8β-glycyrrhetinic acid as major bioactive component of Glycyrrhiza glabra downregulates expression of CD44 and epithelial-mesenchymal transition markers and inhibits xenograft tumor growth in gastric cancer stem cells

8β-glycyrrhetinic acid as major bioactive component of Glycyrrhiza glabra downregulates expression of CD44 and epithelial-mesenchymal transition markers and inhibits xenograft tumor growth in gastric cancer stem cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article 8β-glycyrrhetinic acid as major bioactive component of Glycyrrhiza glabra downregulates expression of CD44 and epithelial-mesenchymal transition markers and inhibits xenograft tumor growth in gastric cancer stem cells Maede Sadat Rahnamaei, Ramiar Kamal Kheder, Omeed Darweesh, Seyedeh Mahya Shariat Razavi, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7312134/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background: Gastric cancer (GC) is a common malignancy with high rates of recurrence, metastasis, and drug resistance, often attributed to gastric cancer stem cells (CSCs). CD44, a surface marker upregulated in CSCs, plays a critical role in promoting epithelial-mesenchymal transition (EMT). 18β-glycyrrhetinic acid (GA), a major bioactive compound of Glycyrrhiza glabra, has known anti-inflammatory and anticancer properties. This study aimed to investigate the effects of GA on CD44 expression, EMT markers, and tumor growth in gastric CSCs. Methods and Results: Gastric CSCs were cultured in serum-free medium with EGF and B-27 under nonadherent conditions and treated with varying GA concentrations (20–160 µM) for 24, 48, and 72 hours. Cell viability was assessed using the MTT assay. mRNA expression levels of CD44, Bcl-2, and EMT markers (ZEB-1 and Snail-1) were measured by real-time PCR, while CD44 protein expression was analyzed by flow cytometry. GA’s effect on tumor growth was evaluated in a xenograft mouse model. Statistical analyses included one-way ANOVA and paired t-tests, with p ≤ 0.05 considered significant. GA reduced gastric CSC viability in a time- and dose-dependent manner. Treatment with 60 µM GA significantly downregulated the mRNA expression of CD44, Bcl-2, ZEB-1, and Snail-1, and reduced surface CD44 protein expression at 48 and 72 hours. In vivo, GA treatment inhibited tumor growth and significantly reduced tumor volume in mice. Conclusions: GA inhibits gastric CSC proliferation and tumor growth, potentially by suppressing EMT-related pathways via downregulation of CD44. These findings support further investigation of GA as a candidate for CSC-targeted gastric cancer therapies. Cancer stem cells 18ß-glycyrrhetinic acid CD44 EMT markers Bcl-2 Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Gastric cancer (GC) is the fifth most common and lethal malignancy worldwide and, according to GLOBOCAN 2020, the fourth leading cause of cancer-related deaths [ 1 ]. Although surgical techniques and chemotherapy for gastric cancer have advanced, chemoresistance still leads to metastasis and relapse after therapy [ 2 ]. Therefore, novel therapeutic strategies for gastric cancer are urgently needed. Recent studies have shown that resistance to chemotherapy, invasion, and metastasis are mainly due to cancer stem cell (CSC) subpopulations within heterogeneous tumors [ 3 – 6 ]. CSCs can be identified by specific surface markers, including CD133, CD44, CD44/CD54, CD24/CD44, and CD166 [ 7 ]. Among these, the CD44 molecule—a transmembrane glycoprotein—is the most widely used marker for isolating CSCs from solid tumors [ 8 ]. CD44 + CSCs possess high proliferative, invasive, and migratory abilities, along with resistance to chemotherapy [ 9 ]. In fact, CD44 expression induces epithelial-mesenchymal transition (EMT), contributing to the generation, maintenance, migration, and invasion of CSCs [ 10 , 11 ]. Multiple signaling pathways are involved in maintaining CSCs; for instance, aberrant activation of STAT3 prevents apoptosis by upregulating anti-apoptotic Bcl-2 family genes such as BCL-xL, BCL-2, and MCL1 [ 12 ]. One component of Glycyrrhiza glabra L. (licorice) is glycyrrhizic acid, which is metabolized into the pentacyclic triterpenoid 18β-glycyrrhetinic acid (GA). GA exhibits numerous physiological and pharmacological activities, including antimicrobial [ 13 , 14 ], anti-inflammatory, and antitumor effects. Among its antitumor properties, GA inhibits cell proliferation, migration, and metastasis [ 15 ] and induces apoptosis [ 16 ]. In this study, we assessed the effect of GA on the expression of the CD44 molecule, the anti-apoptotic BCL-2 protein, and EMT markers (ZEB-1 and Snail-1) in gastric CSCs. Materials and methods Cell culture Gastric CSCs, previously isolated and identified from a gastric cancer patient [ 17 – 19 ] were cultured in suspension using DMEM/F12 medium (Gibco, USA) supplemented with 20 ng/ml human epidermal growth factor (EGF) (Biolegend, USA), 1% B-27 supplement (50X) (Gibco, USA), and 1% penicillin/streptomycin. Cells were plated into non-treated T-25 flasks (Corning, USA) and incubated in a humidified atmosphere containing 5% CO₂ at 37°C. Assessing the viability of gastric CSCs with various GA concentrations by MTT assay The cytotoxic activity of GA was assessed using the MTT assay. Gastric CSCs were seeded in non-treated 96-well plates (Corning, USA) at a density of 3×10⁴ cells/well in 100 µl of complete culture medium (DMEM/F12 supplemented with EGF, B-27, and penicillin/streptomycin) and incubated for 24 hours. Cells were then treated with different concentrations of GA (20–160 µM; Sigma, USA) for 24, 48 and 72 hours. After treatment, 20 µl of MTT solution (5 mg/ml; Sigma, USA) was added to each well and incubated for 4 hours at 37°C. Subsequently, 100 µl of DMSO (Sigma, USA) was added to dissolve the formazan crystals, and the plates were gently shaken at room temperature for 70 minutes. Absorbance was measured at 570 and 630 nm using a microplate spectrophotometer (BioTek Epoch, USA). RNA extraction, cDNA synthesis, and Quantitative real-time PCR RNA extraction, cDNA synthesis, and Quantitative real-time PCR Gastric CSCs were cultured in non-treated 6-well plates (Corning, USA) at a density of 7×10⁵ cells/ml and treated with 60 µM GA for 48 and 72 hours. Total RNA was extracted using TRIzol™ Reagent (Gibco, USA), and cDNA was synthesized using the Easy cDNA Ultra-TM Synthesis Kit (Parstous, Iran). Quantitative real-time PCR (qRT-PCR) was performed using SolisFAST® SolisGreen® qPCR Mix (Solis BioDyne, Estonia). The sequences of the primers are listed in Table 1. qRT-PCR was carried out using a Thermal Cycler (Applied Biosystems, USA). Relative mRNA expression levels were calculated using the 2^−ΔΔCt method, with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as the endogenous control. Detection of surface marker CD44 using flow cytometry Gastric CSCs were cultured in non-treated 6-well plates at a density of 1×10⁶ cells/ml and treated with 60 µM GA for 48 and 72 hours. Following trypsinization and washing with phosphate-buffered saline (PBS; Sigma, USA), cells were resuspended in PBS and incubated for 30 minutes in the dark with APC-conjugated mouse anti-human CD44 antibody (BD Biosciences, USA). Cells were then washed three times with PBS and finally resuspended in 800 µl of PBS. Fluorescence intensity was analyzed using a CyFlow Cube6 flow cytometer (Sysmex, Germany). GA effect on tumor volume in vivo All animal experiments were performed in accordance with the ARRIVE guidelines 2.0 for reporting animal research. The study protocol was approved by the Specialized Ethics Committee for Working with Laboratory Animals of Birjand University of Medical Sciences (IR.BUMS.AEC). Gastric CSCs (1×10⁶ cells/ml) were subcutaneously injected into the right flank of male nude mice (C57BL/6 strain), aged 4–6 weeks (15–20 grams). A total of 18 mice were randomly divided into three groups (n = 6 per group): (1) CSCs + GA treatment group, (2) CSCs without GA control group, and (3) Matrigel-only group without cells. Cells were suspended in serum-free DMEM (Sigma-Aldrich, USA) containing