Effect of fluoride on the expression of Th17-related cytokines profiles in Hepa1-6 cells

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

Abstract Excessive fluorine (F) ion has strong cytotoxicity and can cause inflammatory reaction. However, little is understood about associations between the secretion of T helper-17 (Th17)-related inflammatory factor and the risk of F ion-induced disorders in Hepa1-6 cells. In this study, Hepa1-6 cells were exposed to culture medium containing 0, 1 and 2 mmol/L F ion for 48 h, then the culture supernatant was subjected to detect the Th17-related inflammatory cytokines (macrophage inflammatory protein (MIP)-3α, interleukin (IL)-13, IL-21, transforming growth factor type beta 1 (TGF-β1), IL-17F, IL-5, IL-28A, IL-23, IL-22, IL-17A, IL-2, IL-4, IL-10, IL-1β, Interferon (IFN)-γ, IL-6, IL-12 and tumor necrosis factor (TNF)-α). The results showed that TGF-β1 as the only differential expression protein (DEP) was down-regulated in the 1 mmol/L F ion group when compared with the control group. However, 7 DEPs were detected in the 2 mmol/L F ion group, with 2 DEPs (IL-6 and IL-17F) were up-regulated and 5 DEPs (IL-5, IL-10, TGF-β1, IL-1β and IL-2) were down-regulated. Besides, the expressions of up-regulated IL-6 and down-regulated IL-5 in the 2 mmol/L F ion group were significant difference when compared with the 1 mmol/L F ion group. Additionally, the Gene ontology (GO) database and Kyoto Encyclopedia of Genes and Genomes (KEGG) database were used to analyze the biological processes, cellular component and signaling pathways that DEPs are potentially involved in. Collectively, these data indicate that Th17-related cytokines expression pattern plays an important role in fluoride-induced cytotoxicity.
Full text 122,501 characters · extracted from preprint-html · click to expand
Effect of fluoride on the expression of Th17-related cytokines profiles in Hepa1-6 cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Effect of fluoride on the expression of Th17-related cytokines profiles in Hepa1-6 cells Hong-wei Guo, Xiao-pan Wang, Wen-peng Zhao, Jing Zhao, Hua-wei Li, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5344252/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Excessive fluorine (F) ion has strong cytotoxicity and can cause inflammatory reaction. However, little is understood about associations between the secretion of T helper-17 (Th17)-related inflammatory factor and the risk of F ion-induced disorders in Hepa1-6 cells. In this study, Hepa1-6 cells were exposed to culture medium containing 0, 1 and 2 mmol/L F ion for 48 h, then the culture supernatant was subjected to detect the Th17-related inflammatory cytokines (macrophage inflammatory protein (MIP)-3α, interleukin (IL)-13, IL-21, transforming growth factor type beta 1 (TGF-β1), IL-17F, IL-5, IL-28A, IL-23, IL-22, IL-17A, IL-2, IL-4, IL-10, IL-1β, Interferon (IFN)-γ, IL-6, IL-12 and tumor necrosis factor (TNF)-α). The results showed that TGF-β1 as the only differential expression protein (DEP) was down-regulated in the 1 mmol/L F ion group when compared with the control group. However, 7 DEPs were detected in the 2 mmol/L F ion group, with 2 DEPs (IL-6 and IL-17F) were up-regulated and 5 DEPs (IL-5, IL-10, TGF-β1, IL-1β and IL-2) were down-regulated. Besides, the expressions of up-regulated IL-6 and down-regulated IL-5 in the 2 mmol/L F ion group were significant difference when compared with the 1 mmol/L F ion group. Additionally, the Gene ontology (GO) database and Kyoto Encyclopedia of Genes and Genomes (KEGG) database were used to analyze the biological processes, cellular component and signaling pathways that DEPs are potentially involved in. Collectively, these data indicate that Th17-related cytokines expression pattern plays an important role in fluoride-induced cytotoxicity. Fluoride Hepa1-6 Th17-related cytokines Cancer Immunity Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Fluorine (F) is one of the highly reactive elements with the highest electronegativity. F exists in combination with other elements such as fluoride, and is widely distributed in the natural environment [ 1 , 2 ]. Fluoride-containing drinking water is the main source of fluoride in the human body [ 3 , 4 ]. Due to the extremely narrow margin of safety, long-term exposure to fluoride can cause diverse adverse effects which could induce a serious public health problem [ 5 – 7 ]. Previous studies have evidenced that fluoride can cause damage to many organs and tissues, among which dental and skeletal fluorosis are well-known [ 8 , 9 ]. In recent years, a lot of literatures reported that fluoride has strong cytotoxicity. Inflammation and abnormal cytokine secretion may play an important role in fluoride-induced cytotoxicity and tissue damage [ 10 – 12 ]. Inflammation was recognized as the eighth hallmark of cancer [ 13 ]. Inflammatory cells and cytokines are indispensable components of the tumor microenvironment. Chronic inflammation can promote tumor progression and carcinogenesis by recruiting inflammatory cells into the tumor microenvironment [ 14 , 15 ]. Tumor-derived cytokines regulate multicellular cross-talk, influence tumor aggressiveness, and inhibit the release of cytokines, which play a key role in anti-tumor [ 16 , 17 ]. Fluoride can induce inflammation in diverse organ and tissue, such as lung, cardiac muscle, and testis [ 10 – 12 ]. Our previous studies have demonstrated that excessive fluoride induced a trend of decline cytokine contents in the serum of rat and decreased the expression of pro-inflammatory cytokines in HeLa and Hepa1-6 cells [ 18 – 20 ]. T helper 17 (Th17)-related cytokines are inflammatory factors that play an important role in mediating tumorigenesis and progression [ 21 , 22 ]. Several inflammatory mediators, including tumor necrosis factor (TNF)-α, interleukin-6 (IL-6), IL-10, and transforming growth factor type beta 1 (TGF-β1) have been proven to be involved in the initiation and progression of cancer [ 23 , 24 ]. It was indicated that an increasing trend of Th17 cells had been observed in human and mouse tumor tissues [ 21 , 25 ]. However, the effect of fluoride on Th17-related cytokines expression profiles in Hepa1-6 cells is still unclear. In this study, to investigate the association between fluoride exposure and Th17-related cytokines, a fluoride-exposed Hepa1-6 cell model was established and the cytokine expression profile was determined by Th17-related protein array. Materials and Methods Cell Culture Hepa1-6 cells (Mouse hepatoma cell lines) were obtained from the cell bank of the Chinese Academy of Sciences, Beijing, China. Cells were seeded in culture flasks in DMEM Medium containing 10% fetal bovine serum and 1% penicillin-streptomycin and incubated at 37°C with an atmosphere containing 5% CO 2 . When the cell growth reached a confluence of 80% ~ 90%, the cells were detached from flasks using 0.25% trypsin (trypsinization) and seeded into six-well plates for 0, 1 and 2 mmol/L F ion exposure for 48 h. Then cell culture supernatant was collected for cytokine array assay. Cytokine Array Assay and Data Analysis Cell culture supernatant samples were performed for screening the Th17-related inflammatory cytokines via Mouse Th17 Array 1 Glass Slide (RayBiotech, Inc., Guangzhou, China) according to the manufacturer’s instructions. Briefly: (1) The captured antibodies of target cytokines were coated on the solid surface in advance. 100 µL of cell culture supernatant was added to each well and incubated at room temperature for 1 ~ 2 h. (2) The biotin-labeled detection antibody was added, which can recognize a different epitope of the target cytokine. (3) The cytokine-antibody-biotin complex was visualized by adding the streptavidin-conjugated Cy3 equivalent dye. (4) The signals were visualized via InnoScan 300 Microarray Scanner (Innopsys, France) at 532 nm wavelength. (5) Normalization of the raw data were obtained by capturing the spot densities with a laser scanner, and analyzed in excel-based Analysis Tool software. Gene ontology (GO) database ( http://www.geneontology.org/ ) and Kyoto Encyclopedia of Genes and Genomes (KEGG) database ( http://www.genome.jp/kegg/ ) were used to perform gene annotation and pathway analysis, respectively. Differential expression proteins (DEPs) in Hepa1-6 cells are defined as those with adjusted P -value (adj. P . Val) less than 0.05, and fold change over 1.2 or less than 0.83 (absolute logFC > 0.263). TRUE was presented DEPs. The basic statistics used for significance analysis are moderated t -test. Real-time PCR Analysis The collected cells were added to 1 mL of TRIZOL and placed on ice for cracking, followed by 0.2 mL of chloroform, violently shook for 15 s, left for 5 min, and centrifuged at 4 o C at 12, 000× g for 15 min. After water phase extraction, total RNA extraction was carried out according to the kit instructions. The samples were then synthesized according to cDNA synthesis kit. The gene expression was detected by real-time PCR, and GAPDH was used as the steward gene. The primers are shown in Table 1 . Table 1 Primer sequence Gene Primer Sequence (5’-3’) Size (bp) IL-6 Forward Reverse CGCTATGAAGTTCCTCTCTGC CTGTGAAGTCTCCTCTCCGG 113 IL-17F Forward Reverse GGAAGAAGCAGCCATTGGAG GCTGCTACCTCCCTCAGAAT 111 IL-5 Forward Reverse CACCGAGCTCTGTTGACAAG CCCCACGGACAGTTTGATTC 127 TGF-β1 Forward Reverse GAAGGACCTGGGTTGGAAGT CCGGGTTGTGTTGGTTGTAG 137 IL-1β Forward Reverse GCCCATCCTCTGTGACTCAT TCAGCTCATATGGGTCCGAC 131 IL-2 Forward Reverse AGGAACCTGAAACTCCCCAG AAATCCAGAACATGCCGCAG 122 GAPDH Forward Reverse CAAGAAGGTGGTGAAGCAGG AGGTGGAAGAGTGGGAGTTG 110 Results Differential Cytokines Expression in Hepa1-6 Cells The distribution of DEPs was presented in volcano plot (Figs. 1 A, B and C). As shown in Table 2 , TGF-β1 expression level was significantly down-regulated in the 1 mmol/L F ion group compared with control group. In the 2 mmol/L F ion group, 7 DEPs were detected, of which 2 DEPs (IL-6 and IL-17F) were up-regulated, and 5 DEPs (IL-5, IL-10, TGF-β1, IL-1β and IL-2) were down-regulated compared with the control group (Table 3 ). Compared with the 1 mmol/L F ion group, 2 DEPs were detected (up-regulated IL-6 and down-regulated IL-5) in the 2 mmol/L F ion group (Table 4 ). Table 2 The effect of 1 mmol/L F ion on Th17-related cytokines expression in Hepa1-6 cells Protein ID logFC P.Value adj.P.Val Fold change Regulation Threshold TGF-β1 -0.3028 0.0023 0.0420 0.8107 down TRUE IL-17F 0.2793 0.0110 0.0662 1.2136 up FALSE TNF-α -0.3185 0.0088 0.0662 0.8019 down FALSE IL-4 -0.2775 0.0398 0.1793 0.8250 down FALSE IL-2 -0.1722 0.0997 0.2272 0.8875 down FALSE IL-6 0.2231 0.0711 0.2272 1.1672 up FALSE IL-10 -0.1397 0.1010 0.2272 0.9077 down FALSE IL-13 0.1840 0.0793 0.2272 1.1360 up FALSE IL-5 -0.1175 0.1307 0.2615 0.9218 down FALSE IL-12 -0.1734 0.1685 0.2909 0.8867 down FALSE MIP-3α -0.0883 0.1778 0.2909 0.9406 down FALSE IFN-γ -0.0874 0.2232 0.3348 0.9412 down FALSE IL-1β -0.0821 0.4175 0.5404 0.9447 down FALSE IL-21 