Contrasting patterns in growth attributes, root traits plasticity, and defence mechanism of maize under deficit moisture and phosphorus supply

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

Abstract Background: The phosphorus uptake in plants is decreased due to soil water deficiency which negatively affects plant growth. How the interaction of soil moisture and P deficiency affects the morpho-physiological and biochemical responses of plants is still little known. Methods: This study investigates physiological and biochemical responses of maize hybrids under interaction of moisture and P deficit conditions. Three levels of water (well-watered, moderate drought, severe drought) and P-supply (P100, P50, and P0) were used for two maize hybrids. Results: The interaction of water and P-deficiency (60% and 40% FC along with P50 or P0) reduced the shoot and root traits, and P uptake in both maize cultivars. The activities of SOD, total protein, free proline, and total reducing sugar were increased with decreasing water and P-supply but response of POD and CAT remained variable. The significant upregulation of ZmNAC111 was noted under 40%FC with P100 treatment, but no such effects were recorded under 100%FC at all P treatments in both cultivars. The expression of ZmPHR1.1 and ZmPHR1.2 was increased with reducing P supply, but higher expression was observed at P0 at 60%FC and 40%FC, which indicates these are key genes for P-deficiency tolerance. Conclusions: Overall, P0 with 60% and 40%FC caused severe reductions in growth traits among P levels but 40%FC was most destructive at all levels of P-supply. These findings would be helpful to understand the drought and low P tolerance mechanism of maize and provide future directions for regulation of responsive genes for developing tolerant maize cultivars.
Full text 190,688 characters · extracted from preprint-html · click to expand
Contrasting patterns in growth attributes, root traits plasticity, and defence mechanism of maize under deficit moisture and phosphorus supply | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Contrasting patterns in growth attributes, root traits plasticity, and defence mechanism of maize under deficit moisture and phosphorus supply Hafiz Athar Hussain, Zhang Qingwen, Saddam Hussain, Rubab Zahra Naqvi, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-2476562/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background: The phosphorus uptake in plants is decreased due to soil water deficiency which negatively affects plant growth. How the interaction of soil moisture and P deficiency affects the morpho-physiological and biochemical responses of plants is still little known. Methods: This study investigates physiological and biochemical responses of maize hybrids under interaction of moisture and P deficit conditions. Three levels of water (well-watered, moderate drought, severe drought) and P-supply (P100, P50, and P0) were used for two maize hybrids. Results: The interaction of water and P-deficiency (60% and 40% FC along with P50 or P0) reduced the shoot and root traits, and P uptake in both maize cultivars. The activities of SOD, total protein, free proline, and total reducing sugar were increased with decreasing water and P-supply but response of POD and CAT remained variable. The significant upregulation of ZmNAC111 was noted under 40%FC with P100 treatment, but no such effects were recorded under 100%FC at all P treatments in both cultivars. The expression of ZmPHR1.1 and ZmPHR1.2 was increased with reducing P supply, but higher expression was observed at P0 at 60%FC and 40%FC, which indicates these are key genes for P-deficiency tolerance. Conclusions: Overall, P0 with 60% and 40%FC caused severe reductions in growth traits among P levels but 40%FC was most destructive at all levels of P-supply. These findings would be helpful to understand the drought and low P tolerance mechanism of maize and provide future directions for regulation of responsive genes for developing tolerant maize cultivars. drought P-deficiency root system architecture ROS defence mechanism maize Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction Climate changes have multifaceted effects on the consequences of abiotic stress, threatening the productivity and sustainability of agricultural systems (Hussain et al. 2018 ). During their life spam, plants generally encounter a wide range of abiotic stresses such as drought, salinity, temperature extremes, and nutrient deficiencies. Generally, the occurrence of single stress factor in the natural condition generally leads to other stresses in plants, e.g., water deficiency not only induces osmotic stress but also causes P-starvation (Zhang et al. 2020 , Asensio et al. 2021 , Chen et al. 2022 ). It has been estimated that more than 60% of the global population will inhabit areas with water deficiencies by 2025 (FAO 2018 ). Moreover, > 30% of the global cropland is phosphorus deficient (MacDonald et al. 2011 ), so the P input into croplands is expected to increase by 51–86% by the year 2050 (Mogollón et al. 2018 ). The relationship between P and soil water is well known— soil P movement occurs through mass flow and diffusion and depends on pores filled with water (Oliveira et al. 2010 ). Most of the studies indicated that the plant P uptake is decreased under low soil moisture (Cramer et al. 2009 , He and Dijkstra 2014 , Suriyagoda et al. 2014 ) as P supply is reduced to root that affects water relations factors in the stressed plant (Sardans and Peñuelas 2004 , Hussain et al. 2019 ), and decreased P supply through mineralization and by reduced P diffusion and mass flow in the soil (Sardans and Peñuelas 2012 , Suriyagoda et al. 2014 ). Drought stress affects plant growth by altering ion uptake and enzyme activity, decreasing soil water potential and water uptake by roots (Hussain et al. 2020 , Ali et al. 2022 ), and alterations in the metabolism of plants through overproduction of ROS like hydroxyl ion, hydrogen peroxide and superoxide (Zia et al. 2021 ). However, these radicals affect plant structural and functional stability by oxidizing proteins, lipids, and nucleic acids. Nevertheless, plants are fortified by various physiological and molecular processes to overcome these effects amongst which eliciting of antioxidant enzymes has a vital role in plants stress tolerance (Shemi et al. 2021a , Shemi et al. 2021b ). In addition, inorganic phosphate (Pi) inadequacy is common problem in natural ecosystems due to its relatively high immobility and uneven distribution in soil. Like as drought, P- deficiency exhibited the series of complex morphological, physiological, and developmental adaptations in the roots and shoots (Li et al. 2022 ). Under P deficiency, shoot growth was more reduced than root growth and therefore resulted in a significant increase of biomass allocation to roots (Mollier and Pellerin, 1999). P deficiency also reduce root hydraulic conductance and whole plant water potential, probably by lowering the activity of water channel protein. Zribi et al. (2011) indicated that leaf water content was correlated with leaf osmotic potential under P deficiency. The soluble sugars usually accumulate in P-deficient plants, since utilization of the photo assimilate was largely restricted (Wissuwa et al., 2005). Maize ( Zea mays L.) is sensitive to drought (Hussain et al. 2019 , Hussain et al. 2020 , Shemi et al. 2021b ) and phosphorus deficit condition (Nadeem et al. 2011 , Klamer et al. 2019 , Xia et al. 2021 ) particularly during early growth stages. Single or combined impact of drought and P deficiency considerably decrease maize growth by affecting Fv/Fm, chlorophyll content, leaf relative water content and leaf water potential (Kaya et al. 2020 ). Concurrent effects of drought and P deficiency triggered the morpho-physiological, biochemical and structural responses (Suriyagoda et al. 2014 , Chtouki et al. 2022 ) by reducing leaf area, leaf water potential, photosynthetic activity, soluble protein contents, nutrient uptake, and metabolic enzyme activities of plants (Shubhra, Garg et al. 2004 , Gunes et al. 2006 , Goufo et al. 2017 , Xia et al. 2020 ). Water and P deficiency, both individually and combined, significantly decrease seed weight and aboveground biomass upto ∼80% (Smith et al. 2022 ), indicating that both these stressors are harmful for the physiological and metabolic functioning of the plants. At the molecular level, Arabidopsis ATAF1/2 and CUC2 (NAC) transcription factors play important roles in the regulation of various gene expression in response to stress conditions, and their molecular engineering is proposed as a potential strategy for the genetic improvement of stress tolerance in crops (Tran et al. 2010 ). Previously it was noted that the expression levels of 14 different NAC genes were increased in maize after drought treatments, suggesting that these genes might play important role in stress regulation, particularly those showing strong response to the drought stress whereas 5 NAC genes were involved in the communication between different signal transduction pathways (Peng et al. 2015 ). However, the enhanced expression of ZmNAC111 conferred drought tolerance in maize seedlings, improved plant water-use efficiency (WUE), modulated stomatal closure and enhanced the expression of stress-responsive genes under stress condition (Mao et al. 2015 ). For P-deficient plants, phosphate transporter 1 (PHR1) transcription factor is viewed as a positive regulator for inorganic phosphate (Pi) starvation signalling that up-regulates the “induced by phosphate starvation1” (IPS1) genes (Rubio et al. 2001 ). However, ZmPHR1 led to the upregulation of multiple genes that regulate metabolism during Pi-starvation, which in turn resulted in an elevation of Pi content in plants (Wang et al. 2013 ). Moreover, relative expression of ZmPHR1.1, and ZmPHR1.2, was significantly up-regulated in response to low phosphate conditions in maize (Wang et al. 2021b ). Previously, most of the studies have focused on the single stress factor of drought or P-deficiency, but the synergistic interaction of drought and P deficiency for maize responses and underlying mechanisms need further investigation. Moreover, the response pattern of ZmNAC and ZmPHR1 transcription factor genes to the combination of water and P-deficiency, remains a particularly interesting question. Here, we studied the response of maize hybrids to drought and P-deficiency at physiological, biochemical, and gene levels. The aims of this study were to determine the interactive effects of drought and P-deficiency on the (a) morpho-physiological and biochemical attributes (b) root system architecture (c) P uptake and translocation in plant tissues, and (d) expression pattern of ZmNAC and ZmPHR1 transcription factor genes. We hypothesized that the negative effects of combined water and P-deficiency will be variable and severe than that of individual stress factor. The findings of this study would be helpful to understand the drought and low P tolerance mechanism of plants and will provide future directions for characterization of function and regulation of responsive genes for developing stress tolerant maize cultivars. Material And Methods The experiment was conducted in the growth room with controlled condition at the National Institute for Biotechnology and Genetic Engineering (NIBGE), Faisalabad, Pakistan. The seeds of hybrid maize cv. Zhengdan958 (ZD958) and Xianyu335 (XY335) were obtained from the Institute of Crop Science, Chinese Academy of Agricultural Sciences, Beijing, China. The soil was collected from the 0–20-cm layer of an experimental field of NIBGE, and sieved through 2-mm mesh. The soil texture class was sandy loam with pH 7.46, 12.3 g kg − 1 organic matter, 13.05 mg kg − 1 total nitrogen, 6.52 mg kg − 1 available P, 98.72 mg kg − 1 exchangeable potassium. Seeds were surface sterilized in 70% ethanol for 1 min followed by 5% sodium hypochlorite for 5 min, then washed four times in deionized water and planted in plastic pots (20 cm in-depth, 16 cm in diameter) filled with 2 kg soil. In each pot, four seeds were initially sown and after emergence, one plant was maintained in each pot. Recommended fertilizer was applied in the soil before sowing including the levels of Phosphorus, P1 (100 mg P kg − 1 soil), P2 (50 mg P kg − 1 soil) and P3 (no phosphorus). The plants were allowed to be grow for 18 days at normal condition and then subjected to three different soil moisture regimes as, W1: well-watered (> 80%FC), W2: moderate drought stress (60% FC), W3: severe drought stress (40% FC) for 10 days. The average day-night temperature during the experiment period was 18–32°C and relative humidity was 60–70%, respectively. The plants were harvested at 28 DAS and growth parameters were recorded and fresh samples were taken for physiological and molecular parameters. All the treatments were arranged in a completely randomized design (CRD) with three replications for each treatment. The experimental treatments were re-positioned weekly to minimize the environmental effects. Measurement Of Plant Growth Traits At harvest, shoot length of maize seedlings was recorded with a meter scale and seedlings were further separated immediately into roots and shoots for the measurement of fresh weights using digital electric balance. Subsamples of shoots were stored at − 40°C for biochemical analysis. The root samples were carefully scanned using the Epson PerfectionV700 Photo Flatbed scanner (No. B11B178023, PT Epson, Jakarta, Indonesia) and root functional traits: total root length, root surface area, average diameter, and root volume, were analyzed using the WinRHIZO software (Regent Instructions, Quebec, Canada). Furthermore, the biomass allocation such as root mass fraction (the proportion of root dry weight to the total plant dry weight), the root/shoot ratio (ratio of the belowground biomass to the aboveground biomass), specific root length (length per unit dry weight of total root system), root mass density (mass per unit root volume) were analysed (Wen et al. 2020 ). Later, the samples were oven-dried for recording shoot and root dry weights. Estimation Of Phosphorus Contents The P contents from maize shoot and root samples was determined by vanadate molybdate method with some modifications using a UV/visible spectrophotometer as suggested by Chapman and Pratt (1962). One g of ground plant sample was taken for analysis and placed in a 100-mL volumetric flask, and 10 mL of tri-acid mixture (HNO 3 , H 2 SO 4 and HClO with the ratio of 9:4:1) was added and the contents were mixed by swirling. The flask was placed on a hotplate in the fumehood and start heating at 80–90°C and then the temperature was raised to about 150–200°C. Continues heating were applied until the production of red NO 2 fumes ceases. The contents were further heated until the volume was reduced to 3–4 mL and became colourless. After cooling the contents, the volume was made up with the distilled water and filtered through No. 1 filter paper. Then, 5 mL of digested solution was taken in a 50-mL volumetric flask, and 10 mL of vanadomolybdate reagent and make up the volume with distilled water. The absorbance of samples was observed by spectrophotometer to calculate the P content from the standard curve. Measurement Of Ho And Lipid Peroxidation The H 2 O 2 contents were determined using the procedure described by Velikova et al. (2000). 500 mg of fresh leaves was homogenized with 5 mL of 0.1% (w/v) trichloro-acetic acid in pre-chilled pestle and mortar. The homogenate was centrifuged at 12,000 rpm for 15 min. Then, 0.5 mL supernatant was mixed in 0.5 mL of 0.05 M phosphate buffer (pH 7.0) + 1 mL of 1 M potassium iodide, and absorbance was recorded at 390 nm by using water as blank. The same steps were followed for making a standard curve by preparing different dilution of hydrogen peroxide. Lipid peroxidation was quantified by the estimation of malondialdehyde (MDA) content using thiobarbituric acid assays (De Vos et al.1991). For analysis, fresh leaves (0.2 g) were placed on ice bath, grinded with 5.0 mL of 5% (w/v) TCA, centrifuged, and the MDA content was recorded at 532 and 600 nm spectrophotometrically. Measurement Of Enzymatic Antioxidants Leaf samples were harvested and kept in a disposable zipper bag and stored at -80°C for the determination of antioxidant enzyme activity. The activity of SOD was measured by following procedure of Dhindsa et al. (1981). For this, 200 mg leaf sample was homogenized in 2 mL of extraction buffer (0.5 mM EDTA + 0.1 M phosphate pH 7.5) with precooled mortar and pestle. The homogenate was centrifuged at 10,000 rpm at 4°C and supernatant was stored at 4°C. SOD activity in the supernatant was assayed by its ability to inhibit photochemical reduction of nitro blue tetrazolium. A 3 mL assay mixture containing (0.2 mL of 200 mM methionine + 1.5 M sodium carbonate + 0.1 mL 3 mM EDTA + 0.1 mL 2.25 mM NBT + 0.1 mL riboflavin (60 µM) + 1.5 mL 100 mM potassium phosphate buffer + 1 mL distilled water and 0.1 mL of enzyme) was incubated under two 15 W inflorescent lamps for 15 min; illuminated and nonilluminated reactions without supernatant served as calibration. Absorbance of the samples along with the blank was recorded at 560 nm wavelength in a spectrophotometer (UV-4000, ORI, Germany). One unit of SOD enzyme activity was defined as the quantity of enzyme that reduced the absorbance reading of samples to 50% in comparison with tubes lacking enzymes (supernatant). A 0.5 g of fresh leaves was ground in a 5 mL of 50 mM phosphate buffer (pH 7.8) with the help of pestle and mortar. The homogenates were centrifuged at 15000 rpm for 20 min at 4°C. The supernatant was used to assess peroxidase (POD) and catalase (CAT) activity. POD activity was determined by following procedure of Putter (1974) with slight modifications. The reaction mixture contained 10 mM guaiacol + 5 mM H 2 O 2 and 50 mM phosphate buffer (pH 7.0). The reaction mixture was preheated at 20°C in a water bath. Then, 2.8 mL reaction solution + 0.2 ML enzyme was added in 10 mL centrifuged tube and mix thoroughly. Absorbance was recorded with blank and with reaction mixture. Four absorbance readings were recorded at 470 nm wavelength with 1 minute time interval using spectrophotometer (UV-4000, ORI, Germany). CAT activity in fresh leaves was measured by the method of Aebei (1984) with slight modification. 100 mM H 2 O 2 + 50 mM phosphate buffer (pH 7.8) solution was preheated in water bath at 25°C. In 10 mL tube, 0.2 mL phosphate buffer + 0.2 mL enzyme solution was added and preheated in water bath for 3 min. Then, 0.3 mL (100 mM H 2 O 2 ) solution was added in 10 mL tube. The control tube was heated in boiling water bath for 5 min to kill the enzyme solution. After mixing, the absorbance at the 240 nm wavelength was calculated at interval of 1 min. Continuous determination for 4 min. 1 Unit of enzyme activity (U) was the decrease of 0.1 of A240 within 1 min. Estimation Of Osmolyte Accumulation Free proline contents were assessed by following the acid ninhydrin method (Shan et al. 2007). Fresh leaf material (0.5 g) was extracted using 5 mL of 3% sulfosalicylic acid for 10 min with shaking at 100°C. The 2mL of filtered aqueous extract was mixed with glacial acetic acid (2mL) and acid ninhydrin reagent (2 mL), and heated (100°C) for 30 min. The reaction mixture after cooling was segregated against toluene (4 mL) and the absorbance of the organic phase was recorded at 520nm. The resulting values were related with a standard curve plotted using known amounts of proline (Sigma, St Louis, MO, USA). Total soluble sugar was estimated by anthracene ketone method as described by Zong and Wang. The fresh leaf sample (0.2 g) was homogenized with 25 mL distilled water and centrifuged (4000 rpm) for 20 minutes. Anthracene (0.1 g) was dissolved in 100mL diluted sulfuric acid to prepare anthracene sulfuric acid reagent. One mL extract and 5 mL anthracene sulfuric acid reagent were taken in a tube, shaken and put in boiling bath for 10 minutes. After 2 h stability, the sample was transferred in cuvette and the absorbance was read at 620 nm. Total soluble proteins from the fresh leaf material were measured according to the Bradford (1976) method. 