specifically, experimental data showing that strategies to eliminate cytosolic mtDNA can slow organismal aging and/or prolong healthspan are lacking. In this study, we have examined the role of cytosolic mtDNA and associated pro-inflammatory signaling in lifespan and healthspan determination. We show that there is an accumulation of cytosolic mtDNA in aging muscle and brain tissue of Drosophila . Inducing mitophagy, including in middle-aged flies, prevents the age-onset accumulation of cytosolic mtDNA. Critically, we show that upregulation of either DNase II or Stress Induced DNase (SID) 28 – 30 can ameliorate cytosolic mtDNA accumulation during aging and prolong lifespan and healthspan. We also show that decreasing cytosolic DNA levels during aging, via DNase II or SID overexpression, dampens NF-κB-like proinflammatory signaling in aged flies. Recent work has shown that targeting the immune sensing of DNA, by inhibiting cGAS/STING signaling pathway, can reduce inflammation and improve tissue function in aged mice 27 . The Rel/NF-κB-binding protein EYA has also been shown to induce an innate immune response against cytosolic DNA in both flies and mammals 31 , 32 . However, the question of whether EYA contributes to age-onset inflammation and/or limits healthspan has not been addressed. We show that inhibiting EYA in aging neurons counteracts primary hallmarks of aging, as well as preventing synaptic aging and age-onset cognitive decline, leading to prolonged organismal healthspan. Our findings reveal that upregulation of nuclease activities, or inhibiting the immune sensing of DNA in neurons, during aging can prolong organismal health and longevity. Results Mitophagy counteracts cytosolic mtDNA accumulation in aged flies Recent studies have reported an accumulation of cytosolic mtDNA in retinal cells and microglia of rodents 22 , 27 , and flight muscle of flies 26 . To validate and expand upon these findings, we used both immunofluorescence (IF) and qPCR-based approaches to examine cytosolic mtDNA levels in different tissues of aging Drosophila . We began by analyzing the accumulation of dsDNA in aging indirect flight muscles. Confocal analysis showed extramitochondrial dsDNA accumulation in aged flies compared to young flies (Supplementary Fig. 1a and quantification in b). To validate that the dsDNA antibody labels mtDNA we stained muscle of daGS > UAS-mitoGFP flies with antibodies against the mitochondrial transcription factor A (TFAM) and dsDNA. IF analysis shows that TFAM colocalizes with dsDNA antibody in young and old flies (Supplementary Fig. 1d). To expand our analysis, we adapted an IF staining approach using selective and specific permeabilization of cellular membranes to detect cytosolic dsDNA 33 . As this approach does not permeabilize mitochondria, it only allows detection of cytosolic DNA. Using this approach, we observed an age-related increase in dsDNA in muscle from young flies (day 20) to old flies (day 60) (Fig. 1 a and quantification in b). Next, we sought to determine if cytosolic dsDNA accumulates in fly brain tissue. As in humans, Drosophila olfactory perception declines as a function of aging 34 – 36 . The mushroom body is a key structure for olfactory learning and memory, so we examined whether cytosolic dsDNA accumulates in the cytosol of mushroom body neurons. Confocal analysis showed dsDNA accumulation in aged mushroom body neurons compared to young flies (Fig. 1 c and quantification in 1d). To confirm that cytosolic mtDNA accumulates during aging, we analyzed the levels of mtDNA-encoded genes in the cytosol of young (day 10), middle-aged (day 30), and old (day 45) wild type flies in whole flies, thoraxes, and heads by qPCR after cellular fractionation. First, we validated the fractionation approach using antibodies against mitochondrial proteins (Supplementary Fig. 1c). Using this fractionation approach, we found that the levels of the mtDNA-encoded genes COI (Citrate Oxidase I) and ND2 (mitochondrial NADH-ubiquinone oxidoreductase chain 2) were increased in the cytosolic fraction of old flies (day 45) versus young flies (day 10) in whole flies, heads and thoraxes (Fig. 1 e-g, and Supplementary Fig. 1e and f). To determine whether the accumulation of cytosolic mtDNA was linked to an overall increase in mtDNA in aged flies, we analyzed the levels of total mtDNA in heads and thoraxes of wild-type flies. Interestingly, we observed a slight increase in total mtDNA levels in fly heads at day 30, followed by a decrease at day 45 (Supplementary Fig. 1h). We did not detect any variation in the levels of total mtDNA in thoraxes of wild type flies at any of the time points analyzed (Supplementary Fig. 1h). Together, these results demonstrate that mtDNA accumulates in the cytosol of Drosophila neurons and indirect flight muscles during aging. We hypothesized that stimulating mitophagy may be an effective approach to counteract the accumulation of cytosolic mtDNA during aging. Indeed, recent work has reported that treating mice with Urolithin A, which can induce mitophagy, reduces cytosolic DNA in aged retinal cells 22 . Hence, we examined the ability of mitophagy induction to counteract cytosolic mtDNA accumulation in aged flies. The E3 ubiquitin ligase Parkin is known to play a key role in mitochondrial quality control and mitophagy 37 . Overexpression of Parkin can extend lifespan in flies 38 and delay hallmarks of aging in several tissues and cell types in mammals 39 . In addition, we have shown that promoting dynamin-related protein 1 (Drp1)-mediated mitochondrial fission in midlife facilitates mitophagy and prolongs fly lifespan 40 . Hence, we analyzed the accumulation of cytosolic mtDNA during aging in Parkin and Drp1 overexpressing flies and controls. We used the well-characterized Drosophila Gene-Switch system 41 , 42 to overexpress Parkin and DRP1 in adult flies. This system allows both spatial and temporal control of the expression of the transgene of interest and the comparison of flies from the same cohort, since the only difference between control (uninduced) and experimental (induced) flies is the presence of the activator agent (RU486) or the diluent (ethanol). First, we examined, by IF, if ubiquitous overexpression of Parkin or DRP1 could reduce the accumulation of dsDNA in flight muscle of old flies. As shown in wild type flies, control daGS > UAS-Parkin or daGS > UAS-DRP1 flies accumulate dsDNA in the cytosol of aged muscle (Fig. 1 h and k and quantification in i and j, respectively). Remarkably, 30 days of Parkin or 2 weeks of Drp1 induction from midlife reduce the age-associated accumulation of dsDNA (Fig. 1 h and k and quantification in i and j, respectively). To validate our findings, we analyzed the levels of cytosolic mtDNA in aged flies with and without Parkin or DRP1 induction in heads and thoraxes by cellular fractionation and qPCR. mtDNA accumulates in the cytosolic fraction of daGS > UAS-Parkin and daGS > UAS-DRP1 control flies in heads and thoraxes (Fig. 1 l-o, and Supplementary Fig. 1i-l). Importantly, 30 days of Parkin or one-week of Drp1 overexpression from midlife decreases the levels of the cytosolic mtDNA in heads and thoraxes of aged flies (Fig. 1 l-o, and Supplementary Fig. 1i-l). RU486 treatment does not have any effect on cytosolic mtDNA levels during aging in control flies (Supplementary Fig. 1m). Together, these results show that mitophagy induction reduces the accumulation of cytosolic mtDNA in aged brain and flight muscles. Upregulation of nuclease gene activity during aging prolongs healthspan To gain insight into the importance of cytosolic mtDNA accumulation during aging, we set out to determine whether interventions that reduce the levels of cytosolic DNA could be beneficial for organismal healthspan. First, we analyzed the expression levels of two enzymes with DNA degradation activity during aging: DNase II and Stress induced DNase (Sid). DNase II is a lysosomal enzyme that degrades DNA within the autolysosome 29 , 30 . Sid is an evolutionarily conserved enzyme that degrades both single and double-stranded DNA/RNA 28 . First, we analyzed the expression profile of DNase II and Sid in heads and thoraxes of wild type flies. DNase II mRNA levels do not change in heads or thoraxes of wild type flies during aging (Supplementary Fig. 2a and b). However, qPCR analysis shows that Sid transcript levels decrease in heads of wild type flies with age but does not vary in thoraxes (Supplementary Fig. 2h and i). To investigate the potential role of DNase II and Sid in degrading cytosolic mtDNA, we generated DNase II and Sid transgenic flies. We used the Gene-Switch system to overexpress DNase II and Sid with the ubiquitous driver daughterless-GS ( daGS ) and the neuronal specific driver elavGS , respectively. First, we validated the expression of the transgenes in thoraxes of daGS > UAS-DNase II and heads of elavGS > UAS-Sid flies. DNase II levels were upregulated by approximately 4-fold in thoraxes of young, middle, and old-age daGS > UAS-DNase II overexpressing flies (Supplementary Fig. 2c). Sid mRNA transcripts were upregulated by approximately 4-fold at day 30 and 6-fold at day 45 (Supplementary Fig. 2j). Next, we analyzed the accumulation of cytosolic dsDNA in DNase II and Sid overexpressing flies by using selective and specific cellular membrane permeabilization, without permeabilizing mitochondria. Upregulation of DNase II reduces the cytosolic dsDNA accumulation in aged muscles (Fig. 2 a and quantification in b). In a complementary approach, we analyzed by cellular fractionation and qPCR analysis the levels of mtDNA-encoded genes in the cytosol of DNase II overexpressing flies. DNase II upregulation resulted in a reduction in mtDNA levels in the cytosol of thoraxes and heads on day 45 as compared to controls (Fig. 2 c, and Supplementary Fig. 2d-f). Moreover, we found that neuronal Sid induction reduces the age-associated accumulation of cytosolic dsDNA at day 45 in Drosophila mushroom body neurons (Fig. 2 j and quantification in k). Finally, we quantified the levels of cytosolic mtDNA genes by qPCR in Sid overexpressing flies. Figure 2 shows that cytosolic mtDNA accumulates in elavGS > UAS-Sid control flies and that neuronal Sid upregulation reduces by 50% the age-associated cytosolic mtDNA accumulation on day 45 as compared to control flies (Fig. 2 l, and Supplementary Fig. 2k). These results demonstrate that induction of either of these DNA degrading enzymes reduces the age-associated accumulation of cytosolic mtDNA. To characterize the effects of DNase II and Sid induction on Drosophila health, we analyzed the longevity of daGS > UAS-DNase II and elavGS > UAS-Sid female flies. Ubiquitous upregulation of DNase II or neuronal Sid induction each extends Drosophila median lifespan in several trials (Fig. 2 d and m, and Table s1 and s2). Next, we examined whether nuclease-mediated lifespan extension is associated with improvements in healthspan. First, we determined whether DNase II induction improves intestinal barrier integrity during aging. Loss of intestinal barrier integrity is a well characterized evolutionarily conserved pathophysiological hallmark of aging associated with inflammation, frailty, and mortality 6 . In Drosophila , intestinal barrier dysfunction can be quantified by the “Smurf assay” 43,44 . Remarkably, we observed that DNase II induction delays the loss of intestinal barrier integrity in aged flies (Fig. 2 e). To assess if DNase II and Sid induction could improve brain function in aged flies, we tested associative learning and memory using olfaction aversion training 45 . Briefly, DNase II and Sid overexpressing flies were exposed to a neutral odor (3-octanol, OCT) with a series of electric shocks. After one hour of rest, flies were placed in a T-maze and allowed to choose between OCT and a second neutral odor (4-methylcyclohexanol). Aged DNase II and Sid overexpressing flies perform better than their age-matched control flies in this assay (Fig. 2 f and n). Next, we set out to determine if DNase II and Sid overexpressing flies showed improved locomotor activity and climbing ability. First, we analyzed spontaneous activity during 24 hours of daGS > UAS-DNase II and elavGS > UAS-Sid overexpressing flies. As shown in Fig. 2 , ubiquitous DNase II and neuronal Sid induction increased daytime activity without affecting sleep compared to their respective age-matched controls (Fig. 2 g, h, o, and p, respectively). Second, we analyzed endurance exercise paradigm in daGS > DNase II overexpressing flies. We observed that upregulation of DNase II improves Drosophila endurance when compared with age-matched control flies (Fig. 2 i). Importantly, RU486 treatment does not extend Drosophila lifespan (Supplementary Fig. 2g). Together, these results show that ubiquitous DNase II or neuronal Sid overexpression can prolong healthspan. Mitophagy and nuclease activity counteract NF-κB-like proinflammatory signaling in aged flies To explore the interplay between age-associated cytosolic mtDNA accumulation and the immune response in aged flies, we set out to examine the impact of Parkin and DRP1 upregulation on immune-related gene expression. Consistent with previous reports 46 , 47 , aged control flies present higher levels of expression of the antimicrobial peptide (AMP) AttacinA ( AttA ) compared to young flies (Fig. 3 a and b and Supplementary Fig. 3a and d). Interestingly, whole life Parkin overexpression or one-week Drp1 induction from midlife ameliorates the immune response in heads and thoraxes from old flies (Fig. 3 a and b, and Supplementary Fig. 3a and d). To seek further evidence for the role of mitophagy in age-onset immune activation, we analyzed the expression levels of Turandot A ( TotA ), another polypeptide gene also activated after bacterial and DNA viral infection 48 . First, we analyzed the expression of TotA in aged heads and thoraxes of daGS > UAS-Parkin and daGS > UAS-DRP1 uninduced flies. TotA mRNA transcript levels increase from young to aged flies in heads and thoraxes (Supplementary Fig. 3b, c, e, and f). Upon whole life Parkin or one-week DRP1 induction from midlife TotA mRNA transcript levels decreased in middle-aged flies (Supplementary Fig. 3b, c, e, and f, respectively). These results demonstrate that stimulating mitophagy, which reduces cytosolic mtDNA, ameliorates the activation of the immune response in old flies. To test if cytosolic DNA degradation can reduce age-onset immune activation in Drosophila , we analyzed the mRNA transcript levels of AttA and TotA during aging in DNase II and Sid overexpressing flies and controls. Interestingly, ubiquitous DNase II induction reduces the transcript levels of AttA and TotA in heads and thoraxes of aged flies as compared to age-matched control flies (Fig. 3 c and Supplementary Fig. 3g-i). Moreover, neuronal Sid upregulation ameliorates the activation of the immune response related genes AttA and TotA in aged heads as compared to vehicle fed control flies (Fig. 3 d and Supplementary Fig. 3j). Cytosolic DNA is recognized by the conserved eya gene via its threonine phosphatase motif 31 , 32 . EYA recognizes cytosolic DNA and interacts with the NF-κB-like transcription factor Relish that induces the expression of immune-related genes, including antimicrobial peptides (AMPs) 31 , 49 . Relish is a compound protein with two domains, an N-terminal Rel Homology Domain (RHD), and a C-terminal IkB-like region. Rel activation requires an endoproteolytic cleavage and the translocation of the RHD domain to the nucleus 50 . To further investigate the role of age-associated cytosolic DNA accumulation in immune response activation, we examined by western blotting the levels of the transcription factor Relish (Rel) upon ubiquitous DNase II and neuronal Sid upregulation. Ubiquitous DNase II or neuronal Sid upregulation reduces the levels of nuclear Rel (Rel-49) in heads of aged flies (Fig. 3 e and g, and quantification in f and h, respectively). Moreover, we analyzed, by IF, Rel levels in brains of DNase II overexpressing and control flies. We saw a striking reduction in Rel protein levels in aged fly brains upon whole life DNase II upregulation as compared to age-matched control flies (Fig. 3 i and quantification in j). Using daGS > UAS-DNase II flies, we examined the relationship between DNase II and EYA in aged flies by IF. Remarkably, DNase II upregulation decreases EYA levels in aged brains as compared to control flies (Fig. 3 i and quantification in 3k). Overall, our data indicate that age-associated cytosolic mtDNA accumulation triggers the activation of the immune response in aged flies, and that its reduction ameliorates the expression of immune response-related genes. Neuronal inhibition of EYA during aging prolongs healthspan To better understand the potential role of EYA in aging, we analyzed eya transcript levels in young (day 10), middle-aged (day 28 and 35), and old (day 42) wild type flies. eya mRNA levels increase more than 4-fold from young to middle-aged and old flies and decrease by 37 percent after day 35 in wild type heads (Supplementary Fig. 4a). We also analyzed the eya mRNA levels in thoraxes and showed that eya transcript levels slightly increase from day 10 to day 35 and 42 (Supplementary Fig. 4b). Since, eya transcript levels increase dramatically in heads of aged flies, we examined whether eya neuronal knockdown could ameliorate the activation of the immune response in aged fly heads. First, we validated that RNAi against eya inhibits the expression of EYA protein in aged flies. Confocal analysis shows that EYA protein levels decrease in elavGS > UAS-eya-RNAi induced flies as compared to uninduced control flies (Fig. 4 a and quantification in b). Next, we found that neuronal downregulation of eya decreases AttA mRNA transcript levels in aged fly heads (day 45) compared to control flies and shows a trend towards a reduction in TotA mRNA transcript levels (Fig. 4 d and Supplementary Fig. 4c). To seek evidence that EYA regulates the immune response through its interaction with Rel, we set out to examine the protein levels of Rel in heads of eya neuronal knockdown flies. Interestingly, neuronal inhibition of eya reduces Rel protein levels in brains of aged flies (Fig. 4 a and quantification in c, and 4e and quantification in f). Importantly, neuronal eya knockdown does not change cytosolic mtDNA levels in old flies (Supplementary Fig. 4d). Together, these results demonstrate that EYA contributes to age-onset neuroinflammation. To deepen our understanding of the role of EYA in aging, we set out to analyze the healthspan of eya neuronal knockdown flies. In the first place, we examined the lifespan of elavGS > UAS-eya-RNAi flies and observed that neuronal eya knockdown prolongs Drosophila lifespan in several trials (Fig. 4 g and Supplementary Table s3 ). Importantly, eya neuronal downregulation improves intestinal barrier function (Fig. 4 h), spontaneous activity (Fig. 4 i and j), and endurance exercise capacity (Fig. 4 k). Collectively, these data reveal that neuronal eya downregulation extends Drosophila lifespan, delays age-onset intestinal pathology and improves healthspan. Neuronal inhibition of EYA slows hallmarks of brain aging Age-related memory impairment (AMI) is associated with alterations in neuronal physiology; more specifically in synaptic connectivity 51 , 52 . Studies in Drosophila have shown that an increase in the size of the pre-synaptic active zone is associated with a decline in memory and sleep disruption 53 , 54 . Drosophila , as well as other insects, shares high levels of homology in the design and function of the olfactory nervous system with mammals. Bruchpilot (BRP) shows homology to the active zone human protein ELKS/CAST/ERC 55 . It has been demonstrated that aging increases the active zone structure and the expression of the active zone protein BRP 53 . Here, to better characterize the effect of eya knockdown on synaptic aging, we analyzed the levels of BRP in eya knockdown flies and controls. Importantly, as previously reported 53 , we saw an increase in BRP protein levels in control middle-aged (day 30) flies when compared with young control flies (Fig. 5 a and quantification in b, and Supplementary Fig. 5a). Interestingly, aged brains with reduced levels of EYA showed a reduction in BRP at day 30 when compared with age-matched control flies (Fig. 5 a and quantification in b, and Supplementary Fig. 5a). Next, we examined whether neuronal EYA activity contributes to cognitive decline during aging. Remarkably, neuronal inhibition of EYA improves performance in the olfactory aversion training assay (Fig. 5 c). These results indicate that neuronal eya knockdown suppresses age-related memory impairment and delays synaptic aging. In recent years, significant attention has been focused on the cellular hallmarks of aging 1 , including hallmarks of brain aging 56 . To provide a mechanistic understanding of how neuronal inhibition of EYA slows brain aging, we examined several key cellular hallmarks of aging. In the first place, we examined the impact of neuronal eya knockdown on markers of mitochondrial homeostasis. We have previously shown that dysfunctional mitochondria accumulate in aged fly brain tissue 57 , 58 . Importantly, we find that neuronal eya downregulation decreases mitochondrial content in aged brains as compared to controls (Fig. 5 d and quantification in e). Next, we set out to examine the impact of neuronal eya inhibition on mitochondrial activity during aging, using the mitochondrial membrane potential potentiometric dye TMRE (tetramethylrhodamine, ethyl ester). We observed that eya downregulation in neurons significantly improves mitochondrial membrane potential in aged brains (Fig. 5 f and quantification in g). Together, these data show that neuronal EYA activity compromises mitochondrial homeostasis during brain aging. Disabled autophagy and loss of protein homeostasis (proteostasis) are thought to be primary hallmarks of aging, which unambiguously drive the aging process 1 . Hence, we next sought to determine whether neuronal eya downregulation could improve autophagy and/or proteostasis in aged Drosophila brains. To evaluate autophagic activity in the aging brain, we used a reporter line expressing GFP-mCherry-Atg8a (“Atg8a-tandem”) ubiquitously under the control of the endogenous Atg8a promoter 59 . As autophagosomes fuse with lysosomes, GFP signal on the Atg8a tandem protein is quenched due to its sensitivity to low pH. Remaining mCherry-only foci indicate autolysosomal activity. Using this approach, we find that neuronal eya inhibition results in a significant increase in autolysosomes in aged brains (day 45) compared to control flies (Fig. 5 h and quantification in i as shown in Supplementary Fig. 5b). To examine the impact of eya knockdown on protein homeostasis, we analyzed the accumulation of protein aggregates in aged brains of neuronal eya knockdown flies and controls. IF microscopy analysis shows that brains with reduced levels of EYA present smaller ubiquitin-containing protein aggregates (Fig. 5 j and quantification in k, and Supplementary Fig. 5c and quantification in d). Together, our results indicate that neuronal eya inhibition improves proteostasis and