Total Flavonoids of Litchi Seed alleviates schistosomiasis liver fibrosis by suppressing hepatic stellate cells activation

preprint OA: gold CC-BY-4.0
📄 Open PDF Full text JSON View at publisher
AI-generated summary by claude@2026-07, 2026-07-14

Total Flavonoids of Litchi Seed alleviates schistosomiasis liver fibrosis by suppressing hepatic stellate cell activation and reducing inflammatory cytokines and fibrotic markers.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by claude@2026-07, 2026-07-14 · read from full text

This preprint study examined whether total flavonoids of litchi seed (TFL) could alleviate schistosomiasis-associated liver fibrosis in a mouse model of Schistosoma japonicum infection and explored whether effects involved suppression of hepatic stellate cell (HSC) activation. Female C57 mice were infected with 20 cercariae and treated with TFL (300 or 450 mg/kg) for 9 weeks, with outcomes assessed using ELISA for cytokines, histology (H&E and Masson’s trichrome), immunohistochemistry for α-SMA and collagen I/III, and in vitro HSC-T6 activation induced by TGF-β1 with qPCR readouts; the paper notes it is a preprint and not peer reviewed. TFL lowered serum IL-1β, TNF-α, and IL-6, reduced liver/spleen indices, improved granulomatous pathology, decreased α-SMA and collagen I/III expression in liver tissue, and inhibited TGF-β1–driven HSC activation in vitro. This paper is centrally about endometriosis and/or adenomyosis— it is not about either condition and instead focuses on schistosomiasis liver fibrosis; included in the corpus only via keyword matching.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Background: Infection with Schistosoma japonicum ( S. japonicum ) can lead to liver fibrosis. The activation of hepatic stellate cells (HSCs) is a crucial phase in the development of liver fibrosis, and inhibiting their activation can alleviate this progression. Total Flavonoids of Litchi Seed (TFL) is a naturally extracted drug, and modern pharmacological studies have shown its anti-fibrotic and liver-protective effects. However, the role of TFL in schistosomiasis liver fibrosis still unclear. This study investigates the functions of TFL on liver fibrosis caused by S. japonicum infection and explores its potential mechanisms. Methods: : S. japonicum -induced murine models were generated by abdominal infection with 20 cercariae. The mice were divided into an infection group and a treatment group. The treatment group were treated with TFL (300 and 450 mg/kg). Inflammatory-related cytokines were measured using the Enzyme-Linked Immunosorbent Assay (ELISA) method. Hematoxylin and Eosin (H&E) and Masson's trichrome staining were used to observe pathological changes in the liver. Immunohistochemistry was employed to detect the expressions of α-Smooth Muscle Actin (α-SMA), Collagen I, and Collagen III in the liver tissues. For the cell experiments, a model of HSCs activation induced by Transforming Growth Factor-β1 (TGF-β1) was established, and the effects of TFL on the activation of HSCs were examined using qPCR. Results: TFL significantly reduced the levels of Interleukin-1β (IL-1β), Tumor Necrosis Factor-α (TNF-α), and Interleukin-6 (IL-6) in the serum of S. japonicum infected mice. TFL reduced the liver and spleen index of mice and markedly improved the pathological changes in liver tissues induced by Sj , decreasing the expression of α-SMA, Collagen I protein and Collagen III protein in liver tissues. In vitro studies indicated that TFL apparently inhibited the activation of HCSs induced by TGF-β1 and reduced the levels of α-SMA. Conclusion: TFL could alleviate granulomatous lesions and improve liver fibrosis caused by S. japonicum by inhibiting the activation of HSCs.
Full text 100,712 characters · extracted from preprint-html · click to expand
Total Flavonoids of Litchi Seed alleviates schistosomiasis liver fibrosis by suppressing hepatic stellate cells activation | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Total Flavonoids of Litchi Seed alleviates schistosomiasis liver fibrosis by suppressing hepatic stellate cells activation Tingzheng Zhan, Qiuchen Cheng, Jilong Wang, Jiahui Lv, Jingquan Mo, and 8 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3673443/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Infection with Schistosoma japonicum ( S. japonicum ) can lead to liver fibrosis. The activation of hepatic stellate cells (HSCs) is a crucial phase in the development of liver fibrosis, and inhibiting their activation can alleviate this progression. Total Flavonoids of Litchi Seed (TFL) is a naturally extracted drug, and modern pharmacological studies have shown its anti-fibrotic and liver-protective effects. However, the role of TFL in schistosomiasis liver fibrosis still unclear. This study investigates the functions of TFL on liver fibrosis caused by S. japonicum infection and explores its potential mechanisms. Methods: S. japonicum -induced murine models were generated by abdominal infection with 20 cercariae. The mice were divided into an infection group and a treatment group. The treatment group were treated with TFL (300 and 450 mg/kg). Inflammatory-related cytokines were measured using the Enzyme-Linked Immunosorbent Assay (ELISA) method. Hematoxylin and Eosin (H&E) and Masson's trichrome staining were used to observe pathological changes in the liver. Immunohistochemistry was employed to detect the expressions of α-Smooth Muscle Actin (α-SMA), Collagen I, and Collagen III in the liver tissues. For the cell experiments, a model of HSCs activation induced by Transforming Growth Factor-β1 (TGF-β1) was established, and the effects of TFL on the activation of HSCs were examined using qPCR. Results TFL significantly reduced the levels of Interleukin-1β (IL-1β), Tumor Necrosis Factor-α (TNF-α), and Interleukin-6 (IL-6) in the serum of S. japonicum infected mice. TFL reduced the liver and spleen index of mice and markedly improved the pathological changes in liver tissues induced by Sj , decreasing the expression of α-SMA, Collagen I protein and Collagen III protein in liver tissues. In vitro studies indicated that TFL apparently inhibited the activation of HCSs induced by TGF-β1 and reduced the levels of α-SMA. Conclusion TFL could alleviate granulomatous lesions and improve liver fibrosis caused by S. japonicum by inhibiting the activation of HSCs. Total Flavonoids of Litchi Seed Schistosoma japonicum Liver fibrosis Hepatic stellate cells α-smooth muscle actin Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Background Schistosomiasis is a global public health problem caused by Schistosoma parasites. It's the second-largest parasitic disease following malaria, mainly prevalent in developing countries in Africa, Latin America, and Asia[1-4]. The adult S. japonicum produce eggs that deposit in liver and intestinal tissues, causing severe egg granulomas and fibrotic lesions. Without timely and effective treatment, it can lead to hepatosplenomegaly, ascites, portal hypertension, and eventually chronic or late-stage schistosomiasis, resulting in significant loss of labor and high mortality[5, 6]. Liver fibrosis is characterized by the deposition of extracellular matrix (ECM), disrupting the physiological structure of the liver and gradually causing permanent liver damage or chronic inflammation[7, 8]. HSCs play a crucial role in the process of liver fibrosis. Under disease or inflammatory stimuli, they can transform into collagen-producing myofibroblasts[9-11]. Myofibroblasts migrate to necrotic and inflamed areas, producing major components of the ECM, α-SMA, and collagen[12]. Extensive studies indicated that S. japonicum infection activated HSCs, promoting the development of liver fibrosis, and inhibiting pathways related to HSCs activation can alleviate fibrosis[13-15]. Currently, the pathogenesis of liver fibrosis is not fully understood, and there is a lack of specific and effective drugs for its treatment in clinical practice. Therefore, understanding the pathogenesis of liver fibrosis is essential to explore more effective drugs. Traditional Chinese medicine, with its synergistic actions, low toxicity, and strong safety, holds significant therapeutic potential. Litchi (Litchi chinensis Sonn.) is a subtropical fruit widely distributed in Southeast Asia, mainly found in Guangdong, Guangxi, Fujian, and other regions in China[16-19]. The litchi seed