0.25 g fresh leaf material was grinding in 5 mL of phosphate buffer in chilled pestle and mortar, centrifuge at 12,000 rpm for 10 minutes and separated the supernatant. Then take 0.3 mL of supernatant and added 3 mL of Bradford reagent and gently mixed the solution and place it at room temperature for 10 min and absorbance of reading was taken at 595 nm using spectrophotometer. Rna Isolation And Qrt- Pcr RNA was extracted from maize tissue by using Trizol method with some modification. 1 µg RNA was reverse transcribed into cDNA using RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific). PowerUp™ SYBR™ Green Master Mix was used for the qPCR reaction using CFX96 qPCR thermocycler with the 100 ng of cDNA and 10uM/µl primers. α-tubulin gene primers were used as an internal control. Quantitative real-time PCR primer sequences for ZmTUB4 , ZmPHR1.1 , ZmPHR1.2 and ZmNAC111 , are listed here in Table 1 . Table 1 List of qPCR primer sequences Primer Name Primer sequence (5’-3’) ZmTUB4 Forward GCTATCCTGTGATCTGCCCTGA Reverse CGCCAAACTTAATAACCCAGTA ZmPHR1.1 Forward GCCACAGGCGACAGATCTAA Reverse CTCACCAATGGACTCACGGA ZmPHR1.2 Forward AAGGGCATTGGACACTGGAG Reverse GTGAGGTGGTAGTGGAGTGC ZmNAC111 Forward CCAACGGTGTGAACAAGAGG Reverse CCATGCCTCGAATCACTTGG Data analysis The collected data were statistically analysed through analysis of variance technique using statistical package Statistix 8.1 (Analytical Software, Tallahassee, FL, USA). Mean variances were compared through Tukey’s HSD test (p < 0.05). Graphical presentation was done through Sigmaplot 10.0. and OriginPro 2021. Results Effects of drought and P-deficiency on shoot growth Both water and P-deficiency had profound negative effect on the shoot growth traits viz., shoot length, shoot fresh weight, shoot dry weight and number of leaves of both maize cultivars (Fig. 1 and Fig. 2 ). Significant reductions in the shoot length and number of leaves in both cultivars were observed under all P treatments with moderate (60% FC) and severe (40%FC) drought conditions, nevertheless,shoot length and number of leaves of both cultivars were non-significantly (p < 0.05) affected by all levels of P under well-water supply (100%FC). Same as shoot length, the number of leaves of both cultivars were negatively affected at the 40%FC with different levels of P-supply (Fig. 2 ). Moreover, the shoot fresh weight and shoot dry weight of the both cultivars were significantly (p < 0.05) affected by all interactive levels of water and P-supply (Fig. 1 ). These results indicates that the drought at 40%FC with different levels of P was drastic to the shoot fresh and dry weight of the maize (Fig. 1 c-f), as water deficiency restrict the uptake of P-uptake in the upper parts of the plants. Furthermore, shoot length was affected due to water deficiency but P-deficiency didn’t affect the shoot length significantly Influence of drought and P-deficiency on root system architecture The root growth of both maize cultivars was affected under the individual and interactive levels of water and P deficiency (Table 2 ). Total root length of ZD958 was significantly ( p < 0.05) reduced under all P levels with 60% and 40%FC but non significantly ( p < 0.05) affected by different P levels at 100%FC. Likewise, total root length of XY335 was significantly ( p < 0.05) decreased under all levels of the water and P supply compared with P100 + 100%FC (Table 2 ). Table 2 Effects of water and P- deficiency on the total root length, root fresh weight, root dry weight, specific root length, root tissue density, root mass fraction, root surface area, root average diameter, root volume and root/shoot ratio of the ZD958 and XY335 Maize cultivars. The error bar indicates the ± SE of three replicates. Different alphabetical letters above error bars represent the significant difference among treatments at p < 0.05 Cultivars Treatments Total root length (m) Root fresh weight (g) Root dry weight (g) Specific root length (m g − 1 ) Root mass density (g/ cm3) Root mass fraction (g g − 1 ) Root surface area (cm2) Root average diameter (mm) Root volume (cm3) Root/Shoot ratio (g g − 1 ) ZD958 100% FC + P100 60.57 ± 0.01a 8.97 ± 0.43a 1.55 ± 0.02a 38.99 ± 0.39c 0.18 ± 0.02b 0.31 ± 0.01a 3178.27 ± 265.00a 4.10 ± 0.27a 124.25 ± 4.49a 0.47 ± 0.03bc 100% FC + P50 57.92 ± 0.04a 8.09 ± 0.31a 1.42 ± 0.10ab 41.15 ± 4.11bc 0.18 ± 0.02b 0.31 ± 0.02a 2813.69 ± 202.40a 3.35 ± 0.11ab 109.15 ± 3.18ab 0.48 ± 0.04bc 100% FC + P0 50.69 ± 0.03ab 7.37 ± 0.36ab 0.92 ± 0.03c 55.36 ± 3.64b 0.12 ± 0.01b 0.31 ± 0.01a 2598.99 ± 18.12ab 3.01 ± 0.02b 98.30 ± 7.88b 0.45 ± 0.02cd 60% FC + P100 49.11 ± 0.02ab 7.56 ± 0.54a 1.27 ± 0.04b 38.80 ± 2.20c 0.17 ± 0.02b 0.35 ± 0.01a 2613.12 ± 32.46ab 2.92 ± 0.20b 96.36 ± 6.43b 0.53 ± 0.03abc 60% FC + P50 42.49 ± 0.02bc 7.27 ± 0.56ab 1.23 ± 0.07b 34.90 ± 3.62c 0.17 ± 0.02b 0.36 ± 0.03a 2198.76 ± 138.32b 2.89 ± 0.27b 89.78 ± 3.76b 0.62 ± 0.04ab 60% FC + P0 30.42 ± 0.01 d 5.05 ± 0.23c 0.71 ± 0.01cde 42.65 ± 1.92bc 0.14 ± 0.01b 0.33 ± 0.04a 1255.87 ± 31.11c 1.39 ± 0.07c 45.68 ± 2.67c 0.64 ± 0.03a 40%FC + P100 53.75 ± 0.03ab 5.78 ± 0.25bc 0.75 ± 0.04cd 71.96 ± 1.14a 0.13 ± 0.01b 0.26 ± 0.02a 1284.38 ± 12.21c 1.49 ± 0.10c 46.49 ± 2.91c 0.30 ± 0.01d 40%FC + P50 31.67 ± 0.02cd 2.42 ± 0.06d 0.65 ± 0.03de 48.96 ± 0.72bc 0.27 ± 0.02a 0.30 ± 0.02a 820.16 ± 40.74cd 0.92 ± 0.07c 32.29 ± 0.77cd 0.66 ± 0.04a 40%FC + P0 27.05 ± 0.02d 1.93 ± 0.14d 0.49 ± 0.02e 55.08 ± 5.31b 0.26 ± 0.01a 0.34 ± 0.02a 501.83 ± 38.88d 0.81 ± 0.07c 17.99 ± 0.92d 0.61 ± 0.03ab XY335 100% FC + P100 65.06 ± 0.03a 8.04 ± 0.52a 1.58 ± 0.13a 45.63 ± 3.44d 0.20 ± 0.02a 0.35 ± 0.01a 2599.38 ± 13.96a 3.97 ± 0.20a 135.82 ± 8.23a 0.67 ± 0.08abc 100% FC + P50 46.21 ± 0.01b 7.22 ± 0.21ab 1.26 ± 0.06b 37.09 ± 2.90d 0.17 ± 0.02a 0.33 ± 0.02a 2153.35 ± 173.76b 2.70 ± 0.26bc 101.79 ± 5.24b 0.92 ± 0.05a 100% FC + P0 34.28 ± 0.00c 5.69 ± 0.26c 0.89 ± 0.05cd 38.62 ± 2.04d 0.16 ± 0.01a 0.31 ± 0.02ab 1815.29 ± 94.94b 2.21 ± 0.16bcd 73.94 ± 6.40cd 0.74 ± 0.11ab 60% FC + P100 45.44 ± 0.02b 6.65 ± 0.27bc 1.13 ± 0.09bc 40.99 ± 4.43d 0.17 ± 0.02a 0.35 ± 0.02a 2623.65 ± 32.57a 2.49 ± 0.10bc 88.76 ± 5.62bc 0.58 ± 0.06bc 60% FC + P50 33.13 ± 0.01c 5.40 ± 0.06c 0.97 ± 0.02bc 34.37 ± 1.97d 0.18 ± 0.02a 0.37 ± 0.03a 1763.24 ± 140.38b 2.16 ± 0.12bcd 70.22 ± 2.19cd 0.72 ± 0.03ab 60% FC + P0 28.81 ± 0.00c 3.28 ± 0.28d 0.60 ± 0.03de 48.40 ± 2.90cd 0.18 ± 0.01a 0.27 ± 0.05ab 1315.59 ± 10.35c 2.02 ± 0.09cd 66.59 ± 3.48cd 0.59 ± 0.03bc 40%FC + P100 45.17 ± 0.03b 3.39 ± 0.08d 0.53 ± 0.02e 84.64 ± 2.19a 0.16 ± 0.01a 0.21 ± 0.01b 1924.65 ± 97.88b 2.83 ± 0.17b 82.17 ± 4.16bc 0.41 ± 0.02c 40%FC + P50 32.72 ± 0.00c 2.62 ± 0.02d 0.51 ± 0.02e 64.19 ± 2.74bc 0.20 ± 0.01a 0.31 ± 0.02ab 1207.42 ± 16.65c 1.69 ± 0.05d 51.16 ± 2.08d 0.43 ± 0.02c 40%FC + P0 27.14 ± 0.00c 2.59 ± 0.03d 0.40 ± 0.03e 68.98 ± 5.52ab 0.16 ± 0.02a 0.31 ± 0.02ab 416.85 ± 25.66d 0.47 ± 0.02e 24.87 ± 0.48e 0.48 ± 0.05bc Table 3 Summery of two-way analysis of variance (ANOVA) regarding the effect of different water and P levels on morpho-physiological growth and biochemical attributes of two different maize hybrids. Mean square values are present with significant level: *p < 0.05, **p < 0.01., ***p < 0.001 and not significant: ns, W: water levels, P: phosphorus levels, W×P: water× phosphorus levels; Trait notations: MDA, malondialdehyde; H2O2, hydrogen peroxide; SOD, superoxide dismutase; POD, peroxidase; CAT, catalase. Traits ZD958 XY335 W P W×P W P W×P Shoot length 925.44*** 25.44ns 2.18ns 1849.48*** 45.56ns 1.70ns Shoot fresh weight 149.37*** 125.81*** 1.20ns 48.78*** 59.53*** 5.73ns Shoot dry weight 4.02*** 3.07*** 0.08ns 2.89*** 1.73*** 0.13ns No. of leaves 10.56*** 2.12* 0.07ns 13.59*** 0.44ns 0.09ns Total root length 921.66*** 768.39*** 95.21** 501.90*** 1046.69*** 44.66** Root fresh weight 53.47*** 15.92*** 2.41** 38.20*** 10.68*** 1.45** Root dry weight 1.04*** 0.59*** 0.04** 1.31*** 0.46*** 0.06** Specific root length 9272533*** 2352509** 2363286*** 3026071*** 3194868** 1170267** Root mass density 0.01056*** 0.00535** 0.00847*** 0.00017ns 0.00066ns 0.00105ns Root mass fraction 0.00550* 0.00106ns 0.00228ns 0.00873* 0.00459ns 0.00707* Root surface area 9027154*** 1852858*** 160235* 2224347*** 3063651*** 113333* Root area diameter 13.16*** 2.74*** 0.43** 3.58*** 5.01*** 0.69*** Root volume 13900.9*** 2855.7*** 270.6** 5532.61*** 4748.27*** 355.06** Root/Shoot ratio 0.03863*** 0.06176*** 0.03207*** 0.25844*** 0.04351* 0.01430ns Shoot P 1.49*** 1.38*** 0.04ns 1.24*** 0.97*** 0.04ns Root P 0.38*** 0.62*** 0.01ns 0.96*** 0.16* 0.01ns Malondialdehyde 299.26*** 27.03*** 2.70ns 196.49*** 33.91*** 2.52ns Hydrogen peroxide 805.91*** 85.25*** 6.01ns 780.37*** 57.20*** 7.54ns Superoxide dismutase 5064.80ns 2990.57** 33.98ns 8479.32*** 1682.83ns 30.97ns Peroxidase 43.07* 7.78ns 19.71ns 18.54ns 0.09ns 17.82ns Catalase 420.70*** 54.01** 7.49ns 336.93*** 31.47ns 18.43ns Total protein content 4.13*** 0.31* 0.01ns 6.99*** 0.45** 0.02ns Free Proline 164.94*** 58.89*** 8.37* 387.33*** 111.17*** 7.84* Total soluble sugar 236.55*** 2.29ns 12.03** 226.19*** 14.42ns 12.02ns Moreover, the root fresh weight and root dry weight of the both maize cultivars were significantly reduced by decreasing water and P-supply. But, most significant reduction of root fresh and dry weight of both cultivars was noted under the severe water and P-deficiency (40%FC + P0). Furthermore, significant ( p < 0.05) variations in specific root length of both maize cultivars were noted under the all levels of water and P-supply; the highest specific root length of both cultivars was recorded under severe drought + optimum P-supply (40%FC + P100). In addition, the significantly ( p < 0.05) and maximum root tissue density in ZD958 was noted under 40%FC with different P-levels but the highest root tissue density of XD335 was recorded under 100%FC + P100 and 40%FC + P100. However, there was no statistically difference ( p > 0.05) in root tissue density under all treatments of water and P-supply in XD335. Similarly, there was non-significant ( p > 0.05) variation in the root mass fraction of ZD958 under all treatments of water and P-supply. But, significant ( p < 0.05) variation in the root mass fraction of XD335 was noted under all treatments of water and P-supply. The root surface area, root average diameter and root volume of both maize cultivars were significantly ( p < 0.05) reduced by of the decrease in water and P-supply compared with 100%FC + P100. There was significant ( p < 0.05) variation in the root/shoot ratio of the both maize cultivars under the all treatments of water and P application. Overall, root growth traits were affected by decreasing the water and P-supply but the influence of water deficiency was worse than the P-deficiency (Table 2 ). Influence of drought and P-deficiency on phosphorus (P) uptake The P uptake in both maize cultivars was significantly ( p < 0.05) reduced by decreasing the water and P-supply treatments (Fig. 3 ). Compared to root-P, the shoot-P concentrations were higher in both, ZD958 and XY335 cultivars. At 40%FC + P0, the shoot-P was decreased by 81.7% and 77.4% in ZD958 and XY335, respectively compared with 100%FC + P100. Likewise, the root-P of ZD958 and XY335 was declined by 72.4% and 62.5%, respectively, compared with 100%FC + P100. It was observed that the optimum P-supply (P100) helps the maize plants in P uptake under water deficit conditions (60%FC and 40FC). Likewise, optimum water supply (100%FC) helps the maize plants in P uptake under low P-supply (P50 and P0). Overall, P uptake in maize plants was most affected by the severe water and P-deficiency (40%FC and P0) (Fig. 3 ). Effects of drought and P-deficiency on the oxidative stress markers The MDA and H 2 O 2 contents were significantly ( p < 0.05) increased with decreasing the water and P-supply in both maize cultivars (Fig. 4 ). The MDA and H 2 O 2 contents of both cultivars were significantly increased at 40%FC + P100, 40%FC + P50, and 40%FC + P0 as compared to 100%FC + P100.. Both the 60%FC and 40%FC increased the MDA and H 2 O 2 contents of ZD958 and XY335, but such effects were more severe at 40%FC (Fig. 4 ). These results showed that the overaccumulation of MDA and H 2 O 2 were increased that caused oxidative stress under the influence of water deficiency as compared to all P-levels in both maize cultivars (Fig. 4 ). Effects of drought and P-deficiency on the antioxidant enzymes The activities of antioxidative enzymatic were affected by reducing the water and P-supply levels in ZD958 and XY335 (Fig. 5 ). According to the results, SOD was significantly ( p < 0.05) increased by decreasing the water and P-supply levels but the maximum SOD values were noted under severe water and P-deficiency (40%FC + P0) in both cultivars, as compared to other levels of water and P application. However, non-significant ( p > 0.05) variation in POD values were recorded under the influence of water and P application levels. Interestingly, the highest values of POD were noted under severe water deficiency and optimum P-supply (40%FC + P100) in ZD958 and XY335, compared with other levels of water and P, respectively. The trend of CAT was opposite to SOD, which was significantly ( p < 0.05) reduced by decreasing the water and P-supply levels. The higher reduction of CAT was not at severe water deficiency (40%FC) with all P application levels (P100, P50 and P0) in both maize cultivars, indicating that the CAT was not triggered in maize in response to drought. Effects of drought and P-deficiency on the compatible solutes The levels of compatible solutes viz., total protein contents, free proline, and total soluble sugars in ZD958 and XY335 were significantly (p < 0.05) increased under the interactive levels of water and P-supply (Fig. 6 ). The data indicated that the total protein contents and free proline were increased at 60%FC and 40%FC at all levels of the P-application in both cultivars. However, the higher improvement of total soluble sugar was recorded by severe water deficiency with optimum P-supply (40%FC + P100) in both cultivars, as compared to other levels of water and P-supply. Overall, interaction of 40%FC and P0 significantly up-regulated the compatible solutes in ZD958 and XY335 cultivars. Total protein, free proline and total soluble sugar were less affected by reducing P application, compared with water levels (Fig. 6 ). Relative expression of drought and P-starvation responsive genes To understand the underlying mechanism on how maize plants were affected by interactive levels of water and P-deficiency, the expression of some drought and P-starvation responsive genes were analyzed. Results showed that the ZmNAC111 was upregulated under 60% and 40% FC, as compared to 100% FC with the application of P100 in both maize cultivars. Comparatively, it was less regulated at both water deficit levels with P50 and P0 treatments. Overall, the relative expression trend of ZmNAC111 was P100 > P50 > P0 with 100%FC < 60%FC < 40%FC. However, the higher expression level of ZmPHR1.1 was recorded under P0 with all treatments of water, compared with P100 and P50 but higher level was noted under the interactive level of 40%FC with P0 in both maize cultivars. Moreover, ZmPHR1.1 was more increased in ZD958, as compared to XY335. Similarly, the ZmPHR1.2 was the most upregulated under P0 with all levels of water treatment as compared to P100 and P50 but higher expression was recorded under the interactive level of 40%FC with P0. Overall, the expression trend of ZmPHR1 genes was P100 < P50 < P0 and 100%FC < 60%FC < 40%FC. Correlations matrix revealed association among various traits The Pearson correlation analysis revealed significant positive and negative correlations among the studied traits under the interactive levels of water and P-supply in both maize cultivars (Fig. 8 ). The results showed the positive association of shoot traits with different root traits of both maize cultivars (ZD958 and XD335), but SRL, RTD and R/S ratio of ZD958 were negatively correlated with the shoot traits. The root and shoot P contents were strongly positively correlated with the shoot and root traits except SRL in XD335, and SRL, RTD and RMF. The shoot and root traits of both cultivars were negatively correlated with MDA, H 2 O 2 ,. Moreover, the SRL had positive correlation with MDA, H 2 O 2 , SOD, POD, TPC, TSS, FP but negatively correlation with CAT. Furthermore, H 2 O 2 and MDA had strong positive correlation with SOD, TPC, FP and TSS. Discussion Drought and P-deficiency are two of the most important factors that limit the productivity of plants in natural environment (Ho et al. 2005, Falalou et al. 2018, Smith et al. 2022) and plants responses to these stress conditions are highly complex which involve the changes at the morpho-physiological, biochemical and gene levels. This study explains how interactive levels of water and P supply disturb the morpho-physiological, biochemical and candidate gene responses in maize plants. Our results showed that the interaction of water and P-deficiency levels has a profound negative effect (p<0.05) on the shoot length, shoot fresh weight, shoot dry weight, and the number of leaves of ZD958 and XY335 (Fig.1 and Fig.2). As previously, it was stated that the interactive impacts of water deficit condition and low P application reduces the aboveground biomass of common bean (Smith et al. 2022) and chickpea (Chtouki et al. 2022). Moreover, the maize plants root and shoot growth was additively impaired under the drought and P deficiency (Klamer et al. 2019). Furthermore, water and P-deficiency alter the activities, morphology and architecture system of the plant roots. Previously, it has been reported that the low phosphorus significantly increased the root surface area, root volume and total root length but decreased the average root diameter in maize (Xia et al. 2021). Moreover, the maize root surface area and root volume were not affected by drought, but total root length was increased under drought condition (Hussain et al. 2020). The present study showed that the total root length, root fresh weight, root dry weight, root surface area, root average diameter, and root volume of the ZD958 and XY335 were reduced by the interactive levels of water and P-deficiency (Table 2). Specific root length was increased by decreasing the water and P-supply but root tissue density and root mass fraction showed variations in both maize cultivars under the interactive level water and P-deficiency (Table 2). The root/shoot ratio was most affected by severe water deficiency with optimum P application. Interestingly, total root length, surface area, average diameter, root volume was less affected under severe water deficiency when P level was optimum (Table 2). Drought can majorly impact the root function by altering cell water permeability and influencing the growth and architecture of the plant root system. Drought stress and associated reduction in soil moisture can reduce plant nutrient uptake by reducing nutrient supply through mineralization (Sanaullah et al. 2012). In addition, effect of drought stress on nutrient supply through mineralization may depend on the duration and intensity or severity of dry periods (Farooq et al. 2009). Generally, negative effects of drought on plant P uptake become larger with increased dry period with others stressor. In support of our results, previous findings also reported that sufficient supply of Pi could reduce the negative impact of water deficit condition. Under water-deficit conditions, P application enhanced root growth, nutrient uptake, and water use efficiency, ultimately increasing yield and ameliorating the adverse effects of drought (Waraich et al. 2011). Phosphorus supply could enhance the plant resistance capacity to water stress by enhancement of roots system and improving accessibility of a plant to a large spectrum of water and nutrients sources (Razaq et al., 2017). Water deficiency in soil results in significant decrease in uptake of P at any soil-P levels. Sufficient soil-P levels were observed to reduce the water deficiency damage on uptake of P in comparison with moderate or low P supply in both cultivars. Under well water conditions, positive effects of available soil-Pi levels on uptake of P were noticed , which is in agreement with previous findings reported for various crops ( Vance et al., 2003 ; Jones et al., 2004 ; Jemo et al., 2006 ). Under water-deficit conditions, several cowpea varieties showed higher increase in uptake of P following the high soil-Pi supply as compared to the moderate or low soil-Pi supply. Likewise, internal P concentrations declined with reduced water and low P supply, whereas micronutrients were little affected by drought and P-deficiency (Klamer et al. 2019). The present study demonstrated that the drought stress significantly (p<0.05) reduced the shoot-P and root-P concentrations by decreasing the water and P-supply in ZD958 and XY335 (Fig. 3). So, it is noted that even a mild drought stopped the P uptake roots, due to unavailability of P after the soil dried. Drought and P-deficiency collectively affects many physiological and biochemical processes and thus reduces the plant growth. It is reported that water stress induced by PEG significantly increased the ROS production in the maize cultivars (Hussain et al. 2020). Similar to drought, P deficiency inevitably causes increased production of reactive oxygen species (ROS) as by product of photosynthesis (Meng et al. 2021). Our results showed that the rate of lipid peroxidation and accumulation of ROS were increased in the leaves of maize under different levels of water and P-supply regimes (Fig. 4-7). The higher production of ROS was found under the interactive level of 40%FC and P0. As, water and P deficiency induced higher ROS bursts which are scavenged by antioxidant systems which have been reported in maize previously (Zhang et al. 2014; Hussain et al. 2020). We observed the increased activities of SOD and POD which may help to overcome the negative effect of ROS in the leaves of maize cultivars under the interactive influence of drought stress and P- levels (Fig. 4-8, 4-9, 4-10 and 4-11). The enzymatic components may directly scavenge the ROS or produce the non-enzymatic antioxidants. Specifically, SOD is involved in the dismutation of O2 • − into H 2 O 2 in the mitochondrion, chloroplast, peroxisome and cytoplasm, while POD scavenges for H2O2 produced through the dismutation of O2•− catalysed by SOD. In addition, the higher levels of compatible solutes viz., total protein contents, free proline and total soluble sugar were noted in ZD958 and XY335 under interactive impact of drought and P-deficiency (Fig. 4-12), which indicated that the plants have self-defence mechanism to combat the stress condition. Previously, also the higher accumulation of osmolytes were noted to lower oxidative stress damage in maize under P-deficiency (Tang et al. 2019) and drought (Hussain et al. 2018, Hussain et al. 2020) To understand the mechanism on how maize plants respond to interactive levels of the water and P-deficiency, we tested the relative expression of selected stress responsive genes viz. ZmNAC111 , ZmPHR1.1 and ZmPHR1.2 . Previously, it has been reported that the over expression of ZmNAC111 confer drought tolerance in maize, improves plant water-use efficiency and enhances the expression of stress-responsive genes under drought condition (Mao et al. 2015). However, the role of ZmNAC111 against interactive levels of water and P-deficiency has not yet been reported. In this study, we observed a significant upregulation in the expression of ZmNAC111 in both maize cultivars under severe water deficiency (40%FC) with sufficient P-supply (P100) treatment, and weak expression was noted under sufficient water level (100%FC) at all P-treatments (Fig. 7B). These findings suggest that the upregulation of ZmNAC111 indicate tolerance against drought condition, as optimum P-supply (P100) helps the plants to improve drought tolerance by higher expression of ZmNAC111 . Moreover, ZmPHR1 is the well-described phosphate starvation-responsive transcription factor of the MYB family that enhance the phosphate absorption when it was overexpressed under low-phosphate conditions (Wang et al. 2013, Wang et al. 2021a, Wang et al. 2021b). But its role under the interactive levels of drought and P-deficiency has not yet been reported. Our results indicated the expression of ZmPHR1.1 and ZmPHR1.2 was weak at P100, but the expression level increased with decreasing the P supply. Interestingly, the higher expression of ZmPHR1.1 and ZmPHR1.2 was noted at P-deficiency (P0) treatment with moderate water deficiency (60%FC) and severe water deficiency (40%FC) which indicated that the water deficiency restricted the P movement to upper parts of plants, and P deficiency with drought was more lethal than P deficiency at normal moisture level. Conclusions Interaction of drought and P-deficiency affected the shoot and root traits, oxidative status, nutrients uptake and osmolytes accumulation in both hybrid maize cultivars. The shoot length, fresh and dry weight of root and shoot, root architecture and P uptake were significantly ( p < 0.05) reduced by moderate and severe drought with P50 and P0. However, he H 2 O 2 and MDA contents were increased with decreasing the moisture and P-supply. Moreover, SOD, total protein, free proline and total reducing sugar were increased with decreasing the moisture and P-supply, but POD and CAT were fluctuated to with oxidative stress caused by water and P supply levels. We found the upregulation of ZmNAC111 under severe drought with sufficient P supply, but no such effects were recorded under 100%FC with all P levels which indicates its vital role in drought tolerance and positive coloration with P availability. Moreover, the higher expression of ZmPHR1.1 and ZmPHR1.2 was observed at P-deficiency at moderate and severe drought, which shows these are key genes for P-deficiency tolerance. Further molecular studies are required to determine the mechanistic relationships of water deficit and P deficiency based on the root system architecture, uptake and transport of nutrients and defence mechanism to design strategies for crop breeding. Declarations Funding Financial support for this paper was provided by the National Natural Science Foundation of China (41977072) and Science and Technology Innovation Project of Chinese Academy of Agricultural Sciences. Competing Interests The authors declare no competing interests. References Ali S, Tyagi A, Park S, Mir RA, Mushtaq M, Bhat B, Al-Mahmoudi H, Bae H (2022) Deciphering the Plant Microbiome to Improve Drought Tolerance: Mechanisms and Perspectives. Environmental and Experimental Botany: 104933 Asensio D, Zuccarini P, Ogaya R, Marañón-Jiménez S, Sardans J, Peñuelas J (2021) Simulated climate change and seasonal drought increase carbon and phosphorus demand in Mediterranean forest soils. Soil Biol Biochem 163:108424 Chen N, Qin J, Tong S, Wang W, Jiang Y (2022) One AP2/ERF Transcription Factor Positively Regulates Pi Uptake and Drought Tolerance in Poplar. Int J Mol Sci 23(9):5241 Chtouki M, Laaziz F, Naciri R, Garré S, Nguyen F, Oukarroum A (2022) Interactive effect of soil moisture content and phosphorus fertilizer form on chickpea growth, photosynthesis, and nutrient uptake. Sci Rep 12(1):1–13 Cramer MD, Hawkins H-J, Verboom GA (2009) The importance of nutritional regulation of plant water flux. Oecologia 161(1):15–24 Falalou H, Mariama H, Achirou FB, Oumarou H, Vadez V (2018) Genotypic variation for root development, water extraction and yield components in groundnut under low phosphorus and drought stresses. Am J Agric Forestry 6(5):122–131 FAO (2018) FUTURE OF FOOD AND AGRICULTURE 2018: Alternative Pathways to 2050. FOOD & AGRICULTURE ORG Garg BK, Burman U, Kathju S (2004) The influence of phosphorus nutrition on the physiological response of moth bean genotypes to drought. J Plant Nutr Soil Sci 167(4):503–508 Goufo P, Moutinho-Pereira JM, Jorge TF, Correia CM, Oliveira MR, Rosa EA, António C, Trindade H (2017) Cowpea (Vigna unguiculata L. Walp.) metabolomics: osmoprotection as a physiological strategy for drought stress resistance and improved yield. Front Plant Sci 8:586 Gunes A, Cicek N, Inal A, Alpaslan M, Eraslan F, Guneri E, Guzelordu T (2006) Genotypic response of chickpea (Cicer arietinum L.) cultivars to drought stress implemented at pre-and post-anthesis stages and its relations with nutrient uptake and efficiency. Plant Soil and Environment 52(8):368 He M, Dijkstra FA (2014) Drought effect on plant nitrogen and phosphorus: a meta-analysis. New Phytol 204(4):924–931 Ho MD, Rosas JC, Brown KM, Lynch JP (2005) Root architectural tradeoffs for water and phosphorus acquisition. Funct Plant Biol 32(8):737–748 Hussain HA, Hussain S, Khaliq A, Ashraf U, Anjum SA, Men S, Wang L (2018) Chilling and drought stresses in crop plants: implications, cross talk, and potential management opportunities. Front Plant Sci 9:393 Hussain HA, Men S, Hussain S, Zhang Q, Ashraf U, Anjum SA, Ali I, Wang L (2020) Maize tolerance against drought and chilling stresses varied with root morphology and antioxidative defense system. Plants 9(6):720 Hussain HA, Men S, Hussain S, Chen Y, Ali S, Zhang S, Zhang K, Li Y, Xu Q, Liao C (2019) Interactive effects of drought and heat stresses on morpho-physiological attributes, yield, nutrient uptake and oxidative status in maize hybrids. Sci Rep 9(1):1–12 Kaya C, Şenbayram M, Akram NA, Ashraf M, Alyemeni MN, Ahmad P (2020) Sulfur-enriched leonardite and humic acid soil amendments enhance tolerance to drought and phosphorus deficiency stress in maize (Zea mays L.). Sci Rep 10(1):1–13 Klamer F, Vogel F, Li X, Bremer H, Neumann G, Neuhäuser B, Hochholdinger F, Ludewig U (2019) Estimating the importance of maize root hairs in low phosphorus conditions and under drought. Ann Botany 124(6):961–968 Li P, Weng J, Rehman A, Niu Q (2022) Root Morphological and Physiological Adaptations to Low Phosphate Enhance Phosphorus Efficiency at Melon (Cucumis melo L.) Seedling Stage. Horticulturae 8(7):636 MacDonald GK, Bennett EM, Potter PA, Ramankutty N (2011) Agronomic phosphorus imbalances across the world's croplands. Proceedings of the National Academy of Sciences 108(7): 3086–3091 Mao H, Wang H, Liu S, Li Z, Yang X, Yan J, Li J, Tran L-SP, Qin F (2015) A transposable element in a NAC gene is associated with drought tolerance in maize seedlings. Nat Commun 6(1):1–13 Mogollón J, Beusen A, Van Grinsven H, Westhoek H, Bouwman A (2018) Future agricultural phosphorus demand according to the shared socioeconomic pathways. Glob Environ Change 50:149–163 Nadeem M, Mollier A, Morel C, Vives A, Prud’homme L, Pellerin S (2011) Relative contribution of seed phosphorus reserves and exogenous phosphorus uptake to maize (Zea mays L.) nutrition during early growth stages. Plant Soil 346(1):231–244 Oliveira EMM, Ruiz HA, Alvarez VVH, Ferreira PA, Costa FO, Almeida ICC (2010) Nutrient supply by mass flow and diffusion to maize plants in response to soil aggregate size and water potential. Revista Brasileira de Ciência do Solo 34:317–328 Peng X, Zhao Y, Li X, Wu M, Chai W, Sheng L, Wang Y, Dong Q, Jiang H, Cheng B (2015) Genomewide identification, classification and analysis of NAC type gene family in maize. J Genet 94(3):377–390 Rubio V, Linhares F, Solano R, Martín AC, Iglesias J, Leyva A, Paz-Ares J (2001) A conserved MYB transcription factor involved in phosphate starvation signaling both in vascular plants and in unicellular algae. Genes Dev 15(16):2122–2133 Sardans J, Peñuelas J (2004) Increasing drought decreases phosphorus availability in an evergreen Mediterranean forest. Plant Soil 267(1):367–377 Sardans J, Peñuelas J (2012) The role of plants in the effects of global change on nutrient availability and stoichiometry in the plant-soil system. Plant Physiol 160(4):1741–1761 Shemi R, Wang R, Gheith E-S, Hussain HA, Cholidah L, Zhang K, Zhang S, Wang L (2021a) Role of exogenous-applied salicylic acid, zinc and glycine betaine to improve drought-tolerance in wheat during reproductive growth stages. BMC Plant Biol 21(1):1–15 Shemi R, Wang R, Gheith E-S, Hussain HA, Hussain S, Irfan M, Cholidah L, Zhang K, Zhang S, Wang L (2021b) Effects of salicylic acid, zinc and glycine betaine on morpho-physiological growth and yield of maize under drought stress. Sci Rep 11(1):1–14 Shubhra DJ, Goswami CL, Munjal R (2004) Influence of phosphorus application on water relations, biochemical parameters and gum content in cluster bean under water deficit. Biol Plant 48(3):445–448 Smith MR, Dinglasan E, Veneklaas E, Polania J, Rao IM, Beebe SE, Merchant A (2022) Effect of Drought and Low P on Yield and Nutritional Content in Common Bean. Frontiers in Plant Science 13 Suriyagoda L, De Costa W, Lambers H (2014) Growth and phosphorus nutrition of rice when inorganic fertiliser application is partly replaced by straw under varying moisture availability in sandy and clay soils. Plant Soil 384(1):53–68 Tang H, Niu L, Wei J, Chen X, Chen Y (2019) Phosphorus limitation improved salt tolerance in maize through tissue mass density increase, osmolytes accumulation, and Na + uptake inhibition. Front Plant Sci 10:856 Tran L-SP, Nishiyama R, Yamaguchi-Shinozaki K, Shinozaki K (2010) Potential utilization of NAC transcription factors to enhance abiotic stress tolerance in plants by biotechnological approach. GM crops 1(1):32–39 Wang J, Pan W, Nikiforov A, King W, Hong W, Li W, Han Y, Patton-Vogt J, Shen J, Cheng L (2021a) Identification of two glycerophosphodiester phosphodiesterase genes in maize leaf phosphorus remobilization. Crop J 9(1):95–108 Wang R, Zhong Y, Liu X, Zhao C, Zhao J, Li M, Ul Hassan M, Yang B, Li D, Liu R (2021b) Cis-regulation of the amino acid transporter genes ZmAAP2 and ZmLHT1 by ZmPHR1 transcription factors in maize ear under phosphate limitation. J Exp Bot 72(10):3846–3863 Wang X, Bai J, Liu H, Sun Y, Shi X, Ren Z (2013) Overexpression of a maize transcription factor ZmPHR1 improves shoot inorganic phosphate content and growth of Arabidopsis under low-phosphate conditions. Plant Mol Biology Report 31(3):665–677 Wen Z, Pang J, Tueux G, Liu Y, Shen J, Ryan MH, Lambers H, Siddique KH (2020) Contrasting patterns in biomass allocation, root morphology and mycorrhizal symbiosis for phosphorus acquisition among 20 chickpea genotypes with different amounts of rhizosheath carboxylates. Funct Ecol 34(7):1311–1324 Xia Z, He Y, Zhou B, Korpelainen H, Li C (2020) Sex-related responses in rhizosphere processes of dioecious Populus cathayana exposed to drought and low phosphorus stress. Environ Exp Bot 175:104049 Xia Z, Zhang S, Wang Q, Zhang G, Fu Y, Lu H (2021) Effects of root zone warming on maize seedling growth and photosynthetic characteristics under different phosphorus levels.Frontiers in Plant Science12 Zhang H, Shi L, Lu H, Shao Y, Liu S, Fu S (2020) Drought promotes soil phosphorus transformation and reduces phosphorus bioavailability in a temperate forest. Sci Total Environ 732:139295 Zia R, Nawaz MS, Siddique MJ, Hakim S, Imran A (2021) Plant survival under drought stress: Implications, adaptive responses, and integrated rhizosphere management strategy for stress mitigation. Microbiol Res 242:126626 Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-2476562","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":168486932,"identity":"c53c655c-dddf-452c-8277-728c0111bfb2","order_by":0,"name":"Hafiz Athar Hussain","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABBElEQVRIiWNgGAWjYFACHgYGxgYQA0LKgUXwAjY0LcakaIGAxAZCWvjn9x78XLnjsL18++G2hz/bDqdvOH724IMPDHZyug3YtUgc40uWPHvmcOKGM4ntxrxth3M3nMlLNpzBkGxsdgCHNcd4DCQb2w4nGDAktkkzbgNqOZBjJs3DcCBxGw4t8sd4jH8CtdjL9z9sk/y57XC6wfk3+LUYHOMxA9nC2HAjsU2CdxvQuhsEbDE8lmNm2diWnrjhxsM2ad5/6YYzb7wxNpxhgNsvcofPGN9sbLMGOiz9meSPM9byfOdzDB98qLCTw+l9DKAAVmlArHIQkG8gRfUoGAWjYBSMBAAAovdjM+OGVMIAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0001-5239-6172","institution":"Chinese Academy of Agricultural Sciences","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Hafiz","middleName":"Athar","lastName":"Hussain","suffix":""},{"id":168486933,"identity":"030fef46-e075-4dbc-82bc-c867ce8265fb","order_by":1,"name":"Zhang Qingwen","email":"","orcid":"","institution":"","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Zhang","middleName":"","lastName":"Qingwen","suffix":""},{"id":168486934,"identity":"66fade54-f18e-40d4-b1bf-e4cc033d3b40","order_by":2,"name":"Saddam Hussain","email":"","orcid":"","institution":"","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Saddam","middleName":"","lastName":"Hussain","suffix":""},{"id":168486935,"identity":"d36717ca-ae76-414c-aabc-f5d5584d076f","order_by":3,"name":"Rubab Zahra Naqvi","email":"","orcid":"","institution":"","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Rubab","middleName":"Zahra","lastName":"Naqvi","suffix":""},{"id":168486936,"identity":"75010f4a-0a7e-4840-b3de-88e92a484501","order_by":4,"name":"Rana Muhammad Atif","email":"","orcid":"","institution":"","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Rana","middleName":"Muhammad","lastName":"Atif","suffix":""},{"id":168486937,"identity":"55132c1b-4581-4109-810f-07943583feae","order_by":5,"name":"Muhammad Ahmad","email":"","orcid":"","institution":"","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Muhammad","middleName":"","lastName":"Ahmad","suffix":""},{"id":168486938,"identity":"644c2d23-30d8-42f2-a284-ddef75695299","order_by":6,"name":"Qurat ul Ain","email":"","orcid":"","institution":"","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Qurat","middleName":"ul","lastName":"Ain","suffix":""},{"id":168486939,"identity":"2cdb5e94-e3d3-4f4f-97ea-a35b9b209120","order_by":7,"name":"Asma Imran","email":"","orcid":"","institution":"","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Asma","middleName":"","lastName":"Imran","suffix":""}],"badges":[],"createdAt":"2023-01-13 21:43:06","currentVersionCode":1,"declarations":{"humanSubjects":false,"vertebrateSubjects":false,"conflictsOfInterestStatement":false,"humanSubjectEthicalGuidelines":false,"humanSubjectConsent":false,"humanSubjectClinicalTrial":false,"humanSubjectCaseReport":false,"vertebrateSubjectEthicalGuidelines":false,"coiExplicitlySet":false},"doi":"10.21203/rs.3.rs-2476562/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-2476562/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":31813884,"identity":"9cafc0d7-3d08-4f36-acf4-71a74d1a696f","added_by":"auto","created_at":"2023-01-19 16:10:08","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":79541,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of water and P application levels on the shoot length, shoot fresh weight (SFW), and shoot dry weight (SDW) of the ZD958 and XY335 Maize cultivars. Error bars indicate the ± SE of three replicates. Different alphabetical letters above error bars represent the significant difference among treatments