autophagy in aged Drosophila brains, two of the major primary hallmarks of aging. Discussion Studies in both vertebrate and invertebrate models have shown that mitophagy can counteract aging and prolong lifespan 38 – 40 , 58 , 60 , 61 . These observations strongly support a model in which dysfunctional mitochondria, within aged cells, drive pathology and limit lifespan. Yet, a clear understanding of the mechanisms that underlie age-onset health decline upon mitochondrial dysfunction is lacking. Recent work has shown that mitophagy can dampen age-onset cGAS/STING-driven neuroinflammation in mice 22 . Moreover, treatment with STING inhibitors can reduce age-associated neuroinflammation and improve cognition 27 . Together, these findings support a model in which cytosolic DNA, originating from dysfunctional mitochondria, accumulates in certain aged brain cells, driving cGAS/STING mediated-neuroinflammation and disrupting neurological function. Here, we have extended these findings to show that cytosolic mtDNA accumulates broadly in fly brains, muscle tissue and whole bodies. Moreover, we provide direct evidence that cytosolic DNA and associated pro-inflammatory signaling limits organismal lifespan and healthspan. We show that genetic induction of nuclease activities can dampen age-onset inflammation and prolong organismal healthspan. Critically, we show that inducing DNase II or Sid reduces cytosolic mtDNA levels in aged flies. It should be noted, however, that we cannot exclude the possibility that the nuclease-mediated degradation of additional nucleic acids could contribute to observed phenotypes. The finding that the cGAS/STING signaling pathway is a critical driver of neurodegenerative processes during aging 62 raises the question of whether additional interventions targeting the immune sensing of DNA can counteract aging-related pathophysiology. In addition to the Toll receptor and the Toll signaling pathway, the Drosophila immune response is regulated by another evolutionarily conserved signaling cascade, the immune deficiency (Imd) pathway, which activates Relish/NF-κB 63 . The fly EYA protein acts in a cascade that senses undigested cytosolic DNA and activates the immune response by binding to the I-kappa-B kinase beta (IKKβ), component of the IKK phosphorylation complex that phosphorylates Relish, and Relish 31 . We show that neuronal inhibition of EYA dampens age-onset Relish/NF-κB activity, slows several markers of brain aging and prolongs organismal lifespan. As mammalian EYA4 enhances the innate immune responses against DNA by activating NF-κB 32 , it stands to reason that EYA4 represents an attractive target to slow brain aging and prolong healthspan in mammals. A challenge to consider, in this regard, is that while interventions that reduce the immune sensing of DNA may promote healthspan in laboratory animals, there could be detrimental consequences outside of a laboratory setting. One of the major findings from our study is that inhibiting EYA in aging neurons ameliorates a number of hallmarks of brain aging, including disabled autophagy which has been designated as a primary hallmark of aging 1 , 56 . Our data doesn’t refute the idea that disabled autophagy precedes cytosolic mtDNA accumulation and associated pro-inflammatory signaling during aging. Rather, the simplest interpretation of our findings is that neuronal EYA activity, in response to cytosolic DNA, exacerbates autophagy impairments in aged cells. In turn, disabled autophagy has been shown to contribute to synaptic aging and age-onset cognitive decline 51 , 53 . Hence, a plausible interpretation of our findings is that EYA activity in aging neurons drives cognitive decline via disabled autophagy. We show that neuronal inhibition of EYA counteracts NF-κB-like proinflammatory signaling in aged brains. Previous studies have shown that, under certain conditions, NF- κ B signaling activates the expression of autophagy inhibitors and represses activators of autophagy 64 . Hence, our working hypothesis is that reduced NF-κB-like proinflammatory signaling in aged brains, upon neuronal EYA inhibition, leads to improved brain autophagy. Antimicrobial peptides (AMPs) often target the cellular membrane or cell wall of gram-positive and gram-negative bacteria, viruses, and fungi and have different mechanisms of action including membrane permeabilization 65 . Mitochondrial and bacterial membranes share some similarities like lipid composition 66 . These similarities could make the mitochondrial membrane a suitable target for AMPs. Recent studies have demonstrated that AMPs change mitochondrial membrane permeability and induce apoptosis 67 . It is possible, therefore, that reduced AMP levels in response to EYA inhibition may lead to improved mitochondrial homeostasis in aged brains. Future work could focus on finding ways to dampen NF-κB-like proinflammatory signaling in aged brains without compromising pathogen susceptibility. Materials & Methods Fly Stocks The fly strain Elav–GeneSwitch ( elavGS ) was provided by H. Keshishian (Yale University, New Haven, CT, USA). daughterless-GeneSwitch ( daGS ) was provided by H. Tricoire (Universite´ Paris Diderot–Paris7, Paris, France). UAS-Parkin-HA ( UAS-Park ) was provided by L. Pallanck (University of Washington, Seattle, WA, USA). UAS-DRP1 was provided by J. Chung (Korea Advanced Institute of Science and Technology, Republic of Korea). GFP-mCherry-Atg8a was provided by Eric Baehrecke (University of Massachusetts Medical School, Worcester, MA, USA). UAS-eya RNAi (28733), sqh-mito-EYFP (7194), UAS-mito-HA-GFP (8442), UAS-mCD8::GFP (32185), and w 1118 (3605) were acquired from the Bloomington Drosophila Stock Center. Fly Husbandry and Lifespan Analysis Flies were reared in vials containing cornmeal medium (1% agar, 3% yeast, 1.9% sucrose, 3.8% dextrose, 9.1% cornmeal, 1.1% acid mix (41.8% Propionic acid plus 4.15% Phosphoric acid in vol/vol), and 1.5% methylparaben (10% methylparaben in ethanol), all concentrations given in wt/vol). Flies were collected under light nitrogen-induced anesthesia and housed at a density of 30 female flies per vial. All flies were kept in a humidified, temperature-controlled incubator with a 12 h on/off light cycle at 25°C. RU486 was dissolved in ethanol and administered in the media while preparing food. RU486 concentration is given in mg/mL in the figure legend for each treatment. Flies were flipped to fresh food containing vial every 2–3 days and scored for death. Transgenic flies generation UAS-Sid (UAS-CG9989) and UAS-DNase II (UAS-CG7780) fly lines were generated by phiC31 integrase mediated transformations of flies harboring an intergenic attP site in chromosome 2R ("attP33") 68 with pUASTattB plasmids 69 edited with corresponding cDNA sequences. Sid cDNA was amplified from LP02841 (Drosophila Genomics Resource Center Stock 12973), DNAseII cDNA was amplified from GH10876 (DGRC Stock 6248) using standard PCR protocols. All plasmids were validated by sequencing prior to transformation. Cloning primers (utilizing a SfiI recognition sequence: sid_F-CGCAGGGCCGGACGGGCCAGATGCCCGATCTGAAGTATATG, sid_R- CGCAGGGCCCCAGTGGCCCAAATACCACTTTATATTTATTTTAATATGC, DNase II_F- CGCAGGGCCGGACGGGCCCAACTTGAAGGTTGTACAATGCG, DNase II_R- CGCAGGGCCCCAGTGGCCCAATTTTCTTATGCATTAAATGTAATGC. Spontaneous Physical Activity Assay 10 adult female flies were placed in a Drosophila activity monitor (TriKinetics). Movements were recorded continuously every 30s under normal culturing conditions for 36 h on a 12 h:12 h dark:light cycle. Bar graphs represent mean activity per fly per hour, and the scatterplot shows spontaneous activity per fly during a 12 h:12 h dark:light cycle. Triplicate samples were used for each activity measurement. Climbing Activity Assay At least 60 adult female flies were placed in a 100 mL glass cylinder. Cylinders were tapped quickly, and flies were allowed to settle for 1 min. This step was repeated 8 times. Then the cylinder was tapped quickly and after 1 min, the number of flies in the upper, middle, and lower 1/3rd parts of the cylinder was recorded. Intestinal Barrier Dysfunction Assay (Smurf Assay) Intestinal barrier dysfunction was performed as previously described in 44 Rera et al. (2012). Flies were aged in normal or RU486 containing food until the day of the assay. The day before the assay, flies were transferred to new vials containing standard medium with 2.5% wt/vol F&D blue dye # 1 (SPS Alfachem) and Ethanol for control flies or RU486 for experimental flies. Flies were kept in this medium for at least 16 hours. Flies with dye coloration outside the gut were counted as flies with loss of gut integrity (Smurf fly). Olfactory Training Aversion training was performed with modifications as described in 45 Malik et al. (2014) using a system from MazeEngineers (Conduct Science). Briefly, flies were exposed under low red-light conditions to a neutral odor (3-octanol OCT) by air pump in a training chamber for one minute in a series of twelve 65-V and 0.2 mA electrical-shocks for 1.25s followed by 3.75s of rest. Flies recovered for one hour before being placed in a T-maze with trained odor on one side and a second neutral odor (4-methylcyclohexanol, MCH) on the other side of the maze. After two minutes of exploration under red-light conditions, flies in either chamber of the maze were scored. Performance index was calculated by dividing the number of flies avoiding OCT by the number of participants (OCT + MCH flies). Cellular Fractionation and cytosolic and nuclear DNA isolation Cellular fractionation was performed as described in 70 Mosley and Baker (2022) with modifications. Heads (25 heads) or thoraxes (20 thoraxes) were gently homogenized in 200 µL of cold Mitochondrial Isolation Medium (250 mM sucrose, 10 mM TrisHCl (pH 7.4), 0.15 mM MgCl2). Samples were spun for 5 seconds to remove fly debris and then spun at 15000Xg for 15 min. at 4°C for mitochondria and nuclei purification (nuclear and mitochondrial fraction). Supernatant (cytosolic fraction) was collected (170 mL) in a new 1.5 µL vial and pellet was resuspended in 100 µL Nuclear Isolation Medium (10 mM HEPES-KOH pH 7.5; 2.5 mM MgCl 2 ; 10 mM KCl). Nuclei and cytosolic fraction were incubated with 1 µL of Proteinase K (10 mg/mL) (Fisher-Scientific, cat# BPI1700-100) for 1 hour at 55°C. Proteinase K was inactivated by incubating the samples for 10 min. at 95°C. One volume of phenol:chloroform:isoamyl alcohol (25:24:1) was added to each sample and shaken by hand thoroughly for approximately 20 seconds. Then, samples were spun at 16000Xg for 15 min at room temperature. The upper phase (aqueous phase) containing DNA was transferred to a new 1.5 mL vial, and 1 µL of glycogen, 0.5 volumes of NH 4 OAc, and 2.5 volumes (samples + NH 4 OAc) of EtOH were added. Samples were kept at -20°C overnight. The following day, samples were centrifuged at 15000Xg for 30 min. at 4°C. Pellet (DNA) was washed twice with 70% EtOH and resuspended in 20 µL of TE Buffer (1 mM EDTA & 10 mM PH 8 Tris-Cl). Cytosolic fraction was tested for mitochondria contamination by taking 10 µL each of the cytosolic and nuclear/mitochondria fraction and analyzing the samples by western blot against the mitochondrial protein VDAC1 and the cytosolic protein Actin (Supplementary Fig. 1A). RNA Extraction, cDNA Synthesis and quantitative PCR (qPCR) 10 heads or 5 thoraxes were homogenized in 100 µL of ice cold Trizol (Thermo Fisher Scientific cat# 15596018) for RNA extraction. Samples were incubated at room temperature for 10 min. Then, 20 µL of Chloroform (Millipore-Sigma cat# C2432-500ML) was added to the samples and shaken vigorously by hand for 20 seconds. Samples were incubated for another 10 min. at room temperature, then centrifuged at 12000Xg for 15 min. at 4°C. 45 µL of the upper phase, containing the RNA, was transferred to a new 1.5 mL vial. For head samples, 4.5 µL of 3.5 M Sodium Acetate (Fisher Scientific cat# R1181) and 2 µL of 20 mg/mL RNA Grade Glycogen (Fisher Scientific cat # R0551) were added to the samples. Then, 50 µL of Isopropyl Alcohol (Fisher Scientific cat# 02-003-133) was added to the samples and briefly vortexed to mix. Samples were spun at 12000Xg for 10 min. at 4°C. Pellet (RNA) was washed with 200 µL of 75% EtOH, air dried for 5 min, resuspended in 20 µL ddH20, and incubated at 55°C for 10 min. cDNA synthesis was carried out using the First Strand cDNA Synthesis Kit from Thermo Fisher Scientific (cat# K1621, K1622). PCR was performed with PowerUP SYBR Green Master Mix (Ref#A25777, Applied Biosystems) on a BioRad Real Time PCR system. Cycling conditions were as follows: 95°C for 10 minutes; 95°C for 15 s then 60°C for 60 s, cycled 40 times, and equalized amplicons of Actin5C were used as a reference to normalize for cytosolic mitochondrial DNA, and GAPDH was used as a reference for gene expression analysis. Primers sequences used were as follows: GAPDH_F: CTCCACCACAACTCGGCTC and GAPD_R: TAAATTCGACTCGACTCACGGT Act5C_F: TTGTCTGGGCAAGAGGATCAG and Act5C_R: ACCACTCGCACTTGCACTTTC COI _F: GAATTAGGACATCCTGGAGC and COI_R: GCACTAATCAATTTCCAAATCC ND2_F: AAAAAGTGGAGCCGCTCC and ND2_R: GTTTGATTTAATCCTCCAATAGCTCC DNase II_ F: AGGATGAAGCTGGAAACGATG and DNase II_R: CAGGTGTCATAGTTCTGGCTG Sid_F: TTCCATCTACAAGGCTTATCGC and Sid_R: TTGTGTTGCTCTTCCCTCG Eya_F: GTCAGCTCGGACGACAAT and Eya_R: GTGCCAACATTTCCACGATAG AttA_F: CTCCTGCTGGAAAACATC and Atta_R: GCTCGTTTGGATCTGACC TotA_F: CCCAGTTTGACCCCTGAG and TotA_R: GCCCTTCACACCTGGAGA Western Blot Heads (10 heads per sample) were homogenized in 100 µL of Lysis Buffer (PBS 1X, Protease Inhibitors 1X, NuPAGE LDS Sample Buffer 1X, and DTT (Dithiothreitol) 0.05M). Samples were incubated for 5 min. at 95°C and centrifuged at 16000Xg for 5 min. at 4°C. 10 µL of samples were separated by SDS-PAGE gels, and proteins were transferred to Nitrocellulose membranes. Membranes were probed with antisera against: rabbit anti-GAPDH (Novus Biologicals cat# NB100-56875), mouse anti-actin peroxidase conjugated 1:15000 (Sigma cat# A3854), mouse anti-VDAC1/Porin 1:10000 (ab14734, Abcam), mouse anti-Relish-N 1:1000 (DSHB cat# 21F3). Anti-Rabbit or anti-Mouse Horseradish peroxidase conjugated antibodies were used for detection at a 1:10000 dilution. Amersham ECL Prime Western Blotting Detection Reagent (GE Life Sciences) was used to visualize the presence of horseradish peroxidase, and the chemiluminescent signal was recorded using Syngene Pxi Western Blot Imager. Image analysis was done using ImageJ. Muscle and Brain Immunostaining For muscle staining, flies were fixed in 3.7% formaldehyde in PBS for 20 minutes. After fixation, hemithoraxes were dissected and fixed again for 5 min. Brains were dissected directly in cold PBS and fixed in 3.7% formaldehyde in PBS for 20 min. at RT. For Brp staining, brains were dissected in saline medium (NaCl 103 mM, KCl 3 mM, TES 5 mM, trehalose 10 mM, glucose 10 mM, sucrose 7 mM, NaHCO 3 26 mM, NaH 2 PO 4 1 mM, CaCl 2 1.5 mM, MgCl 2 4 mM adjusted to 280 mOsm) and fixed in 3.7% formaldehyde in PBS for 20 min. at RT. Brains and hemithoraxes were then rinsed 3 times for 10 min. with 0.2% Triton X-100 in PBS (PBST) and blocked in 3% BSA in PBST (PBST-BSA) for 1 hour. Primary antibodies were diluted in PBST-BSA and incubated overnight at 4°C, except for Brp, which was incubated for more than 48 hours. Primary antibodies used were: mouse-anti-FK2 1:250 (04-263, Millipore Sigma); mouse-anti-ATP5A1 1:250 (ab14748, abcam); anti-EYA 1:10 (10H6, DSHB); anti-BRP 1:100 (nc82, DSHB); and anti-Relish-N 1:50 (RB 14-0024-20, RayBiotech). Hemithoraxes and brains were then rinsed 3 times in PBST for 10 min. and incubated with the secondary antibodies and/or stains at room temperature for 3 hours. Secondary antibodies used were: anti-rabbit or anti-mouse AlexaFluor-488 1:500 (Invitrogen); anti-rabbit or anti-mouse AlexaFluor-568 1:500 (Invitrogen); To-Pro-3 (1:1000, Invitrogen) or DAPI (300nM, Invitrogen) for DNA staining. Finally, samples were rinsed 3 times with PBST for 10 min. and mounted in Vectashield Mounting Medium (Vector Lab). Images were acquired using a Zeiss LSM 880 Airyscan Confocal Microscope. Muscle and Brain Low Permeability Immunostaining Low permeability immunostaining was performed as described in 33 Sato et al. (2021) with modifications. For muscle staining, flies were fixed in fixation solution (3.7% formaldehyde in PBS) for 20 min. After fixation, hemithoraxes were dissected and fixed for another 2.5 hours in cold-ice fixation solution. For brain staining, flies were dissected directly in cold PBS and fixed for 2.5 hours in ice-cold fixation solution. After fixation, samples were washed 5 times in cold PBS on ice for 10 mins each. Brains and hemithoraxes were dehydrated using the following EtOH series solutions: 5%, 10%, 20%, 50%, 70%, and 100% for 5 min. each on ice. Samples were then washed once more with 100% EtOH for 10 min on ice and incubated in new 100% EtOH at -20°C overnight. The next day, brains and hemithoraxes were rehydrated in ice-cold EtOH solutions (70%, 50%, 20%, 10%, and 5%) for 5 min each. Samples were then washed four times with ice-cold PBS and three times with room temperature PBS. Brains and hemithoraxes were incubated in permeabilization buffer (Tween 20 0.1% V/V plus Triton X-100 0.01% V/V in PBS) for 5 min. Samples were rinsed with PBS and washed 3 times for 10 min. each in PBS. Next, samples were incubated in blocking buffer (10% normal goat serum in PBS) for 1 hour. Primary antibodies used were: mouse-anti-dsDNA 1:500 (ab27156, Abcam) and chicken anti-GFP 1:1000 (GFP1010, Aves Labs). Primary antibodies were diluted in PBS and incubated for 3 days at 4°C. Hemithoraxes and brains were then washed 3 times in PBS and 3 times in washing buffer (Tween 20 0.05% V/V in PBS) for 10 min each. Samples were incubated with the appropriate secondary antibody for 3 days. Finally, samples were washed 3 times in washing buffer for 10 min. and mounted in Vectashield Mounting Medium (Vector Lab). Images were acquired using a Zeiss LSM 880 Airyscan Confocal Microscope. TMRE Staining Flies were anesthetized and dissected in cold Drosophila Schneider’s Medium (DSM). Brains were incubated in TMRE staining solution (100 nM TMRE (Thermo Fisher Scientific cat# T669) in DSM) for 12 min. at room temperature. After staining samples were rinsed once in wash solution (25 nM TMRE in DSM) for 30 s. Brains were mounted in wash solution. Images were acquired using a Zeiss LSM 880 Airyscan Confocal Microscope with the same settings for laser intensity and gain. Image Analysis Images in Fig. 1 a, b, h, and k, and Fig. 2 a and j were acquired using a Zeiss LSM 880 confocal microscope with Airyscan. For muscles, images were cropped to 21.25 X 13.12 (WXL) microns. For brains, images were cropped to 10.78 X 6.65 (WXL) microns. dsDNA counts were analyzed by quantifying the number of dots outside of mitochondrial staining (GFP). Images in Supplementary Fig. 1a were acquired with a Zeiss LSM 880 confocal microscope with Airyscan microscopy. Images were cropped to 21.25 X 13.12 (WXL) microns for further analysis. Mitochondria morphology and dsDNA were segmented using the ImageJ Plugin Trainable Weka Segmentation. Segmented images were analyzed for dsDNA colocalization using the ImageJ plugin JACoP (Just Another Colocalization Plugin). Manders’ Colocalization Coefficient was applied to quantify the proportion of dsDNA that colocalizes with mitochondria. Images in Fig. 3 i, 4 b, 5 h, and j, and Supplementary Fig. 5b and c were acquired with a Zeiss LSM 880 confocal microscope and cropped to 55.35 X 55.35 (WXL) microns. EYA and Rel intensity analysis were quantified in ImageJ using the same threshold limits, and the mean gray value was quantified for each image and normalized to nuclei (To-Pro-3) intensity. FK2 aggregate size and number were quantified in the image using the “analyze particle” tool. Particles smaller than 0.05 µm 2 were discarded. Images in Fig. 5 d were acquired with a Zeiss LSM 880 confocal microscope and cropped to 23.81X14.76 (WXL). ATP5a percentage was analyzed in ImageJ and normalized to the nuclei percentage. Images in Fig. 5 a were acquired with a Zeiss LSM 880 confocal, using identical settings conditions for each image, and cropped to 428.05X446.96 (WXL) microns. Brp intensity was quantified in the central brain by calculating the mean gray value in ImageJ for each image. For TMRE staining (Fig. 5 f), images were acquired in a Zeiss LSM 880 confocal microscope using identical settings for each condition. Images were cropped to 35.71 X 22.14 (WXL) microns. TMRE intensity was quantified using ImageJ software. Autolysosomes in Fig. 5 h/Sup Fig. 5b were quantified using the mitoQC counter plugin on ImageJ 71 . Briefly, Red dots (autolysosomes) are quantified based on the difference in the intensity profile between the red and green channels. Statistical Analysis GraphPad Prism 10 was used to perform the statistical analysis and graphical display of the data. Statistical significance is expressed as p-values as determined by two-tailed tests. A Gaussian distribution with parametric distribution was used when samples reached the distribution criteria, or non-parametric distribution was used when samples did not reach the criteria for Gaussian distribution. For comparisons between two groups, an unpaired t -test was used. For comparisons of more than two groups, one-way ANOVA with Šídák correction or Tukey and Dunnett test was performed. Kruskal-Wallis tests with Dunn’s multiple comparisons post hoc tests were used when data do not meet the criteria for one-Way ANOVA analysis. When performing grouped analyses with multiple comparisons, two-way ANOVAs with Šídák’s multiple comparisons test were performed. Scatter plots with bars depict mean ± SEM. p values are annotated in each figure legend. The number (n) of biological samples used in each experiment and what n represents can be found in each figure legend. Log-rank (Mantel-Cox) test was used for survival curves comparison. Average median survival is the time point at which the probability of survival equals 50%. Detailed statistical analysis and the difference between survival curves can be found in the supplementary tables. Declarations Acknowledgements We thank E. Baehrecke (UMass Medical School), the Vienna Drosophila Resource Center, and the Bloomington Drosophila Stock Center (NIH no. P40OD018537) for fly stocks. We thank N. Prunet, Ken Yamauchi, and the MCDB/BSCRC Microscopy Core for training and microscope facilities. This work was supported by NIH grants R01AG037514 and R01AG049157 to D.W.W. Competing Interests D.W.W reports a relationship of board membership with Amway Scientific Advisory Board References López-Otín, C., Blasco, M. A., Partridge, L., Serrano, M. & Kroemer, G. Hallmarks of aging: An expanding universe. Cell 186 , 243–278 (2023). Fulop, T. et al. Immunology of Aging: the Birth of Inflammaging. Clin. Rev. Allergy Immunol. 64 , 109–122 (2023). Ferrucci, L. & Fabbri, E. Inflammageing: chronic inflammation in ageing, cardiovascular disease, and frailty. Nat. Rev. Cardiol. 15 , 505–522 (2018). Furman, D. et al. Chronic inflammation in the etiology of disease across the life span. Nat. Med. 25 , 1822–1832 (2019). Nikolich-Žugich, J. The twilight of immunity: emerging concepts in aging of the immune system. Nat. Immunol. 