GA (120 µM) mixed with Matrigel (1:1 ratio; Sigma-Aldrich) for the treated group or in DMEM/Matrigel (1:1) for the untreated control group. Each injection used 100 µl delivered with a microsyringe at the North Research Center, Pasteur Institute of Iran. Tumor growth was monitored weekly, and tumor volume (mm³) was calculated using the formula: 0.5 × D₁² × D₂, where D₁ and D₂ represent the width (larger diameter) and length (smaller diameter) of the tumor, respectively. For humane endpoint, tumor-bearing mice were euthanized by intraperitoneal injection of ketamine (80–100 mg/kg) and xylazine (10 mg/kg) followed by placement in a desiccator to induce death by hypoxia before recovery from anesthesia. Statistical analysis Statistical analyses were performed using GraphPad Prism 10. Data are presented as mean ± SD (n = 3). MTT assay results were compared using one-way analysis of variance (ANOVA), and paired t-tests were used to assess differences in mRNA expression levels. A p-value ≤ 0.05 was considered statistically significant. Results GA inhibits growth of gastric CSCs . The inhibitory effects of GA on gastric CSCs were evaluated using the MTT assay. Our results demonstrated that GA inhibited cell proliferation in a dose- and time-dependent manner (Fig. 1). The IC₅₀ values of GA for gastric CSCs were 106 µM at 48 hours and 84 µM at 72 hours. Based on these findings, a concentration of 60 µM GA was selected for subsequent experiments. GA Reduces Expression Levels of CD44, Bcl-2, and EMT Markers, and Surface CD44 Protein in Gastric CSCs. Following exposure to 60 µM GA for 48 and 72 hours, the mRNA expression levels of CD44, Bcl-2, and EMT markers (ZEB-1 and Snail-1), as well as the protein expression of CD44, were significantly decreased compared to untreated cells (Figs. 2 and 3). GA Reduces Tumor Size In Vivo. Injection of a mixture of gastric CSCs with GA into nude mice resulted in inhibited tumor growth and a reduction in tumor volume compared to the untreated group (CSCs without GA) (Fig. 4). Discussion Gastric cancer (GC) is a highly malignant disease with a poor prognosis. Common treatments for GC include surgery and chemotherapy; however, due to tumor recurrence and metastasis, these therapies have not been very effective [ 20 ]. CSCs are considered a major cause of the inability to completely eradicate tumors because of their role in tumorigenesis, self-renewal, and pluripotency [ 21 ]. Therefore, therapies targeting CSCs are of great importance [ 22 ]. Plant-derived active ingredients have been proposed as potential therapeutic agents with possibly fewer side effects compared to conventional chemotherapy drugs [ 23 ]. In this study, we used 18β-glycyrrhetinic acid (GA), an active component of licorice root, to investigate its effects on inhibiting CSC growth both in vitro and in vivo. Additionally, we assessed the impact of GA on the expression of CD44, EMT markers, and the anti-apoptotic protein BCL-2 in gastric CSCs. Many studies have demonstrated the antitumor effects of GA on cancer cells. For example, exposure of colorectal cancer cell lines (LoVo, SW480, and SW620) to GA activated pro-apoptotic pathways and inhibited cell growth [ 16 ]. Similarly, GA inhibited the proliferation and induced apoptosis in various hepatocellular carcinoma (HCC) cell lines, including HepG2, SMMC-7721, HLF, HLE, Hep3B, and LM3 [ 24 ]. In ovarian cancer cells (SKOV3 and OVCAR3), GA and its derivatives suppressed CSC properties and induced apoptosis [ 25 ]. Hsu et al. also demonstrated that GA induced apoptosis in breast cancer cell lines (MCF-7 and T-47D) and inhibited tumor growth in vivo (BALB/c nude mice) [ 26 ]. Consistent with these findings, we showed that GA has antitumor activity against gastric CSCs, reducing their growth in vitro (Fig. 1) and in vivo (Fig. 4), and downregulating the expression of the anti-apoptotic gene BCL2. The cell surface adhesion receptor CD44 is a widely recognized marker for CSCs and plays a key role in regulating both CSC maintenance and the epithelial-mesenchymal transition (EMT) phenotype. Due to its involvement in both upstream and downstream signaling pathways that regulate stemness and EMT, CD44 is considered a valuable target for therapeutic intervention [ 27 ]. Thus, blockade or depletion of CD44 in CSCs results in the attenuation of the malignant phenotype, inhibition of cancer growth, and reduced resistance to therapy [ 28 ]. For example, overexpression of CD44 in SW480 colon cancer cells leads to the induction of EMT-related changes—such as increased expression of EGFR, activation of PI3K/Akt signaling, and changes in E-cadherin/β-catenin complex formation—whereas knockdown of CD44 results in the downregulation of EMT markers like fibronectin, α-actin, N-cadherin, and MT1-MMP [ 10 ]. Accumulating evidence suggests that GA can reduce CD44 expression and attenuate EMT-related changes. For instance, GA has been shown to upregulate miR-328, which subsequently reduces CD44 expression, thereby impairing cancer cell growth and reducing chemotherapy resistance [ 29 ]. Additionally, a GA derivative (compound 7c) was reported to downregulate CD44 expression in ovarian cancer cells [ 25 ]. Beyond its effects on CD44, GA influences EMT through several signaling pathways. Aberrant activation of the STAT3 pathway has been associated with the upregulation of EMT-related transcription factors such as ZEB, TWIST, and SNAIL [ 30 , 31 ]. GA has been shown to reduce STAT3 phosphorylation, thereby suppressing TGF-β-induced EMT [ 32 ]. Moreover, GA inhibited the migration of A549 lung cancer cells by modulating ROS/MAPK/STAT3/NF-κB signaling pathways; it simultaneously increased E-cadherin expression while decreasing the expression of N-cadherin, Snail-1, and vimentin [ 33 ]. In agreement with these studies, our data demonstrate that GA reduces the expression of CD44 and EMT markers (Snail-1 and ZEB-1) in gastric CSCs (Figs. 2 and 3). Conclusion In summary, considering the effects of GA on decreasing the expression of CD44, BCL-2, and EMT markers, along with its ability to inhibit xenograft tumor growth, and given the direct relationship between CD44 expression and EMT changes, it can be concluded that GA likely exerts its inhibitory function through one or more EMT signaling pathways dependent on CD44 expression. Abbreviations GC Gastric Cancer CSC Cancer Stem Cell EMT Epithelial-Mesenchymal Transition GA 18β-Glycyrrhetinic Acid DMEM/F12 Dulbecco's Modified Eagle Medium/Nutrient Mixture F-12 PBS Phosphate-Buffered Saline qRT-PCR Quantitative Real-Time Polymerase Chain Reaction GAPDH Glyceraldehyde-3-Phosphate Dehydrogenase Declarations Funding This work was financially supported by grants (455983 and 5207). Vahid Bagheriand Gholamreza Anani Sarab have received research support from Birjand University of Medical Sciences, Birjand, Iran. Competing interests The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Authors' contributions All authors contributed to the study conception and design . Maede sadat rahnamaei: Methodology, Validation, Investigation, Writing - Original Draft. Ramiar Kamal Kheder: Methodology, Investigation, Writing - Original Draft. Omeed Darweesh: Formal analysis, Resources, Writing - Original Draft. Seyedeh Mahya Shariat Razavi: Review & Editing Vahid Bagheri: Conceptualization, Methodology, Writing - Review & Editing, Supervision, Project administration, Funding acquisition. Gholamreza Anani Sarab: Conceptualization, Methodology, Writing - Review & Editing, Supervision, Project administration, Funding acquisition. All authors read and approved the final manuscript. Ethics approval The current study did not involve new human sample collection. Gastric cancer stem cells were used that had been previously isolated and characterized in an earlier study “Isolation and identification of chemotherapy‐enriched sphere‐forming cells from a patient with gastric cancer” (Bagheri et al., Journal of Cellular Physiology, 2018), which was conducted under the ethical approval of the appropriate institutional ethics committee. Written informed consent had