SMOX and SMS Responsible for Polyamine Metabolism Enhanced Adipogenesis

SMOX and SMS Responsible for Polyamine Metabolism Enhanced Adipogenesis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article SMOX and SMS Responsible for Polyamine Metabolism Enhanced Adipogenesis Xia Yi, Ping Wu, Jianyun Liu, Ying Gong, Xiaoyuan Xu, Jianjun Xiong This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-192502/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Adipose tissue regulating carbohydrate and lipid metabolism had been extensively focused. However, the regulation of amino acid metabolism during adipocyte differentiation remained detailed. Here we applied RNA-Seq technique to establish the transcriptional landscapes of amino acid metabolism during adipogenesis. We totally screened 17 differentially expressed genes (DEGs) for amino acid metabolism at 7, 14, 21, and 28 days during adipogenesis from human mesenchymal stem cells (hMSCs), especially with 13 up-regulated genes most prevalent in our adipogenic anecdote. Small molecule metabolic process was the most enriched biological process following by oxidation-reduction process. Interestingly, the enforced expression of SMOX (spermine oxidase) responsible for polyamine metabolism in arginine and proline metabolism pathway facilitated adipogenesis more than SMS (spermine synthase) using RNA interference (RNAi). The established potential regulatory network further suggested that adipocyte differentiation tightly related with the basal metabolism of amino acid metabolism with the partially confirmed SMS-SMOX-PPARG signaling pathway. It would highlight the effect of adipogenesis on amino acid metabolism in adipocyte biology and provide the potential treatment strategy for the study of fat metabolic diseases. General Biochemistry Biotechnology and Bioengineering Adipogenesis hMSCs SMS SMOX regulatory network Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction As we known, the consumption of unutilized calories induced a metabolic state promoting the commitment of human mesenchymal stem cells (hMSCs) to become preadipocytes, followed by their differentiation into mature adipocytes known as the primary site for fat storage [ 1 – 3 ]. It had been clinically well established for the dysfunction of the endocrine and paracrine signaling usually responsible for the important regulatory functions of adipocytes leading to metabolic disorders and diseases, such as obesity, type 2 diabetes mellitus (T2DM), inflammation, and insulin resistance [ 4 – 8 ]. As a highly orchestrated process, adipocyte differentiation regulated glucose and lipid homeostasis by storing the excess nutrients in lipid droplets and releasing the bioenergetic substrates via lipolysis [ 9 – 10 ]. Recently, the studies involving in the relationship between amino acid and adipogenic differentiation attracted an increasing focus. Amino acids had been confirmed as the metabolic switch fueling adipogenic differentiation, such as branched-chain amino acid (BCAA) [ 11 ], homocysteine [ 12 ], arginine [ 13 ], and polyamine [ 14 ]. Especially, it had well documented that the inhibition of BCAA catabolism thoroughly compromised adipogenesis [ 11 ]. Hydroxyproline, proline, lysine, glycine, and alanine also showed a potential to induce adipogenic effects in retinal pericytes [ 15 ]. However, relatively little is uncovered for the whole profiling of amino acid metabolism during adipogenesis. In our previous study, we established the whole transcriptional profiling of cellular metabolism during adipogenesis [ 16 ]. Here, we further concentrated our attention on the transcriptional landscapes of amino acid metabolism during adipogenesis using RNA-Seq technique. Among 17 DEGs for amino acid metabolism at 7, 14, 21, and 28 days, we confirmed that the enforced expression of SMOX (spermine oxidase) responsible for polyamine metabolism in arginine and proline metabolism pathway facilitated adipogenesis more than SMS (spermine synthase) using RNA interference (RNAi) by lentiviruses system. The established potential regulatory network further indicated that adipocyte differentiation tightly related with the basal metabolism of amino acid metabolism with the partially confirmed SMS-SMOX-PPARG signaling pathway. This study would highlight the effect of adipogenesis on amino acid metabolism in adipocyte biology and provide the potential treatment strategy for the study of fat metabolic diseases. Material And Methods hMSCs isolation and culture Identified in our previous study [ 16 ], the hMSCs were isolated following the protocols with slight modification [ 17 – 18 ]. Adipogenic differentiation assays were developed following the method with the slight modifications [ 19 – 20 ]. In an Model 3100 series Forma Series Ⅱ Water Jacket CO 2 incubator (Thermo Fisher Scientific, Ohio, United States), we cultured the hMSCs in 5.0 mL hMSCs Basal Medium (Cyagen bioscience, Inc., Santa Clara, CA, USA) supplemented with FBS (fetal bovine serum), penicillin-streptomycin, and L-glutamine in 25 cm 2 flasks (Corning Incorporated, Corning, New York, USA) at 37°C with 5% CO 2 and 95% humidity. Human adipocyte differentiation Expanded to passage 6, the hMSCs with 80–90% of the final confluence were stimulated with adipogenic cocktails of hMSCs Basal Medium including 1.0 µM dexamethasone, 0.01 mg/mL insulin, and 0.5 mM 3-isobutyl-1-methyl-xanthine (Sigma, St. Louis, Mo, USA) on day 0. Adipogenic potential of hMSCs was assessed following the documented method with slight modification [ 21 – 22 ]. Briefly, the hMSCs were fixed with 3.7% formaldehyde for 30 min at room temperature after washed with phosphate buffered saline (PBS) (pH 8.0) buffer twice. And then, the hMSCs were stained with Oil Red O (Cyagen bioscience, Inc., Santa Clara, CA, USA) for 1 h after washing three times with PBS buffer. Cell morphology and the formation of lipid droplets of adipocytes were photographed using a fluorescence microscope (IX73, Olympus, Tokyo, Japan). RNA isolation and RNA-Seq sequencing and analysis Following the manufacturer’s instructions, the total RNA isolated from the adipogenic samples using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) was stored in liquid nitrogen for the further analysis. The freshly isolated RNA samples were for RNA sequencing after purified using the NucleoSpin RNA clean-up kit (Macherey-Nagel, Düren, Germany) and qualified by Bioanalyzer 2200 (Aligent Technologies, Santa Clara, CA, USA). In our previous study [ 23 ], RNA-Seq sequencing was developed by NovelBio Bio-Pharm Technology Co., Ltd, Shanghai, China. Additional remarks, the Ion Total RNA-Seq kit v2.0 (Life Technologies, Santa Clara, CA, USA) following the manufacturer’s instructions was used to prepare RNA of RIN (RNA integrity number) > 8.0 to construct the complementary DNA (cDNA) libraries for single-end sequencing of proton-sequencing process. Here, we systematically established the transcriptional landscapes of amino acid metabolism during adipogenesis depending on KEGG pathway. We defined an absolute value of log 2 ratio ≥ 2.0 as the threshold of the differentially expressed genes (DEGs), and the significant DEGs simultaneously met a false discovery rate (FDR) < 0.001 and an absolute value of log 2 ratio ≥ 2.0. We set the cutoff of p _value < 0.05 as the differential expressed biological process for GO (Gene Ontology) analysis. qRT-PCR assays Here, the relative gene expression level was determined using qRT-PCR (quantitative real-time PCR). 