19 , 10–19 (2018). Salazar, A. M., Aparicio, R., Clark, R. I., Rera, M. & Walker, D. W. Intestinal barrier dysfunction: an evolutionarily conserved hallmark of aging. Dis. Model. Mech. 16 , dmm049969 (2023). Chen, G. Y. & Nuñez, G. Sterile inflammation: sensing and reacting to damage. Nat. Rev. Immunol. 10 , 826–837 (2010). Feldman, N., Rotter-Maskowitz, A. & Okun, E. DAMPs as mediators of sterile inflammation in aging-related pathologies. Ageing Res. Rev. 24 , 29–39 (2015). Green, D. R., Galluzzi, L. & Kroemer, G. Mitochondria and the Autophagy–Inflammation–Cell Death Axis in Organismal Aging. Science 333 , 1109–1112 (2011). Sun, N., Youle, R. J. & Finkel, T. The Mitochondrial Basis of Aging. Mol. Cell 61 , 654–666 (2016). Lin, M., Liu, N., Qin, Z. & Wang, Y. Mitochondrial-derived damage-associated molecular patterns amplify neuroinflammation in neurodegenerative diseases. Acta Pharmacol. Sin. 43 , 2439–2447 (2022). Nakahira, K. et al. Autophagy proteins regulate innate immune responses by inhibiting the release of mitochondrial DNA mediated by the NALP3 inflammasome. Nat. Immunol. 12 , 222–230 (2011). Zhou, R., Yazdi, A. S., Menu, P. & Tschopp, J. A role for mitochondria in NLRP3 inflammasome activation. Nature 469 , 221–225 (2011). Rongvaux, A. et al. Apoptotic Caspases Prevent the Induction of Type I Interferons by Mitochondrial DNA. Cell 159 , 1563–1577 (2014). West, A. P. et al. Mitochondrial DNA stress primes the antiviral innate immune response. Nature 520 , 553–557 (2015). White, M. J. et al. Apoptotic Caspases Suppress mtDNA-Induced STING-Mediated Type I IFN Production. Cell 159 , 1549–1562 (2014). Riley, J. S. & Tait, S. W. Mitochondrial DNA in inflammation and immunity. EMBO Rep. 21 , e49799 (2020). Pérez-Treviño, P., Velásquez, M. & García, N. Mechanisms of mitochondrial DNA escape and its relationship with different metabolic diseases. Biochim. Biophys. Acta (BBA) - Mol. Basis Dis. 1866 , 165761 (2020). Gogvadze, V. & Zhivotovsky, B. Mitochondrial DNA: how does it leave mitochondria? Trends Cell Biol. (2025) doi:10.1016/j.tcb.2025.06.005. Yamamoto, H., Zhang, S. & Mizushima, N. Autophagy genes in biology and disease. Nat. Rev. Genet. 24 , 382–400 (2023). Oka, T. et al. Mitochondrial DNA that escapes from autophagy causes inflammation and heart failure. Nature 485 , 251–255 (2012). Jiménez-Loygorri, J. I. et al. Mitophagy curtails cytosolic mtDNA-dependent activation of cGAS/STING inflammation during aging. Nat. Commun. 15 , 830 (2024). Sliter, D. A. et al. Parkin and PINK1 mitigate STING-induced inflammation. Nature 561 , 258–262 (2018). Rai, P. et al. IRGM1 links mitochondrial quality control to autoimmunity. Nat. Immunol. 22 , 312–321 (2021). Matsui, H. et al. Cytosolic dsDNA of mitochondrial origin induces cytotoxicity and neurodegeneration in cellular and zebrafish models of Parkinson’s disease. Nat. Commun. 12 , 3101 (2021). Shan, Z. et al. mtDNA extramitochondrial replication mediates mitochondrial defect effects. iScience 27 , 108970 (2024). Gulen, M. F. et al. cGAS–STING drives ageing-related inflammation and neurodegeneration. Nature 620 , 374–380 (2023). Seong, C.-S. et al. Cloning and Characterization of a Novel Drosophila Stress Induced DNase. PLoS ONE 9 , e103564 (2014). Seong, C.-S., Varela-Ramirez, A. & Aguilera, R. J. DNase II deficiency impairs innate immune function in Drosophila. Cell. Immunol. 240 , 5–13 (2006). Chan, M. P. et al. DNase II-dependent DNA digestion is required for DNA sensing by TLR9. Nat. Commun. 6 , 5853 (2015). Liu, X. et al. Drosophila EYA Regulates the Immune Response against DNA through an Evolutionarily Conserved Threonine Phosphatase Motif. PLoS ONE 7 , e42725 (2012). Okabe, Y., Sano, T. & Nagata, S. Regulation of the innate immune response by threonine-phosphatase of Eyes absent. Nature 460 , 520–524 (2009). Sato, A. et al. Immunofluorescence microscopy-based assessment of cytosolic DNA accumulation in mammalian cells. STAR Protoc. 2 , 100488 (2021). Hussain, A. et al. Inhibition of oxidative stress in cholinergic projection neurons fully rescues aging-associated olfactory circuit degeneration in Drosophila. eLife 7 , e32018 (2018). Doty, R. L. et al. Smell Identification Ability: Changes with Age. Science 226 , 1441–1443 (1984). Mobley, A. S., Rodriguez-Gil, D. J., Imamura, F. & Greer, C. A. Aging in the olfactory system. Trends Neurosci. 37 , 77–84 (2014). Nguyen, T. N., Padman, B. S. & Lazarou, M. Deciphering the Molecular Signals of PINK1/Parkin Mitophagy. Trends Cell Biol. 26 , 733–744 (2016). Rana, A., Rera, M. & Walker, D. W. Parkin overexpression during aging reduces proteotoxicity, alters mitochondrial dynamics, and extends lifespan. Proc. Natl. Acad. Sci. 110 , 8638–8643 (2013). Leduc‐Gaudet, J., Hussain, S. N. & Gouspillou, G. Parkin: a potential target to promote healthy ageing. J. Physiol. 600 , 3405–3421 (2022). Rana, A. et al. Promoting Drp1-mediated mitochondrial fission in midlife prolongs healthy lifespan of Drosophila melanogaster. Nat. Commun. 8 , 448 (2017). Osterwalder, T., Yoon, K. S., White, B. H. & Keshishian, H. A conditional tissue-specific transgene expression system using inducible GAL4. Proc. Natl. Acad. Sci. 98 , 12596–12601 (2001). Roman, G., Endo, K., Zong, L. & Davis, R. L. P{Switch}, a system for spatial and temporal control of gene expression in Drosophila melanogaster. Proc. Natl. Acad. Sci. 98 , 12602–12607 (2001). Rera, M. et al. Modulation of Longevity and Tissue Homeostasis by the Drosophila PGC-1 Homolog. Cell Metab. 14 , 623–634 (2011). Rera, M., Clark, R. I. & Walker, D. W. Intestinal barrier dysfunction links metabolic and inflammatory markers of aging to death in Drosophila. Proc. Natl. Acad. Sci. 109 , 21528–21533 (2012). Malik, B. R. & Hodge, J. J. L. Drosophila Adult Olfactory Shock Learning. J. Vis. Exp. : JoVE 50107 (2014) doi:10.3791/50107. Pletcher, S. D. et al. Genome-Wide Transcript Profiles in Aging and Calorically Restricted Drosophila melanogaster. Curr. Biol. 12 , 712–723 (2002). Kounatidis, I. et al. NF-κB Immunity in the Brain Determines Fly Lifespan in Healthy Aging and Age-Related Neurodegeneration. Cell Rep. 19 , 836–848 (2017). West, C. & Silverman, N. p38b and JAK-STAT signaling protect against Invertebrate iridescent virus 6 infection in Drosophila. PLoS Pathog. 14 , e1007020 (2018). Hedengren, M. et al. Relish, a Central Factor in the Control of Humoral but Not Cellular Immunity in Drosophila. Mol. Cell 4 , 827–837 (1999). Stöven, S., Ando, I., Kadalayil, L., Engström, Y. & Hultmark, D. Activation of the Drosophila NF‐κB factor Relish by rapid endoproteolytic cleavage. EMBO Rep. 1 , 347–352 (2000). Gupta, V. K. et al. Restoring polyamines protects from age-induced memory impairment in an autophagy-dependent manner. Nat. Neurosci. 16 , 1453–1460 (2013). Foster, T. C. Regulation of synaptic plasticity in memory and memory decline with aging. Prog. Brain Res. 138 , 283–303 (2002). Gupta, V. K. et al. Spermidine Suppresses Age-Associated Memory Impairment by Preventing Adverse Increase of Presynaptic Active Zone Size and Release. PLoS Biol. 14 , e1002563 (2016). Huang, S., Piao, C., Beuschel, C. B., Götz, T. & Sigrist, S. J. Presynaptic Active Zone Plasticity Encodes Sleep Need in Drosophila. Curr. Biol. 30 , 1077-1091.e5 (2020). Wagh, D. A. et al. Bruchpilot, a Protein with Homology to ELKS/CAST, Is Required for Structural Integrity and Function of Synaptic Active Zones in Drosophila. Neuron 49 , 833–844 (2006). Mattson, M. P. & Arumugam, T. V. Hallmarks of Brain Aging: Adaptive and Pathological Modification by Metabolic States. Cell Metab. 27 , 1176–1199 (2018). Schmid, E. T., Schinaman, J. M., Liu-Abramowicz, N., Williams, K. S. & Walker, D. W. Accumulation of F-actin drives brain aging and limits healthspan in Drosophila. Nat. Commun. 15 , 9238 (2024). Schmid, E. T., Pyo, J.-H. & Walker, D. W. Neuronal induction of BNIP3-mediated mitophagy slows systemic aging in Drosophila. Nat. Aging 2 , 494–507 (2022). Lee, T. V., Kaya, H. E. K., Simin, R., Baehrecke, E. H. & Bergmann, A. The initiator caspase Dronc is subject of enhanced autophagy upon proteasome impairment in Drosophila. Cell Death Differ. 23 , 1555–1564 (2016). Aparicio, R., Rana, A. & Walker, D. W. Upregulation of the Autophagy Adaptor p62/SQSTM1 Prolongs Health and Lifespan in Middle-Aged Drosophila. Cell Rep. 28 , 1029-1040.e5 (2019). Ryu, D. et al. Urolithin A induces mitophagy and prolongs lifespan in C. elegans and increases muscle function in rodents. Nat. Med. 22 , 879–888 (2016). Izquierdo, J. M. cGAS-STING triggers inflammaging-associated neurodegeneration. Mol. Neurodegener. 18 , 78 (2023). Myllymäki, H., Valanne, S. & Rämet, M. The Drosophila Imd Signaling Pathway. J. Immunol. 192 , 3455–3462 (2014). Salminen, A., Hyttinen, J. M. T., Kauppinen, A. & Kaarniranta, K. Context‐Dependent Regulation of Autophagy by IKK‐NF‐κB Signaling: Impact on the Aging Process. Int. J. Cell Biol. 2012 , 849541 (2012). Zhang, Q.-Y. et al. Antimicrobial peptides: mechanism of action, activity and clinical potential. Mil. Méd. Res. 8 , 48 (2021). Rappocciolo, E. & Stiban, J. Prokaryotic and Mitochondrial Lipids: A Survey of Evolutionary Origins. Adv. Exp. Med. Biol. 1159 , 5–31 (2019). Wang, H. et al. Antimicrobial Peptides Mediate Apoptosis by Changing Mitochondrial Membrane Permeability. Int. J. Mol. Sci. 23 , 12732 (2022). Markstein, M., Pitsouli, C., Villalta, C., Celniker, S. E. & Perrimon, N. Exploiting position effects and the gypsy retrovirus insulator to engineer precisely expressed transgenes. Nat. Genet. 40 , 476–483 (2008). Bischof, J., Maeda, R. K., Hediger, M., Karch, F. & Basler, K. An optimized transgenesis system for Drosophila using germ-line-specific φC31 integrases. Proc. Natl. Acad. Sci. 104 , 3312–3317 (2007). Mosley, S. R. & Baker, K. Isolation of endogenous cytosolic DNA from cultured cells. STAR Protoc. 3 , 101165 (2022). Montava-Garriga, L., Singh, F., Ball, G. & Ganley, I. G. Semi-automated quantitation of mitophagy in cells and tissues. Mech. Ageing Dev. 185 , 111196 (2020). Additional Declarations Yes there is potential Competing Interest. D.W.W reports a relationship of board membership with Amway Scientific Advisory Board Supplementary Files SupFig3.pdf Supplementary figure 3 SupFig2.pdf Supplementary figure 2 Tables4.pdf Supplementary table s4 SupFig1.pdf Supplementary figure 1 TableS3.pdf Supplementary table s3 Tables2.pdf Supplementary table s2 SupFig4.pdf Supplementary figure 4 SupFig5.pdf Supplementary figure 5 Tables1.pdf Supplementary table s1 Cite Share Download PDF Status: Under Review Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7634140","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":520830197,"identity":"d855f671-bc25-4c2c-8848-ee6e0e0314f5","order_by":0,"name":"David Walker","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA60lEQVRIie3LsWqDUBTG8SPCdTnJfC4WfQVdQoY2fZUGwSlboEsCuSDYJaEv0DxEFucrgi5CVsGlUHCykCcouYFsLTdm63D/nOnw/QBMpv+YVIcADwRgfQJML79gEEFFbDWlYQSuhNEgMq7qUH6nM+Rvu26Fa/LBSTLSEV4vgnyfRuhiNWmxpFBg+aolgYxfilFmo0cxa0eCLEGLiZ4cuwvZoOd3bKnIs/D7G6SJpCIFusSYrchcEOoJb75kvv+pkG9jm3+UFKUYL6c6Mj7Ok1NfrzyqSuvUrx+f3p3i0OjI79h9c5PJZDL91Rnc1UVBnLokQgAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0002-9422-2178","institution":"University of California, Los Angeles","correspondingAuthor":true,"prefix":"","firstName":"David","middleName":"","lastName":"Walker","suffix":""},{"id":520830198,"identity":"1d375eaa-a3c0-47f8-acc6-fd483ec8c352","order_by":1,"name":"Ricardo Aparicio","email":"","orcid":"https://orcid.org/0000-0003-3670-0466","institution":"University of California, Los Angeles","correspondingAuthor":false,"prefix":"","firstName":"Ricardo","middleName":"","lastName":"Aparicio","suffix":""},{"id":520830199,"identity":"370793a7-92b9-4ea7-857c-0e03ad1ef61d","order_by":2,"name":"Roberta Alessi","email":"","orcid":"","institution":"University of California, Los Anlgeles","correspondingAuthor":false,"prefix":"","firstName":"Roberta","middleName":"","lastName":"Alessi","suffix":""},{"id":520830200,"identity":"b723eee4-faac-4c4e-8f62-9fc5e5821503","order_by":3,"name":"Agathe Solans","email":"","orcid":"","institution":"University of California, Los Anlgeles","correspondingAuthor":false,"prefix":"","firstName":"Agathe","middleName":"","lastName":"Solans","suffix":""},{"id":520830201,"identity":"87421f6a-8bbb-4f28-accf-fc0306c5a19b","order_by":4,"name":"Matin Mojdeh","email":"","orcid":"","institution":"University of California, Los Anlgeles","correspondingAuthor":false,"prefix":"","firstName":"Matin","middleName":"","lastName":"Mojdeh","suffix":""},{"id":520830202,"identity":"f53f5601-32aa-4006-aeb7-44f7f0b8eeee","order_by":5,"name":"Vartika Sharma","email":"","orcid":"","institution":"University of California, Los Anlgeles","correspondingAuthor":false,"prefix":"","firstName":"Vartika","middleName":"","lastName":"Sharma","suffix":""},{"id":520830203,"identity":"69b55fb2-923a-4107-ad29-d15997f4f9c1","order_by":6,"name":"Paul Oh","email":"","orcid":"https://orcid.org/0009-0005-2263-8157","institution":"Harvey Mudd College","correspondingAuthor":false,"prefix":"","firstName":"Paul","middleName":"","lastName":"Oh","suffix":""},{"id":520830204,"identity":"131dbf9a-05e9-401d-a7bd-4536f363cd58","order_by":7,"name":"Matea Zelich","email":"","orcid":"https://orcid.org/0009-0008-5928-5318","institution":"Harvey Mudd College","correspondingAuthor":false,"prefix":"","firstName":"Matea","middleName":"","lastName":"Zelich","suffix":""},{"id":520830205,"identity":"83985083-2573-4cf9-9257-2388f5fc59a9","order_by":8,"name":"Toby Frank","email":"","orcid":"","institution":"Harvey Mudd College","correspondingAuthor":false,"prefix":"","firstName":"Toby","middleName":"","lastName":"Frank","suffix":""},{"id":520830206,"identity":"3c61d253-7674-42d2-a681-773b625e8648","order_by":9,"name":"Jae Hur","email":"","orcid":"","institution":"Harvey Mudd College","correspondingAuthor":false,"prefix":"","firstName":"Jae","middleName":"","lastName":"Hur","suffix":""}],"badges":[],"createdAt":"2025-09-16 23:25:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7634140/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7634140/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":93399485,"identity":"d1a29374-c07e-44e1-bfaa-a384a18d67b9","added_by":"auto","created_at":"2025-10-13 12:15:00","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2891452,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMitophagy counteracts cytosolic mitochondrial DNA (mtDNA) accumulation in aged flies.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea)\u003c/strong\u003e\u0026nbsp; Representative images (data point in yellow in b) of immunofluorescence staining of indirect flight muscles from young (day 20), middle-aged (day 45), and old (day 60) \u003cem\u003edaGS\u0026gt; UAS-mitoGFP \u003c/em\u003efemale flies with RU486-mediated transgene expression from day 3 onwards, showing dsDNA (red channel, anti-dsDNA) and mitochondria (green channel, anti-GFP).\u0026nbsp; Scale bar 5mm.\u0026nbsp; Arrows indicate dsDNA staining outside mitochondria.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eb)\u003c/strong\u003e\u0026nbsp; Statistical quantification of dsDNA foci outside of mitochondria as shown in a.\u0026nbsp; d20 n = 15, d45 n = 14, and d60 n = 10 hemithoraxes.\u0026nbsp; d20 vs d45 **p = 0.0039; d20 vs d60 ****p \u0026lt; 0.0001; d45 vs d60 *p = 0.0356.\u0026nbsp; Ordinary one-way ANOVA test with Tukey multiple comparisons test.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ec) \u003c/strong\u003e\u0026nbsp;Representative images (data point in yellow in d) of immunofluorescence staining of \u003cem\u003eDrosophila \u003c/em\u003ebrains (mushroom body) from young (day 10), and old age (day 45) \u003cem\u003eelavGS\u0026gt; UAS-mitoGFP \u003c/em\u003efemale flies, showing dsDNA (red channel, anti-dsDNA) and mitochondria (green channel, anti-GFP).\u0026nbsp; Scale bar 2 mm.\u0026nbsp; Arrows indicate dsDNA staining outside mitochondria.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ed)\u003c/strong\u003e\u0026nbsp; Statistical quantification of dsDNA foci outside of mitochondria as shown in c.\u0026nbsp; d10 n = 9, and d45 n = 11 brains.\u0026nbsp; d10 vs d45 **p = 0.0021.\u0026nbsp; Unpaired t-test.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ee-g)\u003c/strong\u003e\u0026nbsp; qPCR analysis of cytosolic mtDNA levels in wild type female flies in whole flies (e), thoraxes (f), and heads (g).\u0026nbsp; \u003cstrong\u003ee) \u003c/strong\u003ed10 n = 5, d30 n = 5, and d45 n = 4 biological replicates with 20 flies per replicate.\u0026nbsp; d10 vs d30 *p = 0.0119; d10 vs d45 ****p \u0026lt; 0.0001; d30 vs d45 ****p \u0026lt; 0.0001.\u0026nbsp; Ordinary one-way ANOVA test with Tukey’s multiple comparisons test.\u0026nbsp; \u003cstrong\u003ef)\u003c/strong\u003e d10 n = 8, d30 n = 5, and d45 n = 4 biological replicates with 20 thoraxes per replicate.\u0026nbsp; d10 vs d45 ***p = 0.0002; d30 vs d45 ***p = 0.0002.\u0026nbsp; Ordinary one-way ANOVA test with Tukey’s multiple comparisons test.\u0026nbsp; \u003cstrong\u003eg)\u003c/strong\u003e d10 n = 4, d30 n = 4, and d45 n = 3 biological replicates with 25 heads per replicate.\u0026nbsp; d10 vs d30 **p = 0.0058; d10 vs d45 ****p \u0026lt; 0.0001; d30 vs d45 **p = 0.0064.\u0026nbsp; Ordinary one-way ANOVA test with Tukey’s multiple comparisons test.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eh)\u0026nbsp; \u003c/strong\u003eRepresentative images (data point in yellow in i) of immunofluorescence staining of indirect flight muscles from young (day 10), and middle-aged (day 30) \u003cem\u003edaGS\u0026gt; UAS-mitoGFP\u003c/em\u003e,\u003cem\u003e \u003c/em\u003eand\u003cem\u003e daGS\u0026gt; UAS-mitoGFP, UAS-Park \u003c/em\u003efemale flies with RU486-mediated transgene induction from day 3 to day 30, showing dsDNA (red channel, anti-dsDNA) and mitochondria (green channel, anti-GFP).\u0026nbsp; Scale bar 5mm.\u0026nbsp; Arrows indicate dsDNA staining outside mitochondria.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ei)\u0026nbsp; \u003c/strong\u003eStatistical quantification of dsDNA foci outside of the mitochondria as shown in h. \u003cem\u003ew\u003c/em\u003e\u003csup\u003e\u003cem\u003e1118\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e, daGS\u0026gt; UAS-mitoGFP\u003c/em\u003e d10 n = 14, and d30 n = 10, and \u003cem\u003edaGS\u0026gt; UAS-mitoGFP, UAS-Park\u003c/em\u003e d10 n = 12, and d30 n = 17 hemithoraxes.\u0026nbsp; d10 uninduced vs d30 uninduced ****p \u0026lt; 0.0001; d30 uninduced vs d30 induced *p = 0.0426.\u0026nbsp; Ordinary one-way ANOVA test with Sidak’s multiple comparisons test.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ej)\u0026nbsp; \u003c/strong\u003eStatistical quantification of dsDNA foci outside of the mitochondria as shown in k. \u003cem\u003ew\u003c/em\u003e\u003csup\u003e\u003cem\u003e1118\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e, daGS\u0026gt; UAS-mitoGFP\u003c/em\u003e d10 n = 10, and d30 n = 8, and d45 n = 8, and \u003cem\u003edaGS\u0026gt; UAS-mitoGFP, UAS-DRP1\u003c/em\u003e d45 n = 9 hemithoraxes.\u0026nbsp; d10 vs d30 *p = 0.0222; d10 vs d45 ****p \u0026lt; 0.0001; d30 vs d45 **p = 0.0015; d45 vs d45 induced *p = 0.0453.\u0026nbsp; Ordinary one-way ANOVA test with Sidak’s multiple comparisons test.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ek)\u0026nbsp; \u003c/strong\u003eRepresentative images (data point in yellow in j) of immunofluorescence staining of indirect flight muscles from young (day 10), middle-aged (day 30), and old (day 45) \u003cem\u003ew\u003c/em\u003e\u003csup\u003e\u003cem\u003e1118\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e, daGS\u0026gt; UAS-mitoGFP \u003c/em\u003eand\u003cem\u003e daGS\u0026gt; UAS-mitoGFP, UAS-DRP1 \u003c/em\u003eflies with RU486-mediated transgene induction from day 3 onwards for \u003cem\u003edaGS\u0026gt; UAS-mitoGFP \u003c/em\u003eand from day 30 to 45 for \u003cem\u003edaGS\u0026gt; UAS-mitoGFP, UAS-DRP1\u003c/em\u003e, showing dsDNA (red channel, anti-dsDNA) and mitochondria (green channel, anti-GFP).\u0026nbsp; Scale bar 5mm.\u0026nbsp; Arrows indicate dsDNA staining outside mitochondria.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003el-m)\u0026nbsp; \u003c/strong\u003eqPCR analysis of mtDNA levels in the cytosolic fraction compared to nuclei in \u003cem\u003edaGS\u0026gt; UAS-Park \u003c/em\u003efemale flies in thoraxes (l) and heads (m), with or without RU486-mediated transgene induction from day 3 to 30.\u0026nbsp; \u003cstrong\u003el)\u003c/strong\u003e d10 uninduced n = 5, d30 uninduced n = 5, d10 induced n = 5, and d30 induced n = 5 biological replicates with 20 thoraxes per replicate.\u0026nbsp; d30 uninduced vs d30 induced ****p \u0026lt; 0.0001.\u0026nbsp; Ordinary one-way ANOVA test with Sidak’s multiple comparisons test.\u0026nbsp; \u003cstrong\u003em)\u003c/strong\u003e d10 uninduced n = 5, d30 uninduced n = 5, d10 induced n = 5, and d30 induced n = 5 biological replicates with 25 heads per replicate.\u0026nbsp; d10 uninduced vs d30 uninduced **p = 0.0091; d30 uninduced vs d30 induced ****p \u0026lt; 0.0001.\u0026nbsp; Ordinary one-way ANOVA test with Sidak’s multiple comparisons test.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003en-o)\u0026nbsp; \u003c/strong\u003eqPCR analysis of mtDNA levels in the cytosolic fraction compared to nuclei in \u003cem\u003edaGS\u0026gt; UAS-DRP1 \u003c/em\u003eflies in thoraxes (n) and heads (o), with or without RU486-mediated transgene induction from day 30 to 45.\u0026nbsp; \u003cstrong\u003en)\u003c/strong\u003e d10 uninduced n = 5, d30 uninduced n = 5, d37 uninduced n = 5, and d37 induced n = 5 biological replicates with 20 thoraxes per replicate.\u0026nbsp; d10 uninduced vs d37 uninduced **p = 0.0081; d37 uninduced vs d37 induced ***p = 0.0004.\u0026nbsp; Ordinary one-way ANOVA test with Sidak’s multiple comparisons test.\u0026nbsp; \u003cstrong\u003eo)\u003c/strong\u003e d10 uninduced n = 5, d30 uninduced n = 5, d10 uninduced n = 5, and d30 induced n = 5 biological replicates with 25 heads per replicate.\u0026nbsp; d10 uninduced vs d37 uninduced ***p = 0.0002; d37 uninduced vs d37 induced ****p \u0026lt; 0.0001.\u0026nbsp; Ordinary one-way ANOVA test with Sidak’s multiple comparisons test.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eRU486 or vehicle was provided in the media at a concentration of 25 mg/ml for panels a, b, c, d, j, k, j, n, and o; and 5 mg/ml for panels h, i, l, and m in the indicated treatment groups. Ethanol was used as control vehicle. Data are presented as scatter plots overlaying mean values +/− SEM.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-7634140/v1/14d127186efcc72b79c0938a.png"},{"id":93397982,"identity":"3aff8c10-4cea-4250-9eb0-ff90a3f8b67d","added_by":"auto","created_at":"2025-10-13 11:59:00","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":2490302,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eUpregulation of nuclease gene activity during aging prolongs healthspan.