been obtained from the patient at that time. The Institutional Animal Care and Use Committee of Birjand University of Medical Sciences approved all experimental procedures of this study. The projects entitled “The evaluation of the effects of Glycyrrhetinic acid derived from Glycyrrhiza glabra on the expression of STAT3 related signaling pathways genes in Gastric Cancer Stem cells” and “Evaluation of the effect of Glycyrrhetinic acid derived from Glycyrrhiza glabra on expression of EMT-related ZEB-1 gene in Gastric Cancer Stem cells” were approved by the Specialized Ethics Committee for Working with Laboratory Animals of Birjand University of Medical Sciences (IR.BUMS.AEC) under project numbers 455983 (Ethics Code: IR.BUMS.REC.1398.353) and 5207 (Ethics Code: IR.BUMS.REC.1398.367), respectively, on February 10, 2020. consent to participate Not applicable Consent for publication Not applicable Acknowledgments This work was financially supported by grants from Birjand University of Medical Sciences, Birjand, Iran (455983 and 5207). The authors declare that they have not use AI-generated work in this manuscript References Sung H, Ferlay J, Siegel R L, Laversanne M, Soerjomataram I, Jemal A, and Bray F, (2021) Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA: a cancer journal for clinicians 71:209-249. https://doi.org/10.3322/caac.21660 Ferlay J, Soerjomataram I, Dikshit R, Eser S, Mathers C, Rebelo M, Parkin D M, Forman D, and Bray F, (2015) Cancer incidence and mortality worldwide: sources, methods and major patterns in GLOBOCAN 2012. International journal of cancer 136:E359-E386. https://doi.org/10.1002/ijc.29210 Chen H, Lin J, Shan Y, and Zhengmao L, (2019) The promotion of nanoparticle delivery to two populations of gastric cancer stem cells by CD133 and CD44 antibodies. Biomedicine & Pharmacotherapy 115:108857. https://doi.org/10.1016/j.biopha.2019.108857 Courtois S, Durán R V, Giraud J, Sifré E, Izotte J, Mégraud F, Lehours P, Varon C, and Bessède E, (2017) Metformin targets gastric cancer stem cells. European journal of cancer 84:193-201. https://doi.org/10.1016/j.ejca.2017.07.020 Fang D and Kitamura H, (2018) Cancer stem cells and epithelial–mesenchymal transition in urothelial carcinoma: Possible pathways and potential therapeutic approaches. International Journal of Urology 25:7-17. https://doi.org/10.1111/iju.13404 Fu Y, Li H, and Hao X, (2017) The self-renewal signaling pathways utilized by gastric cancer stem cells. Tumor Biology 39:1010428317697577. https://doi.org/10.1177/1010428317697577 Chen T, Yang K, Yu J, Meng W, Yuan D, Bi F, Liu F, Liu J, Dai B, and Chen X, (2012) Identification and expansion of cancer stem cells in tumor tissues and peripheral blood derived from gastric adenocarcinoma patients. Cell research 22:248-258. Wakamatsu Y, Sakamoto N, Oo H Z, Naito Y, Uraoka N, Anami K, Sentani K, Oue N, and Yasui W, (2012) Expression of cancer stem cell markers ALDH1, CD44 and CD133 in primary tumor and lymph node metastasis of gastric cancer. Pathology international 62:112-119. https://doi.org/10.1111/j.1440-1827.2011.02760.x Okamoto A, Chikamatsu K, Sakakura K, Hatsushika K, Takahashi G, and Masuyama K, (2009) Expansion and characterization of cancer stem-like cells in squamous cell carcinoma of the head and neck. Oral oncology 45:633-639. https://doi.org/10.1016/j.oraloncology.2008.10.003 Cho S H, Park Y S, Kim H J, Kim C H, Lim S W, Huh J W, Lee J H, and Kim H R, (2012) CD44 enhances the epithelial-mesenchymal transition in association with colon cancer invasion. International journal of oncology 41:211-218. https://doi.org/10.3892/ijo.2012.1453 Miyazaki H, Takahashi R-u, Prieto-Vila M, Kawamura Y, Kondo S, Shirota T, and Ochiya T, (2018) CD44 exerts a functional role during EMT induction in cisplatin-resistant head and neck cancer cells. Oncotarget 9:10029. 10.18632/oncotarget.24252 Yu H and Jove R, (2004) The STATs of cancer—new molecular targets come of age. Nature Reviews Cancer 4:97-105. Cao D, Jiang J, You L, Jia Z, Tsukamoto T, Cai H, Wang S, Hou Z, Suo Y-e, and Cao X, (2016) The protective effects of 18β‐glycyrrhetinic acid on Helicobacter pylori‐infected gastric mucosa in Mongolian gerbils. BioMed Research International 2016:4943793. https://doi.org/10.1155/2016/4943793 Darvishi B, Manoochehri S, Kamalinia G, Samadi N, Amini M, Mostafavi S H, Maghazei S, Atyabi F, and Dinarvand R, (2015) Preparation and antibacterial activity evaluation of 18-β-glycyrrhetinic acid loaded PLGA nanoparticles. Iranian journal of pharmaceutical research: IJPR 14:373. Wang X-F, Zhou Q-M, Lu Y-Y, Zhang H, Huang S, and Su S-B, (2015) Glycyrrhetinic acid potently suppresses breast cancer invasion and metastasis by impairing the p38 MAPK-AP1 signaling axis. Expert opinion on therapeutic targets 19:577-587. https://doi.org/10.1517/14728222.2015.1012156 Wang S, Shen Y, Qiu R, Chen Z, Chen Z, and Chen W, (2017) 18 β-glycyrrhetinic acid exhibits potent antitumor effects against colorectal cancer via inhibition of cell proliferation and migration. International Journal of Oncology 51:615-624. https://doi.org/10.3892/ijo.2017.4059 Bagheri V, Esmaeili S-A, Gholamin M, and Abbaszadegan M R, (2022) Rapid isolation of gastric adenocarcinoma cancer stem cells as a target for autologous dendritic cell-based immunotherapy. Iranian Journal of Biotechnology 20:e3045. doi: 10.30498/ijb.2021.284841.3045 Bagheri V, Gholamin M, Mansouri A, and Abbaszadegan M R, (2022) Establishment and characterization of chemotherapy-enriched sphere-forming cells with stemness phenotypes as a new cell line (BAG50) of gastric carcinoma. Medical Oncology 39:201. Bagheri V, Memar B, Behzadi R, Aliakbarian M, Jangjoo A, Bahar M M, Talebi S, Gholamin M, and Abbaszadegan M R, (2018) Isolation and identification of chemotherapy‐enriched sphere‐forming cells from a patient with gastric cancer. Journal of Cellular Physiology 233:7036-7046. https://doi.org/10.1002/jcp.26627 Guan W-L, He Y, and Xu R-H, (2023) Gastric cancer treatment: recent progress and future perspectives. Journal of hematology & oncology 16:57. Abbaszadegan M R, Bagheri V, Razavi M S, Momtazi A A, Sahebkar A, and Gholamin M, (2017) Isolation, identification, and characterization of cancer stem cells: A review. Journal of cellular physiology 232:2008-2018. https://doi.org/10.1002/jcp.25759 Esmaeili S A, Sahranavard S, Salehi A, and Bagheri V, (2021) Selectively targeting cancer stem cells: Current and novel therapeutic strategies and approaches in the effective eradication of cancer. IUBMB life 73:1045-1059. https://doi.org/10.1002/iub.2524 Albahri G, Badran A, Abdel Baki Z, Alame M, Hijazi A, Daou A, and Baydoun E, (2024) Potential anti-tumorigenic properties of diverse medicinal plants against the majority of common types of cancer. Pharmaceuticals 17:574. https://doi.org/10.3390/ph17050574 Chen J, Zhang Z-q, Song J, Liu Q-m, Wang C, Huang Z, Chu L, Liang H-f, Zhang B-x, and Chen X-p, (2018) 18β-Glycyrrhetinic-acid-mediated unfolded protein response induces autophagy and apoptosis in hepatocellular carcinoma. Scientific Reports 8:9365. Li X, Liu Y, Wang N, Liu Y, Wang S, Wang H, Li A, and Ren S, (2019) Synthesis and discovery of 18β-glycyrrhetinic acid derivatives inhibiting cancer stem cell properties in ovarian cancer cells. RSC advances 9:27294-27304. 10.1039/C9RA04961D Hsu Y-C, Hsieh W-C, Chen S-H, Li Y-Z, Liao H-F, Lin M-Y, and Sheu S-M, (2023) 18β-Glycyrrhetinic Acid Modulated Autophagy Is Cytotoxic to Breast Cancer Cells. International Journal of Medical Sciences 20:444. 10.7150/ijms.80302 Primeaux M, Gowrikumar S, and Dhawan P, (2022) Role of CD44 isoforms in epithelial-mesenchymal plasticity and metastasis. Clinical & experimental metastasis 39:391-406. Xu H, Tian Y, Yuan X, Wu H, Liu Q, Pestell R G, and Wu K, (2015) The role of CD44 in epithelial–mesenchymal transition and cancer development. OncoTargets and therapy 3783-3792. https://doi.org/10.2147/OTT.S95470 Ishimoto T, Sugihara H, Watanabe M, Sawayama H, Iwatsuki M, Baba Y, Okabe H, Hidaka K, Yokoyama N, and Miyake K, (2014) Macrophage-derived reactive oxygen species suppress miR-328 targeting CD44 in cancer cells and promote redox adaptation. Carcinogenesis 35:1003-1011. Hajimoradi M, Hassan Z M, Ebrahimi M, Soleimani M, Bakhshi M, Firouzi J, and Samani F S, (2016) STAT3 is overactivated in gastric cancer stem-like cells. Cell Journal (Yakhteh) 17:617. 