at \u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-2476562/v1/1e72e43192a140bcf54da2f0.png"},{"id":31815643,"identity":"11a00501-12f9-4b8c-aa22-bd62e615a725","added_by":"auto","created_at":"2023-01-19 16:18:08","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":72353,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of water and P application levels on the number of leaves of the ZD958 and XY335 Maize cultivars. Error bars indicate the ± SE of three replicates. Different alphabetical letters above error bars represent the significant difference among treatments at \u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-2476562/v1/68340b10db5ff64eea73ae09.png"},{"id":31815646,"identity":"f05ee558-400b-4957-bd13-16216a6a8d60","added_by":"auto","created_at":"2023-01-19 16:18:08","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":137647,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of water and P application levels on the shoot phosphorus contents and root phosphorus contents of the ZD958 and XY335 Maize cultivars. Error bars indicate the ± SE of three replicates. Different alphabetical letters above error bars represent the significant difference among treatments at \u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-2476562/v1/6e22df63762bc7c68d168048.png"},{"id":31813886,"identity":"77986c02-551a-47f9-b9ea-5f72fbbf47f6","added_by":"auto","created_at":"2023-01-19 16:10:08","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":117300,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of water and P application levels on the malondialdehyde (MDA) content and Hydrogen peroxide (H2O2) production of the ZD958 and XY335 Maize cultivars. Error bars indicate the ± SE of three replicates. Different alphabetical letters above error bars represent the significant difference among treatments at \u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-2476562/v1/444bb1c1255dd10c7289c929.png"},{"id":31813891,"identity":"9cb1e694-a860-477e-8fe2-b4f884223467","added_by":"auto","created_at":"2023-01-19 16:10:09","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":154642,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of water and P application levels on the superoxide dismutase (SOD), peroxidase (POD), catalase (CAT) activities of the ZD958 and XY335 Maize cultivars. Error bars indicate the ± SE of three replicates. Different alphabetical letters above error bars represent the significant difference among treatments at \u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-2476562/v1/d672e1ce82c761de1ebe00ca.png"},{"id":31815644,"identity":"78e85d73-7ff2-49a7-8864-c0c74ed75e5e","added_by":"auto","created_at":"2023-01-19 16:18:08","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":193857,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of water and P application levels on the total protein contents, free proline and total soluble sugar content of the ZD958 and XY335 Maize cultivars. Error bars indicate the ± SE of three replicates. Different alphabetical letters above error bars represent the significant difference among treatments at \u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-2476562/v1/1aa0b9f17c5118556d689792.png"},{"id":31816360,"identity":"8d68dd2a-8674-455f-999e-cb8e6cd6c77f","added_by":"auto","created_at":"2023-01-19 16:26:08","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":157237,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of water and P application levels on the relative expression of ZmNAC and ZmPHR1genes in ZD958 and XY335 Maize cultivars. Error bars indicate the ± SE of three replicates. Different alphabetical letters above error bars represent the significant difference among treatments at \u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-2476562/v1/32bb8b12e29d15fe282adb93.png"},{"id":31813889,"identity":"85368907-9db3-41ad-a4a2-b2c49a29379d","added_by":"auto","created_at":"2023-01-19 16:10:08","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":865149,"visible":true,"origin":"","legend":"\u003cp\u003ePearson’s correlation among traits of maize hybrids cultivars (ZD958 at low-left diagonal in round shape, XD335 at upper-right diagonal with digits) under interactive levels of water and P application. The scale bar on the right indicates the intensity of the correlation from 1 (highest positive in red) to –1 (highest negative in dark blue). Trait notations: SL, shoot length; SFW, shoot fresh weight; SDW, shoot dry weight; NL, no. of leaves; TRL, total root length; RFW, root fresh weight; RDW, root dry weight; SRL, specific root length; RTD, root tissue density; RMF, root mass fraction, RSA, root surface area; RAD, root average diameter; RV, root volume; R/S ratio, root/shoot ratio; SP, shoot phosphorus; RP, root phosphorus; MDA, malondialdehyde; H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e, hydrogen peroxide; SOD,\u0026nbsp; superoxide dismutase; POD, peroxidase; CAT, catalase; TPC, total protein contents; FP, free proline; TSS, total soluble sugar.\u003c/p\u003e","description":"","filename":"Figure8.png","url":"https://assets-eu.researchsquare.com/files/rs-2476562/v1/1478bd75071c803609ab6d1e.png"},{"id":32056648,"identity":"9f970a05-7150-4f2b-b1da-5ba42ddce414","added_by":"auto","created_at":"2023-01-25 19:30:04","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2157689,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-2476562/v1/a7d575ab-44b8-4c51-9fd8-e85001324691.pdf"}],"financialInterests":"","formattedTitle":"Contrasting patterns in growth attributes, root traits plasticity, and defence mechanism of maize under deficit moisture and phosphorus supply","fulltext":[{"header":"Introduction","content":"\u003cp\u003eClimate changes have multifaceted effects on the consequences of abiotic stress, threatening the productivity and sustainability of agricultural systems (Hussain et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). During their life spam, plants generally encounter a wide range of abiotic stresses such as drought, salinity, temperature extremes, and nutrient deficiencies. Generally, the occurrence of single stress factor in the natural condition generally leads to other stresses in plants, e.g., water deficiency not only induces osmotic stress but also causes P-starvation (Zhang et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2020\u003c/span\u003e, Asensio et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2021\u003c/span\u003e, Chen et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). It has been estimated that more than 60% of the global population will inhabit areas with water deficiencies by 2025 (FAO \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Moreover, \u0026gt;\u0026thinsp;30% of the global cropland is phosphorus deficient (MacDonald et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2011\u003c/span\u003e), so the P input into croplands is expected to increase by 51\u0026ndash;86% by the year 2050 (Mogoll\u0026oacute;n et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). The relationship between P and soil water is well known\u0026mdash; soil P movement occurs through mass flow and diffusion and depends on pores filled with water (Oliveira et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Most of the studies indicated that the plant P uptake is decreased under low soil moisture (Cramer et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2009\u003c/span\u003e, He and Dijkstra \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2014\u003c/span\u003e, Suriyagoda et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2014\u003c/span\u003e) as P supply is reduced to root that affects water relations factors in the stressed plant (Sardans and Pe\u0026ntilde;uelas \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2004\u003c/span\u003e, Hussain et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2019\u003c/span\u003e), and decreased P supply through mineralization and by reduced P diffusion and mass flow in the soil (Sardans and Pe\u0026ntilde;uelas \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2012\u003c/span\u003e, Suriyagoda et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2014\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eDrought stress affects plant growth by altering ion uptake and enzyme activity, decreasing soil water potential and water uptake by roots (Hussain et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2020\u003c/span\u003e, Ali et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), and alterations in the metabolism of plants through overproduction of ROS like hydroxyl ion, hydrogen peroxide and superoxide (Zia et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). However, these radicals affect plant structural and functional stability by oxidizing proteins, lipids, and nucleic acids. Nevertheless, plants are fortified by various physiological and molecular processes to overcome these effects amongst which eliciting of antioxidant enzymes has a vital role in plants stress tolerance (Shemi et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2021a\u003c/span\u003e, Shemi et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2021b\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn addition, inorganic phosphate (Pi) inadequacy is common problem in natural ecosystems due to its relatively high immobility and uneven distribution in soil. Like as drought, P- deficiency exhibited the series of complex morphological, physiological, and developmental adaptations in the roots and shoots (Li et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Under P deficiency, shoot growth was more reduced than root growth and therefore resulted in a significant increase of biomass allocation to roots (Mollier and Pellerin, 1999). P deficiency also reduce root hydraulic conductance and whole plant water potential, probably by lowering the activity of water channel protein. Zribi et al. (2011) indicated that leaf water content was correlated with leaf osmotic potential under P deficiency. The soluble sugars usually accumulate in P-deficient plants, since utilization of the photo assimilate was largely restricted (Wissuwa et al., 2005).\u003c/p\u003e \u003cp\u003eMaize (\u003cem\u003eZea mays\u003c/em\u003e L.) is sensitive to drought (Hussain et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2019\u003c/span\u003e, Hussain et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2020\u003c/span\u003e, Shemi et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2021b\u003c/span\u003e) and phosphorus deficit condition (Nadeem et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2011\u003c/span\u003e, Klamer et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2019\u003c/span\u003e, Xia et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) particularly during early growth stages. Single or combined impact of drought and P deficiency considerably decrease maize growth by affecting Fv/Fm, chlorophyll content, leaf relative water content and leaf water potential (Kaya et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Concurrent effects of drought and P deficiency triggered the morpho-physiological, biochemical and structural responses (Suriyagoda et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2014\u003c/span\u003e, Chtouki et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) by reducing leaf area, leaf water potential, photosynthetic activity, soluble protein contents, nutrient uptake, and metabolic enzyme activities of plants (Shubhra, Garg et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2004\u003c/span\u003e, Gunes et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2006\u003c/span\u003e, Goufo et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2017\u003c/span\u003e, Xia et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Water and P deficiency, both individually and combined, significantly decrease seed weight and aboveground biomass upto \u0026sim;80% (Smith et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), indicating that both these stressors are harmful for the physiological and metabolic functioning of the plants.\u003c/p\u003e \u003cp\u003eAt the molecular level, Arabidopsis ATAF1/2 and CUC2 (NAC) transcription factors play important roles in the regulation of various gene expression in response to stress conditions, and their molecular engineering is proposed as a potential strategy for the genetic improvement of stress tolerance in crops (Tran et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Previously it was noted that the expression levels of 14 different NAC genes were increased in maize after drought treatments, suggesting that these genes might play important role in stress regulation, particularly those showing strong response to the drought stress whereas 5 NAC genes were involved in the communication between different signal transduction pathways (Peng et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). However, the enhanced expression of ZmNAC111 conferred drought tolerance in maize seedlings, improved plant water-use efficiency (WUE), modulated stomatal closure and enhanced the expression of stress-responsive genes under stress condition (Mao et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2015\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eFor P-deficient plants, phosphate transporter 1 (PHR1) transcription factor is viewed as a positive regulator for inorganic phosphate (Pi) starvation signalling that up-regulates the \u0026ldquo;induced by phosphate starvation1\u0026rdquo; (IPS1) genes (Rubio et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). However, ZmPHR1 led to the upregulation of multiple genes that regulate metabolism during Pi-starvation, which in turn resulted in an elevation of Pi content in plants (Wang et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Moreover, relative expression of ZmPHR1.1, and ZmPHR1.2, was significantly up-regulated in response to low phosphate conditions in maize (Wang et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2021b\u003c/span\u003e).\u003c/p\u003e \u003cp\u003ePreviously, most of the studies have focused on the single stress factor of drought or P-deficiency, but the synergistic interaction of drought and P deficiency for maize responses and underlying mechanisms need further investigation. Moreover, the response pattern of ZmNAC and ZmPHR1 transcription factor genes to the combination of water and P-deficiency, remains a particularly interesting question. Here, we studied the response of maize hybrids to drought and P-deficiency at physiological, biochemical, and gene levels. The aims of this study were to determine the interactive effects of drought and P-deficiency on the (a) morpho-physiological and biochemical attributes (b) root system architecture (c) P uptake and translocation in plant tissues, and (d) expression pattern of ZmNAC and ZmPHR1 transcription factor genes. We hypothesized that the negative effects of combined water and P-deficiency will be variable and severe than that of individual stress factor. The findings of this study would be helpful to understand the drought and low P tolerance mechanism of plants and will provide future directions for characterization of function and regulation of responsive genes for developing stress tolerant maize cultivars.\u003c/p\u003e"},{"header":"Material And Methods","content":"\u003cp\u003eThe experiment was conducted in the growth room with controlled condition at the National Institute for Biotechnology and Genetic Engineering (NIBGE), Faisalabad, Pakistan. The seeds of hybrid maize cv. Zhengdan958 (ZD958) and Xianyu335 (XY335) were obtained from the Institute of Crop Science, Chinese Academy of Agricultural Sciences, Beijing, China. The soil was collected from the 0\u0026ndash;20-cm layer of an experimental field of NIBGE, and sieved through 2-mm mesh. The soil texture class was sandy loam with pH 7.46, 12.3 g kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e organic matter, 13.05 mg kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e total nitrogen, 6.52 mg kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e available P, 98.72 mg kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e exchangeable potassium. Seeds were surface sterilized in 70% ethanol for 1 min followed by 5% sodium hypochlorite for 5 min, then washed four times in deionized water and planted in plastic pots (20 cm in-depth, 16 cm in diameter) filled with 2 kg soil. In each pot, four seeds were initially sown and after emergence, one plant was maintained in each pot. Recommended fertilizer was applied in the soil before sowing including the levels of Phosphorus, P1 (100 mg P kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e soil), P2 (50 mg P kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e soil) and P3 (no phosphorus). The plants were allowed to be grow for 18 days at normal condition and then subjected to three different soil moisture regimes as, W1: well-watered (\u0026gt;\u0026thinsp;80%FC), W2: moderate drought stress (60% FC), W3: severe drought stress (40% FC) for 10 days. The average day-night temperature during the experiment period was 18\u0026ndash;32\u0026deg;C and relative humidity was 60\u0026ndash;70%, respectively. The plants were harvested at 28 DAS and growth parameters were recorded and fresh samples were taken for physiological and molecular parameters. All the treatments were arranged in a completely randomized design (CRD) with three replications for each treatment. The experimental treatments were re-positioned weekly to minimize the environmental effects.\u003c/p\u003e\n\u003ch3\u003eMeasurement Of Plant Growth Traits\u003c/h3\u003e\n\u003cp\u003eAt harvest, shoot length of maize seedlings was recorded with a meter scale and seedlings were further separated immediately into roots and shoots for the measurement of fresh weights using digital electric balance. Subsamples of shoots were stored at \u0026minus;\u0026thinsp;40\u0026deg;C for biochemical analysis. The root samples were carefully scanned using the Epson PerfectionV700 Photo Flatbed scanner (No. B11B178023, PT Epson, Jakarta, Indonesia) and root functional traits: total root length, root surface area, average diameter, and root volume, were analyzed using the WinRHIZO software (Regent Instructions, Quebec, Canada). Furthermore, the biomass allocation such as root mass fraction (the proportion of root dry weight to the total plant dry weight), the root/shoot ratio (ratio of the belowground biomass to the aboveground biomass), specific root length (length per unit dry weight of total root system), root mass density (mass per unit root volume) were analysed (Wen et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Later, the samples were oven-dried for recording shoot and root dry weights.\u003c/p\u003e\n\u003ch3\u003eEstimation Of Phosphorus Contents\u003c/h3\u003e\n\u003cp\u003eThe P contents from maize shoot and root samples was determined by vanadate molybdate method with some modifications using a UV/visible spectrophotometer as suggested by Chapman and Pratt (1962). One g of ground plant sample was taken for analysis and placed in a 100-mL volumetric flask, and 10 mL of tri-acid mixture (HNO\u003csub\u003e3\u003c/sub\u003e, H\u003csub\u003e2\u003c/sub\u003eSO\u003csub\u003e4\u003c/sub\u003e and HClO with the ratio of 9:4:1) was added and the contents were mixed by swirling. The flask was placed on a hotplate in the fumehood and start heating at 80\u0026ndash;90\u0026deg;C and then the temperature was raised to about 150\u0026ndash;200\u0026deg;C. Continues heating were applied until the production of red NO\u003csub\u003e2\u003c/sub\u003e fumes ceases. The contents were further heated until the volume was reduced to 3\u0026ndash;4 mL and became colourless. After cooling the contents, the volume was made up with the distilled water and filtered through No. 1 filter paper. Then, 5 mL of digested solution was taken in a 50-mL volumetric flask, and 10 mL of vanadomolybdate reagent and make up the volume with distilled water. The absorbance of samples was observed by spectrophotometer to calculate the P content from the standard curve.