2.0 µg RNA was used to synthesize cDNA using Oligo (dT 18 ) primer complementary base pairing with poly (A) mRNA using the cDNA synthesis kit (Torobo Co., Osaka, Japan) on a 7500 Real Time PCR System (ABI, Foster, CA, USA) from Bio-Rad Laboratories (Hercules, CA, USA). A SYBR Green Realtime PCR Master Mix (Torobo, Osaka, Japan) was used as a fluorescent dye, and amplifications were performed according the manufacturer’s guidelines. The amplification program was as follows: 94 o C for 5 min for predenaturation, and then 35 cycles at 94°C for 1 min for denaturation, 52°C for 30 sec for annealing, and 72 o C for 30 sec for extension. The oligonucleotide primers synthesized by Generay Biotech Co., Ltd (Shanghai, China) were listed in Table 1 . ACTB (actin beta) was used as the internal control [ 24 ]. All experiments were carried out in triplicates. Table 1 Oligonucleotide primers used in this study. Gene Product Forward primer (5'-3') Reverse primer (5'-3') ACTB Actin beta CGAGGACTTTGATTGCACATTG AGAGAAGTGGGGTGGCTTTTAG CEBPG CCAAT enhancer binding protein gamma AGCTTCGGGAATTGTGAG AACTATGCTGGACCTGCC FASN Fatty acid synthase AGAGCTACATCATCGCTG AGAAGTCAACACGAGCTT LPL Lipoprotein lipase GGGAACCCGACTGTGAAA CGACTGTTTTCCCTTCCG PPARG Peroxisome proliferator activated receptor gamma TGCAAGGGTTTCTTCCGG ATCCCCACTGCAAGGCAT SMOX Spermine oxidase TAACTCGTGACCTCCAGC GCGGCTAGCTCTACAGAA SMS Spermine synthase CACAGCGAAGACTGCTAAATGC TCCCTCCAGCAAAACAACGATG Validation studies of the candidate genes In order to investigate gene function of our screened target genes, we strengthened the expression of SMS and SMOX differentially down-regulated during adipogenesis with small interfering RNA (siRNA) using a lentivector expression system. Lentiviral vector pGV492 digested with BamH I/ Age I was used to overexpress SMS (NM_004595) and SMOX (NM_175839). The primer sequences of SMS were as follows: 5’-AGGTCGACTCTAGAGGATCCCGCCACCATGGCAGCAGCACGGCACAGCACG-3’ and 5’-TCCTTGTAGTCCATACCGGGTTTAGCTTTCTTCCAAACAG-3’, and those of SMOX were as follows: 5’-AGGTCGACTCTAGAGGATCCCGCCACCATGCAAAGTTGTGAATCCAGTGG-3’ and 5’-TCCTTGTAGTCCATACCGGTCCCCTGCTGGAAGAGGTCTCG-3’. All the lentiviruses, including SMS-siRNA, SMOX-siRNA, and the negative control, were prepared by GeneChem Co., LTD (Shanghai, China). After expanded to passage 6 approximately with 20% confluence, the hMSCs were separately transfected with SMS-siRNA and SMOX-siRNA lentiviruses using a multiplicity of infection (MOI) of 10 and HitransG Transfection Reagent P (Genechem Inc., Shanghai, China). Transfection efficiency was confirmed according to fluorescence intensity of GFP (Green fluorescent protein) expression under a fluorescence microscope (IX73, Olympus, Tokyo, Japan). Results Adipogenic differentiation Here, we assessed adipogenic potential of hMSCs via Oil Red O staining assays (Fig. 1 ). No lipid droplet appeared at 0 day, and the most obvious phenotypic changes was at 7 days after hMSCs differentiating to adipocytes with lipid-droplets accumulating (Fig. 1 a; 1 b). Specially, the expansion of size and number of lipid droplets increased from 7 to 28 days (Fig. 1 b-f). It indicated our hMSCs differentiating along adipogenesis. Transcriptional landscapes of amino acid metabolism during adipogenesis Here, RNA-Seq technique was performed to establish the transcriptional landscapes of amino acid metabolism during adipogenesis. 17 DEGs were identified during adipogenesis (Fig. 2 ). Furthermore, 13 up-regulated genes were most prevalent at four sampling points in our adipogenic anecdote, and thus suggested adipogenic differentiation facilitated the gene expression of amino acid metabolism pathway. As amino acid metabolism was a high energy demanding process, the facilitation of amino acid metabolism at transcriptional level would be the supply process of the essential energy. Nine DEGs (MAOA, ALDH1A3, AOC2, AOC3, SMS, ALDH4A1, ASS1, GLUL, and SMOX) got involved in more metabolic pathways of amino acid metabolism, including arginine and proline metabolism, glycine, serine and threonine metabolism, histidine metabolism, phenylalanine metabolism, tryptophan metabolism, tyrosine metabolism, cysteine and methionine metabolism, aspartate and glutamate metabolism, and arginine biosynthesis. For the DEG of MAOA (monoamine oxidase A), it related with six amino acid metabolism pathways, such as arginine and proline metabolism, glycine, serine and threonine metabolism, histidine metabolism, phenylalanine metabolism, tryptophan metabolism, and tyrosine metabolism. Seven DEGs (ALDH1A3, AOC2, AOC3, SMS, GGT1, GGT5, and SMOX) were the most abundant for the other amino acids metabolism, including beta-alanine metabolism, glutathione metabolism, taurine and hypotaurine metabolism, and beta-alanine metabolism was the most prevalent. Above all, the gene transcriptional landscapes of amino acid metabolism were strong in response to adipogenesis. The above DEGs were also matched along with biological process by GO analysis (Fig. 3 ). Based on one gene corresponding to multiple GO, we identified the differential expressed biological processes ( p _value < 0.05), such as MAOA (GO:0044281 and GO:0055114), ALDH1A3 (GO:0043065 and GO:0055114), AOC2 (GO:0055114), AOC3 (GO:0006954, GO:0007155, and GO:0055114), SMS (GO:0044281), ALDH4A1 (GO:0044281), ASS1 (GO:0044281), GGT1 (GO:0044281), GGT5 (GO:0006954 and GO:0044281), GLUL (GO:0044281 and GO:0050679), SMOX (GO:0044281 and GO:0055114), ADH1A (GO:0044281, GO:0055114), ADH1B (GO:0044281, and GO:0055114), ADH1C (GO:0044281 and GO:0055114), CYP1B1 (GO:0001525, GO:0008202, GO:0043542, GO:0044281, GO:0055114), and GPX (GO:0055114). In all, small molecule metabolic process (GO:0044281) was the most enriched biological process following by oxidation-reduction process (GO:0055114). As we known, all amino acids derived from the intermediates in glycolysis, the tricarboxylic acid cycle (TCA), or pentose phosphate pathway (PPP). The two differential biological processes would be the key way for the energy supply. SMS and SMOX enhanced adipogenesis The two genes SMS and SMOX were subjected to the further additional validation experiments. Here, we focused on the investigation of effect of overexpression SMS and SMOX on adipogenesis. We firstly confirmed the successful overexpression of the hMSCs following the reporter gene GFP expressing via transfection using lentiviral system (Fig. 4 a; 4 b). With SMS and SMOX overexpressed, respectively, the relative expression level of adipogenic biomarkers, including CEBPA (CCAAT enhancer binding protein alpha), CEBPG (CCAAT enhancer binding protein gamma), FASN (fatty acid synthase), LPL (lipoprotein lipase), and PPARG (peroxisome proliferator activated receptor gamma) (Fig. 4 c), was raised by SMOX more than SMS at transcriptional level. Protein level was brought into correspondence with the increase of PPARG gene expression (Fig. 4 d). Compared with the negative control, the lipid droplets accumulation of SMOX overexpression was also more than that of SMS (Fig. 4 e; 4 f). Above all, SMOX overexpression enhanced adipogenesis at transcriptional, translational, and cellular phenotype level of lipid droplets accumulation more than SMS. Here, we found SMOX overexpression fuels adipogenesis more than SMS using a lentivector expression system. Firstly, polyamine, ubiquitous positively charged amines, comprising agmatine, putrescine, spermidine, and spermine was essential for life, critical for adipogenesis from stem cell differentiation [ 14 , 25 – 28 ]. Specially, spermidine was indispensable in differentiation of 3T3-L1 fibroblasts to adipocytes [ 29 ]. Exogenous polyamine also reciprocally regulated adipogenic differentiation [ 30 ]. Secondly, far fewer effects brought about by SMS enhancement was agreed with the study in transgenic mice displaying just slight increases in spermine and decreases in spermidine levels [ 31 ]. And it had proved that the expression of SMS was regulated primarily depending on substrate availability under the normal conditions and up-regulated when exposured to polyamines and their analogues [ 32 ]. As we known, spermidine was catalyzed by SMS to spermine, and spermine was inversely oxidized by SMOX to spermidine, 3-aminopropanal and hydrogen peroxide in polyamine pathway [ 33 ]. The predicted regulatory network between adipogenic biomarkers and amino acid metabolism Here, except for BHMT2 for cysteine and methionine metabolism and ID2 for adipogenic biomarkers, we established the regulatory network between the other 16 DEGs of amino acid metabolism and 9 adipogenic biomarkers at transcriptional level using the Integrative Genomic Viewer (IGV) software (Fig. 5 ). It indicated that the DEGs of amino acid metabolism tightly related with the classical adipogenic biomarkers, such as AOC3-SMOX-PPARG-MAOA-LPL, AOC2-SMOX-PPARG-MAOA-LPL, ALDH4A1-SMS-SMOX-PPARG-MAOA-LPL, ALDH1A3-SMOX-PPARG-MAOA-LPL, ASS1-SMS-SMOX-PPARG, and so on. Especially, with SMS and SMOX overexpressed, PPARG was also partially confirmed to increase at transcriptional and translational level (Fig. 4 c; 4 d). In all, there was the potential regulatory network, and SMS-SMOX-PPARG was a potential and positive regulation signaling pathway. Although we found some evidence to support