10.22074/cellj.2016.3834 Yang X, Lin Y, Shi Y, Li B, Liu W, Yin W, Dang Y, Chu Y, Fan J, and He R, (2016) FAP promotes immunosuppression by cancer-associated fibroblasts in the tumor microenvironment via STAT3–CCL2 signaling. Cancer research 76:4124-4135. https://doi.org/10.1158/0008-5472.CAN-15-2973 Jie M, Zhang Z-Q, Deng N, Liu Q-M, Wang C, Ge Q-Y, Du P-C, Song S-S, Zhang X-W, and Long-Xin, (2022) 18 β-glycyrrhetinic acid inhibits TGF-β-induced epithelial-to-mesenchymal transition and metastasis of hepatocellular carcinoma by targeting STAT3. The American Journal of Chinese Medicine 50:313-332. https://doi.org/10.1142/S0192415X22500124 Luo Y-H, Wang C, Xu W-T, Zhang Y, Zhang T, Xue H, Li Y-N, Fu Z-R, Wang Y, and Jin C-H, (2021) 18β-Glycyrrhetinic acid has anti-cancer effects via inducing apoptosis and G2/M cell cycle arrest, and inhibiting migration of A549 lung cancer cells. OncoTargets and therapy 5131-5144. https://doi.org/10.2147/OTT.S322852 Table 1 Table 1 . Primer sequences for the amplification of target genes and GAPDH Genes Primer sequence 5' -> 3' CD44 For: TCCAACACCTCCCAGTATGACA Rev: GGCAGGTCTGTGACTGATGTACA Bcl-2 For: TGGAGAGTGCTGAAGATTGATG Rev: GTCTACTTCCTCTGTGATGTTGT ZEB-1 For: GTGGCGGTAGATGGTAAT Rev: CTGTTTGTAGCGACTGGA Snail-1 For: TAGCGAGTGGTTCTTCTGCG Rev: AGGGCTGCTGGAAGGTAAAC GAPDH For: TGGACTCCACGACGTACTCAG Rev: CGGGAAGCTTGTCATCAATGGAA GAPDH, Glyceraldehyde-3-phosphate dehydrogenase Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7312134","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":502407950,"identity":"fc2d85d1-e4da-420c-8c0c-8a4005a1c05f","order_by":0,"name":"Maede Sadat Rahnamaei","email":"","orcid":"","institution":"Birjand University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Maede","middleName":"Sadat","lastName":"Rahnamaei","suffix":""},{"id":502407953,"identity":"129424e6-0a0c-4dec-a159-bcbdf7ec9e80","order_by":1,"name":"Ramiar Kamal Kheder","email":"","orcid":"","institution":"University of Raparin","correspondingAuthor":false,"prefix":"","firstName":"Ramiar","middleName":"Kamal","lastName":"Kheder","suffix":""},{"id":502407955,"identity":"77d164f4-1601-46a0-b9cf-35d4f0e30090","order_by":2,"name":"Omeed Darweesh","email":"","orcid":"","institution":"Al-Kitab University","correspondingAuthor":false,"prefix":"","firstName":"Omeed","middleName":"","lastName":"Darweesh","suffix":""},{"id":502407956,"identity":"62bb3123-ae67-4a08-906a-25dbb04e103a","order_by":3,"name":"Seyedeh Mahya Shariat Razavi","email":"","orcid":"","institution":"Boston College","correspondingAuthor":false,"prefix":"","firstName":"Seyedeh","middleName":"Mahya Shariat","lastName":"Razavi","suffix":""},{"id":502407957,"identity":"69bbcf2e-502b-417f-9b0f-f9f6de89f38c","order_by":4,"name":"Vahid Bagheri","email":"","orcid":"","institution":"Birjand University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Vahid","middleName":"","lastName":"Bagheri","suffix":""},{"id":502407958,"identity":"430c1c66-e4a3-4ef9-8423-92483ed542a4","order_by":5,"name":"Gholamreza Anani Sarab","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAvUlEQVRIiWNgGAWjYHACwwcSP2wSYDweYrQYG1j2pJGmxUyggu1wAgFFSEB32uFtDDd4zucZXDv+gOFHDYOMeQMhK26nlT2cYXG72OB2jgFjzzEGHpkDBLXkmBtL8NxO3HA7h4GBt4GBR4KQw4BazKT/sJ0Dakl/wPiXWC0SEmwHgFoSDJiJtCWt2ECyJ7lYEuiXwzLHJIjRkrwRGJV2eXy30x8+fFNjY09QCwo4wMBAmoZRMApGwSgYBTgAAGKCPrEmTT+lAAAAAElFTkSuQmCC","orcid":"","institution":"Birjand University of Medical Sciences","correspondingAuthor":true,"prefix":"","firstName":"Gholamreza","middleName":"Anani","lastName":"Sarab","suffix":""}],"badges":[],"createdAt":"2025-08-06 17:38:14","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7312134/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7312134/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":89549594,"identity":"629a8112-5018-4609-beb1-012a0e8a44b1","added_by":"auto","created_at":"2025-08-21 08:06:35","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":98495,"visible":true,"origin":"","legend":"\u003cp\u003eGA inhibited gastric CSCs proliferation. After treating GCSCs with various concentrations of GA (20-160 μM) for 24 h, 48 h, and 72 h, cell viability was significantly reduced in time and dose-dependent manners. The data are represented as mean ± SD. Abbreviations: CSC: gastric cancer stem cells; GA: 18ß-glycyrrhetinic acid.\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7312134/v1/8cbfda27698e85e3cb928b29.jpeg"},{"id":89549599,"identity":"1042c2d7-2aeb-484d-b4e5-c2934914ab96","added_by":"auto","created_at":"2025-08-21 08:06:36","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":328454,"visible":true,"origin":"","legend":"\u003cp\u003eGA reduced mRNA expression levels of genes of CD44, EMT markers (ZEB-1 and Snail-1), and anti-apoptotic protein Bcl-2 in gastric CSCs. The cells treated with a concentration of 60 μM GA for 48 and 72 h significantly downregulated mRNA expression of CD44, ZEB-1, Snail-1, and Bcl-2 in compared with the untreated cells (a). The data are represented as mean ± SD. Abbreviations: GA: 18ß-glycyrrhetinic acid; EMT: epithelial-mesenchymal transition; CSCs: cancer stem cells.\u003c/p\u003e","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7312134/v1/eda228844a6c29427ad0ed87.jpeg"},{"id":89549595,"identity":"9340fc42-745f-4575-b9fb-b82de98852f8","added_by":"auto","created_at":"2025-08-21 08:06:36","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":227314,"visible":true,"origin":"","legend":"\u003cp\u003eflow cytometry analysis of CD44 expression after treating gastric CSCs with GA. CD44 expression was significantly reduced in the cells after treatment with a concentration of 60 μM GA for 48 (a) and 72 h (b) compared with untreated cells. The data are represented as mean ± SD. Abbreviations: CSCs: cancer stem cells; GA: 18ß-glycyrrhetinic acid.\u003c/p\u003e","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7312134/v1/30a12f7c7dce03f84bd8a98f.jpeg"},{"id":89550379,"identity":"7867ba0a-7c09-4b53-8397-0ee676971235","added_by":"auto","created_at":"2025-08-21 08:14:35","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":75197,"visible":true,"origin":"","legend":"\u003cp\u003eGA inhibited gastric CSCs growth \u003cem\u003ein vivo\u003c/em\u003e. After inoculation of 1 × 10\u003csup\u003e6\u003c/sup\u003e cells/ml with GA and without GA subcutaneously into the right flank of nude mice, the volume of tumors produced on days 7, 14, 21, and 28 was reduced in treated group (CSCs with GA) compared to untreated group (CSCs without GA). Abbreviations: CSCs: cancer stem cells; GA: 18ß-glycyrrhetinic acid.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7312134/v1/b47a392549536c5e084269e6.png"},{"id":98421751,"identity":"565ac604-183e-47fb-b880-37a85cc6ea69","added_by":"auto","created_at":"2025-12-17 16:29:17","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1416316,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7312134/v1/2ed89fcc-fd3f-4acc-b4cb-06df83ec483b.