The role of Ca 2+ signaling and InsP3R in the pathogenesis of intrahepatic cholestasis of pregnancy

The role of Ca 2+ signaling and InsP3R in the pathogenesis of intrahepatic cholestasis of pregnancy | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article The role of Ca 2+ signaling and InsP3R in the pathogenesis of intrahepatic cholestasis of pregnancy Dan Pan, Mengting Jiang, Guoxian Tao, Jinmei Shi, Zhiwei Song, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-1790802/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract To provide new insights for future treatment of intrahepatic cholestasis of pregnancy (ICP), we evaluated serum Ca2+ levels and inositol 1,4,5-trisphosphate receptor (InsP3R) expression in the liver tissue of a rat ICP model. After establishing the model by injection of estradiol benzoate and progesterone into pregnant rats, animals were divided into normal control and ICP model groups. Expression of InsP3R protein in liver, and serum levels of Ca2+, glycocholic acid, and bile acid were detected. InsP3R mRNA and protein expression in the ICP model group were significantly lower compared with the normal group, as measured by qPCR and immunohistochemistry, respectively. Serum enzyme-linked immunosorbent assay results showed that levels of glycocholic acid and bile acid were significantly higher in the ICP model group compared with the normal group, and Ca2+ levels were significantly lower. Ca2+ levels were significantly and negatively correlated with the level of glycocholic acid. The observed decrease of Ca2+ was related to the increase of total bile acid, but there was no significant correlation. Our results reveal that InsP3R expression and serum Ca2+ levels were significantly decreased in liver tissue of ICP model rats, and Ca2+ levels were negatively correlated with the level of glycocholic acid. Rats intrahepatic cholestasis of pregnancy (ICP) InsP3R calcium ion Figures Figure 1 Figure 2 Figure 3 Introduction Intrahepatic cholestasis of pregnancy (ICP), also known as obstetric cholestasis syndrome, is a disorder specific to the second and third trimesters of pregnancy. Total bile acid and cholylglycine are sensitive biochemical markers for the diagnosis of ICP patients. Overexpression of serum glycocholic acid and high bile acid levels are involved in the occurrence of adverse pregnancy outcomes in patients with ICP 1 . ICP has serious adverse effects on perinatal infants, which can lead to fecal staining of amniotic fluid, fetal growth restriction, neonatal asphyxia, and other issues. Moreover, ICP increases the rate of cesarean sections and total bile acids up to 100 μmol/L significantly increase the risk of stillbirth 2 . Although ICP disappears rapidly after delivery, it frequently recurs in a second pregnancy or in patients on oral estrogen contraceptives, and the incidence increases with age 3 and number of pregnancies 4 . Therefore, close monitoring of serum glycocholic acid and bile acid levels is essential for the diagnosis and management of patients with ICP. Unfortunately, current drug treatment methods for ICP are limited. In recent years, the transporter genes involved in bile formation and secretion have been discovered and cloned 5 These advances have greatly promoted research on the mechanism of cholestasis and ICP. Calcium signals exist intracellularly, either free or bound to calmodulin, and mediate fundamental cellular processes 6 In bile duct cells, inositol 1,4,5-trisphosphate (InsP3) is the main intracellular Ca 2+ mobilization messenger 6 , the inositol 1,4,5-trisphosphate receptor (InsP3R) is the main Ca 2+ release channel in epithelial cells, and the combination of the two regulates Ca 2+ channels 7 . In a study of cholestatic-type liver injury, loss of InsP3R in cholangiocytes is associated with impaired Ca 2+ signaling and Ca 2+ -mediated bicarbonate secretion; however, upstream components of the Ca 2+ signaling pathway were unchanged. This finding suggests that the defect in Ca 2+ signaling results from selective reduction of InsP3R expression 8 . Although cholestasis is the result of a combination of factors, combined loss of Ca 2+ signaling and InsP3R may be the final common pathway leading to cholestasis 9, 10 . Ursodeoxycholic acid, a hydrophilic bile acid and the only effective treatment for some types of chronic cholestatic liver disease 11, 12 , enhances liver function by stimulating bile Ca 2+ -dependent exocytosis 13, 14 . Therefore, stimulation of intracellular Ca 2+ signaling may be an effective strategy for the treatment of cholestatic diseases. At present, no previous research has reported on Ca 2+ signaling and InsP3R in the pathogenesis of ICP. Based on many similarities between ICP and the pathogenesis of cholestasis, we speculate that Ca 2+ signaling may also be impaired in hepatocytes of patients with ICP. Indeed, it is the disruption of Ca 2+ signaling that leads to abnormal operation of intrahepatic bile, ultimately causing cholestasis. Abnormal Ca 2+ signaling and InsP3R expression or function may be the final common pathway for the pathogenesis of ICP. Using a rat ICP model, we aimed to clarify abnormalities of Ca 2+ signaling and InsP3R in ICP, and confirm that alteration of this signaling is the final pathway for ICP pathogenesis. Our findings provide new ideas for effective treatment of ICP in the future, which should reduce perinatal mortality and the occurrence of cesarean sections. Results InsP3R mRNA expression was reduced in ICP rats. InsP3R mRNA expression in the model group was significantly lower than that of the normal group (Figure 1, P < 0.05). InsP3R protein expression was reduced in ICP rats. Expression of InsP3R protein in the model group was significantly lower than that of the normal group (Figure 2, P < 0.05). Correlations between glycocholic acid, total bile acid, and Ca 2+ levels . Levels of total bile acids and glycocholic acid in the model group were significantly higher compared with the normal group (Table 1, P < 0.05). Ca 2+ levels were negatively correlated with glycocholic acid levels (P < 0.05). The decrease of Ca 2+ was related to the increase of total bile acid, but there was no significant correlation (Figure 3). Discussion ICP is a common complication during pregnancy whose pathogenesis is mainly caused by cholestasis in central capillaries of the liver 14 . A meta-analysis found that both total bile acids and glycocholic acids were effective markers for the diagnosis of ICP, and glycocholic acids had a higher diagnostic power than total bile acids. Compared with healthy pregnant women, levels of alanine aminotransferase, aspartate aminotransferase, total bile acid, and glycocholic acid in pregnant women with ICP were abnormally increased (P < 0.05), indicating that ICP was closely related to bile acid and positively correlated with glycolic acid levels. This study found that levels of glycocholic acid and bile acid in the ICP model were higher than those in the normal group, consistent with previous results 15 . There are three types of InsP3R: type 1 (InsP3R1), type 2 (InsP3R2), and type 3 (InsP3R3) 16-18 . Previous studies found that both the loss of InsP3R2 in hepatocytes and loss of InsP3R3 in cholangiocytes are important for the pathogenesis of cholestasis. InsP3R3 expression was decreased in cholangiocytes of patients with biliary diseases such as cirrhotic cholangitis 7, 19 . Basically, all liver functions are regulated by intracellular Ca 2+ at some point. The major epithelial cells of the liver are hepatocytes and cholangiocytes, and InsP3R is the only intracellular Ca 2+ release channel for these cells 20 . To open Ca 2+ channels, four InsP3 molecules must bind to the InsP3R 21 . Furthermore, Ca 2+ directly modulates the open probability of this channel. InsP3R1 releases Ca 2+ at lower Ca 2+ concentrations, while higher Ca 2+ concentrations inhibit this the channel. In contrast, the open probability of InsP3R3 increases with increasing Ca 2+ concentration 22 . Hepatocytes express InsP3R1 and InsP3R2, whereas all three isoforms are expressed in cholangiocytes 20 . Calcium signaling in hepatocytes begins with agonist binding to G protein- coupled receptors or receptor tyrosine kinases. After agonist receptor binding, phospholipase C was activated, leading to the breakdown of the membrane phosphatidyl inositol 4,5-bisphosphate to generate diacylglycerol and InsP3. InsP3 subsequently diffuses into the cytoplasm, where it binds to InsP3Rs located in the endoplasmic reticulum membrane, nuclear membrane, or nucleoplasmic reticulum. InsP3-InsP3R binding results in a conformational change in InsP3R, leading to the release of internal Ca 2+ stores 22, 23 . InsP3 is inactivated upon conversion to inositol 1,2-bisphosphate by type I inositol polyphosphate phosphatase 24 or via InsP3-kinase- mediated phosphorylation to form inositol 1,3,4,5-tetraphosphate 25 . InsP3R2 led to impaired Ca 2+ signaling and inhibited the insertion of multidrug resistance-related protein 2 into the apical plasma membrane of hepatocytes, and affected the ability of this protein to convert organic anions (such as bilirubin, glutathione conjugates, and oxidized glutathione) for secretion into bile. In cholangiocytes, InsP3R3 accounts for approximately 80% of InsP3Rs. InsP3R1 and InsP3R2 are responsible for the release of bicarbonate following activation of muscarinic receptor type 3 by acetylcholine. InsP3R3 is mainly localized in the apical region of cholangiocytes 20, 26 . Activation of InsP3R3 leads to bicarbonate secretion through a cAMP-dependent cascade, in which activation of secretin receptors indirectly stimulates InsP3 production and Ca 2+ release through InsP3R3 27 . Downregulation of InsP3R3 selectively interferes with cAMP-induced bicarbonate secretion; in this model, calcium signaling was impaired or absent 21 . The results of the present study show that InsP3R mRNA and protein expression levels in the ICP model group were significantly lower than those in the normal