Improving Yield and Nitrogen use Efficiency in Wheat by Overexpressing TaNAC2-5A Transcription Factor

Improving Yield and Nitrogen use Efficiency in Wheat by Overexpressing TaNAC2-5A Transcription Factor | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Improving Yield and Nitrogen use Efficiency in Wheat by Overexpressing TaNAC2-5A Transcription Factor Arooj Azhar, Ayesha Jabeen, Asia Khatoon, Aftab Bashir, Kauser A. Malik This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6421854/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract TaNAC2-5A is a transcription factor that is part of the NAC family, which is associated with the regulation of plant growth and the response to stress factors, especially in terms of available nitrate. This research is focused on investigating the effect of TaNAC2-5A expression on wheat yield and nitrogen use efficiency of a local wheat variety. A genetic construct for TaNAC2-5A was designed based on a modified wheat transformation vector pSB219, tested in N. tabacum and used for Agrobacterium -mediated transformation of wheat. Transformed wheat plants (T 0 ) were tested for transgene with PCR until the T 2 generation. Subsequently, the verified plants were evaluated for transgene expression with RT-PCR and qRT-PCR six weeks after germination. The qRT-PCR results revealed that transgenic lines of TaNAC2-5A expressed higher levels of the transcription factor in comparison with the parental line of FSD-2008. The L3 line (NAC2-4 event) indicated 2.25 times higher expression. In agronomic evaluations, the transgenic L3 line was associated with 17.18% higher 1000 grain weight and better root architecture parameters including length, surface area and projected area, suggesting that there is improved nutrient absorption. Also, transgenic lines showed large differences (p ≤ 0.05), in total chlorophyll, protein and sugar contents compared to controls. These findings demonstrate that the constitutive expression of TaNAC2-5A improves wheat yield, root development, and nutrient uptake efficiency, which is beneficial in making high-yield, fertilizer-efficient wheat varieties, thereby having the potential to contribute positively towards food security. Wheat nitrate uptake Nitrogen use efficiency (NUE) Triticum aestivum TaNAC2-5A overexpression Climate smart transgenic wheat Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 Figure 13 Introduction Wheat is one of the highly consumed cereal crops. It is the primary source of carbohydrates, proteins and minerals for one-third of the population across the globe (Huang and Roder 2004; Khan and Zeb 2007 ; Liu et al. 2010 ). In addition, it provides up to 20% of daily energy needs and 25% of global protein consumption. The contribution of wheat to the global cereal market stands at 40% (FAO 2017). However, environmental factors like climate change, salinity, drought, extreme temperatures, and soil nutrient depletion have affected wheat production activities. These factors impede plant growth, its productivity, and efficiency in utilizing resources which call for cutting edge bioengineering techniques in resolving these concerns. One critical concern is the efficient usage of nitrogen, which is a major nutrient for plant development and is usually added to the soil in the form of artificial nitrogen-enriched fertilizers. Even though these fertilizers have been helpful in increasing crop production, their overuse has resulted in environmental problems, such as loss of soil fertility, eutrophication, and climate change (Good et al. 2004 ). Additionally, almost 70% of the nitrogen applied in the field is lost to the ecosystem which causes additional damage to the environment (Hodge et al. 2000 ). In response to these problems, improving Nitrogen Use Efficiency (NUE) through genetic engineering is a promising approach for achieving ecologically friendly agricultural practices (Molina-Rueda and Kirby 2015; Zhang et al. 2024 ). Transcription factors (TFs) are critical components of gene regulatory networks that are responsible for directing plant growth and triggering responses to environmental stress (Mondal et al. 2016 ). Transforming growth factors are high-value targets for genetically engineering agronomical traits that can control numerous gene networks (Century et al. 2008 ). Among numerous TF families, NAC family named after its domains NAM (No apical meristem), ATAF (Arabidopsis transcription activation factor) and CUC (Cup-shaped cotyledon), is one of the major groups of plant specific regulators. They function in a wide array of diverse tasks such as temporal and spatial nutrient remobilization, root formation, senescence of leaves and biotic or abiotic stress interactions (Olsen et al. 2005 ; Uauy et al. 2006 ; Yamaguchi et al. 2010 ). NAC TFs normally compose of a conserved N-terminal domain that has the ability to bind DNA, and an extreme C terminal region that determines the ability of lateral transcriptional pathways (Ernst et al. 2004 ). Plant nitrogen uptake is influenced by soil conditions and the plant’s ability to adapt. In acidic soils, plants tend to absorb nitrogen as ammonium and amino acids, while in alkaline soils, they primarily take up nitrates (Maathuis, 2009; McAllister et al., 2012). Plant roots have two coexisting nitrate transport systems that facilitate nitrogen absorption from the soil and its distribution throughout the plant (Daniel-Vedele et al. 1998 ). These two systems are categorized as low-affinity nitrate transporters (LATS) and high-affinity nitrate transporters (HATS), which are controlled by genes from the NRT1 family. The NRT1.1 transporter, the first to be isolated, has been extensively researched (Tsay et al. 2007 ). This gene is normally expressed in the root tip epidermis, endodermis, and cortex of mature roots, with the proteins located on the plasma membrane. In comparison, NRT1.2 is consistently expressed only in the root epidermis and is associated with low-affinity systems (Huang et al. 1999 ). Whenever plants take up nitrogen in the form of nitrates, they must be transported across different parts of the plant in order to be available to the plant parts in the form of amino acids and ammonium. This long-distance nitrate transport from roots to shoots is carried out by the NRT1.5 gene, which is positioned near the xylem on root pericycle plasma membrane cells (Lin et al. 2008 ). There are several other nitrate transporter genes, including NRT1.4, expressed in petioles of leaves only (Chiu et al. 2004 ) and NRT1.6, which are expressed in funiculus and silique vascular tissues. Moreover, it has been reported that NRT1.6 transports nitrates to developing embryos from maternal tissues (Almagro et al. 2008 ). On the other hand, HATS are only expressed in plants when there is a low concentration of nitrates in the soil, and they involve NRT2 family genes, that is, NRT2.1 and NRT2.2 (Williams and Miller 2001 ). Previous studies suggested that TaNAC2-5A has a significant role in the wheat nitrate transcriptional control of transmembrane transport genes (Aida et al. 1997 ; Kim et al. 2007 ; Yamaguchi et al. 2010 ). As studied by Li et al. ( 2020 ), TaNAC2-5A enhances the expression of TaNRT2.5-3B functional genes which are involved in nitrate transport for nitrogen uptake and assimilation. Increased grain nitrate, seed vigor and nitrogen accumulation were also observed in T. aestivum lines with overexpressed TaNAC2-5A (Li et al. 2020 ). Other studies in Arabidopsis and rice also reported similar findings wherein NAC TFs were identified to be crucial factors in enhancing nitrogen metabolism and root architecture under stressful conditions (Redillas et al. 2012 ; He et al. 2015 ). For instance, overexpression of TaNAC2 in Arabidopsis thaliana enhanced tolerance to high temperatures and salinity (Mao et al. 2014 ) while TaNAC69 enhanced salt stress and drought tolerance in wheat (Xue et al. 2011 ). Wheat varieties with enhanced NUE and more productivity can be developed using TaNAC2-5A due to its capability to impact nitrate signaling and resource allocation to a considerable extent. Previous studies suggest that the overexpression of a transcription factor TaNAC2-5A could increase nitrogen acquisition and assimilation which would lead to an increase in plant vigor as well as yield potential. These findings are promising in combating the environmental challenges that are faced due to regions with fragile agricultural ecosystems, for instance salinity, drought, and nutrient depletion. The focus of this research was on developing transgenic wheat that can utilize and uptake more nitrogen by overexpressing TaNAC2-5A transcription factor in wheat varieties grown in Punjab, Pakistan. Utilizing genetic and molecular technologies including gene cassette construction, Agrobacterium -mediated transformation and qRT-PCR based expression analysis, we were able to develop and test these transgenic wheat varieties in field conditions. Due to nitrogen inefficiency being one of the challenges this study focuses on increasing crop yield efficiency while also promoting sustainable agriculture and food security in wheat-dependent regions. Materials and Methods Plant material The wheat cultivars utilized in this study include FSD-2008 (code no. V-04189) and Galaxy-2013 (code no. V-07096). These approved varieties were transformed with TaNAC2-5A genetic construct to obtain transgenics overexpressing the transcription factor. Wheat seeds were obtained from Ayub Agricultural Research Institute (AARI), Faisalabad, Pakistan and then sown in the fields of Forman Christian College (A Chartered University), Lahore, Pakistan to obtain the donor material on which tissue culture was performed. For the wheat transformation experiments, immature embryos were harvested 15 days after anthesis. Selection of Transformation vector Vector pSB219 was obtained from the Leibniz Institute of Plant Genetics and Crop Plant Research IPK, Germany and was modified for use in this study. The green fluorescent protein (GFP) cassette in the original pSB219 vector was replaced with 177 bp linker containing rare-cutting endonuclease recognition sites for the construction of the multiple cloning site (MCS) (Figure S1 ). The 2X35S promoter was also inserted between the Hin dIII and Sgr D1 sites while 35S CaMV terminator was cloned using the Swa I and Asc I restriction sites. The modified plasmid was named pSB219M-PT. In addition, pSB219 also contained a bar gene selection marker regulated by a maize ubiquitin promoter and 35S terminator. The bar gene makes cells resistant to herbicide Phosphinothricin (BASTA), which was used for the selection of the putative transgenics. The transgenic selection was further combined with the BASTA leaf paint assays in the field to check for herbicide resistance. Primer designing and synthesis The TaNAC2-5A gene belongs to the NAC family of transcription factors in wheat, which are known for their role in stress responses and developmental processes. The coding sequence of TaNAC2-5A , spanning 990 bp, was retrieved from the NCBI database (accession number: AY625683.1). The gene was commercially synthesized by Eurofins MWG Operon (USA) and was delivered into the pUC57 vector. Composite primers were designed to amplify TaNAC2-5A with Sgr D1 and Swa I restriction sites at the start and end of the sequence, respectively. A ribosome-binding site specific for monocots (GCC) was incorporated into the forward primer. Primer properties, including GC content, length, and melting temperature (T m ), were optimized using the OligoCalc tool ( http://bio.tools.nubic.northwestern.edu/OligoCalc.html ). Similarly, primers for transgene screening were designed using a bar gene selection cassette (Table 1 , Figure S3). NCBI Primer BLAST ( https://www.ncbi.nlm.nih.gov/tools/primer-blast/ ) was used to design primers for qRT-PCR analysis. Primers were selected based on low self-complementarity and a T m range of 58–62°C, with a maximum T m difference of ± 2°C between primer pairs. Three primer pairs were designed to amplify TaNAC2-5A for qRT-PCR, which produced amplicons ranging from 274 to 287 bp. For template equalization and internal controls, primers were designed for the wheat 18S rRNA and α-tubulin genes, with amplicon sizes of 113 bp and 250 bp, respectively (Table 2 ). These primers were synthesized by the Eurofins MWG Operon (USA). Table 1 Primer sequences used in the study for the cassette construction and transgene screening Sr. No. Primer Name Primer Sequence (5’ to 3’) Product Size (bp) 1 2X35SF CCGAAGCTTACTCCAAAAATGTCAAAGATACAGTC 671 2 2X35SR TTACGTCGACGCCCTTACGTCAGTGGAGATGT 3 CMVTRF GGCATTTAAATGCTGAAATCACCAGTCTCTCTCTAC 750 4 CMVTRR AATGGCGCGCCGCATGCTCCGGTGTGAGGGAACT 5 NAC2F TCACGTCGACGGCCATGGGGATGCCGGCCGTGA 990 6 NAC2R AGTATTTAAATTTAGAACGGGGCCGGCATG 7 UbiF1 ACGGCACGGCATCTCTGTC 520 8 UbintR1 CACTGGCAAGTTAGCAATCAGAAC 9 UbiF2 GACACCAACCAGCGAACCAG 1000 10 BastR2 TGACCGTGCTTGTCTCGATGTAG Table 2 Primer sequences used in qRT-PCR analysis Sr. No. Primer Name Primer Sequence (5’ to 3’) Product Size (bp) 1 NACqRTF1 GCTACTGGAAGGCCACCG 274 2 NACqRTR1 GTCTCCTCTTCCCCTTGCTG 3 NACqRTF2 GGCAACGGCTACTGGAAGG 286 4 NACqRTR2 TCATCGTCTCCTCTTCCCCT 5 NACqRTF3 CGGCAACGGCTACTGGAA 287 6 NACqRTR3 AAGGGGAAGAGGAGACGATGA 7 18SRTF2 ATGATAACTCGACGGATCG 251 8 18SRTR1 GACACTAATGCGCCCGGTAT 9 AlphaTubF TTCGCCCGTGGTCATTACA 113 10 AlphaTubR1 CGTTGAAGACAAGGAATCCC 11 AlphaTubR2 AGGACACTGTTGTATGGCTC Plasmid construction and bacterial transformation The TaNAC2-5A gene was cloned into the plant transformation vector pSB219M-PT by using the Sgr D1 and Swa I restriction sites. The Sgr D1 and Swa I restriction enzymes were used to digest the gene and the vector, followed by ligation reaction using the T4 DNA Ligase. Electrocompetent cells of E. coli , Top10 strain were transformed with the ligation mixture. The clones were screened using both PCR and restriction digestion as indicated in Table S1 and S2. Full-length gene specific primers indicated in Table 1 were used in the PCR reaction and PCR products were analyzed on 1% agarose gel. DNA sequencing (Eurofins MWG Operon, USA) was also employed later to check the orientation and integrity of the gene and Chromas Lite Software was used for the analysis of the sequencing data. After verification, the pSB219-NAC2 construct was co-transformed with helper plasmid pAL154 (tetracycline resistant) into AGL1 strain of Agrobacterium tumefaciens using electroporation. The transformed cells were incubated on LB agar containing spectinomycin (100 µg mL − 1 ), tetracycline (5 µg mL − 1 ) and rifampicin (50 µg mL − 1 ). PCR screening was performed by targeting the bar gene cassette to confirm positive transformants. Transient expression analysis in Nicotiana tabacum Nicotiana tabacum (L. cv. Samsun-NN) seeds were obtained from National Institute of Biotechnology and Genetic Engineering (NIBGE), Faisalabad, Pakistan. The seeds were placed in growth chambers at (26 ± 1°C) under direct white light and later sown into a soil matrix of peat, fumas and cocoa peat in the ratio of 3:1:1. Hoagland Solution was administered every week and two weeks old plantlets were transferred into pots (Hoagland et al. 1950). Plants of 4–6 weeks were used for agroinfiltrations using protocol described by Norkunas et al. ( 2018 ). Fresh cultures of A. tumefaciens (AGL1) containing pSB219-NAC2 were inoculated in LB broth having 100 µg mL − 1 spectinomycin, 5 µg mL − 1 tetracycline, and 50 µg mL − 1 rifampicin. These cultures were grown for 48 hours at 28°C followed by centrifugation at high speed after being supplemented with 10 mM MES (pH 5.6) and 100 µM acetosyringone. The bacterial cells pellet was resuspended in infiltration buffer consisting of 10 mM MgCl 2 , 10 mM MES and 100 µM acetosyringone, to the OD 600 of 0.8 to 1. With the aid of a needleless syringe, the abaxial side of the leaf was injected and placed in an environment of low light, 25 ± 1°C and high humidity for 48 to 72 hours (Fig. 1 ). Leaf samples were collected at 72 h after infiltration. Total RNA was extracted using Plant RNA Purification Reagent (Invitrogen, Cat#12322-012). RNA quality was verified on 1% agarose gel, and cDNA synthesis was performed using the RevertAid H Minus First-Strand cDNA Synthesis Kit (Thermo Scientific, USA) according to the manufacturer’s instructions. Wheat tissue culture The protocol for wheat tissue culture outlined by Abid et al. ( 2014 ) was adapted. Immature embryos were harvested on 15 days post-anthesis, sterilized, and plated onto Murashige and Skoog (MS) callus induction medium (CIM) containing 2,4-D (10 µg mL − 1 ). AGL1 cultures containing plasmid pSB219-NAC2 were revived and grown to an OD 600 0.4–0.5. Twenty-one days old wheat calli were infected with Agrobacterium cultures and co-cultivated on medium supplemented with acetosyringone (400 µM). The infected calli were then placed on CIM supplemented with Rocephin (100 µg mL − 1 ) for about 3 weeks. In the presence of the light at 24 ± 1°C, the calli were placed on MS regeneration medium containing kinetin (1 mg mL − 1 ). The putative transgenic plantlets were selected on the MS medium supplemented with BASTA (2 mg L − 1 , followed by 3 mg L − 1 ), then transferred to artificial soil for stabilization. PCR screening on the acclimatized plants was performed and mature plant spikes were harvested as T 0 generation and seeds were referred to as T 1 . PCR-based Transgene Screening The T-DNA introduced into the wheat via Agrobacterium containing the pSB219-NAC2 vector contains both TaNAC2-5A and bar gene cassettes which can be used for screening transgenic plants. The CTAB method of total genomic DNA extraction was used to extract genetic material from T 0 , T 1 and T 2 transgenic wheat (Murray and Thompson 1980 ). Screening of T 0 and T 1 transgenic plants was conducted using primers specific to maize ubiquitin promoter: bar gene: t35S terminator in pSB219-NAC2 vector. UbiF1/UbintR1 primer pair was used to screen T 1 transgenic plants giving 520 bp fragments. For T 2 transgenics, Ubi- bar specific primers (UbiF2/BastR2) were used to amplify the fragment of 1 Kb (Table 1 ). Negative controls containing genomic DNA from non-transgenic wild wheat plants were used to confirm the absence of any transgenes, while plasmid DNA of pSB219-NAC2 vector was used as positive control to ensure the amplicon size and PCR conditions. Table 1 shows primer sequences used for transgene screening, while PCR reagent compositions and profiles are listed in Table S2a and S2b. BASTA leaf paint assay T 1 plants of 4-week-old were subjected to BASTA leaf paint following Akhtar et al. ( 2020 ). Approximately 6 cm of the leaflets were painted with a concentration of 0.005% (w/v) of phosphinothricin solution. Non-transgenic control plants were also treated with herbicide and the results were noted 7 to 10 days after herbicide application. Plants showing BASTA resistance were considered as putative transgenics. Expression analysis of transgenics The expression analysis of TaNAC2-5A in T 2 wheat transgenic lines was done by quantitative real-time PCR (qRT-PCR). Young leaves of PCR positive T 2 plants and non-transgenic wild type controls (FSD-2008 and Galaxy) were utilized for RNA extraction using Plant RNA Purification Reagent (Invitrogen, Cat#12322-012). Total RNA was quantified on a 1% agarose gel prior to cDNA synthesis (Figure S4). RevertAid H Minus First Strand cDNA Synthesis Kit (Thermo Scientific) was used to synthesize cDNA following manufacturer’s instructions. All primer pairs selected for TaNAC2-5A expression analysis by qRT-PCR were validated for specificity and efficiency > 90%, and qRT-PCR was done using the selected primer pairs (Table S3) for expression analysis of the TaNAC2-5A gene. To ensure accuracy of results, the α-tubulin gene was used as an internal standard. qRT-PCR was done using the BlasTaq 2X qPCR Master Mix (Cat # G892; abm, Canada) in Bio-Rad CFX96 Real Time PCR system. The acquired data were analyzed using the ΔΔCt method (Livak and Schmittgen 2001 ). Table S4 and S5 show the composition of the qRT-PCR reaction mixture and the PCR profile. Agronomic trait analysis The morphology and growth of T 1 and T 2 transgenics were evaluated in the field experiments conducted in Forman Christian College (A Chartered University), Lahore, Pakistan. Randomized complete block design (RCBD) was used to confirm that the genetic modification was the only reason for their differences in agronomic traits. Traits such as plant height (cm), number of spikes per plant, weight of 1000 grains (g) and grain yield per plant were measured and compared with the non-transgenic controls FSD-2008 and Galaxy. T 2 seeds obtained from T 1 plants were subjected to further expression studies and seed multiplication. Collection of field data and their subsequent analysis were carried out to reduce possible bias of the results. Biochemical analysis Estimation of chlorophyll content Measurement of chlorophyll content can provide a useful insight into the photosynthetic potential of transgenic plants. It signifies the efficiency with which a plant can enhance carbon gain and biomass. Measurement of chlorophyll in leaf extracts of TaNAC2-5A transgenic wheat lines and wild-type control plants was done as described by Arnon ( 1949 ). Fresh leaf tissues (0.2 g) were ground in 10 mL of 80% acetone. The mixture was then centrifuged for 10 minutes at 2500 rpm and the supernatant volume was adjusted to 10 mL with 80% acetone. Absorbance at 645 and 663 nm was recorded for the three sets (three independent replicates) of each. Each sample’s total chlorophyll content was determined using the formula shown below: Total Chlorophyll (mg g − 1 fresh weight) = 20.2 (OD645) – 8.02 (OD663) x W x V ÷ 1000 Estimation of total protein content Estimation of total protein content in transgenic plants is very important as it indicates the overall metabolic rate, nitrogen contents incorporation and physiological characteristics on transgenic versus control plants. To determine the protein concentration of transgenic lines and wild type (non-transgenic) controls, Bradford method (Bradford, 1976 ) was utilized. Fresh leaf tissues (0.2 g) were homogenized in phosphate buffer followed by centrifugation at 5000 rpm for 10 minutes. Coomassie blue reagent was used to mix the supernatant followed by incubation for 5 minutes. Absorbance was taken at 595 nm for three replicates for the wild-type control as well as the transgenic samples. Protein concentrations were determined using Bovine Serum Albumin (BSA) as the standard (Figure S7). Estimation of total soluble sugars Evaluation of total soluble sugars content in transgenic plants is imperative since it determines photosynthetic efficiency, carbohydrate metabolism, and energy storage. These are essential parameters in assessing the effect of genetic modifications on plant growth, stress tolerance, and productivity. Total sugar content in the soluble form was evaluated in relation to the transgenic and the control plants. The procedure described by Malik and Srivastava ( 1982 ) was employed. The dry leaf materials were homogenized in 2 mL of 80% acetone followed by incubation in a shaker for 24 hours at 37 o C. The samples were then centrifuged at 2900×g and the supernatant were mixed with 5 mL of Anthrone reagent. The absorbance was recorded at 625 nm and the amount of sugar content was assessed through D-glucose standard. Root architecture analysis The root architecture of transgenic lines expressing TaNAC2-5A was analyzed. T 2 seeds from the transgenic and control lines were germinated on damp filter paper for five days. Seedlings were transferred to containers containing 15 L of Hoagland’s nutrient solution in a climate-controlled room at 18 ± 1°C. The nutrient solution was refreshed biweekly, and the roots were aerated using air pumps. After five weeks, PCR-positive transgenic plants were identified. Roots were separated, rinsed with distilled water, stained with methyl violet (0.1 g L − 1 ) for one minute, and scanned on a gray–white scale. Root characteristics, including length (cm), surface area (cm²), volume (cm³), average diameter (mm), and projected area (cm²), were analyzed using Epson WhinRhizo software. Statistical analysis All statistical analyses were performed using SPSS (version 25.0) and the Agricolae package in R (version 4.4.2) for the randomized complete block design (RCBD) during field analysis of agronomic traits in transgenic lines. Three independent replicates were used for each treatment. The normality of the data was assessed using the Shapiro-Wilk test, while Levene’s test was used to evaluate the homogeneity of variances. A one-way analysis of variance (ANOVA) was conducted to compare group means. When equal variances were assumed, Dunnett’s test was applied for multiple comparisons, whereas the Games-Howell test was used when variances were not equal. Significance levels were indicated as follows: p ≤ 0.05 (single asterisk *), p ≤ 0.01 (double asterisks **), and p ≤ 0.001 (triple asterisks ***), reflecting increasing levels of confidence in the results, with p > 0.05 represented as “ns” denoting non-significant differences. Results Verification of TaNAC2-5A in pSB219M-PT The incorporation of TaNAC2-5A into the pSB219M-PT vector was confirmed by PCR-based, restriction digestion-based verification, and DNA sequencing analysis. Plasmids isolated from individual colonies were subjected to PCR amplification using full-length gene-specific primers (NAC2F/NAC2R), resulting in a 990 bp product corresponding to the complete TaNAC2-5A gene (Fig. 2 ). Further validation was performed through restriction digestion analysis using Sgr DI and Swa I enzymes, which released a 990 bp gene fragment along with an 11.5 Kb vector backbone (Fig. 3 a). Hin DIII and Asc I digestion confirmed the integration of the complete TaNAC2-5A cassette (~ 2.4 kb), comprising the 2X35S promoter, TaNAC2-5A gene, and CaMV terminator (Fig. 3 b, S2a and S2b). Sequencing was performed to verify the integrity and orientation of the genes. Chromas Lite software was used to analyze the sequencing data, and ClustalW was used for sequence alignment. The results confirmed that the cloned TaNAC2-5A gene sequence matched the original sequence with no base mutations. Transient expression analysis in Nicotiana tabacum The functionality of the TaNAC2-5A cassette was evaluated by transient expression in N. tabacum . The transformed AGL1 cultures containing the pSB219-NAC2 vector were used to infiltrate the tobacco leaves. The tobacco leaves were used after 72 hours to extract total RNA that was digested with DNase 1 to remove the DNA. The RT-PCR showed that TaNAC2-5A transcripts were detected by a 279 bp amplicon product (Fig. 4 ). This confirmed that the gene cassette was functional and expressing in the model plant. Wheat transformation To transform the embryos with pSB219-NAC2 cassette, a total of 2500 immature embryos were excised from each variety FSD-2008 and Galaxy. Of these, infection with FSD-2008 was successful in 1350, and with Galaxy, in 1300 embryos. Following the infection 1150 calli of FSD-2008 and 1220 calli of Galaxy were transferred to Murashige and Skoog (MS) medium containing Rocephin (100 mg mL − 1 ) to control overgrowth of Agrobacterium . Afterwards, 1020 calli of FSD-2008 and 873 calli of Galaxy were able to regenerate on MS medium containing kinetin 1 mg mL − 1 . The 274 plantlets were obtained from FSD-2008 and 290 plantlets from Galaxy at a BASTA concentration of 3mg L − 1 . Fifty-six plantlets were transferred to artificial soil for hardening of FSD-2008 putative transformants, while seventy-five were from Galaxy transformations. A total of three transgenic plantlets of FSD-2008 and four of Galaxy were able to survive the final selection before further evaluation (Table S6). Transgene screening Genomic DNA was extracted from the T 0 , T 1 and T 2 putative transgenic wheat plants carrying the TaNAC2-5A gene, as well as from non-transgenic controls. PCR-based screening of T 1 transgenics was performed using maize ubiquitin promoter::ubiquitin intron specific primers (UbiF1/ UbintR1) giving an amplification product of 520 bp (Fig. 5 ). However, T 2 transgenics were screened using primers specific to the ubiquitin promoter :: bar gene junction (UbiF2/BastR2) and CaMV terminator-specific primers (Table 1 ). The PCR reaction produced an expected 1 Kb Ubi- bar fragment, which confirmed the presence of the transgene in the putative transgenic plants (Fig. 6 ). Seven transgenic events were obtained and named as NAC2-1, NAC2-2, NAC2-3, NAC2-4, NAC2-5, NAC2-6, and NAC2-7. Of these, three events (NAC2-4, NAC2-6, and NAC2-7) originated from the FSD-2008 parent line, while four events (NAC2-1, NAC2-2, NAC2-3, and NAC2-5) were derived from the Galaxy parent line. In T 1 screenings, only three events, NAC2-1, NAC2-2 (Galaxy) and NAC2-4 (FSD-2008) tested positive. Table S6 and Fig. 5 show the positive T 1 transgenic lines obtained from these three events, where lines L2, L3, and L4 in NAC2-1 (Galaxy), lines L1 and L2 in NAC2-2 (Galaxy), and lines L1, L4, L5, L6, L7, and L8 in NAC2-4 (FSD-2008) were confirmed as PCR-positive (Fig. 5 ). The seeds from these lines were then collected for propagation and T 2 screening, including expression studies, agronomic trait evaluations, and biochemical assays. BASTA leaf paint assay The BASTA leaf paint assay confirmed the resistance of the putative TaNAC2-5A transgenic wheat plants to the herbicide phosphinothricin. Six-week-old transgenic plants were painted with a 0.005% w/v solution of BASTA, targeting a 4 cm area of the leaf. Observations recorded after 7–10 d revealed that transgenic plants leave remained green with slight brown lesions on the painted areas, indicating successful integration and expression of the bar gene, which confers herbicide resistance. In contrast, the non-transgenic control plants, Galaxy and FSD-2008, showed complete browning of the painted leaf area, signifying the absence of the bar gene and a lack of resistance to BASTA (Fig. 7 a and 7 b). The plants that survived the BASTA assay were subsequently validated as true transgenics through PCR-based screening, targeting the Ubi-bar junction primers. Expression analysis of TaNAC2-5A in wheat transgenics Primer validation for qRT-PCR For qRT-PCR analysis of TaNAC2-5A transgenics, three primer pairs were designed to generate nine unique combinations (Tables 2 and S3). These combinations were validated using pooled cDNA synthesized from the total RNA extracted from different TaNAC2-5A transgenic wheat lines. All nine primer combinations were tested under standard PCR conditions and the amplification products were analyzed on an agarose gel. Strong amplification bands with negligible primer dimer formation and no non-specific amplification were identified (Fig. 8 a). RT-PCR was repeated to confirm the reliability of the primers and to eliminate false positives (Fig. 8 b). Based on the consistent performance, primer pair 4 (NAC2qRTF2/NAC2qRTR1) was selected for further qRT-PCR studies. This pair demonstrated robust amplification with minimal background noise, ensuring the accurate and reproducible quantification of TaNAC2-5A gene expression in transgenic wheat lines. TaNAC2-5A expression analysis by qRT-PCR The relative expression levels of TaNAC2-5A in transgenic wheat lines were analyzed using qRT-PCR with the ΔΔCT method. The amplification results for the selected transgenic lines are shown in Fig. 9 and the expression data are summarized in Table 3 . The cDNA samples for each transgenic line were run in four replicates to ensure accuracy and reliability. The analysis revealed varying levels of TaNAC2-5A expression across different transgenic events. The relative fold increases were as follows: NAC2-1(L2) 0.99, NAC2-4(L5) 0.87, NAC2-4(L6) 2.25, NAC2-2(L1) 1.68, and NAC2-4(L7), 1.41. Among these, the NAC2-4(L6) transgenic line (parent FSD-2008) exhibited the highest relative expression level, with a fold increase of 2.25, indicating successful overexpression of the TaNAC2-5A gene. The earlier Ct values observed for NAC2-4(L6) highlight enhanced gene expression compared with the other transgenic lines. This variation in expression levels among the lines emphasizes the influence of transgene integration sites or other regulatory factors on transgene expression. Table 3 Relative fold increase of the TaNAC2-5A gene in different transgenic wheat lines Plant Lines Relative Fold Increase Galaxy 0.0 FSD-2008 0.0 NAC2-1(L2) 0.99 NAC2-4(L5) 0.87 NAC2-4(L6) 2.25 NAC2-2(L1) 1.68 NAC2-4(L7) 1.41 Agronomic trait analysis The agronomic performance of T 1 and T 2 TaNAC2-5A transgenic wheat lines was assessed and compared with that of the parent lines FSD-2008 and Galaxy. Key agronomic parameters, including plant height (cm), spike length, tiller number, grain number, and 1000-grain weight (g), were recorded for each transgenic plant separately. In T 1 transgenics, 5–8% increase in grain weight was observed in three transgenic events. Among the T 2 transgenic lines from NAC2-4 transgenic event, NAC2-4(L6) exhibited a significant 17% increase in 1000-grain weight compared with the parent line FSD-2008 (Table 4 a and b). This improvement highlights the positive impact of TaNAC2-5A overexpression on the grain yield potential. To facilitate further studies and seed multiplication, T 2 seeds from TaNAC2-5A transgenics were collected and stored in labeled brown envelopes, each indicating an independent event. A small quantity of Boric acid was added in the envelopes to protect the seeds from wheat weevil attack and enhance seed longevity. Table 4 a Analysis of agronomic traits in TaNAC2-5A harboring T 1 wheat transgenic lines Transgenic Events Plant Height (cm) No. of Tillers/ Spikes per plant Average Spike Length (cm) Total No. of Grains 1000 Grain Weight (g) % Increase in Grain Weight FSD-2008 (Control) 81.15 ± 1.3 22 ± 0.6 10.4 ± 0.9 790 ± 1.6 32.2 ± 0.4 Galaxy (Control) 82 ± 2.1 19 ± 0.9 10.2 ± 0.3 810 ± 2.1 31 ± 0.6 NAC2-1 86 ± 1.9 † 25 ± 1.3 *** 12.5 ± 1.05 * 1060.8 ± 1.2 †† 32.7 ± 0.25 ** 5.48 NAC2-2 89 ± 3 ** 21 ± 2 ns 11.8 ± 0.77 * 977.5 ± 2.6 ns 33.35 ± 0.15 * 7.58 NAC2-4 82.5 ± 2.09 ns 27 ± 1.6 †† 11.6 ± 0.29 * 1156.5 ± 1.9 * 34.8 ± 0.15 * 8.07 Table 4 b Analysis of agronomic traits in TaNAC2-5A harboring T 2 wheat transgenics Transgenic Events Plant Height (cm) No. of Tillers/ Spikes per plant Average Spike Length (cm) Total No. of Grains 1000 Grain Weight (g) % Increase in Grain Weight FSD-2008 (Control) 83.82 ± 0.5 24 ± 2.0 10.6 ± 0.16 860.2 ± 3.0 32 ± 0.33 Galaxy (Control) 82.2 ± 0.5 21 ± 1.6 9.6 ± 0.60 910.2 ± 2.0 30 ± 0.9 NAC2-4(L6) 85 ± 1.2 * 45 ± 3.0 *** 13 ± 0.9 * 1560.8 ± 2.0 * 37.5 ± 0.6 ** 17.18 NAC2-4(L7) 88 ± 0.90 †† 43 ± 2.2 * 12.8 ± 1.9 † 1650.5 ± 3.2 ** 35.9 ± 0.9 * 12 NAC2-4(L5) 86.5 ± 1.6 ns 37 ± 1.2 * 11 ± 0.9 * 1360.5 ± 2.0 ** 35.2 ± 0.3 † 10 NAC2-2(L1) 84 ± 1.6 * 33 ± 1.6 † 10.5 ± 0.6 * 1450.5 ± 0.9 ** 33.2 ± 0.9 ns 10.6 Data in Table 4 a and 4 b are represented as the mean values ± standard error (SE) of three biological replicates. Statistical significance was determined using either Dunnett’s test or Games-Howell post-hoc test, depending on the homogeneity of variances as measured by Levene’s test. Asterisks (*, **, ***) indicate significance levels obtained through Dunnett’s test (*p-value ≤ 0.05, ** p-value ≤ 0.01, *** p-value ≤ 0.001), while daggers (†, ††) indicate significance based on Games-Howell test (†p-value ≤ 0.05, ††p-value ≤ 0.01). “ns” indicates non-significant differences compared to the control (p > 0.05). Biochemical assays Estimation of total chlorophyll content The total chlorophyll content of TaNAC2-5A T 2 transgenic wheat lines was significantly higher than that of the parent controls (FSD-2008 and Galaxy), which measured 86.34 mg g − 1 FW and 84.34 mg g − 1 FW, respectively. The chlorophyll content for the transgenic lines was as follows: NAC2-1(L2) (parent var. Galaxy) at 85.18 mg g − 1 FW, NAC2-4(L5) (parent var. FSD-2008) at 88.81 mg g − 1 FW, NAC2-4(L6) (parent var. FSD-2008) at 90.11 mg g − 1 FW, NAC2-4(L7) (parent var. FSD-2008) at 89.25 mg g − 1 FW, and NAC2-2(L1) (parent var. Galaxy) at 90.93 mg g − 1 FW. These results indicate a notable enhancement in the total chlorophyll content among the TaNAC2-5A transgenic lines compared to the controls, reflecting improved physiological traits associated with photosynthesis (Fig. 10 ). Estimation of total soluble sugars Soluble sugars were determined in four-week-old leaves of the TaNAC2-5A T 2 transgenic wheat lines. The soluble sugar content for the transgenic lines was as follows: NAC2-1(L2) (parent var. Galaxy) at 9.2 mg g -1 FW, NAC2-4(L5) (parent var. FSD-2008) at 11.2 mg g -1 FW, NAC2-4(L6) (parent var. FSD-2008) at 12.04 mg g -1 FW, NAC2-4(L7) (parent var. FSD-2008) at 9.93 mg g -1 FW, and NAC2-2(L1) (parent var. Galaxy) at 10.09 mg g -1 FW. These values were compared to the parent controls, Galaxy and FSD-2008, which showed soluble sugar contents of 8.07 mg g -1 FW and 8.11 mg g -1 FW, respectively. The results highlight a notable enhancement in the total soluble sugar content among the TaNAC2-5A transgenic lines compared to the wild-type controls (Fig. 11 ). Estimation of total proteins The total protein content of the TaNAC2-5A T 2 transgenic wheat lines was estimated using the BSA standard curve. The Galaxy control exhibited a protein content of 12.07 mg g -1 FW. In comparison, the TaNAC2-5A transgenic lines demonstrated the following protein contents: NAC2-1(L2) (parent var. Galaxy) at 18.2 mg g -1 FW, NAC2-4(L5) (parent var. FSD-2008) at 14.04 mg g -1 FW, NAC2-4(L6) (parent var. FSD-2008) at 14.04 mg g -1 FW, NAC2-2(L1) (parent var. Galaxy) at 12.3 mg g -1 FW, and NAC2-4(L7) (parent var. FSD-2008) at 17.1 mg g -1 FW. These results indicated a significant increase in protein content among the transgenic lines compared to the control (Fig. 12 ). Root architectural analysis Root analysis of the TaNAC2-5A T 2 transgenic lines was conducted using WhinRhizo software. The data in Table S7 highlights that the roots of TaNAC2-5A transgenic lines NAC2-4(L6), NAC2-4(L7) and NAC2-4(L5), selected from the NAC2-4 transgenic event, exhibited significantly improved characteristics compared to the FSD-2008 control. These transgenics demonstrated longer roots with enhanced lateral projections, greater average root diameter, and increased volume, surface area, and projected area (Fig. 13 , Table S7). These improved root traits indicate the potential of TaNAC2-5A to enhance root structure and nutrient uptake efficiency in wheat plants. Discussion Wheat is a staple crop that fulfills the nutritional needs of people all over the globe. The changing climatic conditions and increasing population make it critical to increase wheat production for fulfilling the caloric requirements of people. It is predicted that with every 1 o C rice in temperature wheat yield decreases by 4–8% (Shew et al. 2020 ). In order to meet the rising demand for wheat, the land area under wheat cultivation has been expanded in recent years in Pakistan. According to data from the USDA Foreign Agricultural Service (FAS-USDA Report, 10 October, 2024), Pakistan’s wheat-sown area fluctuated from 8,678 thousand hectares in 2019/2020 to 9,600 thousand hectares in 2024/2025, reflecting an effort to increase supply by opening more farmland for wheat cultivation. However, simply expanding cultivation area and relying on excessive fertilizer use to boost yields, is neither sustainable nor sufficient, especially amid climate extremes and limited arable land. There is a need to develop climate-smart wheat varieties through advanced breeding or transgenic technologies that offers a more viable path to sustain or even increase yields (Azhar et al. 2024 ; Grosse-Heilmann et al. 2024 ). By focusing on more efficient gene expression and regulation, wheat plants can better withstand adverse climatic conditions, optimize resource use, and help ensure global food security without placing further strain on land resources (Challinor et al. 2014 ; Li et al. 2023 ). Transcription factors (TFs) are essential for the efficient transcription of gene cascades (Yanagisawa, 1998 ). In plants, TFs influence numerous genetic pathways and reside in specific genomic regions, such as quantitative trait loci (QTLs) and other regulatory domains (Ernst et al. 2004 ; Olsen et al. 2005 ). It is possible to mitigate plant stresses by targeting TFs involved in particular pathway. In this study, we aimed to develop wheat transgenics overexpressing the TaNAC2-5A TF. This TF is involved in controlling the nitrate regulatory pathway, thereby enhancing nutrient utilization from soil, yield, and climate resilience. Nitrates serve as both an organic nutrient and an essential signaling molecule for plants. He et al. ( 2015 ) indicated that the TaNAC2-5A is essential for the expression of nitrate-responsive genes in wheat. These findings suggested that TaNAC2-5A is an important modulator in the processes of nitrogen assimilation and its uptake which are both important for enhancing crop yield and nutrient efficiency of crops. To achieve this, we first designed and verified an expression cassette harboring TaNAC2-5A gene and then transformed those cassettes in two widely cultivated wheat varieties of Pakistan, FSD-2008 and Galaxy. Prior to introducing the expression cassette into wheat varieties, the gene cassettes were validated for TF transient expression in N. tabacum . RT-PCR analysis detected a 279 bp fragment of the TaNAC2-5A gene, confirming the cassette’s functionality in plant cells (Fig. 4 ). The transformation efficiencies in the FSD-2008 and Galaxy wheat lines were low, yielding only seven transgenic events in FSD-2008 and four in Galaxy. T 1 seeds from each event were subsequently collected and cultivated in open fields at Forman Christian College, Lahore, following RCBD to produce T 2 seeds. Table S6 and Fig. 5 detail these independent events alongside the PCR-positive lines obtained from each. Transgenic lines L2, L3 and L4 from transgenic event NAC2-1 (parent var. Galaxy), lines L1 and L2 from transgenic event NAC2-2 (parent var. Galaxy), and lines L1, L4, L5, L6, L7 and L8 from transgenic event NAC2-4 (parent var. FSD-2008) were PCR positive. To ensure reliability, the PCR screens were performed with multiple primer sets, and the lines consistently found positive for the TF were used for expression analysis, biochemical assays, and root evaluation. Each PCR run included negative controls from non-transgenic (wild-type) plants and positive controls using the pSB219-NAC2 plasmid to ensure the specificity and reproducibility of the PCR results. The agronomic evaluation of T 1 wheat transgenics overexpressing the TaNAC2-5A gene revealed significant improvements in number of tillers per plant, and grain yield per plant compared to the non-transgenic controls, FSD-2008 and Galaxy (Table 4 a). Plant height was slightly increased in the transgenic events NAC2-1 (86 cm) and NAC2-2 (89 cm) compared to FSD-2008 (81.15 cm) and Galaxy (82 cm). This enhanced vegetative growth reflects the overall vigor conferred by the overexpression of TaNAC2-5A . However, an increase in height can pose challenges in regions prone to strong winds, as taller plants are more susceptible to lodging, where plants bend or break under their own weight or external forces, leading to potential yield losses. NAC2-4 (82.5 cm), which exhibited a height comparable to the control FSD-2008, may offer a more stable phenotype in wind-prone environments. The number of tillers per plant, a key determinant of grain yield, showed substantial improvement across all transgenic lines. NAC2-4 (parent var. FSD-2008) demonstrated the highest number of tillers (27), significantly outperforming FSD-2008 (22). NAC2-1 also showed a marked increase of 25 tillers, while the tiller count for NAC2-2 was 21 compared to the Galaxy parent that had tiller count of 19. This increase in tiller number correlates directly with higher grain production per plant, highlighting the transgenics potential for increased productivity. A key highlight