is the dry mature seed of the litchi fruit, containing various chemical components such as flavonoids, steroids, saponins, oils, amino acids, proteins, and sugars. Studies have shown that TFL possesses multiple pharmacological activities, such as reducing blood sugar[20], regulating blood lipids, providing antioxidant and liver protection[21], anti-tumor effects, and alleviating neuropathic pain[22]. For several decades, traditional Chinese medicine has been using TFL to treat liver fibrosis. However, the effects of TFL on liver fibrosis caused by S. japonicum have not yet been reported. In this study, a liver fibrosis model was established in S. japonicum infected mice and the mice were treatedwith different concentrations of TFL. The study utilized methods like ELISA, Hematoxylin and Eosin (H&E) staining, Masson's trichrome staining, immunohistochemistry, and qPCR to detect various liver injury and fibrosis-related indicators. Additionally, qPCR was used to detect the activation marker of HSCs, α-SMA, aiming to explore the effects and mechanisms of TFL on liver fibrosis caused by S. japonicum infection. Methods Reagents TFL was purchased from Nanjing Herb Source Biotechnology Co., Ltd. (Nanjing, China). Antibodies against α-SMA, COL1A1, COL3A1, and secondary antibodies were acquired from Wuhan Sanying Biotechnology Co., Ltd. (Wuhan, China). Mouse/Rat TGF-β1 (Transforming Growth Factor-β1) recombinant protein was obtained from Shanghai Zhongqiao Xinzhou Biotechnology Co., Ltd. (Shanghai, China). Anti-alpha smooth muscle Actin Rabbit pAb, Anti-Collagen I Rabbit pAb, and Anti-Collagen III Rabbit pAb were also purchased from Wuhan Sanying Biotechnology Co., Ltd. (Wuhan, China). Hematoxylin and Eosin (H&E) staining and Masson's trichrome staining kits were acquired from Beijing Solarbio Science & Technology Co., Ltd. (Beijing, China). Rat hepatic stellate cells (HSC-T6) were obtained from the Kunming Cell Bank (Kunming, China). ELISA kits were purchased from Invitrogen (269375-007, USA). The total RNA extraction kit for cells and the qRT-PCR kit were purchased from Quanshijin Biotechnology Co., Ltd. (Beijing, China). Primers were obtained from Genesis Biotech Co., Ltd. (Nanning, China). Mice, parasitic infection, and treatment SPF female C57 mice, aged 6-8 weeks and weighing 18-20g, were provided by the Animal Center of Guangxi Medical University. All mouse experiments were approved by the Animal Protection and Use Committee of Guangxi Medical University for appropriateness and humanity. Mice were randomly divided into a normal control group (NC, n =8), an S. japonicum infection group ( Sj , n =8), a low TFL dose group (TFL-L, 300 mg/kg, n =8), and a high TFL dose group (TFL-H, 450mg/kg, n =8). Each mouse in the infection and TFL groups was infected with 20 (±1) S. japonicum cercariae through abdominal skin. Starting from the 7th day post-infection, mice in the TFL groups were orally administered different doses of TFL (300 mg/kg, 450 mg/kg) once a day for 9 consecutive weeks, while the normal control and infection groups were given pure water in the same manner. After the last administration, the mice were euthanized. Serum samples were collected for different biochemical indicators testing. Mouse livers were carefully dissected for gross pathological examination, and liver tissues were either soaked in 4% polyformaldehyde solution for histopathological section preparation or stored at -80°C for subsequent testing. Calculation of mouse liver and spleen index The liver and spleen samples were rinsed with physiological saline, wiped with filter paper, and weighed. The liver index was calculated as: Liver Index = [Liver Weight (g) / Mouse Weight (g)] x 100%. The spleen index was calculated as: Spleen Index = [Spleen Weight (g) / Mouse Weight (g)] x 100%. Detection of mouse serum cytokines Blood samples were centrifuged at 25°C, 3000 rpm for 5 minutes to obtain the supernatant. The levels of serum IL-1β, IL-4, IL-6, and TNF-α were measured using ELISA kits according to the manufacturer’s instructions. The optical density (OD) of the plates was read at 450 nm using an ELISA reader and the concentrations were calculated using standard curves. Histopathological analysis and fibrosis scoring Liver samples from each mouse were fixed with 4% polyformaldehyde and embedded in paraffin. Liver tissues were cut into 4µm thick sections for histopathological analysis using Hematoxylin and Eosin (H&E) staining. Microsopic images were collected and the area of each granuloma was calculated using Image-Pro Plus software for statistical analysis. Masson's trichrome staining was used to detect collagen content in liver tissues, assessing fibrosis. Images were also analyzed using ImageJ software for the area of collagen fibers in Masson's trichrome-stained sections. Immunohistochemical analysis Sections were deparaffinized with xylene and hydrated with graded ethanol, followed by high-temperature antigen retrieval in citrate buffer. The sections were washed three times with PBS, each time for 5 minutes, and incubated with 3% H 2 O 2 at room temperature for 15 minutes to block peroxidase activity, followed by three washes with PBS. The sections were then incubated with goat serum at 37°C for 30 minutes and overnight at 4°C with primary antibodies against α-SMA, Collagen I, and Collagen III (1:300). After incubation, the sections were washed four times with PBS and incubated with the secondary antibody (1:300) at 37°C for 1 hour, followed by color development with 3,3'-diaminobenzidine (DAB) and counterstaining with hematoxylin. The sections were then dehydrated with graded ethanol, cleared with xylene, and finally mounted with neutral balsam. Cell culture and TFL treatment To study the inhibitory effect of different concentrations of TFL on the activation of hepatic stellate cells, rat hepatic stellate cells (HSC-T6) were cultured in high-glucose DMEM medium containing 10% fetal bovine serum in at 5% CO2, 37°C. and divided into five groups: control group, TGF-β1 (10 ng/ml) group, TGF-β1 + low concentration TFL (10 ng/ml and 450ng/L) group, and TGF-β1 + high concentration TFL (10 ng/ml and 600ng/L) group. Both TGF-β1 and TFL were dissolved in culture medium containing 10% fetal bovine serum, and cells were tested 48 hours after administration of different drugs. RNA extraction and Real-Time quantitative PCR Total RNA was extracted from HSC-T6 cells and total cDNA were synthesized. The relative mRNA level of α-SMA were detected by qRT-PCR. β-actin served as the internal control. The forward primer sequence of α-SMA is ATGGGAAGCTGGTCATCAAC, and the reverse primer sequence of α-SMA is GTGGTTCACACCCATCACAA. The PCR reaction was run on the 7500 Real-Time PCR System (Termo Fisher Scientifc) at 95 °C for 10 min, followed by 40 cycles at 95 °C for 15 s and 60 °C for 1 min. Then, the melting curve was measured (95 °C for 30 s, 65 °C for 15 s, and 95 °C for 30 s). The experiments were performed as independent biological replicates at least three times, and the relative expression of the target genes was calculated using the 2 − ΔΔCt method. Statistical methods Results of biochemical indicators were expressed as mean ± standard deviation (x±s) and compared between groups using analysis of variance (ANOVA). Differences were considered statistically significant at P <0.05. If the ANOVA results were significant, the LSD multiple comparison test was used. All data analyses were performed using SPSS 26 software. Results TFL gained body weight and improved the liver and spleen index After infection, the body weight of mice in the Sj group was significantly lower than that in the NC group (Figure 1B). After TFL treatment, the body weight of mice in the TFL-L group slightly increased, but the difference was not statistically significant compared to the Sj group. The body weight of mice in the TFL-H group was significantly higher than that in the Sj group, approaching normal (one-way ANOVA, F (3,4) =5.396, P = 0.010, followed by LSD multiple comparison test: NC ( Sj ): P = 0.001, TFL-H ( Sj ): P = 0.014). The liver index of the Sj group was significantly higher than that of the NC group (Figure 1C) (one-way ANOVA, F (3,4) =31.075, P <0.001). The liver indices in the TFL treatment groups showed some reduction compared to the Sj group, but the difference was not statistically significant. The spleen index also showed an increase after Sj