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea)\u003c/strong\u003e\u0026nbsp; Representative images (data point in yellow in b) of immunofluorescence staining of indirect flight muscles from day 30, day 40, and day 50 \u003cem\u003ew\u003c/em\u003e\u003csup\u003e\u003cem\u003e1118\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e, daGS\u0026gt; UAS-mitoGFP \u003c/em\u003eand\u003cem\u003e daGS\u0026gt; UAS-mitoGFP, UAS-DNase II \u003c/em\u003efemale\u003cem\u003e \u003c/em\u003eflies with RU486-mediated transgene expression from day 3 onwards, showing dsDNA (red channel, anti-dsDNA) and mitochondria (green channel, anti-GFP).\u0026nbsp; Scale bar 5mm.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eb)\u003c/strong\u003e\u0026nbsp; Statistical quantification of dsDNA foci outside of the mitochondria as shown in a. Day 30 n = 12, day 40 n = 20, and day 50 n = 12 hemithoraxes in \u003cem\u003ew\u003c/em\u003e\u003csup\u003e\u003cem\u003e1118\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e, daGS\u0026gt; UAS-mitoGFP\u003c/em\u003e. Day 30 n = 15, day 40 n = 13, and day 50 n = 13 hemithoraxes in \u003cem\u003edaGS\u0026gt; UAS-mitoGFP, UAS-DNase II\u003c/em\u003e.\u0026nbsp; d30 uninduced vs d50 uninduced *p = 0.0311; d40 uninduced vs d40 induced **p = 0.0026; d50 uninduced vs d50 induced **p = 0.0022.\u0026nbsp; Ordinary one-way ANOVA test with Sidak’s multiple comparisons test.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ec)\u0026nbsp; \u003c/strong\u003eqPCR analysis of mtDNA levels in the cytosolic fraction compared to nuclei in \u003cem\u003edaGS\u0026gt; UAS-DNase II \u003c/em\u003eflies in thoraxes with or without RU486-mediated transgene induction from day 3 onwards.\u0026nbsp; d30 uninduced n = 5, d30 induced n = 7, d45 uninduced n = 5, and d45 induced n = 5 biological replicates with 20 thoraxes per replicate.\u0026nbsp; d30 uninduced vs d45 uninduced **p = 0.0011; d45 uninduced vs d45 induced **p = 0.0009.\u0026nbsp; Ordinary one-way ANOVA test with Sidak’s multiple comparisons test.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ed)\u0026nbsp; \u003c/strong\u003eSurvival curves of \u003cem\u003edaGS\u0026gt;UAS-DNase II\u003c/em\u003e females with or without RU486-mediated transgene induction from day 3 onward. See Table S1 for statistical analysis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ee)\u0026nbsp; \u003c/strong\u003ePercentage of flies with\u003cstrong\u003e \u003c/strong\u003eIntestinal barrier integrity loss during aging (Smurf assay) of \u003cem\u003edaGS\u0026gt; UAS-DNase II\u003c/em\u003e females with or without RU486-mediated transgene induction since day 3 onward. n = 300 flies on day 10.\u0026nbsp; d10 uninduced vs d80 uninduced ****p \u0026lt; 0.0001;\u0026nbsp; d30 uninduced vs d70 uninduced ***p = 0.001;\u0026nbsp; d30 uninduced vs d80 uninduced ****p \u0026lt; 0.0001;\u0026nbsp; d45 uninduced vs d70 uninduced ***p \u0026lt; 0.0009;\u0026nbsp; d45 uninduced vs d80 uninduced ****p \u0026lt; 0.0001;\u0026nbsp; d60 uninduced vs d70 uninduced *p = 0.0342;\u0026nbsp; d60 uninduced vs d80 uninduced * p = 0.0382;\u0026nbsp; d60 uninduced vs d80 uninduced ****p \u0026lt; 0.0001;\u0026nbsp; d70 uninduced vs d80 uninduced **p = 0.0011;\u0026nbsp; d80 uninduced vs d80 induced *p = 0.0204.\u0026nbsp; Ordinary one-way ANOVA test with Sidak’s multiple comparisons test.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ef)\u0026nbsp; \u003c/strong\u003ePerformance index in olfactory aversion training at day 45 in \u003cem\u003edaGS\u0026gt;UAS-DNase II\u003c/em\u003e female flies with or without RU486, assessed by the number of flies avoiding a shock-associated odor versus the total number of flies participating in the assay.\u0026nbsp; Uninduced n = 7 and induced n = 5 vials with at least 15 flies per vial.\u0026nbsp; **p = 0.0028.\u0026nbsp; Unpaired t-test.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eg)\u0026nbsp; \u003c/strong\u003eSpontaneous physical activity of 30-day-old \u003cem\u003edaGS\u0026gt; UAS-DNase II\u003c/em\u003e females with or without RU486-mediated transgene induction from day 3 to the day of the assay.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eh)\u003c/strong\u003e\u0026nbsp; Quantification of daytime physical activity of \u003cem\u003edaGS\u0026gt; UAS-DNase II \u003c/em\u003efemale flies with or without RU486 from day 3 to the day of the assay. Uninduced n = 3 and induced n = 3 vials with 10 flies per vial.\u0026nbsp; **p = 0.0016. Unpaired t-test.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ei)\u003c/strong\u003e\u0026nbsp; Climbing index as a measure of endurance of 30-day-old \u003cem\u003edaGS\u0026gt; UAS-DNase II\u003c/em\u003e female flies with or without RU486-mediated transgene induction from day 3 to day 30. Bottom represents the lower 1/3 of the cylinder, middle represents the middle 2/3 of the cylinder, and top represents the upper 1/3 of the cylinder. Uninduced n = 3 and induced n = 3 vials, with 3 vials containing at least 60 flies per vial.\u0026nbsp; Bottom uninduced vs induced **p = 0.0041; top uninduced vs induced **p = 0.0013.\u0026nbsp; 2-way ANOVA test with Sidak’s multiple comparisons test.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ej)\u003c/strong\u003e\u0026nbsp; Representative images (data point in yellow in k) of immunofluorescence staining of \u003cem\u003eDrosophila \u003c/em\u003ebrains (mushroom body) from day 45 \u003cem\u003ew\u003c/em\u003e\u003csup\u003e\u003cem\u003e1118\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e, elavGS\u0026gt; UAS-mitoGFP \u003c/em\u003eand\u003cem\u003e elavGS\u0026gt; UAS-mitoGFP, UAS-Sid \u003c/em\u003efemale\u003cem\u003e \u003c/em\u003eflies with RU486-mediated transgene expression from day 3 onwards, showing dsDNA (red channel, anti-dsDNA) and mitochondria (green channel, anti-GFP).\u0026nbsp; Scale bar 2mm.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ek)\u0026nbsp; \u003c/strong\u003eStatistical quantification of dsDNA foci outside of the mitochondria, as shown in a.\u0026nbsp; Uninduced n = 14 and induced n = 15 brains.\u0026nbsp; Uninduced vs induced **p = 0.0296.\u0026nbsp; Unpaired t-test.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003el)\u0026nbsp; \u003c/strong\u003eqPCR analysis of mtDNA levels in the cytosolic fraction compared to nuclei in \u003cem\u003eelavGS\u0026gt; UAS-Sid \u003c/em\u003eflies in heads with or without RU486-mediated transgene induction from day 3 onwards.\u0026nbsp; d30 uninduced n = 5, d30 induced n = 5, d45 uninduced n = 5, and d45 induced n = 5 biological replicates with 25 heads per replicate.\u0026nbsp; d30 uninduced vs d45 uninduced ***p = 0.0002; d45 uninduced vs d45 induced **p = 0.0036.\u0026nbsp; Ordinary one-way ANOVA test with Sidak’s multiple comparisons test.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003em)\u0026nbsp; \u003c/strong\u003eSurvival curves of \u003cem\u003eelavGS\u0026gt; UAS-Sid \u003c/em\u003efemales with or without RU486-mediated transgene induction from day 3 onward. See Table S2 for statistical analysis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003en)\u0026nbsp; \u003c/strong\u003ePerformance index in olfactory aversion training in 45-day-old \u003cem\u003eelavGS\u0026gt;UAS-Sid \u003c/em\u003efemale flies with or without RU486, assessed by the number of flies avoiding a shock-associated odor versus the total number of flies participating in the assay.\u0026nbsp; Uninduced n = 7 and induced n = 7 vials with at least 15 flies per vial.\u0026nbsp; Uninduced vs induced *p = 0.0442.\u0026nbsp; Unpaired t-test.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e0)\u0026nbsp; \u003c/strong\u003eSpontaneous physical activity of 45-day-old \u003cem\u003eelavGS\u0026gt; UAS-Sid \u003c/em\u003efemales with or without RU486-mediated transgene induction from day 3 to the day of the assay.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eq)\u003c/strong\u003e\u0026nbsp; Quantification of daytime physical activity of \u003cem\u003eelavGS\u0026gt; UAS-Sid \u003c/em\u003efemale flies with or without RU486 from day 3 to the day of the assay.\u0026nbsp; Uninduced n = 3 and Induced n = 3 vials with 10 flies per vial.\u0026nbsp; Uninduced vs induced ****p \u0026lt; 0.0001.\u0026nbsp; Unpaired t-test.\u003c/p\u003e\n\u003cp\u003eRU486 or vehicle was provided in the media at a concentration of 25 mg/ml in the indicated treatment groups.\u0026nbsp; Data are presented as scatter plots overlaying mean values +/− SEM.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-7634140/v1/0bc76238dd5e1683aa9e99e5.png"},{"id":93397983,"identity":"28827953-d693-40d1-8196-4e7aa63a4705","added_by":"auto","created_at":"2025-10-13 11:59:00","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1198297,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMitophagy and nuclease activity counteract NF-κB-like proinflammatory signaling in aged flies.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea) \u003c/strong\u003eqPCR analysis of \u003cem\u003eAttA\u003c/em\u003e levels in \u003cem\u003edaGS\u0026gt; UAS-Park \u003c/em\u003efemale flies in heads with or without RU486-mediated transgene induction from day 3 onwards. d10 uninduced n = 5, d10 induced n = 5, d30 uninduced n = 5, and d30 induced n = 5 biological replicates with 10 heads per replicate. d10 uninduced vs d30 uninduced ***p = 0.0002; d30 uninduced vs d30 induced **p = 0.0065. Ordinary one-way ANOVA test with Sidak’s multiple comparisons test.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eb) \u003c/strong\u003eqPCR analysis of \u003cem\u003eAttA\u003c/em\u003e levels in \u003cem\u003edaGS\u0026gt; UAS-DRP1 \u003c/em\u003efemale flies in heads with or without RU486-mediated transgene induction from day 3 onwards. d10 uninduced n = 5, d28 uninduced n = 5, d37 uninduced n = 5, and d37 induced n = 5 biological replicates with 10 heads per replicate. d28 vs d30 uninduced **p = 0.0045; d10 vs d37 uninduced ****p \u0026lt; 0.0001; d37 uninduced vs d37 induced ****p \u0026lt; 0.0001. Ordinary one-way ANOVA test with Sidak’s multiple comparisons test.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ec) \u003c/strong\u003eqPCR analysis of \u003cem\u003eAttA\u003c/em\u003e levels in \u003cem\u003edaGS\u0026gt; UAS-DNase II \u003c/em\u003efemale flies in heads with or without RU486-mediated transgene induction from day 3 onwards. d30 uninduced n = 5, d30 uninduced n = 5, d45 uninduced n = 5, and d45 induced n = 5 biological replicates with 10 heads per replicate. d30 uninduced vs d45 uninduced **p = 0.0024; d45 uninduced vs d45 induced *p = 0.0133. Ordinary one-way ANOVA test with Sidak’s multiple comparisons test.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ed) \u003c/strong\u003eqPCR analysis of \u003cem\u003eAttA\u003c/em\u003e levels in \u003cem\u003eelavGS\u0026gt; UAS-Sid \u003c/em\u003efemale\u003cem\u003e \u003c/em\u003eflies in heads with or without RU486-mediated transgene induction from day 3 onwards. d30 uninduced n = 5, d30 uninduced n = 5, d45 uninduced n = 4, and d45 induced n = 4 biological replicates with 10 heads per replicate. d30 uninduced vs d45 uninduced ****p \u0026lt; 0.0001; d45 uninduced vs d45 induced ***p = 0.0005. Ordinary one-way ANOVA test with Sidak’s multiple comparisons test.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ee) \u003c/strong\u003eWestern blot detection of Rel-49 levels of day 45 \u003cem\u003edaGS\u0026gt; UAS-DNase II \u003c/em\u003efemale flies in heads with or without RU486-mediated transgene induction. GAPDH was used as a loading control.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ef)\u003c/strong\u003e Western blot quantification of Rel-49 levels as shown in e. Uninduced n = 5, induced n = 4 biological replicates with 10 heads per sample. d45 uninduced vs d45 induced *p = 0.0318. Unpaired t-test.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eg) \u003c/strong\u003eWestern blot detection of Rel-49 levels of day 45 \u003cem\u003eelavGS\u0026gt; UAS-Sid \u003c/em\u003efemale flies in heads with or without RU486-mediated transgene induction. GAPDH was used as a loading control.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eh)\u003c/strong\u003e Western blot quantification of Rel-49 levels as shown in g. Uninduced n = 5, induced n = 5 biological replicates with 10 heads per sample. d45 uninduced vs d45 induced ***p = 0.0009. Unpaired t-test.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ei) \u003c/strong\u003eRepresentative images (data point in yellow in j) of immunofluorescence staining of \u003cem\u003eDrosophila \u003c/em\u003ebrains (optic lobe) from day 45 \u003cem\u003edaGS\u0026gt; UAS-DNase II \u003c/em\u003efemale flies, showing EYA (green channel, anti-EYA), Relish (red channel, anti-Rel-N), and nuclei (blue channel, DAPI). Scale bar 5mm.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ej)\u003c/strong\u003e Statistical quantification of Rel expression as shown in i. Uninduced\u003cem\u003e \u003c/em\u003en = 13 and induced n = 14 brains. d45 Unpaired vs d45 induced ****p \u0026lt; 0.0001. Unpaired t-test.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ek)\u003c/strong\u003e Statistical quantification of Eya expression as shown in i. Uninduced\u003cem\u003e \u003c/em\u003en = 13 and induced n = 14 brains. d45 Unpaired vs d45 induced ***p = 0.0001. Unpaired t-test.\u003c/p\u003e\n\u003cp\u003eRU486 or vehicle was provided in the media at a concentration of 25 mg/ml for all panels except panel a, where the RU486 was 5 mg/ml, in the indicated treatment groups. Data are presented as scatter plots overlaying mean values +/− SEM.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-7634140/v1/428e21ac71e257da3418d0c7.png"},{"id":93398257,"identity":"96116876-f0af-4412-8c33-e19dc8beb9ab","added_by":"auto","created_at":"2025-10-13 12:07:00","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1258423,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNeuronal inhibition of EYA during aging prolongs healthspan.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea) \u003c/strong\u003eRepresentative images (data point in yellow in b and c) of immunofluorescence staining of \u003cem\u003eDrosophila \u003c/em\u003ebrain (optic lobe) from day 45 \u003cem\u003eelavGS\u0026gt; UAS-eya RNAi \u003c/em\u003efemale\u003cem\u003e \u003c/em\u003eflies with RU486-mediated transgene expression from day 3 onwards, showing Eya (green channel, anti-Eya), Relish (red channel, anti-Rel-N), and nuclei (blue channel, DAPI). Scale bar 10 mm.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eb) \u003c/strong\u003eQuantification\u003cstrong\u003e \u003c/strong\u003eof\u003cstrong\u003e \u003c/strong\u003eEYA intensity levels as shown in a. Uninduced n = 11 and induced n =12 brains. ***p = 0.0002. Unpaired t-test.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ec) \u003c/strong\u003eQuantification\u003cstrong\u003e \u003c/strong\u003eof\u003cstrong\u003e \u003c/strong\u003eRel-49 intensity levels as shown in a. Uninduced n = 12 and induced n =11 brains. **p = 0.0022. Unpaired t-test.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ed) \u003c/strong\u003eqPCR analysis of \u003cem\u003eAttA\u003c/em\u003e levels in \u003cem\u003eelavGS\u0026gt; UAS-eya RNAi \u003c/em\u003efemale flies in heads with or without RU486-mediated transgene induction from day 3 onwards. Uninduced n = 8 and induced n = 8 biological replicates with 10 heads per replicate. **p = 0.0030. Unpaired t-test.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ee) \u003c/strong\u003eWestern blot detection of Rel-49 levels of day 45 \u003cem\u003eelavGS\u0026gt; UAS-eya RNAi \u003c/em\u003efemale flies in heads with or without RU486-mediated transgene induction. GAPDH was used as a loading control.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ef)\u003c/strong\u003e Western blot quantification of Rel-49 levels as shown in e. Uninduced n = 5, induced n = 5 biological replicates with 10 heads per sample. *p = 0.0320. Unpaired t-test.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eg)\u003c/strong\u003e Survival curves of \u003cem\u003eelavGS\u0026gt; UAS-eya RNAi \u003c/em\u003efemales with or without RU486-mediated transgene induction from day 3 onward. See Table S4 for statistical analysis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eh)\u003c/strong\u003e Percentage of flies with\u003cstrong\u003e \u003c/strong\u003eIntestinal barrier integrity loss during aging (Smurf assay) of \u003cem\u003eelavGS\u0026gt; UAS-eya RNAi\u003c/em\u003e females with or without RU486-mediated transgene induction since day 3 onward. n = 300 flies on day 10. d10 uninduced vs d30 uninduced ***p = 0.0001; d10 uninduced vs d45 uninduced ****p \u0026lt; 0.0001; d30 uninduced vs d45 uninduced ****p \u0026lt; 0.0001; d45 uninduced vs d45 induced ** p = 0.0019. Ordinary one-way ANOVA test with Sidak’s multiple comparisons test.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ei) \u003c/strong\u003eSpontaneous physical activity of 30-day-old \u003cem\u003eelavGS\u0026gt; UAS-eya RNAi \u003c/em\u003efemale flies with or without RU486-mediated transgene induction from day 3 to the day of the assay.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ej)\u003c/strong\u003e Quantification of daytime physical activity of \u003cem\u003eelavGS\u0026gt; UAS-eya RNAi \u003c/em\u003efemale flies with or without RU486 from day 3 to the day of the assay. Uninduced n = 3 and Induced n = 3 vials with 10 flies per vial. ****p \u0026lt; 0.0001. Unpaired t-test.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ek)\u003c/strong\u003e Climbing index as a measure of endurance of 30-day-old \u003cem\u003eelavGS\u0026gt; UAS-eya RNAi\u003c/em\u003e female flies with or without RU486-mediated transgene induction from day 3 to day 30. Bottom represents the lower 1/3 of the cylinder, middle represents the middle 2/3 of the cylinder, and top represents the upper 1/3 of the cylinder. Uninduced n = 3 and induced n = 3 vials with 3 vials with at least 60 flies per vial. middle uninduced vs induced **p = 0.0083; top uninduced vs induced **p = 0.0018. 2-way ANOVA test with Sidak’s multiple comparisons test.\u003c/p\u003e\n\u003cp\u003eRU486 or vehicle was provided in the media at a concentration of 50 mg/ml in the indicated treatment groups. Data are presented as scatter plots overlaying mean values +/− SEM.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-7634140/v1/97d04c7d686bfad30c99f44b.png"},{"id":93397988,"identity":"39dfdf07-ea7c-44d4-bb8c-7a280b716d82","added_by":"auto","created_at":"2025-10-13 11:59:00","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":2362854,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNeuronal inhibition of EYA slows hallmarks of brain aging.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea) \u003c/strong\u003eRepresentative images (data point in yellow in b) of immunofluorescence staining of \u003cem\u003eDrosophila \u003c/em\u003ebrain from day 10 and 30 \u003cem\u003eelavGS\u0026gt; UAS-eya RNAi \u003c/em\u003efemale\u003cem\u003e \u003c/em\u003eflies with or without RU486-mediated transgene expression from day 3 onwards, showing Bruchpilot (gray channel, anti-nc82). Scale bar 50 mm.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eb) \u003c/strong\u003eQuantification\u003cstrong\u003e \u003c/strong\u003eof\u003cstrong\u003e \u003c/strong\u003eBrp expression as shown in a. d10 Uninduced n = 8, d10 induced n = 10, d30 uninduced n = 9, and d30 induced n = 10 brains. d10 uninduced vs d30 uninduced ****p \u0026lt; 0.0001; d30 uninduced vs d30 induced ****p \u0026lt; 0.0001. Ordinary one-way ANOVA test with Sidak’s multiple comparisons test.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ec)\u003c/strong\u003e Performance index in olfactory aversion training in 45-day-old \u003cem\u003eelavGS\u0026gt; UAS-eya RNAi \u003c/em\u003efemale flies with or without RU486, assessed by the number of flies avoiding a shock-associated odor versus the total number of flies participating in the assay. Uninduced n = 5 and induced n = 6 vials with more than 10 flies per vial. Uninduced vs induced *p = 0.0225. Unpaired t-test.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ed) \u003c/strong\u003eRepresentative images (data point in yellow in e) of immunofluorescence staining\u003cstrong\u003e \u003c/strong\u003eof \u003cem\u003eDrosophila \u003c/em\u003ebrain from day 45 \u003cem\u003eelavGS\u0026gt; UAS-eya RNAi\u003c/em\u003e female flies with or without RU-486-mediated transgene expression from day 3 onwards, showing mitochondria (green channel, a-ATP5a), and nuclei (red channel, To-Pro-3). Scale bar 5 mm.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ee) \u003c/strong\u003eQuantification\u003cstrong\u003e \u003c/strong\u003eof\u003cstrong\u003e \u003c/strong\u003eATP5a amount as shown in a. Uninduced n = 11 and induced n = 15 brains. Uninduced vs induced **p = 0.0021. Unpaired t-test.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ef) \u003c/strong\u003eRepresentative images (data point in yellow in g) of immunofluorescence staining of \u003cem\u003eDrosophila \u003c/em\u003ebrain from day 45 \u003cem\u003eelavGS\u0026gt; UAS-eya RNAi \u003c/em\u003efemale\u003cem\u003e \u003c/em\u003eflies with or without RU486-mediated transgene expression from day 3 onwards, showing mitochondrial membrane potential (red channel, TMRE). Scale bar 5 mm.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eg) \u003c/strong\u003eQuantification\u003cstrong\u003e \u003c/strong\u003eof\u003cstrong\u003e \u003c/strong\u003eTMRE expression as shown in c. Uninduced n = 11 and induced n =15 brains. Uninduced vs induced **p = 0.0028. Unpaired t-test.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eh) \u003c/strong\u003eRepresentative images (data point in yellow in i) of immunofluorescence staining of \u003cem\u003eDrosophila \u003c/em\u003ebrains from young (d10), middle (30), and old (d45) age \u003cem\u003eelavGS, GFP-mCherry-Atg8a\u0026gt; UAS-eya-RNAi \u003c/em\u003efemale flies with or without RU486-mediated transgene expression from day 3 onwards, showing autophagosomes (green and red channel), and autolysosomes (red channel). Scale bar 10 mm.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ei) \u003c/strong\u003eQuantification\u003cstrong\u003e \u003c/strong\u003eof\u003cstrong\u003e \u003c/strong\u003eautolysosome number as shown in e. d10 uninduced n = 6, d10 induced n = 11, d30 uninduced n = 11, d30 induced n =14, d45 uninduced n = 11, d45 n= 13 brains. d45 uninduced vs d45 induced *p = 0.0134. Ordinary one-way ANOVA test with Sidak’s multiple comparisons test.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ej) \u003c/strong\u003eRepresentative images (data point in yellow in j) of immunofluorescence staining of \u003cem\u003eDrosophila \u003c/em\u003ebrain from day 45 \u003cem\u003eelavGS\u0026gt; UAS-eya RNAi \u003c/em\u003efemale\u003cem\u003e \u003c/em\u003eflies with or without RU486-mediated transgene expression from day 3 onwards, showing ubiquitin aggregates (green channel, anti-FK2) and nuclei (blue channel, DAPI). Scale bar 10 mm.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ek) \u003c/strong\u003eQuantification\u003cstrong\u003e \u003c/strong\u003eof\u003cstrong\u003e \u003c/strong\u003eFK2 aggregate size as shown in g. Uninduced n = 11 and induced n = 7 brains. Uninduced vs induced *p = 0.0366. Unpaired t-test.