in agronomic trait analysis of T 1 transgenic lines was the percent increase in grain yield per transgenic event, measured as the 1000-grain weight. NAC2-4 (parent var. FSD-2008) achieved the highest percent increase in grain weight, with an 8.07% improvement over the control. This was followed by NAC2-2 (parent var. Galaxy), with a 7.58% increase, and NAC2-1 (parent var. Galaxy), with a 5.48% increase. These results underline the efficiency of TaNAC2-5A in enhancing nutrient use efficiency and yield. After the T 1 generation, transgenic lines from two events (NAC2-4 derived from FSD-2008 and NAC2-2 derived from Galaxy) were selected on the basis of higher relative expression in comparison to other transgenic lines and controls for T 2 agronomic trait analysis. This strategic selection is critical for developing stable, high-yielding wheat varieties. The agronomic data in Table 4 b underscores significant improvements in tiller count and percent increase in grain yield in the T 2 generation of wheat transgenics overexpressing the TaNAC2-5A gene. The relative expression analysis of TaNAC2-5A in transgenic wheat lines (Fig. 8 and Table 3 ), measured using ΔΔCT in qRT-PCR, revealed significant variation in expression levels, which correlate directly with root architecture and agronomic traits, highlighting the influence of TaNAC2-5A on plant performance. In T 2 generation, the highest expression level, observed in the NAC2-4(L6) line (2.25-fold increase), corresponds with its improved root surface area (1531.771 cm²) and enhanced agronomic traits, including the production of 45 tillers per plant and a 17.18% increase in grain yield. These findings underscore the direct impact of high TaNAC2-5A expression on improving resource uptake and overall productivity. Similarly, NAC2-4(L7), which exhibited a 1.41-fold increase in expression, displayed the longest root length (46 cm) and a 12% grain yield increase, further linking moderate expression levels to improved root penetration and grain production. In contrast, NAC2-4(L5), with a lower expression level (0.87-fold increase), demonstrated significant improvements in root volume (7720.079 cm³) and agronomic traits such as 37 tillers per plant and a 10% increase in grain yield. This suggests that even moderate overexpression of TaNAC2-5A can enhance resource uptake and yield-related traits through improved root architecture (Table 4 b and S7). The variation in expression among lines, likely influenced by transgene integration sites or regulatory factors, reflects the direct relationship between gene expression, root structure, and agronomic traits. The biochemical assays conducted on the TaNAC2-5A T 2 transgenic wheat lines revealed notable improvements in key physiological parameters, which correlate with the enhanced agronomic traits observed in the best-performing transgenic lines. For example, the transgenic lines NAC2-4(L6) and NAC2-4(L7) exhibited significantly higher chlorophyll content (90.11 mg g − 1 FW and 89.25 mg g − 1 FW, respectively) compared to the parent control FSD-2008 (86.34 mg g − 1 FW). This increase in chlorophyll content reflects enhanced photosynthetic capacity, which supports the higher tiller count and grain yield observed in these lines. In addition, NAC2-4(L6), which showed the highest expression of TaNAC2-5A (2.25-fold increase), had the highest soluble sugar content (12.04 mg g − 1 FW), while NAC2-4(L7) also showed a significant increase in soluble sugars (9.93 mg g − 1 FW) compared to the control (FSD-2008: 8.11 mg g − 1 FW). Protein content was significantly higher in several transgenic lines, especially NAC2-4(L7) (17.1 mg g − 1 FW), compared to the controls (FSD-2008: 12.07 mg g − 1 FW) reinforcing the connection between enhanced sugar accumulation and higher protein levels to the improved biomass production and higher grain yield of these lines. The results indicate that the overexpression of TaNAC2-5A has a significant impact on both physiological processes, enhanced nutrient uptake from soil and overall crop performance. The transgenics overexpressing TaNAC2-5A exhibited considerable improvements in tiller number and grain yield per plant, making them highly promising candidates for addressing food security challenges. However, the increase in plant height, while reflective of greater vegetative vigor, may require careful consideration in breeding programs and selection of transgenic lines for future propagation to mitigate risks of lodging in regions with high wind exposure. The significant improvement in grain yield without a proportional increase in input requirements demonstrates the potential of these transgenics to contribute to sustainable agriculture. Conclusion In conclusion, this study demonstrates the successful overexpression of the TaNAC2-5A gene in wheat, resulting in significant improvements in grain yield in T 2 generation. The transgenic lines NAC2-4(L6) and NAC2-4(L7) from the FSD-2008 parent showed impressive increases in grain yield, with NAC2-4(L6) achieving a 17.18% improvement and NAC2-4(L7) exhibiting a 12% increase in 1000-grain weight. NAC2-2(L2) from the Galaxy parent also showed a 10.6% increase in grain yield compared to the wild-type control. The lines, NAC2-4(L6), NAC2-4(L7), and NAC2-2(L2) may be selected for the breeding programs to develop stable homozygous lines. These promising transgenic lines hold significant potential for improving wheat yield and contributing to food security challenges in Pakistan. Declarations Conflict of Interest The authors declare that they have no conflict of interest. Author Contribution The project conceptualization, fund acquisition and supervision of the experiments was done by A.B, all experiments were carried out by A.A, statistical analysis was done by A.A, A.K, and A.J, original manuscript and figures were prepared by A.A, manuscript was edited, proofread and approved by A.B and K.A.M. Acknowledgement We sincerely acknowledge the financial support provided by the Agricultural Linkages Program (ALP) of the Pakistan Agricultural Research Council (PARC) under Project Identification No. CS-407. References Abid N, Maqbool A, Malik KA (2014) Screening commercial wheat ( Triticum aestivum L.) varieties for Agrobacterium -mediated transformation ability. Pak J Agric Sci 51:83-89. Akhtar A, Rizvi Z, Irfan M, Maqbool A, Bashir A, Malik KA (2020) Biochemical and morphological risk assessment of transgenic wheat with enhanced iron and zinc bio accessibility. J Cereal Sci 91:102881. https://doi.org/10.1016/j.jcs.2019.102881 Aida M, Ishida T, Fukaki H, Fujisawa H, Tasaka M (1997) Genes involved in organ separation in Arabidopsis: an analysis of the cup-shaped cotyledon mutant. Plant Cell 9:841-857. https://doi.org/10.1105/tpc.9.6.841 Almagro A, Lin SH, Tsay YF (2008) Characterization of the Arabidopsis nitrate transporter NRT1.6 reveals a role of nitrate in early embryo development. Plant Cell 20:3289-3299. https://doi.org/10.1105/tpc.107.056788 Arnon DI (1949) Copper enzymes in isolated chloroplasts. Polyphenol oxidase in Beta vulgaris . Plant Physiol 24:1-15. https://doi.org/10.1104/pp.24.1.1 Azhar A, Ijaz S, Jabeen A, Kamal A, Bashir A, Malik KA (2024) The transcription factor TaNF-YB4 overexpression in wheat increases plant vigor and yield. Curr Plant Biol 40:100394 https://doi.org/10.1016/j.cpb.2024.100394 Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248-254. https://doi.org/10.1006/abio.1976.9999 Century K, Reuber TL, Ratcliffe OJ (2008) Regulating the regulators: the future prospects for transcription-factor-based agricultural biotechnology products. Plant Physiol 147:20-29. https://doi.org/10.1104/pp.108.117887 Challinor AJ, Watson J, Lobell DB, Howden SM, Smith DR, Chhetri N (2014) A meta-analysis of crop yield under climate change and adaptation. Nat Clim Change 4:287-291. http://dx.doi.org/10.1038/nclimate2153 Chiu CC, Lin CS, Hsia AP, Su RC, Lin HL, Tsay YF (2004) Mutation of a nitrate transporter, AtNRT1: 4, results in a reduced petiole nitrate content and altered leaf development. Plant Cell Physiol 45:1139-1148. https://doi.org/10.1093/pcp/pch143 Daniel-Vedele F, Filleur S, Caboche M (1998) Nitrate transport: a key step in nitrate assimilation. Curr Opin Plant Biol 1:235-239. https://doi.org/10.1016/s1369-5266(98)80110-6 Ernst HA, Olsen AN, Skriver K, Larsen S, Leggio LL (2004) Structure of the conserved domain of ANAC, a member of the NAC family of transcription factors. EMBO Rep 5:297-303. https://doi.org/10.1038/sj.embor.7400093 Good AG, Shrawat AK, Muench DG (2004) Can less yield more? Is reducing nutrient input into the environment compatible with maintaining crop production? Trends Plant Sci 9:597-605. https://doi.org/10.1016/j.tplants.2004.10.008 Grosse-Heilmann M, Cristiano E, Deidda R, Viola F (2024) Durum wheat productivity today and tomorrow: A review of influencing factors and climate change effects. Resour Environ Sustain 100170. https://doi.org/10.1016/j.resenv.2024.100170 He X, Qu B, Li W, Zhao X, Teng W, Ma Y, Tong Y (2015) The nitrate-inducible NAC transcription factor TaNAC2-5A controls nitrate response and increases wheat yield. Plant Physiol 169:1991-2005. https://doi.org/10.1104/pp.15.00568 Hoagland DR, Arnon DI (1950) The water-culture method for growing plants without soil. Circ- Calif Agric Exp Stn 347:2. Hodge A, Robinson D, Fitter A (2000) Are microorganisms more effective than plants at competing for nitrogen? Trends Plant Sci 5:304-308. https://doi.org/10.1016/s1360-1385(00)01656-3 Huang XQ, Röder MS (2004) Molecular mapping of powdery mildew resistance genes in wheat: a review. EUPHYTICA 137:203-223. http://dx.doi.org/10.1023/B:EUPH.0000041576.74566.d7 Huang NC, Liu KH, Lo HJ, Tsay YF (1999) Cloning and functional characterization of an Arabidopsis nitrate transporter gene that encodes a constitutive component of low-affinity uptake. Plant Cell 11:1381-1392. https://doi.org/10.1105/tpc.11.8.1381 Khan I, Zeb A (2007) Nutritional composition of Pakistani wheat varieties. J Zhejiang Univ Sci B 8:555-559. https://doi.org/10.1631/jzus.2007.b0555 Kim HS, Park BO, Yoo JH, Jung MS, Lee SM, Han HJ, Chung WS (2007) Identification of a calmodulin-binding NAC protein as a transcriptional repressor in Arabidopsis. J Biol Chem 282:36292-36302. https://doi.org/10.1074/jbc.m705217200 Li L, Han C, Yang J, Tian Z, Jiang R, Yang F, Yin J (2023) Comprehensive transcriptome analysis of responses during cold stress in wheat (Triticum aestivum L.). Genes 14:844. https://doi.org/10.3390/genes14040844 Li X, Tang Y, Zhou C, Zhang L, Lv J (2020) A wheat WRKY transcription factor TaWRKY46 enhances tolerance to osmotic stress in transgenic Arabidopsis plants. Int J Mol Sci 21:1321. https://doi.org/10.3390/ijms21041321 Lin SH, Kuo HF, Canivenc G, Lin CS, Lepetit M, Hsu PK et al (2008) Mutation of the Arabidopsis NRT1.5 nitrate transporter causes defective root-to-shoot nitrate transport. Plant Cell 20:2514-2528. https://doi.org/10.1105/tpc.108.060244 Liu Q, Qiu Y, Beta T (2010) Comparison of antioxidant activities of different colored wheat grains and analysis of phenolic compounds. J Agric Food Chem 58:9235-9241. https://doi.org/10.1021/jf101700s Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods 25:402–408. https://doi.org/10.1006/meth.2001.1262 Malik CP, Srivastava AK (1982) Text Book of Plant Physiology. Kalyani Publishers, New Delhi. Mao X, Chen S, Li A, Zhai C, Jing R (2014) Novel NAC transcription factor TaNAC67 confers enhanced multi-abiotic stress tolerances in Arabidopsis . PLoS ONE 9:1. https://doi.org/10.1371/journal.pone.0084359 Mondal S, Rutkoski JE, Velu G et al (2016) Harnessing diversity in wheat to enhance grain yield, climate resilience, disease and insect pest resistance, and nutrition through conventional and modern breeding approaches. Front Plant Sci 7:991. https://doi.org/10.3389/fpls.2016.00991 Murray MG, Thompson W (1980) Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res 8:4321-4326. https://doi.org/10.1093/nar/8.19.4321 Norkunas K, Harding R, Dale J, Dugdale B (2018) Improving agroinfiltration-based transient gene expression in Nicotiana benthamiana . Plant Methods 14:1-14. https://doi.org/10.1186/s13007-018-0343-2 Olsen AN, Ernst HA, Leggio LL, Skriver K (2005) NAC transcription factors: structurally distinct, functionally diverse. Trends Plant Sci 10:79-87. https://doi.org/10.1016/j.tplants.2004.12.010 Redillas MC, Jeong JS, Kim YS, Jung H, Bang SW, Choi YD, Kim JK (2012) The overexpression of OsNAC9 alters the root architecture of rice plants enhancing drought resistance and grain yield under field conditions. Plant Biotechnol J 10:792-805. https://doi.org/10.1111/j.1467-7652.2012.00697.x Shew AM, Tack JB, Nalley LL, Chaminuka P (2020) Yield reduction under climate warming varies among wheat cultivars in South Africa. Nat Commun 11:4408. https://doi.org/10.1038/s41467-020-18317-8 Tsay YF, Chiu CC, Tsai CB, Ho CH, Hsu PK (2007) Nitrate transporters and peptide transporters. FEBS Letters 581: 2290-2300. https://doi.org/10.1016/j.febslet.2007.04.047 Uauy C, Distelfeld A, Fahima T, Blechl A, Dubcovsky J (2006) A NAC gene regulating senescence improves grain protein, zinc, and iron content in wheat. Sci 314:1298-1301. https://doi.org/10.1126/science.1133649 Williams LE, Miller AJ (2001) Transporters responsible for the uptake and partitioning of nitrogenous solutes. Annu Rev Plant Biol 52:659-688. https://doi.org/10.1146/annurev.arplant.52.1.659 Xue GP, Way HM, Richardson T, Drenth J, Joyce PA, McIntyre CL (2011) Overexpression of TaNAC69 leads to enhanced transcript levels of stress up-regulated genes and dehydration tolerance in bread wheat. Mol Plant 4:697-712. https://doi.org/10.1093/mp/ssr013 Yamaguchi M, Ohtani M, Mitsuda N, Kubo M, Ohme-Takagi M, Fukuda H, Demura T (2010) VND-INTERACTING2, a NAC domain transcription factor, negatively regulates xylem vessel formation in Arabidopsis . Plant Cell 22:1249-1263. https://doi.org/10.1105/tpc.108.064048 Yanagisawa S (1998) Transcription factors in plants: physiological functions and regulation of expression. J Plant Res 111:363-371. Zhang Z, Peng C, Xu W, Li Y, Qi X, Zhao M (2024) Genome-wide association study of agronomic traits related to nitrogen use efficiency in Henan wheat. BMC Genomics 25: 7. https://doi.org/10.1186/s12864-023-09922-0 Additional Declarations No competing interests reported. Supplementary Files SupplementaryInformation.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6421854","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":455831607,"identity":"4d82325a-3a2a-4805-be1a-2aa6ee49af40","order_by":0,"name":"Arooj Azhar","email":"","orcid":"","institution":"Kauser Abdulla Malik School of Life Sciences, Forman Christian College (A Chartered University), Ferozepur Road, Lahore 54600, Pakistan","correspondingAuthor":false,"prefix":"","firstName":"Arooj","middleName":"","lastName":"Azhar","suffix":""},{"id":455831608,"identity":"0eafeb41-c373-4d22-af70-bab873d17ca2","order_by":1,"name":"Ayesha Jabeen","email":"","orcid":"","institution":"Kauser Abdulla Malik School of Life Sciences, Forman Christian College (A Chartered University), Ferozepur Road, Lahore 54600, Pakistan","correspondingAuthor":false,"prefix":"","firstName":"Ayesha","middleName":"","lastName":"Jabeen","suffix":""},{"id":455831609,"identity":"c88474b5-1c05-4840-93bc-5b5f058f6ce3","order_by":2,"name":"Asia Khatoon","email":"","orcid":"","institution":"Institute of Botany, University of the Punjab, Lahore, Pakistan","correspondingAuthor":false,"prefix":"","firstName":"Asia","middleName":"","lastName":"Khatoon","suffix":""},{"id":455831610,"identity":"92ce5c12-b165-47dc-9ca7-5faf2ea924e3","order_by":3,"name":"Aftab Bashir","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABJklEQVRIie2Rv0vEMBTHX3mQLv2xFo47/4VIoCJK+69cCdzsbQUFDwqd1Nn+Fx3PLUegtxRchRsUCuJYEeRAQdOrOEWom0g+S8JLPrz3TQAMhr8ICkBrAUARrIdUFTy7P+iKqFUI/1aQ1l0BBytqGwxS/NxfvcyXUXxgu4+pOIsmBFE+tXA8LoUrqUYJKsRRUfPkJrPDO1FxRpDMDq9hxkrh8amuzX0GIzfHKZWEbJ4XIsnRCZkDMimFw4TG2FNd3tz8PO6Uk9VO8V/ZO3z8qNAKieoirVIp0CsONgBip+gG268wPCrqdaIUDL6yhNYF5ayQHtfFn1RWs5kvT2N6W1lt92K+nTXtNo3GV+tLGeji6yBB902AzlBB3W379ReKwWAw/Gc+AYzMYX+G5jQ7AAAAAElFTkSuQmCC","orcid":"","institution":"Kauser Abdulla Malik School of Life Sciences, Forman Christian College (A Chartered University), Ferozepur Road, Lahore 54600, Pakistan","correspondingAuthor":true,"prefix":"","firstName":"Aftab","middleName":"","lastName":"Bashir","suffix":""},{"id":455831611,"identity":"860eaf92-e5e5-4991-bc00-0dfcfe0b2732","order_by":4,"name":"Kauser A. Malik","email":"","orcid":"","institution":"Kauser Abdulla Malik School of Life Sciences, Forman Christian College (A Chartered University), Ferozepur Road, Lahore 54600, Pakistan","correspondingAuthor":false,"prefix":"","firstName":"Kauser","middleName":"A.","lastName":"Malik","suffix":""}],"badges":[],"createdAt":"2025-04-10 16:08:16","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6421854/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6421854/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":82710513,"identity":"38426d07-c091-4700-a29d-d9283c56aab0","added_by":"auto","created_at":"2025-05-14 11:25:06","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":283806,"visible":true,"origin":"","legend":"\u003cp\u003eAgroinfiltration of four-week-old \u003cem\u003eNicotiana tabacum\u003c/em\u003e plants. Red boxes highlight the regions infiltrated with AGL1 cultures containing the gene cassette. Approximately 100 µL of culture was infiltrated per spot. Total RNA was extracted from the infiltrated leaf tissues 72 hours post-infiltration. cDNA was synthesized using the RevertAid H Minus First Strand cDNA Synthesis Kit (Thermo Scientific, USA) for subsequent gene expression analysis via RT-PCR.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-6421854/v1/681f525adc91bb6c96213061.png"},{"id":82710520,"identity":"434dc944-40ec-4791-80a0-37506b229b50","added_by":"auto","created_at":"2025-05-14 11:25:07","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":49984,"visible":true,"origin":"","legend":"\u003cp\u003ePCR-based verification of \u003cem\u003eTaNAC2-5A\u003c/em\u003e in the pSB219-NAC2 construct. Lane M: 1 Kb DNA ladder, Lane 1-9 indicates full-length gene amplification from the plasmid template. Nearly, 990 bp \u003cem\u003eTaNAC2-5A\u003c/em\u003e gene fragment was amplified on a 1 % agarose gel\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-6421854/v1/4402ad2a41090582f3ac3798.png"},{"id":82709712,"identity":"e2fcf454-2173-4f4e-b8cb-88bf50fe0131","added_by":"auto","created_at":"2025-05-14 11:17:07","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":144690,"visible":true,"origin":"","legend":"\u003cp\u003eVerification of \u003cem\u003eTaNAC2-5A\u003c/em\u003e in the pSB219-NAC2 vector construct.\u003cstrong\u003e \u003c/strong\u003e(\u003cstrong\u003ea\u003c/strong\u003e) Lane M: 1 kb ladder, lane 1: Digestion of \u003cem\u003eTaNAC2-5A\u003c/em\u003e gene with \u003cem\u003eSgr\u003c/em\u003eDI and \u003cem\u003eSwa\u003c/em\u003eI restriction enzymes. The release of the ~990 bp \u003cem\u003eTaNAC2-5A\u003c/em\u003e gene and 11.5 Kb pSB219M-PT vector backbone is indicated. (\u003cstrong\u003eb\u003c/strong\u003e) Lane M: 1 Kb ladder, lane 1: Digestion of \u003cem\u003eTaNAC2-5A\u003c/em\u003e cassette with \u003cem\u003eHin\u003c/em\u003edIII and \u003cem\u003eAsc\u003c/em\u003eI restriction enzymes. The release of the ~2.4 Kb \u003cem\u003eTaNAC2-5A\u003c/em\u003e gene cassette is indicated. The pSB219M vector backbone (10.140 kb) is shown\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-6421854/v1/ebf0df3000f4907ea04e3bb8.png"},{"id":82709715,"identity":"56c2577f-a00f-41b8-a457-f901a0fc8aea","added_by":"auto","created_at":"2025-05-14 11:17:07","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":97645,"visible":true,"origin":"","legend":"\u003cp\u003eTransient expression analysis of the gene cassette in \u003cem\u003eNicotiana tabacum\u003c/em\u003e plants using RT-PCR.\u003cstrong\u003e \u003c/strong\u003eA) Lane M: 1 Kb DNA ladder; Lane 1: negative control (RNA extracted from untreated \u003cem\u003eN. tabacum\u003c/em\u003e plants without agroinfiltration); Lane 2:279 bp fragment of the \u003cem\u003eTaNAC2-5A\u003c/em\u003e gene amplified from tobacco plants 72 h after \u003cem\u003eAgrobacterium\u003c/em\u003e (pSB219-NAC2) infiltration; Lane 3: Positive control; PCR amplification from plasmid DNA of the pSB219-NAC2 construct\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-6421854/v1/e807d192ccef3e49ad0314b3.png"},{"id":82709690,"identity":"191242d5-7111-42f0-bc0d-9e2322fd1cd4","added_by":"auto","created_at":"2025-05-14 11:17:07","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":120745,"visible":true,"origin":"","legend":"\u003cp\u003eScreening of \u003cem\u003eTaNAC2-5A \u003c/em\u003eT\u003csub\u003e1\u003c/sub\u003e wheat transgenic lines using PCR.\u003cstrong\u003e \u003c/strong\u003eLane M: 1 Kb DNA Ladder, Lane -ve: negative DNA control (Genomic DNA of FSD-2008 and Galaxy), Lane 1 indicates L1 of NAC2-6, Lane 2-6 indicates L1-L5 of NAC2-1, Lane 7-8 indicates L1 and L2 of NAC2-2, Lane 9-16 indicates L1-L8 of NAC2-4, Lane +ve indicates the positive pSB219-NAC2 plasmid DNA control. 520 bp amplifications of the maize ubiquitin promoter fragment indicated the presence of a foreign gene cassette in wheat lines. The red boxes indicate the transgenic lines selected for propagation of the T\u003csub\u003e2\u003c/sub\u003e generation and expression analysis of the\u003cem\u003e TaNAC2-5A\u003c/em\u003e gene in wheat\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-6421854/v1/f12e90a14455172e80f32023.png"},{"id":82711405,"identity":"31ed83ca-6f15-433d-a07f-03875fcc43d7","added_by":"auto","created_at":"2025-05-14 11:33:07","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":246939,"visible":true,"origin":"","legend":"\u003cp\u003ePCR-based screening of T\u003csub\u003e2\u003c/sub\u003e wheat transgenics using PCR.