SMS-SMOX-PPARG signaling pathway working for amino acid metabolism during adipogenesis, further work on additional interaction mechanisms between the upstream and downstream in SMS-SMOX-PPARG signaling pathways should be detailed. Conclusion In summary, we firstly uncovered the transcriptional profiling of amino acid metabolism during adipogenesis by deep sequencing. We totally screened 17 DEGs for amino acid metabolism at 7, 14, 21, and 28 days during adipogenesis from hMSCs, especially with 13 up-regulated genes most prevalent in our adipogenic anecdote. Interestingly, the enforced expression of SMOX (spermine oxidase) responsible for polyamine metabolism in arginine and proline metabolism pathway facilitated adipogenesis more than SMS (spermine synthase). The established potential regulatory network further suggested that adipocyte differentiation tightly related with the basal metabolism of amino acid metabolism with the partially confirmed SMS-SMOX-PPARG signaling pathway. It would highlight the effect of adipogenesis on amino acid metabolism in adipocyte biology and provide the potential treatment strategy for the study of fat metabolic diseases. Declarations Funding This research is supported by the National Natural Science Foundation of China (81760167 and 81860165), Landed Science Project of Jiangxi Province Institution of Higher Education (KJLD13094), Jiangxi Provincial Natural Science Foundation (20202ACB206003), and Doctor Science Research Foundation of Jiujiang University (8879524). Competing Interest The authors declare that they have no conflict of interest. Availability of data and materials The data and materials that support the findings of this study are available from the corresponding author upon reasonable request. Authors’ contributions XY conceived the idea, analyzed the RNA-Seq data and visualized data presentation, performed qRT-PCR and virus transfection experiment, and prepared the manuscript. XY, PW, and YG developed cell culture. XY and JYL carried out western blot. XY, XYX and JJX were in charge of the overall project. All authors read and approved the final manuscript. Ethical statement A 21-year-old non-osteoporotic healthy male volunteer was recruited from Affiliated Hospital of Jiujiang University. All the experimental manipulations performed following the relevant guidelines and regulations were verified and approved by the Medical Ethics Committee of Jiujiang University (Approved ID: 1-2013, February 20, 2013). Consent to participate The donor signed the written informed consent for the research following the ethical guidelines of Jiujiang University. Consent for publication All authors are aware of the content and agree with the submission. References Fève, B. (2005). Adipogenesis: cellular and molecular aspects. Best Pract Res Clin Endocrinol Metab., 19 (4), 483–499. Cinti, S. (2011). Between brown and white: novel aspects of adipocyte differentiation. Ann Med., 43 (2), 104–115. Shepherd, P. R., Gnudi, L., Tozzo, E., Yang, H., Leach, F., & Kahn, B. B. (1993). Adipose cell hyperplasia and enhanced glucose disposal in transgenic mice overexpressing GLUT4 selectively in adipose tissue. J Biol Chem., 268 (30), 22243–22246. Rosen, E. D., & Spiegelman, B. M. (2014). What we talk about when we talk about fat. Cell., 156 (1–2), 20–44. Steppan, C. M., Bailey, S. T., Bhat, S., Brown, E. J., Banerjee, R. R., Wright, C. M., Patel, H. R., Ahima, R. S., & Lazar, M. A. (2001). The hormone resistin links obesity to diabetes. Nature., 409 (6818), 307–312. Glass, C. K., & Olefsky, J. M. (2012). Inflammation and lipid signaling in the etiology of insulin resistance. Cell Metabolism, 15 (5), 635–645. Turer, A. T., & Scherer, P. E. (2012). Adiponectin: mechanistic insights and clinical implications. Diabetologia., 55 (9), 2319–2326. Herman, M. A., Peroni, O. D., Villoria, J., Schön, M. R., Abumrad, N. A., Blüher, M., Klein, S., & Kahn, B. B. (2012). A novel ChREBP isoform in adipose tissue regulates systemic glucose metabolism. Nature., 484 (7394), 333–338. Smith, U., & Kahn, B. B. (2016). Adipose tissue regulates insulin sensitivity: role of adipogenesis, de novo lipogenesis and novel lipids. J Intern Med., 280 (5), 465–475. Morganti, C., Missiroli, S., Lebiedzinska-Arciszewska, M., Ferroni, L., Morganti, L., Perrone, M., Ramaccini, D., Occhionorelli, S., Zavan, B., Wieckowski, M. R., & Giorgi, C. (2019). Regulation of PKCβ levels and autophagy by PML is essential for high-glucose-dependent mesenchymal stem cell adipogenesis. Int J Obes (Lond), 43 (5), 963–973. Green, C. R., Wallace, M., Divakaruni, A. S., Phillips, S. A., Murphy, A. N., Ciaraldi, T. P., & Metallo, C. M. (2016). Branched-chain amino acid catabolism fuels adipocyte differentiation and lipogenesis. Nat Chem Biol., 12 (1), 15–21. Wang, Z., Dou, X., Yao, T., & Song, Z. (2011). Homocysteine inhibits adipogenesis in 3T3-L1 preadipocytes. Exp Biol Med (Maywood)., 236 (12), 1379–1388. Huh, J. E., Choi, J. Y., Shin, Y. O., Park, D. S., Kang, J. W., Nam, D., Choi, D. Y., & Lee, J. D. (2014). Arginine enhances osteoblastogenesis and inhibits adipogenesis through the regulation of Wnt and NFATc signaling in human mesenchymal stem cells. Int J Mol Sci., 15 (7), 13010–13029. Ishii, I., Ikeguchi, Y., Mano, H., Wada, M., Pegg, A. E., & Shirahata, A. (2012). Polyamine metabolism is involved in adipogenesis of 3T3-L1 cells. Amino Acids., 42 (2–3), 619–626. Vidhya, S., Ramya, R., Coral, K., Sulochana, K. N., & Bharathidevi, S. R. (2018). Free amino acids hydroxyproline, lysine, and glycine promote differentiation of retinal pericytes to adipocytes: A protective role against proliferative diabetic retinopathy. Exp Eye Res., 173 , 179–187. Xu, X., Li, X., Yan, R., Jiang, H., Wang, T., Fan, L., & Li, W. (2016). Gene expression profiling of human bone marrow-derived mesenchymal stem cells during adipogenesis. Folia Histochem Cytobiol, 54 (1), 14–24. Casado-Díaz, A., Santiago-Mora, R., Jiménez, R., Caballero-Villarraso, J., Herrera, C., Torres, A., Dorado, G., & Quesada-Gómez, J. M. (2008). Cryopreserved human bone marrow mononuclear cells as a source of mesenchymal stromal cells: application in osteoporosis research. Cytotherapy, 10 , 460–468. Yi, X., Liu, J., Wu, P., Gong, Y., Xu, X., & Li, W. (2020). The key miRNA on lipid droplets formation during adipogenesis from hMSCs. J Cell Physiol., 235 (1), 328–338. Yi, X., Liu, J., Wu, P., Gong, Y., Xu, X., & Li, W. (2020). The whole transcriptional profiling of cellular metabolism during adipogenesis from hMSCs. J Cell Physiol., 235 (1), 349–363. Nakamura, T., Shiojima, S., Hirai, Y., Iwama, T., Tsuruzoe, N., Hirasawa, A., Katsuma, S., & Tsujimoto, G. (2003). Temporal gene expression changes during adipogenesis in human mesenchymal stem cells. Biochem Biophys Res Commun., 303 , 306–12.21. Ross, S. E., Hemati, N., Longo, K. A., Bennett, C. N., Lucas, P. C., Erickson, R. L., & MacDougald, O. A. (2000). Inhibition of adipogenesis by Wnt signaling. Science., 289 , 950–953. Donzelli, E., Lucchini, C., Ballarini, E., Scuteri, A., Carini, F., Tredici, G., & Miloso, M. (2011). ERK1 and ERK2 are involved in recruitment and maturation of human mesenchymal stem cells induced to adipogenic differentiation. J Mol Cell Biol., 3 (2), 123–131. Yi, X., Wu, P., Liu, J., Gong, Y., Xu, X., & Li, W. (2019). Identification of the potential key genes for adipogenesis from human mesenchymal stem cells by RNA-SEq. J Cell Physiol., 234 (11), 2021–20227. Livak, K. J., & Schmittgen, T. D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2 (–Delta Delta C(T)) . Methods, 25 (4), 402–408. Bethell, D. R., & Pegg, A. E. (1981). Polyamines are needed for the differentiation of 3T3-L1 fibroblasts into adipose cells. Biochem Biophys Res Commun., 102 (1), 272–278. Erwin, B. G., Bethell, D. R., & Pegg, A. E. (1984). Role of polyamines in differentiation of 3T3-L1 fibroblasts into adipocytes. Am J Physiol., 246 (3Pt1), C293–C300. Minguet, E. G., Vera-Sirera, F., Marina, A., Carbonell, J., & Blázquez, M. A. (2008). Evolutionary diversification in polyamine biosynthesis. Mol Biol Evol., 25 (10), 2119–2128. Brenner, S., Bercovich, Z., Feiler, Y., Keshet, R., & Kahana, C. (2015). Dual Regulatory Role of Polyamines in Adipogenesis. J Biol Chem, 290 (45), 27384–27392. Vuohelainen, S., Pirinen, E., Cerrada-Gimenez, M., Keinänen, T. A., Uimari, A., Pietilä, M., Khomutov, A. R., Jänne, J., & Alhonen, L. (2010). Spermidine is indispensable in differentiation of 3T3-L1 fibroblasts to adipocytes. J Cell Mol Med., 14 (6B), 1683–1692. Lee, M. J., Chen, Y., Huang, Y. P., Hsu, Y. C., Chiang, L. H., Chen, T. Y., & Wang, G. J. (2013). Exogenous polyamines promote osteogenic differentiation by reciprocally regulating osteogenic and adipogenic gene expression. J Cell Biochem., 114 (12), 2718–2728. Ikeguchi, Y., Wang, X., McCloskey, D. E., Coleman, C. S., Nelson, P., Hu, G., Shantz, L. M., & Pegg, A. E. (2004). Characterization of transgenic mice with widespread overexpression of spermine synthase. Biochem J., 381 (Pt3), 701–707. Ikeguchi, Y., Bewley, M. C., & Pegg, A. E. (2006). Aminopropyltransferases: function, structure and genetics. J Biochem., 139 , 1–9. Wang, Y., & Casero, R. A. (2006). Mammalian polyamine catabolism: a therapeutic target, a pathological problem, or both? J Biochem., 139 , 17–25. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-192502","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":10727231,"identity":"df197a59-aae4-4284-ab0d-d32a1a8f92d2","order_by":0,"name":"Xia Yi","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA/0lEQVRIiWNgGAWjYDACZgaGAwwVDAxs7AgxAyK0nAFqYYbwJQhrAQHGNohe4rQYHOcxPPBz3jZ5PmYGxgc/2+rqGNibt0kw1NzBreUwW8LB3m23DduYGZgNe9sOSzDwHCuTYDj2DI8W5gMHeLfdZgRqYZNmbDsgwSCRYybB2HAYjxbGhoN/59y2B2ph/83YVifBIP+GkBbmA4d5G24ngmxhBtoFtIUHvxZJoF8Oyxy7ndzGzNgs2XPusGQbT1qxRcIx3Fr4zp8x/vim5rbt/Pbmgx9+lNXx87Mf3njjQw1uLQoH4EzGBjDFBiIScGpgYJBvwCM5CkbBKBgFowAMAPDCTvvmfgWhAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0002-0260-4057","institution":"Jiujiang University","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Xia","middleName":"","lastName":"Yi","suffix":""},{"id":10727232,"identity":"795b5c83-4f83-4b1d-9900-73c2c2a93aa9","order_by":1,"name":"Ping Wu","email":"","orcid":"","institution":"Jiujiang University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Ping","middleName":"","lastName":"Wu","suffix":""},{"id":10727233,"identity":"5ed97946-df21-4baf-b1df-d44637dfa41e","order_by":2,"name":"Jianyun Liu","email":"","orcid":"","institution":"Jiujiang University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jianyun","middleName":"","lastName":"Liu","suffix":""},{"id":10727234,"identity":"e3cf4187-b74d-45cc-88a1-a9e16f43bc97","order_by":3,"name":"Ying Gong","email":"","orcid":"","institution":"Jiujiang University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Ying","middleName":"","lastName":"Gong","suffix":""},{"id":10727235,"identity":"d7e7fa5a-195a-414a-9689-c5b46a4fb732","order_by":4,"name":"Xiaoyuan Xu","email":"","orcid":"","institution":"Jiujiang University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xiaoyuan","middleName":"","lastName":"Xu","suffix":""},{"id":10727236,"identity":"1f947380-22b4-4cc1-9926-2bd4effb513c","order_by":5,"name":"Jianjun Xiong","email":"","orcid":"","institution":"Jiujiang University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jianjun","middleName":"","lastName":"Xiong","suffix":""}],"badges":[],"createdAt":"2021-01-31 02:54:38","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-192502/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-192502/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":5974720,"identity":"7b1df5f5-bc57-43ac-b938-308502042dca","added_by":"auto","created_at":"2021-02-15 16:34:12","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":365347,"visible":true,"origin":"","legend":"Adipogenic potential at 0 day (a), 7 days (b), 14 days (c), 21 days (d), and 28 days (e) from hMSCs. Scale bar was 20 μm.","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-192502/v1/09962270a35e1e3723835cf5.png"},{"id":5974721,"identity":"0f7dab67-086c-4576-9ff1-317b27aa1d6c","added_by":"auto","created_at":"2021-02-15 16:34:13","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":137793,"visible":true,"origin":"","legend":"Heat map of the DEGs for amino acid metabolism at 7, 14, 21, and 28 days during adipogenesis. The figures between brackets indicated the types of amino acid metabolism pathway. ","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-192502/v1/8b4114b9c4e198ec070b4acc.png"},{"id":5974168,"identity":"a8d3544f-36ea-4d61-8cb9-7bf3be08c017","added_by":"auto","created_at":"2021-02-15 16:31:12","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":253633,"visible":true,"origin":"","legend":"GO analysis of the DEGs for amino acid metabolism during adipogenesis. ","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-192502/v1/55da9186bc481ab1e3d03b20.png"},{"id":5974722,"identity":"cb5ad47d-2820-46d9-91f8-519de46c4b55","added_by":"auto","created_at":"2021-02-15 16:34:13","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":774619,"visible":true,"origin":"","legend":"Gene function of SMS and SMOX during adipogenesis. (a) Fluorescence intensity after RNAi. Scale bar was 50 μm. (b) The relative expression level of SMS and SMOX after RNAi. (c) The relative expression level of adipogenic biomarkers with SMS and SMOX overexpressing, respectively. (d) Protein level via western blot. (e) Adipogenic potential of hMSCs via Oil Red O staining. Scale bar was 20 μm. (f) Quantification of Oil Red O during adipogenesis.","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-192502/v1/5fbe54f1a7d8eba941530c2d.png"},{"id":5974171,"identity":"0d0e43da-a71f-4e01-b489-72b27ccf90f3","added_by":"auto","created_at":"2021-02-15 16:31:13","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":103067,"visible":true,"origin":"","legend":"Regulatory networks between our DEGs and adipogenic biomarkers. Our DEGs were included in amino metabolism. The labeling of the selected genes were added manually using the Integrative Genomic Viewer (IGV) software. SMS and SMOX were colored yellow, and the classic adipogenic biomarkers were colored green. ","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-192502/v1/1dca166e41fcfb2629615bca.png"},{"id":13660325,"identity":"f1bc494e-043f-493e-859b-d729b442c772","added_by":"auto","created_at":"2021-09-17 10:23:55","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3478362,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-192502/v1/06e849d2-2942-447b-8156-a6d473b04838.pdf"}],"financialInterests":"","formattedTitle":"\u003cp\u003eSMOX and SMS Responsible for Polyamine Metabolism Enhanced Adipogenesis\u003c/p\u003e","fulltext":[{"header":"Introduction","content":" \u003cp\u003eAs we known, the consumption of unutilized calories induced a metabolic state promoting the commitment of human mesenchymal stem cells (hMSCs) to become preadipocytes, followed by their differentiation into mature adipocytes known as the primary site for fat storage [\u003cspan additionalcitationids=\"CR2\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. It had been clinically well established for the dysfunction of the endocrine and paracrine signaling usually responsible for the important regulatory functions of adipocytes leading to metabolic disorders and diseases, such as obesity, type 2 diabetes mellitus (T2DM), inflammation, and insulin resistance [\u003cspan additionalcitationids=\"CR5 CR6 CR7\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. As a highly orchestrated process, adipocyte differentiation regulated glucose and lipid homeostasis by storing the excess nutrients in lipid droplets and releasing the bioenergetic substrates via lipolysis [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eRecently, the studies involving in the relationship between amino acid and adipogenic differentiation attracted an increasing focus. Amino acids had been confirmed as the metabolic switch fueling adipogenic differentiation, such as branched-chain amino acid (BCAA) [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e], homocysteine [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], arginine [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], and polyamine [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Especially, it had well documented that the inhibition of BCAA catabolism thoroughly compromised adipogenesis [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Hydroxyproline, proline, lysine, glycine, and alanine also showed a potential to induce adipogenic effects in retinal pericytes [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. However, relatively little is uncovered for the whole profiling of amino acid metabolism during adipogenesis.