infection (Figure 1D). The spleen index of the Sj group was also significantly higher than that of the NC group, and the liver indices in both TFL-L and TFL-H groups were significantly reduced compared to the Sj group (one-way ANOVA, F (3,4) =43.939, P <0.001, followed by LSD multiple comparison test: NC( Sj ): P <0.001, TFL-L( Sj ): P =0.001, TFL-H( Sj ): P =0.001). These results indicate that TFL treatment can alleviate liver damage caused by S. japonicum infection to a certain extent. TFL reduces inflammation in mice caused by S. japonicum infection The levels of serum cytokines in mice before and after schistosome infection were measured using ELISA. The levels of IL-1β, TNF-α, and IL-6 in the serum of mice in the Sj group (Figure 2A-C) were significantly higher than in the NC group. Specifically, IL-1β levels decreased in a dose-dependent manner in all TFL groups (one-way ANOVA, F (3,4) =11.470, P = 0.001, followed by LSD multiple comparison test: NC( Sj ): P =0.003, TFL-L( Sj ): P =0.002, TFL-H( Sj ): P <0.001); TNF-α levels significantly decreased in both TFL-L and TFL-H groups compared to the Sj group (one-way ANOVA, F (3,4) =11.098, P = 0.001, followed by LSD multiple comparison test: NC( Sj ): P <0.001, TFL-L( Sj ): P =0.001, TFL-H( Sj ): P <0.001), but IL-6 levels only significantly decreased in the TFL-H group compared to the Sj group (one-way ANOVA, F (3,4) =14.593, P < 0.001, followed by LSD multiple comparison test: NC( Sj ): P <0.001, TFL-H( Sj ): P =0.023). Additionally, the results showed that the level of the anti-inflammatory cytokine IL-13 in the serum of mice in the Sj group (Figure 2D) was slightly lower than in the NC group and increased in a dose-dependent manner in all TFL groups, but the difference was not statistically significant. These results suggested that TFL treatment improved inflammation in mice caused by S. japonicum . TFL alleviate e gg granuloma and liver fibrosis To understand the severity of liver damage, we used H&E and Masson's trichrome staining to assess the histopathological damage and degree of fibrosis in liver tissues. H&E staining results showed that in the Sj group, liver structure was disorganized, with significant fibroblast and inflammatory cell infiltration around the hepatic lobules. There was also bile duct proliferation and cholestasis around the lobules. These symptoms were alleviated to varying degrees after using TFL (Figures 3A, B). In the TFL-H group, the bile stasis and inflammatory infiltration were significantly reduced (one-way ANOVA, F (3,4) =621.373, P < 0.001, followed by LSD's multiple comparison test: NC( Sj ): P <0.001, TFL-L( Sj ): P <0.001, TFL-H( Sj ): P <0.001). Masson's trichrome staining results showed that in the Sj group, there was high-density collagen staining around the central vein, with fibrotic septa and evident collagen fiber proliferation (Figures 3C, D). TFL treatment significantly reduced collagen deposition and alleviated liver fibrosis, especially noticeable in the TFL-H treatment group (one-way ANOVA, F (3,4) =412.867, P < 0.001, followed by LSD's multiple comparison test: NC( Sj ): P <0.001, TFL-L( Sj ): P <0.001, TFL-H( Sj ): P <0.001). TFL reduced the expression of α-SMA, Collagen I and Collagen III in liver tissue Immunohistochemical staining results showed that the expressions of α-SMA, Collagen I and Collagen III were significantly increased in the Sj group, with a noticeable increase in brown-yellow stained areas. In contrast, TFL treatment groups showed a significant reduction in positive expression and a decrease in the brown-yellow staining, making the staining lighter (Figures 4A, C, E). Using Image J to analyze the staining and expression of α-SMA, Collagen I and Collagen III, it was found that their expression was significantly elevated in the Sj group and significantly decreased after TFL treatment, with statistically significant differences (one-way ANOVA, α-SMA: F (3,4) =253.217, P < 0.001; Collagen I: F (3,4) =86.471, P < 0.001; Collagen III: F (3,4) =444.144, P < 0.001, followed by LSD's multiple comparison test: NC( Sj ): P <0.001, TFL-L( Sj ): P <0.001, TFL-H( Sj ): P <0.001). These results indicate that TFL can significantly inhibit the inflammatory response and liver fibrosis and has a protective effect on liver tissue. TFL inhibits the activation of HSC-T6 cells in vitro TGF-β1 is a major fibrogenic growth factor in liver fibrosis. TGF-β1 was used to promote the proliferation and activation of HSCs, followed by treatment with TFL on these activated cells (Figure 5). When cells were co-stimulated with TGF-β1 (10 ng/ml) and TFL (450, 600 ng/ml) for 48 hours, we measured the expression of α-SMA mRNA. It was found that TFL inhibited the expression of α-SMA mRNA to varying degrees, and this inhibitory effect was concentration-dependent (one-way ANOVA, F (3,4) =14.460, P = 0.001, followed by LSD's multiple comparison test: NC( Sj ): P =0.005, TFL-L( Sj ): P =0.015, TFL-H( Sj ): P <0.001).This i ndicated that TFL played a similar inhibitory role in the activation model of other HSCs. Discussion In this study, the anti-liver fibrosis effect of TFL was investigated in S. japonicum infected mice, and its possible mechanism was explored. Our results showed that TFL treatment led to weight resotration in S. japonicum -infected mice, a decrease in liver and spleen indexes, and a reduction in inflammation caused by S. japonicum infection. Pathological results showed that TFL alleviated S. japonicum -induced granuloma and liver fibrosis, and reduced the expression of α-SMA, Collagen I and Collagen III in liver tissue. In vitro studies found that TFL inhibited the activation of HSC-T6 cells induced by TGF-β. This suggested that TFL alleviated S. japonicum -induced liver fibrosis by inhibiting the activation of hepatic stellate cells. Liver fibrosis is recognized as a reversible pathological process, which lends both theoretical feasibility and significant clinical relevance to its treatment. In recent years, there has been a growing focus on the extraction of efficient, low-toxicity compounds from natural sources to mitigate liver fibrosis. TFL is one such group of compounds extracted from litchi seeds, known for their anti-inflammatory, antioxidant, and anti-fibrotic properties[23]. Research had indicated that TFL effectively reduced liver fibrosis induced by carbon tetrachloride (CCl 4 ) in rats. The underlying mechanism appeared to involve the upregulation of retinol metabolism, which impacted both lipid metabolism and the degradation of the ECM[24]. Additionally, TFL had shown promise in improving liver fibrosis caused by dimethylnitrosamine (DMN), potentially through the upregulation of Bcl-2 and the downregulation of Bax expression[25]. CCl 4 and DMN are artificial chemical reagents that inflict quick damage to liver and induce actue liver fibrosis. However, in clinical practice, liver fibrosis caused by chronic liver damage is also very common, such as fatty liver, alcoholic liver, viral hepatitis, or parasitic infections, etc. It remained unclear whether TFL would exert a similar protective effect in the context of actual disease. Our study addressed this gap by demonstrating, for the first time, that TFL indeed ameliorated liver fibrosis in mice inflicted with schistosomiasis. Moreover, our laboratory observed comparable effects of TFL in alleviating liver fibrosis in rats infected with Clonorchis sinensis (unpublished data). These results suggested that TFL had a protective effect against liver fibrosis in authentic disease models, highlighting its potential for future clinical applications. Schistosomiasis japonica is a typical chronic infectious disease[26]. Both humoral immunity and cellular immunity are involved in the formation and development of schistosome egg granulomas and fibrosis. The survival of Schistosoma japonicum within the host requires active modulation of the host's immune system and evasion of harmful immune responses. CD4 + T cells play an important role in the onset, development, and immunoregulation of the disease. Studies show that Th1 cells, which act early in the infection, release SEA slowly from eggs deposited in the liver, and the expression of a series of pro-inflammatory cytokines secreted by Th1 cells increases, including IFN-γ, tumor necrosis factor-a (TNF-a), IL-1, and IL-6[27]. As the infection progresses, Th2 immune responses begin to dominate, with a