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"8β-glycyrrhetinic acid as major bioactive component of Glycyrrhiza glabra downregulates expression of CD44 and epithelial-mesenchymal transition markers and inhibits xenograft tumor growth in gastric cancer stem cells","fulltext":[{"header":"Introduction","content":"\u003cp\u003eGastric cancer (GC) is the fifth most common and lethal malignancy worldwide and, according to GLOBOCAN 2020, the fourth leading cause of cancer-related deaths [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Although surgical techniques and chemotherapy for gastric cancer have advanced, chemoresistance still leads to metastasis and relapse after therapy [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Therefore, novel therapeutic strategies for gastric cancer are urgently needed. Recent studies have shown that resistance to chemotherapy, invasion, and metastasis are mainly due to cancer stem cell (CSC) subpopulations within heterogeneous tumors [\u003cspan additionalcitationids=\"CR4 CR5\" citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eCSCs can be identified by specific surface markers, including CD133, CD44, CD44/CD54, CD24/CD44, and CD166 [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Among these, the CD44 molecule\u0026mdash;a transmembrane glycoprotein\u0026mdash;is the most widely used marker for isolating CSCs from solid tumors [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. CD44\u0026thinsp;+\u0026thinsp;CSCs possess high proliferative, invasive, and migratory abilities, along with resistance to chemotherapy [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. In fact, CD44 expression induces epithelial-mesenchymal transition (EMT), contributing to the generation, maintenance, migration, and invasion of CSCs [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Multiple signaling pathways are involved in maintaining CSCs; for instance, aberrant activation of STAT3 prevents apoptosis by upregulating anti-apoptotic Bcl-2 family genes such as BCL-xL, BCL-2, and MCL1 [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eOne component of Glycyrrhiza glabra L. (licorice) is glycyrrhizic acid, which is metabolized into the pentacyclic triterpenoid 18β-glycyrrhetinic acid (GA). GA exhibits numerous physiological and pharmacological activities, including antimicrobial [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e], anti-inflammatory, and antitumor effects. Among its antitumor properties, GA inhibits cell proliferation, migration, and metastasis [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e] and induces apoptosis [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. In this study, we assessed the effect of GA on the expression of the CD44 molecule, the anti-apoptotic BCL-2 protein, and EMT markers (ZEB-1 and Snail-1) in gastric CSCs.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eCell culture\u003c/h2\u003e\u003cp\u003eGastric CSCs, previously isolated and identified from a gastric cancer patient [\u003cspan additionalcitationids=\"CR18\" citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e] were cultured in suspension using DMEM/F12 medium (Gibco, USA) supplemented with 20 ng/ml human epidermal growth factor (EGF) (Biolegend, USA), 1% B-27 supplement (50X) (Gibco, USA), and 1% penicillin/streptomycin.\u003c/p\u003e\u003cp\u003eCells were plated into non-treated T-25 flasks (Corning, USA) and incubated in a humidified atmosphere containing 5% CO₂ at 37\u0026deg;C.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eAssessing the viability of gastric CSCs with various GA concentrations by MTT assay\u003c/h3\u003e\n\u003cp\u003eThe cytotoxic activity of GA was assessed using the MTT assay. Gastric CSCs were seeded in non-treated 96-well plates (Corning, USA) at a density of 3\u0026times;10⁴ cells/well in 100 \u0026micro;l of complete culture medium (DMEM/F12 supplemented with EGF, B-27, and penicillin/streptomycin) and incubated for 24 hours. Cells were then treated with different concentrations of GA (20\u0026ndash;160 \u0026micro;M; Sigma, USA) for 24, 48 and 72 hours. After treatment, 20 \u0026micro;l of MTT solution (5 mg/ml; Sigma, USA) was added to each well and incubated for 4 hours at 37\u0026deg;C. Subsequently, 100 \u0026micro;l of DMSO (Sigma, USA) was added to dissolve the formazan crystals, and the plates were gently shaken at room temperature for 70 minutes. Absorbance was measured at 570 and 630 nm using a microplate spectrophotometer (BioTek Epoch, USA).\u003c/p\u003e\n\u003ch3\u003eRNA extraction, cDNA synthesis, and Quantitative real-time PCR\u003c/h3\u003e\n\u003cdiv class=\"Heading\"\u003eRNA extraction, cDNA synthesis, and Quantitative real-time PCR\u003c/div\u003e\u003cp\u003eGastric CSCs were cultured in non-treated 6-well plates (Corning, USA) at a density of 7\u0026times;10⁵ cells/ml and treated with 60 \u0026micro;M GA for 48 and 72 hours. Total RNA was extracted using TRIzol\u0026trade; Reagent (Gibco, USA), and cDNA was synthesized using the Easy cDNA Ultra-TM Synthesis Kit (Parstous, Iran). Quantitative real-time PCR (qRT-PCR) was performed using SolisFAST\u0026reg; SolisGreen\u0026reg; qPCR Mix (Solis BioDyne, Estonia). The sequences of the primers are listed in Table\u0026nbsp;1. qRT-PCR was carried out using a Thermal Cycler (Applied Biosystems, USA). Relative mRNA expression levels were calculated using the 2^\u0026minus;ΔΔCt method, with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as the endogenous control.\u003c/p\u003e\n\u003ch3\u003eDetection of surface marker CD44 using flow cytometry\u003c/h3\u003e\n\u003cp\u003eGastric CSCs were cultured in non-treated 6-well plates at a density of 1\u0026times;10⁶ cells/ml and treated with 60 \u0026micro;M GA for 48 and 72 hours. Following trypsinization and washing with phosphate-buffered saline (PBS; Sigma, USA), cells were resuspended in PBS and incubated for 30 minutes in the dark with APC-conjugated mouse anti-human CD44 antibody (BD Biosciences, USA). Cells were then washed three times with PBS and finally resuspended in 800 \u0026micro;l of PBS. Fluorescence intensity was analyzed using a CyFlow Cube6 flow cytometer (Sysmex, Germany).\u003c/p\u003e\u003cp\u003e\u003cb\u003eGA effect on tumor volume\u003c/b\u003e \u003cb\u003ein vivo\u003c/b\u003e\u003c/p\u003e\u003cp\u003eAll animal experiments were performed in accordance with the ARRIVE guidelines 2.0 for reporting animal research. The study protocol was approved by the Specialized Ethics Committee for Working with Laboratory Animals of Birjand University of Medical Sciences (IR.BUMS.AEC). Gastric CSCs (1\u0026times;10⁶ cells/ml) were subcutaneously injected into the right flank of male nude mice (C57BL/6 strain), aged 4\u0026ndash;6 weeks (15\u0026ndash;20 grams). A total of 18 mice were randomly divided into three groups (n\u0026thinsp;=\u0026thinsp;6 per group): (1) CSCs\u0026thinsp;+\u0026thinsp;GA treatment group, (2) CSCs without GA control group, and (3) Matrigel-only group without cells. Cells were suspended in serum-free DMEM (Sigma-Aldrich, USA) containing GA (120 \u0026micro;M) mixed with Matrigel (1:1 ratio; Sigma-Aldrich) for the treated group or in DMEM/Matrigel (1:1) for the untreated control group. Each injection used 100 \u0026micro;l delivered with a microsyringe at the North Research Center, Pasteur Institute of Iran. Tumor growth was monitored weekly, and tumor volume (mm\u0026sup3;) was calculated using the formula: 0.5 \u0026times; D₁\u0026sup2; \u0026times; D₂, where D₁ and D₂ represent the width (larger diameter) and length (smaller diameter) of the tumor, respectively. For humane endpoint, tumor-bearing mice were euthanized by intraperitoneal injection of ketamine (80\u0026ndash;100 mg/kg) and xylazine (10 mg/kg) followed by placement in a desiccator to induce death by hypoxia before recovery from anesthesia.\u003c/p\u003e\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\u003ch2\u003eStatistical analysis\u003c/h2\u003e\u003cp\u003eStatistical analyses were performed using GraphPad Prism 10. Data are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD (n\u0026thinsp;=\u0026thinsp;3). MTT assay results were compared using one-way analysis of variance (ANOVA), and paired t-tests were used to assess differences in mRNA expression levels. A p-value\u0026thinsp;\u0026le;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e\u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cb\u003eGA inhibits growth of gastric CSCs\u003c/b\u003e.\u003c/p\u003e\u003cp\u003eThe inhibitory effects of GA on gastric CSCs were evaluated using the MTT assay. Our results demonstrated that GA inhibited cell proliferation in a dose- and time-dependent manner (Fig.\u0026nbsp;1). The IC₅₀ values of GA for gastric CSCs were 106 \u0026micro;M at 48 hours and 84 \u0026micro;M at 72 hours. Based on these findings, a concentration of 60 \u0026micro;M GA was selected for subsequent experiments.