group. Therefore, we speculated that the mechanism of cholestasis in patients with ICP is similar to that of intrahepatic cholestasis caused by other diseases. Ca 2+ levels in the ICP model group were lower compared with the normal group, and significantly and negatively correlated with the glycocholic acid level (P < 0.05). This obvious correlation was considered to be the result of an insufficient sample size. Thus, the correlation between Ca 2+ and bile acids needs further confirmation in a larger number of samples. Bile duct cells contain estrogen receptors, and the estrogen level in ICP patients is significantly increased, which could lead to the activation of nuclear transcription factor erythroid 2-like 2 (NRF2) in bile duct cells. A previous study 28 identified a musculo-aponeurotic fibrosarcoma recognition element in the InsP3R3 promoter that directly binds to NRF2 in cholangiocytes. Increased NRF2 binding at this site led to chromatin remodeling, which reduced promoter activity to inhibit InsP3R3 expression in cholangiocytes, resulting in reduced Ca 2+ signaling and bile duct secretion. Normal bile acid flux can stimulate the influx of Ca 2+ through store-operated calcium channels (SOC) 29, 30 . Some scholars believe that cholestatic bile acids inhibit Ca 2+ influx, leading to the disruption of intracellular Ca 2+ homeostasis and signaling in the downstream region of SOC 30, 31 . Other studies 32 show that administration of ursodeoxycholic acid during the early stage of ICP or other liver diseases could significantly reduce bilirubin, alanine aminotransferase, and alkaline phosphatase contents to treat cholestasis. Collectively, these studies show that choleretic bile acids can increase the concentration of free Ca 2+ ions in the cytoplasm by depleting Ca 2+ in the intracellular pool, which induces translocation of matrix interacting molecules (such as STIM1) to generate SOC in the plasma membrane. Opening of SOC produces inflow of extracellular Ca 2+ , restoring Ca 2+ in the intracellular pool. This subsequently constricts the bile ducts, enhances excretion of bile acids, reduces accumulation of bile acids, and thus reduces the effect of accumulated bile acids on bile ducts and hepatocyte damage. Therefore, by increasing the concentration of serum Ca 2+ or artificially controlling the influx of Ca 2+ , choleretic drugs might promote Ca 2+ influx through SOC to increase the concentration of intracytoplasmic Ca 2+ , thereby enhancing excretion of bile acids and achieving treatment of patients with cholestasis (including ICP). However, this speculation still needs further experiments to confirm. Conclusion Serum Ca 2+ levels and InsP3R expression in liver tissue were significantly decreased in the rat ICP model, and the Ca 2+ level was negatively correlated with the level of glycocholic acid. These findings solve a fundamental problem of current ICP treatment and provide new insight for future treatment of ICP. Indeed, our results have the potential to markedly reduce both perinatal mortality and cesarean sections, which is of great significance and has a far-reaching impact. Materials And Methods Experimental animals. Female and male Sprague Dawley rats (specific pathogen-free grade) aged 10 weeks were purchased from Hunan Slaccas Jingda Laboratory Animal (Hunan, China) with license number SCXK (Xiang) 2019-0004. Ethics Statement . The experimental procedures were performed in accordance with the principles of the Guide for the Ethical Use of Animals in Applied Etiology Research 33 and the licenses of experimental animals (license number SCXK (Xiang) 2019-0004), and the experimental procedures were approved by the Ethics Committee of Taizhou Municipal Hospital of China (protocol number LWPJ106). Furthermore, we confirmed that all methods were reported in accordance with ARRIVE guidelines 34 . Reagents and Instruments. Estradiol benzoate (50-50-0) was purchased from Beijing Solaibao Technology (Beijing, China). Progesterone (57-83-0) was purchased from Shanghai Ye Yuan Biotechnology. (Shanghai, China). Corn oil (GB/T19111) was provided by Qinglong Hi-Tech Oils & Fats Industry (Jiangxi, China). Trizon reagent (cw0580s), Ultrapure RNA Ultrapure RNA Extraction Kit (CW0581M), and DAB color reagent kit (CW0125) were purchased from Kangwei Century (Dongtai, China). HiScript II Q RT SuperMix for qPCR (+gDNA wiper) (R223-01) was purchased from Vazyme Biotech (Nanjing, China). 2×SYBR Green PCR Master Mix (A4004M) was purchased from Lifeint Technology (Xiamen, China). Hematoxylin Stain Solution (ZLI-9610) and horseradish-enzyme-labeled goat anti-rabbit IgG (H+L) (ZB-2301) were purchased from Zhongshan Jinqiao Biotechnology Group (Beijing, China). InsP3R (19962-1-AP) was purchased from BioLion Technology (Singapore). Centrifugation was accomplished with a D1008E microcentrifuge (SciLogex, Rocky Hill, CT, USA). The vortex mixer (XH-C) was purchased from Changzhou Yuexin Instrument Manufacturing (Changzhou, China). The dry electric heater (GL-150) was purchased from Haimen City Qilin Bell Instrument Manufacturing (Nantong, China). RNA was quantified using a nanophotometer. The low-temperature high-speed centrifuge (5424R) was a product of Eppendorf (Hamburg, Germany). The fluorescence PCR instrument (CFX Connect™) was a product of Bó Lè Life Medical Products (Shanghai, China). The automatic sample rapid grinder (Tiss-12) was a product of Shanghai Jingxin Industrial Development (Shanghai, China). The electric heating constant temperature incubator (DHP-9054) was a product of Shandong Broke Biological Industry (Shangdong, China). A CX41 microscope (Olympus, Tokyo, Japan), and slicer (2235, Leica, Wetzlar, Germany) were used. The electric-heating blast-drying oven (DHG-9070A) was a product of Heng Science Instrument (Beijing, China). Methods Experimental Groups. Experimental animals were divided into normal control and ICP model groups. Animal Model Construction and Drug Administration. Estradiol benzoate solution was prepared by dissolving 12.5 mg of estradiol benzoate in 100 ml of corn oil to make a 0.125 mg/ml solution. Progesterone solution was prepared by dissolving 750 mg of progesterone in 100 ml of corn oil to make a 7.5 mg/ml solution. Each pair of female and male rats was caged at a ratio of 1:1, and female rats exhibiting a vaginal plug on the same day were recorded as pregnancy 1 d. On the fifteenth day of pregnancy, each ICP model group was given a 10 ml/kg dose of benzoic acid. Glycol solution and progesterone solution were continuously administered by intragastric administration for 5 d, and then rats were sacrificed with 10% chloral hydrate. Real-time Fluorescent Quantitative PCR. Samples were collected for mRNA extraction. After extraction, the concentration and purity of RNA were measured by a micro UV spectrophotometer, and the quality of RNA was determined by agarose gel electrophoresis. cDNA was synthesized with a HiScript II Q RT SuperMix for qPCR (+gDNA wiper) reverse transcription kit according to the manufacturer’s instructions. Briefly, cDNA was used as the template, the sample was loaded with fluorescent dyes, and the program was set on the fluorescence quantitative PCR instrument to carry out the amplification reaction. According to the relative quantitative 2 - △△ Ct method, relative mRNA expression of VEGF5 and sflt-1 were calculated with β-actin as the internal reference. All primers were designed using Primer 5.0 software and Primer Blast of NCBI, and synthesized by General Biosystems (Anhui, China). The purification method for primers was polyacrylamide gel electrophoresis PAGE. The operating system was as follows: Reagent Volume (20 μl reaction system) 2×SYBR Green PCR Master Mix 10 μl cDNA 1 μl Upstream primer 0.4 μl Downstream primer 0.4 μl RNase Free ddH20 8.2 μl The reaction procedure was as follows: step temperature time Cycles No. Pre denaturation 95°C 10 min 1 denaturation 95°C 10 s 40 annealing 58°C 30 s extend 72°C 30 s Primers were as follows: Primer Primer sequence Primer length (nt) Product length (bp) Annealing temperature (°C) InsP3R F CTCTCCGGCACCCAAAGAAGAG 22 141 62.1 InsP3R R AGCACATCTCCTACTCCGCC 20 β-actin F GCCATGTACGTAGCCATCCA 20 375 59.5 β-actin R GAACCGCTCATTGCCGATAG 20 Immunohistochemical Detection. Tissue sections were placed in a 65°C oven for 2 h, followed by xylene for 10 min, which was replaced with xylene for another 10 min, Subsequently, sections were placed for 5 min each in 100% ethanol, 100% ethanol, 95% ethanol, and 80% ethanol in purified water. For antigen retrieval, sections were placed in a repair box with antigen retrieval solution (citrate buffer), heated in a pressure cooker (allowed to automatically deflate), and allowed to naturally cool for 2 min on the heat source. After discarding the antigen retrieval solution and rinsing sections with PBS, they were moved into a wet box with freshly prepared 3% hydrogen peroxide to remove the endogenous peroxidase blocking solution for 10 min at room temperature, and rinsed with PBS. Next, the slides were soaked three times in PBS (5 min each), the PBS around the tissue was blotted with absorbent paper, 5% bovine serum albumin was added dropwise onto the slides for blocking at 37°C for 30 min. After absorbing the blocking solution around the tissue with absorbent paper (without washing), a sufficient amount of diluted primary TH antibody (1:200) was dropped onto each slide, which were put it in a humid box and incubated at 4°C overnight. For secondary antibody staining the following day, the wet box was allowed to stand at room temperature for 45 min, the slides were soaked in PBS three times (5 min each), and goat anti-rabbit antibody (1:100) was added for incubation at 37°C for 30 min. After washing the slides with PBS, color development and counterstaining was performed with DAB for 5–10 min. The degree of staining was checked under a microscope before rinsing slides with PBS or tap water for 1 min, counterstaining with hematoxylin for 3 min, differentiating with hydrochloric