\u003c/p\u003e\n\u003cp\u003eRU486 or vehicle was provided in the media at a concentration of 50 mg/ml in the indicated treatment groups. Data are presented as scatter plots overlaying mean values +/− SEM.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-7634140/v1/16c3d8f8c6c30e4be4e2b20f.png"},{"id":93399714,"identity":"ddd939f5-f5e8-49f8-9a2d-77319e62e113","added_by":"auto","created_at":"2025-10-13 12:23:07","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":12812591,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7634140/v1/f5a47b96-be4b-4311-a706-1cdbe99b8d88.pdf"},{"id":93397980,"identity":"05b01f25-0fa0-4c79-8c86-85f8daa155fc","added_by":"auto","created_at":"2025-10-13 11:59:00","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":557924,"visible":true,"origin":"","legend":"Supplementary figure 3","description":"","filename":"SupFig3.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7634140/v1/bfbc36dbb68b96b15ee96dab.pdf"},{"id":93397985,"identity":"9c72df6b-944a-444e-b23d-a68eb517c769","added_by":"auto","created_at":"2025-10-13 11:59:00","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":653646,"visible":true,"origin":"","legend":"Supplementary figure 2","description":"","filename":"SupFig2.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7634140/v1/70a5c8fc445299cb5b8a9b51.pdf"},{"id":93397979,"identity":"0b4f35b4-d311-4e88-981b-1a6068af757c","added_by":"auto","created_at":"2025-10-13 11:59:00","extension":"pdf","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":40076,"visible":true,"origin":"","legend":"Supplementary table s4","description":"","filename":"Tables4.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7634140/v1/b82f60d8d05add2df8717cc1.pdf"},{"id":93397990,"identity":"63d358db-4747-477a-8f55-e52506da4769","added_by":"auto","created_at":"2025-10-13 11:59:00","extension":"pdf","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":5714118,"visible":true,"origin":"","legend":"Supplementary figure 1","description":"","filename":"SupFig1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7634140/v1/636021a2123662930a269a77.pdf"},{"id":93398258,"identity":"e54bf8f5-4dad-4d6b-8e74-fbfa558072e1","added_by":"auto","created_at":"2025-10-13 12:07:00","extension":"pdf","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":44531,"visible":true,"origin":"","legend":"Supplementary table s3","description":"","filename":"TableS3.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7634140/v1/969c1142286f44cdc0038a34.pdf"},{"id":93399484,"identity":"4875e87f-5fa0-456d-a31d-f84c016bb01f","added_by":"auto","created_at":"2025-10-13 12:15:00","extension":"pdf","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":45002,"visible":true,"origin":"","legend":"Supplementary table s2","description":"","filename":"Tables2.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7634140/v1/18f7f128abf989b3d9ecfc6b.pdf"},{"id":93398261,"identity":"aab39f77-deb4-49f4-9197-5ffa7c380d48","added_by":"auto","created_at":"2025-10-13 12:07:00","extension":"pdf","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":11447929,"visible":true,"origin":"","legend":"Supplementary figure 4","description":"","filename":"SupFig4.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7634140/v1/ccfc448d4a093896b71fac6a.pdf"},{"id":93397993,"identity":"2b0efceb-5281-49e0-bab8-6ea03d43115b","added_by":"auto","created_at":"2025-10-13 11:59:00","extension":"pdf","order_by":8,"title":"","display":"","copyAsset":false,"role":"supplement","size":12782596,"visible":true,"origin":"","legend":"Supplementary figure 5","description":"","filename":"SupFig5.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7634140/v1/10d0d72d43fcccbd8c88e50a.pdf"},{"id":93398262,"identity":"bbe7f2a7-8e47-49a6-8bd6-0169d7fa9e3c","added_by":"auto","created_at":"2025-10-13 12:07:00","extension":"pdf","order_by":9,"title":"","display":"","copyAsset":false,"role":"supplement","size":43711,"visible":true,"origin":"","legend":"Supplementary table s1","description":"","filename":"Tables1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7634140/v1/08c5dacc186379b254a27262.pdf"}],"financialInterests":"\u003cb\u003eYes\u003c/b\u003e there is potential Competing Interest.\nD.W.W reports a relationship of board membership with Amway Scientific Advisory Board","formattedTitle":"Cytosolic mtDNA and associated EYA-mediated pro-inflammatory signaling modulate healthspan in Drosophila","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe accumulation of dysfunctional mitochondria and persistent pro-inflammatory responses are each key hallmarks of aging\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. Indeed, it is widely accepted that chronic inflammation, which has been called \u0026lsquo;inflammaging\u0026rsquo;\u003csup\u003e2\u003c/sup\u003e, contributes to the pathogenesis of age-related diseases limiting healthspan\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e,\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. Potential mechanisms of inflammaging include changes to gut microbiota composition, intestinal barrier dysfunction, and chronic infections\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e,\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. In addition, it is now apparent that sterile inflammation occurs in the absence of microorganisms and is typically associated with the recognition of intracellular debris released from damaged cells or organelles (also known as damage-associated molecular patterns; DAMPs)\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e,\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. As mitochondrial dysfunction and inflammation are shared features of aging, it is interesting to speculate that mitochondrial-derived DAMPs may play a prominent role in inflammaging\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e,\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. In support of this model, it is well-established that mitochondrial damage or dysfunction can lead to the release of mitochondrial DNA (mtDNA) which can activate innate immunity\u003csup\u003e\u003cspan additionalcitationids=\"CR12 CR13 CR14 CR15 CR16\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e. While the release of mtDNA from mitochondria is well established, the mechanisms allowing transfer to the cytosol are less clear\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. There is an emerging understanding, however, that decreased mitochondrial membrane potential and increased mitochondrial permeability regulate the release of mtDNA into the cytosol\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. On entering the cytoplasm, mtDNA can activate a plethora of different cytoplasmic DNA sensors and innate immune responses, including the cGAS/STING pathway, to trigger pro-inflammatory responses contributing to inflammatory pathology\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eAutophagy is a catabolic process in which cytoplasmic contents, including nucleic acids and organelles, are delivered to lysosomes for degradation\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. A number of studies have reported that autophagy and/or mitochondrial autophagy (mitophagy) can restrain the innate immune response\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e,\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e,\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e. Mechanistically, there have been several reports that reveal an important role for autophagy/mitophagy in preventing the accumulation of cytosolic mtDNA-mediated inflammation\u003csup\u003e\u003cspan additionalcitationids=\"CR22 CR23\" citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. A key concept that emerges from these studies is that mitophagy ensures the removal of damaged mitochondria and can, therefore, counteract the release of mtDNA into the cytosol and resulting inflammatory responses\u003csup\u003e\u003cspan additionalcitationids=\"CR23\" citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. Furthermore, it has been shown that deletion of DNase II, which degrades mtDNA in the autophagy-lysosome system, predisposes to heart failure and cardiac inflammation in rodents\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. Cytosolic mtDNA escaping from lysosomal degradation has also been shown to induce cytotoxicity in cultured cells and Parkinson\u0026rsquo;s disease phenotypes \u003cem\u003ein vivo\u003c/em\u003e\u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e. Recent studies have found that aging corresponds with the buildup of cytosolic mtDNA in certain cell types, such as rodent retinal cells, microglia, and \u003cem\u003eDrosophila\u003c/em\u003e flight muscle\u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e,\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. Although the accumulation of cytosolic mtDNA has been linked to brain aging, retinal aging, and neurodegeneration\u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e,\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e, a causal role for cytosolic mtDNA in organismal aging and lifespan determination is not well established. More specifically, experimental data showing that strategies to eliminate cytosolic mtDNA can slow organismal aging and/or prolong healthspan are lacking.\u003c/p\u003e\u003cp\u003eIn this study, we have examined the role of cytosolic mtDNA and associated pro-inflammatory signaling in lifespan and healthspan determination. We show that there is an accumulation of cytosolic mtDNA in aging muscle and brain tissue of \u003cem\u003eDrosophila\u003c/em\u003e. Inducing mitophagy, including in middle-aged flies, prevents the age-onset accumulation of cytosolic mtDNA. Critically, we show that upregulation of either DNase II or Stress Induced DNase (SID)\u003csup\u003e\u003cspan additionalcitationids=\"CR29\" citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e can ameliorate cytosolic mtDNA accumulation during aging and prolong lifespan and healthspan. We also show that decreasing cytosolic DNA levels during aging, via DNase II or SID overexpression, dampens NF-κB-like proinflammatory signaling in aged flies. Recent work has shown that targeting the immune sensing of DNA, by inhibiting cGAS/STING signaling pathway, can reduce inflammation and improve tissue function in aged mice\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. The Rel/NF-κB-binding protein EYA has also been shown to induce an innate immune response against cytosolic DNA in both flies and mammals\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e,\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e. However, the question of whether EYA contributes to age-onset inflammation and/or limits healthspan has not been addressed. We show that inhibiting EYA in aging neurons counteracts primary hallmarks of aging, as well as preventing synaptic aging and age-onset cognitive decline, leading to prolonged organismal healthspan. Our findings reveal that upregulation of nuclease activities, or inhibiting the immune sensing of DNA in neurons, during aging can prolong organismal health and longevity.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eMitophagy counteracts cytosolic mtDNA accumulation in aged flies\u003c/h2\u003e\u003cp\u003eRecent studies have reported an accumulation of cytosolic mtDNA in retinal cells and microglia of rodents\u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e,\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e, and flight muscle of flies\u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. To validate and expand upon these findings, we used both immunofluorescence (IF) and qPCR-based approaches to examine cytosolic mtDNA levels in different tissues of aging \u003cem\u003eDrosophila\u003c/em\u003e. We began by analyzing the accumulation of dsDNA in aging indirect flight muscles. Confocal analysis showed extramitochondrial dsDNA accumulation in aged flies compared to young flies (Supplementary Fig.\u0026nbsp;1a and quantification in b). To validate that the dsDNA antibody labels mtDNA we stained muscle of \u003cem\u003edaGS\u0026thinsp;\u0026gt;\u0026thinsp;UAS-mitoGFP\u003c/em\u003e flies with antibodies against the mitochondrial transcription factor A (TFAM) and dsDNA. IF analysis shows that TFAM colocalizes with dsDNA antibody in young and old flies (Supplementary Fig.\u0026nbsp;1d). To expand our analysis, we adapted an IF staining approach using selective and specific permeabilization of cellular membranes to detect cytosolic dsDNA\u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e. As this approach does not permeabilize mitochondria, it only allows detection of cytosolic DNA. Using this approach, we observed an age-related increase in dsDNA in muscle from young flies (day 20) to old flies (day 60) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea and quantification in b). Next, we sought to determine if cytosolic dsDNA accumulates in fly brain tissue. As in humans, \u003cem\u003eDrosophila\u003c/em\u003e olfactory perception declines as a function of aging\u003csup\u003e\u003cspan additionalcitationids=\"CR35\" citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e. The mushroom body is a key structure for olfactory learning and memory, so we examined whether cytosolic dsDNA accumulates in the cytosol of mushroom body neurons. Confocal analysis showed dsDNA accumulation in aged mushroom body neurons compared to young flies (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec and quantification in 1d). To confirm that cytosolic mtDNA accumulates during aging, we analyzed the levels of mtDNA-encoded genes in the cytosol of young (day 10), middle-aged (day 30), and old (day 45) wild type flies in whole flies, thoraxes, and heads by qPCR after cellular fractionation. First, we validated the fractionation approach using antibodies against mitochondrial proteins (Supplementary Fig.\u0026nbsp;1c). Using this fractionation approach, we found that the levels of the mtDNA-encoded genes COI (Citrate Oxidase I) and ND2 (mitochondrial NADH-ubiquinone oxidoreductase chain 2) were increased in the cytosolic fraction of old flies (day 45) versus young flies (day 10) in whole flies, heads and thoraxes (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ee-g, and Supplementary Fig.\u0026nbsp;1e and f). To determine whether the accumulation of cytosolic mtDNA was linked to an overall increase in mtDNA in aged flies, we analyzed the levels of total mtDNA in heads and thoraxes of wild-type flies. Interestingly, we observed a slight increase in total mtDNA levels in fly heads at day 30, followed by a decrease at day 45 (Supplementary Fig.\u0026nbsp;1h). We did not detect any variation in the levels of total mtDNA in thoraxes of wild type flies at any of the time points analyzed (Supplementary Fig.\u0026nbsp;1h). Together, these results demonstrate that mtDNA accumulates in the cytosol of \u003cem\u003eDrosophila\u003c/em\u003e neurons and indirect flight muscles during aging.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eWe hypothesized that stimulating mitophagy may be an effective approach to counteract the accumulation of cytosolic mtDNA during aging. Indeed, recent work has reported that treating mice with Urolithin A, which can induce mitophagy, reduces cytosolic DNA in aged retinal cells\u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e. Hence, we examined the ability of mitophagy induction to counteract cytosolic mtDNA accumulation in aged flies. The E3 ubiquitin ligase Parkin is known to play a key role in mitochondrial quality control and mitophagy\u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. Overexpression of Parkin can extend lifespan in flies\u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e and delay hallmarks of aging in several tissues and cell types in mammals\u003csup\u003e\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e. In addition, we have shown that promoting dynamin-related protein 1 (Drp1)-mediated mitochondrial fission in midlife facilitates mitophagy and prolongs fly lifespan\u003csup\u003e\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e. Hence, we analyzed the accumulation of cytosolic mtDNA during aging in \u003cem\u003eParkin\u003c/em\u003e and \u003cem\u003eDrp1\u003c/em\u003e overexpressing flies and controls. We used the well-characterized \u003cem\u003eDrosophila\u003c/em\u003e Gene-Switch system\u003csup\u003e\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e,\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e to overexpress Parkin and DRP1 in adult flies. This system allows both spatial and temporal control of the expression of the transgene of interest and the comparison of flies from the same cohort, since the only difference between control (uninduced) and experimental (induced) flies is the presence of the activator agent (RU486) or the diluent (ethanol). First, we examined, by IF, if ubiquitous overexpression of \u003cem\u003eParkin\u003c/em\u003e or \u003cem\u003eDRP1\u003c/em\u003e could reduce the accumulation of dsDNA in flight muscle of old flies. As shown in wild type flies, control \u003cem\u003edaGS\u0026thinsp;\u0026gt;\u0026thinsp;UAS-Parkin\u003c/em\u003e or \u003cem\u003edaGS\u0026thinsp;\u0026gt;\u0026thinsp;UAS-DRP1\u003c/em\u003e flies accumulate dsDNA in the cytosol of aged muscle (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eh and k and quantification in i and j, respectively). Remarkably, 30 days of \u003cem\u003eParkin\u003c/em\u003e or 2 weeks of \u003cem\u003eDrp1\u003c/em\u003e induction from midlife reduce the age-associated accumulation of dsDNA (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eh and k and quantification in i and j, respectively). To validate our findings, we analyzed the levels of cytosolic mtDNA in aged flies with and without \u003cem\u003eParkin\u003c/em\u003e or \u003cem\u003eDRP1\u003c/em\u003e induction in heads and thoraxes by cellular fractionation and qPCR. mtDNA accumulates in the cytosolic fraction of \u003cem\u003edaGS\u0026thinsp;\u0026gt;\u0026thinsp;UAS-Parkin\u003c/em\u003e and \u003cem\u003edaGS\u0026thinsp;\u0026gt;\u0026thinsp;UAS-DRP1\u003c/em\u003e control flies in heads and thoraxes (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003el-o, and Supplementary Fig.\u0026nbsp;1i-l). Importantly, 30 days of \u003cem\u003eParkin\u003c/em\u003e or one-week of \u003cem\u003eDrp1\u003c/em\u003e overexpression from midlife decreases the levels of the cytosolic mtDNA in heads and thoraxes of aged flies (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003el-o, and Supplementary Fig.\u0026nbsp;1i-l). RU486 treatment does not have any effect on cytosolic mtDNA levels during aging in control flies (Supplementary Fig.\u0026nbsp;1m). Together, these results show that mitophagy induction reduces the accumulation of cytosolic mtDNA in aged brain and flight muscles.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eUpregulation of nuclease gene activity during aging prolongs healthspan\u003c/h3\u003e\n\u003cp\u003eTo gain insight into the importance of cytosolic mtDNA accumulation during aging, we set out to determine whether interventions that reduce the levels of cytosolic DNA could be beneficial for organismal healthspan. First, we analyzed the expression levels of two enzymes with DNA degradation activity during aging: DNase II and Stress induced DNase (Sid). DNase II is a lysosomal enzyme that degrades DNA within the autolysosome\u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e,\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e. Sid is an evolutionarily conserved enzyme that degrades both single and double-stranded DNA/RNA\u003csup\u003e28\u003c/sup\u003e. First, we analyzed the expression profile of \u003cem\u003eDNase II\u003c/em\u003e and \u003cem\u003eSid\u003c/em\u003e in heads and thoraxes of wild type flies. \u003cem\u003eDNase II\u003c/em\u003e mRNA levels do not change in heads or thoraxes of wild type flies during aging (Supplementary Fig.\u0026nbsp;2a and b). However, qPCR analysis shows that \u003cem\u003eSid\u003c/em\u003e transcript levels decrease in heads of wild type flies with age but does not vary in thoraxes (Supplementary Fig.\u0026nbsp;2h and i). To investigate the potential role of DNase II and Sid in degrading cytosolic mtDNA, we generated DNase II and Sid transgenic flies. We used the Gene-Switch system to overexpress \u003cem\u003eDNase II\u003c/em\u003e and \u003cem\u003eSid\u003c/em\u003e with the ubiquitous driver \u003cem\u003edaughterless-GS\u003c/em\u003e (\u003cem\u003edaGS\u003c/em\u003e) and the neuronal specific driver \u003cem\u003eelavGS\u003c/em\u003e, respectively. First, we validated the expression of the transgenes in thoraxes of \u003cem\u003edaGS\u0026thinsp;\u0026gt;\u0026thinsp;UAS-DNase II\u003c/em\u003e and heads of \u003cem\u003eelavGS\u0026thinsp;\u0026gt;\u0026thinsp;UAS-Sid\u003c/em\u003e flies. \u003cem\u003eDNase II\u003c/em\u003e levels were upregulated by approximately 4-fold in thoraxes of young, middle, and old-age \u003cem\u003edaGS\u0026thinsp;\u0026gt;\u0026thinsp;UAS-DNase II\u003c/em\u003e overexpressing flies (Supplementary Fig.\u0026nbsp;2c). \u003cem\u003eSid\u003c/em\u003e mRNA transcripts were upregulated by approximately 4-fold at day 30 and 6-fold at day 45 (Supplementary Fig.\u0026nbsp;2j). Next, we analyzed the accumulation of cytosolic dsDNA in \u003cem\u003eDNase II\u003c/em\u003e and \u003cem\u003eSid\u003c/em\u003e overexpressing flies by using selective and specific cellular membrane permeabilization, without permeabilizing mitochondria. Upregulation of \u003cem\u003eDNase II\u003c/em\u003e reduces the cytosolic dsDNA accumulation in aged muscles (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea and quantification in b). In a complementary approach, we analyzed by cellular fractionation and qPCR analysis the levels of mtDNA-encoded genes in the cytosol of \u003cem\u003eDNase II\u003c/em\u003e overexpressing flies. \u003cem\u003eDNase II\u003c/em\u003e upregulation resulted in a reduction in mtDNA levels in the cytosol of thoraxes and heads on day 45 as compared to controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec, and Supplementary Fig.\u0026nbsp;2d-f). Moreover, we found that neuronal \u003cem\u003eSid\u003c/em\u003e induction reduces the age-associated accumulation of cytosolic dsDNA at day 45 in \u003cem\u003eDrosophila\u003c/em\u003e mushroom body neurons (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ej and quantification in k). Finally, we quantified the levels of cytosolic mtDNA genes by qPCR in \u003cem\u003eSid\u003c/em\u003e overexpressing flies. Figure\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e shows that cytosolic mtDNA accumulates in \u003cem\u003eelavGS\u0026thinsp;\u0026gt;\u0026thinsp;UAS-Sid\u003c/em\u003e control flies and that neuronal \u003cem\u003eSid\u003c/em\u003e upregulation reduces by 50% the age-associated cytosolic mtDNA accumulation on day 45 as compared to control flies (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003el, and Supplementary Fig.\u0026nbsp;2k). These results demonstrate that induction of either of these DNA degrading enzymes reduces the age-associated accumulation of cytosolic mtDNA.