\u003c/p\u003e\n\u003ch3\u003eMeasurement Of Ho And Lipid Peroxidation\u003c/h3\u003e\n\u003cp\u003eThe H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e contents were determined using the procedure described by Velikova et al. (2000). 500 mg of fresh leaves was homogenized with 5 mL of 0.1% (w/v) trichloro-acetic acid in pre-chilled pestle and mortar. The homogenate was centrifuged at 12,000 rpm for 15 min. Then, 0.5 mL supernatant was mixed in 0.5 mL of 0.05 M phosphate buffer (pH 7.0)\u0026thinsp;+\u0026thinsp;1 mL of 1 M potassium iodide, and absorbance was recorded at 390 nm by using water as blank. The same steps were followed for making a standard curve by preparing different dilution of hydrogen peroxide.\u003c/p\u003e \u003cp\u003eLipid peroxidation was quantified by the estimation of malondialdehyde (MDA) content using thiobarbituric acid assays (De Vos et al.1991). For analysis, fresh leaves (0.2 g) were placed on ice bath, grinded with 5.0 mL of 5% (w/v) TCA, centrifuged, and the MDA content was recorded at 532 and 600 nm spectrophotometrically.\u003c/p\u003e\n\u003ch3\u003eMeasurement Of Enzymatic Antioxidants\u003c/h3\u003e\n\u003cp\u003eLeaf samples were harvested and kept in a disposable zipper bag and stored at -80\u0026deg;C for the determination of antioxidant enzyme activity. The activity of SOD was measured by following procedure of Dhindsa et al. (1981). For this, 200 mg leaf sample was homogenized in 2 mL of extraction buffer (0.5 mM EDTA\u0026thinsp;+\u0026thinsp;0.1 M phosphate pH 7.5) with precooled mortar and pestle. The homogenate was centrifuged at 10,000 rpm at 4\u0026deg;C and supernatant was stored at 4\u0026deg;C. SOD activity in the supernatant was assayed by its ability to inhibit photochemical reduction of nitro blue tetrazolium. A 3 mL assay mixture containing (0.2 mL of 200 mM methionine\u0026thinsp;+\u0026thinsp;1.5 M sodium carbonate\u0026thinsp;+\u0026thinsp;0.1 mL 3 mM EDTA\u0026thinsp;+\u0026thinsp;0.1 mL 2.25 mM NBT\u0026thinsp;+\u0026thinsp;0.1 mL riboflavin (60 \u0026micro;M)\u0026thinsp;+\u0026thinsp;1.5 mL 100 mM potassium phosphate buffer\u0026thinsp;+\u0026thinsp;1 mL distilled water and 0.1 mL of enzyme) was incubated under two 15 W inflorescent lamps for 15 min; illuminated and nonilluminated reactions without supernatant served as calibration. Absorbance of the samples along with the blank was recorded at 560 nm wavelength in a spectrophotometer (UV-4000, ORI, Germany). One unit of SOD enzyme activity was defined as the quantity of enzyme that reduced the absorbance reading of samples to 50% in comparison with tubes lacking enzymes (supernatant). A 0.5 g of fresh leaves was ground in a 5 mL of 50 mM phosphate buffer (pH 7.8) with the help of pestle and mortar. The homogenates were centrifuged at 15000 rpm for 20 min at 4\u0026deg;C. The supernatant was used to assess peroxidase (POD) and catalase (CAT) activity. POD activity was determined by following procedure of Putter (1974) with slight modifications. The reaction mixture contained 10 mM guaiacol\u0026thinsp;+\u0026thinsp;5 mM H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e and 50 mM phosphate buffer (pH 7.0). The reaction mixture was preheated at 20\u0026deg;C in a water bath. Then, 2.8 mL reaction solution\u0026thinsp;+\u0026thinsp;0.2 ML enzyme was added in 10 mL centrifuged tube and mix thoroughly. Absorbance was recorded with blank and with reaction mixture. Four absorbance readings were recorded at 470 nm wavelength with 1 minute time interval using spectrophotometer (UV-4000, ORI, Germany).\u003c/p\u003e \u003cp\u003eCAT activity in fresh leaves was measured by the method of Aebei (1984) with slight modification. 100 mM H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e\u0026thinsp;+\u0026thinsp;50 mM phosphate buffer (pH 7.8) solution was preheated in water bath at 25\u0026deg;C. In 10 mL tube, 0.2 mL phosphate buffer\u0026thinsp;+\u0026thinsp;0.2 mL enzyme solution was added and preheated in water bath for 3 min. Then, 0.3 mL (100 mM H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e) solution was added in 10 mL tube. The control tube was heated in boiling water bath for 5 min to kill the enzyme solution. After mixing, the absorbance at the 240 nm wavelength was calculated at interval of 1 min. Continuous determination for 4 min. 1 Unit of enzyme activity (U) was the decrease of 0.1 of A240 within 1 min.\u003c/p\u003e\n\u003ch3\u003eEstimation Of Osmolyte Accumulation\u003c/h3\u003e\n\u003cp\u003eFree proline contents were assessed by following the acid ninhydrin method (Shan et al. 2007). Fresh leaf material (0.5 g) was extracted using 5 mL of 3% sulfosalicylic acid for 10 min with shaking at 100\u0026deg;C. The 2mL of filtered aqueous extract was mixed with glacial acetic acid (2mL) and acid ninhydrin reagent (2 mL), and heated (100\u0026deg;C) for 30 min. The reaction mixture after cooling was segregated against toluene (4 mL) and the absorbance of the organic phase was recorded at 520nm. The resulting values were related with a standard curve plotted using known amounts of proline (Sigma, St Louis, MO, USA).\u003c/p\u003e \u003cp\u003eTotal soluble sugar was estimated by anthracene ketone method as described by Zong and Wang. The fresh leaf sample (0.2 g) was homogenized with 25 mL distilled water and centrifuged (4000 rpm) for 20 minutes. Anthracene (0.1 g) was dissolved in 100mL diluted sulfuric acid to prepare anthracene sulfuric acid reagent. One mL extract and 5 mL anthracene sulfuric acid reagent were taken in a tube, shaken and put in boiling bath for 10 minutes. After 2 h stability, the sample was transferred in cuvette and the absorbance was read at 620 nm.\u003c/p\u003e \u003cp\u003eTotal soluble proteins from the fresh leaf material were measured according to the Bradford (1976) method. 0.25 g fresh leaf material was grinding in 5 mL of phosphate buffer in chilled pestle and mortar, centrifuge at 12,000 rpm for 10 minutes and separated the supernatant. Then take 0.3 mL of supernatant and added 3 mL of Bradford reagent and gently mixed the solution and place it at room temperature for 10 min and absorbance of reading was taken at 595 nm using spectrophotometer.\u003c/p\u003e\n\u003ch3\u003eRna Isolation And Qrt- Pcr\u003c/h3\u003e\n\u003cp\u003eRNA was extracted from maize tissue by using Trizol method with some modification. 1 \u0026micro;g RNA was reverse transcribed into cDNA using RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific). PowerUp\u0026trade; SYBR\u0026trade; Green Master Mix was used for the qPCR reaction using CFX96 qPCR thermocycler with the 100 ng of cDNA and 10uM/\u0026micro;l primers. α-tubulin gene primers were used as an internal control. Quantitative real-time PCR primer sequences for \u003cem\u003eZmTUB4\u003c/em\u003e, \u003cem\u003eZmPHR1.1\u003c/em\u003e, \u003cem\u003eZmPHR1.2\u003c/em\u003e and \u003cem\u003eZmNAC111\u003c/em\u003e, are listed here in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eList of qPCR primer sequences\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer Name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePrimer sequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eZmTUB4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCTATCCTGTGATCTGCCCTGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGCCAAACTTAATAACCCAGTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eZmPHR1.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCCACAGGCGACAGATCTAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTCACCAATGGACTCACGGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eZmPHR1.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAAGGGCATTGGACACTGGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTGAGGTGGTAGTGGAGTGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eZmNAC111\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCAACGGTGTGAACAAGAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCATGCCTCGAATCACTTGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eData analysis\u003c/h2\u003e \u003cp\u003eThe collected data were statistically analysed through analysis of variance technique using statistical package Statistix 8.1 (Analytical Software, Tallahassee, FL, USA). Mean variances were compared through Tukey\u0026rsquo;s HSD test (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Graphical presentation was done through Sigmaplot 10.0. and OriginPro 2021.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eEffects of drought and P-deficiency on shoot growth\u003c/h2\u003e \u003cp\u003eBoth water and P-deficiency had profound negative effect on the shoot growth traits viz., shoot length, shoot fresh weight, shoot dry weight and number of leaves of both maize cultivars (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003e and Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Significant reductions in the shoot length and number of leaves in both cultivars were observed under all P treatments with moderate (60% FC) and severe (40%FC) drought conditions, nevertheless,shoot length and number of leaves of both cultivars were non-significantly (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) affected by all levels of P under well-water supply (100%FC). Same as shoot length, the number of leaves of both cultivars were negatively affected at the 40%FC with different levels of P-supply (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Moreover, the shoot fresh weight and shoot dry weight of the both cultivars were significantly (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) affected by all interactive levels of water and P-supply (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003e). These results indicates that the drought at 40%FC with different levels of P was drastic to the shoot fresh and dry weight of the maize (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003ec-f), as water deficiency restrict the uptake of P-uptake in the upper parts of the plants. Furthermore, shoot length was affected due to water deficiency but P-deficiency didn\u0026rsquo;t affect the shoot length significantly\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eInfluence of drought and P-deficiency on root system architecture\u003c/h2\u003e \u003cp\u003eThe root growth of both maize cultivars was affected under the individual and interactive levels of water and P deficiency (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Total root length of ZD958 was significantly (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) reduced under all P levels with 60% and 40%FC but non significantly (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) affected by different P levels at 100%FC. Likewise, total root length of XY335 was significantly (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) decreased under all levels of the water and P supply compared with P100\u0026thinsp;+\u0026thinsp;100%FC (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eEffects of water and P- deficiency on the total root length, root fresh weight, root dry weight, specific root length, root tissue density, root mass fraction, root surface area, root average diameter, root volume and root/shoot ratio of the ZD958 and XY335 Maize cultivars. The error bar indicates the \u0026plusmn;\u0026thinsp;SE of three replicates. Different alphabetical letters above error bars represent the significant difference among treatments at \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"12\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c10\" colnum=\"10\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c11\" colnum=\"11\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c12\" colnum=\"12\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCultivars\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTreatments\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTotal root length (m)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eRoot fresh weight (g)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eRoot dry weight (g)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eSpecific root length (m g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eRoot mass density\u003c/p\u003e \u003cp\u003e(g/ cm3)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eRoot mass fraction (g g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c9\"\u003e \u003cp\u003eRoot surface area (cm2)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c10\"\u003e \u003cp\u003eRoot average diameter (mm)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c11\"\u003e \u003cp\u003eRoot volume (cm3)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c12\"\u003e \u003cp\u003eRoot/Shoot ratio (g g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"8\" rowspan=\"9\"\u003e \u003cp\u003eZD958\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e100% FC\u0026thinsp;+\u0026thinsp;P100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e60.57\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8.97\u0026thinsp;\u0026plusmn;\u0026thinsp;0.43a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.55\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e38.99\u0026thinsp;\u0026plusmn;\u0026thinsp;0.39c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.18\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.31\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e3178.27\u0026thinsp;\u0026plusmn;\u0026thinsp;265.00a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e4.10\u0026thinsp;\u0026plusmn;\u0026thinsp;0.27a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e124.25\u0026thinsp;\u0026plusmn;\u0026thinsp;4.49a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.47\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03bc\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e100% FC\u0026thinsp;+\u0026thinsp;P50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e57.92\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8.09\u0026thinsp;\u0026plusmn;\u0026thinsp;0.31a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.42\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10ab\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e41.15\u0026thinsp;\u0026plusmn;\u0026thinsp;4.11bc\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.18\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.31\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e2813.69\u0026thinsp;\u0026plusmn;\u0026thinsp;202.40a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e3.35\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11ab\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e109.15\u0026thinsp;\u0026plusmn;\u0026thinsp;3.18ab\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.48\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04bc\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e100% FC\u0026thinsp;+\u0026thinsp;P0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e50.69\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03ab\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e7.37\u0026thinsp;\u0026plusmn;\u0026thinsp;0.36ab\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.92\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e55.36\u0026thinsp;\u0026plusmn;\u0026thinsp;3.64b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.12\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.31\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e2598.99\u0026thinsp;\u0026plusmn;\u0026thinsp;18.12ab\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e3.01\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e98.30\u0026thinsp;\u0026plusmn;\u0026thinsp;7.88b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.45\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02cd\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e60% FC\u0026thinsp;+\u0026thinsp;P100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e49.11\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02ab\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e7.56\u0026thinsp;\u0026plusmn;\u0026thinsp;0.54a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.27\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e38.80\u0026thinsp;\u0026plusmn;\u0026thinsp;2.20c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.17\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.35\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e2613.12\u0026thinsp;\u0026plusmn;\u0026thinsp;32.46ab\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e2.92\u0026thinsp;\u0026plusmn;\u0026thinsp;0.20b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e96.36\u0026thinsp;\u0026plusmn;\u0026thinsp;6.43b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.53\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03abc\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e60% FC\u0026thinsp;+\u0026thinsp;P50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e42.49\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02bc\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e7.27\u0026thinsp;\u0026plusmn;\u0026thinsp;0.56ab\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.23\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e34.90\u0026thinsp;\u0026plusmn;\u0026thinsp;3.62c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.17\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.36\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e2198.76\u0026thinsp;\u0026plusmn;\u0026thinsp;138.32b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e2.89\u0026thinsp;\u0026plusmn;\u0026thinsp;0.27b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e89.78\u0026thinsp;\u0026plusmn;\u0026thinsp;3.76b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.62\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04ab\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e60% FC\u0026thinsp;+\u0026thinsp;P0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e30.42\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01 