acid alcohol, and returning to blue. Finally, slides were rinsed with tap water for 1 min, dehydrated, cleared, covered, and examined by microscopy. Serum ELISA Detection. Pregnant rats were sacrificed after anesthesia with 10% chloral hydrate, and 1.5 ml of whole blood was collected by encapsulating the eyes. After whole-blood samples were collected, they were allowed to stand at room temperature for 30 min, centrifuged at 3,000 rpm for 15 min, and about 0.5 ml of serum was taken for ELISA detection. Statistical Analysis . SPSS 20.0 software was used for statistical analysis. All experiments were repeated three times. Quantitative results are expressed as the mean and standard deviation (χ ± s). One-way ANOVA was used for comparison of the two groups, the Student-Newman-Keuls method was used for pairwise comparisons, and Pearson correlation analysis was used to assess for linear relationships between the two groups. The test level was α = 0.05 and P < 0.05 indicated a significant difference. Declarations Acknowledgments This work was supported by Medical and Health Science and Technology Projects of Zhejiang Province (2022KY1388). We thank Liwen Bianji (Edanz) (www.liwenbianji.cn/) for basic language editing of a draft of this manuscript. Author contributions D.P. and M.J. made substantial contributions to acquisition, analysis, and interpretation of the data, and wrote the first draft of the manuscript; M.J., G.T., J.S., Z S., R.C. and D.W. made substantial contributions to acquisition of data. D.P. and D.W. contributed to experimental conception and design, and analysis and interpretation of data, and drafted the manuscript and revised it critically. All authors read and approved the final manuscript. Conflict of interest The authors declare no conflict of interest. Data availability statement All generated raw data and/or analyzed data from the current study are available from the corresponding author on reasonable request. References Vasavan, T., Deepak, S., Jayawardane, I. A., Lucchini, M., Martin, C., Geenes, V. et al . Fetal cardiac dysfunction in intrahepatic cholestasis of pregnancy is associated with elevated serum bile acid concentrations. J. Hepatol. 74 , 1087–1096 (2021). Çelik, S., Çalışkan, C. S., Çelik, H., Güçlü, M. & Başbuğ, A. Predictors of adverse perinatal outcomes in intrahepatic cholestasis of pregnancy. Ginekol. Pol. 90 , 217–222 (2019). Gao, X-X., Ye, M-Y., Liu, Y., Li, J-Y., Li, L., Chen, W. et al . Prevalence and risk factors of intrahepatic cholestasis of pregnancy in a Chinese population. Sci. Rep . 10 , 16307 (2020). Mangla, A., Guerra, M. T. & Nathanson, M. H. Type 3 inositol 1,4,5-trisphosphate receptor: A calcium channel for all seasons. Cell Calcium. 85 , 102132 (2020). Garrido, A., Kim, E., Teijeiro, A., Sánchez, P. S., Gallo, R. et al. Histone acetylation of bile acid transporter genes plays a critical role in cirrhosis. J. Hepatol . 76 , 850-861 (2022). Rodrigues, M. A., Gomes, D. A. & Nathanson, M. H. Calcium Signaling in Cholangiocytes: Methods, Mechanisms, and Effects. Int. J. Mol. Sci . 19 , 3913 (2018). Franca, A., Lima Filho, A. C. M., Guerra, M. T., Weerachayaphorn, J., Dos Santos M. L., et al . Effects of Endotoxin on Type 3 Inositol 1,4,5-Trisphosphate Receptor in Human Cholangiocytes. Hepatology . 69 , 817–830 (2019). Herta, T., Kersten, R., Chang, J. C., Hubers, L., Go, S. et al . Role of the IgG4- related cholangitis autoantigen annexin A11 in cholangiocyte protection. J. Hepatol . 76 , 319–331 (2022). Amaya, M. J. & Nathanson, M. H. Calcium signaling and the secretory activity of bile duct epithelia. Cell Calcium . 55 , 317–324 (2014). Meng, F., Kennedy, L., Hargrove, L., Demieville, J., Jones, H. et al . Ursodeoxycholate inhibits mast cell activation and reverses biliary injury and fibrosis in Mdr2-/-mice and human primary sclerosing cholangitis. Lab. Invest . 98 , 1465–1477 (2018). Mayo, M. J., Wigg, A. J., Leggett, B. A., Arnold, H., Thompson, A. J., et al . Leggett BANGM282 for treatment of patients with primary biliary cholangitis: a multicenter, randomized, double-blind, placebo-controlled trial. Hepatol. Commun . 2 , 1037–1050 (2018). Zhou, Q., Guo, W., Jia, Y. & Xu, J. Effect of 4-phenylbutyric acid and tauroursodeoxycholic acid on magnesium and calcium metabolism in streptozocin-induced type 1 diabetic mice. Biol. Trace Elem. Res . 189 , 501–510 (2019). Zhou, L., Wang, X. & Mao, W. Effects of taurochenodeoxycholic acid on Ca 2+ /CaM signalling mediated by the TGR5 signalling pathway. Pharmazie . 71 , 390–393 (2016). Fu, C. & Xu, Y. Value of serum glycocholic acid and total bile acids in predicting maternal and perinatal outcomes in intrahepatic cholestasis of pregnancy. J. Healthc. Eng . 2021 , 3911998 (2021). Piechota, J., Jelski, W. Intrahepatic Cholestasis in Pregnancy: Review of the Literature. J. Clin. Med . 9 , 1361 (2020). Yang, F., Ma, H., Butler, M. R. & Ding, X-Q. Preservation of endoplasmic reticulum (ER) Ca 2+ stores by deletion of inositol-1,4,5-trisphosphate receptor type 1 promotes ER retrotranslocation, proteostasis, and protein outer segment localization in cyclic nucleotide-gated channel- deficient cone photoreceptors. FASEB J . 35 , e21579 (2021). Iyer, R. & Franzini-Armstrong, C. The location of InsP3 receptors in Purkinje cells of murine cerebellum does not supports a direct interaction in the transfer of calcium ions between ER and mitochondria. Eur. J. Transl. Myol . 31 , 9935 (2021). Amroudie, M. N. & Ataei, F. Experimental and theoretical study of IBC domain from human IP3R2; molecular cloning, bacterial expression and protein purification. Int. J. Biol. Macromol . 124 , 1321–1327(2019). Rodrigues, M. A., Gomes, D. A., Cosme, A. L., Sanches, M. D., Resende, V. et al . Inositol 1, 4, 5- trisphosphate receptor type 3 (ITPR3) is overexpressed in cholangiocarcinoma and its expression correlates with S100 calcium-binding protein A4 (S100A4). Biomed. Pharmacother . 145 , 112403 (2022). Zhang, L., Zhang, Y., Jiang, Y., Dou, X., Li, S. et al . Upregulated SOCC and IP3R calcium channels and subsequent elevated cytoplasmic calcium signaling promote nonalcoholic fatty liver disease by inhibiting autophagy. Mol. Cell Biochem . 476 , 3163–3175 (2021). Alzayady, K. J., Wang, L., Chandrasekhar, R.,Wagner, L. E., Van Petegem, F. & Yule, D. I. Defining the stoichiometry of inositol 1, 4, 5-trisphosphate binding required to initiate Ca 2+ release. Sci. Signal . 9 , ra35 (2016). Hagar, R. E. & Ehrlich, B. E. Regulation of the type III InsP(3) receptor by InsP(3) and ATP. Biophys. J . 79 , 271–278 (2000). Hodeify, R., Yu, F., Courjaret, R., Nader, N., Dib, M. et al . Regulation and Role of Store-Operated Ca 2+ Entry in Cellular Proliferation. In: Calcium Entry Channels in Non- Excitable Cells. Boca Raton (FL): CRC Press/Taylor & Francis . Chapter 12 (2018). de Miranda M. C., Rodrigues M. A., de Angelis Campos A. C., Faria J. A. Q. A., Kunrath-Lima, M., et al . Epidermal growth factor (EGF) triggers nuclear calcium signaling through the intranuclear phospholipase Cδ-4 (PLCδ4). J. Biol. Chem ,. 294 , 16650–16662 (2019). Marongiu, L., Mingozzi, F., Cigni, C., Marzi, R., Di Gioia, M. et al . Inositol 1, 4, 5-trisphosphate 3-kinase B promotes Ca 2+ mobilization and the inflammatory activity of dendritic cells. Sci. Signal . 14 , eaaz2120 (2021). Rodrigues, M. A., Gomes, D. A. & Nathanson, M. H. Calcium signaling in cholangiocytes: methods, mechanisms, and effects. Int. J. Mol. Sci . 19 , 3913 (2018). Roos, F. J. M., Bijvelds, M. J. C., Verstegen, M. M. A., Roest, H. P., Metselaar, H. J. et al . Impact of hypoxia and AMPK on CFTR-mediated bicarbonate secretion in human cholangiocyte organoids. Am. J. Physiol. Gastrointest. Liver Physiol . 320 , G741–G752 (2021). Ueaasilamongkol, P., Khamphaya, T., Guerra, M. T., Rodrigues, M. A., Gomes, D. A. et al . Type 3 inositol 1,4,5-trisphosphate receptor is increased and enhances malignant properties in Cholangiocarcinoma. Hepatology . 71 , 583–599 (2020). Gupta, K., Ng, I. C., Balachander, G. M., Nguyen, B. P., Tucker-Kellogg, L., Low, B. C., Yu, H. et al . Bile canaliculi contract autonomously by releasing calcium into hepatocytes via mechanosensitive calcium channel. Biomaterials . 259 , 120283 (2020). Bird, G. S., Putney, J. W, Jr., Kozak, J. A. & Putney, J. W., Jr. Pharmacology of Store-Operated Calcium Entry Channels. In: Calcium Entry Channels in Non-Excitable Cells. Boca Raton (FL): CRC Press/Taylor & Francis . Chapter 16 (2018). Bonus, M., Häussinger, D. & Gohlke, H. Liver cell hydration and integrin signaling. Biol. Chem . 402 , 1033–1045 (2021). Krupa, Ł., Staroń, R., Dulko, D., Łozińska, N., Mackie, A. R. et al . Importance of bile composition for diagnosis of biliary obstructions. Molecules . 26 , 7279 (2021). Li, Y., Tang, R., Leung, P. S. C., Gershwin, M. E., Ma, X. et al . Bile acids and intestinal microbiota in autoimmune cholestatic liver diseases. Autoimmun. Rev . 16 , 885–896 (2017). Sherwin, C. M., Christiansen, S. B., Duncan, I. J., Erhard, H. W., Clay, D., Jr. et al . Guidelines for the ethical use of animals in applied ethology studies. Appl. Anim. Behav . Sci . 81 , 291–305 (2003). Kilkenny, C., Browne, W. J., Cuthi, I., Emerson, M., Altman, D. G. Improving bioscience research reporting: the ARRIVE guidelines for reporting animal research. Vet. Clin. Pathol. 