\u003cstrong\u003e \u003c/strong\u003eLane M: 1 Kb DNA ladder, Lane -ve: negative DNA control (wild-type FSD-2008 and Galaxy). Upper 1-10 lanes indicate the PCR amplifications of the 1 Kb Ubi-\u003cem\u003ebar\u003c/em\u003e fragment, and the lower lane indicates the amplified 750 bp CaMV terminator region in \u003cem\u003eTaNAC2-5A\u003c/em\u003e transgenic lines. +ve indicates positive control DNA (PCR on the plasmid DNA having \u003cem\u003eTaNAC2-5A\u003c/em\u003e)\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-6421854/v1/8d39580e70605d814d275f98.png"},{"id":82709713,"identity":"688053ac-5505-4276-82e9-e4c5c20ba8ac","added_by":"auto","created_at":"2025-05-14 11:17:07","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":630114,"visible":true,"origin":"","legend":"\u003cp\u003eT\u003csub\u003e1\u003c/sub\u003e generation \u003cem\u003eTaNAC2-5A\u003c/em\u003e single-gene wheat transgenics were grown in Forman Christian College (A Chartered University). (\u003cstrong\u003ea\u003c/strong\u003e) The plants were tagged separately prior to the BASTA leaf paint assay, and leaf samples were collected for genomic DNA extraction for PCR-based screening of transgenics. (\u003cstrong\u003eb\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eBasta leaf paint assay showing single-gene \u003cem\u003eTaNAC2-5A\u003c/em\u003e wheat transgenics.\u003cstrong\u003e \u003c/strong\u003eThe FSD-2008 and Galaxy control showed leaf browning owing to the absence of the herbicide resistance \u003cem\u003ebar\u003c/em\u003e gene. The \u003cem\u003eTaNAC2-5A\u003c/em\u003e transgenic lines NAC2-1(L2), NAC2-2(L1) (Galaxy parent), NAC2-4(L5), and NAC2-4(L7) (FSD-2008 parent) showed slightly brown lesions and were considered transgenic because of their resistance to the BASTA herbicide\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-6421854/v1/60fa9bb9e702e1bb28dacb56.png"},{"id":82709740,"identity":"b6767b28-b820-4249-8db4-28ad01fc9d38","added_by":"auto","created_at":"2025-05-14 11:17:08","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":110629,"visible":true,"origin":"","legend":"\u003cp\u003ePrimer validation of \u003cem\u003eTaNAC2-5A \u003c/em\u003eusing pooled cDNA templates.\u003cstrong\u003e \u003c/strong\u003e(\u003cstrong\u003ea\u003c/strong\u003e) Lane M: 1 Kb DNA Ladder, Lane 1: Primer pair 1 (NAC2qRTF1/NAC2qRTR1), product size: 274 bp, Lane 2: Primer pair 2 (NAC2qRTF1/NAC2qRTR2), product size: 279 bp, Lane 3: Primer pair 3 (NAC2qRTF1/NAC2qRTR3), product size: 279 bp, Lane 4: Primer pair 4 (NAC2qRTF2/NAC2qRTR1), product size: 279 bp, Lane 5: Primer pair 5 (NAC2qRTF2/NAC2qRTR2), product size: 286 bp, Lane 6: Primer pair 6 (NAC2qRTF2/NAC2qRTR3), product size: 286 bp, Lane 7: Primer pair 7 (NAC2qRTF3/NAC2qRTR1), product size: 282 bp, Lane 8: Primer pair 8 (NAC2qRTF3/NAC2qRTR2), product size: 287 bp, Lane 9: Primer pair 9 (NAC2qRTF3/NAC2qRTR3), product size: 287 bp. Red underlined bands indicate the selected primer pairs labelled as 1, 2, 3, 4, 5 and 6 in Figure 8b. (\u003cstrong\u003eb\u003c/strong\u003e) Lane M: 1 Kb DNA Ladder, Lane 1: Primer pair 2, Lane 2: Primer pair 3, Lane 3: Primer pair 4, Lane 4: Primer pair 6, Lane 5: Primer pair 8, Lane 6: Primer pair 9. The red box indicates the primer pair selected for qRT-PCR analysis of \u003cem\u003eTaNAC2-5A\u003c/em\u003e\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-6421854/v1/7a531ac3f0b3bf83f080b281.png"},{"id":82709729,"identity":"f2878797-f7ec-49e4-b59b-eca21f3d8bde","added_by":"auto","created_at":"2025-05-14 11:17:07","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":104056,"visible":true,"origin":"","legend":"\u003cp\u003eGraph showing relative expression analysis of \u003cem\u003eTaNAC2-5A\u003c/em\u003e in transgenic wheat lines using the ΔΔCt method. Relative fold increase in transgenic lines NAC2-1(L2) (parent var. Galaxy: 0.99), NAC2-4(L5) (parent var. FSD-2008: 0.87), NAC2-4(L6) (parent var. FSD-2008: 2.25), NAC2-2(L1) (parent var. Galaxy: 1.68), and NAC2-4(L7) (parent var. FSD-2008: 1.41) was determined using \u003cem\u003eα-tubulin\u003c/em\u003e as the internal reference gene. Error bars represent mean ± standard error (SE) from three independent biological replicates. To assess statistical significance, Dunnett’s test was applied in one-way ANOVA, comparing transgenic lines to their respective wild-type controls (FSD-2008 or Galaxy). Asterisks (***) indicate statistical significance at p value ≤ 0.001.\u003c/p\u003e","description":"","filename":"9.png","url":"https://assets-eu.researchsquare.com/files/rs-6421854/v1/0ddc0c87a6dae9b24b1fd54a.png"},{"id":82709696,"identity":"10faa787-fdd8-4310-a001-5929a7a06a58","added_by":"auto","created_at":"2025-05-14 11:17:07","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":210093,"visible":true,"origin":"","legend":"\u003cp\u003eEstimation of total chlorophyll content (mg g\u003csup\u003e-1\u003c/sup\u003e FW) in \u003cem\u003eTaNAC2-5A\u003c/em\u003e T\u003csub\u003e2\u003c/sub\u003e transgenic wheat lines compared to wild-type controls (FSD-2008 and Galaxy). Chlorophyll content was measured in young leaves using three independent biological replicates. Values are presented as mean ± standard error (SE). Statistical significance was assessed using one-way ANOVA followed by Dunnett’s test to compare each transgenic line to its respective wild-type control. Asterisks indicate statistically significant differences at p-value≤ 0.05 (*), p-value≤ 0.01 (**) and p-value≤ 0.001 (***) and “ns” denotes non-significant differences.\u003c/p\u003e","description":"","filename":"10.png","url":"https://assets-eu.researchsquare.com/files/rs-6421854/v1/f61e8a781ef1019dacd58b3a.png"},{"id":82710523,"identity":"33a61e2e-32a7-4887-8c56-ffbcdf1491e5","added_by":"auto","created_at":"2025-05-14 11:25:07","extension":"png","order_by":11,"title":"Figure 11","display":"","copyAsset":false,"role":"figure","size":172703,"visible":true,"origin":"","legend":"\u003cp\u003eEstimation of total soluble sugars (mg g\u003csup\u003e-1\u003c/sup\u003e FW) in \u003cem\u003eTaNAC2-5A\u003c/em\u003e T\u003csub\u003e2\u003c/sub\u003e transgenic wheat lines compared to wild-type controls (FSD-2008 and Galaxy). Soluble sugar content was measured in fully expanded young leaves using three independent biological replicates. Values are presented as mean ± standard error (SE). Statistical significance was assessed using one-way ANOVA followed by Dunnett’s test to compare each transgenic line to its respective wild-type control. Asterisks indicate statistically significant differences \u003cem\u003ep\u003c/em\u003e ≤ 0.001 (***), while “ns” denotes non-significant differences from wild-type controls.\u003c/p\u003e","description":"","filename":"11.png","url":"https://assets-eu.researchsquare.com/files/rs-6421854/v1/080fad66da9541286f5776b5.png"},{"id":82709731,"identity":"7a77d42d-9760-4316-8f88-337364e523ac","added_by":"auto","created_at":"2025-05-14 11:17:07","extension":"png","order_by":12,"title":"Figure 12","display":"","copyAsset":false,"role":"figure","size":191551,"visible":true,"origin":"","legend":"\u003cp\u003eEstimation of total soluble proteins (mg g\u003csup\u003e-1\u003c/sup\u003e FW) in the\u003cem\u003e TaNAC2-5A\u003c/em\u003e T\u003csub\u003e2\u003c/sub\u003e transgenic and wild-type controls.\u003cstrong\u003e \u003c/strong\u003eValues are presented as mean ± SE from three independent biological replicates. Triple asterisks (***) indicate significant differences from the non-transgenic control at p ≤ 0.001, based on the Dunnett test and “ns” stands for “not significant,” indicating that the difference between the transgenic lines and the wild-type control is not statistically significant.\u003c/p\u003e","description":"","filename":"12.png","url":"https://assets-eu.researchsquare.com/files/rs-6421854/v1/bb9cfeb0ee426451a792b2b1.png"},{"id":82709727,"identity":"1ce38265-b9e8-441e-abfa-761b910d68cf","added_by":"auto","created_at":"2025-05-14 11:17:07","extension":"png","order_by":13,"title":"Figure 13","display":"","copyAsset":false,"role":"figure","size":392426,"visible":true,"origin":"","legend":"\u003cp\u003eScanned images of the roots of \u003cem\u003eTaNAC2-5A\u003c/em\u003e transgenic plants grown in hydroponics.\u003cstrong\u003e \u003c/strong\u003eThe transgenic lines exhibited enhanced lateral root projections, facilitating improved absorption of nutrients from the soil compared to the wild-type non-transgenic FSD-2008 control. This improved root architecture not only increased the surface area for nutrient uptake but also enhanced water absorption, contributing to better plant growth\u003c/p\u003e","description":"","filename":"13.png","url":"https://assets-eu.researchsquare.com/files/rs-6421854/v1/bb680f1a920ef73115b2aa5f.png"},{"id":86483813,"identity":"990fa528-2c48-4486-86df-6bfd49d2df99","added_by":"auto","created_at":"2025-07-11 08:02:11","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4233304,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6421854/v1/9313e0fb-6de9-4df2-899a-3b8352998206.pdf"},{"id":82710514,"identity":"d8715bcd-f3d0-4669-9912-b36c0ed522f1","added_by":"auto","created_at":"2025-05-14 11:25:06","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":854669,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryInformation.docx","url":"https://assets-eu.researchsquare.com/files/rs-6421854/v1/ec9f865d9f364003736f7144.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Improving Yield and Nitrogen use Efficiency in Wheat by Overexpressing TaNAC2-5A Transcription Factor","fulltext":[{"header":"Introduction","content":"\u003cp\u003eWheat is one of the highly consumed cereal crops. It is the primary source of carbohydrates, proteins and minerals for one-third of the population across the globe (Huang and Roder 2004; Khan and Zeb \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Liu et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). In addition, it provides up to 20% of daily energy needs and 25% of global protein consumption. The contribution of wheat to the global cereal market stands at 40% (FAO 2017). However, environmental factors like climate change, salinity, drought, extreme temperatures, and soil nutrient depletion have affected wheat production activities. These factors impede plant growth, its productivity, and efficiency in utilizing resources which call for cutting edge bioengineering techniques in resolving these concerns.\u003c/p\u003e \u003cp\u003eOne critical concern is the efficient usage of nitrogen, which is a major nutrient for plant development and is usually added to the soil in the form of artificial nitrogen-enriched fertilizers. Even though these fertilizers have been helpful in increasing crop production, their overuse has resulted in environmental problems, such as loss of soil fertility, eutrophication, and climate change (Good et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). Additionally, almost 70% of the nitrogen applied in the field is lost to the ecosystem which causes additional damage to the environment (Hodge et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2000\u003c/span\u003e). In response to these problems, improving Nitrogen Use Efficiency (NUE) through genetic engineering is a promising approach for achieving ecologically friendly agricultural practices (Molina-Rueda and Kirby 2015; Zhang et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2024\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eTranscription factors (TFs) are critical components of gene regulatory networks that are responsible for directing plant growth and triggering responses to environmental stress (Mondal et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Transforming growth factors are high-value targets for genetically engineering agronomical traits that can control numerous gene networks (Century et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). Among numerous TF families, NAC family named after its domains NAM (No apical meristem), ATAF (Arabidopsis transcription activation factor) and CUC (Cup-shaped cotyledon), is one of the major groups of plant specific regulators. They function in a wide array of diverse tasks such as temporal and spatial nutrient remobilization, root formation, senescence of leaves and biotic or abiotic stress interactions (Olsen et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; Uauy et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2006\u003c/span\u003e; Yamaguchi et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). NAC TFs normally compose of a conserved N-terminal domain that has the ability to bind DNA, and an extreme C terminal region that determines the ability of lateral transcriptional pathways (Ernst et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). Plant nitrogen uptake is influenced by soil conditions and the plant\u0026rsquo;s ability to adapt. In acidic soils, plants tend to absorb nitrogen as ammonium and amino acids, while in alkaline soils, they primarily take up nitrates (Maathuis, 2009; McAllister et al., 2012). Plant roots have two coexisting nitrate transport systems that facilitate nitrogen absorption from the soil and its distribution throughout the plant (Daniel-Vedele et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e1998\u003c/span\u003e). These two systems are categorized as low-affinity nitrate transporters (LATS) and high-affinity nitrate transporters (HATS), which are controlled by genes from the NRT1 family. The NRT1.1 transporter, the first to be isolated, has been extensively researched (Tsay et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). This gene is normally expressed in the root tip epidermis, endodermis, and cortex of mature roots, with the proteins located on the plasma membrane. In comparison, NRT1.2 is consistently expressed only in the root epidermis and is associated with low-affinity systems (Huang et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e1999\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eWhenever plants take up nitrogen in the form of nitrates, they must be transported across different parts of the plant in order to be available to the plant parts in the form of amino acids and ammonium. This long-distance nitrate transport from roots to shoots is carried out by the NRT1.5 gene, which is positioned near the xylem on root pericycle plasma membrane cells (Lin et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). There are several other nitrate transporter genes, including NRT1.4, expressed in petioles of leaves only (Chiu et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2004\u003c/span\u003e) and NRT1.6, which are expressed in funiculus and silique vascular tissues. Moreover, it has been reported that NRT1.6 transports nitrates to developing embryos from maternal tissues (Almagro et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). On the other hand, HATS are only expressed in plants when there is a low concentration of nitrates in the soil, and they involve NRT2 family genes, that is, NRT2.1 and NRT2.2 (Williams and Miller \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2001\u003c/span\u003e).\u003c/p\u003e \u003cp\u003ePrevious studies suggested that \u003cem\u003eTaNAC2-5A\u003c/em\u003e has a significant role in the wheat nitrate transcriptional control of transmembrane transport genes (Aida et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e1997\u003c/span\u003e; Kim et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Yamaguchi et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). As studied by Li et al. (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), \u003cem\u003eTaNAC2-5A\u003c/em\u003e enhances the expression of \u003cem\u003eTaNRT2.5-3B\u003c/em\u003e functional genes which are involved in nitrate transport for nitrogen uptake and assimilation. Increased grain nitrate, seed vigor and nitrogen accumulation were also observed in \u003cem\u003eT. aestivum\u003c/em\u003e lines with overexpressed \u003cem\u003eTaNAC2-5A\u003c/em\u003e (Li et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Other studies in \u003cem\u003eArabidopsis\u003c/em\u003e and rice also reported similar findings wherein NAC TFs were identified to be crucial factors in enhancing nitrogen metabolism and root architecture under stressful conditions (Redillas et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; He et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). For instance, overexpression of \u003cem\u003eTaNAC2\u003c/em\u003e in \u003cem\u003eArabidopsis thaliana\u003c/em\u003e enhanced tolerance to high temperatures and salinity (Mao et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2014\u003c/span\u003e) while \u003cem\u003eTaNAC69\u003c/em\u003e enhanced salt stress and drought tolerance in wheat (Xue et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2011\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eWheat varieties with enhanced NUE and more productivity can be developed using \u003cem\u003eTaNAC2-5A\u003c/em\u003e due to its capability to impact nitrate signaling and resource allocation to a considerable extent. Previous studies suggest that the overexpression of a transcription factor \u003cem\u003eTaNAC2-5A\u003c/em\u003e could increase nitrogen acquisition and assimilation which would lead to an increase in plant vigor as well as yield potential. These findings are promising in combating the environmental challenges that are faced due to regions with fragile agricultural ecosystems, for instance salinity, drought, and nutrient depletion.\u003c/p\u003e \u003cp\u003eThe focus of this research was on developing transgenic wheat that can utilize and uptake more nitrogen by overexpressing \u003cem\u003eTaNAC2-5A\u003c/em\u003e transcription factor in wheat varieties grown in Punjab, Pakistan. Utilizing genetic and molecular technologies including gene cassette construction, \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated transformation and qRT-PCR based expression analysis, we were able to develop and test these transgenic wheat varieties in field conditions. Due to nitrogen inefficiency being one of the challenges this study focuses on increasing crop yield efficiency while also promoting sustainable agriculture and food security in wheat-dependent regions.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n \u003ch2\u003ePlant material\u003c/h2\u003e\n \u003cp\u003eThe wheat cultivars utilized in this study include FSD-2008 (code no. V-04189) and Galaxy-2013 (code no. V-07096). These approved varieties were transformed with \u003cem\u003eTaNAC2-5A\u003c/em\u003e genetic construct to obtain transgenics overexpressing the transcription factor. Wheat seeds were obtained from Ayub Agricultural Research Institute (AARI), Faisalabad, Pakistan and then sown in the fields of Forman Christian College (A Chartered University), Lahore, Pakistan to obtain the donor material on which tissue culture was performed. For the wheat transformation experiments, immature embryos were harvested 15 days after anthesis.\u003c/p\u003e\n\u003c/div\u003e\n\u003ch3\u003eSelection of Transformation vector\u003c/h3\u003e\n\u003cp\u003eVector pSB219 was obtained from the Leibniz Institute of Plant Genetics and Crop Plant Research IPK, Germany and was modified for use in this study. The green fluorescent protein (GFP) cassette in the original pSB219 vector was replaced with 177 bp linker containing rare-cutting endonuclease recognition sites for the construction of the multiple cloning site (MCS) (Figure \u003cspan class=\"InternalRef\"\u003eS1\u003c/span\u003e). The 2X35S promoter was also inserted between the \u003cem\u003eHin\u003c/em\u003edIII and \u003cem\u003eSgr\u003c/em\u003eD1 sites while 35S CaMV terminator was cloned using the \u003cem\u003eSwa\u003c/em\u003eI and \u003cem\u003eAsc\u003c/em\u003eI restriction sites. The modified plasmid was named pSB219M-PT. In addition, pSB219 also contained a \u003cem\u003ebar\u003c/em\u003e gene selection marker regulated by a maize ubiquitin promoter and 35S terminator. The \u003cem\u003ebar\u003c/em\u003e gene makes cells resistant to herbicide Phosphinothricin (BASTA), which was used for the selection of the putative transgenics. The transgenic selection was further combined with the BASTA leaf paint assays in the field to check for herbicide resistance.\u003c/p\u003e\n\u003ch3\u003ePrimer designing and synthesis\u003c/h3\u003e\n\u003cp\u003eThe \u003cem\u003eTaNAC2-5A\u003c/em\u003e gene belongs to the NAC family of transcription factors in wheat, which are known for their role in stress responses and developmental processes. The coding sequence of \u003cem\u003eTaNAC2-5A\u003c/em\u003e, spanning 990 bp, was retrieved from the NCBI database (accession number: AY625683.1). The gene was commercially synthesized by Eurofins MWG Operon (USA) and was delivered into the pUC57 vector. Composite primers were designed to amplify \u003cem\u003eTaNAC2-5A\u003c/em\u003e with \u003cem\u003eSgr\u003c/em\u003eD1 and \u003cem\u003eSwa\u003c/em\u003eI restriction sites at the start and end of the sequence, respectively. A ribosome-binding site specific for monocots (GCC) was incorporated into the forward primer. Primer properties, including GC content, length, and melting temperature (T\u003csub\u003em\u003c/sub\u003e), were optimized using the OligoCalc tool (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://bio.tools.nubic.northwestern.edu/OligoCalc.html\u003c/span\u003e\u003c/span\u003e). Similarly, primers for transgene screening were designed using a \u003cem\u003ebar\u003c/em\u003e gene selection cassette (Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e, Figure S3). NCBI Primer BLAST (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/tools/primer-blast/\u003c/span\u003e\u003c/span\u003e) was used to design primers for qRT-PCR analysis. Primers were selected based on low self-complementarity and a T\u003csub\u003em\u003c/sub\u003e range of 58\u0026ndash;62\u0026deg;C, with a maximum T\u003csub\u003em\u003c/sub\u003e difference of \u0026plusmn;\u0026thinsp;2\u0026deg;C between primer pairs. Three primer pairs were designed to amplify \u003cem\u003eTaNAC2-5A\u003c/em\u003e for qRT-PCR, which produced amplicons ranging from 274 to 287 bp. For template equalization and internal controls, primers were designed for the wheat 18S rRNA and \u003cem\u003e\u0026alpha;-tubulin\u003c/em\u003e genes, with amplicon sizes of 113 bp and 250 bp, respectively (Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). These primers were synthesized by the Eurofins MWG Operon (USA).