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo characterize the effects of \u003cem\u003eDNase II\u003c/em\u003e and \u003cem\u003eSid\u003c/em\u003e induction on \u003cem\u003eDrosophila\u003c/em\u003e health, we analyzed the longevity of \u003cem\u003edaGS\u0026thinsp;\u0026gt;\u0026thinsp;UAS-DNase II\u003c/em\u003e and \u003cem\u003eelavGS\u0026thinsp;\u0026gt;\u0026thinsp;UAS-Sid\u003c/em\u003e female flies. Ubiquitous upregulation of \u003cem\u003eDNase II\u003c/em\u003e or neuronal \u003cem\u003eSid\u003c/em\u003e induction each extends \u003cem\u003eDrosophila\u003c/em\u003e median lifespan in several trials (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ed and m, and Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003es1\u003c/span\u003e and s2). Next, we examined whether nuclease-mediated lifespan extension is associated with improvements in healthspan. First, we determined whether \u003cem\u003eDNase II\u003c/em\u003e induction improves intestinal barrier integrity during aging. Loss of intestinal barrier integrity is a well characterized evolutionarily conserved pathophysiological hallmark of aging associated with inflammation, frailty, and mortality\u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. In \u003cem\u003eDrosophila\u003c/em\u003e, intestinal barrier dysfunction can be quantified by the \u0026ldquo;Smurf assay\u0026rdquo;\u003csup\u003e43,44\u003c/sup\u003e. Remarkably, we observed that \u003cem\u003eDNase II\u003c/em\u003e induction delays the loss of intestinal barrier integrity in aged flies (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ee). To assess if \u003cem\u003eDNase II\u003c/em\u003e and \u003cem\u003eSid\u003c/em\u003e induction could improve brain function in aged flies, we tested associative learning and memory using olfaction aversion training\u003csup\u003e\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u003c/sup\u003e. Briefly, \u003cem\u003eDNase II\u003c/em\u003e and \u003cem\u003eSid\u003c/em\u003e overexpressing flies were exposed to a neutral odor (3-octanol, OCT) with a series of electric shocks. After one hour of rest, flies were placed in a T-maze and allowed to choose between OCT and a second neutral odor (4-methylcyclohexanol). Aged \u003cem\u003eDNase II\u003c/em\u003e and \u003cem\u003eSid\u003c/em\u003e overexpressing flies perform better than their age-matched control flies in this assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ef and n). Next, we set out to determine if \u003cem\u003eDNase II\u003c/em\u003e and \u003cem\u003eSid\u003c/em\u003e overexpressing flies showed improved locomotor activity and climbing ability. First, we analyzed spontaneous activity during 24 hours of \u003cem\u003edaGS\u0026thinsp;\u0026gt;\u0026thinsp;UAS-DNase II\u003c/em\u003e and \u003cem\u003eelavGS\u0026thinsp;\u0026gt;\u0026thinsp;UAS-Sid\u003c/em\u003e overexpressing flies. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, ubiquitous \u003cem\u003eDNase II\u003c/em\u003e and neuronal \u003cem\u003eSid\u003c/em\u003e induction increased daytime activity without affecting sleep compared to their respective age-matched controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eg, h, o, and p, respectively). Second, we analyzed endurance exercise paradigm in \u003cem\u003edaGS\u0026thinsp;\u0026gt;\u0026thinsp;DNase II\u003c/em\u003e overexpressing flies. We observed that upregulation of DNase II improves \u003cem\u003eDrosophila\u003c/em\u003e endurance when compared with age-matched control flies (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ei). Importantly, RU486 treatment does not extend \u003cem\u003eDrosophila\u003c/em\u003e lifespan (Supplementary Fig.\u0026nbsp;2g). Together, these results show that ubiquitous \u003cem\u003eDNase II\u003c/em\u003e or neuronal \u003cem\u003eSid\u003c/em\u003e overexpression can prolong healthspan.\u003c/p\u003e\n\u003ch3\u003eMitophagy and nuclease activity counteract NF-κB-like proinflammatory signaling in aged flies\u003c/h3\u003e\n\u003cp\u003eTo explore the interplay between age-associated cytosolic mtDNA accumulation and the immune response in aged flies, we set out to examine the impact of \u003cem\u003eParkin\u003c/em\u003e and \u003cem\u003eDRP1\u003c/em\u003e upregulation on immune-related gene expression. Consistent with previous reports\u003csup\u003e\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e,\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u003c/sup\u003e, aged control flies present higher levels of expression of the antimicrobial peptide (AMP) \u003cem\u003eAttacinA\u003c/em\u003e (\u003cem\u003eAttA\u003c/em\u003e) compared to young flies (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea and b and Supplementary Fig.\u0026nbsp;3a and d). Interestingly, whole life \u003cem\u003eParkin\u003c/em\u003e overexpression or one-week \u003cem\u003eDrp1\u003c/em\u003e induction from midlife ameliorates the immune response in heads and thoraxes from old flies (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea and b, and Supplementary Fig.\u0026nbsp;3a and d). To seek further evidence for the role of mitophagy in age-onset immune activation, we analyzed the expression levels of \u003cem\u003eTurandot A\u003c/em\u003e (\u003cem\u003eTotA\u003c/em\u003e), another polypeptide gene also activated after bacterial and DNA viral infection\u003csup\u003e\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u003c/sup\u003e. First, we analyzed the expression of \u003cem\u003eTotA\u003c/em\u003e in aged heads and thoraxes of \u003cem\u003edaGS\u0026thinsp;\u0026gt;\u0026thinsp;UAS-Parkin\u003c/em\u003e and \u003cem\u003edaGS\u0026thinsp;\u0026gt;\u0026thinsp;UAS-DRP1\u003c/em\u003e uninduced flies. \u003cem\u003eTotA\u003c/em\u003e mRNA transcript levels increase from young to aged flies in heads and thoraxes (Supplementary Fig.\u0026nbsp;3b, c, e, and f). Upon whole life \u003cem\u003eParkin\u003c/em\u003e or one-week \u003cem\u003eDRP1\u003c/em\u003e induction from midlife \u003cem\u003eTotA\u003c/em\u003e mRNA transcript levels decreased in middle-aged flies (Supplementary Fig.\u0026nbsp;3b, c, e, and f, respectively). These results demonstrate that stimulating mitophagy, which reduces cytosolic mtDNA, ameliorates the activation of the immune response in old flies.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo test if cytosolic DNA degradation can reduce age-onset immune activation in \u003cem\u003eDrosophila\u003c/em\u003e, we analyzed the mRNA transcript levels of \u003cem\u003eAttA\u003c/em\u003e and \u003cem\u003eTotA\u003c/em\u003e during aging in \u003cem\u003eDNase II\u003c/em\u003e and \u003cem\u003eSid\u003c/em\u003e overexpressing flies and controls. Interestingly, ubiquitous \u003cem\u003eDNase II\u003c/em\u003e induction reduces the transcript levels of \u003cem\u003eAttA\u003c/em\u003e and \u003cem\u003eTotA\u003c/em\u003e in heads and thoraxes of aged flies as compared to age-matched control flies (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec and Supplementary Fig.\u0026nbsp;3g-i). Moreover, neuronal \u003cem\u003eSid\u003c/em\u003e upregulation ameliorates the activation of the immune response related genes \u003cem\u003eAttA\u003c/em\u003e and \u003cem\u003eTotA\u003c/em\u003e in aged heads as compared to vehicle fed control flies (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ed and Supplementary Fig.\u0026nbsp;3j).\u003c/p\u003e\u003cp\u003eCytosolic DNA is recognized by the conserved \u003cem\u003eeya\u003c/em\u003e gene via its threonine phosphatase motif\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e,\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e. EYA recognizes cytosolic DNA and interacts with the NF-κB-like transcription factor Relish that induces the expression of immune-related genes, including antimicrobial peptides (AMPs)\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e,\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e\u003c/sup\u003e. Relish is a compound protein with two domains, an N-terminal Rel Homology Domain (RHD), and a C-terminal IkB-like region. Rel activation requires an endoproteolytic cleavage and the translocation of the RHD domain to the nucleus\u003csup\u003e\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e\u003c/sup\u003e. To further investigate the role of age-associated cytosolic DNA accumulation in immune response activation, we examined by western blotting the levels of the transcription factor Relish (Rel) upon ubiquitous \u003cem\u003eDNase II\u003c/em\u003e and neuronal \u003cem\u003eSid\u003c/em\u003e upregulation. Ubiquitous \u003cem\u003eDNase II\u003c/em\u003e or neuronal \u003cem\u003eSid\u003c/em\u003e upregulation reduces the levels of nuclear Rel (Rel-49) in heads of aged flies (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ee and g, and quantification in f and h, respectively). Moreover, we analyzed, by IF, Rel levels in brains of \u003cem\u003eDNase II\u003c/em\u003e overexpressing and control flies. We saw a striking reduction in Rel protein levels in aged fly brains upon whole life \u003cem\u003eDNase II\u003c/em\u003e upregulation as compared to age-matched control flies (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ei and quantification in j). Using \u003cem\u003edaGS\u0026thinsp;\u0026gt;\u0026thinsp;UAS-DNase II\u003c/em\u003e flies, we examined the relationship between DNase II and EYA in aged flies by IF. Remarkably, DNase II upregulation decreases EYA levels in aged brains as compared to control flies (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ei and quantification in 3k). Overall, our data indicate that age-associated cytosolic mtDNA accumulation triggers the activation of the immune response in aged flies, and that its reduction ameliorates the expression of immune response-related genes.\u003c/p\u003e\n\u003ch3\u003eNeuronal inhibition of EYA during aging prolongs healthspan\u003c/h3\u003e\n\u003cp\u003eTo better understand the potential role of EYA in aging, we analyzed \u003cem\u003eeya\u003c/em\u003e transcript levels in young (day 10), middle-aged (day 28 and 35), and old (day 42) wild type flies. \u003cem\u003eeya\u003c/em\u003e mRNA levels increase more than 4-fold from young to middle-aged and old flies and decrease by 37 percent after day 35 in wild type heads (Supplementary Fig.\u0026nbsp;4a). We also analyzed the \u003cem\u003eeya\u003c/em\u003e mRNA levels in thoraxes and showed that \u003cem\u003eeya\u003c/em\u003e transcript levels slightly increase from day 10 to day 35 and 42 (Supplementary Fig.\u0026nbsp;4b). Since, \u003cem\u003eeya\u003c/em\u003e transcript levels increase dramatically in heads of aged flies, we examined whether \u003cem\u003eeya\u003c/em\u003e neuronal knockdown could ameliorate the activation of the immune response in aged fly heads. First, we validated that RNAi against \u003cem\u003eeya\u003c/em\u003e inhibits the expression of EYA protein in aged flies. Confocal analysis shows that EYA protein levels decrease in \u003cem\u003eelavGS\u0026thinsp;\u0026gt;\u0026thinsp;UAS-eya-RNAi\u003c/em\u003e induced flies as compared to uninduced control flies (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea and quantification in b). Next, we found that neuronal downregulation of \u003cem\u003eeya\u003c/em\u003e decreases \u003cem\u003eAttA\u003c/em\u003e mRNA transcript levels in aged fly heads (day 45) compared to control flies and shows a trend towards a reduction in \u003cem\u003eTotA\u003c/em\u003e mRNA transcript levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ed and Supplementary Fig.\u0026nbsp;4c). To seek evidence that EYA regulates the immune response through its interaction with Rel, we set out to examine the protein levels of Rel in heads of \u003cem\u003eeya\u003c/em\u003e neuronal knockdown flies. Interestingly, neuronal inhibition of \u003cem\u003eeya\u003c/em\u003e reduces Rel protein levels in brains of aged flies (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea and quantification in c, and 4e and quantification in f). Importantly, neuronal \u003cem\u003eeya\u003c/em\u003e knockdown does not change cytosolic mtDNA levels in old flies (Supplementary Fig.\u0026nbsp;4d). Together, these results demonstrate that EYA contributes to age-onset neuroinflammation.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo deepen our understanding of the role of EYA in aging, we set out to analyze the healthspan of \u003cem\u003eeya\u003c/em\u003e neuronal knockdown flies. In the first place, we examined the lifespan of \u003cem\u003eelavGS\u0026thinsp;\u0026gt;\u0026thinsp;UAS-eya-RNAi\u003c/em\u003e flies and observed that neuronal \u003cem\u003eeya\u003c/em\u003e knockdown prolongs \u003cem\u003eDrosophila\u003c/em\u003e lifespan in several trials (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eg and Supplementary Table \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003es3\u003c/span\u003e). Importantly, \u003cem\u003eeya\u003c/em\u003e neuronal downregulation improves intestinal barrier function (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eh), spontaneous activity (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ei and j), and endurance exercise capacity (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ek). Collectively, these data reveal that neuronal \u003cem\u003eeya\u003c/em\u003e downregulation extends \u003cem\u003eDrosophila\u003c/em\u003e lifespan, delays age-onset intestinal pathology and improves healthspan.\u003c/p\u003e\n\u003ch3\u003eNeuronal inhibition of EYA slows hallmarks of brain aging\u003c/h3\u003e\n\u003cp\u003eAge-related memory impairment (AMI) is associated with alterations in neuronal physiology; more specifically in synaptic connectivity\u003csup\u003e\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e,\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e\u003c/sup\u003e. Studies in \u003cem\u003eDrosophila\u003c/em\u003e have shown that an increase in the size of the pre-synaptic active zone is associated with a decline in memory and sleep disruption\u003csup\u003e\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e,\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e\u003c/sup\u003e. \u003cem\u003eDrosophila\u003c/em\u003e, as well as other insects, shares high levels of homology in the design and function of the olfactory nervous system with mammals. Bruchpilot (BRP) shows homology to the active zone human protein ELKS/CAST/ERC\u003csup\u003e55\u003c/sup\u003e. It has been demonstrated that aging increases the active zone structure and the expression of the active zone protein BRP\u003csup\u003e\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e\u003c/sup\u003e. Here, to better characterize the effect of \u003cem\u003eeya\u003c/em\u003e knockdown on synaptic aging, we analyzed the levels of BRP in \u003cem\u003eeya\u003c/em\u003e knockdown flies and controls. Importantly, as previously reported\u003csup\u003e\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e\u003c/sup\u003e, we saw an increase in BRP protein levels in control middle-aged (day 30) flies when compared with young control flies (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea and quantification in b, and Supplementary Fig.\u0026nbsp;5a). Interestingly, aged brains with reduced levels of EYA showed a reduction in BRP at day 30 when compared with age-matched control flies (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea and quantification in b, and Supplementary Fig.\u0026nbsp;5a). Next, we examined whether neuronal EYA activity contributes to cognitive decline during aging. Remarkably, neuronal inhibition of EYA improves performance in the olfactory aversion training assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ec). These results indicate that neuronal \u003cem\u003eeya\u003c/em\u003e knockdown suppresses age-related memory impairment and delays synaptic aging.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eIn recent years, significant attention has been focused on the cellular hallmarks of aging\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e, including hallmarks of brain aging\u003csup\u003e\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e\u003c/sup\u003e. To provide a mechanistic understanding of how neuronal inhibition of EYA slows brain aging, we examined several key cellular hallmarks of aging. In the first place, we examined the impact of neuronal \u003cem\u003eeya\u003c/em\u003e knockdown on markers of mitochondrial homeostasis. We have previously shown that dysfunctional mitochondria accumulate in aged fly brain tissue\u003csup\u003e\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e,\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e\u003c/sup\u003e. Importantly, we find that neuronal \u003cem\u003eeya\u003c/em\u003e downregulation decreases mitochondrial content in aged brains as compared to controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ed and quantification in e). Next, we set out to examine the impact of neuronal \u003cem\u003eeya\u003c/em\u003e inhibition on mitochondrial activity during aging, using the mitochondrial membrane potential potentiometric dye TMRE (tetramethylrhodamine, ethyl ester). We observed that \u003cem\u003eeya\u003c/em\u003e downregulation in neurons significantly improves mitochondrial membrane potential in aged brains (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ef and quantification in g). Together, these data show that neuronal EYA activity compromises mitochondrial homeostasis during brain aging.\u003c/p\u003e\u003cp\u003eDisabled autophagy and loss of protein homeostasis (proteostasis) are thought to be primary hallmarks of aging, which unambiguously drive the aging process\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. Hence, we next sought to determine whether neuronal \u003cem\u003eeya\u003c/em\u003e downregulation could improve autophagy and/or proteostasis in aged \u003cem\u003eDrosophila\u003c/em\u003e brains. To evaluate autophagic activity in the aging brain, we used a reporter line expressing GFP-mCherry-Atg8a (\u0026ldquo;Atg8a-tandem\u0026rdquo;) ubiquitously under the control of the endogenous Atg8a promoter\u003csup\u003e\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e\u003c/sup\u003e. As autophagosomes fuse with lysosomes, GFP signal on the Atg8a tandem protein is quenched due to its sensitivity to low pH. Remaining mCherry-only foci indicate autolysosomal activity. Using this approach, we find that neuronal \u003cem\u003eeya\u003c/em\u003e inhibition results in a significant increase in autolysosomes in aged brains (day 45) compared to control flies (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eh and quantification in i as shown in Supplementary Fig.\u0026nbsp;5b). To examine the impact of \u003cem\u003eeya\u003c/em\u003e knockdown on protein homeostasis, we analyzed the accumulation of protein aggregates in aged brains of neuronal \u003cem\u003eeya\u003c/em\u003e knockdown flies and controls. IF microscopy analysis shows that brains with reduced levels of EYA present smaller ubiquitin-containing protein aggregates (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ej and quantification in k, and Supplementary Fig.\u0026nbsp;5c and quantification in d). Together, our results indicate that neuronal \u003cem\u003eeya\u003c/em\u003e inhibition improves proteostasis and autophagy in aged \u003cem\u003eDrosophila\u003c/em\u003e brains, two of the major primary hallmarks of aging.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eStudies in both vertebrate and invertebrate models have shown that mitophagy can counteract aging and prolong lifespan\u003csup\u003e\u003cspan additionalcitationids=\"CR39\" citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e,\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e,\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e,\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e\u003c/sup\u003e. These observations strongly support a model in which dysfunctional mitochondria, within aged cells, drive pathology and limit lifespan. Yet, a clear understanding of the mechanisms that underlie age-onset health decline upon mitochondrial dysfunction is lacking. Recent work has shown that mitophagy can dampen age-onset cGAS/STING-driven neuroinflammation in mice\u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e. Moreover, treatment with STING inhibitors can reduce age-associated neuroinflammation and improve cognition\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. Together, these findings support a model in which cytosolic DNA, originating from dysfunctional mitochondria, accumulates in certain aged brain cells, driving cGAS/STING mediated-neuroinflammation and disrupting neurological function. Here, we have extended these findings to show that cytosolic mtDNA accumulates broadly in fly brains, muscle tissue and whole bodies. Moreover, we provide direct evidence that cytosolic DNA and associated pro-inflammatory signaling limits organismal lifespan and healthspan. We show that genetic induction of nuclease activities can dampen age-onset inflammation and prolong organismal healthspan. Critically, we show that inducing DNase II or Sid reduces cytosolic mtDNA levels in aged flies. It should be noted, however, that we cannot exclude the possibility that the nuclease-mediated degradation of additional nucleic acids could contribute to observed phenotypes.\u003c/p\u003e\u003cp\u003eThe finding that the cGAS/STING signaling pathway is a critical driver of neurodegenerative processes during aging\u003csup\u003e\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e\u003c/sup\u003e raises the question of whether additional interventions targeting the immune sensing of DNA can counteract aging-related pathophysiology. In addition to the Toll receptor and the Toll signaling pathway, the \u003cem\u003eDrosophila\u003c/em\u003e immune response is regulated by another evolutionarily conserved signaling cascade, the immune deficiency (Imd) pathway, which activates Relish/NF-κB\u003csup\u003e63\u003c/sup\u003e. The fly EYA protein acts in a cascade that senses undigested cytosolic DNA and activates the immune response by binding to the I-kappa-B kinase beta (IKKβ), component of the IKK phosphorylation complex that phosphorylates Relish, and Relish\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. We show that neuronal inhibition of EYA dampens age-onset Relish/NF-κB activity, slows several markers of brain aging and prolongs organismal lifespan. As mammalian EYA4 enhances the innate immune responses against DNA by activating NF-κB\u003csup\u003e32\u003c/sup\u003e, it stands to reason that EYA4 represents an attractive target to slow brain aging and prolong healthspan in mammals. A challenge to consider, in this regard, is that while interventions that reduce the immune sensing of DNA may promote healthspan in laboratory animals, there could be detrimental consequences outside of a laboratory setting.