significant increase in the expression of fibrosis-promoting cytokines such as IL-4, IL-5, IL-13[28]. Among them, IL-4 and IL-13 are the most well-studied Th2 cytokines, with IL-13 being the main cytokine driving fibrosis, and IL-4 enhancing the fibrogenic effect of IL-13[29]. At the same time, Th17/IL-17, Th9/IL-9, Tfh/IL-21 are also involved, promoting the development of egg granulomas to their maximum extent about 7 weeks after infection, and studies have shown that blocking IL-17/ IL-9/ IL-21 can reduce the degree of fibrosis[30-35]. In the chronic phase of the infection, the volume of egg granulomas gradually decreases, due to the negative feedback regulation by Treg cells and their secretion of IL-10[36-38]. It is clear that the development of schistosomiasis is the result of mutual regulation between various Th subgroups and cytokines. This study found that intervention with TFL significantly reduced the expression of pro-inflammatory cytokines such as IL-1, TNF-a, and IL-6 in the serum of mice with schistosomiasis japonica . HE staining results also showed that after TFL treatment, the degree of liver egg granulomas in mice was significantly reduced, especially with increased TFL concentration. These results suggested that TFL inhibited schistosomiasis. In addition, Masson staining results showed that TFL intervention significantly improved the degree of liver fibrosis in schistosomiasis, which was consistent with the results of previous research. However, serological results showed that although the expression of IL-13 in the serum of mice with schistosomiasis japonica decreased after TFL intervention, the change was notignificant. Previous studies indicated that TFL treatment significantly replenished 9-cis retinoic acid (RA) levels in CCl4-induced liver fibrosis in rats[24]. The increase of retinol and (RA) in rat liver tissue after TFL treatment was associated with the increased expression of acetaldehyde dehydrogenase 2(ALDH2), ALDH1a7, and Aox3, which promoted retinol to RA convertion. The mechanism of TFL in treating liver fibrosis might be associated with the Rxra-mediated lipid metabolism pathway which regulated steatosis and lipid deposition[24]. TGM2 and TLR4 signaling are crucial in S. japonicum induced liver fibrosis. In HSC-LX-2 cells, all-trans-retinoic acid (ATRA) enhanced TLR4 signaling at low concentrations by increasing TGM2 expression, while at high concentrations it inhibited TLR4 signaling and reduced α-SMA expression[39]. This indicated that ATRA was also closely related to liver fibrosis caused by S. japonicum infection. Similarly, ATRA ameliorates inflammatory response mediated by TLR4/NF-κB during initiation of diabetic nephropathy, reducing, and improved the increase of pro-inflammatory factors such as IL-1, IL-2, IL-13, IL-16, TNF-α, TGF-β1 induced by inflammation, which was similar to the results of our current study[40, 41]. ATRA can only bind to RARs, while 9-cis retinoic acid can bind to both RARs and RXRs, indicating that both ATRA and 9-cis retinoic acid can transmit signals through RARs to downstream regulatory effects[42]. The effect of RA on IL-13 may be tissue-specific. On the one hand, RA can prevent dendritic cells in the mesenteric lymph nodes (MLN-DCs) from inducing the production of IL-13 by inflammatory Th2 cells[43, 44]. However, it was also found that ATRA and 9-cis RA promote the synthesis of IL-4, IL-5, and IL-13 in PBMC cells[42]. This might also explain why IL-13 in the serum was not significantly reduced after TFL treatment while the fibrosis was alleviated in this study. HSCs activation is a critical point in triggering liver fibrosis. In various models of liver fibrosis, the elevated expression of α-SMA is an important indicator of HSC activation. In this study, an increase in α-SMA expression was detected both in the livers of rats infected with schistosomiasis and in T6 cells stimulated with TGF-β in vitro. Similarly, after TFL treatment, the expression of α-SMA in both cases significantly decreased, suggesting that there is a similar mechanism of liver fibrosis across different disease models, and that TFL can alleviate the harm by inhibiting α-SMA expression, a common node of liver fibrosis. Conclusions In this study, results from morphological, serological, pathological analysis and cellular experiments all demonstrate that TFL has a significant anti-liver fibrosis effect in mice infected with S. japonicum, showing its potential in future clinical application. The mechanism of anti-liver fibrosis of TFL in different disease models likely shares a commonality in inhibiting the activation of HSCs by suppressing the expression of α-SMA. Future research should attempt to apply TFL to more fibrosis models to further verify its efficacy, and use various high-throughput analyses including transcriptomics and proteomics to identify and verify genes and pathways that represent the common alterations after TFL intervention across various disease models, in order to better elucidate the mechanism of liver fibrosis and the anti-fibrotic mechanism of TFL. Declarations Acknowledgements Not applicable. Author contributions JH, QC, QL and TZ conceived and designed the study and drafted the manuscript. JW, ZT, and SX performed the experiments and collected data, and handled statistical analysis. LL, LT, and SH participated in the study design and revised the draft version of the paper. All authors read and approved the final manuscript. Funding This work was supported by the National Natural Science Foundation of China (No. 82260407 and 81860358), the Guangxi Natural Science Foundation of China (No. 2018GXNSFAA281059), Guangxi Natural Science Foundation for Youth Fund of China (No.2023GXNSFBA026068), Guangxi Zhuang National Health Commission Administration (No. Z-A20230160) and National College Students’ innovation and entrepreneurship training program (202210598014). The funders had no role in study design, data collection, analysis, publication decision, or manuscript preparation. Availability of data and materials All data supporting the conclusions of this study are included in the article. Ethics approval and consent to participate All animal experiments were approved by the ethical committee for animal research at the Guangxi Medical University (approval no. 202212005) and strictly performed following the guidelines of the National Laboratory Animal Center in China. Consent for publication Not applicable. Competing interests The authors declare that they have no competing interests. Author details 1 Department of Parasitology, Guangxi Medical University, Nanning 530021, Guangxi, China. 2 Department of Gastroenterology, the People's Hospital of Guangxi Zhuang Autonomous Region, Guangxi Academy of Medical Sciences, Nanning 530021, Guangxi, China. 3 School of Pre-clinical Medicine, Guangxi Medical University, Nanning, China. 4 Department of Clinical Laboratory, Liuzhou People′s Hospital, Liuzhou 545006, Guangxi, China. 5 Department of Cell Biology and Genetics, Guangxi Medical University, Nanning 530021, Guangxi, China. 6 Key Laboratory of Longevity and Aging-Related Diseases of Chinese Ministry of Education, Guangxi Medical University, Nanning 530021, Guangxi, China. 7 Key Laboratory of Basic Research on Regional Diseases (Guangxi Medical University), Education Department of Guangxi Zhuang Autonomous Region, Nanning 530021, Guangxi, China. References Colley DG, Bustinduy AL, Secor WE, King CH. Human schistosomiasis. Lancet (London, England). 2014;383:2253-64. Gryseels B, Polman K, Clerinx J, Kestens L. Human schistosomiasis. Lancet (London, England). 2006;368:1106-18. McManus DP, Dunne DW, Sacko M, Utzinger J, Vennervald BJ, Zhou XN. Schistosomiasis. Nature reviews Disease primers. 2018;4:13. Ross AG, Bartley PB, Sleigh AC, Olds GR, Li Y, Williams GM, et al. Schistosomiasis. The New England journal of medicine. 2002;346:1212-20. McManus DP, Gray DJ, Li Y, Feng Z, Williams GM, Stewart D, et al. Schistosomiasis in the People's Republic of China: the era of the Three Gorges Dam. Clinical microbiology reviews. 2010;23:442-66. Burke ML, Jones MK, Gobert GN, Li YS, Ellis MK, McManus DP. Immunopathogenesis of human schistosomiasis. Parasite immunology. 2009;31:163-76. Kong D, Zhang F, Zhang Z, Lu Y, Zheng S. Clearance of activated stellate cells for hepatic fibrosis regression: molecular basis and translational potential. Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie. 2013;67:246-50. Iredale JP. Models of liver fibrosis: exploring the dynamic nature of inflammation and repair in a solid organ. The Journal of clinical investigation. 2007;117:539-48. Zhou WC, Zhang QB, Qiao L. Pathogenesis of liver cirrhosis. World journal of gastroenterology. 2014;20:7312-24. Elpek G. Cellular and molecular mechanisms in the pathogenesis of liver fibrosis: An update. World journal of gastroenterology. 2014;20:7260-76. Anthony B, Allen JT, Li YS, McManus DP. Hepatic stellate cells and parasite-induced liver fibrosis. Parasites & vectors. 2010;3:60. Otogawa K, Ogawa T, Shiga R, Ikeda K, Kawada N. Induction of tropomyosin during hepatic stellate cell activation and the progression of liver fibrosis. Hepatology international. 2009;3:378-83. Wang Y, Fan X, Lei N, He X, Wang X, Luo X, et al. A MicroRNA Derived From Schistosoma japonicum Promotes Schistosomiasis Hepatic Fibrosis by Targeting Host Secreted Frizzled-Related Protein 1. Frontiers in cellular and infection microbiology. 2020;10:101. Liu P, Wang M, Lu XD, Zhang SJ, Tang WX. Schistosoma japonicum egg antigen up-regulates fibrogenesis and inhibits proliferation in primary hepatic stellate cells in a concentration-dependent manner. World journal of gastroenterology. 2013;19:1230-8. Chen L, Ji X, Wang M, Liao X, Liang C, Tang J, et al. Involvement of TLR4 signaling regulated-COX2/PGE2 axis in liver fibrosis induced by Schistosoma japonicum infection. Parasites & vectors. 2021;14:279. Zhao L, Wang K, Wang K, Zhu J, Hu Z. Nutrient components, health benefits, and safety of litchi (Litchi chinensis Sonn.): A review. Comprehensive reviews in food science and food safety. 2020;19:2139-63. Kim WJ, Yang S, Choi G, Park I, Noh P, Kim MJ, et al. Accurate and Rapid Identification of Longan Arillus and Litchi Semen by a Multiplex PCR Assay. Plants (Basel, Switzerland). 2020;9: Jinato T, Chayanupatkul M, Dissayabutra T, Chutaputti A, Tangkijvanich P, Chuaypen N. Litchi-Derived Polyphenol Alleviates Liver Steatosis and Gut Dysbiosis in Patients with Non-Alcoholic Fatty Liver Disease: A Randomized Double-Blinded, Placebo-Controlled Study. Nutrients. 2022;14: Emanuele S, Lauricella M, Calvaruso G, D'Anneo A, Giuliano M. Litchi chinensis as a Functional Food and a Source of Antitumor Compounds: An Overview and a Description of Biochemical Pathways. Nutrients. 2017;9: Man S, Ma J, Yao J, Cui J, Wang C, Li Y, et al. Systemic Perturbations of Key Metabolites in Type 2 Diabetic Rats Treated by Polyphenol Extracts from Litchi chinensis Seeds. Journal of agricultural and food chemistry. 2017;65:7698-704. Tang Y, Yu C, Wu J, Chen H, Zeng Y, Wang X, et al. Lychee seed extract protects against neuronal injury and improves cognitive function in rats with type II diabetes mellitus with cognitive impairment. International journal of molecular medicine. 2018;41:251-63. Chung YC, Chen CH, Tsai YT, Lin CC, Chou JC, Kao TY, et al. Litchi seed extract inhibits epidermal growth factor receptor signaling and growth of Two Non-small cell lung carcinoma cells. BMC complementary and alternative medicine. 2017;17:16. Cheng Q, Qin W, Zhuo L, Zhao Y, Fan L, Lin W, et al. Comparison of Total Flavone of Litchi Chinensis Son in Two Kinds of Hepatic Fibrosis Model of Rats. Her Med. 2020;39:1179-84. Yan J, Feng Y, Fang X, Cui X, Xia X, Li F, et al. Anti-liver fibrosis effects of the total flavonoids of litchi semen on CCl(4)-induced liver fibrosis in rats associated with the upregulation of retinol metabolism. Pharmaceutical biology. 2022;60:1264-77. Zhou X, Liu Q. Improving Effect of Total Flavone from Litchi chinensis on the Hepatocyte Injury in Liver Fibrosis Model Rats. China Pharmacy. 2015;26:3099-102. Pearce EJ, MacDonald AS. The immunobiology of schistosomiasis. Nature reviews Immunology. 2002;2:499-511. Stadecker MJ, Asahi H, Finger E, Hernandez HJ, Rutitzky LI, Sun J. The immunobiology of Th1 polarization in high-pathology schistosomiasis. Immunological reviews. 2004;201:168-79. Kaplan MH, Whitfield JR, Boros DL, Grusby MJ. Th2 cells are required for the Schistosoma mansoni egg-induced granulomatous response. Journal of immunology (Baltimore, Md : 1950). 1998;160:1850-6. Fallon PG, Richardson EJ, McKenzie GJ, McKenzie AN. Schistosome infection of transgenic mice defines distinct and contrasting pathogenic roles for IL-4 and IL-13: IL-13 is a profibrotic agent. Journal of immunology (Baltimore, Md : 1950). 2000;164:2585-91. Zhang Y, Huang D, Gao W, Yan J, Zhou W, Hou X, et al. Lack of IL-17 signaling decreases liver fibrosis in murine schistosomiasis japonica. International immunology. 2015;27:317-25. Chen D, Luo X, Xie H, Gao Z, Fang H, Huang J. Characteristics of IL-17 induction by Schistosoma japonicum infection in C57BL/6 mouse liver. Immunology. 2013;139:523-32. Wang B, Liang S, Wang Y, Zhu XQ, Gong W, Zhang HQ, et al. Th17 down-regulation is involved in reduced progression of schistosomiasis fibrosis in ICOSL KO mice. PLoS neglected tropical diseases. 2015;9:e0003434. Zhan T, Zhang T, Wang Y, Wang X, Lin C, Ma H, et al. Dynamics of Th9 cells and their potential role in immunopathogenesis of murine schistosomiasis. Parasites & vectors. 2017;10:305. Zhan T, Ma H, Jiang S, Zhong Z, Wang X, Li C, et al. Interleukin-9 blockage reduces early hepatic granuloma formation and fibrosis during Schistosoma japonicum infection in mice. Immunology. 2019;158:296-303. Wang Y, Lin C, Cao Y, Duan Z, Guan Z, Xu J, et al. Up-regulation of Interleukin-21 Contributes to Liver Pathology of Schistosomiasis by Driving GC Immune Responses and Activating HSCs in Mice. Scientific reports. 2017;7:16682. Hesse M, Piccirillo CA, Belkaid Y, Prufer J, Mentink-Kane M, Leusink M, et al. The pathogenesis of schistosomiasis is controlled by cooperating IL-10-producing innate effector and regulatory T cells. Journal of immunology (Baltimore, Md : 1950). 2004;172:3157-66. Hoffmann KF, Cheever AW, Wynn TA. IL-10 and the dangers of immune polarization: excessive type 1 and type 2 cytokine responses induce distinct forms of lethal immunopathology in murine schistosomiasis. Journal of immunology (Baltimore, Md : 1950). 2000;164:6406-16. Roh YS, Park S, Lim CW, Kim B. Depletion of Foxp3+ Regulatory T Cells Promotes Profibrogenic Milieu of Cholestasis-Induced Liver Injury. Digestive diseases and sciences. 2015;60:2009-18. Wen Z, Ji X, Tang J, Lin G, Xiao L, Liang C, et al. Positive Feedback Regulation between Transglutaminase 2 and Toll-Like Receptor 4 Signaling in Hepatic Stellate Cells Correlates with Liver Fibrosis Post Schistosoma japonicum Infection. Frontiers in immunology. 2017;8:1808. Sierra-Mondragon E, Rodríguez-Muñoz R, Namorado-Tonix C, Molina-Jijon E, Romero-Trejo D, Pedraza-Chaverri J, et al. All-Trans Retinoic Acid Attenuates Fibrotic Processes by Downregulating TGF-β1/Smad3 in Early Diabetic Nephropathy. Biomolecules. 2019;9: Sierra-Mondragon E, Molina-Jijon E, Namorado-Tonix C, Rodríguez-Muñoz R, Pedraza-Chaverri J, Reyes JL. All-trans retinoic acid ameliorates inflammatory response mediated by TLR4/NF-κB during initiation of diabetic nephropathy. The Journal of nutritional biochemistry. 2018;60:47-60. Dawson HD, Collins G, Pyle R, Key M, Taub DD. The Retinoic Acid Receptor-alpha mediates human T-cell activation and Th2 cytokine and chemokine production. BMC immunology. 2008;9:16. Yokota-Nakatsuma A. [Retinoic Acid Prevents Dendritic Cells from Inducing Novel Inflammatory T Cells That Produce Abundant Interleukin-13]. Yakugaku zasshi : Journal of the Pharmaceutical Society of Japan. 2017;137:1491-6. Yokota-Nakatsuma A, Takeuchi H, Ohoka Y, Kato C, Song SY, Hoshino T, et al. Retinoic acid prevents mesenteric lymph node dendritic cells from inducing IL-13-producing inflammatory Th2 cells. Mucosal immunology. 2014;7:786-801. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3673443","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":253867406,"identity":"3f417d73-41d1-4fdb-9e9a-9d61556d6bb1","order_by":0,"name":"Tingzheng Zhan","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAyElEQVRIiWNgGAWjYBACNvkHCQckfvyT42dvIFILH0PCwweWPQeMJXsOEKlFjiHxsUEF24FEgxkJxDqM4XCaxA2eOwkGko833mCosYkmrIWxLU1yhsWzPHPptGILhmNpuQ0EtTDzpElL8DAXW87OMZNgbDhMhBY2/m/Sf9iYEzfcPEOsFh6GZAMJtsOJG27wEKtFgiHxgWRPGjCQgX5JIMYv8jMYQFFpA4zKwxtvfKixIawFGRhIJJCiHKKFVB2jYBSMglEwMgAASNw+q6Or4hAAAAAASUVORK5CYII=","orcid":"","institution":"Guangxi Medical University","correspondingAuthor":true,"prefix":"","firstName":"Tingzheng","middleName":"","lastName":"Zhan","suffix":""},{"id":253867407,"identity":"62ba7967-1ecb-43d3-a664-e4f58e0e3afd","order_by":1,"name":"Qiuchen Cheng","email":"","orcid":"","institution":"The People's Hospital of Guangxi Zhuang Autonomous Region","correspondingAuthor":false,"prefix":"","firstName":"Qiuchen","middleName":"","lastName":"Cheng","suffix":""},{"id":253867408,"identity":"7021658b-71d6-4687-90ed-cda71be8cd8c","order_by":2,"name":"Jilong Wang","email":"","orcid":"","institution":"Guangxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Jilong","middleName":"","lastName":"Wang","suffix":""},{"id":253867409,"identity":"a35b8442-605e-4951-b913-fd804b8fbfa8","order_by":3,"name":"Jiahui Lv","email":"","orcid":"","institution":"Guangxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Jiahui","middleName":"","lastName":"Lv","suffix":""},{"id":253867410,"identity":"074101fb-5cc3-46b4-9cfb-9591df78bd49","order_by":4,"name":"Jingquan Mo","email":"","orcid":"","institution":"Guangxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Jingquan","middleName":"","lastName":"Mo","suffix":""},{"id":253867411,"identity":"cf58fb9c-8698-438c-a63b-673d107fe1e6","order_by":5,"name":"Ran Qiu","email":"","orcid":"","institution":"Guangxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Ran","middleName":"","lastName":"Qiu","suffix":""},{"id":253867412,"identity":"f26a8d3d-4159-4f83-8e85-070158054528","order_by":6,"name":"Caiqi Li","email":"","orcid":"","institution":"Guangxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Caiqi","middleName":"","lastName":"Li","suffix":""},{"id":253867413,"identity":"eef7ad0d-e70b-4720-9e3c-a63d2c9e7730","order_by":7,"name":"Suyu Xiao","email":"","orcid":"","institution":"Guangxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Suyu","middleName":"","lastName":"Xiao","suffix":""},{"id":253867414,"identity":"04aa2cc1-81c2-467e-a8e6-7535786d11ff","order_by":8,"name":"Liuchun Luo","email":"","orcid":"","institution":"Liuzhou People′s Hospital","correspondingAuthor":false,"prefix":"","firstName":"Liuchun","middleName":"","lastName":"Luo","suffix":""},{"id":253867415,"identity":"e2a5a3d0-f405-4e27-aafb-788fa9df8eb8","order_by":9,"name":"Lili Tang","email":"","orcid":"","institution":"Guangxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Lili","middleName":"","lastName":"Tang","suffix":""},{"id":253867416,"identity":"e1bbda55-771b-4f02-8a27-d8455dab425b","order_by":10,"name":"Shanshan He","email":"","orcid":"","institution":"Guangxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Shanshan","middleName":"","lastName":"He","suffix":""},{"id":253867417,"identity":"9b399f0c-61ac-4ff0-8039-5251d6d21a95","order_by":11,"name":"Zeli Tang","email":"","orcid":"","institution":"Guangxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Zeli","middleName":"","lastName":"Tang","suffix":""},{"id":253867420,"identity":"491fc936-fb83-4b4b-be66-278e509b55bc","order_by":12,"name":"Qing Li","email":"","orcid":"","institution":"Guangxi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Qing","middleName":"","lastName":"Li","suffix":""}],"badges":[],"createdAt":"2023-11-27 17:47:23","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3673443/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3673443/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":47391324,"identity":"8d80a09a-1a76-461c-a4dc-117f4fec5f34","added_by":"auto","created_at":"2023-11-30 18:36:03","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":756616,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of TFL treatment on liver and spleen indices. (A) Experimental design. (B) Mouse body weight. (C) Mouse liver index. (D) Mouse spleen index. All data are expressed as mean ± standard deviation. (n = 8). *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.01, ***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001 compared to the \u003cem\u003eSj\u003c/em\u003e group.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-3673443/v1/acc158a7b25551099f557732.png"},{"id":47392785,"identity":"70e3980f-2bfc-4d3e-a428-bca3c5ca8cc8","added_by":"auto","created_at":"2023-11-30 18:44:03","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":503583,"visible":true,"origin":"","legend":"\u003cp\u003eTFL improves inflammation in mice caused by \u003cem\u003eSj\u003c/em\u003e infection. (A) Serum levels of IL-1β. (B) Serum levels of TNF-α. (C) Serum levels of IL-6. (D) Serum levels of IL-13. All data are presented as mean ± standard deviation. (n = 8). * \u003cem\u003eP\u003c/em\u003e\u0026lt; 0.05, ** \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, *** \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001 compared to the \u003cem\u003eSj\u003c/em\u003e group\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-3673443/v1/42a017ca0c12b6a8899f743a.png"},{"id":47391325,"identity":"a6c75e59-f7bb-4db6-b889-84ea2327176c","added_by":"auto","created_at":"2023-11-30 18:36:03","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":752598,"visible":true,"origin":"","legend":"\u003cp\u003eTFL alleviates \u003cem\u003eS. japonicum\u003c/em\u003e infected mice and the mice were treatedwith different concentrations of TFL. The study utilize Egg Granuloma and Liver Fibrosis. (A) H\u0026amp;E staining of mouse liver. (B) Percentage area of individual egg granuloma. (C) Masson's trichrome staining of mouse liver. (D) Percentage collagen area measured in individual egg granuloma. All data are presented as mean ± standard deviation. (n = 8). * \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, ** \u003cem\u003eP\u003c/em\u003e\u0026lt; 0.01, *** \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001 compared to the \u003cem\u003eSj\u003c/em\u003e group.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-3673443/v1/9356351af871de7878ccd0e0.png"},{"id":47391326,"identity":"df77928a-3e64-44c9-abe2-46570b5d4974","added_by":"auto","created_at":"2023-11-30 18:36:03","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":843517,"visible":true,"origin":"","legend":"\u003cp\u003eTFL reduces the expressions of α-SMA, Collagen I and Collagen III in liver tissue. (A) Immunohistochemical staining of α-SMA in mouse liver. (B) Percentage of α-SMA positive expression in individual granulomas. (C) Immunohistochemical staining of Collagen I in mouse liver. (D) Percentage of Collagen I positive expression in individual granulomas. (E) Immunohistochemical staining of Collagen III in mouse liver. (F) Percentage of Collagen III positive expression in individual granulomas. All data are presented as mean ± standard deviation. (n = 8). * \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, ** \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, *** \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001 compared to the \u003cem\u003eSj\u003c/em\u003egroup\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-3673443/v1/ca4ced7a5db5449b3683a2e6.png"},{"id":47391328,"identity":"5a6e7c08-f960-4b7d-a0e9-36948329db75","added_by":"auto","created_at":"2023-11-30 18:36:04","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":174816,"visible":true,"origin":"","legend":"\u003cp\u003eTFL inhibits the activation of HSC-T6 cells. *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, ** \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, *** \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001 compared to the \u003cem\u003eSj\u003c/em\u003e group\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-3673443/v1/a0a5e7d0dc065f923d948c2e.png"},{"id":47866877,"identity":"3f612416-b07c-41fc-a5a5-d796e1998f8a","added_by":"auto","created_at":"2023-12-08 16:38:13","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2368428,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3673443/v1/1fdec88a-cee3-4a82-9dc5-d9477897242c.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Total Flavonoids of Litchi Seed alleviates schistosomiasis liver fibrosis by suppressing hepatic stellate cells activation","fulltext":[{"header":"Background","content":"\u003cp\u003eSchistosomiasis is a global public health problem caused by \u003cem\u003eSchistosoma\u003c/em\u003e parasites. It\u0026apos;s the second-largest parasitic disease following malaria, mainly prevalent in developing countries in Africa, Latin America, and Asia[1-4]. The adult \u003cem\u003eS. japonicum\u003c/em\u003e produce eggs that deposit in liver and intestinal tissues, causing severe egg granulomas and fibrotic lesions. Without timely and effective treatment, it can lead to hepatosplenomegaly, ascites, portal hypertension, and eventually chronic or late-stage schistosomiasis, resulting in significant loss of labor and high mortality[5, 6].