\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\u0026nbsp;\u003ctable id=\"Tab1\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003ePrimer sequences used in the study for the cassette construction and transgene screening\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003ccolgroup cols=\"4\"\u003e\u003c/colgroup\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSr. No.\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003ePrimer Name\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003ePrimer Sequence\u003c/p\u003e\n \u003cp\u003e(5\u0026rsquo; to 3\u0026rsquo;)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eProduct Size\u003c/p\u003e\n \u003cp\u003e(bp)\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2X35SF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCCGAAGCTTACTCCAAAAATGTCAAAGATACAGTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" rowspan=\"2\"\u003e\n \u003cp\u003e671\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2X35SR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTTACGTCGACGCCCTTACGTCAGTGGAGATGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCMVTRF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGCATTTAAATGCTGAAATCACCAGTCTCTCTCTAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" rowspan=\"2\"\u003e\n \u003cp\u003e750\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCMVTRR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAATGGCGCGCCGCATGCTCCGGTGTGAGGGAACT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNAC2F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTCACGTCGACGGCCATGGGGATGCCGGCCGTGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" rowspan=\"2\"\u003e\n \u003cp\u003e990\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNAC2R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAGTATTTAAATTTAGAACGGGGCCGGCATG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eUbiF1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eACGGCACGGCATCTCTGTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" rowspan=\"2\"\u003e\n \u003cp\u003e520\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eUbintR1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCACTGGCAAGTTAGCAATCAGAAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eUbiF2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGACACCAACCAGCGAACCAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" rowspan=\"2\"\u003e\n \u003cp\u003e1000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBastR2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTGACCGTGCTTGTCTCGATGTAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cdiv class=\"gridtable\"\u003e\n \u003cdiv align=\"left\" class=\"colspec\"\u003e\u003cbr\u003e\u003c/div\u003e\n \u003cdiv align=\"char\" class=\"colspec\"\u003e\u003cbr\u003e\u003c/div\u003e\u0026nbsp;\u003ctable id=\"Tab2\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003ePrimer sequences used in qRT-PCR analysis\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003ccolgroup cols=\"4\"\u003e\u003c/colgroup\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSr. No.\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003ePrimer Name\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003ePrimer Sequence (5\u0026rsquo; to 3\u0026rsquo;)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eProduct Size (bp)\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNACqRTF1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGCTACTGGAAGGCCACCG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" rowspan=\"2\"\u003e\n \u003cp\u003e274\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNACqRTR1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGTCTCCTCTTCCCCTTGCTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNACqRTF2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGCAACGGCTACTGGAAGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" rowspan=\"2\"\u003e\n \u003cp\u003e286\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNACqRTR2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTCATCGTCTCCTCTTCCCCT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNACqRTF3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCGGCAACGGCTACTGGAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" rowspan=\"2\"\u003e\n \u003cp\u003e287\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNACqRTR3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAAGGGGAAGAGGAGACGATGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e18SRTF2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eATGATAACTCGACGGATCG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" rowspan=\"2\"\u003e\n \u003cp\u003e251\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e18SRTR1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGACACTAATGCGCCCGGTAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAlphaTubF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTTCGCCCGTGGTCATTACA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" rowspan=\"2\"\u003e\n \u003cp\u003e113\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAlphaTubR1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCGTTGAAGACAAGGAATCCC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAlphaTubR2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAGGACACTGTTGTATGGCTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003ch3\u003ePlasmid construction and bacterial transformation\u003c/h3\u003e\n\u003cp\u003eThe \u003cem\u003eTaNAC2-5A\u003c/em\u003e gene was cloned into the plant transformation vector pSB219M-PT by using the \u003cem\u003eSgr\u003c/em\u003eD1 and \u003cem\u003eSwa\u003c/em\u003eI restriction sites. The \u003cem\u003eSgr\u003c/em\u003eD1 and \u003cem\u003eSwa\u003c/em\u003eI restriction enzymes were used to digest the gene and the vector, followed by ligation reaction using the \u003cem\u003eT4\u003c/em\u003e DNA Ligase. Electrocompetent cells of \u003cem\u003eE. coli\u003c/em\u003e, Top10 strain were transformed with the ligation mixture. The clones were screened using both PCR and restriction digestion as indicated in Table \u003cspan class=\"InternalRef\"\u003eS1\u003c/span\u003e and S2. Full-length gene specific primers indicated in Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e were used in the PCR reaction and PCR products were analyzed on 1% agarose gel. DNA sequencing (Eurofins MWG Operon, USA) was also employed later to check the orientation and integrity of the gene and Chromas Lite Software was used for the analysis of the sequencing data. After verification, the pSB219-NAC2 construct was co-transformed with helper plasmid pAL154 (tetracycline resistant) into AGL1 strain of \u003cem\u003eAgrobacterium tumefaciens\u003c/em\u003e using electroporation. The transformed cells were incubated on LB agar containing spectinomycin (100 \u0026micro;g mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e), tetracycline (5 \u0026micro;g mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) and rifampicin (50 \u0026micro;g mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e). PCR screening was performed by targeting the \u003cem\u003ebar\u003c/em\u003e gene cassette to confirm positive transformants.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTransient expression analysis in\u003c/strong\u003e \u003cstrong\u003eNicotiana tabacum\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eNicotiana tabacum\u003c/em\u003e (L. cv. Samsun-NN) seeds were obtained from National Institute of Biotechnology and Genetic Engineering (NIBGE), Faisalabad, Pakistan. The seeds were placed in growth chambers at (26\u0026thinsp;\u0026plusmn;\u0026thinsp;1\u0026deg;C) under direct white light and later sown into a soil matrix of peat, fumas and cocoa peat in the ratio of 3:1:1. Hoagland Solution was administered every week and two weeks old plantlets were transferred into pots (Hoagland et al. 1950). Plants of 4\u0026ndash;6 weeks were used for agroinfiltrations using protocol described by Norkunas et al. (\u003cspan class=\"CitationRef\"\u003e2018\u003c/span\u003e). Fresh cultures of \u003cem\u003eA. tumefaciens\u003c/em\u003e (AGL1) containing pSB219-NAC2 were inoculated in LB broth having 100 \u0026micro;g mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e spectinomycin, 5 \u0026micro;g mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e tetracycline, and 50 \u0026micro;g mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e rifampicin. These cultures were grown for 48 hours at 28\u0026deg;C followed by centrifugation at high speed after being supplemented with 10 mM MES (pH 5.6) and 100 \u0026micro;M acetosyringone. The bacterial cells pellet was resuspended in infiltration buffer consisting of 10 mM MgCl\u003csub\u003e2\u003c/sub\u003e, 10 mM MES and 100 \u0026micro;M acetosyringone, to the OD\u003csub\u003e600\u003c/sub\u003e of 0.8 to 1. With the aid of a needleless syringe, the abaxial side of the leaf was injected and placed in an environment of low light, 25\u0026thinsp;\u0026plusmn;\u0026thinsp;1\u0026deg;C and high humidity for 48 to 72 hours (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eLeaf samples were collected at 72 h after infiltration. Total RNA was extracted using Plant RNA Purification Reagent (Invitrogen, Cat#12322-012). RNA quality was verified on 1% agarose gel, and cDNA synthesis was performed using the RevertAid H Minus First-Strand cDNA Synthesis Kit (Thermo Scientific, USA) according to the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e\n\u003ch3\u003eWheat tissue culture\u003c/h3\u003e\n\u003cp\u003eThe protocol for wheat tissue culture outlined by Abid et al. (\u003cspan class=\"CitationRef\"\u003e2014\u003c/span\u003e) was adapted. Immature embryos were harvested on 15 days post-anthesis, sterilized, and plated onto Murashige and Skoog (MS) callus induction medium (CIM) containing 2,4-D (10 \u0026micro;g mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e). AGL1 cultures containing plasmid pSB219-NAC2 were revived and grown to an OD\u003csub\u003e600\u003c/sub\u003e 0.4\u0026ndash;0.5. Twenty-one days old wheat calli were infected with \u003cem\u003eAgrobacterium\u003c/em\u003e cultures and co-cultivated on medium supplemented with acetosyringone (400 \u0026micro;M). The infected calli were then placed on CIM supplemented with Rocephin (100 \u0026micro;g mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) for about 3 weeks. In the presence of the light at 24\u0026thinsp;\u0026plusmn;\u0026thinsp;1\u0026deg;C, the calli were placed on MS regeneration medium containing kinetin (1 mg mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e). The putative transgenic plantlets were selected on the MS medium supplemented with BASTA (2 mg L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, followed by 3 mg L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e), then transferred to artificial soil for stabilization. PCR screening on the acclimatized plants was performed and mature plant spikes were harvested as T\u003csub\u003e0\u003c/sub\u003e generation and seeds were referred to as T\u003csub\u003e1\u003c/sub\u003e.\u003c/p\u003e\n\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\n \u003ch2\u003ePCR-based Transgene Screening\u003c/h2\u003e\n \u003cp\u003eThe T-DNA introduced into the wheat via \u003cem\u003eAgrobacterium\u003c/em\u003e containing the pSB219-NAC2 vector contains both \u003cem\u003eTaNAC2-5A\u003c/em\u003e and \u003cem\u003ebar\u003c/em\u003e gene cassettes which can be used for screening transgenic plants. The CTAB method of total genomic DNA extraction was used to extract genetic material from T\u003csub\u003e0\u003c/sub\u003e, T\u003csub\u003e1\u003c/sub\u003e and T\u003csub\u003e2\u003c/sub\u003e transgenic wheat (Murray and Thompson \u003cspan class=\"CitationRef\"\u003e1980\u003c/span\u003e). Screening of T\u003csub\u003e0\u003c/sub\u003e and T\u003csub\u003e1\u003c/sub\u003e transgenic plants was conducted using primers specific to \u003cem\u003emaize ubiquitin promoter: bar gene: t35S terminator\u003c/em\u003e in pSB219-NAC2 vector. UbiF1/UbintR1 primer pair was used to screen T\u003csub\u003e1\u003c/sub\u003e transgenic plants giving 520 bp fragments. For T\u003csub\u003e2\u003c/sub\u003e transgenics, Ubi-\u003cem\u003ebar\u003c/em\u003e specific primers (UbiF2/BastR2) were used to amplify the fragment of 1 Kb (Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). Negative controls containing genomic DNA from non-transgenic wild wheat plants were used to confirm the absence of any transgenes, while plasmid DNA of pSB219-NAC2 vector was used as positive control to ensure the amplicon size and PCR conditions. Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e shows primer sequences used for transgene screening, while PCR reagent compositions and profiles are listed in Table S2a and S2b.\u003c/p\u003e\n\u003c/div\u003e\n\u003ch3\u003eBASTA leaf paint assay\u003c/h3\u003e\n\u003cp\u003eT\u003csub\u003e1\u003c/sub\u003e plants of 4-week-old were subjected to BASTA leaf paint following Akhtar et al. (\u003cspan class=\"CitationRef\"\u003e2020\u003c/span\u003e). Approximately 6 cm of the leaflets were painted with a concentration of 0.005% (w/v) of phosphinothricin solution. Non-transgenic control plants were also treated with herbicide and the results were noted 7 to 10 days after herbicide application. Plants showing BASTA resistance were considered as putative transgenics.\u003c/p\u003e\n\u003ch3\u003eExpression analysis of transgenics\u003c/h3\u003e\n\u003cp\u003eThe expression analysis of \u003cem\u003eTaNAC2-5A\u003c/em\u003e in T\u003csub\u003e2\u003c/sub\u003e wheat transgenic lines was done by quantitative real-time PCR (qRT-PCR). Young leaves of PCR positive T\u003csub\u003e2\u003c/sub\u003e plants and non-transgenic wild type controls (FSD-2008 and Galaxy) were utilized for RNA extraction using Plant RNA Purification Reagent (Invitrogen, Cat#12322-012). Total RNA was quantified on a 1% agarose gel prior to cDNA synthesis (Figure S4). RevertAid H Minus First Strand cDNA Synthesis Kit (Thermo Scientific) was used to synthesize cDNA following manufacturer\u0026rsquo;s instructions. All primer pairs selected for \u003cem\u003eTaNAC2-5A\u003c/em\u003e expression analysis by qRT-PCR were validated for specificity and efficiency\u0026thinsp;\u0026gt;\u0026thinsp;90%, and qRT-PCR was done using the selected primer pairs (Table S3) for expression analysis of the \u003cem\u003eTaNAC2-5A\u003c/em\u003e gene. To ensure accuracy of results, the \u003cem\u003e\u0026alpha;-tubulin\u003c/em\u003e gene was used as an internal standard. qRT-PCR was done using the BlasTaq 2X qPCR Master Mix (Cat # G892; abm, Canada) in Bio-Rad CFX96 Real Time PCR system. The acquired data were analyzed using the \u0026Delta;\u0026Delta;Ct method (Livak and Schmittgen \u003cspan class=\"CitationRef\"\u003e2001\u003c/span\u003e). Table S4 and S5 show the composition of the qRT-PCR reaction mixture and the PCR profile.\u003c/p\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n \u003ch2\u003eAgronomic trait analysis\u003c/h2\u003e\n \u003cp\u003eThe morphology and growth of T\u003csub\u003e1\u003c/sub\u003e and T\u003csub\u003e2\u003c/sub\u003e transgenics were evaluated in the field experiments conducted in Forman Christian College (A Chartered University), Lahore, Pakistan. Randomized complete block design (RCBD) was used to confirm that the genetic modification was the only reason for their differences in agronomic traits. Traits such as plant height (cm), number of spikes per plant, weight of 1000 grains (g) and grain yield per plant were measured and compared with the non-transgenic controls FSD-2008 and Galaxy. T\u003csub\u003e2\u003c/sub\u003e seeds obtained from T\u003csub\u003e1\u003c/sub\u003e plants were subjected to further expression studies and seed multiplication. Collection of field data and their subsequent analysis were carried out to reduce possible bias of the results.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n \u003ch2\u003eBiochemical analysis\u003c/h2\u003e\n \u003cdiv id=\"Sec13\" class=\"Section3\"\u003e\n \u003ch2\u003eEstimation of chlorophyll content\u003c/h2\u003e\n \u003cp\u003eMeasurement of chlorophyll content can provide a useful insight into the photosynthetic potential of transgenic plants. It signifies the efficiency with which a plant can enhance carbon gain and biomass. Measurement of chlorophyll in leaf extracts of \u003cem\u003eTaNAC2-5A\u003c/em\u003e transgenic wheat lines and wild-type control plants was done as described by Arnon (\u003cspan class=\"CitationRef\"\u003e1949\u003c/span\u003e). Fresh leaf tissues (0.2 g) were ground in 10 mL of 80% acetone. The mixture was then centrifuged for 10 minutes at 2500 rpm and the supernatant volume was adjusted to 10 mL with 80% acetone. Absorbance at 645 and 663 nm was recorded for the three sets (three independent replicates) of each. Each sample\u0026rsquo;s total chlorophyll content was determined using the formula shown below:\u003c/p\u003e\n \u003cp\u003eTotal Chlorophyll (mg g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e fresh weight)\u0026thinsp;=\u0026thinsp;20.2 (OD645) \u0026ndash; 8.02 (OD663) x W x V\u0026thinsp;\u0026divide;\u0026thinsp;1000\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\n \u003ch2\u003eEstimation of total protein content\u003c/h2\u003e\n \u003cp\u003eEstimation of total protein content in transgenic plants is very important as it indicates the overall metabolic rate, nitrogen contents incorporation and physiological characteristics on transgenic versus control plants. To determine the protein concentration of transgenic lines and wild type (non-transgenic) controls, Bradford method (Bradford, \u003cspan class=\"CitationRef\"\u003e1976\u003c/span\u003e) was utilized. Fresh leaf tissues (0.2 g) were homogenized in phosphate buffer followed by centrifugation at 5000 rpm for 10 minutes. Coomassie blue reagent was used to mix the supernatant followed by incubation for 5 minutes. Absorbance was taken at 595 nm for three replicates for the wild-type control as well as the transgenic samples. Protein concentrations were determined using Bovine Serum Albumin (BSA) as the standard (Figure S7).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\n \u003ch2\u003eEstimation of total soluble sugars\u003c/h2\u003e\n \u003cp\u003eEvaluation of total soluble sugars content in transgenic plants is imperative since it determines photosynthetic efficiency, carbohydrate metabolism, and energy storage. These are essential parameters in assessing the effect of genetic modifications on plant growth, stress tolerance, and productivity. Total sugar content in the soluble form was evaluated in relation to the transgenic and the control plants. The procedure described by Malik and Srivastava (\u003cspan class=\"CitationRef\"\u003e1982\u003c/span\u003e) was employed. The dry leaf materials were homogenized in 2 mL of 80% acetone followed by incubation in a shaker for 24 hours at 37\u003csup\u003eo\u003c/sup\u003eC. The samples were then centrifuged at 2900\u0026times;g and the supernatant were mixed with 5 mL of Anthrone reagent. The absorbance was recorded at 625 nm and the amount of sugar content was assessed through D-glucose standard.