0.1142 0.4203 0.5404 1.0824 up FALSE IL-28A -0.0571 0.4582 0.5499 0.9612 down FALSE IL-17A 0.0782 0.5675 0.6385 1.0557 up FALSE IL-22 0.1590 0.9413 0.9777 1.1165 up FALSE IL-23 -0.0026 0.9777 0.9777 0.9982 down FALSE Note: TRUE and FALSE are presented DEPs and not DEPs, respectively. (1 mmol/L F ion group compared with control group) Table 3 The effect of 2 mmol/L F ion on Th17-related cytokines expression in in Hepa1-6 cells Protein ID logFC P.Value adj.P.Val Fold change Regulation Threshold IL-6 1.6177 0.0000 0.0000 3.0688 up TRUE IL-5 -0.4887 0.0000 0.0001 0.7127 down TRUE IL-10 -0.3282 0.0011 0.0048 0.7965 down TRUE TGF-β1 -0.3357 0.0011 0.0048 0.7924 down TRUE IL-17F 0.3365 0.0034 0.0122 1.2627 up TRUE IL-1β -0.3049 0.0080 0.0240 0.8095 down TRUE IL-2 -0.2760 0.0136 0.0351 0.8259 down TRUE IL-23 0.2258 0.0247 0.0545 1.1694 up FALSE IFN-γ -0.1655 0.0303 0.0545 0.8916 down FALSE TNF-α -0.2552 0.0286 0.0545 0.8379 down FALSE IL-12 -0.2740 0.0380 0.0622 0.8270 down FALSE IL-28A -0.1269 0.1128 0.1692 0.9158 down FALSE IL-21 0.2093 0.1507 0.2087 1.1561 up FALSE MIP-3α -0.0787 0.2262 0.2908 0.9469 down FALSE IL-4 -0.1413 0.2672 0.3206 0.9067 down FALSE IL-13 0.1063 0.2922 0.3287 1.0765 up FALSE IL-22 0.2942 0.8917 0.9442 1.2262 up FALSE IL-17A -0.0043 0.9745 0.9745 0.9970 down FALSE Note: TRUE and FALSE are presented DEPs and not DEPs, respectively. (2 mmol/L F ion group compared with control group) Table 4 The effect of 2 mmol/L F ion on Th17-related cytokines expression in Hepa1-6 cells compared with 1 mmol/L F ion Protein ID logFC P.Value adj.P.Val Fold change Regulation Threshold IL-6 1.3946 0.0000 0.0000 2.6292 up TRUE IL-5 -0.3711 0.0002 0.0017 0.7732 down TRUE IL-23 0.2283 0.0234 0.1405 1.1715 up FALSE IL-1β -0.2227 0.0402 0.1448 0.8569 down FALSE IL-10 -0.1885 0.0329 0.1448 0.8775 down FALSE IL-2 -0.1038 0.3056 0.6688 0.9306 down FALSE IL-4 0.1362 0.2839 0.6688 1.0990 up FALSE IL-12 -0.1006 0.4135 0.6688 0.9327 down FALSE IL-13 -0.0777 0.4371 0.6688 0.9476 down FALSE IL-17A -0.0825 0.5465 0.6688 0.9444 down FALSE IL-17F 0.0572 0.5573 0.6688 1.0404 up FALSE IL-21 0.0951 0.5008 0.6688 1.0681 up FALSE IL-28A -0.0697 0.3677 0.6688 0.9528 down FALSE IFN-γ -0.0782 0.2733 0.6688 0.9473 down FALSE TNF-α 0.0634 0.5533 0.6688 1.0449 up FALSE TGF-β1 -0.0329 0.6911 0.7778 0.9774 down FALSE MIP-3α 0.0095 0.8802 0.9320 1.0066 up FALSE IL-22 0.1352 0.9501 0.9501 1.0982 up FALSE Note: TRUE and FALSE are presented DEPs and not DEPs, respectively. (2 mmol/L F ion group compared with 1 mmol/L F ion group) Clustering heatmap was applied to the microarray data analysis. Figure 1 D showed a clear separation between 2 mmol/L F ion group and control group. Obviously, upregulated IL-6 and downregulated IL-5 were observed in the 2 mmol/L F ion group compared with that of 1 mmol/L F ion group (Fig. 1 E). GO Analysis Figure 2 showed GO function classification of the DEPs in the 2 mmol/L F ion group compared with the control group. These DEPs were involved in the following biological processes: positive regulation of protein secretion, positive regulation of peptide secretion, positive regulation of secretion by cell, regulation of protein secretion, positive regulation of protein transport, positive regulation of establishment of protein localization, regulation of peptide secretion, positive regulation of secretion, regulation of lymphocyte proliferation and regulation of mononuclear cell proliferation. Among them, positive regulation of protein secretion and positive regulation of peptide secretion accounted for higher percent. Molecular function analysis showed that DEPs were associated with cytokine activity, cytokine receptor binding, receptor ligand activity, growth factor receptor binding, growth factor activity, IL-2 receptor binding, type Ⅱ transforming growth factor beta receptor (TGFβRⅡ) binding, IL-6 receptor binding, opioid receptor binding and TGFβRⅠ binding. Among them cytokine activity, cytokine receptor binding and receptor ligand activity accounted for higher percent (Fig. 2 A and B). KEGG Analysis Via KEGG analysis, DEPs in 2 mmol/L F ion group were involved in 12 pathways compared with the control group, including inflammatory bowel disease (IBD), Intestinal immune network for IgA production, Cytokine-cytokine receptor interaction, Th17 cell differentiation and Chagas disease (American trypanosomiasis), Malaria, IL-17 signaling pathway, Amoebiasis, C-type lectin receptor signaling pathway, African trypanosomiasis, JAK-STAT signaling pathway and Tuberculosis (Fig. 3 ). Among them, IL-17 signaling pathway and JAK-STAT signaling pathway are involved in fluoride-induced immunotoxicity and tumor growth, respectively. mRNA expression of cytokines in Hepa1-6 cells Figure 4 showed that the mRNA expression changes of IL-1β, IL-2, IL-5, TGF-β1, IL-6 and IL-17F in Hepa1-6 cells after fluoride treatment. Compared with the control group, the mRNA expression level of TGF-β1 was down-regulated in the 1 mmol/L F ion and 2 mmol/L F ion group (Fig. 4 , P < 0.05 or P < 0.01), and the mRNA expression levels of IL-5, IL-10, IL-1β and IL-2 were down-regulated in the 2 mmol/L F ion group (Fig. 4 , P < 0.01). However, the mRNA expression levels of IL-6 and IL-17F were up-regulated in the 2 mmol/L F ion group compared with the control group (Fig. 4 , P < 0.01). Besides, the mRNA expression of up-regulated IL-6 and down-regulated IL-5 in the 2 mmol/L F ion group were significant difference when compared with the 1 mmol/L F ion group (Fig. 4 , P < 0.05). Discussion In October 2005, the research group of Chen Dong and Casey T Weaver identified a third type of helper T cells which produced the cytokine IL-17, named Th17 cell, and played an important role in autoimmune diseases and inflammatory regulation [ 26 – 28 ]. The cytokine IL-17 has been found to be closely related to autoimmune diseases, in particular rheumatoid arthritis [ 29 ]. Recently, emerging evidence has pointed to the critical role of Th17 cell-related cytokines in the pathogenesis of cancer [ 22 , 25 , 30 ]. Th17-related cytokines involved in cancer progression by enhancing the angiogenesis and tumor immune evasion [ 21 , 22 , 31 ]. Fluoride, an effective caries prophylactic, has been widely studied for its contribution to drug design and development. The extremely high electronegativity of F contributes to the effect and stability of different drugs in the body [ 32 ]. Therefore, fluorinated drugs have been used in various medicines such as anesthetics, antibiotics, anti-cancer and anti-inflammatory agents. Besides, it is reported that F-containing anticancer drugs have higher activity to resist the progression of cancer [ 3 , 33 ]. It makes a lot of sense to elucidate the expression patterns of Th17-related cytokines in the pathogenesis of disease, especially in tumorigenesis, which will provide new ideas for the prevention and treatment of cancer. There is growing evidence that fluoride could inhibit the viability of cancer cell [ 34 – 36 ]. However, it remains unknown whether the inhibition of fluoride on the cancer cells proliferation is related to Th17 related cytokines. This study showed that fluoride caused the IL-6 and IL-17F upregulation and IL-5, IL-10, TGF-β1, IL-1β and IL-2 downregulation in the 2 mmol/L F ion group compared with the control group. Obviously, fluoride can induce Th17-related cytokine secretion disorder. The expression of IL-6 in the tumor microenvironment is higher than in normal microenvironment. Resistance to multiple chemotherapy drugs (multidrug resistance) has been correlated with IL-6 over-expression in multiple cancer cells [ 37 ]. The up-regulation of IL-6 induced by anticancer therapies could influence and regulate nearly all hallmarks of cancer, contributing to therapeutic resistance, finally leading to tumor regrowth, invasion, and angiogenesis [ 23 , 24 ]. In addition, IL-6 can activate the JAK/STAT signaling pathway by binding to its receptor (IL-6R), resulting in the promotion of tumor growth [ 38 ]. The JAK/STAT pathway was found in this study indicated that the up-regulation of IL-6 may involve in the resistance of fluoride-induced cytotoxicity. IL-1β is a typical pro-inflammatory cytokine, and the increased expression of IL-1β has been found in the microenvironment of invasive tumors [ 39 ]. In this study, the up-regulation of IL-6 and down-regulation of IL-1β may involve in the fluoride induced Hepa1-6 cells damage and growth inhibition, which is consistent with our previous findings [ 10 , 20 ]. A recent study has proved that fluoride can activate the IL-17 signaling pathway, induce apoptosis and autophagy, and eventually lead to liver damage [ 40 ]. Also, fluoride significantly increased the mRNA levels of IL-17 and IL-17 receptor C in mice testis [ 41 , 42 ]. RNA deep sequencing analysis also confirmed that the high expressions of the IL-17 signal pathway relative molecules involved in immune privilege of testis after fluoride exposure [ 42 ]. In the present study, KEGG pathway analysis revealed that fluoride-induced DEPs are associated with IL-17 pathway. The increased expression of IL-17F may be one of the evidence for fluoride-induced cells damage, further inhibit the growth and development of Hepa1-6 cells [ 20 , 40 ]. Additionally, the biological processes and cellular component of fluoride-induced DEPs was provided by GO analysis. Taken together, results presented in this study indicate that Th17-related cytokine secretion disorder could contribute to cytotoxicity induced by fluoride. It is speculated that fluoride may be used as a potential anticancer agent by targeting Th17-related cytokines in tumor microenvironment. Declarations Conflicts of interest The authors declare that there is no conflict of interest. Author Contribution Hong-wei Guo, Ideas, Formulation, or evolution of overarching research goals and aims, Methodology, Funding acquisition, Review & Editing and Project administration. Xiao-pan Wang, Writing-Original Draf, Software, Validation, Formal analysis, Data Curation. Wen-peng Zhao, Creation of cell culture model. Jing Zhao, Performing the experiments, Formal analysis, Data Curation. Hua-wei Li and Ming Zheng, Provision of study materials, Reagents. Acknowledgement This work was supported by the Science and Technology Department of Henan Province, China (grant no. 182102110021). References Peckham S, Awofeso N (2014) Water fluoridation: a critical review of the physiological effects of ingested fluoride as a public health intervention. Sci World J 293019 Vithanage M, Bhattacharya P (2015) Fluoride in the environment: sources, distribution and defluoridation. Environ Chem Lett 13(2):131–147 Sharma D, Singh A, Verma K, Paliwal S, Sharma S, Dwivedi J (2017) Fluoride: a review of pre-clinical and clinical studies. Environ Toxicol Phar 56:297–313 Dharmaratne RW (2015) Fluoride in drinking water and diet: the causative factor of chronic kidney diseases in the North Central Province of Sri Lanka. Environ Health Prev 20(4):237–242 Jha SK, Mishra VK, Sharma