\u003c/p\u003e\n\u003cp\u003eLiver fibrosis is characterized by the deposition of extracellular matrix (ECM), disrupting the physiological structure of the liver and gradually causing permanent liver damage or chronic inflammation[7, 8]. HSCs play a crucial role in the process of liver fibrosis. Under disease or inflammatory stimuli, they can transform into collagen-producing myofibroblasts[9-11]. Myofibroblasts migrate to necrotic and inflamed areas, producing major components of the ECM, \u0026alpha;-SMA, and collagen[12]. Extensive studies indicated that \u003cem\u003eS. japonicum\u003c/em\u003e infection activated HSCs, promoting the development of liver fibrosis, and inhibiting pathways related to HSCs activation can alleviate fibrosis[13-15]. Currently, the pathogenesis of liver fibrosis is not fully understood, and there is a lack of specific and effective drugs for its treatment in clinical practice. Therefore, understanding the pathogenesis of liver fibrosis is essential to explore more effective drugs.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTraditional Chinese medicine, with its synergistic actions, low toxicity, and strong safety, holds significant therapeutic potential. Litchi (Litchi chinensis Sonn.) is a subtropical fruit widely distributed in Southeast Asia, mainly found in Guangdong, Guangxi, Fujian, and other regions in China[16-19]. The litchi seed is the dry mature seed of the litchi fruit, containing various chemical components such as flavonoids, steroids, saponins, oils, amino acids, proteins, and sugars. Studies have shown that TFL possesses multiple pharmacological activities, such as reducing blood sugar[20], regulating blood lipids, providing antioxidant and liver protection[21], anti-tumor effects, and alleviating neuropathic pain[22]. For several decades, traditional Chinese medicine has been using TFL to treat liver fibrosis. However, the effects of TFL on liver fibrosis caused by \u003cem\u003eS. japonicum\u003c/em\u003e have not yet been reported.\u003c/p\u003e\n\u003cp\u003eIn this study, a liver fibrosis model was established in \u003cem\u003eS. japonicum\u003c/em\u003e infected mice and the mice were treatedwith different concentrations of TFL. The study utilized methods like ELISA, Hematoxylin and Eosin (H\u0026amp;E) staining, Masson\u0026apos;s trichrome staining, immunohistochemistry, and qPCR to detect various liver injury and fibrosis-related indicators. Additionally, qPCR was used to detect the activation marker of HSCs, \u0026alpha;-SMA, aiming to explore the effects and mechanisms of TFL on liver fibrosis caused by \u003cem\u003eS. japonicum\u003c/em\u003e infection.\u003c/p\u003e"},{"header":"Methods ","content":"\u003cp\u003e\u003cstrong\u003eReagents\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTFL was purchased from Nanjing Herb Source Biotechnology Co., Ltd. (Nanjing, China). Antibodies against α-SMA, COL1A1, COL3A1, and secondary antibodies were acquired from Wuhan Sanying Biotechnology Co., Ltd. (Wuhan, China). Mouse/Rat TGF-β1 (Transforming Growth Factor-β1) recombinant protein was obtained from Shanghai Zhongqiao Xinzhou Biotechnology Co., Ltd. (Shanghai, China). Anti-alpha smooth muscle Actin Rabbit pAb, Anti-Collagen I Rabbit pAb, and Anti-Collagen III Rabbit pAb were also purchased from Wuhan Sanying Biotechnology Co., Ltd. (Wuhan, China). Hematoxylin and Eosin (H\u0026amp;E) staining and Masson's trichrome staining kits were acquired from Beijing Solarbio Science \u0026amp; Technology Co., Ltd. (Beijing, China).\u003c/p\u003e\n\u003cp\u003eRat hepatic stellate cells (HSC-T6) were obtained from the Kunming Cell Bank (Kunming, China). ELISA kits were purchased from Invitrogen (269375-007, USA). The total RNA extraction kit for cells and the qRT-PCR kit were purchased from Quanshijin Biotechnology Co., Ltd. (Beijing, China). Primers were obtained from Genesis Biotech Co., Ltd. (Nanning, China).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMice, parasitic infection, and treatment\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSPF female C57 mice, aged 6-8 weeks and weighing 18-20g, were provided by the Animal Center of Guangxi Medical University. All mouse experiments were approved by the Animal Protection and Use Committee of Guangxi Medical University for appropriateness and humanity. Mice were randomly divided into a normal control group (NC, \u003cem\u003en\u003c/em\u003e=8), an \u003cem\u003eS. japonicum\u003c/em\u003e infection group (\u003cem\u003eSj\u003c/em\u003e, \u003cem\u003en\u003c/em\u003e=8), a low TFL dose group (TFL-L, 300 mg/kg, \u003cem\u003en\u003c/em\u003e=8), and a high TFL dose group (TFL-H, 450mg/kg, \u003cem\u003en\u003c/em\u003e=8). Each mouse in the infection and TFL groups was infected with 20 (±1) \u003cem\u003eS. japonicum\u003c/em\u003e cercariae through abdominal skin. Starting from the 7th day post-infection, mice in the TFL groups were orally administered different doses of TFL (300 mg/kg, 450 mg/kg) once a day for 9 consecutive weeks, while the normal control and infection groups were given pure water in the same manner. After the last administration, the mice were euthanized. Serum samples were collected for different biochemical indicators testing. Mouse livers were carefully dissected for gross pathological examination, and liver tissues were either soaked in 4% polyformaldehyde solution for histopathological section preparation or stored at -80°C for subsequent testing.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCalculation of mouse liver and spleen index\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe liver and spleen samples were rinsed with physiological saline, wiped with filter paper, and weighed. The liver index was calculated as: Liver Index = [Liver Weight (g) / Mouse Weight (g)] x 100%. The spleen index was calculated as: Spleen Index = [Spleen Weight (g) / Mouse Weight (g)] x 100%.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDetection of mouse serum cytokines\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBlood samples were centrifuged at 25°C, 3000 rpm for 5 minutes to obtain the supernatant. The levels of serum IL-1β, IL-4, IL-6, and TNF-α were measured using ELISA kits according to the manufacturer’s instructions. The optical density (OD) of the plates was read at 450 nm using an ELISA reader and the concentrations were calculated using standard curves.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHistopathological analysis and fibrosis scoring\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLiver samples from each mouse were fixed with 4% polyformaldehyde and embedded in paraffin. Liver tissues were cut into 4µm thick sections for histopathological analysis using Hematoxylin and Eosin (H\u0026amp;E) staining. Microsopic images were collected and the area of each granuloma was calculated using Image-Pro Plus software for statistical analysis. Masson's trichrome staining was used to detect collagen content in liver tissues, assessing fibrosis. Images were also analyzed using ImageJ software for the area of collagen fibers in Masson's trichrome-stained sections.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmunohistochemical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSections were deparaffinized with xylene and hydrated with graded ethanol, followed by high-temperature antigen retrieval in citrate buffer. The sections were washed three times with PBS, each time for 5 minutes, and incubated with 3% H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e at room temperature for 15 minutes to block peroxidase activity, followed by three washes with PBS. The sections were then incubated with goat serum at 37°C for 30 minutes and overnight at 4°C with primary antibodies against α-SMA, Collagen I, and Collagen III (1:300). After incubation, the sections were washed four times with PBS and incubated with the secondary antibody (1:300) at 37°C for 1 hour, followed by color development with 3,3'-diaminobenzidine (DAB) and counterstaining with hematoxylin. The sections were then dehydrated with graded ethanol, cleared with xylene, and finally mounted with neutral balsam.