41 , 27–31 (2012). Tables Table 1 Comparison of ELISA indexes （ χ ± s) Groups Ca 2+ （ nmol/L ） TBA （ μmol/L ） CG （ μg/mL ） Normal group 2.49±0.18 22.72±12.09 5.42±4.31 ICP group 21.75±0.55 59.00±20.83 26.37±10.36 P 0.021 0.010 0.003 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-1790802","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":117541332,"identity":"c5725eb4-3a69-495c-a94b-7f703b1a918c","order_by":0,"name":"Dan Pan","email":"","orcid":"","institution":"Taizhou Municipal Hospital affiliated with Taizhou University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Dan","middleName":"","lastName":"Pan","suffix":""},{"id":117541333,"identity":"c86ba0e9-dbd4-4db5-b267-9014e8e1e4b4","order_by":1,"name":"Mengting Jiang","email":"","orcid":"","institution":"Taizhou Municipal Hospital affiliated with Taizhou University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Mengting","middleName":"","lastName":"Jiang","suffix":""},{"id":117541334,"identity":"e01f3a4b-7c62-4fc8-bb64-b99ad7c214ae","order_by":2,"name":"Guoxian Tao","email":"","orcid":"","institution":"Taizhou Municipal Hospital affiliated with Taizhou University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Guoxian","middleName":"","lastName":"Tao","suffix":""},{"id":117541335,"identity":"0babb7e6-f4b2-4518-a226-703f6ed22bbe","order_by":3,"name":"Jinmei Shi","email":"","orcid":"","institution":"Taizhou Municipal Hospital affiliated with Taizhou University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jinmei","middleName":"","lastName":"Shi","suffix":""},{"id":117541336,"identity":"7b4f8217-9912-4e21-8647-dd0495f3690f","order_by":4,"name":"Zhiwei Song","email":"","orcid":"","institution":"Taizhou Municipal Hospital affiliated with Taizhou University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Zhiwei","middleName":"","lastName":"Song","suffix":""},{"id":117541337,"identity":"e0add2b3-e0e4-4d87-8019-756343ffc7ba","order_by":5,"name":"Ren Chen","email":"","orcid":"","institution":"Taizhou Municipal Hospital affiliated with Taizhou University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Ren","middleName":"","lastName":"Chen","suffix":""},{"id":117541338,"identity":"454c343d-3500-473b-bd50-e76514ef7baf","order_by":6,"name":"Dongguo Wang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAArklEQVRIiWNgGAWjYFCCBBBhw8PP30C8Fkag2jQZyRkHSNNy2MagIYFIDQbH068//PHnPI8BwwHGDx9ziNFy5k1hg2TbbR5z5gZmyZnbiNBidiMnscGw4TaPZcMBNmZeorUk/DnHY3AggWgt6QeB5h8gQYv9mTeMMxvbknkkZxxsJs4vku3pDz7++GNnz8/ffPDDR2K0MDAAgxcCQPFDHGB/QKzKUTAKRsEoGKkAAOlMPEVZVrW4AAAAAElFTkSuQmCC","orcid":"","institution":"Taizhou Municipal Hospital affiliated with Taizhou University","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Dongguo","middleName":"","lastName":"Wang","suffix":""}],"badges":[],"createdAt":"2022-06-24 07:44:21","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-1790802/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-1790802/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":23590902,"identity":"6fa73b08-ce28-4b97-9940-a592fbcf163a","added_by":"auto","created_at":"2022-07-07 16:04:29","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":69678,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cspan class=\"ql-cursor\"\u003e\u003c/span\u003eqPCR analysis of InsP3R mRNA expression. A, Results of PCR amplification. B, lnsP3R mRNA relative expression of different groups. *, InsP3R mRNA expression in the model group was significantly lower compared with the normal group (P \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"Fig1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-1790802/v1/43aae1e845c12ef138371a2c.jpg"},{"id":23591639,"identity":"3b5932a7-c1ea-4f51-97c3-a9c5cb09fc47","added_by":"auto","created_at":"2022-07-07 16:09:29","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":72238,"visible":true,"origin":"","legend":"\u003cp\u003eImmunohistochemistry analysis of InsP3R expression. A, Images of immunohistochemistry. B, Relative expression of lnsP3R mRNA in each group. *, Expression of InsP3R in the model group was significantly lower compared with the normal group (P \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"Fig2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-1790802/v1/b52b02d62712e63f1c1f7e52.jpg"},{"id":23590900,"identity":"aa3db83f-02cc-428b-993e-e74ac2da02c0","added_by":"auto","created_at":"2022-07-07 16:04:29","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":33422,"visible":true,"origin":"","legend":"\u003cp\u003eCorrelation between glycocholic acid, total bile acid, and calcium ion.\u003c/p\u003e","description":"","filename":"Fig3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-1790802/v1/9deabf8fbbc5de7ec22e3529.jpg"},{"id":23696026,"identity":"a06cc34e-3969-4df8-a4bc-d2e114b9dc66","added_by":"auto","created_at":"2022-07-11 07:59:34","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":497942,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1790802/v1/01e29077-b855-4db6-b5a3-4d95edebdad3.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"The role of Ca 2+ signaling and InsP3R in the pathogenesis of intrahepatic cholestasis of pregnancy","fulltext":[{"header":"Introduction","content":"\u003cp\u003eIntrahepatic cholestasis of pregnancy (ICP), also known as obstetric cholestasis syndrome, is a disorder specific to the second and third trimesters of pregnancy. Total bile acid and cholylglycine are sensitive biochemical markers for the diagnosis of ICP patients. Overexpression of serum glycocholic acid and high bile acid levels are involved in the occurrence of adverse pregnancy outcomes in patients with ICP\u003csup\u003e1\u003c/sup\u003e. ICP has serious adverse effects on perinatal infants, which can lead to fecal staining of amniotic fluid, fetal growth restriction, neonatal asphyxia, and other issues. Moreover, ICP increases the rate of cesarean sections and total bile acids up to 100 \u0026mu;mol/L significantly increase the risk of stillbirth\u003csup\u003e2\u003c/sup\u003e. Although ICP disappears rapidly after delivery, it frequently recurs in a second pregnancy or in patients on oral estrogen contraceptives, and the incidence increases with age\u003csup\u003e3\u003c/sup\u003e and number of pregnancies\u003csup\u003e4\u003c/sup\u003e. Therefore, close monitoring of serum glycocholic acid and bile acid levels is essential for the diagnosis and management of patients with ICP. Unfortunately, current drug treatment methods for ICP are limited.\u003c/p\u003e\n\u003cp\u003eIn recent years, the transporter genes involved in bile formation and secretion have been discovered and cloned\u003csup\u003e5\u003c/sup\u003e These advances have greatly promoted research on the mechanism of cholestasis and ICP. Calcium signals exist intracellularly, either free or bound to calmodulin, and mediate fundamental cellular processes\u003csup\u003e6\u003c/sup\u003e In bile duct cells, inositol 1,4,5-trisphosphate (InsP3) is the main intracellular Ca\u003csup\u003e2+\u003c/sup\u003e mobilization messenger\u003csup\u003e6\u003c/sup\u003e, the inositol 1,4,5-trisphosphate receptor (InsP3R) is the main Ca\u003csup\u003e2+\u003c/sup\u003e release channel in epithelial cells, and the combination of the two regulates Ca\u003csup\u003e2+\u003c/sup\u003e channels\u003csup\u003e7\u003c/sup\u003e. In a study of cholestatic-type liver injury, loss of InsP3R in cholangiocytes is associated with impaired Ca\u003csup\u003e2+\u003c/sup\u003e signaling and Ca\u003csup\u003e2+\u003c/sup\u003e-mediated bicarbonate secretion; however, upstream components of the Ca\u003csup\u003e2+\u003c/sup\u003e signaling pathway were unchanged. This finding suggests that the defect in Ca\u003csup\u003e2+\u003c/sup\u003e signaling results from selective reduction of InsP3R expression\u003csup\u003e8\u003c/sup\u003e. Although cholestasis is the result of a combination of factors, combined loss of Ca\u003csup\u003e2+\u003c/sup\u003e signaling and InsP3R may be the final common pathway leading to cholestasis\u003csup\u003e9, 10\u0026nbsp;\u003c/sup\u003e. Ursodeoxycholic acid, a hydrophilic bile acid and the only effective treatment for some types of chronic cholestatic liver disease\u003csup\u003e11, 12\u003c/sup\u003e, enhances liver function by stimulating bile Ca\u003csup\u003e2+\u003c/sup\u003e-dependent exocytosis\u003csup\u003e13, 14\u003c/sup\u003e. Therefore, stimulation of intracellular Ca\u003csup\u003e2+\u003c/sup\u003e signaling may be an effective strategy for the treatment of cholestatic diseases.\u003c/p\u003e\n\u003cp\u003eAt present, no previous research has reported on Ca\u003csup\u003e2+\u003c/sup\u003e signaling and InsP3R in the pathogenesis of ICP. Based on many similarities between ICP and the pathogenesis of cholestasis, we speculate that Ca\u003csup\u003e2+\u003c/sup\u003e signaling may also be impaired in hepatocytes of patients with ICP. Indeed, it is the disruption of Ca\u003csup\u003e2+\u003c/sup\u003e signaling that leads to abnormal operation of intrahepatic bile, ultimately causing cholestasis. Abnormal Ca\u003csup\u003e2+\u003c/sup\u003e signaling and InsP3R expression or function may be the final common pathway for the pathogenesis of ICP. Using a rat ICP model, we aimed to clarify abnormalities of Ca\u003csup\u003e2+\u003c/sup\u003e signaling and InsP3R in ICP, and confirm that alteration of this signaling is the final pathway for ICP pathogenesis. Our findings provide new ideas for effective treatment of ICP in the future, which should reduce perinatal mortality and the occurrence of cesarean sections.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eInsP3R mRNA expression was reduced in ICP rats.\u003c/strong\u003e\u0026nbsp; \u0026nbsp;InsP3R mRNA expression in the model group was significantly lower than that of the normal group (Figure 1, P \u0026lt; 0.05).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInsP3R protein expression was reduced in ICP rats.\u003c/strong\u003e\u0026nbsp; \u0026nbsp;Expression of InsP3R protein in the model group was significantly lower than that of the normal group (Figure 2, P \u0026lt; 0.05).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCorrelations between glycocholic acid, total bile acid, and Ca\u003csup\u003e2+\u003c/sup\u003e levels\u003c/strong\u003e. \u0026nbsp; Levels of total bile acids and glycocholic acid in the model group were significantly higher compared with the normal group (Table 1, P \u0026lt; 0.05). Ca\u003csup\u003e2+\u003c/sup\u003e levels were negatively correlated with glycocholic acid levels (P \u0026lt; 0.05). The decrease of Ca\u003csup\u003e2+\u003c/sup\u003e was related to the increase of total bile acid, but there was no significant correlation (Figure 3).