\u003c/p\u003e\n \u003cp\u003e\u003cimg src=\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAzoAAABmCAYAAAADFeSlAAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAAJcEhZcwAAFiUAABYlAUlSJPAAACUrSURBVHhe7d3/i1tV/j/wZz6/q72Z/rCwblly0x8WlYp7R0XiD12wdxxlWdlKIusPBaElUyksq9M1U2GFtttEYUHcmWmxUESazOoP/SVjp4UKm1DWzmyZoNIFJ0GK+FPupLV/wPn8YF73fe7JTXIz35s+HxCYOffkfjnf7jnJPScxpZQCERERERHREPl/ZgAREREREdH9jgMdIiIiIiIaOhzoEBERERHR0OFAh4iIiIiIhg4HOkRERERENHQ40CEiIiIioqHDgQ4REREREQ0dDnSIiIiIiGjocKBDRERERERDhwMdIiIiIiIaOhzoEBERERHR0OFAh4iIiIiIhg4HOkRERERENHQ40CEiIiIioqHDgQ4REREREQ0dDnSIiIiIiGjocKBDRERERERDhwMdIiIiIiIaOhzoEBERERHR0OFAh4iIiIiIhs4DNdCZn59HJpPB2NiYuWlT1Go1TExMIB6Pm5v6qlarmJiY6HuunuehVCphdHQUhULB3ExE61AqlRCLxVCtVs1NO4rneZiamkI8HkcsFsPY2BhqtZoZLRK2KdujWq1ibGxsU9Pc8zwUCoU13ZPWYj33wF5kn57nmZtoAzUaDRQKBSSTyW1pAz3Pw9mzZ7ft+LqofTLaeTZ1oFMoFBCLxSK9NrsQS4M4Nzdnbto09+7dw5UrV9BqtcxNPTUaDaDdyern7t27uH37NpaWlsxN9ACRG8Lo6Khfp6SjKp0bGtzDDz9sBu1IR48exZ49e7C6uopKpYIbN27gX//6lxktErYpW69areLixYtYWFgwN22o8+fP49y5cwPfk9ZqrffAfizLMoPuC7VaDZlMxm+jM5kMqtUq5ufnN70PtBb37t3DzZs3Ua/XzU0bolAoYH5+3gz23bp1C7dv396040c1SJ+Mdp5NHegAwOzsLJRS/gsAXNf1/282m8hms7h+/br51p6mpqbMoJ5GRkYwPj5uBm+qVCqFZDJpBveVSCSQSqXw9NNPm5s6JBIJPPfcc2YwPUBqtRr27t2L999/H3/5y1/QbDahlMLc3Bz27NmDvXv34vjx4+bb7muD1v8owvY5Pj4OpRRSqZS5aceo1WqYm5vDY489BrTbndXVVZw6dcqMGgnblJ+FlYfNkkqlMD09bQZvuMnJSRw+fNgM3jRrvQfqwvLh1KlTWF1dxcjIiLlpx6rVati/fz/i8bjfRr/zzjv46KOP8NJLL5nRd4R9+/bhqaeeMoM3hOd5OHPmDD788ENzky+VSuHFF180g7fcIH0y2nk2daCzZ88eHDlyxAwOGBkZGbiBr1ar+O9//2sGEz1w9JvnV199hUwm49/8E4kEMpkMvvzyy/v2E9AwnudhZmbGDF6XzdjnVvnPf/5jBtE68R6zM9zP9dL097//HfF4HNPT034bvW/fPpRKJbiua0YfelevXkWr1cLCwsKO/DaLhsemDnQymYwZ1NXk5KQZFMrzPBw6dMgMJnogHT9+HK1WCydPnuz66ea+ffsG/jBhJzt69OiGPwqzGfvcKnfv3jWDaB14j9k57ud6abpz5w5WV1dD5xUdO3bMDBp6J06cQD6fBwB89NFH5maiDbOpA521kIlvsVgMyWTSn2OA9nOSe/fuRb1ex8LCgj/pFu2b08TEhP/sq7x3rWTCphzD/PpdjidxRkdH+z6/Wa1WA/OSxNjYWM+5Sp7n+XGSyWTPZ1p1jUaj43lgeda0Gz0d4/E4xsbG/AGrfu5ynvo8LDO95+fnA3NG9NfExETH8eT69P00Gg1MTU35kxGnpqYQi8X8xxn65ZNuJ80Z2wi1Ws1/pr/fhwrm9m7Pigsz3efn5/16GfYoSbVaDexvYmKi44ZerVb98hCPxzE1NeXHqbYnesqkZcnXeDweqFejo6P+PDs5lqfNTyoUCiiVSojH4xgdHQUilLGwfSIkDXQbnX5h+h1D2hN5LPH5559HLKQemvQ21nx1a8P0Nkr2r7dn5gTdRqMRaB/DFkfod30SR2/7wibry2RliXP27NnA9jB6foyOjmJ0dBTVanVd95hB89y8/rA4/Y6p1xv9PqHfI/T8TiaTuHnzpr+tl35t62bfA7vVS7Ot0JlpapapQfNIp59jrF0PetUB06FDh9BqtULrwvj4eODx2H75bi4SUK1W/esYGxuD53nwPM9PC4kn+y6VSshkMigUCoE6Njo62nFu3VR7tOf9lEolHDhwAJOTk7BtG3Nzc337Jmi/T8qbeY/p1XcRg5YPs78h9LqWDOmT6Wkq6arHkfSXvJLzTiaTHenvtefY6nXYPJ5nLEYj7Rm1qS0GQLmuawYrpZRKp9PKcRxVr9eVUkrNzs4qAMpxnEC8sH24rqts21bNZlM1m02VTqcVALW8vByIF/ZeU7FYVLZtd5yHaDabyrZtlc1m/eNls1kFQOVyOW1PP59X2HvNpJf3VyoVP8x1XeU4jkqn0yqfz/txAKhyuezHq1QqCoDK5/N+WL1eV7Zt+/urVCrKsixl27YfJ0w2m1XpdDpwXXp6Sbrq51ksFjuOb56TnA8AP11VhHxbXl72rzubzapisahc11W5XK5vPg07ud5+5dm0vLysAKjZ2Vml2nnjOE6gXOnpnsvlVD6fV5VKxQ8rFov+/srlsrIsK1DWzPMql8uhdTubzfrvkXPI5/OqWCwGwswyo+dzvV7395dOp9Xs7KzKZrN+u9GvjIXtUxlpoJf3jU6/MFGOIfL5fMc5dmPGlbwy2wUJ1+u0pLHZzsDI63q9rizLCpy7bdvKsizVbDaVGuD6bNsOtCGO4wSOn8vlQtvhXukr56yngV5+VZf7RL9yNEieLy8vK8uy/HPXr1+/vn7HrITUG9u2/TTMZrOBa5M8RJ92sl/bKvexsLTf6HugGU+/Zl2UMjVIHoWRdNDrSzqd9tOhn1wu56d/NpsNtGu6fvne7zpyuZxKp9OqXC777bNlWUq106VcLvvxpE7JMSzLCpyX2WaoCO15P7bWN5H9d3tvpd0WZbNZlc1mVT6f98uPtPEqQt9l0PKRNfobKmKfrNlsKsuyVDqd9o8j7Z9sl2tyHEflcrlAPpltseM4fvnSy4KeH47jhF5Xt/L1oOnd2m0ChNxAlNZZ1jsfSmv89AYobB9S+IQUJL0wqC7vNeXz+UAFUu3z0P+WQquTyqcXrrCGOiwsrDHRGzuhVxAzTL9BZrPZjhuONLK9GnO9Ugv92sPOM+z4Uhl10hiaFbRfvskxzfPul0/DTtKlX3k22bYdSHOldf70Rlb2r3c8JZ6e17Ztd5QZx3ECeaN3vvQ40OqL1Au9vEu7YNYLs2zpN0NTlDIWtk/VpbxvdPqFiXoM1eUcu7Esq6O8hNXVsDodFqZC2tSsNsgUuVwu0IGKen1h6SfHl/h6eWk2mx37MMl1mOVMTz/zmlTEchQ1z6XDpJOOmB4vyjGl7JqdGolr1ruw/Db1a1u38h5oxusWHrVMRc2jbuT9ufaHbWFtTi+VSsU/f7TbLHOQFCXfu+UvQj4clnu/Du0yrh9b4unteVi+RGnPuymXy4G6JQMDGHVSyHVKR15IGsp5uH36LoOWD7O/oSL2yerGBz1K26cuLJ+kvyvk/qcfr9wepMp1F4vFjv1InEHL5rDaMY+uXbp0CWjPJ9DJYgYXLlwIhJsWFxdRKpX8rx5///vfm1EiO3jwIOr1OjKZjP81oj7HoVQqha6+8fbbbwMAPv/8c3PTmiWTycDci1QqBcdx+i79WiqVcPr0af+r01gshtOnTwMAbt++bUb3HTt2DKdPn0ahUPC/Sl7L/A55rED/OvpXv/qVFuNng+Tbo48+Gvi/Xz6ZCkP26Npa1Go11Ov1jpV0EokE0uk06vV6x7XrSywnEonAtmq1inq93rEyzuLiIhYXFwHtmC+99FIgjaUM//jjj4H36uXdzPN+fv3rX5tBA5WxfjY6/cKs5RhRxeNxrKysBMJs2w78v14zMzN49dVXA2GySlYikRjo+nK5HF5//XWUSiV4nodEIuHP57x69SoAYPfu3X6Z2r17NwD0XI5W2tCxsTH/EZBMJtN3Zb1BylGvPG80GlhYWOhII/PehwGPaR7n4sWLQPuxKJ2Z7mH6ta1beQ+MYpAyJXrlUS+Tk5NIp9M4ffo0Ll261POeEyaVSuHy5cuoVCqwbRszMzPYu3dv4JGlQfI9bAl8c77mI488ArTba93vfve7QNw33ngDAHouxDFoe2768MMPA3OSRkZG/EfMzp8/r8UMklUlhezjm2++8f/v1ndZS/nodu/p1ydLJBJYXV3FkSNHUG0/Ztlt1VMzn8z714ULF+C6biCerAQq9frSpUtYWloK5IWs4hflccAHwY4Z6Ny5c8cMAro0/mHkOccDBw7giSeewKeffmpGiSyRSGBpaQnxeBxPPvkkxsbGApWg2+RIsyJuFrNyhGm1Wsjn82h/axd49Vr4YXx8HJVKBdeuXYNt25iYmFhTZXnrrbdg2zY++OAD/3nhTz75BI7jhD6LvJZ865dPpsnJyY606Pbq1+nZCR5//HEA6Oi49nLv3j0zyGfeBDaKHLNSqXSk81ak9XrKmGkr0m8zj/Hhhx9idXXVn8fSaDQwNzeHXC5nRt00g1zfqVOnMD09jRMnTmDv3r0oaHM2ZREGszzJq5fLly/j1Vdfxeuvv45kMtl3bgk2sBz16wjq1nPMtbTbol/but33QNMgZWojyIeGV65cWXM6p1IprKysIJ/Po9VqBTrD68n39Ygy4FtPe16tVrGwsNAxSJKV9c6cOROYd9OLOcDr1XfZ7PJh9slkjs7Jkyfx8ssv+4subIY7d+4EfrJFf12+fNmM/kDaMQMdYU7EErt27TKDfDIxbHV1FSsrK8hkMh2VYFCJRALT09Oo1+vYtWsXnn/++UBDf+PGjUB8nXx6spn6fQprWRa+//57MxiI8KNX+idOi4uLcBwncuMjEokE3n77bSwuLmL37t3+J616xduIfOuXT8NsfHwctm2HfhrVT68JyQ899JAZ1NcXX3xhBqHantwt+/vhhx/MKGg0GgOf+yA2ooyF2ej0C7MZxxgfH8eBAwfw8ccfIxaLwXEcpNPpNf/mTjefffaZGQTP8wKTaKNeXyaTwcrKCqanp3HmzBn86U9/ArR2Nqyj2a+NGxkZweTkJL777jscPnwYr732WsciB7rNKEf9VsvbqGMO2naLfm3rdt8Dw0QtU+shg5ByuQwASKfTkdJ4or0Aj2lychKO4/gLy2xUvq9Hr/7WetrzkydPdv0A1nEctFqtgb8N3LNnj/93v77LZpYP6ZPV2j/58Morr+Dy5csd36gOamFhIbR8SRu3a9eurh929msHHxQ7ZqAjy3maK+bIwOfNN98MhOtu3bqFpaUl7N+/39y0JvqnholEAqVSCbZt+z9qms1m0Wq1OgrRt99+C8uycPDgwUB4FP1uesLzPNy4caPvj74dOHAAMzMzHed49uxZ/OY3vwmE6fTVRVKpFObm5tBqtXDr1q1APN1PP/1kBqFWq+Hjjz/G4uKi35CVSqXAJx/rzbd++fQgkB9b+/Of/xzaGAp5DCKVSnVd5ebmzZtwXTfyt6holxHLsjAzMxP4kMLzPFy8eBGJRAL79u2DZVmYmJjo+CDjgw8+6PkJ4Hqtt4yZNjr9wmzmMc6ePQvbtv16uZ4fFkWXTnQ6ncbS0lJH2/Puu+/imWeeGej69PYok8lgenra7xA+++yzQEhH0/M8fP311/7/pmp7tS1oA55sNotr166ZUX0bWY6k/Z2bmwtNP7HeY/72t78F1vgYWb+2dTvvgWEGKVPrdfToUeTzeYyPj+PTTz/F0tIS3n33XTNah0aj0bFalk5+62y9+T4Is+Mvg5Q//OEPgXDdWtvzarWKlZWVrk+U/OMf/wAAvP/++z3rhbh+/Tosy8ILL7wA9Om7bGb5MPtkCwsLaLVafvu0Hq+88grQbjt1pVLJH/zu378f9Xq9YyBdq9XWVaeGijlpZzPJxKpuE9ZkMpu5eoQ5ocpxHGVZliqXyyqbzfqTOB3HUeVyWRWLRX/CpaxoobTJnuZkMpNMxNRXttEnp8lkM301m0p75R59AltTW11GX2RBn8xYqVT8FVLQngwpcV3XDUxqk/QwJ57JJH99op2s6iPh+fYKIeZkPZPruiqrrQYj5yr/S1q4rqsqlYrK5/P+BMZ0Ou2nh7zPdV3/ldNWh1FafvTLN5mgZ557v3x6UEi9sm1bFYvFQN2SOqJPHJWJio6xao5lWYFyKvmqT6qUPNMnk8rxLcvy89jWVtUx42TbK+e4rhs4L6n/+jlI2dYnCevnlcvlVL1e9/dvTq6NWsbC9qm0sqenwUanX5iox9BX4TEn64aRNkWvl/l8XuXz+UC5CWtTlPp5Aq1MRC4Wi349l/xuNpuBtkfPaz0Po16fXFdTW3FInzgs+WO3F8SQNiHs/iKkrZa8r7dXRdLvM2u9x0TNc719lHPV63G5XI50zGaz6dcbvS4pbZK3eQ9x25O489q9xtSvbd2qe2BYvdSvWd9n1DIVNY9MzfZKXjnjPiTnbfZTTFL39LrWbDb9tJB0i5LvSktD/Trq2uR6vR2U9+t5g3Z7LPlXb/cvzDQIa1+itOc62bfZnuia7YVEJC3l/KXs6XVF2if9eG6fvkvU8tGtv6Ei9sn0trPS7iNJnSu2Fz2Ra+2WT5InelmXNjRrrCanx3HaK+jlcrmOfHyQbdlARwqw/jIzotlsqlzu59V5pBDoN0dRLBaV1V6Gz2wQpRBKQ+y2Oz5SWfSXFCaTXjDlPMxORL1e9wulFDCzkpvHk2tpNpv+/uUa5MZSLBb9gl+v11U2m/VvFGHpIZVZf4nl5WX/HK12J7SfdHuJb/26zHTS01oqrpyb3oBLA2CeH7S075dvej4gpLPQL58eFGZZkfSQzoGpoi3RinajrDf2Yeneq6yVy2X/2GFlRuLIMe32oEyY+zXzVs5Btcu13V6uU+9sh52XilDGwvapQtJAr3sbnX5h+h0jrE1Dj3ZNadeplxN5We3ln3udp7S90DoCVruzo5/b8vJyoI0Lq5f9rk+1V0rSzzWdTneU57yx3Ky5D5McV65D2ka9w7GWe8ygeT47O+uft+u6ark9QNTrbL9jmvs27w/6fcpqd7Klbun1z2TWv7A83Ip7YFi9NPepl/d+ZWrQPNLp75Vjmu91e3QupYwV26tk6e8x62y/fA+7jrD2ICxM8gDt9JF9hdWDsOOIXu25yTwHU9h56vGK7WWeJdzMVxWx77KW8qEz77N2SJ/MLNuVSsUfZOXaA3vzOsPC9Loig6+wPNLjSJuWbi+zTT+LqZ8LIdGGKpVKuHv3rr9qnvA8z19ZpdtX2ES0OSYmJnDkyJGOxzQajQZyuRzefPPNro+eENHwiMViyOfzvA/T0Nsxc3RoeDQaDbz22muhz2mPjIxgz549eO6558xNRLSJSqUSFhcXOwY5aM/DsG275/w9IiKi+w0HOrTh/ve//wEAxsbGUCqVUK1W/dfU1BT+/e9/81Njoi329ddfY2lpCZlMBvPz836dnJ+fRyaTwRNPPNGxTCoRDR9ZRCBsdUSiYcNH12hTVKtVfPTRR7hy5Yr/mwvpdJqPxhBto1KphAsXLvgrl1mWhUwmg7feeivSb2gQ0f2tUCh0/IBlpVLhfZmGFgc6REREREQ0dPjoGhERERERDR0OdIiIiIiIaOhwoENEREREREOHAx0iIiIiIho6HOgQEREREdHQ4UCHiIiIiIiGDgc6REREREQ0dDjQISIiIiKiocOBDhERERERDR0OdIiIiIiIaOhwoENEREREREOHAx0iIiIiIho6HOgQEREREdHQ4UCHiIiIiIiGDgc6REREREQ0dGJKKWUGEtHm+9vf/ob33nsPsVhsW18AOsK247UTzmMnnENsh5wHz+H/XttxHkREtH4c6BBtI6XUtr14/O07/oN6bLXNx9/OY6sBjx828DHDtuO1E85jJ5xDbIecB8/h/1474Ty24hxoMBzoEBER7TDmwGcjXpu13yiv7Ty22ubjb+ex1TYffzuPrbb5+Jt1bHPgE/bCOgdcv/zlL7G0tIRhwIEOEREREdF9wBz4dHsNEtd8/eIXvzAPe9/iQIeIiIiIiIYOV10jIiIiIqKhw4EOERERERENHQ50iIiIiIho6HCgQ0REREREQ4cDHSIiIiIiGjoc6BARERER0dDhQIeIiIiIiIYOBzpERERERDR0ONAhIiIiIqKhw4EOERERERENHQ50iIiIiIho6HCgQ0REREREQ4cDHSJ6YFSrVUxMTGBsbMzctKU8z8PZs2eRTCZRrVbNzQ+ERqOBTCaDWCyGWCyGiYkJeJ5nRouk0WigUCg80Om5HUql0qaneaPR2NI6Oz8/j0wms+HHm5iYQDweX3MZJ6K14UCHiIaC53k9OyeNRgNod862261bt3D79m3U63Vz0wPB8zwcOHAA77zzDpRSmJ2dxczMDL766iszaiT37t3DzZs3H9j03A6lUgkXLlzY1DRvNBr4/PPPMTMzY27aFDIImZubMzetm2VZZhARbQEOdIhoKJw/fx4LCwtdP11OJBJIpVJ4+umnzU1bLpVK4cUXXzSDHxiff/456vU69u3bBwA4cuQIlFIYHx83o0ayb98+PPXUU2bwA8XzPBQKBTN402QyGZw4ccIM3lCJRAKTk5NwXdfctClGRkbWXAZ1U1NTZhBOnTqF1dVVjIyMmJuIaBNxoENEQ+HcuXMAgJMnT5qbaIf58ssvzSBap/Pnz5tBtA08z9uyb6CIqD8OdIjovlcqlXDgwAHYto2FhQXUajUzCu0gd+7cMYNoHWq1Go4fP24G0zY4evQoWq2WGUxE24QDHSK67504cQJvvfWW/23O2bNnzSgdZE5PLBZDMpnE/Px8YPv8/DySySRisRhGR0cxOjra8VicTICXfRQKhcBk41Kp5E9srtVqSCaTiMfj/nwhPV48Hu86Kb9QKPjb4/F4IE6j0cDU1JQ/KVw/77BHaKrVat9FAKrVKkZHR/3jTU1NdcQJMz8/H3jfxMRE4FoLhQJisRgWFhYAwD8HM111nuf5E7klvv4y01LocWT/cvxYLNbxmFeUdOl3fRKnX7mRhShi7XITpbzqZWBsbAzJZBJoH+/JJ58EABw/fjxwbbVazS/jcj56OZfFOeLxeOAY8Xg8dC6bef0XL140owx0TL0OShwzv8fGxjryIYy8T85tbGwMmUwmEKdWqwXyOJPJdOSNqVqt+vFjsZgfrl+j7GN0dNSf36PHN9NZZ6apWabM9/bLIyIyKCKi+1ixWFSu6yqllGo2m8qyLAVA1et1M6pSSinXdZXjOCqdTqt8Pq+y2awCoACocrmslFKqXq8rAKpSqSillKpUKsqyLP9/pZRKp9PKcRz/OLOzswqAchxHqfa5VCoVPyyfz6t8Pq9s21b1et3fls1mVTab9bfp+1BKqXw+rwCo5eXlwP+zs7NKKaWWl5f9a8jlciqfz6tKpeKHFYtFf1/lcjlwHXIOkn4SJ+y6stmsHyfM7Oxsx74ty1KWZXXkheu6Kurtx3VdP82Udv3m+Ui4mUdmWLFYVABUPp/3w6KkS5Tri1JucrmcymazqtlsqmazGZpPpmKxGEgDyRMh56tfk9SFdDqtVPvcbNtWlmUF3uc4jv/eYrEYCNPzTdJNyp1cm369az2mbduqXC6rZrOpHMfxy5+ePnpehMlmsyqdTgfSVX/P8vJy4Pzr9bp/HlLvhXm8ZrPp102dnJuev2FlW79mXZQyFZZe3fKIiDpFu9MQEe1QjuMEOhrS4c3lcoF4QjrOzWbTD5OOogww5H89jnQw5G9ogw8R1mkFoGzbDsRT2jGk4yWkoySdr1wuF+goqvY+9U6tXLPeYZNOtx7Ptu2OdJGOpR7H7Pj161TJscxrkXQyByVhncEw0jnVr0EppSzL6uj4hg10wsIk3QdJl6jX16/cyH707c1mU6FLGRH5fD6QR6pd1kTYNdXrdWVZVuCcJT10khfmOevpJgMYM41kwKVf3yDHNMuTxNXPRXXJb5Pruh3np6eRbdv+AExIfphpj5CBVViZDStfYfHCwqOWKRUxj4goHB9dI6L7ljwykkql/LCDBw8CAGZmZro+8pJMJgOrH6VSKTiOg6WlpcD/Y2Nj/iM1mUzGP86lS5eA9mpfuiNHjgAALly4EAiXx4zCPPbYY4H/jx07BgD45ptvAG21Jk/77Z1uHn74Yf/vRCIR2FatVlGv1ztWe1tcXMTi4iLQfrSnXq/jpZdeCjyuI+ny448/Bt4rrl69CoRcSyaTgWVZa56c/dBDDwEAvv/++0C4bduB/9cjSrpEvb5+5Ub2s3v3bj9td+/eDQA9l2k+ePAg6vU6MpmMP/9senrajBaQSCSwurqKI0eO+I8/9ZrHo9eHRx99NLDt6tWraLVaHWlkpsegxzTL6Llz5+C6bsfKZFFWSjx27BhOnz6NQqHgP/olaSTl2lyZL5FIIJ1Oo16v932EbaNFLVO6XnlEROE40CGi+9bJkyextLQU6JRLJ7jVag20EpXZubp8+TJeffVVvP7660gmk4Hn4btNpjcHPmuhD1ZEoVDAM888g7t37+LKlSvm5g1z7949AEClUkH7G//ASx9Q6u7evWsG+aJ0UrtJJBLI5/MolUp+R7RarWJpackfEG6FQa6vV7mR/ZjpKq9uEokElpaWEI/H8eSTT2JsbCxSx1zmy5w8eRIvv/wy8vm8GSWS27dvm0FdreeYvQZ7/YyPj6NSqeDatWuwbTsw10XKdRhz8LNVBilTRLR2HOgQ0X2pWq3ixo0baDabHR3GcrkMADhz5oz5tp70bwpGRkYwOTmJ7777DocPH8Zrr73WMYG92+puu3btMoMGtmfPHqD9i+rnzp3DV199hcnJyY5PwQf1xRdfmEGoVqtoNBr+Nyg//PCDGQWNRqNv5/rbb781g4B1/ljiG2+8Adu2cejQIcRiMRw6dAjFYnFDfu9E1ytdRJTr61VuHnnkEUD78Vpdv4nliUQC09PTqNfr2LVrF55//vme+VGr1bB//3688soruHz58oak108//WQGBWzEMbt9CxtFKpXC5cuXUalUsLi4CMdxAvu7efNmIL5Oyv5Wi1KmiGjtONAhovvSyZMnMT093fFNDNqf7rqui1arFWlFK8/zcOPGDRw+fBhod3Dl0SPpuGazWVy7dg0AcOjQISBkdTcZ+Lz55puB8EFcv34dlmXhhRdeANqP4DmOE3qdg0ilUv4jMfoAzfM8XLx4EYlEAvv27YNlWZiYmOgYxH3wwQddv9GRxwXff/99cxNu3LiBv/71r2ZwZEePHsV7772HlZUVKKWwsrLSsZrWIMzOepR0iXp9/crNs88+CwBIp9OBDrjnefj666/9/036an6JRAKlUgm2beP69etmVN/CwgJarZZ/zPV4/PHHAQCffPKJuSlgvceUx0fNsheFvsJgKpXC3NwcWq0Wbt26hVQqBdu2MTc31zHIvHnzJlzXXdO3sb2+leknapkionUyJ+0QEe10MgnaXAxAl8vlFICOVa9c1w1MmJbVl/TJ3pX26kf6Kmy2bQcmCMsEfXM/ehyZcKyvoiRkArnruv42uS59MQBZhalYLKpyuexfl+u6/qIHEqZPbJaJ/PqkapnALBPL8+2V3vT00eNk26vBua7bsUCBSc7BXFHMcZzAJGpJy375J9CeLO66rnJd118tb3Z2NrBfWWFNTwM9jSuVisrn8/55ptNp/7qjpEuU64tSbmTBClkAQRYaMMuHTuJIesl1Sf7LggaO46hyueynj36dko/yPrk2Kcd6Xsh79cUN5L25XM6/fjMtoxyz2V5ZDSGrncl16WlfqVT88lIul7umk+u6KpvN+ttloQD5v1wu+2mk1zfLsgLXLvXGNhYskf3lcjlVqVRULpfzy1w+n/f3odfFXC6n6u3V48LSOUqZUgPkERF14kCHiO4r0uGQV9iNXjpXYfHq9brKZrN+58m27Y59VNrLt1rt5XOlA6x3PqSjJ3HM/UinTX/pHWelLY0t29PpdEfnv1gs+seQc3AcR9m2rZaXlzuu1XXdjjSC9plWuVz2r90xVqzT40jnyrZtv0Pdz+zsrL9vGSiFdRbNVy+zs7OBvDCvVYXktz64k86kDBal45zP5wOd5ijp0u/6opQb1U4H/Vhmnpv0AQPaeaIP6JR2na7r+p1meY8MHKSzn2uvTqanGdp1pFtamuU9m836aSaDzrUeUydpKPsol8v+ICYsT4Qs9y77DctDfd8IqW+96qx5bcvLyyrfHoAWi0U/j5eXl5XdXlJb6k23faoIZcp8b688IqJOMdVrBiQREdE28TwPR48exT//+c+OR/dqtRr++Mc/YmVlJRBOREQkOEeHiIh2pHfffRe2bXcMctBe4e7AgQNmMBERkY/f6BAR0Y40OjqKpaUl5HK5wG+4/PDDD7hw4QLy+fyaJpETEdGDgQMdIiLakTzPw/nz5/HZZ5/5P1pq2zYOHz6MN954I/SbHiIiIsGBDhERERERDR3O0SEiIiIioqHDgQ4REREREQ0dDnSIiIiIiGjocKBDRERERERDhwMdIiIiIiIaOhzoEBERERHR0OFAh4iIiIiIhg4HOkRERERENHQ40CEiIiIioqHDgQ4REREREQ0dDnSIiIiIiGjo/H8yi7ZHpZfOuQAAAABJRU5ErkJggg==\"\u003e\u003cbr\u003e\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\n \u003ch2\u003eRoot architecture analysis\u003c/h2\u003e\n \u003cp\u003eThe root architecture of transgenic lines expressing \u003cem\u003eTaNAC2-5A\u003c/em\u003e was analyzed. T\u003csub\u003e2\u003c/sub\u003e seeds from the transgenic and control lines were germinated on damp filter paper for five days. Seedlings were transferred to containers containing 15 L of Hoagland\u0026rsquo;s nutrient solution in a climate-controlled room at 18\u0026thinsp;\u0026plusmn;\u0026thinsp;1\u0026deg;C. The nutrient solution was refreshed biweekly, and the roots were aerated using air pumps. After five weeks, PCR-positive transgenic plants were identified. Roots were separated, rinsed with distilled water, stained with methyl violet (0.1 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) for one minute, and scanned on a gray\u0026ndash;white scale. Root characteristics, including length (cm), surface area (cm\u0026sup2;), volume (cm\u0026sup3;), average diameter (mm), and projected area (cm\u0026sup2;), were analyzed using Epson WhinRhizo software.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\n \u003ch2\u003eStatistical analysis\u003c/h2\u003e\n \u003cp\u003eAll statistical analyses were performed using SPSS (version 25.0) and the Agricolae package in R (version 4.4.2) for the randomized complete block design (RCBD) during field analysis of agronomic traits in transgenic lines. Three independent replicates were used for each treatment. The normality of the data was assessed using the Shapiro-Wilk test, while Levene\u0026rsquo;s test was used to evaluate the homogeneity of variances. A one-way analysis of variance (ANOVA) was conducted to compare group means. When equal variances were assumed, Dunnett\u0026rsquo;s test was applied for multiple comparisons, whereas the Games-Howell test was used when variances were not equal. Significance levels were indicated as follows: \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;0.05 (single asterisk *), \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;0.01 (double asterisks **), and \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;0.001 (triple asterisks ***), reflecting increasing levels of confidence in the results, with \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05 represented as \u0026ldquo;ns\u0026rdquo; denoting non-significant differences.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eVerification of\u003c/b\u003e \u003cb\u003eTaNAC2-5A\u003c/b\u003e \u003cb\u003ein pSB219M-PT\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe incorporation of \u003cem\u003eTaNAC2-5A\u003c/em\u003e into the pSB219M-PT vector was confirmed by PCR-based, restriction digestion-based verification, and DNA sequencing analysis. Plasmids isolated from individual colonies were subjected to PCR amplification using full-length gene-specific primers (NAC2F/NAC2R), resulting in a 990 bp product corresponding to the complete \u003cem\u003eTaNAC2-5A\u003c/em\u003e gene (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Further validation was performed through restriction digestion analysis using \u003cem\u003eSgr\u003c/em\u003eDI and \u003cem\u003eSwa\u003c/em\u003eI enzymes, which released a 990 bp gene fragment along with an 11.5 Kb vector backbone (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea). \u003cem\u003eHin\u003c/em\u003eDIII and \u003cem\u003eAsc\u003c/em\u003eI digestion confirmed the integration of the complete \u003cem\u003eTaNAC2-5A\u003c/em\u003e cassette (~\u0026thinsp;2.4 kb), comprising the 2X35S promoter, \u003cem\u003eTaNAC2-5A\u003c/em\u003e gene, and CaMV terminator (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb, S2a and S2b). Sequencing was performed to verify the integrity and orientation of the genes. Chromas Lite software was used to analyze the sequencing data, and ClustalW was used for sequence alignment. The results confirmed that the cloned \u003cem\u003eTaNAC2-5A\u003c/em\u003e gene sequence matched the original sequence with no base mutations.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eTransient expression analysis in\u003c/b\u003e \u003cb\u003eNicotiana tabacum\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe functionality of the \u003cem\u003eTaNAC2-5A\u003c/em\u003e cassette was evaluated by transient expression in \u003cem\u003eN. tabacum\u003c/em\u003e. The transformed AGL1 cultures containing the pSB219-NAC2 vector were used to infiltrate the tobacco leaves. The tobacco leaves were used after 72 hours to extract total RNA that was digested with \u003cem\u003eDNase\u003c/em\u003e 1 to remove the DNA. The RT-PCR showed that \u003cem\u003eTaNAC2-5A\u003c/em\u003e transcripts were detected by a 279 bp amplicon product (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). This confirmed that the gene cassette was functional and expressing in the model plant.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eWheat transformation\u003c/h2\u003e \u003cp\u003eTo transform the embryos with pSB219-NAC2 cassette, a total of 2500 immature embryos were excised from each variety FSD-2008 and Galaxy. Of these, infection with FSD-2008 was successful in 1350, and with Galaxy, in 1300 embryos. Following the infection 1150 calli of FSD-2008 and 1220 calli of Galaxy were transferred to Murashige and Skoog (MS) medium containing Rocephin (100 mg mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) to control overgrowth of \u003cem\u003eAgrobacterium\u003c/em\u003e. Afterwards, 1020 calli of FSD-2008 and 873 calli of Galaxy were able to regenerate on MS medium containing kinetin 1 mg mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e. The 274 plantlets were obtained from FSD-2008 and 290 plantlets from Galaxy at a BASTA concentration of 3mg L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e. Fifty-six plantlets were transferred to artificial soil for hardening of FSD-2008 putative transformants, while seventy-five were from Galaxy transformations. A total of three transgenic plantlets of FSD-2008 and four of Galaxy were able to survive the final selection before further evaluation (Table S6).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eTransgene screening\u003c/h2\u003e \u003cp\u003eGenomic DNA was extracted from the T\u003csub\u003e0\u003c/sub\u003e, T\u003csub\u003e1\u003c/sub\u003e and T\u003csub\u003e2\u003c/sub\u003e putative transgenic wheat plants carrying the \u003cem\u003eTaNAC2-5A\u003c/em\u003e gene, as well as from non-transgenic controls. PCR-based screening of T\u003csub\u003e1\u003c/sub\u003e transgenics was performed using maize \u003cem\u003eubiquitin promoter::ubiquitin intron\u003c/em\u003e specific primers (UbiF1/ UbintR1) giving an amplification product of 520 bp (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). However, T\u003csub\u003e2\u003c/sub\u003e transgenics were screened using primers specific to the \u003cem\u003eubiquitin promoter\u003c/em\u003e::\u003cem\u003ebar\u003c/em\u003e gene junction (UbiF2/BastR2) and CaMV terminator-specific primers (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The PCR reaction produced an expected 1 Kb Ubi-\u003cem\u003ebar\u003c/em\u003e fragment, which confirmed the presence of the transgene in the putative transgenic plants (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eSeven transgenic events were obtained and named as NAC2-1, NAC2-2, NAC2-3, NAC2-4, NAC2-5, NAC2-6, and NAC2-7. Of these, three events (NAC2-4, NAC2-6, and NAC2-7) originated from the FSD-2008 parent line, while four events (NAC2-1, NAC2-2, NAC2-3, and NAC2-5) were derived from the Galaxy parent line. In T\u003csub\u003e1\u003c/sub\u003e screenings, only three events, NAC2-1, NAC2-2 (Galaxy) and NAC2-4 (FSD-2008) tested positive. Table S6 and Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e show the positive T\u003csub\u003e1\u003c/sub\u003e transgenic lines obtained from these three events, where lines L2, L3, and L4 in NAC2-1 (Galaxy), lines L1 and L2 in NAC2-2 (Galaxy), and lines L1, L4, L5, L6, L7, and L8 in NAC2-4 (FSD-2008) were confirmed as PCR-positive (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). The seeds from these lines were then collected for propagation and T\u003csub\u003e2\u003c/sub\u003e screening, including expression studies, agronomic trait evaluations, and biochemical assays.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eBASTA leaf paint assay\u003c/h2\u003e \u003cp\u003eThe BASTA leaf paint assay confirmed the resistance of the putative \u003cem\u003eTaNAC2-5A\u003c/em\u003e transgenic wheat plants to the herbicide phosphinothricin. Six-week-old transgenic plants were painted with a 0.005% w/v solution of BASTA, targeting a 4 cm area of the leaf. Observations recorded after 7\u0026ndash;10 d revealed that transgenic plants leave remained green with slight brown lesions on the painted areas, indicating successful integration and expression of the \u003cem\u003ebar\u003c/em\u003e gene, which confers herbicide resistance. In contrast, the non-transgenic control plants, Galaxy and FSD-2008, showed complete browning of the painted leaf area, signifying the absence of the \u003cem\u003ebar\u003c/em\u003e gene and a lack of resistance to BASTA (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ea and \u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eb). The plants that survived the BASTA assay were subsequently validated as true transgenics through PCR-based screening, targeting the Ubi-bar junction primers.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eExpression analysis of\u003c/b\u003e \u003cb\u003eTaNAC2-5A\u003c/b\u003e \u003cb\u003ein wheat transgenics\u003c/b\u003e\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003ePrimer validation for qRT-PCR\u003c/h2\u003e \u003cp\u003eFor qRT-PCR analysis of \u003cem\u003eTaNAC2-5A\u003c/em\u003e transgenics, three primer pairs were designed to generate nine unique combinations (Tables\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e and S3). These combinations were validated using pooled cDNA synthesized from the total RNA extracted from different \u003cem\u003eTaNAC2-5A\u003c/em\u003e transgenic wheat lines. All nine primer combinations were tested under standard PCR conditions and the amplification products were analyzed on an agarose gel. Strong amplification bands with negligible primer dimer formation and no non-specific amplification were identified (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003ea). RT-PCR was repeated to confirm the reliability of the primers and to eliminate false positives (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eb). Based on the consistent performance, primer pair 4 (NAC2qRTF2/NAC2qRTR1) was selected for further qRT-PCR studies. This pair demonstrated robust amplification with minimal background noise, ensuring the accurate and reproducible quantification of \u003cem\u003eTaNAC2-5A\u003c/em\u003e gene expression in transgenic wheat lines.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eTaNAC2-5A\u003c/b\u003e \u003cb\u003eexpression analysis by qRT-PCR\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe relative expression levels of \u003cem\u003eTaNAC2-5A\u003c/em\u003e in transgenic wheat lines were analyzed using qRT-PCR with the ΔΔCT method. The amplification results for the selected transgenic lines are shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e and the expression data are summarized in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. The cDNA samples for each transgenic line were run in four replicates to ensure accuracy and reliability. The analysis revealed varying levels of \u003cem\u003eTaNAC2-5A\u003c/em\u003e expression across different transgenic events. The relative fold increases were as follows: NAC2-1(L2) 0.99, NAC2-4(L5) 0.87, NAC2-4(L6) 2.25, NAC2-2(L1) 1.68, and NAC2-4(L7), 1.41. Among these, the NAC2-4(L6) transgenic line (parent FSD-2008) exhibited the highest relative expression level, with a fold increase of 2.25, indicating successful overexpression of the \u003cem\u003eTaNAC2-5A\u003c/em\u003e gene. The earlier Ct values observed for NAC2-4(L6) highlight enhanced gene expression compared with the other transgenic lines. This variation in expression levels among the lines emphasizes the influence of transgene integration sites or other regulatory factors on transgene expression.