\u003c/p\u003e \u003cp\u003eIn our previous study, we established the whole transcriptional profiling of cellular metabolism during adipogenesis [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Here, we further concentrated our attention on the transcriptional landscapes of amino acid metabolism during adipogenesis using RNA-Seq technique. Among 17 DEGs for amino acid metabolism at 7, 14, 21, and 28 days, we confirmed that the enforced expression of SMOX (spermine oxidase) responsible for polyamine metabolism in arginine and proline metabolism pathway facilitated adipogenesis more than SMS (spermine synthase) using RNA interference (RNAi) by lentiviruses system. The established potential regulatory network further indicated that adipocyte differentiation tightly related with the basal metabolism of amino acid metabolism with the partially confirmed SMS-SMOX-PPARG signaling pathway. This study would highlight the effect of adipogenesis on amino acid metabolism in adipocyte biology and provide the potential treatment strategy for the study of fat metabolic diseases.\u003c/p\u003e "},{"header":"Material And Methods","content":"\u003ch2\u003ehMSCs isolation and culture\u003c/h2\u003e\n\u003cp\u003eIdentified in our previous study [\u003cspan class=\"CitationRef\"\u003e16\u003c/span\u003e], the hMSCs were isolated following the protocols with slight modification [\u003cspan class=\"CitationRef\"\u003e17\u003c/span\u003e\u0026ndash;\u003cspan class=\"CitationRef\"\u003e18\u003c/span\u003e]. Adipogenic differentiation assays were developed following the method with the slight modifications [\u003cspan class=\"CitationRef\"\u003e19\u003c/span\u003e\u0026ndash;\u003cspan class=\"CitationRef\"\u003e20\u003c/span\u003e]. In an Model 3100 series Forma Series Ⅱ Water Jacket CO\u003csub\u003e2\u003c/sub\u003e incubator (Thermo Fisher Scientific, Ohio, United States), we cultured the hMSCs in 5.0 mL hMSCs Basal Medium (Cyagen bioscience, Inc., Santa Clara, CA, USA) supplemented with FBS (fetal bovine serum), penicillin-streptomycin, and L-glutamine in 25 cm\u003csup\u003e2\u003c/sup\u003e flasks (Corning Incorporated, Corning, New York, USA) at 37\u0026deg;C with 5% CO\u003csub\u003e2\u003c/sub\u003e and 95% humidity.\u003c/p\u003e\n\u003ch2\u003eHuman adipocyte differentiation\u003c/h2\u003e\n\u003cp\u003eExpanded to passage 6, the hMSCs with 80\u0026ndash;90% of the final confluence were stimulated with adipogenic cocktails of hMSCs Basal Medium including 1.0 \u0026micro;M dexamethasone, 0.01 mg/mL insulin, and 0.5 mM 3-isobutyl-1-methyl-xanthine (Sigma, St. Louis, Mo, USA) on day 0. Adipogenic potential of hMSCs was assessed following the documented method with slight modification [\u003cspan class=\"CitationRef\"\u003e21\u003c/span\u003e\u0026ndash;\u003cspan class=\"CitationRef\"\u003e22\u003c/span\u003e]. Briefly, the hMSCs were fixed with 3.7% formaldehyde for 30 min at room temperature after washed with phosphate buffered saline (PBS) (pH 8.0) buffer twice. And then, the hMSCs were stained with Oil Red O (Cyagen bioscience, Inc., Santa Clara, CA, USA) for 1 h after washing three times with PBS buffer. Cell morphology and the formation of lipid droplets of adipocytes were photographed using a fluorescence microscope (IX73, Olympus, Tokyo, Japan).\u003c/p\u003e\n\u003ch2\u003eRNA isolation and RNA-Seq sequencing and analysis\u003c/h2\u003e\n\u003cp\u003eFollowing the manufacturer\u0026rsquo;s instructions, the total RNA isolated from the adipogenic samples using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) was stored in liquid nitrogen for the further analysis. The freshly isolated RNA samples were for RNA sequencing after purified using the NucleoSpin RNA clean-up kit (Macherey-Nagel, D\u0026uuml;ren, Germany) and qualified by Bioanalyzer 2200 (Aligent Technologies, Santa Clara, CA, USA).\u003c/p\u003e\n\u003cp\u003eIn our previous study [\u003cspan class=\"CitationRef\"\u003e23\u003c/span\u003e], RNA-Seq sequencing was developed by NovelBio Bio-Pharm Technology Co., Ltd, Shanghai, China. Additional remarks, the Ion Total RNA-Seq kit v2.0 (Life Technologies, Santa Clara, CA, USA) following the manufacturer\u0026rsquo;s instructions was used to prepare RNA of RIN (RNA integrity number)\u0026thinsp;\u0026gt;\u0026thinsp;8.0 to construct the complementary DNA (cDNA) libraries for single-end sequencing of proton-sequencing process.\u003c/p\u003e\n\u003cp\u003eHere, we systematically established the transcriptional landscapes of amino acid metabolism during adipogenesis depending on KEGG pathway. We defined an absolute value of log\u003csub\u003e2\u003c/sub\u003e ratio\u0026thinsp;\u0026ge;\u0026thinsp;2.0 as the threshold of the differentially expressed genes (DEGs), and the significant DEGs simultaneously met a false discovery rate (FDR)\u0026thinsp;\u0026lt;\u0026thinsp;0.001 and an absolute value of log\u003csub\u003e2\u003c/sub\u003e ratio\u0026thinsp;\u0026ge;\u0026thinsp;2.0. We set the cutoff of \u003cem\u003ep\u003c/em\u003e_value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 as the differential expressed biological process for GO (Gene Ontology) analysis.\u003c/p\u003e\n\u003ch2\u003eqRT-PCR assays\u003c/h2\u003e\n\u003cp\u003eHere, the relative gene expression level was determined using qRT-PCR (quantitative real-time PCR). 2.0 \u0026micro;g RNA was used to synthesize cDNA using Oligo (dT\u003csub\u003e18\u003c/sub\u003e) primer complementary base pairing with poly (A) mRNA using the cDNA synthesis kit (Torobo Co., Osaka, Japan) on a 7500 Real Time PCR System (ABI, Foster, CA, USA) from Bio-Rad Laboratories (Hercules, CA, USA). A SYBR Green Realtime PCR Master Mix (Torobo, Osaka, Japan) was used as a fluorescent dye, and amplifications were performed according the manufacturer\u0026rsquo;s guidelines. The amplification program was as follows: 94 \u003csup\u003eo\u003c/sup\u003eC for 5 min for predenaturation, and then 35 cycles at 94\u0026deg;C for 1 min for denaturation, 52\u0026deg;C for 30 sec for annealing, and 72 \u003csup\u003eo\u003c/sup\u003eC for 30 sec for extension. The oligonucleotide primers synthesized by Generay Biotech Co., Ltd (Shanghai, China) were listed in Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e. ACTB (actin beta) was used as the internal control [\u003cspan class=\"CitationRef\"\u003e24\u003c/span\u003e]. All experiments were carried out in triplicates.\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003ctable id=\"Tab1\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003eOligonucleotide primers used in this study.\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eGene\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eProduct\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eForward primer (5'-3')\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eReverse primer (5'-3')\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eACTB\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eActin beta\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCGAGGACTTTGATTGCACATTG\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAGAGAAGTGGGGTGGCTTTTAG\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCEBPG\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCCAAT enhancer binding protein gamma\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAGCTTCGGGAATTGTGAG\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAACTATGCTGGACCTGCC\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eFASN\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eFatty acid synthase\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAGAGCTACATCATCGCTG\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAGAAGTCAACACGAGCTT\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eLPL\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eLipoprotein lipase\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eGGGAACCCGACTGTGAAA\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCGACTGTTTTCCCTTCCG\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ePPARG\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ePeroxisome proliferator activated receptor gamma\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTGCAAGGGTTTCTTCCGG\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eATCCCCACTGCAAGGCAT\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eSMOX\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eSpermine