DK, Damodaran T (2011) Fluoride in the environment and its metabolism in humans. In: whitacre DM (ed) reviews of environmental contamination and toxicology. Reviews of Environmental Contamination and Toxicology, vol 211. Springer, New York, pp 121–142 Ghosh A, Mukherjee K, Ghosh SK, Saha B (2013) Sources and toxicity of fluoride in the environment. Res Chem Intermediat 39(7):2881–2915 Wang JD (2019) Fluoride-induced reproductive toxicity. Fluoride 52(1):81 Johnston NR, Strobel SA (2020) Principles of fluoride toxicity and the cellular response: a review. Arch Toxicol 94(4):1051–1069 Zuo H, Chen L, Kong M, Qiu LP, Lu P, Wu P, Yang YH, Chen KP (2018) Toxic effects of fluoride on organisms. Life Sci 198:18–24 Quadri JA, Sarwar S, Pinky, Kar P, Singh S, Mallick SR, Arava S, Nag TC, Roy TS, Shariff A (2018) Fluoride induced tissue hypercalcemia, IL-17 mediated inflammation and apoptosis lead to cardiomyopathy: ultrastructural and biochemical findings. Toxicology 406:44–57 Ameeramja J, Perumal E (2018) Possible modulatory effect of tamarind seed coat extract on fluoride-induced pulmonary inflammation and fibrosis in rats. Inflammation 41(3):886–895 Chen LL, Kuang P, Liu H, Wei Q, Cui HM, Fang J, Zuo ZC, Deng JL, Li YL, Wang X, Zhao L (2019) Sodium fluoride (NaF) induces inflammatory responses via activating MAPKs/NF-κB signaling pathway and reducing anti-inflammatory cytokine expression in the mouse liver. Biol Trace Elem Res 189(1):157–171 Hanahan D, Weinberg RA (2011) Hallmarks of cancer: the next generation. Cell 144(5):646–674 Mantovani A (2018) The inflammation-cancer connection. FEBS J 285(4):638–640 Mariko M (2018) Inflammation and cancer. Environ Health Prev 23(1):50 Albulescu R, Codrici E, Popescu ID, Mihai S, Necula LG, Petrescu D, Teodoru M, Tanase CP (2013) Cytokine patterns in brain tumor progression. Mediat Inflamm 2013: 979748 Marques P, Barry S, Carlsen E, Collier D, Ronaldson A, Awad S, Dorward N, Grieve J, Mendoza N, Muquit S, Grossman AB, Balkwill F, Korbonits M (2019) Pituitary tumor fibroblast-derived cytokines influence tumor aggressiveness. Endocr-Relat Cancer 26(12):853–865 Wang HW, Liu J, Zhao WP, Zhang ZH, Li SQ, Li SH, Zhu SQ, Zhou BH (2019) Effect of fluoride on small intestine morphology and serum cytokine contents in rats. Biol Trace Elem Res 189(2):511–518 Wang HW, Zhou BH, Cao JW, Zhao J, Zhao WP, Tan PP (2017) Pro-inflammatory cytokines are involved in fluoride-induced cytotoxic potential in HeLa cells. Biol Trace Elem Res 17(1):98–102 Zhang Y, Zhou BH, Tan PP, Chen Y, Miao CY, Wang HW (2020) Key role of pro-inflammatory cytokines in the toxic effect of fluoride on Hepa1-6 cells. Biol Trace Elem Res 197(1):115–122 Qi WH, Huang XJ, Wang JY (2013) Correlation between Th17 cells and tumor microenvironment. Cell Immunol 285(1–2):18–22 Shahid A, Bharadwaj M (2019) The connection between the Th17 cell related cytokines and cancer stem cells in cancer: novel therapeutic targets. Immunol Lett 213:9–20 Landskron G, De la Fuente M, Thuwajit P, Thuwajit C, Hermoso MA (2014) Chronic inflammation and cytokines in the tumor microenvironment. J Immunol Res 2014:149185 Kumari N, Dwarakanath BS, Das A, Bhatt AN (2016) Role of interleukin-6 in cancer progression and therapeutic resistance. Tumor Biol 37(9):11553–11572 Wang JS, Xu KY, Wu J, Luo CH, Li YC, Wu XB, Gao H, Feng GS, Yuan BZ (2012) The changes of Th17 cells and the related cytokines in the progression of human colorectal cancers. BMC Cancer 12:418 Dong C (2020) Seventeen on inflammation. Nat Immunol 21(8):821–822 Park H, Li ZX, Yang XO, Chang SH, Nurieva R, Wang YH, Wang Y, Hood L, Zhu Z, Tian Q, Dong C (2005) A distinct lineage of CD4 T cells regulates tissue inflammation by producing interleukin 17. Nat Immunol 6(11):1133–1141 Harrington LE, Hatton RD, Mangan PR, Turner H, Murphy TL, Murphy KM, Weaver CT (2005) Interleukin 17-producing CD4 + effector T cells develop via a lineage distinct from the T helper type 1 and 2 lineages. Nat Immunol 6(11):1123–1132 Lubberts E (2015) The IL-23-IL-17 axis in inflammatory arthritis. Nat Rev Rheumatol 11(7):415–429 Blake SJ, Teng MWL (2014) Role of IL-17 and IL-22 in autoimmunity and cancer. Actas Dermo-Sifiliogr 105(Suppl 1):41–50 Maniati E, Soper R, Hagemann T (2010) Up for Mischief IL-17/Th17 in the tumor microenvironment. Oncogene 29(42):5653–5662 Gillis EP, Eastman KJ, Hill MD, Donnelly DJ, Meanwell NA (2015) Applications of fluorine in medicinal chemistry. J Med Chem 58(21):8315–8359 Haranahalli K, Honda T, Ojima I (2019) Recent progress in the strategic incorporation of fluorine into medicinally active compounds. J Fluor Chem 217:29–40 Ameeramja J, Panneerselvam L, Govindarajan V, Jeyachandran S, Baskaralingam V, Perumal E (2016) Tamarind seed coat ameliorates fluoride induced cytotoxicity, oxidative stress, mitochondrial dysfunction and apoptosis in A549 cells. J Hazard Mater 301:554–565 Sakagami H, Sugimoto M, Tanaka S, Onuma H, Ota S, Kaneko M, Soga T, Tomita M (2014) Metabolomic profiling of sodium fluoride-induced cytotoxicity in an oral squamous cell carcinoma cell line. Metabolomics 10(2):270–279 Verma A, Ali D, Pathak AK (2017) Fluoride induces DNA damage and cytotoxicity in human hepatocellular carcinoma cells. Toxicol Environ Chem 99(1):148–159 Edwardson DW, Parissenti AM, Kovala AT (2019) Chemotherapy and inflammatory cytokine signalling in cancer cells and the tumour microenvironment. In: Ahmad A (ed) Breast Cancer Metastasis and Drug Resistance: Challenges and Progress, 2nd Edition, vol 1152. Advances in Experimental Medicine and Biology. Springer International Publishing Ag, Cham, pp 173–215 Hodge DR, Hurt EM, Farrar WL (2005) The role of IL-6 and STAT3 in inflammation and cancer. Eur J Cancer 41(16):2502–2512 Oh K, Lee OY, Park Y, Seo MW, Lee DS (2016) IL-1 beta induces IL-6 production and increases invasiveness and estrogen-independent growth in a TG2-dependent manner in human breast cancer cells. BMC Cancer 16:724 Zhao YF, Li YY, Wang JM, Manthari RK, Wang JD (2018) Fluoride induces apoptosis and autophagy through the IL-17 signaling pathway in mice hepatocytes. Arch Toxicol 92(11):3277–3289 Wei RF, Luo GY, Sun ZL, Wang SL, Wang JD (2016) Chronic fluoride exposure-induced testicular toxicity is associated with inflammatory response in mice. Chemosphere 153:419–425 Huo MJ, Han HJ, Sun ZL, Lu ZJ, Yao XL, Wang SL, Wang JD (2016) Role of IL-17 pathways in immune privilege: a RNA deep sequencing analysis of the mice testis exposure to fluoride. Sci Rep 6:32173 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5344252","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":373579533,"identity":"9635c7b0-ea11-4844-805a-21d00b93d5f4","order_by":0,"name":"Hong-wei Guo","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA9UlEQVRIiWNgGAWjYHACNgjFzHwMRCWACAkitbClkaqFgceMOC3yEcnHHnzcUZvYz87z7XFhm10ePwPzwds8DHZ5uLQY3khLN5x55njizGbe7cYz25KLJRvYkq15GJKLcWqZkWMmzdt2LHfDYd5tQAZz4oYDPGbSPAwHEhsIadl/mOcZkFGfuP8A/ze8WuQlwFpqcjcw87ABGYcTNzAAGfi0GPA8S5Oc2XagfsZhNqB7zh1PBDKMLecYJOO2pT35mMTHtjpj/v7Dz6R5yqoT+9ubH954U2GH25YDYOowkhAzWByHepAtELPqcKsYBaNgFIyCUQAAU7RSrsUaoeYAAAAASUVORK5CYII=","orcid":"","institution":"Henan University of Animal Husbandry and Economy","correspondingAuthor":true,"prefix":"","firstName":"Hong-wei","middleName":"","lastName":"Guo","suffix":""},{"id":373579534,"identity":"2bc2faa6-7bac-4915-938c-74b8dd17842f","order_by":1,"name":"Xiao-pan Wang","email":"","orcid":"","institution":"Henan University of Science and Technology","correspondingAuthor":false,"prefix":"","firstName":"Xiao-pan","middleName":"","lastName":"Wang","suffix":""},{"id":373579535,"identity":"21277e8d-8566-4bd3-b107-64c9cc2eda8a","order_by":2,"name":"Wen-peng Zhao","email":"","orcid":"","institution":"Henan University of Science and Technology","correspondingAuthor":false,"prefix":"","firstName":"Wen-peng","middleName":"","lastName":"Zhao","suffix":""},{"id":373579536,"identity":"b3248c5b-56e2-4cc4-9eaf-5f771c9adf78","order_by":3,"name":"Jing Zhao","email":"","orcid":"","institution":"Henan University of Science and Technology","correspondingAuthor":false,"prefix":"","firstName":"Jing","middleName":"","lastName":"Zhao","suffix":""},{"id":373579537,"identity":"9cdede66-2edc-4c39-a3b7-1d5c4aaa8218","order_by":4,"name":"Hua-wei Li","email":"","orcid":"","institution":"Henan University of Animal Husbandry and Economy","correspondingAuthor":false,"prefix":"","firstName":"Hua-wei","middleName":"","lastName":"Li","suffix":""},{"id":373579538,"identity":"02c91403-2c34-4565-a437-c24a404b45c6","order_by":5,"name":"Ming Zheng","email":"","orcid":"","institution":"Henan University of Animal Husbandry and Economy","correspondingAuthor":false,"prefix":"","firstName":"Ming","middleName":"","lastName":"Zheng","suffix":""}],"badges":[],"createdAt":"2024-10-28 05:53:07","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5344252/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5344252/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":68476068,"identity":"458f3832-29a4-4330-864d-14260bac1db8","added_by":"auto","created_at":"2024-11-07 16:01:53","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":60657,"visible":true,"origin":"","legend":"\u003cp\u003eThe volcano plot and cluster heat map of differential expression proteins (DEPs) in Hepa1-6 cells after fluoride exposure. TRUE presented DEPs. (A) 1 mmol/L F ion group compared with control group.(B) 2 mmol/L F ion group compared with control group. (C) 2 mmol/L F ion group compared with 1 mmol/L F ion group. (D) Cluster heat map comparing the protein expression patterns of 2 mmol/L F ion group compared with control group. (E) Cluster heat map comparing the protein expression patterns of 2 mmol/L F ion group compared with 1 mmol/L F ion group.\u003c/p\u003e","description":"","filename":"Onlinefloatimage110.png","url":"https://assets-eu.researchsquare.com/files/rs-5344252/v1/a775ef1b0905b9518fff0bf6.png"},{"id":68475831,"identity":"047137f2-bea2-4af2-98b7-3faa0414716a","added_by":"auto","created_at":"2024-11-07 15:53:52","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":59187,"visible":true,"origin":"","legend":"\u003cp\u003eThe volcano plot and cluster heat map of differential expression proteins (DEPs) in Hepa1-6 cells after fluoride exposure. TRUE presented DEPs. (A) 1 mmol/L F ion group compared with control group.(B) 2 mmol/L F ion group compared with control group. (C) 2 mmol/L F ion group compared with 1 mmol/L F ion group. (D) Cluster heat map comparing the protein expression patterns of 2 mmol/L F ion group compared with control group. (E) Cluster heat map comparing the protein expression patterns of 2 mmol/L F ion group compared with 1 mmol/L F ion group.\u003c/p\u003e","description":"","filename":"Onlinefloatimage212.png","url":"https://assets-eu.researchsquare.com/files/rs-5344252/v1/201d42681fc8ee7261b8c83a.png"},{"id":68475835,"identity":"504b0149-1fb5-4629-a1ce-db81c40acf84","added_by":"auto","created_at":"2024-11-07 15:53:53","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":60044,"visible":true,"origin":"","legend":"\u003cp\u003eKyoto Encyclopedia of Genes and Genomes analysis of the DEPs in Hepa1-6 cells when 2 mmol/L F ion group compared with control group.