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eICP is a common complication during pregnancy whose pathogenesis is mainly caused by cholestasis in central capillaries of the liver\u003csup\u003e14\u003c/sup\u003e. A meta-analysis found that both total bile acids and glycocholic acids were effective markers for the diagnosis of ICP, and glycocholic acids had a higher diagnostic power than total bile acids. Compared with healthy pregnant women, levels of alanine aminotransferase, aspartate aminotransferase, total bile acid, and glycocholic acid in pregnant women with ICP were abnormally increased (P \u0026lt; 0.05), indicating that ICP was closely related to bile acid and positively correlated with glycolic acid levels. This study found that levels of glycocholic acid and bile acid in the ICP model were higher than those in the normal group, consistent with previous results\u003csup\u003e15\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eThere are three types of InsP3R: type 1 (InsP3R1), type 2 (InsP3R2), and type 3 (InsP3R3)\u003csup\u003e\u0026nbsp;\u003c/sup\u003e\u003csup\u003e16-18\u003c/sup\u003e. Previous studies found that both the loss of InsP3R2 in hepatocytes and loss of InsP3R3 in cholangiocytes are important for the pathogenesis of cholestasis. InsP3R3 expression was decreased in cholangiocytes of patients with biliary diseases such as cirrhotic cholangitis\u003csup\u003e7, 19\u003c/sup\u003e. Basically, all liver functions are regulated by intracellular Ca\u003csup\u003e2+\u003c/sup\u003e at some point. The major epithelial cells of the liver are hepatocytes and cholangiocytes, and InsP3R is the only intracellular Ca\u003csup\u003e2+\u003c/sup\u003e release channel for these cells\u003csup\u003e20\u003c/sup\u003e. To open Ca\u003csup\u003e2+\u003c/sup\u003e channels, four InsP3 molecules must bind to the InsP3R\u003csup\u003e21\u003c/sup\u003e. Furthermore, Ca\u003csup\u003e2+\u003c/sup\u003e directly modulates the open probability of this channel. InsP3R1 releases Ca\u003csup\u003e2+\u0026nbsp;\u003c/sup\u003eat lower Ca\u003csup\u003e2+\u003c/sup\u003e concentrations, while higher Ca\u003csup\u003e2+\u003c/sup\u003e concentrations inhibit this the channel. In contrast, the open probability of InsP3R3 increases with increasing Ca\u003csup\u003e2+\u003c/sup\u003e concentration\u003csup\u003e22\u003c/sup\u003e. Hepatocytes express InsP3R1 and InsP3R2, whereas all three isoforms are expressed in cholangiocytes\u003csup\u003e20\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eCalcium signaling in hepatocytes begins with agonist binding to G protein- coupled receptors or receptor tyrosine kinases. After agonist receptor binding, phospholipase C was activated, leading to the breakdown of the membrane phosphatidyl inositol 4,5-bisphosphate to generate diacylglycerol and InsP3. InsP3 subsequently diffuses into the cytoplasm, where it binds to InsP3Rs located in the endoplasmic reticulum membrane, nuclear membrane, or nucleoplasmic reticulum. InsP3-InsP3R binding results in a conformational change in InsP3R, leading to the release of internal Ca\u003csup\u003e2+\u003c/sup\u003e stores\u003csup\u003e22, 23\u003c/sup\u003e. InsP3 is inactivated upon conversion to inositol 1,2-bisphosphate by type I inositol polyphosphate phosphatase\u003csup\u003e24\u003c/sup\u003e\u003csup\u003e\u0026nbsp;\u003c/sup\u003eor via InsP3-kinase- mediated phosphorylation to form inositol 1,3,4,5-tetraphosphate\u003csup\u003e25\u003c/sup\u003e. InsP3R2 led to impaired Ca\u003csup\u003e2+\u003c/sup\u003e signaling and inhibited the insertion of multidrug resistance-related protein 2 into the apical plasma membrane of hepatocytes, and affected the ability of this protein to convert organic anions (such as bilirubin, glutathione conjugates, and oxidized glutathione) for secretion into bile.\u003c/p\u003e\n\u003cp\u003eIn cholangiocytes, InsP3R3 accounts for approximately 80% of InsP3Rs. InsP3R1 and InsP3R2 are responsible for the release of bicarbonate following activation of muscarinic receptor type 3 by acetylcholine. InsP3R3 is mainly localized in the apical region of cholangiocytes\u003csup\u003e20, 26\u003c/sup\u003e. Activation of InsP3R3 leads to bicarbonate secretion through a cAMP-dependent cascade, in which activation of secretin receptors indirectly stimulates InsP3 production and Ca\u003csup\u003e2+\u003c/sup\u003e release through InsP3R3\u003csup\u003e27\u003c/sup\u003e. Downregulation of InsP3R3 selectively interferes with cAMP-induced bicarbonate secretion; in this model, calcium signaling was impaired or absent\u003csup\u003e21\u003c/sup\u003e. The results of the present study show that InsP3R mRNA and protein expression levels in the ICP model group were significantly lower than those in the normal group. Therefore, we speculated that the mechanism of cholestasis in patients with ICP is similar to that of intrahepatic cholestasis caused by other diseases. Ca\u003csup\u003e2+\u003c/sup\u003e levels in the ICP model group were lower compared with the normal group, and significantly and negatively correlated with the glycocholic acid level (P \u0026lt; 0.05). This obvious correlation was considered to be the result of an insufficient sample size. Thus, the correlation between Ca\u003csup\u003e2+\u003c/sup\u003e and bile acids needs further confirmation in a larger number of samples.\u0026nbsp;Bile duct cells contain estrogen receptors, and the estrogen level in ICP patients is significantly increased, which could lead to the activation of nuclear transcription factor erythroid 2-like 2 (NRF2) in bile duct cells. A previous study\u003csup\u003e28\u003c/sup\u003e\u003csup\u003e\u0026nbsp;\u003c/sup\u003eidentified a musculo-aponeurotic fibrosarcoma recognition element in the InsP3R3 promoter that directly binds to NRF2 in cholangiocytes. Increased NRF2 binding at this site led to chromatin remodeling, which reduced promoter activity to inhibit InsP3R3 expression in cholangiocytes, resulting in reduced Ca\u003csup\u003e2+\u003c/sup\u003e signaling and bile duct secretion.\u003c/p\u003e\n\u003cp\u003eNormal bile acid flux can stimulate the influx of Ca\u003csup\u003e2+\u003c/sup\u003e through store-operated calcium channels (SOC)\u003csup\u003e29, 30\u003c/sup\u003e. Some scholars believe that cholestatic bile acids inhibit Ca\u003csup\u003e2+\u003c/sup\u003e influx, leading to the disruption of intracellular Ca\u003csup\u003e2+\u003c/sup\u003e homeostasis and signaling in the downstream region of SOC\u003csup\u003e30, 31\u003c/sup\u003e. Other studies\u003csup\u003e32\u003c/sup\u003e show that administration of ursodeoxycholic acid during the early stage of ICP or other liver diseases could significantly reduce bilirubin, alanine aminotransferase, and alkaline phosphatase contents to treat cholestasis. Collectively, these studies show that choleretic bile acids can increase the concentration of free Ca\u003csup\u003e2+\u003c/sup\u003e ions in the cytoplasm by depleting Ca\u003csup\u003e2+\u003c/sup\u003e in the intracellular pool, which induces translocation of matrix interacting molecules (such as STIM1) to generate SOC in the plasma membrane. Opening of SOC produces inflow of extracellular Ca\u003csup\u003e2+\u003c/sup\u003e, restoring Ca\u003csup\u003e2+\u003c/sup\u003e in the intracellular pool. This subsequently constricts the bile ducts, enhances excretion of bile acids, reduces accumulation of bile acids, and thus reduces the effect of accumulated bile acids on bile ducts and hepatocyte damage. Therefore, by increasing the concentration of serum Ca\u003csup\u003e2+\u003c/sup\u003e or artificially controlling the influx of Ca\u003csup\u003e2+\u003c/sup\u003e, choleretic drugs might promote Ca\u003csup\u003e2+\u003c/sup\u003e influx through SOC to increase the concentration of intracytoplasmic Ca\u003csup\u003e2+\u003c/sup\u003e, thereby enhancing excretion of bile acids and achieving treatment of patients with cholestasis (including ICP). However, this speculation still needs further experiments to confirm.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eSerum Ca\u003csup\u003e2+\u003c/sup\u003e levels and InsP3R expression in liver tissue were significantly decreased in the rat ICP model, and the Ca\u003csup\u003e2+\u003c/sup\u003e level was negatively correlated with the level of glycocholic acid. These findings solve a fundamental problem of current ICP treatment and provide new insight for future treatment of ICP. Indeed, our results have the potential to markedly reduce both perinatal mortality and cesarean sections, which is of great significance and has a far-reaching impact.\u003c/p\u003e"},{"header":"Materials And Methods","content":"\u003cp\u003e\u003cstrong\u003eExperimental animals.\u003c/strong\u003e Female and male Sprague Dawley rats (specific pathogen-free grade) aged 10 weeks were purchased from Hunan Slaccas Jingda Laboratory Animal (Hunan, China) with license number SCXK (Xiang) 2019-0004.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics Statement\u003c/strong\u003e\u003cstrong\u003e.\u003c/strong\u003e The experimental procedures were performed in accordance with the principles of the Guide for the Ethical Use of Animals in Applied Etiology Research\u003csup\u003e33\u003c/sup\u003e and the licenses of experimental animals (license number SCXK (Xiang) 2019-0004), and the experimental procedures were approved by the Ethics Committee of Taizhou Municipal Hospital of China (protocol number LWPJ106). Furthermore, we confirmed that all methods were reported in accordance with ARRIVE guidelines\u003csup\u003e34\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eReagents and Instruments.\u003c/strong\u003e Estradiol benzoate (50-50-0) was purchased from Beijing Solaibao Technology (Beijing, China). Progesterone (57-83-0) was purchased from Shanghai Ye Yuan Biotechnology. (Shanghai, China). Corn oil (GB/T19111) was provided by Qinglong Hi-Tech Oils \u0026amp; Fats Industry (Jiangxi, China). Trizon reagent (cw0580s), Ultrapure RNA Ultrapure RNA Extraction Kit (CW0581M), and DAB color reagent kit (CW0125) were purchased from Kangwei Century (Dongtai, China). HiScript II Q RT SuperMix for qPCR (+gDNA wiper) (R223-01) was purchased from Vazyme Biotech (Nanjing, China). 