oxidase\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTAACTCGTGACCTCCAGC\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eGCGGCTAGCTCTACAGAA\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eSMS\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eSpermine synthase\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCACAGCGAAGACTGCTAAATGC\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTCCCTCCAGCAAAACAACGATG\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003ch2\u003eValidation studies of the candidate genes\u003c/h2\u003e\n\u003cp\u003eIn order to investigate gene function of our screened target genes, we strengthened the expression of SMS and SMOX differentially down-regulated during adipogenesis with small interfering RNA (siRNA) using a lentivector expression system. Lentiviral vector pGV492 digested with \u003cem\u003eBamH\u003c/em\u003eI/\u003cem\u003eAge\u003c/em\u003eI was used to overexpress SMS (NM_004595) and SMOX (NM_175839). The primer sequences of SMS were as follows: 5\u0026rsquo;-AGGTCGACTCTAGAGGATCCCGCCACCATGGCAGCAGCACGGCACAGCACG-3\u0026rsquo; and 5\u0026rsquo;-TCCTTGTAGTCCATACCGGGTTTAGCTTTCTTCCAAACAG-3\u0026rsquo;, and those of SMOX were as follows: 5\u0026rsquo;-AGGTCGACTCTAGAGGATCCCGCCACCATGCAAAGTTGTGAATCCAGTGG-3\u0026rsquo; and 5\u0026rsquo;-TCCTTGTAGTCCATACCGGTCCCCTGCTGGAAGAGGTCTCG-3\u0026rsquo;. All the lentiviruses, including SMS-siRNA, SMOX-siRNA, and the negative control, were prepared by GeneChem Co., LTD (Shanghai, China).\u003c/p\u003e\n\u003cp\u003eAfter expanded to passage 6 approximately with 20% confluence, the hMSCs were separately transfected with SMS-siRNA and SMOX-siRNA lentiviruses using a multiplicity of infection (MOI) of 10 and HitransG Transfection Reagent P (Genechem Inc., Shanghai, China). Transfection efficiency was confirmed according to fluorescence intensity of GFP (Green fluorescent protein) expression under a fluorescence microscope (IX73, Olympus, Tokyo, Japan).\u003c/p\u003e"},{"header":"Results","content":"\u003ch2\u003eAdipogenic differentiation\u003c/h2\u003e\n\u003cp\u003eHere, we assessed adipogenic potential of hMSCs via Oil Red O staining assays (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). No lipid droplet appeared at 0 day, and the most obvious phenotypic changes was at 7 days after hMSCs differentiating to adipocytes with lipid-droplets accumulating (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ea; \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eb). Specially, the expansion of size and number of lipid droplets increased from 7 to 28 days (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eb-f). It indicated our hMSCs differentiating along adipogenesis.\u0026nbsp;\u003c/p\u003e\n\u003ch2\u003eTranscriptional landscapes of amino acid metabolism during adipogenesis\u003c/h2\u003e\n\u003cp\u003eHere, RNA-Seq technique was performed to establish the transcriptional landscapes of amino acid metabolism during adipogenesis. 17 DEGs were identified during adipogenesis (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). Furthermore, 13 up-regulated genes were most prevalent at four sampling points in our adipogenic anecdote, and thus suggested adipogenic differentiation facilitated the gene expression of amino acid metabolism pathway. As amino acid metabolism was a high energy demanding process, the facilitation of amino acid metabolism at transcriptional level would be the supply process of the essential energy.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eNine DEGs (MAOA, ALDH1A3, AOC2, AOC3, SMS, ALDH4A1, ASS1, GLUL, and SMOX) got involved in more metabolic pathways of amino acid metabolism, including arginine and proline metabolism, glycine, serine and threonine metabolism, histidine metabolism, phenylalanine metabolism, tryptophan metabolism, tyrosine metabolism, cysteine and methionine metabolism, aspartate and glutamate metabolism, and arginine biosynthesis. For the DEG of MAOA (monoamine oxidase A), it related with six amino acid metabolism pathways, such as arginine and proline metabolism, glycine, serine and threonine metabolism, histidine metabolism, phenylalanine metabolism, tryptophan metabolism, and tyrosine metabolism. Seven DEGs (ALDH1A3, AOC2, AOC3, SMS, GGT1, GGT5, and SMOX) were the most abundant for the other amino acids metabolism, including beta-alanine metabolism, glutathione metabolism, taurine and hypotaurine metabolism, and beta-alanine metabolism was the most prevalent. Above all, the gene transcriptional landscapes of amino acid metabolism were strong in response to adipogenesis.\u003c/p\u003e\n\u003cp\u003eThe above DEGs were also matched along with biological process by GO analysis (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e). Based on one gene corresponding to multiple GO, we identified the differential expressed biological processes (\u003cem\u003ep\u003c/em\u003e_value\u0026thinsp;\u0026lt;\u0026thinsp;0.05), such as MAOA (GO:0044281 and GO:0055114), ALDH1A3 (GO:0043065 and GO:0055114), AOC2 (GO:0055114), AOC3 (GO:0006954, GO:0007155, and GO:0055114), SMS (GO:0044281), ALDH4A1 (GO:0044281), ASS1 (GO:0044281), GGT1 (GO:0044281), GGT5 (GO:0006954 and GO:0044281), GLUL (GO:0044281 and GO:0050679), SMOX (GO:0044281 and GO:0055114), ADH1A (GO:0044281, GO:0055114), ADH1B (GO:0044281, and GO:0055114), ADH1C (GO:0044281 and GO:0055114), CYP1B1 (GO:0001525, GO:0008202, GO:0043542, GO:0044281, GO:0055114), and GPX (GO:0055114). In all, small molecule metabolic process (GO:0044281) was the most enriched biological process following by oxidation-reduction process (GO:0055114). As we known, all amino acids derived from the intermediates in glycolysis, the tricarboxylic acid cycle (TCA), or pentose phosphate pathway (PPP). The two differential biological processes would be the key way for the energy supply.\u0026nbsp;\u003c/p\u003e\n\u003ch2\u003eSMS and SMOX enhanced adipogenesis\u003c/h2\u003e\n\u003cp\u003eThe two genes SMS and SMOX were subjected to the further additional validation experiments. Here, we focused on the investigation of effect of overexpression SMS and SMOX on adipogenesis.\u003c/p\u003e\n\u003cp\u003eWe firstly confirmed the successful overexpression of the hMSCs following the reporter gene GFP expressing via transfection using lentiviral system (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ea; \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eb). With SMS and SMOX overexpressed, respectively, the relative expression level of adipogenic biomarkers, including CEBPA (CCAAT enhancer binding protein alpha), CEBPG (CCAAT enhancer binding protein gamma), FASN (fatty acid synthase), LPL (lipoprotein lipase), and PPARG (peroxisome proliferator activated receptor gamma) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ec), was raised by SMOX more than SMS at transcriptional level. Protein level was brought into correspondence with the increase of PPARG gene expression (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ed). Compared with the negative control, the lipid droplets accumulation of SMOX overexpression was also more than that of SMS (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ee; \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ef). Above all, SMOX overexpression enhanced adipogenesis at transcriptional, translational, and cellular phenotype level of lipid droplets accumulation more than SMS.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eHere, we found SMOX overexpression fuels adipogenesis more than SMS using a lentivector expression system. Firstly, polyamine, ubiquitous positively charged amines, comprising agmatine, putrescine, spermidine, and spermine was essential for life, critical for adipogenesis from stem cell differentiation [\u003cspan class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e25\u003c/span\u003e\u0026ndash;\u003cspan class=\"CitationRef\"\u003e28\u003c/span\u003e]. Specially, spermidine was indispensable in differentiation of 3T3-L1 fibroblasts to adipocytes [\u003cspan class=\"CitationRef\"\u003e29\u003c/span\u003e]. Exogenous polyamine also reciprocally regulated adipogenic differentiation [\u003cspan class=\"CitationRef\"\u003e30\u003c/span\u003e]. Secondly, far fewer effects brought about by SMS enhancement was agreed with the study in transgenic mice displaying just slight increases in spermine and decreases in spermidine levels [\u003cspan class=\"CitationRef\"\u003e31\u003c/span\u003e]. And it had proved that the expression of SMS was regulated primarily depending on substrate availability under the normal conditions and up-regulated when exposured to polyamines and their analogues [\u003cspan class=\"CitationRef\"\u003e32\u003c/span\u003e]. As we known, spermidine was catalyzed by SMS to spermine, and spermine was inversely oxidized by SMOX to spermidine, 3-aminopropanal and hydrogen peroxide in polyamine pathway [\u003cspan class=\"CitationRef\"\u003e33\u003c/span\u003e].