\u003c/p\u003e\u003cp\u003eOne of the major findings from our study is that inhibiting EYA in aging neurons ameliorates a number of hallmarks of brain aging, including disabled autophagy which has been designated as a primary hallmark of aging\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e,\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e\u003c/sup\u003e. Our data doesn\u0026rsquo;t refute the idea that disabled autophagy precedes cytosolic mtDNA accumulation and associated pro-inflammatory signaling during aging. Rather, the simplest interpretation of our findings is that neuronal EYA activity, in response to cytosolic DNA, exacerbates autophagy impairments in aged cells. In turn, disabled autophagy has been shown to contribute to synaptic aging and age-onset cognitive decline\u003csup\u003e\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e,\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e\u003c/sup\u003e. Hence, a plausible interpretation of our findings is that EYA activity in aging neurons drives cognitive decline via disabled autophagy. We show that neuronal inhibition of EYA counteracts NF-κB-like proinflammatory signaling in aged brains. Previous studies have shown that, under certain conditions, NF-\u003cem\u003eκ\u003c/em\u003eB signaling activates the expression of autophagy inhibitors and represses activators of autophagy\u003csup\u003e\u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e\u003c/sup\u003e. Hence, our working hypothesis is that reduced NF-κB-like proinflammatory signaling in aged brains, upon neuronal EYA inhibition, leads to improved brain autophagy. Antimicrobial peptides (AMPs) often target the cellular membrane or cell wall of gram-positive and gram-negative bacteria, viruses, and fungi and have different mechanisms of action including membrane permeabilization\u003csup\u003e\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e\u003c/sup\u003e. Mitochondrial and bacterial membranes share some similarities like lipid composition\u003csup\u003e\u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e\u003c/sup\u003e. These similarities could make the mitochondrial membrane a suitable target for AMPs. Recent studies have demonstrated that AMPs change mitochondrial membrane permeability and induce apoptosis\u003csup\u003e\u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e\u003c/sup\u003e. It is possible, therefore, that reduced AMP levels in response to EYA inhibition may lead to improved mitochondrial homeostasis in aged brains. Future work could focus on finding ways to dampen NF-κB-like proinflammatory signaling in aged brains without compromising pathogen susceptibility.\u003c/p\u003e"},{"header":"Materials \u0026 Methods","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\u003ch2\u003eFly Stocks\u003c/h2\u003e\u003cp\u003eThe fly strain \u003cem\u003eElav\u0026ndash;GeneSwitch\u003c/em\u003e (\u003cem\u003eelavGS\u003c/em\u003e) was provided by H. Keshishian (Yale University, New Haven, CT, USA). \u003cem\u003edaughterless-GeneSwitch\u003c/em\u003e (\u003cem\u003edaGS\u003c/em\u003e) was provided by H. Tricoire (Universite\u0026acute; Paris Diderot\u0026ndash;Paris7, Paris, France). \u003cem\u003eUAS-Parkin-HA\u003c/em\u003e (\u003cem\u003eUAS-Park\u003c/em\u003e) was provided by L. Pallanck (University of Washington, Seattle, WA, USA). \u003cem\u003eUAS-DRP1\u003c/em\u003e was provided by J. Chung (Korea Advanced Institute of Science and Technology, Republic of Korea). GFP-mCherry-Atg8a was provided by Eric Baehrecke (University of Massachusetts Medical School, Worcester, MA, USA). \u003cem\u003eUAS-eya RNAi\u003c/em\u003e (28733), \u003cem\u003esqh-mito-EYFP\u003c/em\u003e (7194), \u003cem\u003eUAS-mito-HA-GFP\u003c/em\u003e (8442), \u003cem\u003eUAS-mCD8::GFP\u003c/em\u003e (32185), and \u003cem\u003ew\u003c/em\u003e\u003csup\u003e\u003cem\u003e1118\u003c/em\u003e\u003c/sup\u003e (3605) were acquired from the Bloomington \u003cem\u003eDrosophila\u003c/em\u003e Stock Center.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eFly Husbandry and Lifespan Analysis\u003c/h2\u003e\u003cp\u003eFlies were reared in vials containing cornmeal medium (1% agar, 3% yeast, 1.9% sucrose, 3.8% dextrose, 9.1% cornmeal, 1.1% acid mix (41.8% Propionic acid plus 4.15% Phosphoric acid in vol/vol), and 1.5% methylparaben (10% methylparaben in ethanol), all concentrations given in wt/vol). Flies were collected under light nitrogen-induced anesthesia and housed at a density of 30 female flies per vial. All flies were kept in a humidified, temperature-controlled incubator with a 12 h on/off light cycle at 25\u0026deg;C. RU486 was dissolved in ethanol and administered in the media while preparing food. RU486 concentration is given in mg/mL in the figure legend for each treatment. Flies were flipped to fresh food containing vial every 2\u0026ndash;3 days and scored for death.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eTransgenic flies generation\u003c/h2\u003e\u003cp\u003e\u003cem\u003eUAS-Sid\u003c/em\u003e (UAS-CG9989) and \u003cem\u003eUAS-DNase II\u003c/em\u003e (UAS-CG7780) fly lines were generated by phiC31 integrase mediated transformations of flies harboring an intergenic attP site in chromosome 2R (\"attP33\")\u003csup\u003e68\u003c/sup\u003e with pUASTattB plasmids\u003csup\u003e\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e\u003c/sup\u003e edited with corresponding cDNA sequences. Sid cDNA was amplified from LP02841 (Drosophila Genomics Resource Center Stock 12973), DNAseII cDNA was amplified from GH10876 (DGRC Stock 6248) using standard PCR protocols. All plasmids were validated by sequencing prior to transformation. Cloning primers (utilizing a SfiI recognition sequence: sid_F-CGCAGGGCCGGACGGGCCAGATGCCCGATCTGAAGTATATG, sid_R- CGCAGGGCCCCAGTGGCCCAAATACCACTTTATATTTATTTTAATATGC, DNase II_F- CGCAGGGCCGGACGGGCCCAACTTGAAGGTTGTACAATGCG, DNase II_R- CGCAGGGCCCCAGTGGCCCAATTTTCTTATGCATTAAATGTAATGC.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003eSpontaneous Physical Activity Assay\u003c/h2\u003e\u003cp\u003e10 adult female flies were placed in a \u003cem\u003eDrosophila\u003c/em\u003e activity monitor (TriKinetics). Movements were recorded continuously every 30s under normal culturing conditions for 36 h on a 12 h:12 h dark:light cycle. Bar graphs represent mean activity per fly per hour, and the scatterplot shows spontaneous activity per fly during a 12 h:12 h dark:light cycle. Triplicate samples were used for each activity measurement.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003eClimbing Activity Assay\u003c/h2\u003e\u003cp\u003eAt least 60 adult female flies were placed in a 100 mL glass cylinder. Cylinders were tapped quickly, and flies were allowed to settle for 1 min. This step was repeated 8 times. Then the cylinder was tapped quickly and after 1 min, the number of flies in the upper, middle, and lower 1/3rd parts of the cylinder was recorded.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003eIntestinal Barrier Dysfunction Assay (Smurf Assay)\u003c/h2\u003e\u003cp\u003eIntestinal barrier dysfunction was performed as previously described in\u003csup\u003e44\u003c/sup\u003e Rera et al. (2012). Flies were aged in normal or RU486 containing food until the day of the assay. The day before the assay, flies were transferred to new vials containing standard medium with 2.5% wt/vol F\u0026amp;D blue dye # 1 (SPS Alfachem) and Ethanol for control flies or RU486 for experimental flies. Flies were kept in this medium for at least 16 hours. Flies with dye coloration outside the gut were counted as flies with loss of gut integrity (Smurf fly).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003eOlfactory Training\u003c/h2\u003e\u003cp\u003eAversion training was performed with modifications as described in\u003csup\u003e45\u003c/sup\u003e Malik et al. (2014) using a system from MazeEngineers (Conduct Science). Briefly, flies were exposed under low red-light conditions to a neutral odor (3-octanol OCT) by air pump in a training chamber for one minute in a series of twelve 65-V and 0.2 mA electrical-shocks for 1.25s followed by 3.75s of rest. Flies recovered for one hour before being placed in a T-maze with trained odor on one side and a second neutral odor (4-methylcyclohexanol, MCH) on the other side of the maze. After two minutes of exploration under red-light conditions, flies in either chamber of the maze were scored. Performance index was calculated by dividing the number of flies avoiding OCT by the number of participants (OCT\u0026thinsp;+\u0026thinsp;MCH flies).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003eCellular Fractionation and cytosolic and nuclear DNA isolation\u003c/h2\u003e\u003cp\u003eCellular fractionation was performed as described in\u003csup\u003e70\u003c/sup\u003e Mosley and Baker (2022) with modifications. Heads (25 heads) or thoraxes (20 thoraxes) were gently homogenized in 200 \u0026micro;L of cold Mitochondrial Isolation Medium (250 mM sucrose, 10 mM TrisHCl (pH 7.4), 0.15 mM MgCl2). Samples were spun for 5 seconds to remove fly debris and then spun at 15000Xg for 15 min. at 4\u0026deg;C for mitochondria and nuclei purification (nuclear and mitochondrial fraction). Supernatant (cytosolic fraction) was collected (170 mL) in a new 1.5 \u0026micro;L vial and pellet was resuspended in 100 \u0026micro;L Nuclear Isolation Medium (10 mM HEPES-KOH pH 7.5; 2.5 mM MgCl\u003csub\u003e2\u003c/sub\u003e; 10 mM KCl). Nuclei and cytosolic fraction were incubated with 1 \u0026micro;L of Proteinase K (10 mg/mL) (Fisher-Scientific, cat# BPI1700-100) for 1 hour at 55\u0026deg;C. Proteinase K was inactivated by incubating the samples for 10 min. at 95\u0026deg;C. One volume of phenol:chloroform:isoamyl alcohol (25:24:1) was added to each sample and shaken by hand thoroughly for approximately 20 seconds. Then, samples were spun at 16000Xg for 15 min at room temperature. The upper phase (aqueous phase) containing DNA was transferred to a new 1.5 mL vial, and 1 \u0026micro;L of glycogen, 0.5 volumes of NH\u003csub\u003e4\u003c/sub\u003eOAc, and 2.5 volumes (samples\u0026thinsp;+\u0026thinsp;NH\u003csub\u003e4\u003c/sub\u003eOAc) of EtOH were added. Samples were kept at -20\u0026deg;C overnight. The following day, samples were centrifuged at 15000Xg for 30 min. at 4\u0026deg;C. Pellet (DNA) was washed twice with 70% EtOH and resuspended in 20 \u0026micro;L of TE Buffer (1 mM EDTA \u0026amp; 10 mM PH 8 Tris-Cl). Cytosolic fraction was tested for mitochondria contamination by taking 10 \u0026micro;L each of the cytosolic and nuclear/mitochondria fraction and analyzing the samples by western blot against the mitochondrial protein VDAC1 and the cytosolic protein Actin (Supplementary Fig.\u0026nbsp;1A).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003eRNA Extraction, cDNA Synthesis and quantitative PCR (qPCR)\u003c/h2\u003e\u003cp\u003e10 heads or 5 thoraxes were homogenized in 100 \u0026micro;L of ice cold Trizol (Thermo Fisher Scientific cat# 15596018) for RNA extraction. Samples were incubated at room temperature for 10 min. Then, 20 \u0026micro;L of Chloroform (Millipore-Sigma cat# C2432-500ML) was added to the samples and shaken vigorously by hand for 20 seconds. Samples were incubated for another 10 min. at room temperature, then centrifuged at 12000Xg for 15 min. at 4\u0026deg;C. 45 \u0026micro;L of the upper phase, containing the RNA, was transferred to a new 1.5 mL vial. For head samples, 4.5 \u0026micro;L of 3.5 M Sodium Acetate (Fisher Scientific cat# R1181) and 2 \u0026micro;L of 20 mg/mL RNA Grade Glycogen (Fisher Scientific cat # R0551) were added to the samples. Then, 50 \u0026micro;L of Isopropyl Alcohol (Fisher Scientific cat# 02-003-133) was added to the samples and briefly vortexed to mix. Samples were spun at 12000Xg for 10 min. at 4\u0026deg;C. Pellet (RNA) was washed with 200 \u0026micro;L of 75% EtOH, air dried for 5 min, resuspended in 20 \u0026micro;L ddH20, and incubated at 55\u0026deg;C for 10 min.\u003c/p\u003e\u003cp\u003ecDNA synthesis was carried out using the First Strand cDNA Synthesis Kit from Thermo Fisher Scientific (cat# K1621, K1622). PCR was performed with PowerUP SYBR Green Master Mix (Ref#A25777, Applied Biosystems) on a BioRad Real Time PCR system. Cycling conditions were as follows: 95\u0026deg;C for 10 minutes; 95\u0026deg;C for 15 s then 60\u0026deg;C for 60 s, cycled 40 times, and equalized amplicons of Actin5C were used as a reference to normalize for cytosolic mitochondrial DNA, and GAPDH was used as a reference for gene expression analysis. Primers sequences used were as follows:\u003c/p\u003e\u003cp\u003eGAPDH_F: CTCCACCACAACTCGGCTC and GAPD_R: TAAATTCGACTCGACTCACGGT\u003c/p\u003e\u003cp\u003eAct5C_F: TTGTCTGGGCAAGAGGATCAG and Act5C_R: ACCACTCGCACTTGCACTTTC\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eCOI\u003c/strong\u003e\u003cp\u003e_F: GAATTAGGACATCCTGGAGC and COI_R: GCACTAATCAATTTCCAAATCC\u003c/p\u003e\u003c/p\u003e\u003cp\u003eND2_F: AAAAAGTGGAGCCGCTCC and ND2_R: GTTTGATTTAATCCTCCAATAGCTCC\u003c/p\u003e\u003cp\u003eDNase II_ F: AGGATGAAGCTGGAAACGATG and DNase II_R: CAGGTGTCATAGTTCTGGCTG\u003c/p\u003e\u003cp\u003eSid_F: TTCCATCTACAAGGCTTATCGC and Sid_R: TTGTGTTGCTCTTCCCTCG\u003c/p\u003e\u003cp\u003eEya_F: GTCAGCTCGGACGACAAT and Eya_R: GTGCCAACATTTCCACGATAG\u003c/p\u003e\u003cp\u003eAttA_F: CTCCTGCTGGAAAACATC and Atta_R: GCTCGTTTGGATCTGACC\u003c/p\u003e\u003cp\u003eTotA_F: CCCAGTTTGACCCCTGAG and TotA_R: GCCCTTCACACCTGGAGA\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003eWestern Blot\u003c/h2\u003e\u003cp\u003eHeads (10 heads per sample) were homogenized in 100 \u0026micro;L of Lysis Buffer (PBS 1X, Protease Inhibitors 1X, NuPAGE LDS Sample Buffer 1X, and DTT (Dithiothreitol) 0.05M). Samples were incubated for 5 min. at 95\u0026deg;C and centrifuged at 16000Xg for 5 min. at 4\u0026deg;C. 10 \u0026micro;L of samples were separated by SDS-PAGE gels, and proteins were transferred to Nitrocellulose membranes. Membranes were probed with antisera against: rabbit anti-GAPDH (Novus Biologicals cat# NB100-56875), mouse anti-actin peroxidase conjugated 1:15000 (Sigma cat# A3854), mouse anti-VDAC1/Porin 1:10000 (ab14734, Abcam), mouse anti-Relish-N 1:1000 (DSHB cat# 21F3). Anti-Rabbit or anti-Mouse Horseradish peroxidase conjugated antibodies were used for detection at a 1:10000 dilution. Amersham ECL Prime Western Blotting Detection Reagent (GE Life Sciences) was used to visualize the presence of horseradish peroxidase, and the chemiluminescent signal was recorded using Syngene Pxi Western Blot Imager. Image analysis was done using ImageJ.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003ch2\u003eMuscle and Brain Immunostaining\u003c/h2\u003e\u003cp\u003eFor muscle staining, flies were fixed in 3.7% formaldehyde in PBS for 20 minutes. After fixation, hemithoraxes were dissected and fixed again for 5 min. Brains were dissected directly in cold PBS and fixed in 3.7% formaldehyde in PBS for 20 min. at RT. For Brp staining, brains were dissected in saline medium (NaCl 103 mM, KCl 3 mM, TES 5 mM, trehalose 10 mM, glucose 10 mM, sucrose 7 mM, NaHCO\u003csub\u003e3\u003c/sub\u003e 26 mM, NaH\u003csub\u003e2\u003c/sub\u003ePO\u003csub\u003e4\u003c/sub\u003e 1 mM, CaCl\u003csub\u003e2\u003c/sub\u003e 1.5 mM, MgCl\u003csub\u003e2\u003c/sub\u003e 4 mM adjusted to 280 mOsm) and fixed in 3.7% formaldehyde in PBS for 20 min. at RT. Brains and hemithoraxes were then rinsed 3 times for 10 min. with 0.2% Triton X-100 in PBS (PBST) and blocked in 3% BSA in PBST (PBST-BSA) for 1 hour. Primary antibodies were diluted in PBST-BSA and incubated overnight at 4\u0026deg;C, except for Brp, which was incubated for more than 48 hours. Primary antibodies used were: mouse-anti-FK2 1:250 (04-263, Millipore Sigma); mouse-anti-ATP5A1 1:250 (ab14748, abcam); anti-EYA 1:10 (10H6, DSHB); anti-BRP 1:100 (nc82, DSHB); and anti-Relish-N 1:50 (RB 14-0024-20, RayBiotech). Hemithoraxes and brains were then rinsed 3 times in PBST for 10 min. and incubated with the secondary antibodies and/or stains at room temperature for 3 hours. Secondary antibodies used were: anti-rabbit or anti-mouse AlexaFluor-488 1:500 (Invitrogen); anti-rabbit or anti-mouse AlexaFluor-568 1:500 (Invitrogen); To-Pro-3 (1:1000, Invitrogen) or DAPI (300nM, Invitrogen) for DNA staining. Finally, samples were rinsed 3 times with PBST for 10 min. and mounted in Vectashield Mounting Medium (Vector Lab). Images were acquired using a Zeiss LSM 880 Airyscan Confocal Microscope.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\u003ch2\u003eMuscle and Brain Low Permeability Immunostaining\u003c/h2\u003e\u003cp\u003eLow permeability immunostaining was performed as described in\u003csup\u003e33\u003c/sup\u003e Sato et al. (2021) with modifications. For muscle staining, flies were fixed in fixation solution (3.7% formaldehyde in PBS) for 20 min. After fixation, hemithoraxes were dissected and fixed for another 2.5 hours in cold-ice fixation solution. For brain staining, flies were dissected directly in cold PBS and fixed for 2.5 hours in ice-cold fixation solution. After fixation, samples were washed 5 times in cold PBS on ice for 10 mins each. Brains and hemithoraxes were dehydrated using the following EtOH series solutions: 5%, 10%, 20%, 50%, 70%, and 100% for 5 min. each on ice. Samples were then washed once more with 100% EtOH for 10 min on ice and incubated in new 100% EtOH at -20\u0026deg;C overnight. The next day, brains and hemithoraxes were rehydrated in ice-cold EtOH solutions (70%, 50%, 20%, 10%, and 5%) for 5 min each. Samples were then washed four times with ice-cold PBS and three times with room temperature PBS. Brains and hemithoraxes were incubated in permeabilization buffer (Tween 20 0.1% V/V plus Triton X-100 0.01% V/V in PBS) for 5 min. Samples were rinsed with PBS and washed 3 times for 10 min. each in PBS. Next, samples were incubated in blocking buffer (10% normal goat serum in PBS) for 1 hour. Primary antibodies used were: mouse-anti-dsDNA 1:500 (ab27156, Abcam) and chicken anti-GFP 1:1000 (GFP1010, Aves Labs). Primary antibodies were diluted in PBS and incubated for 3 days at 4\u0026deg;C. Hemithoraxes and brains were then washed 3 times in PBS and 3 times in washing buffer (Tween 20 0.05% V/V in PBS) for 10 min each. Samples were incubated with the appropriate secondary antibody for 3 days. Finally, samples were washed 3 times in washing buffer for 10 min. and mounted in Vectashield Mounting Medium (Vector Lab). Images were acquired using a Zeiss LSM 880 Airyscan Confocal Microscope.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec22\" class=\"Section2\"\u003e\u003ch2\u003eTMRE Staining\u003c/h2\u003e\u003cp\u003eFlies were anesthetized and dissected in cold Drosophila Schneider\u0026rsquo;s Medium (DSM). Brains were incubated in TMRE staining solution (100 nM TMRE (Thermo Fisher Scientific cat# T669) in DSM) for 12 min. at room temperature. After staining samples were rinsed once in wash solution (25 nM TMRE in DSM) for 30 s. Brains were mounted in wash solution. Images were acquired using a Zeiss LSM 880 Airyscan Confocal Microscope with the same settings for laser intensity and gain.\u003c/p\u003e\u003cdiv id=\"Sec23\" class=\"Section3\"\u003e\u003ch2\u003eImage Analysis\u003c/h2\u003e\u003cp\u003eImages in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea, b, h, and k, and Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea and j were acquired using a Zeiss LSM 880 confocal microscope with Airyscan. For muscles, images were cropped to 21.25 X 13.12 (WXL) microns. For brains, images were cropped to 10.78 X 6.65 (WXL) microns. dsDNA counts were analyzed by quantifying the number of dots outside of mitochondrial staining (GFP).\u003c/p\u003e\u003cp\u003eImages in Supplementary Fig.\u0026nbsp;1a were acquired with a Zeiss LSM 880 confocal microscope with Airyscan microscopy. Images were cropped to 21.25 X 13.12 (WXL) microns for further analysis. Mitochondria morphology and dsDNA were segmented using the ImageJ Plugin Trainable Weka Segmentation. Segmented images were analyzed for dsDNA colocalization using the ImageJ plugin JACoP (Just Another Colocalization Plugin). Manders\u0026rsquo; Colocalization Coefficient was applied to quantify the proportion of dsDNA that colocalizes with mitochondria.\u003c/p\u003e\u003cp\u003eImages in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ei, \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb, \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eh, and j, and Supplementary Fig.\u0026nbsp;5b and c were acquired with a Zeiss LSM 880 confocal microscope and cropped to 55.35 X 55.35 (WXL) microns. EYA and Rel intensity analysis were quantified in ImageJ using the same threshold limits, and the mean gray value was quantified for each image and normalized to nuclei (To-Pro-3) intensity. FK2 aggregate size and number were quantified in the image using the \u0026ldquo;analyze particle\u0026rdquo; tool. Particles smaller than 0.05 \u0026micro;m\u003csup\u003e2\u003c/sup\u003e were discarded.\u003c/p\u003e\u003cp\u003eImages in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ed were acquired with a Zeiss LSM 880 confocal microscope and cropped to 23.81X14.76 (WXL). ATP5a percentage was analyzed in ImageJ and normalized to the nuclei percentage.\u003c/p\u003e\u003cp\u003eImages in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea were acquired with a Zeiss LSM 880 confocal, using identical settings conditions for each image, and cropped to 428.05X446.96 (WXL) microns. Brp intensity was quantified in the central brain by calculating the mean gray value in ImageJ for each image.\u003c/p\u003e\u003cp\u003eFor TMRE staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ef), images were acquired in a Zeiss LSM 880 confocal microscope using identical settings for each condition. Images were cropped to 35.71 X 22.14 (WXL) microns. TMRE intensity was quantified using ImageJ software.\u003c/p\u003e\u003cp\u003eAutolysosomes in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eh/Sup Fig.\u0026nbsp;5b were quantified using the mitoQC counter plugin on ImageJ\u003csup\u003e\u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e71\u003c/span\u003e\u003c/sup\u003e. Briefly, Red dots (autolysosomes) are quantified based on the difference in the intensity profile between the red and green channels.\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv id=\"Sec24\" class=\"Section2\"\u003e\u003ch2\u003eStatistical Analysis\u003c/h2\u003e\u003cp\u003eGraphPad Prism 10 was used to perform the statistical analysis and graphical display of the data. Statistical significance is expressed as p-values as determined by two-tailed tests. A Gaussian distribution with parametric distribution was used when samples reached the distribution criteria, or non-parametric distribution was used when samples did not reach the criteria for Gaussian distribution. For comparisons between two groups, an unpaired \u003cem\u003et\u003c/em\u003e-test was used. For comparisons of more than two groups, one-way ANOVA with Š\u0026iacute;d\u0026aacute;k correction or Tukey and Dunnett test was performed. Kruskal-Wallis tests with Dunn\u0026rsquo;s multiple comparisons post hoc tests were used when data do not meet the criteria for one-Way ANOVA analysis. When performing grouped analyses with multiple comparisons, two-way ANOVAs with Š\u0026iacute;d\u0026aacute;k\u0026rsquo;s multiple comparisons test were performed. Scatter plots with bars depict mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM. p values are annotated in each figure legend. The number (n) of biological samples used in each experiment and what n represents can be found in each figure legend.