\u003c/p\u003e","description":"","filename":"Onlinefloatimage311.png","url":"https://assets-eu.researchsquare.com/files/rs-5344252/v1/6f76c66b86abf7492061acbc.png"},{"id":68475832,"identity":"88160e13-0662-436a-b8b0-72c48219a0c0","added_by":"auto","created_at":"2024-11-07 15:53:53","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":113845,"visible":true,"origin":"","legend":"\u003cp\u003eReal time PCR analysis of cytokines in Hepa1-6 cells. (A)-(F) mRNA relative expression of IL-1β, IL-2, IL-5, TGF-β1, IL-6 and IL-17F in Hepa1-6 cells. \u003csup\u003e*\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 or \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 was considered significant difference.\u003c/p\u003e","description":"","filename":"Onlinefloatimage47.png","url":"https://assets-eu.researchsquare.com/files/rs-5344252/v1/23f4eda388391c39d97eacb2.png"},{"id":71711025,"identity":"b05b748f-52f6-4a56-a877-df375a9782c0","added_by":"auto","created_at":"2024-12-18 02:16:52","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":831458,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5344252/v1/9257be32-52e0-4977-974a-382da8115e1f.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Effect of fluoride on the expression of Th17-related cytokines profiles in Hepa1-6 cells","fulltext":[{"header":"Introduction","content":"\u003cp\u003eFluorine (F) is one of the highly reactive elements with the highest electronegativity. F exists in combination with other elements such as fluoride, and is widely distributed in the natural environment [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Fluoride-containing drinking water is the main source of fluoride in the human body [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Due to the extremely narrow margin of safety, long-term exposure to fluoride can cause diverse adverse effects which could induce a serious public health problem [\u003cspan additionalcitationids=\"CR6\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Previous studies have evidenced that fluoride can cause damage to many organs and tissues, among which dental and skeletal fluorosis are well-known [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. In recent years, a lot of literatures reported that fluoride has strong cytotoxicity. Inflammation and abnormal cytokine secretion may play an important role in fluoride-induced cytotoxicity and tissue damage [\u003cspan additionalcitationids=\"CR11\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eInflammation was recognized as the eighth hallmark of cancer [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Inflammatory cells and cytokines are indispensable components of the tumor microenvironment. Chronic inflammation can promote tumor progression and carcinogenesis by recruiting inflammatory cells into the tumor microenvironment [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Tumor-derived cytokines regulate multicellular cross-talk, influence tumor aggressiveness, and inhibit the release of cytokines, which play a key role in anti-tumor [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Fluoride can induce inflammation in diverse organ and tissue, such as lung, cardiac muscle, and testis [\u003cspan additionalcitationids=\"CR11\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Our previous studies have demonstrated that excessive fluoride induced a trend of decline cytokine contents in the serum of rat and decreased the expression of pro-inflammatory cytokines in HeLa and Hepa1-6 cells [\u003cspan additionalcitationids=\"CR19\" citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. T helper 17 (Th17)-related cytokines are inflammatory factors that play an important role in mediating tumorigenesis and progression [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Several inflammatory mediators, including tumor necrosis factor (TNF)-α, interleukin-6 (IL-6), IL-10, and transforming growth factor type beta 1 (TGF-β1) have been proven to be involved in the initiation and progression of cancer [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. It was indicated that an increasing trend of Th17 cells had been observed in human and mouse tumor tissues [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. However, the effect of fluoride on Th17-related cytokines expression profiles in Hepa1-6 cells is still unclear. In this study, to investigate the association between fluoride exposure and Th17-related cytokines, a fluoride-exposed Hepa1-6 cell model was established and the cytokine expression profile was determined by Th17-related protein array.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCell Culture\u003c/h2\u003e \u003cp\u003eHepa1-6 cells (Mouse hepatoma cell lines) were obtained from the cell bank of the Chinese Academy of Sciences, Beijing, China. Cells were seeded in culture flasks in DMEM Medium containing 10% fetal bovine serum and 1% penicillin-streptomycin and incubated at 37\u0026deg;C with an atmosphere containing 5% CO\u003csub\u003e2\u003c/sub\u003e. When the cell growth reached a confluence of 80% ~ 90%, the cells were detached from flasks using 0.25% trypsin (trypsinization) and seeded into six-well plates for 0, 1 and 2 mmol/L F ion exposure for 48 h. Then cell culture supernatant was collected for cytokine array assay.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eCytokine Array Assay and Data Analysis\u003c/h3\u003e\n\u003cp\u003eCell culture supernatant samples were performed for screening the Th17-related inflammatory cytokines via Mouse Th17 Array 1 Glass Slide (RayBiotech, Inc., Guangzhou, China) according to the manufacturer\u0026rsquo;s instructions. Briefly: (1) The captured antibodies of target cytokines were coated on the solid surface in advance. 100 \u0026micro;L of cell culture supernatant was added to each well and incubated at room temperature for 1\u0026thinsp;~\u0026thinsp;2 h. (2) The biotin-labeled detection antibody was added, which can recognize a different epitope of the target cytokine. (3) The cytokine-antibody-biotin complex was visualized by adding the streptavidin-conjugated Cy3 equivalent dye. (4) The signals were visualized via InnoScan 300 Microarray Scanner (Innopsys, France) at 532 nm wavelength. (5) Normalization of the raw data were obtained by capturing the spot densities with a laser scanner, and analyzed in excel-based Analysis Tool software. Gene ontology (GO) database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.geneontology.org/\u003c/span\u003e\u003cspan address=\"http://www.geneontology.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and Kyoto Encyclopedia of Genes and Genomes (KEGG) database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.genome.jp/kegg/\u003c/span\u003e\u003cspan address=\"http://www.genome.jp/kegg/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) were used to perform gene annotation and pathway analysis, respectively.\u003c/p\u003e \u003cp\u003eDifferential expression proteins (DEPs) in Hepa1-6 cells are defined as those with adjusted \u003cem\u003eP\u003c/em\u003e-value (adj. \u003cem\u003eP\u003c/em\u003e. Val) less than 0.05, and fold change over 1.2 or less than 0.83 (absolute logFC\u0026thinsp;\u0026gt;\u0026thinsp;0.263). TRUE was presented DEPs. The basic statistics used for significance analysis are moderated \u003cem\u003et\u003c/em\u003e-test.\u003c/p\u003e\n\u003ch3\u003eReal-time PCR Analysis\u003c/h3\u003e\n\u003cp\u003eThe collected cells were added to 1 mL of TRIZOL and placed on ice for cracking, followed by 0.2 mL of chloroform, violently shook for 15 s, left for 5 min, and centrifuged at 4 \u003csup\u003eo\u003c/sup\u003eC at 12, 000\u0026times;\u003cem\u003eg\u003c/em\u003e for 15 min. After water phase extraction, total RNA extraction was carried out according to the kit instructions. The samples were then synthesized according to cDNA synthesis kit. The gene expression was detected by real-time PCR, and GAPDH was used as the steward gene. The primers are shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequence\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSize (bp)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGCTATGAAGTTCCTCTCTGC\u003c/p\u003e \u003cp\u003eCTGTGAAGTCTCCTCTCCGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e113\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-17F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGAAGAAGCAGCCATTGGAG\u003c/p\u003e \u003cp\u003eGCTGCTACCTCCCTCAGAAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e111\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCACCGAGCTCTGTTGACAAG\u003c/p\u003e \u003cp\u003eCCCCACGGACAGTTTGATTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e127\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTGF-β1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAAGGACCTGGGTTGGAAGT\u003c/p\u003e \u003cp\u003eCCGGGTTGTGTTGGTTGTAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e137\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-1β\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCCCATCCTCTGTGACTCAT\u003c/p\u003e \u003cp\u003eTCAGCTCATATGGGTCCGAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e131\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGGAACCTGAAACTCCCCAG\u003c/p\u003e \u003cp\u003eAAATCCAGAACATGCCGCAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e122\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAAGAAGGTGGTGAAGCAGG\u003c/p\u003e \u003cp\u003eAGGTGGAAGAGTGGGAGTTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e110\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eDifferential Cytokines Expression in Hepa1-6 Cells\u003c/h2\u003e \u003cp\u003eThe distribution of DEPs was presented in volcano plot (Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, B and C). As shown in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, TGF-β1 expression level was significantly down-regulated in the 1 mmol/L F ion group compared with control group. In the 2 mmol/L F ion group, 7 DEPs were detected, of which 2 DEPs (IL-6 and IL-17F) were up-regulated, and 5 DEPs (IL-5, IL-10, TGF-β1, IL-1β and IL-2) were down-regulated compared with the control group (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Compared with the 1 mmol/L F ion group, 2 DEPs were detected (up-regulated IL-6 and down-regulated IL-5) in the 2 mmol/L F ion group (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe effect of 1 mmol/L F ion on Th17-related cytokines expression in Hepa1-6 cells\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eProtein ID\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003elogFC\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eP.Value\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eadj.P.Val\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eFold