\u003c/p\u003e\n\u003ch2\u003eThe predicted regulatory network between adipogenic biomarkers and amino acid metabolism\u003c/h2\u003e\n\u003cp\u003eHere, except for BHMT2 for cysteine and methionine metabolism and ID2 for adipogenic biomarkers, we established the regulatory network between the other 16 DEGs of amino acid metabolism and 9 adipogenic biomarkers at transcriptional level using the Integrative Genomic Viewer (IGV) software (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e). It indicated that the DEGs of amino acid metabolism tightly related with the classical adipogenic biomarkers, such as AOC3-SMOX-PPARG-MAOA-LPL, AOC2-SMOX-PPARG-MAOA-LPL, ALDH4A1-SMS-SMOX-PPARG-MAOA-LPL, ALDH1A3-SMOX-PPARG-MAOA-LPL, ASS1-SMS-SMOX-PPARG, and so on. Especially, with SMS and SMOX overexpressed, PPARG was also partially confirmed to increase at transcriptional and translational level (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ec; \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ed). In all, there was the potential regulatory network, and SMS-SMOX-PPARG was a potential and positive regulation signaling pathway. Although we found some evidence to support SMS-SMOX-PPARG signaling pathway working for amino acid metabolism during adipogenesis, further work on additional interaction mechanisms between the upstream and downstream in SMS-SMOX-PPARG signaling pathways should be detailed.\u0026nbsp;\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn summary, we firstly uncovered the transcriptional profiling of amino acid metabolism during adipogenesis by deep sequencing. We totally screened 17 DEGs for amino acid metabolism at 7, 14, 21, and 28 days during adipogenesis from hMSCs, especially with 13 up-regulated genes most prevalent in our adipogenic anecdote. Interestingly, the enforced expression of SMOX (spermine oxidase) responsible for polyamine metabolism in arginine and proline metabolism pathway facilitated adipogenesis more than SMS (spermine synthase). The established potential regulatory network further suggested that adipocyte differentiation tightly related with the basal metabolism of amino acid metabolism with the partially confirmed SMS-SMOX-PPARG signaling pathway. It would highlight the effect of adipogenesis on amino acid metabolism in adipocyte biology and provide the potential treatment strategy for the study of fat metabolic diseases.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eFunding\u0026nbsp;\u003c/h2\u003e\n\u003cp\u003eThis research is supported by the National Natural Science Foundation of China (81760167 and 81860165), Landed Science Project of Jiangxi Province Institution of Higher Education (KJLD13094), Jiangxi Provincial Natural Science Foundation (20202ACB206003), and Doctor Science Research Foundation of Jiujiang University (8879524).\u003c/p\u003e\n\u003ch2\u003eCompeting Interest \u0026nbsp;\u003c/h2\u003e\n\u003cp\u003eThe authors declare that they have no conflict of interest.\u003c/p\u003e\n\u003ch2\u003eAvailability of data and materials\u0026nbsp;\u003c/h2\u003e\n\u003cp\u003eThe data and materials that support the findings of this study are available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003ch2\u003eAuthors\u0026rsquo; contributions\u0026nbsp;\u003c/h2\u003e\n\u003cp\u003eXY conceived the idea, analyzed the RNA-Seq data and visualized data presentation, performed qRT-PCR and virus transfection experiment, and prepared the manuscript. XY, PW, and YG developed cell culture. XY and JYL carried out western blot. XY, XYX and JJX were in charge of the overall project. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003ch2\u003eEthical statement \u0026nbsp;\u003c/h2\u003e\n\u003cp\u003eA 21-year-old non-osteoporotic healthy male volunteer was recruited from Affiliated Hospital of Jiujiang University. All the experimental manipulations performed following the relevant guidelines and regulations were verified and approved by the Medical Ethics Committee of Jiujiang University (Approved ID: 1-2013, February 20, 2013).\u003c/p\u003e\n\u003ch2\u003eConsent to participate\u003c/h2\u003e\n\u003cp\u003e\u0026nbsp;The donor signed the written informed consent for the research following the ethical guidelines of Jiujiang University.\u003c/p\u003e\n\u003ch2\u003eConsent for publication\u0026nbsp;\u003c/h2\u003e\n\u003cp\u003eAll authors are aware of the content and agree with the submission.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eF\u0026egrave;ve, B. (2005). Adipogenesis: cellular and molecular aspects. \u003cem\u003eBest Pract Res Clin Endocrinol Metab., 19\u003c/em\u003e(4), 483\u0026ndash;499.\u003c/li\u003e\n\u003cli\u003eCinti, S. (2011). Between brown and white: novel aspects of adipocyte differentiation. \u003cem\u003eAnn Med., 43\u003c/em\u003e(2), 104\u0026ndash;115.\u003c/li\u003e\n\u003cli\u003eShepherd, P. R., Gnudi, L., Tozzo, E., Yang, H., Leach, F., \u0026amp; Kahn, B. B. (1993). Adipose cell hyperplasia and enhanced glucose disposal in transgenic mice overexpressing GLUT4 selectively in adipose tissue. \u003cem\u003eJ Biol Chem., 268\u003c/em\u003e(30), 22243\u0026ndash;22246.\u003c/li\u003e\n\u003cli\u003eRosen, E. D., \u0026amp; Spiegelman, B. M. (2014). What we talk about when we talk about fat. \u003cem\u003eCell., 156\u003c/em\u003e(1\u0026ndash;2), 20\u0026ndash;44.\u003c/li\u003e\n\u003cli\u003eSteppan, C. M., Bailey, S. T., Bhat, S., Brown, E. J., Banerjee, R. R., Wright, C. M., Patel, H. R., Ahima, R. S., \u0026amp; Lazar, M. A. (2001). The hormone resistin links obesity to diabetes. \u003cem\u003eNature., 409\u003c/em\u003e(6818), 307\u0026ndash;312.\u003c/li\u003e\n\u003cli\u003eGlass, C. K., \u0026amp; Olefsky, J. M. (2012). Inflammation and lipid signaling in the etiology of insulin resistance. \u003cem\u003eCell Metabolism, 15\u003c/em\u003e(5), 635\u0026ndash;645.\u003c/li\u003e\n\u003cli\u003eTurer, A. T., \u0026amp; Scherer, P. E. (2012). Adiponectin: mechanistic insights and clinical implications. \u003cem\u003eDiabetologia., 55\u003c/em\u003e(9), 2319\u0026ndash;2326.\u003c/li\u003e\n\u003cli\u003eHerman, M. A., Peroni, O. D., Villoria, J., Sch\u0026ouml;n, M. R., Abumrad, N. A., Bl\u0026uuml;her, M., Klein, S., \u0026amp; Kahn, B. B. (2012). A novel ChREBP isoform in adipose tissue regulates systemic glucose metabolism. \u003cem\u003eNature., 484\u003c/em\u003e(7394), 333\u0026ndash;338.\u003c/li\u003e\n\u003cli\u003eSmith, U., \u0026amp; Kahn, B. B. (2016). Adipose tissue regulates insulin sensitivity: role of adipogenesis, de novo lipogenesis and novel lipids. \u003cem\u003eJ Intern Med., 280\u003c/em\u003e(5), 465\u0026ndash;475.\u003c/li\u003e\n\u003cli\u003eMorganti, C., Missiroli, S., Lebiedzinska-Arciszewska, M., Ferroni, L., Morganti, L., Perrone, M., Ramaccini, D., Occhionorelli, S., Zavan, B., Wieckowski, M. R., \u0026amp; Giorgi, C. (2019). Regulation of PKC\u0026beta; levels and autophagy by PML is essential for high-glucose-dependent mesenchymal stem cell adipogenesis. \u003cem\u003eInt J Obes (Lond), 43\u003c/em\u003e(5), 963\u0026ndash;973.\u003c/li\u003e\n\u003cli\u003eGreen, C. R., Wallace, M., Divakaruni, A. S., Phillips, S. A., Murphy, A. N., Ciaraldi, T. P., \u0026amp; Metallo, C. M. (2016). Branched-chain amino acid catabolism fuels adipocyte differentiation and lipogenesis. \u003cem\u003eNat Chem Biol., 12\u003c/em\u003e(1), 15\u0026ndash;21.\u003c/li\u003e\n\u003cli\u003eWang, Z., Dou, X., Yao, T., \u0026amp; Song, Z. (2011). Homocysteine inhibits adipogenesis in 3T3-L1 preadipocytes. \u003cem\u003eExp Biol Med (Maywood)., 236\u003c/em\u003e(12), 1379\u0026ndash;1388.