\u003c/p\u003e\u003cp\u003e\u003cb\u003eGA Reduces Expression Levels of CD44, Bcl-2, and EMT Markers, and Surface CD44 Protein in Gastric CSCs.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eFollowing exposure to 60 \u0026micro;M GA for 48 and 72 hours, the mRNA expression levels of CD44, Bcl-2, and EMT markers (ZEB-1 and Snail-1), as well as the protein expression of CD44, were significantly decreased compared to untreated cells (Figs.\u0026nbsp;2 and 3).\u003c/p\u003e\u003cp\u003e\u003cb\u003eGA Reduces Tumor Size In Vivo.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eInjection of a mixture of gastric CSCs with GA into nude mice resulted in inhibited tumor growth and a reduction in tumor volume compared to the untreated group (CSCs without GA) (Fig.\u0026nbsp;4).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eGastric cancer (GC) is a highly malignant disease with a poor prognosis. Common treatments for GC include surgery and chemotherapy; however, due to tumor recurrence and metastasis, these therapies have not been very effective [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. CSCs are considered a major cause of the inability to completely eradicate tumors because of their role in tumorigenesis, self-renewal, and pluripotency [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Therefore, therapies targeting CSCs are of great importance [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Plant-derived active ingredients have been proposed as potential therapeutic agents with possibly fewer side effects compared to conventional chemotherapy drugs [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. In this study, we used 18β-glycyrrhetinic acid (GA), an active component of licorice root, to investigate its effects on inhibiting CSC growth both in vitro and in vivo. Additionally, we assessed the impact of GA on the expression of CD44, EMT markers, and the anti-apoptotic protein BCL-2 in gastric CSCs.\u003c/p\u003e\u003cp\u003eMany studies have demonstrated the antitumor effects of GA on cancer cells. For example, exposure of colorectal cancer cell lines (LoVo, SW480, and SW620) to GA activated pro-apoptotic pathways and inhibited cell growth [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Similarly, GA inhibited the proliferation and induced apoptosis in various hepatocellular carcinoma (HCC) cell lines, including HepG2, SMMC-7721, HLF, HLE, Hep3B, and LM3 [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. In ovarian cancer cells (SKOV3 and OVCAR3), GA and its derivatives suppressed CSC properties and induced apoptosis [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Hsu et al. also demonstrated that GA induced apoptosis in breast cancer cell lines (MCF-7 and T-47D) and inhibited tumor growth in vivo (BALB/c nude mice) [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Consistent with these findings, we showed that GA has antitumor activity against gastric CSCs, reducing their growth in vitro (Fig.\u0026nbsp;1) and in vivo (Fig.\u0026nbsp;4), and downregulating the expression of the anti-apoptotic gene BCL2.\u003c/p\u003e\u003cp\u003eThe cell surface adhesion receptor CD44 is a widely recognized marker for CSCs and plays a key role in regulating both CSC maintenance and the epithelial-mesenchymal transition (EMT) phenotype. Due to its involvement in both upstream and downstream signaling pathways that regulate stemness and EMT, CD44 is considered a valuable target for therapeutic intervention [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Thus, blockade or depletion of CD44 in CSCs results in the attenuation of the malignant phenotype, inhibition of cancer growth, and reduced resistance to therapy [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. For example, overexpression of CD44 in SW480 colon cancer cells leads to the induction of EMT-related changes\u0026mdash;such as increased expression of EGFR, activation of PI3K/Akt signaling, and changes in E-cadherin/β-catenin complex formation\u0026mdash;whereas knockdown of CD44 results in the downregulation of EMT markers like fibronectin, α-actin, N-cadherin, and MT1-MMP [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eAccumulating evidence suggests that GA can reduce CD44 expression and attenuate EMT-related changes.\u003c/p\u003e\u003cp\u003eFor instance, GA has been shown to upregulate miR-328, which subsequently reduces CD44 expression, thereby impairing cancer cell growth and reducing chemotherapy resistance [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Additionally, a GA derivative (compound 7c) was reported to downregulate CD44 expression in ovarian cancer cells [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Beyond its effects on CD44, GA influences EMT through several signaling pathways. Aberrant activation of the STAT3 pathway has been associated with the upregulation of EMT-related transcription factors such as ZEB, TWIST, and SNAIL [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. GA has been shown to reduce STAT3 phosphorylation, thereby suppressing TGF-β-induced EMT [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Moreover, GA inhibited the migration of A549 lung cancer cells by modulating ROS/MAPK/STAT3/NF-κB signaling pathways; it simultaneously increased E-cadherin expression while decreasing the expression of N-cadherin, Snail-1, and vimentin [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. In agreement with these studies, our data demonstrate that GA reduces the expression of CD44 and EMT markers (Snail-1 and ZEB-1) in gastric CSCs (Figs.\u0026nbsp;2 and 3).\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn summary, considering the effects of GA on decreasing the expression of CD44, BCL-2, and EMT markers, along with its ability to inhibit xenograft tumor growth, and given the direct relationship between CD44 expression and EMT changes, it can be concluded that GA likely exerts its inhibitory function through one or more EMT signaling pathways dependent on CD44 expression.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cb\u003eGC\u003c/b\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eGastric Cancer\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cb\u003eCSC\u003c/b\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eCancer Stem Cell\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cb\u003eEMT\u003c/b\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eEpithelial-Mesenchymal Transition\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cb\u003eGA\u003c/b\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003e18β-Glycyrrhetinic Acid\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cb\u003eDMEM/F12\u003c/b\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eDulbecco's Modified Eagle Medium/Nutrient Mixture F-12\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cb\u003ePBS\u003c/b\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003ePhosphate-Buffered Saline\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cb\u003eqRT-PCR\u003c/b\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eQuantitative Real-Time Polymerase Chain Reaction\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cb\u003eGAPDH\u003c/b\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eGlyceraldehyde-3-Phosphate Dehydrogenase\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was financially supported by grants (455983\u0026nbsp;and 5207). Vahid Bagheriand Gholamreza Anani Sarab have received research support from Birjand University of Medical Sciences, Birjand, Iran.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors contributed to the study conception and design\u003cem\u003e.\u0026nbsp;\u003c/em\u003eMaede sadat rahnamaei: Methodology, Validation, Investigation, Writing - Original Draft. Ramiar Kamal Kheder: Methodology, Investigation, Writing - Original Draft. Omeed Darweesh: Formal analysis, Resources, Writing - Original Draft. Seyedeh Mahya Shariat Razavi: Review \u0026amp; Editing Vahid Bagheri: Conceptualization, Methodology, Writing - Review \u0026amp; Editing, Supervision, Project administration, Funding acquisition. Gholamreza Anani Sarab: Conceptualization, Methodology, Writing - Review \u0026amp; Editing, Supervision, Project administration, Funding acquisition. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe current study did not involve new human sample collection. Gastric cancer stem cells were used that had been previously isolated and characterized in an earlier study \u0026ldquo;Isolation and identification of chemotherapy‐enriched sphere‐forming cells from a patient with gastric cancer\u0026rdquo; (Bagheri et al., Journal of Cellular Physiology, 2018), which was conducted under the ethical approval of the appropriate institutional ethics committee. Written informed consent had been obtained from the patient at that time. The Institutional Animal Care and Use Committee of Birjand University of Medical Sciences approved all experimental procedures of this study. The projects entitled \u0026ldquo;The evaluation of the effects of Glycyrrhetinic acid derived from Glycyrrhiza glabra on the expression of STAT3 related signaling pathways genes in Gastric Cancer Stem cells\u0026rdquo; and \u0026ldquo;Evaluation of the effect of Glycyrrhetinic acid derived from Glycyrrhiza glabra on expression of EMT-related ZEB-1 gene in Gastric Cancer Stem cells\u0026rdquo; were approved by the Specialized Ethics Committee for Working with Laboratory Animals of Birjand University of Medical Sciences (IR.BUMS.AEC) under project numbers 455983 (Ethics Code: IR.BUMS.REC.1398.353) and 5207 (Ethics Code: IR.BUMS.REC.1398.367), respectively, on February 10, 2020.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003econsent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was financially supported by grants from Birjand University of Medical Sciences, Birjand, Iran (455983\u0026nbsp;and 5207).\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have not use AI-generated work in this manuscript\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eSung H, Ferlay J, Siegel R L, Laversanne M, Soerjomataram I, Jemal A, and Bray F, (2021) Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA: a cancer journal for clinicians 71:209-249. https://doi.org/10.3322/caac.21660\u003c/li\u003e\n\u003cli\u003eFerlay J, Soerjomataram I, Dikshit R, Eser S, Mathers C, Rebelo M, Parkin D M, Forman D, and Bray F, (2015) Cancer incidence and mortality worldwide: sources, methods and major patterns in GLOBOCAN 2012. International journal of cancer 136:E359-E386. https://doi.org/10.1002/ijc.29210\u003c/li\u003e\n\u003cli\u003eChen H, Lin J, Shan Y, and Zhengmao L, (2019) The promotion of nanoparticle delivery to two populations of gastric cancer stem cells by CD133 and CD44 antibodies. Biomedicine \u0026amp; Pharmacotherapy 115:108857. https://doi.org/10.1016/j.biopha.2019.108857\u003c/li\u003e\n\u003cli\u003eCourtois S, Dur\u0026aacute;n R V, Giraud J, Sifr\u0026eacute; E, Izotte J, M\u0026eacute;graud F, Lehours P, Varon C, and Bess\u0026egrave;de E, (2017) Metformin targets gastric cancer stem cells. European journal of cancer 84:193-201. https://doi.org/10.1016/j.ejca.2017.07.020\u003c/li\u003e\n\u003cli\u003eFang D and Kitamura H, (2018) Cancer stem cells and epithelial\u0026ndash;mesenchymal transition in urothelial carcinoma: Possible pathways and potential therapeutic approaches. International Journal of Urology 25:7-17. https://doi.org/10.1111/iju.13404\u003c/li\u003e\n\u003cli\u003eFu Y, Li H, and Hao X, (2017) The self-renewal signaling pathways utilized by gastric cancer stem cells. Tumor Biology 39:1010428317697577. https://doi.org/10.1177/1010428317697577\u003c/li\u003e\n\u003cli\u003eChen T, Yang K, Yu J, Meng W, Yuan D, Bi F, Liu F, Liu J, Dai B, and Chen X, (2012) Identification and expansion of cancer stem cells in tumor tissues and peripheral blood derived from gastric adenocarcinoma patients. Cell research 22:248-258. \u003c/li\u003e\n\u003cli\u003eWakamatsu Y, Sakamoto N, Oo H Z, Naito Y, Uraoka N, Anami K, Sentani K, Oue N, and Yasui W, (2012) Expression of cancer stem cell markers ALDH1, CD44 and CD133 in primary tumor and lymph node metastasis of gastric cancer. Pathology international 62:112-119. https://doi.org/10.1111/j.1440-1827.2011.02760.x\u003c/li\u003e\n\u003cli\u003eOkamoto A, Chikamatsu K, Sakakura K, Hatsushika K, Takahashi G, and Masuyama K, (2009) Expansion and characterization of cancer stem-like cells in squamous cell carcinoma of the head and neck. Oral oncology 45:633-639. https://doi.org/10.1016/j.oraloncology.2008.10.003\u003c/li\u003e\n\u003cli\u003eCho S H, Park Y S, Kim H J, Kim C H, Lim S W, Huh J W, Lee J H, and Kim H R, (2012) CD44 enhances the epithelial-mesenchymal transition in association with colon cancer invasion. International journal of oncology 41:211-218. https://doi.org/10.3892/ijo.2012.1453\u003c/li\u003e\n\u003cli\u003eMiyazaki H, Takahashi R-u, Prieto-Vila M, Kawamura Y, Kondo S, Shirota T, and Ochiya T, (2018) CD44 exerts a functional role during EMT induction in cisplatin-resistant head and neck cancer cells. Oncotarget 9:10029. 10.18632/oncotarget.24252\u003c/li\u003e\n\u003cli\u003eYu H and Jove R, (2004) The STATs of cancer\u0026mdash;new molecular targets come of age. Nature Reviews Cancer 4:97-105. \u003c/li\u003e\n\u003cli\u003eCao D, Jiang J, You L, Jia Z, Tsukamoto T, Cai H, Wang S, Hou Z, Suo Y-e, and Cao X, (2016) The protective effects of 18\u0026beta;‐glycyrrhetinic acid on Helicobacter pylori‐infected gastric mucosa in Mongolian gerbils. BioMed Research International 2016:4943793. https://doi.org/10.1155/2016/4943793\u003c/li\u003e\n\u003cli\u003eDarvishi B, Manoochehri S, Kamalinia G, Samadi N, Amini M, Mostafavi S H, Maghazei S, Atyabi F, and Dinarvand R, (2015) Preparation and antibacterial activity evaluation of 18-\u0026beta;-glycyrrhetinic acid loaded PLGA nanoparticles. Iranian journal of pharmaceutical research: IJPR 14:373. \u003c/li\u003e\n\u003cli\u003eWang X-F, Zhou Q-M, Lu Y-Y, Zhang H, Huang S, and Su S-B, (2015) Glycyrrhetinic acid potently suppresses breast cancer invasion and metastasis by impairing the p38 MAPK-AP1 signaling axis. Expert opinion on therapeutic targets 19:577-587. https://doi.org/10.1517/14728222.2015.1012156\u003c/li\u003e\n\u003cli\u003eWang S, Shen Y, Qiu R, Chen Z, Chen Z, and Chen W, (2017) 18 \u0026beta;-glycyrrhetinic acid exhibits potent antitumor effects against colorectal cancer via inhibition of cell proliferation and migration. International Journal of Oncology 51:615-624. https://doi.org/10.3892/ijo.2017.4059\u003c/li\u003e\n\u003cli\u003eBagheri V, Esmaeili S-A, Gholamin M, and Abbaszadegan M R, (2022) Rapid isolation of gastric adenocarcinoma cancer stem cells as a target for autologous dendritic cell-based immunotherapy. Iranian Journal of Biotechnology 20:e3045. doi: 10.30498/ijb.2021.284841.3045\u003c/li\u003e\n\u003cli\u003eBagheri V, Gholamin M, Mansouri A, and Abbaszadegan M R, (2022) Establishment and characterization of chemotherapy-enriched sphere-forming cells with stemness phenotypes as a new cell line (BAG50) of gastric carcinoma. Medical Oncology 39:201. \u003c/li\u003e\n\u003cli\u003eBagheri V, Memar B, Behzadi R, Aliakbarian M, Jangjoo A, Bahar M M, Talebi S, Gholamin M, and Abbaszadegan M R, (2018) Isolation and identification of chemotherapy‐enriched sphere‐forming cells from a patient with gastric cancer. Journal of Cellular Physiology 233:7036-7046. https://doi.org/10.1002/jcp.26627\u003c/li\u003e\n\u003cli\u003eGuan W-L, He Y, and Xu R-H, (2023) Gastric cancer treatment: recent progress and future perspectives. Journal of hematology \u0026amp; oncology 16:57. \u003c/li\u003e\n\u003cli\u003eAbbaszadegan M R, Bagheri V, Razavi M S, Momtazi A A, Sahebkar A, and Gholamin M, (2017) Isolation, identification, and characterization of cancer stem cells: A review. Journal of cellular physiology 232:2008-2018. https://doi.org/10.1002/jcp.25759\u003c/li\u003e\n\u003cli\u003eEsmaeili S A, Sahranavard S, Salehi A, and Bagheri V, (2021) Selectively targeting cancer stem cells: Current and novel therapeutic strategies and approaches in the effective eradication of cancer. IUBMB life 73:1045-1059. https://doi.org/10.1002/iub.2524\u003c/li\u003e\n\u003cli\u003eAlbahri G, Badran A, Abdel Baki Z, Alame M, Hijazi A, Daou A, and Baydoun E, (2024) Potential anti-tumorigenic properties of diverse medicinal plants against the majority of common types of cancer. Pharmaceuticals 17:574. https://doi.org/10.3390/ph17050574\u003c/li\u003e\n\u003cli\u003eChen J, Zhang Z-q, Song J, Liu Q-m, Wang C, Huang Z, Chu L, Liang H-f, Zhang B-x, and Chen X-p, (2018) 18\u0026beta;-Glycyrrhetinic-acid-mediated unfolded protein response induces autophagy and apoptosis in hepatocellular carcinoma. Scientific Reports 8:9365. \u003c/li\u003e\n\u003cli\u003eLi X, Liu Y, Wang N, Liu Y, Wang S, Wang H, Li A, and Ren S, (2019) Synthesis and discovery of 18\u0026beta;-glycyrrhetinic acid derivatives inhibiting cancer stem cell properties in ovarian cancer cells. RSC advances 9:27294-27304. 