change\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eRegulation\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eThreshold\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTGF-β1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-0.3028\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.0023\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0420\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.8107\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003edown\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eTRUE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-17F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.2793\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.0110\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0662\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.2136\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eup\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFALSE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTNF-α\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-0.3185\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.0088\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0662\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.8019\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003edown\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFALSE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-0.2775\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.0398\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.1793\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.8250\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003edown\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFALSE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-0.1722\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.0997\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.2272\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.8875\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003edown\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFALSE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.2231\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.0711\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.2272\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.1672\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eup\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFALSE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-0.1397\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.1010\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.2272\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.9077\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003edown\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFALSE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.1840\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.0793\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.2272\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.1360\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eup\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFALSE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-0.1175\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.1307\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.2615\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.9218\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003edown\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFALSE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-0.1734\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.1685\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.2909\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.8867\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003edown\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFALSE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMIP-3α\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-0.0883\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.1778\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.2909\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.9406\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003edown\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFALSE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIFN-γ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-0.0874\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.2232\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.3348\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.9412\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003edown\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFALSE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-1β\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-0.0821\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.4175\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.5404\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.9447\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003edown\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFALSE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.1142\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.4203\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.5404\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.0824\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eup\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFALSE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-28A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-0.0571\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.4582\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.5499\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.9612\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003edown\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFALSE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-17A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.0782\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.5675\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.6385\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.0557\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eup\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFALSE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.1590\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.9413\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.9777\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.1165\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eup\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFALSE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-0.0026\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.9777\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.9777\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.9982\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003edown\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFALSE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"7\"\u003eNote: TRUE and FALSE are presented DEPs and not DEPs, respectively. (1 mmol/L F ion group compared with control group)\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe effect of 2 mmol/L F ion on Th17-related cytokines expression in in Hepa1-6 cells\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eProtein ID\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003elogFC\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eP.Value\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eadj.P.Val\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eFold change\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eRegulation\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eThreshold\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1.6177\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.0000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e3.0688\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eup\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eTRUE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-0.4887\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.0000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0001\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.7127\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003edown\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eTRUE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-0.3282\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.0011\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.7965\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003edown\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eTRUE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTGF-β1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-0.3357\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.0011\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.7924\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003edown\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eTRUE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-17F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.3365\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.0034\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0122\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.2627\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eup\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eTRUE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-1β\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-0.3049\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.0080\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0240\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.8095\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003edown\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eTRUE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-0.2760\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.0136\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0351\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.8259\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003edown\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eTRUE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.2258\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.0247\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0545\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.1694\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eup\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFALSE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIFN-γ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-0.1655\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.0303\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0545\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.8916\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003edown\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFALSE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTNF-α\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