d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5.05\u0026thinsp;\u0026plusmn;\u0026thinsp;0.23c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.71\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01cde\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e42.65\u0026thinsp;\u0026plusmn;\u0026thinsp;1.92bc\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.14\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.33\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e1255.87\u0026thinsp;\u0026plusmn;\u0026thinsp;31.11c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e1.39\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e45.68\u0026thinsp;\u0026plusmn;\u0026thinsp;2.67c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.64\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e40%FC\u0026thinsp;+\u0026thinsp;P100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e53.75\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03ab\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5.78\u0026thinsp;\u0026plusmn;\u0026thinsp;0.25bc\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.75\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04cd\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e71.96\u0026thinsp;\u0026plusmn;\u0026thinsp;1.14a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.13\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.26\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e1284.38\u0026thinsp;\u0026plusmn;\u0026thinsp;12.21c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e1.49\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e46.49\u0026thinsp;\u0026plusmn;\u0026thinsp;2.91c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.30\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01d\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e40%FC\u0026thinsp;+\u0026thinsp;P50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e31.67\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02cd\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.42\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.65\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03de\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e48.96\u0026thinsp;\u0026plusmn;\u0026thinsp;0.72bc\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.27\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.30\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e820.16\u0026thinsp;\u0026plusmn;\u0026thinsp;40.74cd\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e0.92\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e32.29\u0026thinsp;\u0026plusmn;\u0026thinsp;0.77cd\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.66\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e40%FC\u0026thinsp;+\u0026thinsp;P0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e27.05\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.93\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.49\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e55.08\u0026thinsp;\u0026plusmn;\u0026thinsp;5.31b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.26\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.34\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e501.83\u0026thinsp;\u0026plusmn;\u0026thinsp;38.88d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e0.81\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e17.99\u0026thinsp;\u0026plusmn;\u0026thinsp;0.92d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.61\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03ab\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"8\" rowspan=\"9\"\u003e \u003cp\u003eXY335\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e100% FC\u0026thinsp;+\u0026thinsp;P100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e65.06\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8.04\u0026thinsp;\u0026plusmn;\u0026thinsp;0.52a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.58\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e45.63\u0026thinsp;\u0026plusmn;\u0026thinsp;3.44d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.20\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.35\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e2599.38\u0026thinsp;\u0026plusmn;\u0026thinsp;13.96a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e3.97\u0026thinsp;\u0026plusmn;\u0026thinsp;0.20a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e135.82\u0026thinsp;\u0026plusmn;\u0026thinsp;8.23a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.67\u0026thinsp;\u0026plusmn;\u0026thinsp;0.08abc\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e100% FC\u0026thinsp;+\u0026thinsp;P50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e46.21\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e7.22\u0026thinsp;\u0026plusmn;\u0026thinsp;0.21ab\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.26\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e37.09\u0026thinsp;\u0026plusmn;\u0026thinsp;2.90d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.17\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.33\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e2153.35\u0026thinsp;\u0026plusmn;\u0026thinsp;173.76b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e2.70\u0026thinsp;\u0026plusmn;\u0026thinsp;0.26bc\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e101.79\u0026thinsp;\u0026plusmn;\u0026thinsp;5.24b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.92\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e100% FC\u0026thinsp;+\u0026thinsp;P0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e34.28\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5.69\u0026thinsp;\u0026plusmn;\u0026thinsp;0.26c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.89\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05cd\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e38.62\u0026thinsp;\u0026plusmn;\u0026thinsp;2.04d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.16\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.31\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02ab\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e1815.29\u0026thinsp;\u0026plusmn;\u0026thinsp;94.94b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e2.21\u0026thinsp;\u0026plusmn;\u0026thinsp;0.16bcd\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e73.94\u0026thinsp;\u0026plusmn;\u0026thinsp;6.40cd\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.74\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11ab\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e60% FC\u0026thinsp;+\u0026thinsp;P100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e45.44\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e6.65\u0026thinsp;\u0026plusmn;\u0026thinsp;0.27bc\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.13\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09bc\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e40.99\u0026thinsp;\u0026plusmn;\u0026thinsp;4.43d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.17\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.35\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e2623.65\u0026thinsp;\u0026plusmn;\u0026thinsp;32.57a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e2.49\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10bc\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e88.76\u0026thinsp;\u0026plusmn;\u0026thinsp;5.62bc\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.58\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06bc\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e60% FC\u0026thinsp;+\u0026thinsp;P50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e33.13\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5.40\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.97\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02bc\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e34.37\u0026thinsp;\u0026plusmn;\u0026thinsp;1.97d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.18\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.37\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e1763.24\u0026thinsp;\u0026plusmn;\u0026thinsp;140.38b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e2.16\u0026thinsp;\u0026plusmn;\u0026thinsp;0.12bcd\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e70.22\u0026thinsp;\u0026plusmn;\u0026thinsp;2.19cd\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.72\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03ab\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e60% FC\u0026thinsp;+\u0026thinsp;P0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e28.81\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3.28\u0026thinsp;\u0026plusmn;\u0026thinsp;0.28d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.60\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03de\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e48.40\u0026thinsp;\u0026plusmn;\u0026thinsp;2.90cd\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.18\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.27\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05ab\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e1315.59\u0026thinsp;\u0026plusmn;\u0026thinsp;10.35c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e2.02\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09cd\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e66.59\u0026thinsp;\u0026plusmn;\u0026thinsp;3.48cd\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.59\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03bc\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e40%FC\u0026thinsp;+\u0026thinsp;P100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e45.17\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3.39\u0026thinsp;\u0026plusmn;\u0026thinsp;0.08d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.53\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e84.64\u0026thinsp;\u0026plusmn;\u0026thinsp;2.19a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.16\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.21\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e1924.65\u0026thinsp;\u0026plusmn;\u0026thinsp;97.88b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e2.83\u0026thinsp;\u0026plusmn;\u0026thinsp;0.17b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e82.17\u0026thinsp;\u0026plusmn;\u0026thinsp;4.16bc\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.41\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02c\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e40%FC\u0026thinsp;+\u0026thinsp;P50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e32.72\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.62\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.51\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e64.19\u0026thinsp;\u0026plusmn;\u0026thinsp;2.74bc\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.20\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.31\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02ab\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e1207.42\u0026thinsp;\u0026plusmn;\u0026thinsp;16.65c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e1.69\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e51.16\u0026thinsp;\u0026plusmn;\u0026thinsp;2.08d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.43\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02c\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e40%FC\u0026thinsp;+\u0026thinsp;P0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e27.14\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.59\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.40\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e68.98\u0026thinsp;\u0026plusmn;\u0026thinsp;5.52ab\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.16\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.31\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02ab\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e416.85\u0026thinsp;\u0026plusmn;\u0026thinsp;25.66d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e0.47\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e24.87\u0026thinsp;\u0026plusmn;\u0026thinsp;0.48e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.48\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05bc\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSummery of two-way analysis of variance (ANOVA) regarding the effect of different water and P levels on morpho-physiological growth and biochemical attributes of two different maize hybrids. Mean square values are present with significant level: *p\u0026thinsp;\u0026lt;\u0026thinsp;0.05, **p\u0026thinsp;\u0026lt;\u0026thinsp;0.01., ***p\u0026thinsp;\u0026lt;\u0026thinsp;0.001 and not significant: ns, W: water levels, P: phosphorus levels, W\u0026times;P: water\u0026times; phosphorus levels; Trait notations: MDA, malondialdehyde; H2O2, hydrogen peroxide; SOD, superoxide dismutase; POD, peroxidase; CAT, catalase.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"8\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTraits\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003eZD958\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c8\" namest=\"c6\"\u003e \u003cp\u003eXY335\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eW\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eP\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eW\u0026times;P\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eW\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eP\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eW\u0026times;P\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eShoot length\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e925.44***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e25.44ns\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.18ns\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1849.48***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e45.56ns\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1.70ns\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eShoot fresh weight\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e149.37***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e125.81***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.20ns\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e48.78***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e59.53***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e5.73ns\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eShoot dry weight\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4.02***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3.07***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.08ns\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2.89***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1.73***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.13ns\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eNo. of leaves\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e10.56***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2.12*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.07ns\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e13.59***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.44ns\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.09ns\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eTotal root length\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e921.66***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e768.39***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e95.21**\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e501.90***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1046.69***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e44.66**\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eRoot fresh weight\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e53.47***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e15.92***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.41**\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e38.20***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e10.68***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1.45**\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eRoot dry weight\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.04***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.59***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.04**\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1.31***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.46***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.06**\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eSpecific root length\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e9272533***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2352509**\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2363286***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e3026071***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e3194868**\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1170267**\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eRoot mass density\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.01056***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.00535**\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.00847***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.00017ns\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.00066ns\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.00105ns\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eRoot mass fraction\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.00550*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.00106ns\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.00228ns\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.00873*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.00459ns\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.00707*\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eRoot surface area\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e9027154***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1852858***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e160235*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2224347***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e3063651***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e113333*\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eRoot area diameter\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e13.16***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2.74***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.43**\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e3.58***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e5.01***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.69***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eRoot volume\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e13900.9***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2855.7***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e270.6**\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e5532.61***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e4748.27***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e355.06**\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eRoot/Shoot ratio\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.03863***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.06176***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.03207***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.25844***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.04351*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.01430ns\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eShoot P\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.49***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.38***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.04ns\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1.24***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.97***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.04ns\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eRoot P\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.38***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.62***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.01ns\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.96***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.16*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.01ns\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMalondialdehyde\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e299.26***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e27.03***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.70ns\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e196.49***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e33.91***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e2.52ns\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eHydrogen