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eRelative fold increase of the \u003cem\u003eTaNAC2-5A\u003c/em\u003e gene in different transgenic wheat lines\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePlant Lines\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRelative Fold Increase\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGalaxy\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFSD-2008\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNAC2-1(L2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.99\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNAC2-4(L5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.87\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNAC2-4(L6)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2.25\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNAC2-2(L1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1.68\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNAC2-4(L7)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1.41\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003eAgronomic trait analysis\u003c/h2\u003e \u003cp\u003eThe agronomic performance of T\u003csub\u003e1\u003c/sub\u003e and T\u003csub\u003e2\u003c/sub\u003e \u003cem\u003eTaNAC2-5A\u003c/em\u003e transgenic wheat lines was assessed and compared with that of the parent lines FSD-2008 and Galaxy. Key agronomic parameters, including plant height (cm), spike length, tiller number, grain number, and 1000-grain weight (g), were recorded for each transgenic plant separately. In T\u003csub\u003e1\u003c/sub\u003e transgenics, 5\u0026ndash;8% increase in grain weight was observed in three transgenic events. Among the T\u003csub\u003e2\u003c/sub\u003e transgenic lines from NAC2-4 transgenic event, NAC2-4(L6) exhibited a significant 17% increase in 1000-grain weight compared with the parent line FSD-2008 (Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e4\u003c/span\u003ea and b). This improvement highlights the positive impact of \u003cem\u003eTaNAC2-5A\u003c/em\u003e overexpression on the grain yield potential. To facilitate further studies and seed multiplication, T\u003csub\u003e2\u003c/sub\u003e seeds from \u003cem\u003eTaNAC2-5A\u003c/em\u003e transgenics were collected and stored in labeled brown envelopes, each indicating an independent event. A small quantity of Boric acid was added in the envelopes to protect the seeds from wheat weevil attack and enhance seed longevity.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003e\u003cb\u003ea\u003c/b\u003e Analysis of agronomic traits in \u003cem\u003eTaNAC2-5A\u003c/em\u003e harboring T\u003csub\u003e1\u003c/sub\u003e wheat transgenic lines\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTransgenic Events\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePlant Height (cm)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNo. of Tillers/ Spikes per plant\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAverage Spike Length (cm)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eTotal No. of Grains\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1000 Grain Weight (g)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003e% Increase in Grain Weight\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eFSD-2008 (Control)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e81.15\u0026thinsp;\u0026plusmn;\u0026thinsp;1.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e22\u0026thinsp;\u0026plusmn;\u0026thinsp;0.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e10.4\u0026thinsp;\u0026plusmn;\u0026thinsp;0.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e790\u0026thinsp;\u0026plusmn;\u0026thinsp;1.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e32.2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eGalaxy (Control)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e82\u0026thinsp;\u0026plusmn;\u0026thinsp;2.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e19\u0026thinsp;\u0026plusmn;\u0026thinsp;0.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e10.2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e810\u0026thinsp;\u0026plusmn;\u0026thinsp;2.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e31\u0026thinsp;\u0026plusmn;\u0026thinsp;0.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eNAC2-1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e86\u0026thinsp;\u0026plusmn;\u0026thinsp;1.9\u003csup\u003e\u0026dagger;\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e25\u0026thinsp;\u0026plusmn;\u0026thinsp;1.3\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e12.5\u0026thinsp;\u0026plusmn;\u0026thinsp;1.05\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1060.8\u0026thinsp;\u0026plusmn;\u0026thinsp;1.2\u003csup\u003e\u0026dagger;\u0026dagger;\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e32.7\u0026thinsp;\u0026plusmn;\u0026thinsp;0.25\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e5.48\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eNAC2-2\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e89\u0026thinsp;\u0026plusmn;\u0026thinsp;3\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e21\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u003csup\u003ens\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e11.8\u0026thinsp;\u0026plusmn;\u0026thinsp;0.77\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e977.5\u0026thinsp;\u0026plusmn;\u0026thinsp;2.6\u003csup\u003ens\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e33.35\u0026thinsp;\u0026plusmn;\u0026thinsp;0.15\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e7.58\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eNAC2-4\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e82.5\u0026thinsp;\u0026plusmn;\u0026thinsp;2.09\u003csup\u003ens\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e27\u0026thinsp;\u0026plusmn;\u0026thinsp;1.6\u003csup\u003e\u0026dagger;\u0026dagger;\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e11.6\u0026thinsp;\u0026plusmn;\u0026thinsp;0.29\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1156.5\u0026thinsp;\u0026plusmn;\u0026thinsp;1.9\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e34.8\u0026thinsp;\u0026plusmn;\u0026thinsp;0.15\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e8.07\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003e\u003cb\u003eb\u003c/b\u003e Analysis of agronomic traits in \u003cem\u003eTaNAC2-5A\u003c/em\u003e harboring T\u003csub\u003e2\u003c/sub\u003e wheat transgenics\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTransgenic Events\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePlant Height (cm)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNo. of Tillers/ Spikes per plant\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAverage Spike Length (cm)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eTotal No. of Grains\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1000 Grain Weight (g)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003e% Increase in Grain Weight\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eFSD-2008 (Control)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e83.82\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e24\u0026thinsp;\u0026plusmn;\u0026thinsp;2.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e10.6\u0026thinsp;\u0026plusmn;\u0026thinsp;0.16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e860.2\u0026thinsp;\u0026plusmn;\u0026thinsp;3.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e32\u0026thinsp;\u0026plusmn;\u0026thinsp;0.33\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eGalaxy (Control)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e82.2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e21\u0026thinsp;\u0026plusmn;\u0026thinsp;1.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e9.6\u0026thinsp;\u0026plusmn;\u0026thinsp;0.60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e910.2\u0026thinsp;\u0026plusmn;\u0026thinsp;2.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e30\u0026thinsp;\u0026plusmn;\u0026thinsp;0.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eNAC2-4(L6)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e85\u0026thinsp;\u0026plusmn;\u0026thinsp;1.2\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e45\u0026thinsp;\u0026plusmn;\u0026thinsp;3.0\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e13\u0026thinsp;\u0026plusmn;\u0026thinsp;0.9\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e1560.8\u0026thinsp;\u0026plusmn;\u0026thinsp;2.0\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e37.5\u0026thinsp;\u0026plusmn;\u0026thinsp;0.6\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e17.18\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eNAC2-4(L7)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e88\u0026thinsp;\u0026plusmn;\u0026thinsp;0.90\u003csup\u003e\u0026dagger;\u0026dagger;\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e43\u0026thinsp;\u0026plusmn;\u0026thinsp;2.2\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e12.8\u0026thinsp;\u0026plusmn;\u0026thinsp;1.9\u003csup\u003e\u0026dagger;\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e1650.5\u0026thinsp;\u0026plusmn;\u0026thinsp;3.2\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e35.9\u0026thinsp;\u0026plusmn;\u0026thinsp;0.9\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eNAC2-4(L5)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e86.5\u0026thinsp;\u0026plusmn;\u0026thinsp;1.6\u003csup\u003ens\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e37\u0026thinsp;\u0026plusmn;\u0026thinsp;1.2\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e11\u0026thinsp;\u0026plusmn;\u0026thinsp;0.9\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e1360.5\u0026thinsp;\u0026plusmn;\u0026thinsp;2.0\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e35.2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3\u003csup\u003e\u0026dagger;\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eNAC2-2(L1)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e84\u0026thinsp;\u0026plusmn;\u0026thinsp;1.6\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e33\u0026thinsp;\u0026plusmn;\u0026thinsp;1.6\u003csup\u003e\u0026dagger;\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e10.5\u0026thinsp;\u0026plusmn;\u0026thinsp;0.6\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e1450.5\u0026thinsp;\u0026plusmn;\u0026thinsp;0.9\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e33.2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.9\u003csup\u003ens\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e10.6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eData in Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e4\u003c/span\u003ea and \u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e4\u003c/span\u003eb are represented as the mean values\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error (SE) of three biological replicates. Statistical significance was determined using either Dunnett\u0026rsquo;s test or Games-Howell post-hoc test, depending on the homogeneity of variances as measured by Levene\u0026rsquo;s test. Asterisks (*, **, ***) indicate significance levels obtained through Dunnett\u0026rsquo;s test (*p-value\u0026thinsp;\u0026le;\u0026thinsp;0.05, ** p-value\u0026thinsp;\u0026le;\u0026thinsp;0.01, *** p-value\u0026thinsp;\u0026le;\u0026thinsp;0.001), while daggers (\u0026dagger;, \u0026dagger;\u0026dagger;) indicate significance based on Games-Howell test (\u0026dagger;p-value\u0026thinsp;\u0026le;\u0026thinsp;0.05, \u0026dagger;\u0026dagger;p-value\u0026thinsp;\u0026le;\u0026thinsp;0.01). \u0026ldquo;ns\u0026rdquo; indicates non-significant differences compared to the control (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05).\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003eBiochemical assays\u003c/h2\u003e \u003cdiv id=\"Sec25\" class=\"Section3\"\u003e \u003ch2\u003eEstimation of total chlorophyll content\u003c/h2\u003e \u003cp\u003eThe total chlorophyll content of \u003cem\u003eTaNAC2-5A\u003c/em\u003e T\u003csub\u003e2\u003c/sub\u003e transgenic wheat lines was significantly higher than that of the parent controls (FSD-2008 and Galaxy), which measured 86.34 mg g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e FW and 84.34 mg g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e FW, respectively. The chlorophyll content for the transgenic lines was as follows: NAC2-1(L2) (parent var. Galaxy) at 85.18 mg g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e FW, NAC2-4(L5) (parent var. FSD-2008) at 88.81 mg g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e FW, NAC2-4(L6) (parent var. FSD-2008) at 90.11 mg g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e FW, NAC2-4(L7) (parent var. FSD-2008) at 89.25 mg g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e FW, and NAC2-2(L1) (parent var. Galaxy) at 90.93 mg g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e FW. These results indicate a notable enhancement in the total chlorophyll content among the \u003cem\u003eTaNAC2-5A\u003c/em\u003e transgenic lines compared to the controls, reflecting improved physiological traits associated with photosynthesis (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec26\" class=\"Section3\"\u003e \u003ch2\u003eEstimation of total soluble sugars\u003c/h2\u003e \u003cp\u003eSoluble sugars were determined in four-week-old leaves of the \u003cem\u003eTaNAC2-5A\u003c/em\u003e T\u003csub\u003e2\u003c/sub\u003e transgenic wheat lines. The soluble sugar content for the transgenic lines was as follows: NAC2-1(L2) (parent var. Galaxy) at 9.2 mg g\u003csup\u003e-1\u003c/sup\u003e FW, NAC2-4(L5) (parent var. FSD-2008) at 11.2 mg g\u003csup\u003e-1\u003c/sup\u003e FW, NAC2-4(L6) (parent var. FSD-2008) at 12.04 mg g\u003csup\u003e-1\u003c/sup\u003e FW, NAC2-4(L7) (parent var. FSD-2008) at 9.93 mg g\u003csup\u003e-1\u003c/sup\u003e FW, and NAC2-2(L1) (parent var. Galaxy) at 10.09 mg g\u003csup\u003e-1\u003c/sup\u003e FW. These values were compared to the parent controls, Galaxy and FSD-2008, which showed soluble sugar contents of 8.07 mg g\u003csup\u003e-1\u003c/sup\u003e FW and 8.11 mg g\u003csup\u003e-1\u003c/sup\u003e FW, respectively. The results highlight a notable enhancement in the total soluble sugar content among the \u003cem\u003eTaNAC2-5A\u003c/em\u003e transgenic lines compared to the wild-type controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e11\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec27\" class=\"Section3\"\u003e \u003ch2\u003eEstimation of total proteins\u003c/h2\u003e \u003cp\u003eThe total protein content of the \u003cem\u003eTaNAC2-5A\u003c/em\u003e T\u003csub\u003e2\u003c/sub\u003e transgenic wheat lines was estimated using the BSA standard curve. The Galaxy control exhibited a protein content of 12.07 mg g\u003csup\u003e-1\u003c/sup\u003e FW. In comparison, the \u003cem\u003eTaNAC2-5A\u003c/em\u003e transgenic lines demonstrated the following protein contents: NAC2-1(L2) (parent var. Galaxy) at 18.2 mg g\u003csup\u003e-1\u003c/sup\u003e FW, NAC2-4(L5) (parent var. FSD-2008) at 14.04 mg g\u003csup\u003e-1\u003c/sup\u003e FW, NAC2-4(L6) (parent var. FSD-2008) at 14.04 mg g\u003csup\u003e-1\u003c/sup\u003e FW, NAC2-2(L1) (parent var. Galaxy) at 12.3 mg g\u003csup\u003e-1\u003c/sup\u003e FW, and NAC2-4(L7) (parent var. FSD-2008) at 17.1 mg g\u003csup\u003e-1\u003c/sup\u003e FW. These results indicated a significant increase in protein content among the transgenic lines compared to the control (Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e12\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec28\" class=\"Section2\"\u003e \u003ch2\u003eRoot architectural analysis\u003c/h2\u003e \u003cp\u003eRoot analysis of the \u003cem\u003eTaNAC2-5A\u003c/em\u003e T\u003csub\u003e2\u003c/sub\u003e transgenic lines was conducted using WhinRhizo software. The data in Table S7 highlights that the roots of \u003cem\u003eTaNAC2-5A\u003c/em\u003e transgenic lines NAC2-4(L6), NAC2-4(L7) and NAC2-4(L5), selected from the NAC2-4 transgenic event, exhibited significantly improved characteristics compared to the FSD-2008 control. These transgenics demonstrated longer roots with enhanced lateral projections, greater average root diameter, and increased volume, surface area, and projected area (Fig.\u0026nbsp;\u003cspan refid=\"Fig13\" class=\"InternalRef\"\u003e13\u003c/span\u003e, Table S7). These improved root traits indicate the potential of \u003cem\u003eTaNAC2-5A\u003c/em\u003e to enhance root structure and nutrient uptake efficiency in wheat plants.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eWheat is a staple crop that fulfills the nutritional needs of people all over the globe. The changing climatic conditions and increasing population make it critical to increase wheat production for fulfilling the caloric requirements of people. It is predicted that with every 1\u003csup\u003eo\u003c/sup\u003eC rice in temperature wheat yield decreases by 4\u0026ndash;8% (Shew et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). In order to meet the rising demand for wheat, the land area under wheat cultivation has been expanded in recent years in Pakistan. According to data from the USDA Foreign Agricultural Service (FAS-USDA Report, 10 October, 2024), Pakistan\u0026rsquo;s wheat-sown area fluctuated from 8,678 thousand hectares in 2019/2020 to 9,600 thousand hectares in 2024/2025, reflecting an effort to increase supply by opening more farmland for wheat cultivation. However, simply expanding cultivation area and relying on excessive fertilizer use to boost yields, is neither sustainable nor sufficient, especially amid climate extremes and limited arable land. There is a need to develop climate-smart wheat varieties through advanced breeding or transgenic technologies that offers a more viable path to sustain or even increase yields (Azhar et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Grosse-Heilmann et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). By focusing on more efficient gene expression and regulation, wheat plants can better withstand adverse climatic conditions, optimize resource use, and help ensure global food security without placing further strain on land resources (Challinor et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Li et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eTranscription factors (TFs) are essential for the efficient transcription of gene cascades (Yanagisawa, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e1998\u003c/span\u003e). In plants, TFs influence numerous genetic pathways and reside in specific genomic regions, such as quantitative trait loci (QTLs) and other regulatory domains (Ernst et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; Olsen et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). It is possible to mitigate plant stresses by targeting TFs involved in particular pathway. In this study, we aimed to develop wheat transgenics overexpressing the \u003cem\u003eTaNAC2-5A\u003c/em\u003e TF. This TF is involved in controlling the nitrate regulatory pathway, thereby enhancing nutrient utilization from soil, yield, and climate resilience. Nitrates serve as both an organic nutrient and an essential signaling molecule for plants. He et al. (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2015\u003c/span\u003e) indicated that the \u003cem\u003eTaNAC2-5A\u003c/em\u003e is essential for the expression of nitrate-responsive genes in wheat. These findings suggested that \u003cem\u003eTaNAC2-5A\u003c/em\u003e is an important modulator in the processes of nitrogen assimilation and its uptake which are both important for enhancing crop yield and nutrient efficiency of crops. To achieve this, we first designed and verified an expression cassette harboring \u003cem\u003eTaNAC2-5A\u003c/em\u003e gene and then transformed those cassettes in two widely cultivated wheat varieties of Pakistan, FSD-2008 and Galaxy.\u003c/p\u003e \u003cp\u003ePrior to introducing the expression cassette into wheat varieties, the gene cassettes were validated for TF transient expression in \u003cem\u003eN. tabacum\u003c/em\u003e. RT-PCR analysis detected a 279 bp fragment of the \u003cem\u003eTaNAC2-5A\u003c/em\u003e gene, confirming the cassette\u0026rsquo;s functionality in plant cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). The transformation efficiencies in the FSD-2008 and Galaxy wheat lines were low, yielding only seven transgenic events in FSD-2008 and four in Galaxy. T\u003csub\u003e1\u003c/sub\u003e seeds from each event were subsequently collected and cultivated in open fields at Forman Christian College, Lahore, following RCBD to produce T\u003csub\u003e2\u003c/sub\u003e seeds. Table S6 and Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e detail these independent events alongside the PCR-positive lines obtained from each. Transgenic lines L2, L3 and L4 from transgenic event NAC2-1 (parent var. Galaxy), lines L1 and L2 from transgenic event NAC2-2 (parent var. Galaxy), and lines L1, L4, L5, L6, L7 and L8 from transgenic event NAC2-4 (parent var. FSD-2008) were PCR positive. To ensure reliability, the PCR screens were performed with multiple primer sets, and the lines consistently found positive for the TF were used for expression analysis, biochemical assays, and root evaluation. Each PCR run included negative controls from non-transgenic (wild-type) plants and positive controls using the pSB219-NAC2 plasmid to ensure the specificity and reproducibility of the PCR results.