-0.2552\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.0286\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0545\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.8379\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003edown\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFALSE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-0.2740\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.0380\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0622\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.8270\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003edown\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFALSE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-28A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-0.1269\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.1128\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.1692\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.9158\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003edown\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFALSE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.2093\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.1507\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.2087\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.1561\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eup\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFALSE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMIP-3α\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-0.0787\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.2262\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.2908\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.9469\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003edown\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFALSE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-0.1413\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.2672\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.3206\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.9067\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003edown\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFALSE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.1063\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.2922\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.3287\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.0765\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eup\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFALSE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.2942\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.8917\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.9442\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.2262\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eup\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFALSE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-17A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-0.0043\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.9745\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.9745\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.9970\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003edown\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFALSE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"7\"\u003eNote: TRUE and FALSE are presented DEPs and not DEPs, respectively. (2 mmol/L F ion group compared with control group)\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe effect of 2 mmol/L F ion on Th17-related cytokines expression in Hepa1-6 cells compared with 1 mmol/L F ion\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eProtein ID\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003elogFC\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eP.Value\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eadj.P.Val\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eFold change\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eRegulation\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eThreshold\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1.3946\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.0000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e2.6292\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eup\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eTRUE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-0.3711\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.0002\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0017\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.7732\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003edown\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eTRUE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.2283\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.0234\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.1405\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.1715\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eup\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFALSE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-1β\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-0.2227\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.0402\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.1448\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.8569\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003edown\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFALSE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-0.1885\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.0329\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.1448\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.8775\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003edown\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFALSE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-0.1038\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.3056\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.6688\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.9306\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003edown\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFALSE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.1362\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.2839\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.6688\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.0990\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eup\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFALSE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-0.1006\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.4135\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.6688\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.9327\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003edown\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFALSE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-0.0777\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.4371\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.6688\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.9476\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003edown\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFALSE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-17A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-0.0825\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.5465\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.6688\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.9444\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003edown\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFALSE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-17F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.0572\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.5573\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.6688\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.0404\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eup\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFALSE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.0951\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.5008\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.6688\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.0681\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eup\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFALSE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-28A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-0.0697\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.3677\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.6688\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.9528\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003edown\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFALSE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIFN-γ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-0.0782\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.2733\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.6688\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.9473\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003edown\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFALSE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTNF-α\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.0634\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.5533\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.6688\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.0449\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eup\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFALSE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTGF-β1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-0.0329\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.6911\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.7778\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.9774\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003edown\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFALSE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMIP-3α\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.0095\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.8802\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.9320\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.0066\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eup\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFALSE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.1352\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.9501\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.9501\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.0982\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eup\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFALSE\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"7\"\u003eNote: TRUE and FALSE are presented DEPs and not DEPs, respectively. (2 mmol/L F