peroxide\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e805.91***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e85.25***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e6.01ns\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e780.37***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e57.20***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e7.54ns\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eSuperoxide dismutase\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5064.80ns\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2990.57**\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e33.98ns\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e8479.32***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1682.83ns\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e30.97ns\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003ePeroxidase\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e43.07*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e7.78ns\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e19.71ns\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e18.54ns\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.09ns\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e17.82ns\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCatalase\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e420.70***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e54.01**\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e7.49ns\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e336.93***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e31.47ns\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e18.43ns\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eTotal protein content\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4.13***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.31*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.01ns\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e6.99***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.45**\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.02ns\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eFree Proline\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e164.94***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e58.89***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8.37*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e387.33***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e111.17***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e7.84*\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eTotal soluble sugar\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e236.55***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2.29ns\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e12.03**\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e226.19***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e14.42ns\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e12.02ns\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eMoreover, the root fresh weight and root dry weight of the both maize cultivars were significantly reduced by decreasing water and P-supply. But, most significant reduction of root fresh and dry weight of both cultivars was noted under the severe water and P-deficiency (40%FC\u0026thinsp;+\u0026thinsp;P0).\u003c/p\u003e \u003cp\u003eFurthermore, significant (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) variations in specific root length of both maize cultivars were noted under the all levels of water and P-supply; the highest specific root length of both cultivars was recorded under severe drought\u0026thinsp;+\u0026thinsp;optimum P-supply (40%FC\u0026thinsp;+\u0026thinsp;P100).\u003c/p\u003e \u003cp\u003eIn addition, the significantly (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) and maximum root tissue density in ZD958 was noted under 40%FC with different P-levels but the highest root tissue density of XD335 was recorded under 100%FC\u0026thinsp;+\u0026thinsp;P100 and 40%FC\u0026thinsp;+\u0026thinsp;P100. However, there was no statistically difference (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05) in root tissue density under all treatments of water and P-supply in XD335.\u003c/p\u003e \u003cp\u003eSimilarly, there was non-significant (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05) variation in the root mass fraction of ZD958 under all treatments of water and P-supply. But, significant (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) variation in the root mass fraction of XD335 was noted under all treatments of water and P-supply.\u003c/p\u003e \u003cp\u003eThe root surface area, root average diameter and root volume of both maize cultivars were significantly (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) reduced by of the decrease in water and P-supply compared with 100%FC\u0026thinsp;+\u0026thinsp;P100. There was significant (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) variation in the root/shoot ratio of the both maize cultivars under the all treatments of water and P application. Overall, root growth traits were affected by decreasing the water and P-supply but the influence of water deficiency was worse than the P-deficiency (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eInfluence of drought and P-deficiency on phosphorus (P) uptake\u003c/h2\u003e \u003cp\u003eThe P uptake in both maize cultivars was significantly (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) reduced by decreasing the water and P-supply treatments (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Compared to root-P, the shoot-P concentrations were higher in both, ZD958 and XY335 cultivars. At 40%FC\u0026thinsp;+\u0026thinsp;P0, the shoot-P was decreased by 81.7% and 77.4% in ZD958 and XY335, respectively compared with 100%FC\u0026thinsp;+\u0026thinsp;P100. Likewise, the root-P of ZD958 and XY335 was declined by 72.4% and 62.5%, respectively, compared with 100%FC\u0026thinsp;+\u0026thinsp;P100. It was observed that the optimum P-supply (P100) helps the maize plants in P uptake under water deficit conditions (60%FC and 40FC). Likewise, optimum water supply (100%FC) helps the maize plants in P uptake under low P-supply (P50 and P0). Overall, P uptake in maize plants was most affected by the severe water and P-deficiency (40%FC and P0) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eEffects of drought and P-deficiency on the oxidative stress markers\u003c/h2\u003e \u003cp\u003eThe MDA and H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e contents were significantly (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) increased with decreasing the water and P-supply in both maize cultivars (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003e). The MDA and H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e contents of both cultivars were significantly increased at 40%FC\u0026thinsp;+\u0026thinsp;P100, 40%FC\u0026thinsp;+\u0026thinsp;P50, and 40%FC\u0026thinsp;+\u0026thinsp;P0 as compared to 100%FC\u0026thinsp;+\u0026thinsp;P100.. Both the 60%FC and 40%FC increased the MDA and H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e contents of ZD958 and XY335, but such effects were more severe at 40%FC (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003e). These results showed that the overaccumulation of MDA and H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e were increased that caused oxidative stress under the influence of water deficiency as compared to all P-levels in both maize cultivars (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eEffects of drought and P-deficiency on the antioxidant enzymes\u003c/h2\u003e \u003cp\u003eThe activities of antioxidative enzymatic were affected by reducing the water and P-supply levels in ZD958 and XY335 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003e). According to the results, SOD was significantly (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) increased by decreasing the water and P-supply levels but the maximum SOD values were noted under severe water and P-deficiency (40%FC\u0026thinsp;+\u0026thinsp;P0) in both cultivars, as compared to other levels of water and P application.\u003c/p\u003e \u003cp\u003eHowever, non-significant (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05) variation in POD values were recorded under the influence of water and P application levels. Interestingly, the highest values of POD were noted under severe water deficiency and optimum P-supply (40%FC\u0026thinsp;+\u0026thinsp;P100) in ZD958 and XY335, compared with other levels of water and P, respectively.\u003c/p\u003e \u003cp\u003eThe trend of CAT was opposite to SOD, which was significantly (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) reduced by decreasing the water and P-supply levels. The higher reduction of CAT was not at severe water deficiency (40%FC) with all P application levels (P100, P50 and P0) in both maize cultivars, indicating that the CAT was not triggered in maize in response to drought.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eEffects of drought and P-deficiency on the compatible solutes\u003c/h2\u003e \u003cp\u003eThe levels of compatible solutes viz., total protein contents, free proline, and total soluble sugars in ZD958 and XY335 were significantly (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) increased under the interactive levels of water and P-supply (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003e). The data indicated that the total protein contents and free proline were increased at 60%FC and 40%FC at all levels of the P-application in both cultivars. However, the higher improvement of total soluble sugar was recorded by severe water deficiency with optimum P-supply (40%FC\u0026thinsp;+\u0026thinsp;P100) in both cultivars, as compared to other levels of water and P-supply. Overall, interaction of 40%FC and P0 significantly up-regulated the compatible solutes in ZD958 and XY335 cultivars. Total protein, free proline and total soluble sugar were less affected by reducing P application, compared with water levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eRelative expression of drought and P-starvation responsive genes\u003c/h2\u003e \u003cp\u003eTo understand the underlying mechanism on how maize plants were affected by interactive levels of water and P-deficiency, the expression of some drought and P-starvation responsive genes were analyzed. Results showed that the \u003cem\u003eZmNAC111\u003c/em\u003e was upregulated under 60% and 40% FC, as compared to 100% FC with the application of P100 in both maize cultivars. Comparatively, it was less regulated at both water deficit levels with P50 and P0 treatments.\u003c/p\u003e \u003cp\u003eOverall, the relative expression trend of \u003cem\u003eZmNAC111\u003c/em\u003e was P100\u0026thinsp;\u0026gt;\u0026thinsp;P50\u0026thinsp;\u0026gt;\u0026thinsp;P0 with 100%FC\u0026thinsp;\u0026lt;\u0026thinsp;60%FC\u0026thinsp;\u0026lt;\u0026thinsp;40%FC. However, the higher expression level of \u003cem\u003eZmPHR1.1\u003c/em\u003e was recorded under P0 with all treatments of water, compared with P100 and P50 but higher level was noted under the interactive level of 40%FC with P0 in both maize cultivars. Moreover, \u003cem\u003eZmPHR1.1\u003c/em\u003e was more increased in ZD958, as compared to XY335. Similarly, the \u003cem\u003eZmPHR1.2\u003c/em\u003e was the most upregulated under P0 with all levels of water treatment as compared to P100 and P50 but higher expression was recorded under the interactive level of 40%FC with P0. Overall, the expression trend of \u003cem\u003eZmPHR1\u003c/em\u003e genes was P100\u0026thinsp;\u0026lt;\u0026thinsp;P50\u0026thinsp;\u0026lt;\u0026thinsp;P0 and 100%FC\u0026thinsp;\u0026lt;\u0026thinsp;60%FC\u0026thinsp;\u0026lt;\u0026thinsp;40%FC.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eCorrelations matrix revealed association among various traits\u003c/h2\u003e \u003cp\u003eThe Pearson correlation analysis revealed significant positive and negative correlations among the studied traits under the interactive levels of water and P-supply in both maize cultivars (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e8\u003c/span\u003e). The results showed the positive association of shoot traits with different root traits of both maize cultivars (ZD958 and XD335), but SRL, RTD and R/S ratio of ZD958 were negatively correlated with the shoot traits. The root and shoot P contents were strongly positively correlated with the shoot and root traits except SRL in XD335, and SRL, RTD and RMF. The shoot and root traits of both cultivars were negatively correlated with MDA, H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e,. Moreover, the SRL had positive correlation with MDA, H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e, SOD, POD, TPC, TSS, FP but negatively correlation with CAT. Furthermore, H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e and MDA had strong positive correlation with SOD, TPC, FP and TSS.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eDrought and P-deficiency are two of the most important factors that limit the productivity of plants in natural environment\u0026nbsp;(Ho et al. 2005, Falalou et al. 2018, Smith et al. 2022)\u0026nbsp;and plants responses to these stress conditions are highly complex which involve the changes at the morpho-physiological, biochemical and gene levels. This study explains how interactive levels of water and P supply disturb the morpho-physiological, biochemical and candidate gene responses in maize plants. Our results showed that the interaction of water and P-deficiency levels has a profound negative effect (p\u0026lt;0.05) on the shoot length, shoot fresh weight, shoot dry weight, and the number of leaves of ZD958 and XY335 (Fig.1\u0026nbsp;and\u0026nbsp;Fig.2). As previously, it was stated that the interactive impacts of water deficit condition and low P application reduces the aboveground biomass of common bean\u0026nbsp;(Smith et al. 2022)\u0026nbsp;and chickpea\u0026nbsp;(Chtouki et al. 2022). Moreover, the maize plants root and shoot growth was additively impaired under the drought and P deficiency\u0026nbsp;(Klamer et al. 2019). Furthermore, water and P-deficiency alter the activities, morphology and architecture system of the plant roots. Previously, it has been reported that the low phosphorus significantly increased the root surface area, root volume and total root length but decreased the average root diameter in maize (Xia et al. 2021). Moreover, the maize root surface area and root volume were not affected by drought, but total root length was increased under drought condition\u0026nbsp;(Hussain et al. 2020). The present study showed that the total root length, root fresh weight, root dry weight, root surface area, root average diameter, and root volume of the ZD958 and XY335 were reduced by the interactive levels of water and P-deficiency (Table 2). Specific root length was increased by decreasing the water and P-supply but root tissue density and root mass fraction showed variations in both maize cultivars under the interactive level water and P-deficiency (Table 2). The root/shoot ratio was most affected by severe water deficiency with optimum P application. Interestingly, total root length, surface area, average diameter, root volume was less affected under severe water deficiency when P level was optimum (Table 2). Drought can majorly impact the root function by altering cell water permeability and influencing the growth and architecture of the plant root system. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eDrought stress and associated reduction in soil moisture can reduce plant nutrient uptake by reducing nutrient supply through mineralization (Sanaullah et al. 2012). In addition, effect of drought stress on nutrient supply through mineralization may depend on the duration and intensity or severity of dry periods (Farooq et al. 2009). Generally, negative effects of drought on plant P uptake become larger with increased dry period with others stressor.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn support of our results, previous findings also reported that sufficient supply of Pi could reduce the negative impact of water deficit condition. Under water-deficit conditions, P application enhanced root growth, nutrient uptake, and water use efficiency, ultimately increasing yield and ameliorating the adverse effects of drought (Waraich et al. 2011). Phosphorus supply could enhance the plant resistance capacity to water stress by enhancement of roots system and improving accessibility of a plant to a large spectrum of water and nutrients sources (Razaq et al., 2017).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;Water deficiency in soil results in significant decrease in uptake of P at any soil-P levels. Sufficient soil-P levels were observed to reduce the water deficiency damage on uptake of P in comparison with moderate or low P supply in both cultivars. Under well water conditions, positive effects of available soil-Pi levels on uptake of P were noticed , which is in agreement with previous findings reported for various crops (\u003ca href=\"https://www.frontiersin.org/articles/10.3389/fpls.2017.02111/full#B84\"\u003eVance et al., 2003\u003c/a\u003e;\u0026nbsp;\u003ca href=\"https://www.frontiersin.org/articles/10.3389/fpls.2017.02111/full#B43\"\u003eJones et al., 2004\u003c/a\u003e;\u0026nbsp;\u003ca href=\"https://www.frontiersin.org/articles/10.3389/fpls.2017.02111/full#B39\"\u003eJemo et al., 2006\u003c/a\u003e). Under water-deficit conditions, several cowpea varieties showed higher increase in uptake of P following the high soil-Pi supply as compared to the moderate or low soil-Pi supply. Likewise, internal P concentrations declined with reduced water and low P supply, whereas micronutrients were little affected by drought and P-deficiency (Klamer et al. 2019).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe present study demonstrated that the drought stress significantly (p\u0026lt;0.05) reduced the shoot-P and root-P concentrations by decreasing the water and P-supply in ZD958 and XY335 (Fig.\u0026nbsp;3). So, it is noted that even a mild drought stopped the P uptake roots, due to unavailability of P after the soil dried. Drought and P-deficiency collectively affects many physiological and biochemical processes and thus reduces the plant growth. It is reported that water stress induced by PEG significantly increased the ROS production in the maize cultivars (Hussain et al. 2020). Similar to drought, P deficiency inevitably causes increased production of reactive oxygen species (ROS) as by product of photosynthesis (Meng et al. 2021). Our results showed that the rate of lipid peroxidation and accumulation of ROS were increased in the leaves of maize under different levels of water and P-supply regimes (Fig.\u0026nbsp;4-7).\u0026nbsp;The higher production of ROS was found under the interactive level of 40%FC and P0. \u0026nbsp;As, water and P deficiency induced higher ROS bursts which are scavenged by antioxidant systems which have been reported in maize previously (Zhang et al. 2014; Hussain et al. 2020).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eWe observed the increased activities of SOD and POD which may help to overcome the negative effect of ROS in the leaves of maize cultivars under the interactive influence of drought stress and P- levels (Fig.