2\u0026times;SYBR Green PCR Master Mix (A4004M) was purchased from Lifeint Technology (Xiamen, China). Hematoxylin Stain Solution (ZLI-9610) and horseradish-enzyme-labeled goat anti-rabbit IgG (H+L) (ZB-2301) were purchased from Zhongshan Jinqiao Biotechnology Group (Beijing, China). InsP3R (19962-1-AP) was purchased from BioLion Technology (Singapore). Centrifugation was accomplished with a D1008E microcentrifuge (SciLogex, Rocky Hill, CT, USA). The vortex mixer (XH-C) was purchased from Changzhou Yuexin Instrument Manufacturing (Changzhou, China). The dry electric heater (GL-150) was purchased from Haimen City Qilin Bell Instrument Manufacturing (Nantong, China). RNA was quantified using a nanophotometer. The low-temperature high-speed centrifuge (5424R) was a product of Eppendorf (Hamburg, Germany). The fluorescence PCR instrument (CFX Connect\u0026trade;) was a product of B\u0026oacute; L\u0026egrave; Life Medical Products (Shanghai, China). The automatic sample rapid grinder (Tiss-12) was a product of Shanghai Jingxin Industrial Development (Shanghai, China). The electric heating constant temperature incubator (DHP-9054) was a product of Shandong Broke Biological Industry (Shangdong, China). A CX41 microscope (Olympus, Tokyo, Japan), and slicer (2235, Leica, Wetzlar, Germany) were used. The electric-heating blast-drying oven (DHG-9070A) was a product of Heng Science Instrument (Beijing, China).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eExperimental Groups.\u003c/strong\u003e Experimental animals were divided into normal control and ICP model groups.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAnimal Model Construction and Drug Administration.\u003c/strong\u003e Estradiol benzoate solution was prepared by dissolving 12.5 mg of estradiol benzoate in 100 ml of corn oil to make a 0.125 mg/ml solution. Progesterone solution was prepared by dissolving 750 mg of progesterone in 100 ml of corn oil to make a 7.5 mg/ml solution. Each pair of female and male rats was caged at a ratio of 1:1, and female rats exhibiting a vaginal plug on the same day were recorded as pregnancy 1 d. On the fifteenth day of pregnancy, each ICP model group was given a 10 ml/kg dose of benzoic acid. Glycol solution and progesterone solution were continuously administered by intragastric administration for 5 d, and then rats were sacrificed with 10% chloral hydrate.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eReal-time Fluorescent Quantitative PCR.\u003c/strong\u003e Samples were collected for mRNA extraction. After extraction, the concentration and purity of RNA were measured by a micro UV spectrophotometer, and the quality of RNA was determined by agarose gel electrophoresis. cDNA was synthesized with a HiScript II Q RT SuperMix for qPCR (+gDNA wiper) reverse transcription kit according to the manufacturer\u0026rsquo;s instructions. Briefly, cDNA was used as the template, the sample was loaded with fluorescent dyes, and the program was set on the fluorescence quantitative PCR instrument to carry out the amplification reaction. According to the relative quantitative 2\u003csup\u003e-\u003c/sup\u003e\u003csup\u003e△△\u003c/sup\u003eCt method, relative mRNA expression of VEGF5 and sflt-1 were calculated with \u0026beta;-actin as the internal reference. All primers were designed using Primer 5.0 software and Primer Blast of NCBI, and synthesized by General Biosystems (Anhui, China). The purification method for primers was polyacrylamide gel electrophoresis PAGE.\u003c/p\u003e\n\u003cp\u003eThe operating system was as follows:\u003c/p\u003e\n\u003ctable border=\"1\" cellpadding=\"0\" cellspacing=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"47.201492537313435%\"\u003e\n \u003cp\u003eReagent\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"52.798507462686565%\"\u003e\n \u003cp\u003eVolume (20 \u0026mu;l reaction system)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"47.201492537313435%\"\u003e\n \u003cp\u003e2\u0026times;SYBR Green PCR Master Mix\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"52.798507462686565%\"\u003e\n \u003cp\u003e10 \u0026mu;l\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"47.201492537313435%\"\u003e\n \u003cp\u003ecDNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"52.798507462686565%\"\u003e\n \u003cp\u003e1 \u0026mu;l\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"47.201492537313435%\"\u003e\n \u003cp\u003eUpstream primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"52.798507462686565%\"\u003e\n \u003cp\u003e0.4 \u0026mu;l\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"47.201492537313435%\"\u003e\n \u003cp\u003eDownstream primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"52.798507462686565%\"\u003e\n \u003cp\u003e0.4 \u0026mu;l\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"47.201492537313435%\"\u003e\n \u003cp\u003eRNase Free ddH20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"52.798507462686565%\"\u003e\n \u003cp\u003e8.2 \u0026mu;l\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003cp\u003eThe reaction procedure was as follows:\u003c/p\u003e\n\u003ctable border=\"1\" cellpadding=\"0\" cellspacing=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"29.859719438877754%\"\u003e\n \u003cp\u003estep\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"23.44689378757515%\"\u003e\n \u003cp\u003etemperature\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.637274549098198%\"\u003e\n \u003cp\u003etime\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"28.0561122244489%\"\u003e\n \u003cp\u003eCycles No.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"29.859719438877754%\"\u003e\n \u003cp\u003ePre denaturation\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"23.44689378757515%\"\u003e\n \u003cp\u003e95\u0026deg;C\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.637274549098198%\"\u003e\n \u003cp\u003e10 min\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"28.0561122244489%\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"29.859719438877754%\"\u003e\n \u003cp\u003edenaturation\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"23.44689378757515%\"\u003e\n \u003cp\u003e95\u0026deg;C\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.637274549098198%\"\u003e\n \u003cp\u003e10 s\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"3\" valign=\"top\" width=\"28.0561122244489%\"\u003e\n \u003cp\u003e40\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"41.5041782729805%\"\u003e\n \u003cp\u003eannealing\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"32.590529247910865%\"\u003e\n \u003cp\u003e58\u0026deg;C\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"25.905292479108635%\"\u003e\n \u003cp\u003e30 s\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"41.5041782729805%\"\u003e\n \u003cp\u003eextend\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"32.590529247910865%\"\u003e\n \u003cp\u003e72\u0026deg;C\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"25.905292479108635%\"\u003e\n \u003cp\u003e30 s\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003cp\u003ePrimers were as follows:\u003c/p\u003e\n\u003ctable align=\"left\" border=\"1\" cellpadding=\"0\" cellspacing=\"0\" width=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.153846153846153%\"\u003e\n \u003cp\u003ePrimer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"40.76923076923077%\"\u003e\n \u003cp\u003ePrimer sequence\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.076923076923077%\"\u003e\n \u003cp\u003ePrimer length (nt)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.076923076923077%\"\u003e\n \u003cp\u003eProduct length (bp)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.923076923076923%\"\u003e\n \u003cp\u003eAnnealing temperature (\u0026deg;C)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.153846153846153%\"\u003e\n \u003cp\u003eInsP3R F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"40.76923076923077%\"\u003e\n \u003cp\u003eCTCTCCGGCACCCAAAGAAGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.076923076923077%\"\u003e\n \u003cp\u003e22\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" width=\"13.076923076923077%\"\u003e\n \u003cp\u003e141\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" width=\"18.923076923076923%\"\u003e\n \u003cp\u003e62.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.81447963800905%\"\u003e\n \u003cp\u003eInsP3R R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"59.95475113122172%\"\u003e\n \u003cp\u003eAGCACATCTCCTACTCCGCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"19.23076923076923%\"\u003e\n \u003cp\u003e20\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.153846153846153%\"\u003e\n \u003cp\u003e\u0026beta;-actin F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"40.76923076923077%\"\u003e\n \u003cp\u003eGCCATGTACGTAGCCATCCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.076923076923077%\"\u003e\n \u003cp\u003e20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" width=\"13.076923076923077%\"\u003e\n \u003cp\u003e375\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" width=\"18.923076923076923%\"\u003e\n \u003cp\u003e59.5\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"20.81447963800905%\"\u003e\n \u003cp\u003e\u0026beta;-actin R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"59.95475113122172%\"\u003e\n \u003cp\u003eGAACCGCTCATTGCCGATAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.23076923076923%\"\u003e\n \u003cp\u003e20\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmunohistochemical Detection.