ion group compared with 1 mmol/L F ion group)\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eClustering heatmap was applied to the microarray data analysis. Figure\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD showed a clear separation between 2 mmol/L F ion group and control group. Obviously, upregulated IL-6 and downregulated IL-5 were observed in the 2 mmol/L F ion group compared with that of 1 mmol/L F ion group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eGO Analysis\u003c/h2\u003e \u003cp\u003eFigure\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e showed GO function classification of the DEPs in the 2 mmol/L F ion group compared with the control group. These DEPs were involved in the following biological processes: positive regulation of protein secretion, positive regulation of peptide secretion, positive regulation of secretion by cell, regulation of protein secretion, positive regulation of protein transport, positive regulation of establishment of protein localization, regulation of peptide secretion, positive regulation of secretion, regulation of lymphocyte proliferation and regulation of mononuclear cell proliferation. Among them, positive regulation of protein secretion and positive regulation of peptide secretion accounted for higher percent. Molecular function analysis showed that DEPs were associated with cytokine activity, cytokine receptor binding, receptor ligand activity, growth factor receptor binding, growth factor activity, IL-2 receptor binding, type Ⅱ transforming growth factor beta receptor (TGFβRⅡ) binding, IL-6 receptor binding, opioid receptor binding and TGFβRⅠ binding. Among them cytokine activity, cytokine receptor binding and receptor ligand activity accounted for higher percent (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA and B).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eKEGG Analysis\u003c/h3\u003e\n\u003cp\u003eVia KEGG analysis, DEPs in 2 mmol/L F ion group were involved in 12 pathways compared with the control group, including inflammatory bowel disease (IBD), Intestinal immune network for IgA production, Cytokine-cytokine receptor interaction, Th17 cell differentiation and Chagas disease (American trypanosomiasis), Malaria, IL-17 signaling pathway, Amoebiasis, C-type lectin receptor signaling pathway, African trypanosomiasis, JAK-STAT signaling pathway and Tuberculosis (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Among them, IL-17 signaling pathway and JAK-STAT signaling pathway are involved in fluoride-induced immunotoxicity and tumor growth, respectively.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003emRNA expression of cytokines in Hepa1-6 cells\u003c/h3\u003e\n\u003cp\u003eFigure\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e showed that the mRNA expression changes of IL-1β, IL-2, IL-5, TGF-β1, IL-6 and IL-17F in Hepa1-6 cells after fluoride treatment. Compared with the control group, the mRNA expression level of TGF-β1 was down-regulated in the 1 mmol/L F ion and 2 mmol/L F ion group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 or \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), and the mRNA expression levels of IL-5, IL-10, IL-1β and IL-2 were down-regulated in the 2 mmol/L F ion group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e, P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). However, the mRNA expression levels of IL-6 and IL-17F were up-regulated in the 2 mmol/L F ion group compared with the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e, P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Besides, the mRNA expression of up-regulated IL-6 and down-regulated IL-5 in the 2 mmol/L F ion group were significant difference when compared with the 1 mmol/L F ion group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn October 2005, the research group of Chen Dong and Casey T Weaver identified a third type of helper T cells which produced the cytokine IL-17, named Th17 cell, and played an important role in autoimmune diseases and inflammatory regulation [\u003cspan additionalcitationids=\"CR27\" citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. The cytokine IL-17 has been found to be closely related to autoimmune diseases, in particular rheumatoid arthritis [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Recently, emerging evidence has pointed to the critical role of Th17 cell-related cytokines in the pathogenesis of cancer [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Th17-related cytokines involved in cancer progression by enhancing the angiogenesis and tumor immune evasion [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Fluoride, an effective caries prophylactic, has been widely studied for its contribution to drug design and development. The extremely high electronegativity of F contributes to the effect and stability of different drugs in the body [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Therefore, fluorinated drugs have been used in various medicines such as anesthetics, antibiotics, anti-cancer and anti-inflammatory agents. Besides, it is reported that F-containing anticancer drugs have higher activity to resist the progression of cancer [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIt makes a lot of sense to elucidate the expression patterns of Th17-related cytokines in the pathogenesis of disease, especially in tumorigenesis, which will provide new ideas for the prevention and treatment of cancer. There is growing evidence that fluoride could inhibit the viability of cancer cell [\u003cspan additionalcitationids=\"CR35\" citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. However, it remains unknown whether the inhibition of fluoride on the cancer cells proliferation is related to Th17 related cytokines. This study showed that fluoride caused the IL-6 and IL-17F upregulation and IL-5, IL-10, TGF-β1, IL-1β and IL-2 downregulation in the 2 mmol/L F ion group compared with the control group. Obviously, fluoride can induce Th17-related cytokine secretion disorder.\u003c/p\u003e \u003cp\u003eThe expression of IL-6 in the tumor microenvironment is higher than in normal microenvironment. Resistance to multiple chemotherapy drugs (multidrug resistance) has been correlated with IL-6 over-expression in multiple cancer cells [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. The up-regulation of IL-6 induced by anticancer therapies could influence and regulate nearly all hallmarks of cancer, contributing to therapeutic resistance, finally leading to tumor regrowth, invasion, and angiogenesis [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. In addition, IL-6 can activate the JAK/STAT signaling pathway by binding to its receptor (IL-6R), resulting in the promotion of tumor growth [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. The JAK/STAT pathway was found in this study indicated that the up-regulation of IL-6 may involve in the resistance of fluoride-induced cytotoxicity. IL-1β is a typical pro-inflammatory cytokine, and the increased expression of IL-1β has been found in the microenvironment of invasive tumors [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. In this study, the up-regulation of IL-6 and down-regulation of IL-1β may involve in the fluoride induced Hepa1-6 cells damage and growth inhibition, which is consistent with our previous findings [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eA recent study has proved that fluoride can activate the IL-17 signaling pathway, induce apoptosis and autophagy, and eventually lead to liver damage [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Also, fluoride significantly increased the mRNA levels of IL-17 and IL-17 receptor C in mice testis [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. RNA deep sequencing analysis also confirmed that the high expressions of the IL-17 signal pathway relative molecules involved in immune privilege of testis after fluoride exposure [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. In the present study, KEGG pathway analysis revealed that fluoride-induced DEPs are associated with IL-17 pathway. The increased expression of IL-17F may be one of the evidence for fluoride-induced cells damage, further inhibit the growth and development of Hepa1-6 cells [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Additionally, the biological processes and cellular component of fluoride-induced DEPs was provided by GO analysis.\u003c/p\u003e \u003cp\u003eTaken together, results presented in this study indicate that Th17-related cytokine secretion disorder could contribute to cytotoxicity induced by fluoride. It is speculated that fluoride may be used as a potential anticancer agent by targeting Th17-related cytokines in tumor microenvironment.\u003c/p\u003e"},{"header":"Declarations","content":" \u003ch2\u003eConflicts of interest\u003c/h2\u003e \u003cp\u003eThe authors declare that there is no conflict of interest.\u003c/p\u003e \u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eHong-wei Guo, Ideas, Formulation, or evolution of overarching research goals and aims, Methodology, Funding acquisition, Review \u0026amp; Editing and Project administration. Xiao-pan Wang, Writing-Original Draf, Software, Validation, Formal analysis, Data Curation. Wen-peng Zhao, Creation of cell culture model. Jing Zhao, Performing the experiments, Formal analysis, Data Curation. Hua-wei Li and Ming Zheng, Provision of study materials, Reagents.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eThis work was supported by the Science and Technology Department of Henan Province, China (grant no. 182102110021).