\u003c/li\u003e\n\u003cli\u003eHuh, J. E., Choi, J. Y., Shin, Y. O., Park, D. S., Kang, J. W., Nam, D., Choi, D. Y., \u0026amp; Lee, J. D. (2014). Arginine enhances osteoblastogenesis and inhibits adipogenesis through the regulation of Wnt and NFATc signaling in human mesenchymal stem cells. \u003cem\u003eInt J Mol Sci., 15\u003c/em\u003e(7), 13010\u0026ndash;13029.\u003c/li\u003e\n\u003cli\u003eIshii, I., Ikeguchi, Y., Mano, H., Wada, M., Pegg, A. E., \u0026amp; Shirahata, A. (2012). Polyamine metabolism is involved in adipogenesis of 3T3-L1 cells. \u003cem\u003eAmino Acids., 42\u003c/em\u003e(2\u0026ndash;3), 619\u0026ndash;626.\u003c/li\u003e\n\u003cli\u003eVidhya, S., Ramya, R., Coral, K., Sulochana, K. N., \u0026amp; Bharathidevi, S. R. (2018). Free amino acids hydroxyproline, lysine, and glycine promote differentiation of retinal pericytes to adipocytes: A protective role against proliferative diabetic retinopathy. \u003cem\u003eExp Eye Res., 173\u003c/em\u003e, 179\u0026ndash;187.\u003c/li\u003e\n\u003cli\u003eXu, X., Li, X., Yan, R., Jiang, H., Wang, T., Fan, L., \u0026amp; Li, W. (2016). Gene expression profiling of human bone marrow-derived mesenchymal stem cells during adipogenesis. \u003cem\u003eFolia Histochem Cytobiol, 54\u003c/em\u003e(1), 14\u0026ndash;24.\u003c/li\u003e\n\u003cli\u003eCasado-D\u0026iacute;az, A., Santiago-Mora, R., Jim\u0026eacute;nez, R., Caballero-Villarraso, J., Herrera, C., Torres, A., Dorado, G., \u0026amp; Quesada-G\u0026oacute;mez, J. M. (2008). Cryopreserved human bone marrow mononuclear cells as a source of mesenchymal stromal cells: application in osteoporosis research. \u003cem\u003eCytotherapy, 10\u003c/em\u003e, 460\u0026ndash;468.\u003c/li\u003e\n\u003cli\u003eYi, X., Liu, J., Wu, P., Gong, Y., Xu, X., \u0026amp; Li, W. (2020). The key miRNA on lipid droplets formation during adipogenesis from hMSCs. \u003cem\u003eJ Cell Physiol., 235\u003c/em\u003e(1), 328\u0026ndash;338.\u003c/li\u003e\n\u003cli\u003eYi, X., Liu, J., Wu, P., Gong, Y., Xu, X., \u0026amp; Li, W. (2020). The whole transcriptional profiling of cellular metabolism during adipogenesis from hMSCs. \u003cem\u003eJ Cell Physiol., 235\u003c/em\u003e(1), 349\u0026ndash;363.\u003c/li\u003e\n\u003cli\u003eNakamura, T., Shiojima, S., Hirai, Y., Iwama, T., Tsuruzoe, N., Hirasawa, A., Katsuma, S., \u0026amp; Tsujimoto, G. (2003). Temporal gene expression changes during adipogenesis in human mesenchymal stem cells. \u003cem\u003eBiochem Biophys Res Commun., 303\u003c/em\u003e, 306\u0026ndash;12.21.\u003c/li\u003e\n\u003cli\u003eRoss, S. E., Hemati, N., Longo, K. A., Bennett, C. N., Lucas, P. C., Erickson, R. L., \u0026amp; MacDougald, O. A. (2000). Inhibition of adipogenesis by Wnt signaling. \u003cem\u003eScience., 289\u003c/em\u003e, 950\u0026ndash;953.\u003c/li\u003e\n\u003cli\u003eDonzelli, E., Lucchini, C., Ballarini, E., Scuteri, A., Carini, F., Tredici, G., \u0026amp; Miloso, M. (2011). ERK1 and ERK2 are involved in recruitment and maturation of human mesenchymal stem cells induced to adipogenic differentiation. \u003cem\u003eJ Mol Cell Biol., 3\u003c/em\u003e(2), 123\u0026ndash;131.\u003c/li\u003e\n\u003cli\u003eYi, X., Wu, P., Liu, J., Gong, Y., Xu, X., \u0026amp; Li, W. (2019). Identification of the potential key genes for adipogenesis from human mesenchymal stem cells by RNA-SEq. \u003cem\u003eJ Cell Physiol., 234\u003c/em\u003e(11), 2021\u0026ndash;20227.\u003c/li\u003e\n\u003cli\u003eLivak, K. J., \u0026amp; Schmittgen, T. D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2\u003csup\u003e(\u0026ndash;Delta Delta C(T))\u003c/sup\u003e. \u003cem\u003eMethods, 25\u003c/em\u003e(4), 402\u0026ndash;408.\u003c/li\u003e\n\u003cli\u003eBethell, D. R., \u0026amp; Pegg, A. E. (1981). Polyamines are needed for the differentiation of 3T3-L1 fibroblasts into adipose cells. \u003cem\u003eBiochem Biophys Res Commun., 102\u003c/em\u003e(1), 272\u0026ndash;278.\u003c/li\u003e\n\u003cli\u003eErwin, B. G., Bethell, D. R., \u0026amp; Pegg, A. E. (1984). Role of polyamines in differentiation of 3T3-L1 fibroblasts into adipocytes. \u003cem\u003eAm J Physiol., 246\u003c/em\u003e(3Pt1), C293\u0026ndash;C300.\u003c/li\u003e\n\u003cli\u003eMinguet, E. G., Vera-Sirera, F., Marina, A., Carbonell, J., \u0026amp; Bl\u0026aacute;zquez, M. A. (2008). Evolutionary diversification in polyamine biosynthesis. \u003cem\u003eMol Biol Evol., 25\u003c/em\u003e(10), 2119\u0026ndash;2128.\u003c/li\u003e\n\u003cli\u003eBrenner, S., Bercovich, Z., Feiler, Y., Keshet, R., \u0026amp; Kahana, C. (2015). Dual Regulatory Role of Polyamines in Adipogenesis. \u003cem\u003eJ Biol Chem, 290\u003c/em\u003e(45), 27384\u0026ndash;27392.\u003c/li\u003e\n\u003cli\u003eVuohelainen, S., Pirinen, E., Cerrada-Gimenez, M., Kein\u0026auml;nen, T. A., Uimari, A., Pietil\u0026auml;, M., Khomutov, A. R., J\u0026auml;nne, J., \u0026amp; Alhonen, L. (2010). Spermidine is indispensable in differentiation of 3T3-L1 fibroblasts to adipocytes. \u003cem\u003eJ Cell Mol Med., 14\u003c/em\u003e(6B), 1683\u0026ndash;1692.\u003c/li\u003e\n\u003cli\u003eLee, M. J., Chen, Y., Huang, Y. P., Hsu, Y. C., Chiang, L. H., Chen, T. Y., \u0026amp; Wang, G. J. (2013). Exogenous polyamines promote osteogenic differentiation by reciprocally regulating osteogenic and adipogenic gene expression. \u003cem\u003eJ Cell Biochem., 114\u003c/em\u003e(12), 2718\u0026ndash;2728.\u003c/li\u003e\n\u003cli\u003eIkeguchi, Y., Wang, X., McCloskey, D. E., Coleman, C. S., Nelson, P., Hu, G., Shantz, L. M., \u0026amp; Pegg, A. E. (2004). Characterization of transgenic mice with widespread overexpression of spermine synthase. \u003cem\u003eBiochem J., 381\u003c/em\u003e(Pt3), 701\u0026ndash;707.\u003c/li\u003e\n\u003cli\u003eIkeguchi, Y., Bewley, M. C., \u0026amp; Pegg, A. E. (2006). Aminopropyltransferases: function, structure and genetics. \u003cem\u003eJ Biochem., 139\u003c/em\u003e, 1\u0026ndash;9.\u003c/li\u003e\n\u003cli\u003eWang, Y., \u0026amp; Casero, R. A. (2006). Mammalian polyamine catabolism: a therapeutic target, a pathological problem, or both? \u003cem\u003eJ Biochem., 139\u003c/em\u003e, 17\u0026ndash;25.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Adipogenesis, hMSCs, SMS, SMOX, regulatory network","lastPublishedDoi":"10.21203/rs.3.rs-192502/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-192502/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAdipose tissue regulating carbohydrate and lipid metabolism had been extensively focused. However, the regulation of amino acid metabolism during adipocyte differentiation remained detailed. Here we applied RNA-Seq technique to establish the transcriptional landscapes of amino acid metabolism during adipogenesis. We totally screened 17 differentially expressed genes (DEGs) for amino acid metabolism at 7, 14, 21, and 28 days during adipogenesis from human mesenchymal stem cells (hMSCs), especially with 13 up-regulated genes most prevalent in our adipogenic anecdote. Small molecule metabolic process was the most enriched biological process following by oxidation-reduction process. Interestingly, the enforced expression of SMOX (spermine oxidase) responsible for polyamine metabolism in arginine and proline metabolism pathway facilitated adipogenesis more than SMS (spermine synthase) using RNA interference (RNAi). The established potential regulatory network further suggested that adipocyte differentiation tightly related with the basal metabolism of amino acid metabolism with the partially confirmed SMS-SMOX-PPARG signaling pathway. It would highlight the effect of adipogenesis on amino acid metabolism in adipocyte biology and provide the potential treatment strategy for the study of fat metabolic diseases.\u003c/p\u003e","manuscriptTitle":"SMOX and SMS Responsible for Polyamine Metabolism Enhanced Adipogenesis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2021-02-15 16:31:10","doi":"10.21203/rs.3.rs-192502/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"b91be1d9-fb3e-4a42-a445-d64229274cdd","owner":[],"postedDate":"February 15th, 2021","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":2424646,"name":"General Biochemistry"},{"id":2424647,"name":"Biotechnology and Bioengineering"}],"tags":[],"updatedAt":"2021-02-15T16:34:12+00:00","versionOfRecord":[],"versionCreatedAt":"2021-02-15 16:31:10","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-192502","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-192502","identity":"rs-192502","version":["v1"]},"buildId":"7rjqhiLT3MXkJMwkYKINL","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}