\u0026nbsp;\u003c/strong\u003eTissue sections were placed in a 65\u0026deg;C oven for 2 h, followed by xylene for 10 min, which was replaced with xylene for another 10 min, Subsequently, sections were placed for 5 min each in 100% ethanol, 100% ethanol, 95% ethanol, and 80% ethanol in purified water. For antigen retrieval, sections were placed in a repair box with antigen retrieval solution (citrate buffer), heated in a pressure cooker (allowed to automatically deflate), and allowed to naturally cool for 2 min on the heat source. After discarding the antigen retrieval solution and rinsing sections with PBS, they were moved into a wet box with freshly prepared 3% hydrogen peroxide to remove the endogenous peroxidase blocking solution for 10 min at room temperature, and rinsed with PBS. Next, the slides were soaked three times in PBS (5 min each), the PBS around the tissue was blotted with absorbent paper, 5% bovine serum albumin was added dropwise onto the slides for blocking at 37\u0026deg;C for 30 min. After absorbing the blocking solution around the tissue with absorbent paper (without washing), a sufficient amount of diluted primary TH antibody (1:200) was dropped onto each slide, which were put it in a humid box and incubated at 4\u0026deg;C overnight. For secondary antibody staining the following day, the wet box was allowed to stand at room temperature for 45 min, the slides were soaked in PBS three times (5 min each), and goat anti-rabbit antibody (1:100) was added for incubation at 37\u0026deg;C for 30 min. After washing the slides with PBS, color development and counterstaining was performed with DAB for 5\u0026ndash;10 min. The degree of staining was checked under a microscope before rinsing slides with PBS or tap water for 1 min, counterstaining with hematoxylin for 3 min, differentiating with hydrochloric acid alcohol, and returning to blue. Finally, slides were rinsed with tap water for 1 min, dehydrated, cleared, covered, and examined by microscopy.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSerum ELISA Detection.\u003c/strong\u003e Pregnant rats were sacrificed after anesthesia with 10% chloral hydrate, and 1.5 ml of whole blood was collected by encapsulating the eyes. After whole-blood samples were collected, they were allowed to stand at room temperature for 30 min, centrifuged at 3,000 rpm for 15 min, and about 0.5 ml of serum was taken for ELISA detection.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical Analysis\u003c/strong\u003e. SPSS 20.0 software was used for statistical analysis. All experiments were repeated three times. Quantitative results are expressed as the mean and standard deviation (\u0026chi; \u0026plusmn; s). One-way ANOVA was used for comparison of the two groups, the Student-Newman-Keuls method was used for pairwise comparisons, and Pearson correlation analysis was used to assess for linear relationships between the two groups. The test level was \u0026alpha; = 0.05 and P \u0026lt; 0.05 indicated a significant difference.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by Medical and Health Science and Technology Projects of Zhejiang Province (2022KY1388). We thank Liwen Bianji (Edanz) (www.liwenbianji.cn/) for basic language editing of a draft of this manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eD.P. and M.J. made substantial contributions to acquisition, analysis, and interpretation of the data, and wrote the first draft of the manuscript; M.J., G.T., J.S., Z S., R.C. and D.W. made substantial contributions to acquisition of data. D.P. and D.W. contributed to experimental conception and design, and analysis and interpretation of data, and drafted the manuscript and revised it critically. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll generated raw data and/or analyzed data from the current study are available from the corresponding author on reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eVasavan, T., Deepak, S., Jayawardane, I. A., Lucchini, M., Martin, C., Geenes, V. \u003cem\u003eet al\u003c/em\u003e. Fetal cardiac dysfunction in intrahepatic cholestasis of pregnancy is associated with elevated serum bile acid concentrations. \u003cem\u003eJ. Hepatol.\u003c/em\u003e \u003cstrong\u003e74\u003c/strong\u003e, 1087–1096 (2021).\u003c/li\u003e\n\u003cli\u003eÇelik, S., Çalışkan, C. S., Çelik, H., Güçlü, M. \u0026amp; Başbuğ, A. Predictors of adverse perinatal outcomes in intrahepatic cholestasis of pregnancy.\u003cem\u003e Ginekol. Pol. \u003c/em\u003e\u003cstrong\u003e90\u003c/strong\u003e, 217–222 (2019).\u003c/li\u003e\n\u003cli\u003e Gao, X-X., Ye, M-Y., Liu, Y., Li, J-Y., Li, L., Chen, W. \u003cem\u003eet al\u003c/em\u003e. Prevalence and risk factors of intrahepatic cholestasis of pregnancy in a Chinese population. \u003cem\u003eSci. Rep\u003c/em\u003e. \u003cstrong\u003e10\u003c/strong\u003e, 16307 (2020).\u003c/li\u003e\n\u003cli\u003eMangla, A., Guerra, M. T. \u0026amp; Nathanson, M. H. Type 3 inositol 1,4,5-trisphosphate receptor: A calcium channel for all seasons. \u003cem\u003eCell Calcium.\u003c/em\u003e\u003cstrong\u003e 85\u003c/strong\u003e, 102132 (2020).\u003c/li\u003e\n\u003cli\u003eGarrido, A., Kim, E., Teijeiro, A., Sánchez, P. S., Gallo, R. \u003cem\u003eet al. \u003c/em\u003eHistone acetylation of bile acid transporter genes plays a critical role in cirrhosis. \u003cem\u003eJ. Hepatol\u003c/em\u003e. \u003cstrong\u003e76\u003c/strong\u003e, 850-861 (2022).\u003c/li\u003e\n\u003cli\u003eRodrigues, M. A., Gomes, D. A. \u0026amp; Nathanson, M. H. Calcium Signaling in Cholangiocytes: Methods, Mechanisms, and Effects. \u003cem\u003eInt. J. Mol. Sci\u003c/em\u003e. \u003cstrong\u003e19\u003c/strong\u003e, 3913 (2018).\u003c/li\u003e\n\u003cli\u003eFranca, A., Lima Filho, A. C. M., Guerra, M. T., Weerachayaphorn, J., Dos Santos M. L., \u003cem\u003eet al\u003c/em\u003e. Effects of Endotoxin on Type 3 Inositol 1,4,5-Trisphosphate Receptor in Human Cholangiocytes. \u003cem\u003eHepatology\u003c/em\u003e. \u003cstrong\u003e69\u003c/strong\u003e, 817–830 (2019).\u003c/li\u003e\n\u003cli\u003eHerta, T., Kersten, R., Chang, J. C., Hubers, L., Go, S. \u003cem\u003eet al\u003c/em\u003e. Role of the IgG4- related cholangitis autoantigen annexin A11 in cholangiocyte protection. \u003cem\u003eJ. Hepatol\u003c/em\u003e. \u003cstrong\u003e76\u003c/strong\u003e, 319–331 (2022).\u003c/li\u003e\n\u003cli\u003eAmaya, M. J. \u0026amp; Nathanson, M. H. Calcium signaling and the secretory activity of bile duct epithelia. \u003cem\u003eCell Calcium\u003c/em\u003e. \u003cstrong\u003e55\u003c/strong\u003e, 317–324 (2014).\u003c/li\u003e\n\u003cli\u003eMeng, F., Kennedy, L., Hargrove, L., Demieville, J., Jones, H. \u003cem\u003eet al\u003c/em\u003e. Ursodeoxycholate inhibits mast cell activation and reverses biliary injury and fibrosis in Mdr2-/-mice and human primary sclerosing cholangitis. \u003cem\u003eLab. Invest\u003c/em\u003e. \u003cstrong\u003e98\u003c/strong\u003e, 1465–1477 (2018).\u003c/li\u003e\n\u003cli\u003eMayo, M. J., Wigg, A. J., Leggett, B. A., Arnold, H., Thompson, A. J., \u003cem\u003eet al\u003c/em\u003e. Leggett BANGM282 for treatment of patients with primary biliary cholangitis: a multicenter, randomized, double-blind, placebo-controlled trial. \u003cem\u003eHepatol. Commun\u003c/em\u003e. \u003cstrong\u003e2\u003c/strong\u003e, 1037–1050 (2018).\u003c/li\u003e\n\u003cli\u003eZhou, Q., Guo, W., Jia, Y. \u0026amp; Xu, J. Effect of 4-phenylbutyric acid and tauroursodeoxycholic acid on magnesium and calcium metabolism in streptozocin-induced type 1 diabetic mice. \u003cem\u003eBiol. Trace Elem. Res\u003c/em\u003e. \u003cstrong\u003e189\u003c/strong\u003e, 501–510 (2019).\u003c/li\u003e\n\u003cli\u003eZhou, L., Wang, X. \u0026amp; Mao, W. Effects of taurochenodeoxycholic acid on Ca\u003csup\u003e2+\u003c/sup\u003e/CaM signalling mediated by the TGR5 signalling pathway. \u003cem\u003ePharmazie\u003c/em\u003e. \u003cstrong\u003e71\u003c/strong\u003e, 390–393 (2016).\u003c/li\u003e\n\u003cli\u003e Fu, C. \u0026amp; Xu, Y. Value of serum glycocholic acid and total bile acids in predicting maternal and perinatal outcomes in intrahepatic cholestasis of pregnancy. \u003cem\u003eJ. Healthc. Eng\u003c/em\u003e. \u003cstrong\u003e2021\u003c/strong\u003e, 3911998 (2021).\u003c/li\u003e\n\u003cli\u003ePiechota, J., Jelski, W. Intrahepatic Cholestasis in Pregnancy: Review of the Literature. \u003cem\u003eJ. Clin. Med\u003c/em\u003e. \u003cstrong\u003e9\u003c/strong\u003e, 1361 (2020).\u003c/li\u003e\n\u003cli\u003eYang, F., Ma, H., Butler, M. R. \u0026amp; Ding, X-Q. Preservation of endoplasmic reticulum (ER) Ca\u003csup\u003e2+\u003c/sup\u003e stores by deletion of inositol-1,4,5-trisphosphate receptor type 1 promotes ER retrotranslocation, proteostasis, and protein outer segment localization in cyclic nucleotide-gated channel- deficient cone photoreceptors. \u003cem\u003eFASEB J\u003c/em\u003e. \u003cstrong\u003e35\u003c/strong\u003e, e21579 (2021).\u003c/li\u003e\n\u003cli\u003eIyer, R. \u0026amp; Franzini-Armstrong, C. The location of InsP3 receptors in Purkinje cells of murine cerebellum does not supports a direct interaction in the transfer of calcium ions between ER and mitochondria.\u003cem\u003e Eur. J. Transl. Myol\u003c/em\u003e. \u003cstrong\u003e31\u003c/strong\u003e, 9935 (2021).\u003c/li\u003e\n\u003cli\u003eAmroudie, M. N. \u0026amp; Ataei, F. Experimental and theoretical study of IBC domain from human IP3R2; molecular cloning, bacterial expression and protein purification.\u003cem\u003e Int. J. Biol. Macromol\u003c/em\u003e. \u003cstrong\u003e124\u003c/strong\u003e, 1321–1327(2019).\u003c/li\u003e\n\u003cli\u003eRodrigues, M. A., Gomes, D. A., Cosme, A. L., Sanches, M. D., Resende, V. \u003cem\u003eet al\u003c/em\u003e. Inositol 1, 4, 5- trisphosphate receptor type 3 (ITPR3) is overexpressed in cholangiocarcinoma and its expression correlates with S100 calcium-binding protein A4 (S100A4). \u003cem\u003eBiomed. Pharmacother\u003c/em\u003e. \u003cstrong\u003e145\u003c/strong\u003e, 112403 (2022).\u003c/li\u003e\n\u003cli\u003eZhang, L., Zhang, Y., Jiang, Y., Dou, X., Li, S. \u003cem\u003eet al\u003c/em\u003e. Upregulated SOCC and IP3R calcium channels and subsequent elevated cytoplasmic calcium signaling promote nonalcoholic fatty liver disease by inhibiting autophagy. \u003cem\u003eMol. Cell Biochem\u003c/em\u003e.