\u003c/p\u003e \u003cp\u003eThe agronomic evaluation of T\u003csub\u003e1\u003c/sub\u003e wheat transgenics overexpressing the \u003cem\u003eTaNAC2-5A\u003c/em\u003e gene revealed significant improvements in number of tillers per plant, and grain yield per plant compared to the non-transgenic controls, FSD-2008 and Galaxy (Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e4\u003c/span\u003ea). Plant height was slightly increased in the transgenic events NAC2-1 (86 cm) and NAC2-2 (89 cm) compared to FSD-2008 (81.15 cm) and Galaxy (82 cm). This enhanced vegetative growth reflects the overall vigor conferred by the overexpression of \u003cem\u003eTaNAC2-5A\u003c/em\u003e. However, an increase in height can pose challenges in regions prone to strong winds, as taller plants are more susceptible to lodging, where plants bend or break under their own weight or external forces, leading to potential yield losses. NAC2-4 (82.5 cm), which exhibited a height comparable to the control FSD-2008, may offer a more stable phenotype in wind-prone environments.\u003c/p\u003e \u003cp\u003eThe number of tillers per plant, a key determinant of grain yield, showed substantial improvement across all transgenic lines. NAC2-4 (parent var. FSD-2008) demonstrated the highest number of tillers (27), significantly outperforming FSD-2008 (22). NAC2-1 also showed a marked increase of 25 tillers, while the tiller count for NAC2-2 was 21 compared to the Galaxy parent that had tiller count of 19. This increase in tiller number correlates directly with higher grain production per plant, highlighting the transgenics potential for increased productivity. A key highlight in agronomic trait analysis of T\u003csub\u003e1\u003c/sub\u003e transgenic lines was the percent increase in grain yield per transgenic event, measured as the 1000-grain weight. NAC2-4 (parent var. FSD-2008) achieved the highest percent increase in grain weight, with an 8.07% improvement over the control. This was followed by NAC2-2 (parent var. Galaxy), with a 7.58% increase, and NAC2-1 (parent var. Galaxy), with a 5.48% increase. These results underline the efficiency of \u003cem\u003eTaNAC2-5A\u003c/em\u003e in enhancing nutrient use efficiency and yield.\u003c/p\u003e \u003cp\u003eAfter the T\u003csub\u003e1\u003c/sub\u003e generation, transgenic lines from two events (NAC2-4 derived from FSD-2008 and NAC2-2 derived from Galaxy) were selected on the basis of higher relative expression in comparison to other transgenic lines and controls for T\u003csub\u003e2\u003c/sub\u003e agronomic trait analysis. This strategic selection is critical for developing stable, high-yielding wheat varieties. The agronomic data in Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e4\u003c/span\u003eb underscores significant improvements in tiller count and percent increase in grain yield in the T\u003csub\u003e2\u003c/sub\u003e generation of wheat transgenics overexpressing the \u003cem\u003eTaNAC2-5A\u003c/em\u003e gene.\u003c/p\u003e \u003cp\u003eThe relative expression analysis of \u003cem\u003eTaNAC2-5A\u003c/em\u003e in transgenic wheat lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e and Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e), measured using ΔΔCT in qRT-PCR, revealed significant variation in expression levels, which correlate directly with root architecture and agronomic traits, highlighting the influence of \u003cem\u003eTaNAC2-5A\u003c/em\u003e on plant performance. In T\u003csub\u003e2\u003c/sub\u003e generation, the highest expression level, observed in the NAC2-4(L6) line (2.25-fold increase), corresponds with its improved root surface area (1531.771 cm\u0026sup2;) and enhanced agronomic traits, including the production of 45 tillers per plant and a 17.18% increase in grain yield. These findings underscore the direct impact of high \u003cem\u003eTaNAC2-5A\u003c/em\u003e expression on improving resource uptake and overall productivity. Similarly, NAC2-4(L7), which exhibited a 1.41-fold increase in expression, displayed the longest root length (46 cm) and a 12% grain yield increase, further linking moderate expression levels to improved root penetration and grain production. In contrast, NAC2-4(L5), with a lower expression level (0.87-fold increase), demonstrated significant improvements in root volume (7720.079 cm\u0026sup3;) and agronomic traits such as 37 tillers per plant and a 10% increase in grain yield. This suggests that even moderate overexpression of \u003cem\u003eTaNAC2-5A\u003c/em\u003e can enhance resource uptake and yield-related traits through improved root architecture (Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e4\u003c/span\u003eb and S7). The variation in expression among lines, likely influenced by transgene integration sites or regulatory factors, reflects the direct relationship between gene expression, root structure, and agronomic traits.\u003c/p\u003e \u003cp\u003eThe biochemical assays conducted on the \u003cem\u003eTaNAC2-5A\u003c/em\u003e T\u003csub\u003e2\u003c/sub\u003e transgenic wheat lines revealed notable improvements in key physiological parameters, which correlate with the enhanced agronomic traits observed in the best-performing transgenic lines. For example, the transgenic lines NAC2-4(L6) and NAC2-4(L7) exhibited significantly higher chlorophyll content (90.11 mg g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e FW and 89.25 mg g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e FW, respectively) compared to the parent control FSD-2008 (86.34 mg g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e FW). This increase in chlorophyll content reflects enhanced photosynthetic capacity, which supports the higher tiller count and grain yield observed in these lines. In addition, NAC2-4(L6), which showed the highest expression of \u003cem\u003eTaNAC2-5A\u003c/em\u003e (2.25-fold increase), had the highest soluble sugar content (12.04 mg g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e FW), while NAC2-4(L7) also showed a significant increase in soluble sugars (9.93 mg g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e FW) compared to the control (FSD-2008: 8.11 mg g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e FW). Protein content was significantly higher in several transgenic lines, especially NAC2-4(L7) (17.1 mg g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e FW), compared to the controls (FSD-2008: 12.07 mg g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e FW) reinforcing the connection between enhanced sugar accumulation and higher protein levels to the improved biomass production and higher grain yield of these lines.\u003c/p\u003e \u003cp\u003eThe results indicate that the overexpression of \u003cem\u003eTaNAC2-5A\u003c/em\u003e has a significant impact on both physiological processes, enhanced nutrient uptake from soil and overall crop performance. The transgenics overexpressing \u003cem\u003eTaNAC2-5A\u003c/em\u003e exhibited considerable improvements in tiller number and grain yield per plant, making them highly promising candidates for addressing food security challenges. However, the increase in plant height, while reflective of greater vegetative vigor, may require careful consideration in breeding programs and selection of transgenic lines for future propagation to mitigate risks of lodging in regions with high wind exposure. The significant improvement in grain yield without a proportional increase in input requirements demonstrates the potential of these transgenics to contribute to sustainable agriculture.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn conclusion, this study demonstrates the successful overexpression of the \u003cem\u003eTaNAC2-5A\u003c/em\u003e gene in wheat, resulting in significant improvements in grain yield in T\u003csub\u003e2\u003c/sub\u003e generation. The transgenic lines NAC2-4(L6) and NAC2-4(L7) from the FSD-2008 parent showed impressive increases in grain yield, with NAC2-4(L6) achieving a 17.18% improvement and NAC2-4(L7) exhibiting a 12% increase in 1000-grain weight. NAC2-2(L2) from the Galaxy parent also showed a 10.6% increase in grain yield compared to the wild-type control. The lines, NAC2-4(L6), NAC2-4(L7), and NAC2-2(L2) may be selected for the breeding programs to develop stable homozygous lines. These promising transgenic lines hold significant potential for improving wheat yield and contributing to food security challenges in Pakistan.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eConflict of Interest\u003c/h2\u003e \u003cp\u003eThe authors declare that they have no conflict of interest.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eThe project conceptualization, fund acquisition and supervision of the experiments was done by A.B, all experiments were carried out by A.A, statistical analysis was done by A.A, A.K, and A.J, original manuscript and figures were prepared by A.A, manuscript was edited, proofread and approved by A.B and K.A.M.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eWe sincerely acknowledge the financial support provided by the Agricultural Linkages Program (ALP) of the Pakistan Agricultural Research Council (PARC) under Project Identification No. CS-407.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eAbid N, Maqbool A, Malik KA (2014) Screening commercial wheat (\u003cem\u003eTriticum aestivum\u003c/em\u003e L.) varieties for \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated transformation ability. Pak J Agric Sci 51:83-89.\u003c/li\u003e\n \u003cli\u003eAkhtar A, Rizvi Z, Irfan M, Maqbool A, Bashir A, Malik KA (2020) Biochemical and morphological risk assessment of transgenic wheat with enhanced iron and zinc bio accessibility. J Cereal Sci 91:102881. https://doi.org/10.1016/j.jcs.2019.102881\u003c/li\u003e\n \u003cli\u003eAida M, Ishida T, Fukaki H, Fujisawa H, Tasaka M (1997) Genes involved in organ separation in Arabidopsis: an analysis of the cup-shaped cotyledon mutant. Plant Cell 9:841-857. https://doi.org/10.1105/tpc.9.6.841\u003c/li\u003e\n \u003cli\u003eAlmagro A, Lin SH, Tsay YF (2008) Characterization of the Arabidopsis nitrate transporter NRT1.6 reveals a role of nitrate in early embryo development. Plant Cell 20:3289-3299. https://doi.org/10.1105/tpc.107.056788\u003c/li\u003e\n \u003cli\u003eArnon DI (1949) Copper enzymes in isolated chloroplasts. Polyphenol oxidase in \u003cem\u003eBeta vulgaris\u003c/em\u003e. Plant Physiol 24:1-15. https://doi.org/10.1104/pp.24.1.1\u003c/li\u003e\n \u003cli\u003eAzhar A, Ijaz S, Jabeen A, Kamal A, Bashir A, Malik KA (2024) The transcription factor TaNF-YB4 overexpression in wheat increases plant vigor and yield. Curr Plant Biol 40:100394 https://doi.org/10.1016/j.cpb.2024.100394\u003c/li\u003e\n \u003cli\u003eBradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248-254. https://doi.org/10.1006/abio.1976.9999\u003c/li\u003e\n \u003cli\u003eCentury K, Reuber TL, Ratcliffe OJ (2008) Regulating the regulators: the future prospects for transcription-factor-based agricultural biotechnology products. Plant Physiol 147:20-29. https://doi.org/10.1104/pp.108.117887\u003c/li\u003e\n \u003cli\u003eChallinor AJ, Watson J, Lobell DB, Howden SM, Smith DR, Chhetri N (2014) A meta-analysis of crop yield under climate change and adaptation. Nat Clim Change 4:287-291. http://dx.doi.org/10.1038/nclimate2153\u003c/li\u003e\n \u003cli\u003eChiu CC, Lin CS, Hsia AP, Su RC, Lin HL, Tsay YF (2004) Mutation of a nitrate transporter, AtNRT1: 4, results in a reduced petiole nitrate content and altered leaf development. Plant Cell Physiol 45:1139-1148. https://doi.org/10.1093/pcp/pch143\u003c/li\u003e\n \u003cli\u003eDaniel-Vedele F, Filleur S, Caboche M (1998) Nitrate transport: a key step in nitrate assimilation. Curr Opin Plant Biol 1:235-239. https://doi.org/10.1016/s1369-5266(98)80110-6\u003c/li\u003e\n \u003cli\u003eErnst HA, Olsen AN, Skriver K, Larsen S, Leggio LL (2004) Structure of the conserved domain of ANAC, a member of the NAC family of transcription factors. EMBO Rep 5:297-303. https://doi.org/10.1038/sj.embor.7400093\u003c/li\u003e\n \u003cli\u003eGood AG, Shrawat AK, Muench DG (2004) Can less yield more? Is reducing nutrient input into the environment compatible with maintaining crop production? Trends Plant Sci 9:597-605. https://doi.org/10.1016/j.tplants.2004.10.008\u003c/li\u003e\n \u003cli\u003eGrosse-Heilmann M, Cristiano E, Deidda R, Viola F (2024) Durum wheat productivity today and tomorrow: A review of influencing factors and climate change effects. Resour Environ Sustain 100170. https://doi.org/10.1016/j.resenv.2024.100170\u003c/li\u003e\n \u003cli\u003eHe X, Qu B, Li W, Zhao X, Teng W, Ma Y, Tong Y (2015) The nitrate-inducible NAC transcription factor \u003cem\u003eTaNAC2-5A\u003c/em\u003e controls nitrate response and increases wheat yield. Plant Physiol 169:1991-2005. https://doi.org/10.1104/pp.15.00568\u003c/li\u003e\n \u003cli\u003eHoagland DR, Arnon DI (1950) The water-culture method for growing plants without soil. Circ- Calif Agric Exp Stn 347:2.\u003c/li\u003e\n \u003cli\u003eHodge A, Robinson D, Fitter A (2000) Are microorganisms more effective than plants at competing for nitrogen? Trends Plant Sci 5:304-308. https://doi.org/10.1016/s1360-1385(00)01656-3\u003c/li\u003e\n \u003cli\u003eHuang XQ, R\u0026ouml;der MS (2004) Molecular mapping of powdery mildew resistance genes in wheat: a review. EUPHYTICA 137:203-223. http://dx.doi.org/10.1023/B:EUPH.0000041576.74566.d7\u003c/li\u003e\n \u003cli\u003eHuang NC, Liu KH, Lo HJ, Tsay YF (1999) Cloning and functional characterization of an Arabidopsis nitrate transporter gene that encodes a constitutive component of low-affinity uptake. Plant Cell 11:1381-1392. https://doi.org/10.1105/tpc.11.8.1381\u003c/li\u003e\n \u003cli\u003eKhan I, Zeb A (2007) Nutritional composition of Pakistani wheat varieties. J Zhejiang Univ Sci B 8:555-559. https://doi.org/10.1631/jzus.2007.b0555\u003c/li\u003e\n \u003cli\u003eKim HS, Park BO, Yoo JH, Jung MS, Lee SM, Han HJ, Chung WS (2007) Identification of a calmodulin-binding NAC protein as a transcriptional repressor in Arabidopsis. J Biol Chem 282:36292-36302. https://doi.org/10.1074/jbc.m705217200\u003c/li\u003e\n \u003cli\u003eLi L, Han C, Yang J, Tian Z, Jiang R, Yang F, Yin J (2023) Comprehensive transcriptome analysis of responses during cold stress in wheat (Triticum aestivum L.). Genes 14:844. https://doi.org/10.3390/genes14040844\u003c/li\u003e\n \u003cli\u003eLi X, Tang Y, Zhou C, Zhang L, Lv J (2020) A wheat WRKY transcription factor TaWRKY46 enhances tolerance to osmotic stress in transgenic Arabidopsis plants. Int J Mol Sci 21:1321. https://doi.org/10.3390/ijms21041321\u003c/li\u003e\n \u003cli\u003eLin SH, Kuo HF, Canivenc G, Lin CS, Lepetit M, Hsu PK et al (2008) Mutation of the Arabidopsis NRT1.5 nitrate transporter causes defective root-to-shoot nitrate transport. Plant Cell 20:2514-2528. https://doi.org/10.1105/tpc.108.060244\u003c/li\u003e\n \u003cli\u003eLiu Q, Qiu Y, Beta T (2010) Comparison of antioxidant activities of different colored wheat grains and analysis of phenolic compounds. J Agric Food Chem 58:9235-9241. https://doi.org/10.1021/jf101700s\u003c/li\u003e\n \u003cli\u003eLivak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2-\u0026Delta;\u0026Delta;CT method. Methods 25:402\u0026ndash;408. https://doi.org/10.1006/meth.2001.1262\u003c/li\u003e\n \u003cli\u003eMalik CP, Srivastava AK (1982) Text Book of Plant Physiology. Kalyani Publishers, New Delhi.\u003c/li\u003e\n \u003cli\u003eMao X, Chen S, Li A, Zhai C, Jing R (2014) Novel NAC transcription factor TaNAC67 confers enhanced multi-abiotic stress tolerances in \u003cem\u003eArabidopsis\u003c/em\u003e. PLoS ONE 9:1. https://doi.org/10.1371/journal.pone.0084359\u003c/li\u003e\n \u003cli\u003eMondal S, Rutkoski JE, Velu G et al (2016) Harnessing diversity in wheat to enhance grain yield, climate resilience, disease and insect pest resistance, and nutrition through conventional and modern breeding approaches. Front Plant Sci 7:991. https://doi.org/10.3389/fpls.2016.00991\u003c/li\u003e\n \u003cli\u003eMurray MG, Thompson W (1980) Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res 8:4321-4326. https://doi.org/10.1093/nar/8.19.4321\u003c/li\u003e\n \u003cli\u003eNorkunas K, Harding R, Dale J, Dugdale B (2018) Improving agroinfiltration-based transient gene expression in \u003cem\u003eNicotiana benthamiana\u003c/em\u003e. Plant Methods 14:1-14. https://doi.org/10.1186/s13007-018-0343-2\u003c/li\u003e\n \u003cli\u003eOlsen AN, Ernst HA, Leggio LL, Skriver K (2005) NAC transcription factors: structurally distinct, functionally diverse. Trends Plant Sci 10:79-87. https://doi.org/10.1016/j.tplants.2004.12.010\u003c/li\u003e\n \u003cli\u003eRedillas MC, Jeong JS, Kim YS, Jung H, Bang SW, Choi YD, Kim JK (2012) The overexpression of OsNAC9 alters the root architecture of rice plants enhancing drought resistance and grain yield under field conditions. Plant Biotechnol J 10:792-805. https://doi.org/10.1111/j.1467-7652.2012.00697.x\u003c/li\u003e\n \u003cli\u003eShew AM, Tack JB, Nalley LL, Chaminuka P (2020) Yield reduction under climate warming varies among wheat cultivars in South Africa. Nat Commun 11:4408. https://doi.org/10.1038/s41467-020-18317-8\u003c/li\u003e\n \u003cli\u003eTsay YF, Chiu CC, Tsai CB, Ho CH, Hsu PK (2007) Nitrate transporters and peptide transporters. FEBS Letters 581: 2290-2300. https://doi.org/10.1016/j.febslet.2007.04.047\u003c/li\u003e\n \u003cli\u003eUauy C, Distelfeld A, Fahima T, Blechl A, Dubcovsky J (2006) A NAC gene regulating senescence improves grain protein, zinc, and iron content in wheat. Sci 314:1298-1301. https://doi.org/10.1126/science.1133649\u003c/li\u003e\n \u003cli\u003eWilliams LE, Miller AJ (2001) Transporters responsible for the uptake and partitioning of nitrogenous solutes. Annu Rev Plant Biol 52:659-688. https://doi.org/10.1146/annurev.arplant.52.1.659\u003c/li\u003e\n \u003cli\u003eXue GP, Way HM, Richardson T, Drenth J, Joyce PA, McIntyre CL (2011) Overexpression of TaNAC69 leads to enhanced transcript levels of stress up-regulated genes and dehydration tolerance in bread wheat. Mol Plant 4:697-712. https://doi.org/10.1093/mp/ssr013\u003c/li\u003e\n \u003cli\u003eYamaguchi M, Ohtani M, Mitsuda N, Kubo M, Ohme-Takagi M, Fukuda H, Demura T (2010) VND-INTERACTING2, a NAC domain transcription factor, negatively regulates xylem vessel formation in \u003cem\u003eArabidopsis\u003c/em\u003e. Plant Cell 22:1249-1263. https://doi.org/10.1105/tpc.108.064048\u003c/li\u003e\n \u003cli\u003eYanagisawa S (1998) Transcription factors in plants: physiological functions and regulation of expression. J Plant Res 111:363-371.\u003c/li\u003e\n \u003cli\u003eZhang Z, Peng C, Xu W, Li Y, Qi X, Zhao M (2024) Genome-wide association study of agronomic traits related to nitrogen use efficiency in Henan wheat. BMC Genomics 25: 7. https://doi.org/10.1186/s12864-023-09922-0\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Wheat nitrate uptake, Nitrogen use efficiency (NUE), Triticum aestivum, TaNAC2-5A overexpression, Climate smart transgenic wheat","lastPublishedDoi":"10.21203/rs.3.rs-6421854/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6421854/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cem\u003eTaNAC2-5A\u003c/em\u003e is a transcription factor that is part of the NAC family, which is associated with the regulation of plant growth and the response to stress factors, especially in terms of available nitrate. This research is focused on investigating the effect of \u003cem\u003eTaNAC2-5A\u003c/em\u003e expression on wheat yield and nitrogen use efficiency of a local wheat variety. A genetic construct for \u003cem\u003eTaNAC2-5A\u003c/em\u003e was designed based on a modified wheat transformation vector pSB219, tested in \u003cem\u003eN. tabacum\u003c/em\u003e and used for \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated transformation of wheat. Transformed wheat plants (T\u003csub\u003e0\u003c/sub\u003e) were tested for transgene with PCR until the T\u003csub\u003e2\u003c/sub\u003e generation. Subsequently, the verified plants were evaluated for transgene expression with RT-PCR and qRT-PCR six weeks after germination. The qRT-PCR results revealed that transgenic lines of \u003cem\u003eTaNAC2-5A\u003c/em\u003e expressed higher levels of the transcription factor in comparison with the parental line of FSD-2008. The L3 line (NAC2-4 event) indicated 2.25 times higher expression. In agronomic evaluations, the transgenic L3 line was associated with 17.18% higher 1000 grain weight and better root architecture parameters including length, surface area and projected area, suggesting that there is improved nutrient absorption. Also, transgenic lines showed large differences (p ≤ 0.05), in total chlorophyll, protein and sugar contents compared to controls. These findings demonstrate that the constitutive expression of \u003cem\u003eTaNAC2-5A\u003c/em\u003e improves wheat yield, root development, and nutrient uptake efficiency, which is beneficial in making high-yield, fertilizer-efficient wheat varieties, thereby having the potential to contribute positively towards food security.\u003c/p\u003e","manuscriptTitle":"Improving Yield and Nitrogen use Efficiency in Wheat by Overexpressing TaNAC2-5A Transcription Factor","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-05-14 11:17:01","doi":"10.21203/rs.3.rs-6421854/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"1a5559dc-c612-4f4d-af71-d7cfce71d801","owner":[],"postedDate":"May 14th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-07-11T07:53:55+00:00","versionOfRecord":[],"versionCreatedAt":"2025-05-14 11:17:01","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6421854","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6421854","identity":"rs-6421854","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}