\u003c/p\u003e\u003cp\u003eLog-rank (Mantel-Cox) test was used for survival curves comparison. Average median survival is the time point at which the probability of survival equals 50%. Detailed statistical analysis and the difference between survival curves can be found in the supplementary tables.\u003c/p\u003e\u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank E. Baehrecke (UMass Medical School), the Vienna \u003cem\u003eDrosophila\u003c/em\u003e Resource Center, and the Bloomington Drosophila Stock Center (NIH no. P40OD018537) for fly stocks. We thank N. Prunet, Ken Yamauchi, and the MCDB/BSCRC Microscopy Core for training and microscope facilities. This work was supported by NIH grants R01AG037514 and R01AG049157 to D.W.W.\u003cstrong\u003e\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003c/p\u003e\n\n\u003cp\u003eD.W.W reports a relationship of board membership with Amway Scientific Advisory Board\u003c/p\u003e\n"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eL\u0026oacute;pez-Ot\u0026iacute;n, C., Blasco, M. A., Partridge, L., Serrano, M. \u0026amp; Kroemer, G. Hallmarks of aging: An expanding universe. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e186\u003c/strong\u003e, 243\u0026ndash;278 (2023).\u003c/li\u003e\n\u003cli\u003eFulop, T. \u003cem\u003eet al.\u003c/em\u003e Immunology of Aging: the Birth of Inflammaging. \u003cem\u003eClin. Rev. Allergy Immunol.\u003c/em\u003e \u003cstrong\u003e64\u003c/strong\u003e, 109\u0026ndash;122 (2023).\u003c/li\u003e\n\u003cli\u003eFerrucci, L. \u0026amp; Fabbri, E. Inflammageing: chronic inflammation in ageing, cardiovascular disease, and frailty. \u003cem\u003eNat. Rev. Cardiol.\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, 505\u0026ndash;522 (2018).\u003c/li\u003e\n\u003cli\u003eFurman, D. \u003cem\u003eet al.\u003c/em\u003e Chronic inflammation in the etiology of disease across the life span. \u003cem\u003eNat. Med.\u003c/em\u003e \u003cstrong\u003e25\u003c/strong\u003e, 1822\u0026ndash;1832 (2019).\u003c/li\u003e\n\u003cli\u003eNikolich-Žugich, J. The twilight of immunity: emerging concepts in aging of the immune system. \u003cem\u003eNat. Immunol.\u003c/em\u003e \u003cstrong\u003e19\u003c/strong\u003e, 10\u0026ndash;19 (2018).\u003c/li\u003e\n\u003cli\u003eSalazar, A. M., Aparicio, R., Clark, R. I., Rera, M. \u0026amp; Walker, D. W. Intestinal barrier dysfunction: an evolutionarily conserved hallmark of aging. \u003cem\u003eDis. Model. Mech.\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, dmm049969 (2023).\u003c/li\u003e\n\u003cli\u003eChen, G. Y. \u0026amp; Nu\u0026ntilde;ez, G. Sterile inflammation: sensing and reacting to damage. \u003cem\u003eNat. Rev. Immunol.\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, 826\u0026ndash;837 (2010).\u003c/li\u003e\n\u003cli\u003eFeldman, N., Rotter-Maskowitz, A. \u0026amp; Okun, E. DAMPs as mediators of sterile inflammation in aging-related pathologies. \u003cem\u003eAgeing Res. Rev.\u003c/em\u003e \u003cstrong\u003e24\u003c/strong\u003e, 29\u0026ndash;39 (2015).\u003c/li\u003e\n\u003cli\u003eGreen, D. R., Galluzzi, L. \u0026amp; Kroemer, G. Mitochondria and the Autophagy\u0026ndash;Inflammation\u0026ndash;Cell Death Axis in Organismal Aging. \u003cem\u003eScience\u003c/em\u003e \u003cstrong\u003e333\u003c/strong\u003e, 1109\u0026ndash;1112 (2011).\u003c/li\u003e\n\u003cli\u003eSun, N., Youle, R. J. \u0026amp; Finkel, T. The Mitochondrial Basis of Aging. \u003cem\u003eMol. Cell\u003c/em\u003e \u003cstrong\u003e61\u003c/strong\u003e, 654\u0026ndash;666 (2016).\u003c/li\u003e\n\u003cli\u003eLin, M., Liu, N., Qin, Z. \u0026amp; Wang, Y. Mitochondrial-derived damage-associated molecular patterns amplify neuroinflammation in neurodegenerative diseases. \u003cem\u003eActa Pharmacol. Sin.\u003c/em\u003e \u003cstrong\u003e43\u003c/strong\u003e, 2439\u0026ndash;2447 (2022).\u003c/li\u003e\n\u003cli\u003eNakahira, K. \u003cem\u003eet al.\u003c/em\u003e Autophagy proteins regulate innate immune responses by inhibiting the release of mitochondrial DNA mediated by the NALP3 inflammasome. \u003cem\u003eNat. Immunol.\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 222\u0026ndash;230 (2011).\u003c/li\u003e\n\u003cli\u003eZhou, R., Yazdi, A. S., Menu, P. \u0026amp; Tschopp, J. A role for mitochondria in NLRP3 inflammasome activation. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e469\u003c/strong\u003e, 221\u0026ndash;225 (2011).\u003c/li\u003e\n\u003cli\u003eRongvaux, A. \u003cem\u003eet al.\u003c/em\u003e Apoptotic Caspases Prevent the Induction of Type I Interferons by Mitochondrial DNA. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e159\u003c/strong\u003e, 1563\u0026ndash;1577 (2014).\u003c/li\u003e\n\u003cli\u003eWest, A. P. \u003cem\u003eet al.\u003c/em\u003e Mitochondrial DNA stress primes the antiviral innate immune response. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e520\u003c/strong\u003e, 553\u0026ndash;557 (2015).\u003c/li\u003e\n\u003cli\u003eWhite, M. J. \u003cem\u003eet al.\u003c/em\u003e Apoptotic Caspases Suppress mtDNA-Induced STING-Mediated Type I IFN Production. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e159\u003c/strong\u003e, 1549\u0026ndash;1562 (2014).\u003c/li\u003e\n\u003cli\u003eRiley, J. S. \u0026amp; Tait, S. W. Mitochondrial DNA in inflammation and immunity. \u003cem\u003eEMBO Rep.\u003c/em\u003e \u003cstrong\u003e21\u003c/strong\u003e, e49799 (2020).\u003c/li\u003e\n\u003cli\u003eP\u0026eacute;rez-Trevi\u0026ntilde;o, P., Vel\u0026aacute;squez, M. \u0026amp; Garc\u0026iacute;a, N. Mechanisms of mitochondrial DNA escape and its relationship with different metabolic diseases. \u003cem\u003eBiochim. Biophys. Acta (BBA) - Mol. Basis Dis.\u003c/em\u003e \u003cstrong\u003e1866\u003c/strong\u003e, 165761 (2020).\u003c/li\u003e\n\u003cli\u003eGogvadze, V. \u0026amp; Zhivotovsky, B. Mitochondrial DNA: how does it leave mitochondria? \u003cem\u003eTrends Cell Biol.\u003c/em\u003e (2025) doi:10.1016/j.tcb.2025.06.005.\u003c/li\u003e\n\u003cli\u003eYamamoto, H., Zhang, S. \u0026amp; Mizushima, N. Autophagy genes in biology and disease. \u003cem\u003eNat. Rev. Genet.\u003c/em\u003e \u003cstrong\u003e24\u003c/strong\u003e, 382\u0026ndash;400 (2023).\u003c/li\u003e\n\u003cli\u003eOka, T. \u003cem\u003eet al.\u003c/em\u003e Mitochondrial DNA that escapes from autophagy causes inflammation and heart failure. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e485\u003c/strong\u003e, 251\u0026ndash;255 (2012).\u003c/li\u003e\n\u003cli\u003eJim\u0026eacute;nez-Loygorri, J. I. \u003cem\u003eet al.\u003c/em\u003e Mitophagy curtails cytosolic mtDNA-dependent activation of cGAS/STING inflammation during aging. \u003cem\u003eNat. Commun.\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, 830 (2024).\u003c/li\u003e\n\u003cli\u003eSliter, D. A. \u003cem\u003eet al.\u003c/em\u003e Parkin and PINK1 mitigate STING-induced inflammation. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e561\u003c/strong\u003e, 258\u0026ndash;262 (2018).\u003c/li\u003e\n\u003cli\u003eRai, P. \u003cem\u003eet al.\u003c/em\u003e IRGM1 links mitochondrial quality control to autoimmunity. \u003cem\u003eNat. Immunol.\u003c/em\u003e \u003cstrong\u003e22\u003c/strong\u003e, 312\u0026ndash;321 (2021).\u003c/li\u003e\n\u003cli\u003eMatsui, H. \u003cem\u003eet al.\u003c/em\u003e Cytosolic dsDNA of mitochondrial origin induces cytotoxicity and neurodegeneration in cellular and zebrafish models of Parkinson\u0026rsquo;s disease. \u003cem\u003eNat. Commun.\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 3101 (2021).\u003c/li\u003e\n\u003cli\u003eShan, Z. \u003cem\u003eet al.\u003c/em\u003e mtDNA extramitochondrial replication mediates mitochondrial defect effects. \u003cem\u003eiScience\u003c/em\u003e \u003cstrong\u003e27\u003c/strong\u003e, 108970 (2024).\u003c/li\u003e\n\u003cli\u003eGulen, M. F. \u003cem\u003eet al.\u003c/em\u003e cGAS\u0026ndash;STING drives ageing-related inflammation and neurodegeneration. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e620\u003c/strong\u003e, 374\u0026ndash;380 (2023).\u003c/li\u003e\n\u003cli\u003eSeong, C.-S. \u003cem\u003eet al.\u003c/em\u003e Cloning and Characterization of a Novel Drosophila Stress Induced DNase. \u003cem\u003ePLoS ONE\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, e103564 (2014).\u003c/li\u003e\n\u003cli\u003eSeong, C.-S., Varela-Ramirez, A. \u0026amp; Aguilera, R. J. DNase II deficiency impairs innate immune function in Drosophila. \u003cem\u003eCell. Immunol.\u003c/em\u003e \u003cstrong\u003e240\u003c/strong\u003e, 5\u0026ndash;13 (2006).\u003c/li\u003e\n\u003cli\u003eChan, M. P. \u003cem\u003eet al.\u003c/em\u003e DNase II-dependent DNA digestion is required for DNA sensing by TLR9. \u003cem\u003eNat. Commun.\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e, 5853 (2015).\u003c/li\u003e\n\u003cli\u003eLiu, X. \u003cem\u003eet al.\u003c/em\u003e Drosophila EYA Regulates the Immune Response against DNA through an Evolutionarily Conserved Threonine Phosphatase Motif. \u003cem\u003ePLoS ONE\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, e42725 (2012).\u003c/li\u003e\n\u003cli\u003eOkabe, Y., Sano, T. \u0026amp; Nagata, S. Regulation of the innate immune response by threonine-phosphatase of Eyes absent. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e460\u003c/strong\u003e, 520\u0026ndash;524 (2009).\u003c/li\u003e\n\u003cli\u003eSato, A. \u003cem\u003eet al.\u003c/em\u003e Immunofluorescence microscopy-based assessment of cytosolic DNA accumulation in mammalian cells. \u003cem\u003eSTAR Protoc.\u003c/em\u003e \u003cstrong\u003e2\u003c/strong\u003e, 100488 (2021).\u003c/li\u003e\n\u003cli\u003eHussain, A. \u003cem\u003eet al.\u003c/em\u003e Inhibition of oxidative stress in cholinergic projection neurons fully rescues aging-associated olfactory circuit degeneration in Drosophila. \u003cem\u003eeLife\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, e32018 (2018).\u003c/li\u003e\n\u003cli\u003eDoty, R. L. \u003cem\u003eet al.\u003c/em\u003e Smell Identification Ability: Changes with Age. \u003cem\u003eScience\u003c/em\u003e \u003cstrong\u003e226\u003c/strong\u003e, 1441\u0026ndash;1443 (1984).\u003c/li\u003e\n\u003cli\u003eMobley, A. S., Rodriguez-Gil, D. J., Imamura, F. \u0026amp; Greer, C. A. Aging in the olfactory system. \u003cem\u003eTrends Neurosci.\u003c/em\u003e \u003cstrong\u003e37\u003c/strong\u003e, 77\u0026ndash;84 (2014).\u003c/li\u003e\n\u003cli\u003eNguyen, T. N., Padman, B. S. \u0026amp; Lazarou, M. Deciphering the Molecular Signals of PINK1/Parkin Mitophagy. \u003cem\u003eTrends Cell Biol.\u003c/em\u003e \u003cstrong\u003e26\u003c/strong\u003e, 733\u0026ndash;744 (2016).\u003c/li\u003e\n\u003cli\u003eRana, A., Rera, M. \u0026amp; Walker, D. W. Parkin overexpression during aging reduces proteotoxicity, alters mitochondrial dynamics, and extends lifespan. \u003cem\u003eProc. Natl. Acad. Sci.\u003c/em\u003e \u003cstrong\u003e110\u003c/strong\u003e, 8638\u0026ndash;8643 (2013).\u003c/li\u003e\n\u003cli\u003eLeduc‐Gaudet, J., Hussain, S. N. \u0026amp; Gouspillou, G. Parkin: a potential target to promote healthy ageing. \u003cem\u003eJ. Physiol.\u003c/em\u003e \u003cstrong\u003e600\u003c/strong\u003e, 3405\u0026ndash;3421 (2022).\u003c/li\u003e\n\u003cli\u003eRana, A. \u003cem\u003eet al.\u003c/em\u003e Promoting Drp1-mediated mitochondrial fission in midlife prolongs healthy lifespan of Drosophila melanogaster. \u003cem\u003eNat. Commun.\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, 448 (2017).\u003c/li\u003e\n\u003cli\u003eOsterwalder, T., Yoon, K. S., White, B. H. \u0026amp; Keshishian, H. A conditional tissue-specific transgene expression system using inducible GAL4. \u003cem\u003eProc. Natl. Acad. Sci.\u003c/em\u003e \u003cstrong\u003e98\u003c/strong\u003e, 12596\u0026ndash;12601 (2001).\u003c/li\u003e\n\u003cli\u003eRoman, G., Endo, K., Zong, L. \u0026amp; Davis, R. L. P{Switch}, a system for spatial and temporal control of gene expression in Drosophila melanogaster. \u003cem\u003eProc. Natl. Acad. Sci.\u003c/em\u003e \u003cstrong\u003e98\u003c/strong\u003e, 12602\u0026ndash;12607 (2001).\u003c/li\u003e\n\u003cli\u003eRera, M. \u003cem\u003eet al.\u003c/em\u003e Modulation of Longevity and Tissue Homeostasis by the Drosophila PGC-1 Homolog. \u003cem\u003eCell Metab.\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, 623\u0026ndash;634 (2011).\u003c/li\u003e\n\u003cli\u003eRera, M., Clark, R. I. \u0026amp; Walker, D. W. Intestinal barrier dysfunction links metabolic and inflammatory markers of aging to death in Drosophila. \u003cem\u003eProc. Natl. Acad. Sci.\u003c/em\u003e \u003cstrong\u003e109\u003c/strong\u003e, 21528\u0026ndash;21533 (2012).\u003c/li\u003e\n\u003cli\u003eMalik, B. R. \u0026amp; Hodge, J. J. L. Drosophila Adult Olfactory Shock Learning. \u003cem\u003eJ. Vis. Exp. : JoVE\u003c/em\u003e 50107 (2014) doi:10.3791/50107.\u003c/li\u003e\n\u003cli\u003ePletcher, S. D. \u003cem\u003eet al.\u003c/em\u003e Genome-Wide Transcript Profiles in Aging and Calorically Restricted Drosophila melanogaster. \u003cem\u003eCurr. Biol.\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 712\u0026ndash;723 (2002).\u003c/li\u003e\n\u003cli\u003eKounatidis, I. \u003cem\u003eet al.\u003c/em\u003e NF-\u0026kappa;B Immunity in the Brain Determines Fly Lifespan in Healthy Aging and Age-Related Neurodegeneration. \u003cem\u003eCell Rep.\u003c/em\u003e \u003cstrong\u003e19\u003c/strong\u003e, 836\u0026ndash;848 (2017).\u003c/li\u003e\n\u003cli\u003eWest, C. \u0026amp; Silverman, N. p38b and JAK-STAT signaling protect against Invertebrate iridescent virus 6 infection in Drosophila. \u003cem\u003ePLoS Pathog.\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, e1007020 (2018).\u003c/li\u003e\n\u003cli\u003eHedengren, M. \u003cem\u003eet al.\u003c/em\u003e Relish, a Central Factor in the Control of Humoral but Not Cellular Immunity in Drosophila. \u003cem\u003eMol. Cell\u003c/em\u003e \u003cstrong\u003e4\u003c/strong\u003e, 827\u0026ndash;837 (1999).\u003c/li\u003e\n\u003cli\u003eSt\u0026ouml;ven, S., Ando, I., Kadalayil, L., Engstr\u0026ouml;m, Y. \u0026amp; Hultmark, D. Activation of the Drosophila NF‐\u0026kappa;B factor Relish by rapid endoproteolytic cleavage. \u003cem\u003eEMBO Rep.\u003c/em\u003e \u003cstrong\u003e1\u003c/strong\u003e, 347\u0026ndash;352 (2000).\u003c/li\u003e\n\u003cli\u003eGupta, V. K. \u003cem\u003eet al.\u003c/em\u003e Restoring polyamines protects from age-induced memory impairment in an autophagy-dependent manner. \u003cem\u003eNat. Neurosci.\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, 1453\u0026ndash;1460 (2013).\u003c/li\u003e\n\u003cli\u003eFoster, T. C. Regulation of synaptic plasticity in memory and memory decline with aging. \u003cem\u003eProg. Brain Res.\u003c/em\u003e \u003cstrong\u003e138\u003c/strong\u003e, 283\u0026ndash;303 (2002).\u003c/li\u003e\n\u003cli\u003eGupta, V. K. \u003cem\u003eet al.\u003c/em\u003e Spermidine Suppresses Age-Associated Memory Impairment by Preventing Adverse Increase of Presynaptic Active Zone Size and Release. \u003cem\u003ePLoS Biol.\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, e1002563 (2016).\u003c/li\u003e\n\u003cli\u003eHuang, S., Piao, C., Beuschel, C. B., G\u0026ouml;tz, T. \u0026amp; Sigrist, S. J. Presynaptic Active Zone Plasticity Encodes Sleep Need in Drosophila. \u003cem\u003eCurr. Biol.\u003c/em\u003e \u003cstrong\u003e30\u003c/strong\u003e, 1077-1091.e5 (2020).\u003c/li\u003e\n\u003cli\u003eWagh, D. A. \u003cem\u003eet al.\u003c/em\u003e Bruchpilot, a Protein with Homology to ELKS/CAST, Is Required for Structural Integrity and Function of Synaptic Active Zones in Drosophila. \u003cem\u003eNeuron\u003c/em\u003e \u003cstrong\u003e49\u003c/strong\u003e, 833\u0026ndash;844 (2006).\u003c/li\u003e\n\u003cli\u003eMattson, M. P. \u0026amp; Arumugam, T. V. Hallmarks of Brain Aging: Adaptive and Pathological Modification by Metabolic States. \u003cem\u003eCell Metab.\u003c/em\u003e \u003cstrong\u003e27\u003c/strong\u003e, 1176\u0026ndash;1199 (2018).\u003c/li\u003e\n\u003cli\u003eSchmid, E. T., Schinaman, J. M., Liu-Abramowicz, N., Williams, K. S. \u0026amp; Walker, D. W. Accumulation of F-actin drives brain aging and limits healthspan in Drosophila. \u003cem\u003eNat. Commun.\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, 9238 (2024).\u003c/li\u003e\n\u003cli\u003eSchmid, E. T., Pyo, J.-H. \u0026amp; Walker, D. W. Neuronal induction of BNIP3-mediated mitophagy slows systemic aging in Drosophila. \u003cem\u003eNat. Aging\u003c/em\u003e \u003cstrong\u003e2\u003c/strong\u003e, 494\u0026ndash;507 (2022).\u003c/li\u003e\n\u003cli\u003eLee, T. V., Kaya, H. E. K., Simin, R., Baehrecke, E. H. \u0026amp; Bergmann, A. The initiator caspase Dronc is subject of enhanced autophagy upon proteasome impairment in Drosophila. \u003cem\u003eCell Death Differ.\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, 1555\u0026ndash;1564 (2016).\u003c/li\u003e\n\u003cli\u003eAparicio, R., Rana, A. \u0026amp; Walker, D. W. Upregulation of the Autophagy Adaptor p62/SQSTM1 Prolongs Health and Lifespan in Middle-Aged Drosophila. \u003cem\u003eCell Rep.\u003c/em\u003e \u003cstrong\u003e28\u003c/strong\u003e, 1029-1040.e5 (2019).\u003c/li\u003e\n\u003cli\u003eRyu, D. \u003cem\u003eet al.\u003c/em\u003e Urolithin A induces mitophagy and prolongs lifespan in C. elegans and increases muscle function in rodents. \u003cem\u003eNat. Med.\u003c/em\u003e \u003cstrong\u003e22\u003c/strong\u003e, 879\u0026ndash;888 (2016).\u003c/li\u003e\n\u003cli\u003eIzquierdo, J. M. cGAS-STING triggers inflammaging-associated neurodegeneration. \u003cem\u003eMol. Neurodegener.\u003c/em\u003e \u003cstrong\u003e18\u003c/strong\u003e, 78 (2023).\u003c/li\u003e\n\u003cli\u003eMyllym\u0026auml;ki, H., Valanne, S. \u0026amp; R\u0026auml;met, M. The Drosophila Imd Signaling Pathway. \u003cem\u003eJ. Immunol.\u003c/em\u003e \u003cstrong\u003e192\u003c/strong\u003e, 3455\u0026ndash;3462 (2014).\u003c/li\u003e\n\u003cli\u003eSalminen, A., Hyttinen, J. M. T., Kauppinen, A. \u0026amp; Kaarniranta, K. Context‐Dependent Regulation of Autophagy by IKK‐NF‐\u0026kappa;B Signaling: Impact on the Aging Process. \u003cem\u003eInt. J. Cell Biol.\u003c/em\u003e \u003cstrong\u003e2012\u003c/strong\u003e, 849541 (2012).\u003c/li\u003e\n\u003cli\u003eZhang, Q.-Y. \u003cem\u003eet al.\u003c/em\u003e Antimicrobial peptides: mechanism of action, activity and clinical potential. \u003cem\u003eMil. Méd. Res.\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, 48 (2021).\u003c/li\u003e\n\u003cli\u003eRappocciolo, E. \u0026amp; Stiban, J. Prokaryotic and Mitochondrial Lipids: A Survey of Evolutionary Origins. \u003cem\u003eAdv. Exp. Med. Biol.\u003c/em\u003e \u003cstrong\u003e1159\u003c/strong\u003e, 5\u0026ndash;31 (2019).\u003c/li\u003e\n\u003cli\u003eWang, H. \u003cem\u003eet al.\u003c/em\u003e Antimicrobial Peptides Mediate Apoptosis by Changing Mitochondrial Membrane Permeability. \u003cem\u003eInt. J. Mol. Sci.\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, 12732 (2022).\u003c/li\u003e\n\u003cli\u003eMarkstein, M., Pitsouli, C., Villalta, C., Celniker, S. E. \u0026amp; Perrimon, N. Exploiting position effects and the gypsy retrovirus insulator to engineer precisely expressed transgenes. \u003cem\u003eNat. Genet.\u003c/em\u003e \u003cstrong\u003e40\u003c/strong\u003e, 476\u0026ndash;483 (2008).\u003c/li\u003e\n\u003cli\u003eBischof, J., Maeda, R. K., Hediger, M., Karch, F. \u0026amp; Basler, K. An optimized transgenesis system for Drosophila using germ-line-specific \u0026phi;C31 integrases. \u003cem\u003eProc. Natl. Acad. Sci.\u003c/em\u003e \u003cstrong\u003e104\u003c/strong\u003e, 3312\u0026ndash;3317 (2007).\u003c/li\u003e\n\u003cli\u003eMosley, S. R. \u0026amp; Baker, K. Isolation of endogenous cytosolic DNA from cultured cells. \u003cem\u003eSTAR Protoc.\u003c/em\u003e \u003cstrong\u003e3\u003c/strong\u003e, 101165 (2022).\u003c/li\u003e\n\u003cli\u003eMontava-Garriga, L., Singh, F., Ball, G. \u0026amp; Ganley, I. G. Semi-automated quantitation of mitophagy in cells and tissues. \u003cem\u003eMech. Ageing Dev.\u003c/em\u003e \u003cstrong\u003e185\u003c/strong\u003e, 111196 (2020).\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"nature-portfolio","isNatureJournal":true,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"","title":"Nature Portfolio","twitterHandle":"","acdcEnabled":false,"dfaEnabled":false,"editorialSystem":"ejp","reportingPortfolio":"","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"cognitive function, Nuclease activity, DNautophagy","lastPublishedDoi":"10.21203/rs.3.rs-7634140/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7634140/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eMitochondrial dysfunction and pro-inflammatory signaling are each key drivers of aging. However, a clear understanding of the connections between mitochondrial homeostasis, inflammation and lifespan determination remains elusive. Upon mitochondrial stress or damage, mtDNA can be released into the cytosol thus encountering cytosolic DNA sensors and activating pro-inflammatory responses. Here, we report a striking age-related increase in cytosolic mtDNA, which can be counteracted by mitophagy, in \u003cem\u003eDrosophila\u003c/em\u003e brain and muscle tissue. We find that upregulation of DNase II, an acid DNase which digests DNA in the autophagy\u0026ndash;lysosome system, reduces cytosolic mtDNA levels in aged flies and prolongs healthspan. Reducing the abundance of cytosolic DNA in aged flies also dampens Rel/NF-κB pro-inflammatory signaling. Furthermore, we show that inhibition of EYA, a Rel/NF-κB-binding protein involved in immune sensing of DNA, in aging neurons counteracts brain aging and prolongs healthspan. Our findings identify DNase II and EYA as therapeutic targets to prolong healthspan.\u003c/p\u003e","manuscriptTitle":"Cytosolic mtDNA and associated EYA-mediated pro-inflammatory signaling modulate healthspan in Drosophila","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-10-13 11:58:55","doi":"10.21203/rs.3.rs-7634140/v1","editorialEvents":[],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"nature-communications","isNatureJournal":true,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"NCOMMS","sideBox":"Learn more about [Nature Communications](http://www.nature.com/ncomms/)","snPcode":"","submissionUrl":"https://mts-ncomms.nature.com/","title":"Nature Communications","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature Communications","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"979948f3-de13-4131-878f-1a06d7326d65","owner":[],"postedDate":"October 13th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":55364290,"name":"Biological sciences/Physiology/Ageing"},{"id":55364291,"name":"Biological sciences/Immunology/Inflammation"}],"tags":[],"updatedAt":"2025-10-13T11:58:55+00:00","versionOfRecord":[],"versionCreatedAt":"2025-10-13 11:58:55","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7634140","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7634140","identity":"rs-7634140","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.