\u0026nbsp;4-8, 4-9, 4-10 and 4-11). The enzymatic components may directly scavenge the ROS or produce the non-enzymatic antioxidants. Specifically, SOD is involved in the dismutation of O2\u003csup\u003e•\u003c/sup\u003e\u003csup\u003e−\u003c/sup\u003einto H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e in the mitochondrion, chloroplast, peroxisome and cytoplasm, while POD scavenges for H2O2 produced through the dismutation of O2•− catalysed by SOD.\u0026nbsp;In addition, the higher levels of compatible solutes viz., total protein contents, free proline and total soluble sugar were noted in ZD958 and XY335 under interactive impact of drought and P-deficiency (Fig. 4-12), which indicated that the plants have self-defence mechanism to combat the stress condition. Previously, also the higher accumulation of\u0026nbsp;osmolytes\u0026nbsp;were noted to lower oxidative stress damage in maize under P-deficiency\u0026nbsp;(Tang et al. 2019)\u0026nbsp;and drought\u0026nbsp;(Hussain et al. 2018, Hussain et al. 2020)\u003c/p\u003e\n\u003cp\u003eTo understand the mechanism on how maize plants respond to interactive levels of the water and P-deficiency, we tested the relative expression of selected stress responsive genes viz. \u003cem\u003eZmNAC111\u003c/em\u003e, \u003cem\u003eZmPHR1.1\u003c/em\u003e and \u003cem\u003eZmPHR1.2\u003c/em\u003e. Previously, it has been reported that the over expression of \u003cem\u003eZmNAC111\u003c/em\u003e confer drought tolerance in maize, improves plant water-use efficiency and enhances the expression of stress-responsive genes under drought condition\u0026nbsp;(Mao et al. 2015). However, the role of \u003cem\u003eZmNAC111\u003c/em\u003e against interactive levels of water and P-deficiency has not yet been reported. In this study, we observed a significant upregulation in the expression of \u003cem\u003eZmNAC111\u003c/em\u003e in both maize cultivars under severe water deficiency (40%FC) with sufficient P-supply (P100) treatment, and weak expression was noted under sufficient water level (100%FC) at all P-treatments (Fig.\u0026nbsp;7B). These findings suggest that the upregulation of \u003cem\u003eZmNAC111\u003c/em\u003e indicate tolerance against drought condition, as optimum P-supply (P100) helps the plants to improve drought tolerance by higher expression of \u003cem\u003eZmNAC111\u003c/em\u003e. Moreover, \u003cem\u003eZmPHR1\u003c/em\u003e is the well-described phosphate starvation-responsive transcription factor of the MYB family that enhance the phosphate absorption when it was overexpressed under low-phosphate conditions\u0026nbsp;(Wang et al. 2013, Wang et al. 2021a, Wang et al. 2021b). But its role under the interactive levels of drought and P-deficiency has not yet been reported. Our results indicated the expression of \u003cem\u003eZmPHR1.1\u003c/em\u003e and \u003cem\u003eZmPHR1.2\u003c/em\u003e was weak at P100, but the expression level increased with decreasing the P supply. Interestingly, the higher expression of \u003cem\u003eZmPHR1.1\u003c/em\u003e and \u003cem\u003eZmPHR1.2\u003c/em\u003e was noted at P-deficiency (P0) treatment with moderate water deficiency (60%FC) and severe water deficiency (40%FC) which indicated that the water deficiency restricted the P movement to upper parts of plants, and P deficiency with drought was more lethal than P deficiency at normal moisture level.\u003c/p\u003e\n"},{"header":"Conclusions","content":"\u003cp\u003eInteraction of drought and P-deficiency affected the shoot and root traits, oxidative status, nutrients uptake and osmolytes accumulation in both hybrid maize cultivars. The shoot length, fresh and dry weight of root and shoot, root architecture and P uptake were significantly (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) reduced by moderate and severe drought with P50 and P0. However, he H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e and MDA contents were increased with decreasing the moisture and P-supply. Moreover, SOD, total protein, free proline and total reducing sugar were increased with decreasing the moisture and P-supply, but POD and CAT were fluctuated to with oxidative stress caused by water and P supply levels. We found the upregulation of \u003cem\u003eZmNAC111\u003c/em\u003e under severe drought with sufficient P supply, but no such effects were recorded under 100%FC with all P levels which indicates its vital role in drought tolerance and positive coloration with P availability. Moreover, the higher expression of \u003cem\u003eZmPHR1.1\u003c/em\u003e and \u003cem\u003eZmPHR1.2\u003c/em\u003e was observed at P-deficiency at moderate and severe drought, which shows these are key genes for P-deficiency tolerance. Further molecular studies are required to determine the mechanistic relationships of water deficit and P deficiency based on the root system architecture, uptake and transport of nutrients and defence mechanism to design strategies for crop breeding.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFinancial support for this paper was provided by the National Natural Science Foundation of China (41977072) and Science and Technology Innovation Project of Chinese Academy of Agricultural Sciences.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003e\u003cspan\u003eAli S, Tyagi A, Park S, Mir RA, Mushtaq M, Bhat B, Al-Mahmoudi H, Bae H (2022) Deciphering the Plant Microbiome to Improve Drought Tolerance: Mechanisms and Perspectives. Environmental and Experimental Botany: 104933\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eAsensio D, Zuccarini P, Ogaya R, Mara\u0026ntilde;\u0026oacute;n-Jim\u0026eacute;nez S, Sardans J, Pe\u0026ntilde;uelas J (2021) Simulated climate change and seasonal drought increase carbon and phosphorus demand in Mediterranean forest soils. Soil Biol Biochem 163:108424\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eChen N, Qin J, Tong S, Wang W, Jiang Y (2022) One AP2/ERF Transcription Factor Positively Regulates Pi Uptake and Drought Tolerance in Poplar. Int J Mol Sci 23(9):5241\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eChtouki M, Laaziz F, Naciri R, Garr\u0026eacute; S, Nguyen F, Oukarroum A (2022) Interactive effect of soil moisture content and phosphorus fertilizer form on chickpea growth, photosynthesis, and nutrient uptake. Sci Rep 12(1):1\u0026ndash;13\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eCramer MD, Hawkins H-J, Verboom GA (2009) The importance of nutritional regulation of plant water flux. Oecologia 161(1):15\u0026ndash;24\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eFalalou H, Mariama H, Achirou FB, Oumarou H, Vadez V (2018) Genotypic variation for root development, water extraction and yield components in groundnut under low phosphorus and drought stresses. Am J Agric Forestry 6(5):122\u0026ndash;131\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eFAO (2018) FUTURE OF FOOD AND AGRICULTURE 2018: Alternative Pathways to 2050. FOOD \u0026amp; AGRICULTURE ORG\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eGarg BK, Burman U, Kathju S (2004) The influence of phosphorus nutrition on the physiological response of moth bean genotypes to drought. J Plant Nutr Soil Sci 167(4):503\u0026ndash;508\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eGoufo P, Moutinho-Pereira JM, Jorge TF, Correia CM, Oliveira MR, Rosa EA, Ant\u0026oacute;nio C, Trindade H (2017) Cowpea (Vigna unguiculata L. Walp.) metabolomics: osmoprotection as a physiological strategy for drought stress resistance and improved yield. Front Plant Sci 8:586\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eGunes A, Cicek N, Inal A, Alpaslan M, Eraslan F, Guneri E, Guzelordu T (2006) Genotypic response of chickpea (Cicer arietinum L.) cultivars to drought stress implemented at pre-and post-anthesis stages and its relations with nutrient uptake and efficiency. Plant Soil and Environment 52(8):368\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eHe M, Dijkstra FA (2014) Drought effect on plant nitrogen and phosphorus: a meta-analysis. New Phytol 204(4):924\u0026ndash;931\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eHo MD, Rosas JC, Brown KM, Lynch JP (2005) Root architectural tradeoffs for water and phosphorus acquisition. Funct Plant Biol 32(8):737\u0026ndash;748\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eHussain HA, Hussain S, Khaliq A, Ashraf U, Anjum SA, Men S, Wang L (2018) Chilling and drought stresses in crop plants: implications, cross talk, and potential management opportunities. Front Plant Sci 9:393\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eHussain HA, Men S, Hussain S, Zhang Q, Ashraf U, Anjum SA, Ali I, Wang L (2020) Maize tolerance against drought and chilling stresses varied with root morphology and antioxidative defense system. Plants 9(6):720\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eHussain HA, Men S, Hussain S, Chen Y, Ali S, Zhang S, Zhang K, Li Y, Xu Q, Liao C (2019) Interactive effects of drought and heat stresses on morpho-physiological attributes, yield, nutrient uptake and oxidative status in maize hybrids. Sci Rep 9(1):1\u0026ndash;12\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eKaya C, Şenbayram M, Akram NA, Ashraf M, Alyemeni MN, Ahmad P (2020) Sulfur-enriched leonardite and humic acid soil amendments enhance tolerance to drought and phosphorus deficiency stress in maize (Zea mays L.). Sci Rep 10(1):1\u0026ndash;13\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eKlamer F, Vogel F, Li X, Bremer H, Neumann G, Neuh\u0026auml;user B, Hochholdinger F, Ludewig U (2019) Estimating the importance of maize root hairs in low phosphorus conditions and under drought. Ann Botany 124(6):961\u0026ndash;968\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eLi P, Weng J, Rehman A, Niu Q (2022) Root Morphological and Physiological Adaptations to Low Phosphate Enhance Phosphorus Efficiency at Melon (Cucumis melo L.) Seedling Stage. Horticulturae 8(7):636\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eMacDonald GK, Bennett EM, Potter PA, Ramankutty N (2011) Agronomic phosphorus imbalances across the world\u0026apos;s croplands. Proceedings of the National Academy of Sciences 108(7): 3086\u0026ndash;3091\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eMao H, Wang H, Liu S, Li Z, Yang X, Yan J, Li J, Tran L-SP, Qin F (2015) A transposable element in a NAC gene is associated with drought tolerance in maize seedlings. Nat Commun 6(1):1\u0026ndash;13\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eMogoll\u0026oacute;n J, Beusen A, Van Grinsven H, Westhoek H, Bouwman A (2018) Future agricultural phosphorus demand according to the shared socioeconomic pathways. Glob Environ Change 50:149\u0026ndash;163\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eNadeem M, Mollier A, Morel C, Vives A, Prud\u0026rsquo;homme L, Pellerin S (2011) Relative contribution of seed phosphorus reserves and exogenous phosphorus uptake to maize (Zea mays L.) nutrition during early growth stages. Plant Soil 346(1):231\u0026ndash;244\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eOliveira EMM, Ruiz HA, Alvarez VVH, Ferreira PA, Costa FO, Almeida ICC (2010) Nutrient supply by mass flow and diffusion to maize plants in response to soil aggregate size and water potential. Revista Brasileira de Ci\u0026ecirc;ncia do Solo 34:317\u0026ndash;328\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003ePeng X, Zhao Y, Li X, Wu M, Chai W, Sheng L, Wang Y, Dong Q, Jiang H, Cheng B (2015) Genomewide identification, classification and analysis of NAC type gene family in maize. J Genet 94(3):377\u0026ndash;390\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eRubio V, Linhares F, Solano R, Mart\u0026iacute;n AC, Iglesias J, Leyva A, Paz-Ares J (2001) A conserved MYB transcription factor involved in phosphate starvation signaling both in vascular plants and in unicellular algae. Genes Dev 15(16):2122\u0026ndash;2133\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eSardans J, Pe\u0026ntilde;uelas J (2004) Increasing drought decreases phosphorus availability in an evergreen Mediterranean forest. Plant Soil 267(1):367\u0026ndash;377\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eSardans J, Pe\u0026ntilde;uelas J (2012) The role of plants in the effects of global change on nutrient availability and stoichiometry in the plant-soil system. Plant Physiol 160(4):1741\u0026ndash;1761\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eShemi R, Wang R, Gheith E-S, Hussain HA, Cholidah L, Zhang K, Zhang S, Wang L (2021a) Role of exogenous-applied salicylic acid, zinc and glycine betaine to improve drought-tolerance in wheat during reproductive growth stages. BMC Plant Biol 21(1):1\u0026ndash;15\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eShemi R, Wang R, Gheith E-S, Hussain HA, Hussain S, Irfan M, Cholidah L, Zhang K, Zhang S, Wang L (2021b) Effects of salicylic acid, zinc and glycine betaine on morpho-physiological growth and yield of maize under drought stress. Sci Rep 11(1):1\u0026ndash;14\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eShubhra DJ, Goswami CL, Munjal R (2004) Influence of phosphorus application on water relations, biochemical parameters and gum content in cluster bean under water deficit. Biol Plant 48(3):445\u0026ndash;448\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eSmith MR, Dinglasan E, Veneklaas E, Polania J, Rao IM, Beebe SE, Merchant A (2022) Effect of Drought and Low P on Yield and Nutritional Content in Common Bean. Frontiers in Plant Science 13\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eSuriyagoda L, De Costa W, Lambers H (2014) Growth and phosphorus nutrition of rice when inorganic fertiliser application is partly replaced by straw under varying moisture availability in sandy and clay soils. Plant Soil 384(1):53\u0026ndash;68\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eTang H, Niu L, Wei J, Chen X, Chen Y (2019) Phosphorus limitation improved salt tolerance in maize through tissue mass density increase, osmolytes accumulation, and Na + uptake inhibition. Front Plant Sci 10:856\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eTran L-SP, Nishiyama R, Yamaguchi-Shinozaki K, Shinozaki K (2010) Potential utilization of NAC transcription factors to enhance abiotic stress tolerance in plants by biotechnological approach. GM crops 1(1):32\u0026ndash;39\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eWang J, Pan W, Nikiforov A, King W, Hong W, Li W, Han Y, Patton-Vogt J, Shen J, Cheng L (2021a) Identification of two glycerophosphodiester phosphodiesterase genes in maize leaf phosphorus remobilization. Crop J 9(1):95\u0026ndash;108\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eWang R, Zhong Y, Liu X, Zhao C, Zhao J, Li M, Ul Hassan M, Yang B, Li D, Liu R (2021b) Cis-regulation of the amino acid transporter genes ZmAAP2 and ZmLHT1 by ZmPHR1 transcription factors in maize ear under phosphate limitation. J Exp Bot 72(10):3846\u0026ndash;3863\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eWang X, Bai J, Liu H, Sun Y, Shi X, Ren Z (2013) Overexpression of a maize transcription factor ZmPHR1 improves shoot inorganic phosphate content and growth of Arabidopsis under low-phosphate conditions. Plant Mol Biology Report 31(3):665\u0026ndash;677\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eWen Z, Pang J, Tueux G, Liu Y, Shen J, Ryan MH, Lambers H, Siddique KH (2020) Contrasting patterns in biomass allocation, root morphology and mycorrhizal symbiosis for phosphorus acquisition among 20 chickpea genotypes with different amounts of rhizosheath carboxylates. Funct Ecol 34(7):1311\u0026ndash;1324\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eXia Z, He Y, Zhou B, Korpelainen H, Li C (2020) Sex-related responses in rhizosphere processes of dioecious Populus cathayana exposed to drought and low phosphorus stress. Environ Exp Bot 175:104049\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eXia Z, Zhang S, Wang Q, Zhang G, Fu Y, Lu H (2021) Effects of root zone warming on maize seedling growth and photosynthetic characteristics under different phosphorus levels.Frontiers in Plant Science12\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eZhang H, Shi L, Lu H, Shao Y, Liu S, Fu S (2020) Drought promotes soil phosphorus transformation and reduces phosphorus bioavailability in a temperate forest. Sci Total Environ 732:139295\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eZia R, Nawaz MS, Siddique MJ, Hakim S, Imran A (2021) Plant survival under drought stress: Implications, adaptive responses, and integrated rhizosphere management strategy for stress mitigation. Microbiol Res 242:126626\u003c/span\u003e\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"drought, P-deficiency, root system architecture, ROS, defence mechanism, maize ","lastPublishedDoi":"10.21203/rs.3.rs-2476562/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-2476562/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eBackground: \u003c/strong\u003e\u003c/em\u003e\u003cem\u003eThe phosphorus uptake in plants is decreased due to soil water deficiency which negatively affects plant growth. How the interaction of soil moisture and P deficiency affects the morpho-physiological and biochemical responses of plants is still little known.\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e\u003cstrong\u003eMethods: \u003c/strong\u003e\u003c/em\u003e\u003cem\u003eThis study investigates physiological and biochemical responses of maize hybrids under interaction of moisture and P deficit conditions. Three levels of water (well-watered, moderate drought, severe drought) and P-supply (P100, P50, and P0) were used for two maize hybrids.\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e\u003cstrong\u003eResults: \u003c/strong\u003e\u003c/em\u003e\u003cem\u003eThe interaction of water and P-deficiency (60% and 40% FC along with P50 or P0) reduced the shoot and root traits, and P uptake in both maize cultivars. The activities of SOD, total protein, free proline, and total reducing sugar were increased with decreasing water and P-supply but response of POD and CAT remained variable. The significant upregulation of ZmNAC111 was noted under 40%FC with P100 treatment, but no such effects were recorded under 100%FC at all P treatments in both cultivars. The expression of ZmPHR1.1 and ZmPHR1.2 was increased with reducing P supply, but higher expression was observed at P0 at 60%FC and 40%FC, which indicates these are key genes for P-deficiency tolerance.\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e\u003cstrong\u003eConclusions:\u003c/strong\u003e\u003c/em\u003e\u003cem\u003e Overall, P0 with 60% and 40%FC caused severe reductions in growth traits among P levels but 40%FC was most destructive at all levels of P-supply. These findings would be helpful to understand the drought and low P tolerance mechanism of maize and provide future directions for regulation of responsive genes for developing tolerant maize cultivars.\u003c/em\u003e\u003c/p\u003e","manuscriptTitle":"Contrasting patterns in growth attributes, root traits plasticity, and defence mechanism of maize under deficit moisture and phosphorus supply","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-01-19 16:10:03","doi":"10.21203/rs.3.rs-2476562/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"f95acb43-58da-4ef3-b10b-70012987c948","owner":[],"postedDate":"January 19th, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2023-01-25T19:29:51+00:00","versionOfRecord":[],"versionCreatedAt":"2023-01-19 16:10:03","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-2476562","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-2476562","identity":"rs-2476562","version":["v1"]},"buildId":"ehx78VzkSd0WSzXnipQa-","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00
unpaywall
last seen: 2026-05-22T02:00:06.705733+00:00
License: CC-BY-4.0