10.1039/C9RA04961D \u003c/li\u003e\n\u003cli\u003eHsu Y-C, Hsieh W-C, Chen S-H, Li Y-Z, Liao H-F, Lin M-Y, and Sheu S-M, (2023) 18\u0026beta;-Glycyrrhetinic Acid Modulated Autophagy Is Cytotoxic to Breast Cancer Cells. International Journal of Medical Sciences 20:444. 10.7150/ijms.80302\u003c/li\u003e\n\u003cli\u003ePrimeaux M, Gowrikumar S, and Dhawan P, (2022) Role of CD44 isoforms in epithelial-mesenchymal plasticity and metastasis. Clinical \u0026amp; experimental metastasis 39:391-406. \u003c/li\u003e\n\u003cli\u003eXu H, Tian Y, Yuan X, Wu H, Liu Q, Pestell R G, and Wu K, (2015) The role of CD44 in epithelial\u0026ndash;mesenchymal transition and cancer development. OncoTargets and therapy 3783-3792. https://doi.org/10.2147/OTT.S95470\u003c/li\u003e\n\u003cli\u003eIshimoto T, Sugihara H, Watanabe M, Sawayama H, Iwatsuki M, Baba Y, Okabe H, Hidaka K, Yokoyama N, and Miyake K, (2014) Macrophage-derived reactive oxygen species suppress miR-328 targeting CD44 in cancer cells and promote redox adaptation. Carcinogenesis 35:1003-1011. \u003c/li\u003e\n\u003cli\u003eHajimoradi M, Hassan Z M, Ebrahimi M, Soleimani M, Bakhshi M, Firouzi J, and Samani F S, (2016) STAT3 is overactivated in gastric cancer stem-like cells. Cell Journal (Yakhteh) 17:617. 10.22074/cellj.2016.3834\u003c/li\u003e\n\u003cli\u003eYang X, Lin Y, Shi Y, Li B, Liu W, Yin W, Dang Y, Chu Y, Fan J, and He R, (2016) FAP promotes immunosuppression by cancer-associated fibroblasts in the tumor microenvironment via STAT3\u0026ndash;CCL2 signaling. Cancer research 76:4124-4135. https://doi.org/10.1158/0008-5472.CAN-15-2973\u003c/li\u003e\n\u003cli\u003eJie M, Zhang Z-Q, Deng N, Liu Q-M, Wang C, Ge Q-Y, Du P-C, Song S-S, Zhang X-W, and Long-Xin, (2022) 18 \u0026beta;-glycyrrhetinic acid inhibits TGF-\u0026beta;-induced epithelial-to-mesenchymal transition and metastasis of hepatocellular carcinoma by targeting STAT3. The American Journal of Chinese Medicine 50:313-332. https://doi.org/10.1142/S0192415X22500124\u003c/li\u003e\n\u003cli\u003eLuo Y-H, Wang C, Xu W-T, Zhang Y, Zhang T, Xue H, Li Y-N, Fu Z-R, Wang Y, and Jin C-H, (2021) 18\u0026beta;-Glycyrrhetinic acid has anti-cancer effects via inducing apoptosis and G2/M cell cycle arrest, and inhibiting migration of A549 lung cancer cells. OncoTargets and therapy 5131-5144. https://doi.org/10.2147/OTT.S322852\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Table 1","content":"\u003cp\u003eTable 1\u003cstrong\u003e.\u003c/strong\u003e Primer sequences for the amplification of target genes and GAPDH\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 16.4706%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eGenes\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 83.2353%;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePrimer sequence 5\u0026apos; -\u0026gt; 3\u0026apos;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 16.4706%;\"\u003e\n \u003cp\u003eCD44\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 83.2353%;\"\u003e\n \u003cp\u003eFor: TCCAACACCTCCCAGTATGACA\u003c/p\u003e\n \u003cp\u003eRev: GGCAGGTCTGTGACTGATGTACA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 16.4706%;\"\u003e\n \u003cp\u003eBcl-2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 83.2353%;\"\u003e\n \u003cp\u003eFor: TGGAGAGTGCTGAAGATTGATG\u003c/p\u003e\n \u003cp\u003eRev: GTCTACTTCCTCTGTGATGTTGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 16.4706%;\"\u003e\n \u003cp\u003eZEB-1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 83.2353%;\"\u003e\n \u003cp\u003eFor: GTGGCGGTAGATGGTAAT\u003c/p\u003e\n \u003cp\u003eRev: CTGTTTGTAGCGACTGGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 16.4706%;\"\u003e\n \u003cp\u003eSnail-1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 83.2353%;\"\u003e\n \u003cp\u003eFor: TAGCGAGTGGTTCTTCTGCG\u003c/p\u003e\n \u003cp\u003eRev: AGGGCTGCTGGAAGGTAAAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 16.4706%;\"\u003e\n \u003cp\u003eGAPDH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85%;\"\u003e\n \u003cp\u003eFor: TGGACTCCACGACGTACTCAG\u003c/p\u003e\n \u003cp\u003eRev: CGGGAAGCTTGTCATCAATGGAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eGAPDH, Glyceraldehyde-3-phosphate dehydrogenase\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Cancer stem cells, 18ß-glycyrrhetinic acid, CD44, EMT markers, Bcl-2","lastPublishedDoi":"10.21203/rs.3.rs-7312134/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7312134/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground:\u003c/h2\u003e\u003cp\u003eGastric cancer (GC) is a common malignancy with high rates of recurrence, metastasis, and drug resistance, often attributed to gastric cancer stem cells (CSCs). CD44, a surface marker upregulated in CSCs, plays a critical role in promoting epithelial-mesenchymal transition (EMT). 18β-glycyrrhetinic acid (GA), a major bioactive compound of Glycyrrhiza glabra, has known anti-inflammatory and anticancer properties. This study aimed to investigate the effects of GA on CD44 expression, EMT markers, and tumor growth in gastric CSCs.\u003c/p\u003e\u003ch2\u003eMethods and Results:\u003c/h2\u003e\u003cp\u003eGastric CSCs were cultured in serum-free medium with EGF and B-27 under nonadherent conditions and treated with varying GA concentrations (20\u0026ndash;160 \u0026micro;M) for 24, 48, and 72 hours. Cell viability was assessed using the MTT assay. mRNA expression levels of CD44, Bcl-2, and EMT markers (ZEB-1 and Snail-1) were measured by real-time PCR, while CD44 protein expression was analyzed by flow cytometry. GA\u0026rsquo;s effect on tumor growth was evaluated in a xenograft mouse model. Statistical analyses included one-way ANOVA and paired t-tests, with p\u0026thinsp;\u0026le;\u0026thinsp;0.05 considered significant. GA reduced gastric CSC viability in a time- and dose-dependent manner. Treatment with 60 \u0026micro;M GA significantly downregulated the mRNA expression of CD44, Bcl-2, ZEB-1, and Snail-1, and reduced surface CD44 protein expression at 48 and 72 hours. In vivo, GA treatment inhibited tumor growth and significantly reduced tumor volume in mice.\u003c/p\u003e\u003ch2\u003eConclusions:\u003c/h2\u003e\u003cp\u003eGA inhibits gastric CSC proliferation and tumor growth, potentially by suppressing EMT-related pathways via downregulation of CD44. These findings support further investigation of GA as a candidate for CSC-targeted gastric cancer therapies.\u003c/p\u003e","manuscriptTitle":"8β-glycyrrhetinic acid as major bioactive component of Glycyrrhiza glabra downregulates expression of CD44 and epithelial-mesenchymal transition markers and inhibits xenograft tumor growth in gastric cancer stem cells","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-08-21 08:06:31","doi":"10.21203/rs.3.rs-7312134/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"51f234ed-4a4d-497e-845c-7a73b3c234e2","owner":[],"postedDate":"August 21st, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-12-09T05:53:56+00:00","versionOfRecord":[],"versionCreatedAt":"2025-08-21 08:06:31","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7312134","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7312134","identity":"rs-7312134","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}