\u003cstrong\u003e 476\u003c/strong\u003e, 3163–3175 (2021). \u003c/li\u003e\n\u003cli\u003eAlzayady, K. J., Wang, L., Chandrasekhar, R.,Wagner, L. E., Van Petegem, F. \u0026amp; Yule, D. I. Defining the stoichiometry of inositol 1, 4, 5-trisphosphate binding required to initiate Ca\u003csup\u003e2+\u003c/sup\u003e release. \u003cem\u003eSci. Signal\u003c/em\u003e. \u003cstrong\u003e9\u003c/strong\u003e, ra35 (2016).\u003c/li\u003e\n\u003cli\u003eHagar, R. E. \u0026amp; Ehrlich, B. E. Regulation of the type III InsP(3) receptor by InsP(3) and ATP. \u003cem\u003eBiophys. J\u003c/em\u003e. \u003cstrong\u003e79\u003c/strong\u003e, 271–278 (2000).\u003c/li\u003e\n\u003cli\u003eHodeify, R., Yu, F., Courjaret, R., Nader, N., Dib, M. \u003cem\u003eet al\u003c/em\u003e. Regulation and Role of Store-Operated Ca\u003csup\u003e2+\u003c/sup\u003e Entry in Cellular Proliferation. \u003cem\u003eIn: Calcium Entry Channels in Non- Excitable Cells. Boca Raton (FL): CRC Press/Taylor \u0026amp; Francis\u003c/em\u003e. \u003cstrong\u003eChapter 12\u003c/strong\u003e (2018).\u003c/li\u003e\n\u003cli\u003ede Miranda M. C., Rodrigues M. A., de Angelis Campos A. C., Faria J. A. Q. A., Kunrath-Lima, M., \u003cem\u003eet al\u003c/em\u003e. Epidermal growth factor (EGF) triggers nuclear calcium signaling through the intranuclear phospholipase Cδ-4 (PLCδ4). \u003cem\u003eJ. Biol. Chem\u003c/em\u003e,.\u003cstrong\u003e 294\u003c/strong\u003e, 16650–16662 (2019). \u003c/li\u003e\n\u003cli\u003eMarongiu, L., Mingozzi, F., Cigni, C., Marzi, R., Di Gioia, M. \u003cem\u003eet al\u003c/em\u003e. Inositol 1, 4, 5-trisphosphate 3-kinase B promotes Ca\u003csup\u003e2+\u003c/sup\u003e mobilization and the inflammatory activity of dendritic cells.\u003cem\u003e Sci. Signal\u003c/em\u003e. \u003cstrong\u003e14\u003c/strong\u003e, eaaz2120 (2021). \u003c/li\u003e\n\u003cli\u003eRodrigues, M. A., Gomes, D. A. \u0026amp; Nathanson, M. H. Calcium signaling in cholangiocytes: methods, mechanisms, and effects. \u003cem\u003eInt. J. Mol. Sci\u003c/em\u003e. \u003cstrong\u003e19\u003c/strong\u003e, 3913 (2018).\u003c/li\u003e\n\u003cli\u003eRoos, F. J. M., Bijvelds, M. J. C., Verstegen, M. M. A., Roest, H. P., Metselaar, H. J. \u003cem\u003eet al\u003c/em\u003e. Impact of hypoxia and AMPK on CFTR-mediated bicarbonate secretion in human cholangiocyte organoids. \u003cem\u003eAm. J. Physiol. Gastrointest. Liver Physiol\u003c/em\u003e. \u003cstrong\u003e320\u003c/strong\u003e, G741–G752 (2021). \u003c/li\u003e\n\u003cli\u003eUeaasilamongkol, P., Khamphaya, T., Guerra, M. T., Rodrigues, M. A., Gomes, D. A.\u003cem\u003e et al\u003c/em\u003e. Type 3 inositol 1,4,5-trisphosphate receptor is increased and enhances malignant properties in Cholangiocarcinoma. \u003cem\u003eHepatology\u003c/em\u003e. \u003cstrong\u003e71\u003c/strong\u003e, 583–599 (2020). \u003c/li\u003e\n\u003cli\u003eGupta, K., Ng, I. C., Balachander, G. M., Nguyen, B. P., Tucker-Kellogg, L., Low, B. C., Yu, H.\u003cem\u003e et al\u003c/em\u003e. Bile canaliculi contract autonomously by releasing calcium into hepatocytes via mechanosensitive calcium channel.\u003cem\u003e Biomaterials\u003c/em\u003e. \u003cstrong\u003e259\u003c/strong\u003e, 120283 (2020).\u003c/li\u003e\n\u003cli\u003eBird, G. S., Putney, J. W, Jr., Kozak, J. A. \u0026amp; Putney, J. W., Jr. Pharmacology of Store-Operated Calcium Entry Channels. \u003cem\u003eIn: Calcium Entry Channels in Non-Excitable Cells. Boca Raton (FL): CRC Press/Taylor \u0026amp; Francis\u003c/em\u003e. \u003cstrong\u003eChapter 16\u003c/strong\u003e (2018).\u003c/li\u003e\n\u003cli\u003eBonus, M., Häussinger, D. \u0026amp; Gohlke, H. Liver cell hydration and integrin signaling. \u003cem\u003eBiol. Chem\u003c/em\u003e. \u003cstrong\u003e402\u003c/strong\u003e, 1033–1045 (2021).\u003c/li\u003e\n\u003cli\u003eKrupa, Ł., Staroń, R., Dulko, D., Łozińska, N., Mackie, A. R. \u003cem\u003eet al\u003c/em\u003e. Importance of bile composition for diagnosis of biliary obstructions. \u003cem\u003eMolecules\u003c/em\u003e. \u003cstrong\u003e26\u003c/strong\u003e, 7279 (2021).\u003c/li\u003e\n\u003cli\u003eLi, Y., Tang, R., Leung, P. S. C., Gershwin, M. E., Ma, X. \u003cem\u003eet al\u003c/em\u003e. Bile acids and intestinal microbiota in autoimmune cholestatic liver diseases. \u003cem\u003eAutoimmun. Rev\u003c/em\u003e. \u003cstrong\u003e16\u003c/strong\u003e, 885–896 (2017).\u003c/li\u003e\n\u003cli\u003eSherwin, C. M., Christiansen, S. B., Duncan, I. J., Erhard, H. W., Clay, D., Jr. \u003cem\u003eet al\u003c/em\u003e. Guidelines for the ethical use of animals in applied ethology studies. \u003cem\u003eAppl. Anim. Behav\u003c/em\u003e. \u003cem\u003eSci\u003c/em\u003e. \u003cstrong\u003e81\u003c/strong\u003e, 291–305 (2003).\u003c/li\u003e\n\u003cli\u003eKilkenny, C., Browne, W. J., Cuthi, I., Emerson, M., Altman, D. G. Improving bioscience research reporting: the ARRIVE guidelines for reporting animal research. \u003cem\u003eVet. Clin. Pathol.\u003c/em\u003e\u003cstrong\u003e41\u003c/strong\u003e, 27–31 (2012).\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003e\u003cstrong\u003eTable 1 Comparison of ELISA indexes\u003c/strong\u003e\u003cstrong\u003e（\u003c/strong\u003e\u003cstrong\u003e\u0026chi; \u0026plusmn; s)\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellpadding=\"0\" cellspacing=\"0\" width=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"22.011385199240987%\"\u003e\n \u003cp\u003e\u003cstrong\u003eGroups\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24.098671726755217%\"\u003e\n \u003cp\u003e\u003cstrong\u003eCa\u003csup\u003e2+\u003c/sup\u003e\u003c/strong\u003e\u003cstrong\u003e（\u003c/strong\u003e\u003cstrong\u003enmol/L\u003c/strong\u003e\u003cstrong\u003e）\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"28.842504743833018%\"\u003e\n \u003cp\u003e\u003cstrong\u003eTBA\u003c/strong\u003e\u003cstrong\u003e（\u003c/strong\u003e\u003cstrong\u003e\u0026mu;mol/L\u003c/strong\u003e\u003cstrong\u003e）\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"25.047438330170777%\"\u003e\n \u003cp\u003e\u003cstrong\u003eCG\u003c/strong\u003e\u003cstrong\u003e（\u003c/strong\u003e\u003cstrong\u003e\u0026mu;g/mL\u003c/strong\u003e\u003cstrong\u003e）\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"22.011385199240987%\"\u003e\n \u003cp\u003eNormal group\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24.098671726755217%\"\u003e\n \u003cp\u003e2.49\u0026plusmn;0.18\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"28.842504743833018%\"\u003e\n \u003cp\u003e22.72\u0026plusmn;12.09\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.047438330170777%\"\u003e\n \u003cp\u003e5.42\u0026plusmn;4.31\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"22.011385199240987%\"\u003e\n \u003cp\u003eICP group\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24.098671726755217%\"\u003e\n \u003cp\u003e21.75\u0026plusmn;0.55\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"28.842504743833018%\"\u003e\n \u003cp\u003e59.00\u0026plusmn;20.83\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"25.047438330170777%\"\u003e\n \u003cp\u003e26.37\u0026plusmn;10.36\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"22.011385199240987%\"\u003e\n \u003cp\u003eP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24.098671726755217%\"\u003e\n \u003cp\u003e0.021\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"28.842504743833018%\"\u003e\n \u003cp\u003e0.010\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"25.047438330170777%\"\u003e\n \u003cp\u003e0.003\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Rats, intrahepatic cholestasis of pregnancy (ICP), InsP3R, calcium ion","lastPublishedDoi":"10.21203/rs.3.rs-1790802/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-1790802/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"To provide new insights for future treatment of intrahepatic cholestasis of pregnancy (ICP), we evaluated serum Ca2+ levels and inositol 1,4,5-trisphosphate receptor (InsP3R) expression in the liver tissue of a rat ICP model. After establishing the model by injection of estradiol benzoate and progesterone into pregnant rats, animals were divided into normal control and ICP model groups. Expression of InsP3R protein in liver, and serum levels of Ca2+, glycocholic acid, and bile acid were detected. InsP3R mRNA and protein expression in the ICP model group were significantly lower compared with the normal group, as measured by qPCR and immunohistochemistry, respectively. Serum enzyme-linked immunosorbent assay results showed that levels of glycocholic acid and bile acid were significantly higher in the ICP model group compared with the normal group, and Ca2+ levels were significantly lower. Ca2+ levels were significantly and negatively correlated with the level of glycocholic acid. The observed decrease of Ca2+ was related to the increase of total bile acid, but there was no significant correlation. Our results reveal that InsP3R expression and serum Ca2+ levels were significantly decreased in liver tissue of ICP model rats, and Ca2+ levels were negatively correlated with the level of glycocholic acid.","manuscriptTitle":"The role of Ca 2+ signaling and InsP3R in the pathogenesis of intrahepatic cholestasis of pregnancy","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-07-07 16:04:27","doi":"10.21203/rs.3.rs-1790802/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"046630b4-b8d3-44de-9878-6fc764a2e2ee","owner":[],"postedDate":"July 7th, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2022-07-11T07:59:26+00:00","versionOfRecord":[],"versionCreatedAt":"2022-07-07 16:04:27","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-1790802","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-1790802","identity":"rs-1790802","version":["v1"]},"buildId":"7rjqhiLT3MXkJMwkYKINL","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}