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003ePeckham S, Awofeso N (2014) Water fluoridation: a critical review of the physiological effects of ingested fluoride as a public health intervention. Sci World J 293019\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVithanage M, Bhattacharya P (2015) Fluoride in the environment: sources, distribution and defluoridation. Environ Chem Lett 13(2):131\u0026ndash;147\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSharma D, Singh A, Verma K, Paliwal S, Sharma S, Dwivedi J (2017) Fluoride: a review of pre-clinical and clinical studies. Environ Toxicol Phar 56:297\u0026ndash;313\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDharmaratne RW (2015) Fluoride in drinking water and diet: the causative factor of chronic kidney diseases in the North Central Province of Sri Lanka. Environ Health Prev 20(4):237\u0026ndash;242\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJha SK, Mishra VK, Sharma DK, Damodaran T (2011) Fluoride in the environment and its metabolism in humans. In: whitacre DM (ed) reviews of environmental contamination and toxicology. Reviews of Environmental Contamination and Toxicology, vol 211. Springer, New York, pp 121\u0026ndash;142\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGhosh A, Mukherjee K, Ghosh SK, Saha B (2013) Sources and toxicity of fluoride in the environment. Res Chem Intermediat 39(7):2881\u0026ndash;2915\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang JD (2019) Fluoride-induced reproductive toxicity. Fluoride 52(1):81\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJohnston NR, Strobel SA (2020) Principles of fluoride toxicity and the cellular response: a review. Arch Toxicol 94(4):1051\u0026ndash;1069\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZuo H, Chen L, Kong M, Qiu LP, Lu P, Wu P, Yang YH, Chen KP (2018) Toxic effects of fluoride on organisms. Life Sci 198:18\u0026ndash;24\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQuadri JA, Sarwar S, Pinky, Kar P, Singh S, Mallick SR, Arava S, Nag TC, Roy TS, Shariff A (2018) Fluoride induced tissue hypercalcemia, IL-17 mediated inflammation and apoptosis lead to cardiomyopathy: ultrastructural and biochemical findings. Toxicology 406:44\u0026ndash;57\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAmeeramja J, Perumal E (2018) Possible modulatory effect of tamarind seed coat extract on fluoride-induced pulmonary inflammation and fibrosis in rats. Inflammation 41(3):886\u0026ndash;895\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen LL, Kuang P, Liu H, Wei Q, Cui HM, Fang J, Zuo ZC, Deng JL, Li YL, Wang X, Zhao L (2019) Sodium fluoride (NaF) induces inflammatory responses via activating MAPKs/NF-κB signaling pathway and reducing anti-inflammatory cytokine expression in the mouse liver. Biol Trace Elem Res 189(1):157\u0026ndash;171\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHanahan D, Weinberg RA (2011) Hallmarks of cancer: the next generation. Cell 144(5):646\u0026ndash;674\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMantovani A (2018) The inflammation-cancer connection. FEBS J 285(4):638\u0026ndash;640\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMariko M (2018) Inflammation and cancer. Environ Health Prev 23(1):50\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlbulescu R, Codrici E, Popescu ID, Mihai S, Necula LG, Petrescu D, Teodoru M, Tanase CP (2013) Cytokine patterns in brain tumor progression. Mediat Inflamm 2013: 979748\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarques P, Barry S, Carlsen E, Collier D, Ronaldson A, Awad S, Dorward N, Grieve J, Mendoza N, Muquit S, Grossman AB, Balkwill F, Korbonits M (2019) Pituitary tumor fibroblast-derived cytokines influence tumor aggressiveness. Endocr-Relat Cancer 26(12):853\u0026ndash;865\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang HW, Liu J, Zhao WP, Zhang ZH, Li SQ, Li SH, Zhu SQ, Zhou BH (2019) Effect of fluoride on small intestine morphology and serum cytokine contents in rats. Biol Trace Elem Res 189(2):511\u0026ndash;518\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang HW, Zhou BH, Cao JW, Zhao J, Zhao WP, Tan PP (2017) Pro-inflammatory cytokines are involved in fluoride-induced cytotoxic potential in HeLa cells. Biol Trace Elem Res 17(1):98\u0026ndash;102\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Y, Zhou BH, Tan PP, Chen Y, Miao CY, Wang HW (2020) Key role of pro-inflammatory cytokines in the toxic effect of fluoride on Hepa1-6 cells. Biol Trace Elem Res 197(1):115\u0026ndash;122\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQi WH, Huang XJ, Wang JY (2013) Correlation between Th17 cells and tumor microenvironment. Cell Immunol 285(1\u0026ndash;2):18\u0026ndash;22\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShahid A, Bharadwaj M (2019) The connection between the Th17 cell related cytokines and cancer stem cells in cancer: novel therapeutic targets. Immunol Lett 213:9\u0026ndash;20\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLandskron G, De la Fuente M, Thuwajit P, Thuwajit C, Hermoso MA (2014) Chronic inflammation and cytokines in the tumor microenvironment. J Immunol Res 2014:149185\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumari N, Dwarakanath BS, Das A, Bhatt AN (2016) Role of interleukin-6 in cancer progression and therapeutic resistance. Tumor Biol 37(9):11553\u0026ndash;11572\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang JS, Xu KY, Wu J, Luo CH, Li YC, Wu XB, Gao H, Feng GS, Yuan BZ (2012) The changes of Th17 cells and the related cytokines in the progression of human colorectal cancers. BMC Cancer 12:418\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDong C (2020) Seventeen on inflammation. Nat Immunol 21(8):821\u0026ndash;822\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePark H, Li ZX, Yang XO, Chang SH, Nurieva R, Wang YH, Wang Y, Hood L, Zhu Z, Tian Q, Dong C (2005) A distinct lineage of CD4 T cells regulates tissue inflammation by producing interleukin 17. Nat Immunol 6(11):1133\u0026ndash;1141\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHarrington LE, Hatton RD, Mangan PR, Turner H, Murphy TL, Murphy KM, Weaver CT (2005) Interleukin 17-producing CD4\u0026thinsp;+\u0026thinsp;effector T cells develop via a lineage distinct from the T helper type 1 and 2 lineages. Nat Immunol 6(11):1123\u0026ndash;1132\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLubberts E (2015) The IL-23-IL-17 axis in inflammatory arthritis. Nat Rev Rheumatol 11(7):415\u0026ndash;429\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBlake SJ, Teng MWL (2014) Role of IL-17 and IL-22 in autoimmunity and cancer. Actas Dermo-Sifiliogr 105(Suppl 1):41\u0026ndash;50\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eManiati E, Soper R, Hagemann T (2010) Up for Mischief IL-17/Th17 in the tumor microenvironment. Oncogene 29(42):5653\u0026ndash;5662\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGillis EP, Eastman KJ, Hill MD, Donnelly DJ, Meanwell NA (2015) Applications of fluorine in medicinal chemistry. J Med Chem 58(21):8315\u0026ndash;8359\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHaranahalli K, Honda T, Ojima I (2019) Recent progress in the strategic incorporation of fluorine into medicinally active compounds. J Fluor Chem 217:29\u0026ndash;40\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAmeeramja J, Panneerselvam L, Govindarajan V, Jeyachandran S, Baskaralingam V, Perumal E (2016) Tamarind seed coat ameliorates fluoride induced cytotoxicity, oxidative stress, mitochondrial dysfunction and apoptosis in A549 cells. J Hazard Mater 301:554\u0026ndash;565\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSakagami H, Sugimoto M, Tanaka S, Onuma H, Ota S, Kaneko M, Soga T, Tomita M (2014) Metabolomic profiling of sodium fluoride-induced cytotoxicity in an oral squamous cell carcinoma cell line. Metabolomics 10(2):270\u0026ndash;279\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVerma A, Ali D, Pathak AK (2017) Fluoride induces DNA damage and cytotoxicity in human hepatocellular carcinoma cells. Toxicol Environ Chem 99(1):148\u0026ndash;159\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEdwardson DW, Parissenti AM, Kovala AT (2019) Chemotherapy and inflammatory cytokine signalling in cancer cells and the tumour microenvironment. In: Ahmad A (ed) Breast Cancer Metastasis and Drug Resistance: Challenges and Progress, 2nd Edition, vol 1152. Advances in Experimental Medicine and Biology. Springer International Publishing Ag, Cham, pp 173\u0026ndash;215\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHodge DR, Hurt EM, Farrar WL (2005) The role of IL-6 and STAT3 in inflammation and cancer. Eur J Cancer 41(16):2502\u0026ndash;2512\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOh K, Lee OY, Park Y, Seo MW, Lee DS (2016) IL-1 beta induces IL-6 production and increases invasiveness and estrogen-independent growth in a TG2-dependent manner in human breast cancer cells. BMC Cancer 16:724\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao YF, Li YY, Wang JM, Manthari RK, Wang JD (2018) Fluoride induces apoptosis and autophagy through the IL-17 signaling pathway in mice hepatocytes. Arch Toxicol 92(11):3277\u0026ndash;3289\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWei RF, Luo GY, Sun ZL, Wang SL, Wang JD (2016) Chronic fluoride exposure-induced testicular toxicity is associated with inflammatory response in mice. Chemosphere 153:419\u0026ndash;425\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuo MJ, Han HJ, Sun ZL, Lu ZJ, Yao XL, Wang SL, Wang JD (2016) Role of IL-17 pathways in immune privilege: a RNA deep sequencing analysis of the mice testis exposure to fluoride. Sci Rep 6:32173\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Fluoride, Hepa1-6, Th17-related cytokines, Cancer, Immunity","lastPublishedDoi":"10.21203/rs.3.rs-5344252/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5344252/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eExcessive fluorine (F) ion has strong cytotoxicity and can cause inflammatory reaction. However, little is understood about associations between the secretion of T helper-17 (Th17)-related inflammatory factor and the risk of F ion-induced disorders in Hepa1-6 cells. In this study, Hepa1-6 cells were exposed to culture medium containing 0, 1 and 2 mmol/L F ion for 48 h, then the culture supernatant was subjected to detect the Th17-related inflammatory cytokines (macrophage inflammatory protein (MIP)-3α, interleukin (IL)-13, IL-21, transforming growth factor type beta 1 (TGF-β1), IL-17F, IL-5, IL-28A, IL-23, IL-22, IL-17A, IL-2, IL-4, IL-10, IL-1β, Interferon (IFN)-γ, IL-6, IL-12 and tumor necrosis factor (TNF)-α). The results showed that TGF-β1 as the only differential expression protein (DEP) was down-regulated in the 1 mmol/L F ion group when compared with the control group. However, 7 DEPs were detected in the 2 mmol/L F ion group, with 2 DEPs (IL-6 and IL-17F) were up-regulated and 5 DEPs (IL-5, IL-10, TGF-β1, IL-1β and IL-2) were down-regulated. Besides, the expressions of up-regulated IL-6 and down-regulated IL-5 in the 2 mmol/L F ion group were significant difference when compared with the 1 mmol/L F ion group. Additionally, the Gene ontology (GO) database and Kyoto Encyclopedia of Genes and Genomes (KEGG) database were used to analyze the biological processes, cellular component and signaling pathways that DEPs are potentially involved in. Collectively, these data indicate that Th17-related cytokines expression pattern plays an important role in fluoride-induced cytotoxicity.\u003c/p\u003e","manuscriptTitle":"Effect of fluoride on the expression of Th17-related cytokines profiles in Hepa1-6 cells","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-11-07 15:53:48","doi":"10.21203/rs.3.rs-5344252/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"ba5c1b23-1e96-4a52-949a-62e41355213b","owner":[],"postedDate":"November 7th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-12-18T02:08:44+00:00","versionOfRecord":[],"versionCreatedAt":"2024-11-07 15:53:48","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5344252","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5344252","identity":"rs-5344252","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-22T02:00:06.705733+00:00
License: CC-BY-4.0