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell culture and TFL treatment\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo study the inhibitory effect of different concentrations of TFL on the activation of hepatic stellate cells, rat hepatic stellate cells (HSC-T6) were cultured in high-glucose DMEM medium containing 10% fetal bovine serum in at 5% CO2, 37°C. and divided into five groups: control group, TGF-β1 (10 ng/ml) group, TGF-β1 + low concentration TFL (10 ng/ml and 450ng/L) group, and TGF-β1 + high concentration TFL (10 ng/ml and 600ng/L) group. Both TGF-β1 and TFL were dissolved in culture medium containing 10% fetal bovine serum, and cells were tested 48 hours after administration of different drugs.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRNA extraction and Real-Time quantitative PCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted from HSC-T6 cells and total cDNA were synthesized. The relative mRNA level of α-SMA were detected by qRT-PCR. β-actin served as the internal control. The forward primer sequence of α-SMA is ATGGGAAGCTGGTCATCAAC, and the reverse primer sequence of α-SMA is GTGGTTCACACCCATCACAA. The PCR reaction was run on the 7500 Real-Time PCR System (Termo Fisher Scientifc) at 95\u0026nbsp;°C for 10\u0026nbsp;min, followed by 40 cycles at 95\u0026nbsp;°C for 15\u0026nbsp;s and 60\u0026nbsp;°C for 1\u0026nbsp;min. Then, the melting curve was measured (95\u0026nbsp;°C for 30\u0026nbsp;s, 65\u0026nbsp;°C for 15\u0026nbsp;s, and 95 °C for 30\u0026nbsp;s). The experiments were performed as independent biological replicates at least three times, and the relative expression of the target genes was calculated using the 2\u003csup\u003e−\u003c/sup\u003e\u003csup\u003eΔΔCt\u003c/sup\u003e method.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical methods\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eResults of biochemical indicators were expressed as mean ± standard deviation (x±s) and compared between groups using analysis of variance (ANOVA). Differences were considered statistically significant at \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05. If the ANOVA results were significant, the LSD multiple comparison test was used. All data analyses were performed using SPSS 26 software.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eTFL gained body weight and improved the liver and spleen index\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter infection, the body weight of mice in the\u0026nbsp;\u003cem\u003eSj\u003c/em\u003e group was significantly lower than that in the NC group (Figure 1B). After TFL treatment, the body weight of mice in the TFL-L group slightly increased, but the difference was not statistically significant compared to the\u0026nbsp;\u003cem\u003eSj\u003c/em\u003e group. The body weight of mice in the TFL-H group was significantly higher than that in the\u0026nbsp;\u003cem\u003eSj\u003c/em\u003e group, approaching normal (one-way ANOVA, \u003cem\u003eF\u003c/em\u003e\u003csub\u003e(3,4)\u003c/sub\u003e=5.396, \u003cem\u003eP\u003c/em\u003e = 0.010, followed by LSD multiple comparison test: NC (\u003cem\u003eSj\u003c/em\u003e): \u003cem\u003eP\u003c/em\u003e= 0.001, TFL-H (\u003cem\u003eSj\u003c/em\u003e): \u003cem\u003eP\u003c/em\u003e= 0.014).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe liver index of the \u003cem\u003eSj\u003c/em\u003e group was significantly higher than that of the NC group (Figure 1C) (one-way ANOVA, \u003cem\u003eF\u003c/em\u003e\u003csub\u003e(3,4)\u003c/sub\u003e=31.075,\u003cem\u003e\u0026nbsp;P\u003c/em\u003e \u0026lt;0.001). The liver indices in the TFL treatment groups showed some reduction compared to the \u003cem\u003eSj\u003c/em\u003e group, but the difference was not statistically significant. The spleen index also showed an increase after \u003cem\u003eSj\u003c/em\u003e infection (Figure 1D). The spleen index of the \u003cem\u003eSj\u003c/em\u003e group was also significantly higher than that of the NC group, and the liver indices in both TFL-L and TFL-H groups were significantly reduced compared to the \u003cem\u003eSj\u003c/em\u003e group (one-way ANOVA, \u003cem\u003eF\u003c/em\u003e\u003csub\u003e(3,4)\u003c/sub\u003e=43.939, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.001, followed by LSD multiple comparison test: NC(\u003cem\u003eSj\u003c/em\u003e):\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001, TFL-L(\u003cem\u003eSj\u003c/em\u003e):\u003cem\u003eP\u003c/em\u003e=0.001, TFL-H(\u003cem\u003eSj\u003c/em\u003e):\u003cem\u003eP\u003c/em\u003e=0.001). These results indicate that TFL treatment can alleviate liver damage caused by \u003cem\u003eS. japonicum\u003c/em\u003e infection to a certain extent.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTFL reduces inflammation in mice caused by \u003cem\u003eS. japonicum\u003c/em\u003e infection\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe levels of serum cytokines in mice before and after schistosome infection were measured using ELISA. The levels of IL-1\u0026beta;, TNF-\u0026alpha;, and IL-6 in the serum of mice in the \u003cem\u003eSj\u003c/em\u003e group (Figure 2A-C) were significantly higher than in the NC group. \u0026nbsp;Specifically, IL-1\u0026beta; levels decreased in a dose-dependent manner in all TFL groups (one-way ANOVA, \u003cem\u003eF\u003c/em\u003e\u003csub\u003e(3,4)\u003c/sub\u003e=11.470, \u003cem\u003eP\u003c/em\u003e = 0.001, followed by LSD multiple comparison test: NC(\u003cem\u003eSj\u003c/em\u003e): \u003cem\u003eP\u003c/em\u003e=0.003, TFL-L(\u003cem\u003eSj\u003c/em\u003e): \u003cem\u003eP\u003c/em\u003e=0.002, TFL-H(\u003cem\u003eSj\u003c/em\u003e): \u003cem\u003eP\u003c/em\u003e\u0026lt;0.001); TNF-\u0026alpha; levels significantly decreased in both TFL-L and TFL-H groups compared to the \u003cem\u003eSj\u003c/em\u003e group (one-way ANOVA, \u003cem\u003eF\u003c/em\u003e\u003csub\u003e(3,4)\u003c/sub\u003e=11.098, \u003cem\u003eP\u003c/em\u003e = 0.001, followed by LSD multiple comparison test: NC(\u003cem\u003eSj\u003c/em\u003e): \u003cem\u003eP\u003c/em\u003e\u0026lt;0.001, TFL-L(\u003cem\u003eSj\u003c/em\u003e): \u003cem\u003eP\u003c/em\u003e=0.001, TFL-H(\u003cem\u003eSj\u003c/em\u003e): \u003cem\u003eP\u003c/em\u003e\u0026lt;0.001), but IL-6 levels only significantly decreased in the TFL-H group compared to the \u003cem\u003eSj\u003c/em\u003e group (one-way ANOVA, \u003cem\u003eF\u003c/em\u003e\u003csub\u003e(3,4)\u003c/sub\u003e=14.593, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001, followed by LSD multiple comparison test: NC(\u003cem\u003eSj\u003c/em\u003e): \u003cem\u003eP\u003c/em\u003e\u0026lt;0.001, TFL-H(\u003cem\u003eSj\u003c/em\u003e): \u003cem\u003eP\u003c/em\u003e=0.023). Additionally, the results showed that the level of the anti-inflammatory cytokine IL-13 in the serum of mice in the \u003cem\u003eSj\u003c/em\u003e group (Figure 2D) was slightly lower than in the NC group and increased in a dose-dependent manner in all TFL groups, but the difference was not statistically significant. These results suggested that TFL treatment improved inflammation in mice caused by \u003cem\u003eS. japonicum\u003c/em\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTFL alleviate\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003ee\u003c/strong\u003e\u003cstrong\u003egg granuloma and liver fibrosis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo understand the severity of liver damage, we used H\u0026amp;E and Masson\u0026apos;s trichrome staining to assess the histopathological damage and degree of fibrosis in liver tissues. H\u0026amp;E staining results showed that in the \u003cem\u003eSj\u003c/em\u003e group, liver structure was disorganized, with significant fibroblast and inflammatory cell infiltration around the hepatic lobules. There was also bile duct proliferation and cholestasis around the lobules. These symptoms were alleviated to varying degrees after using TFL (Figures 3A, B). In the TFL-H group, the bile stasis and inflammatory infiltration were significantly reduced (one-way ANOVA, \u003cem\u003eF\u003c/em\u003e\u003csub\u003e(3,4)\u003c/sub\u003e=621.373, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001, followed by LSD\u0026apos;s multiple comparison test: NC(\u003cem\u003eSj\u003c/em\u003e): \u003cem\u003eP\u003c/em\u003e\u0026lt;0.001, TFL-L(\u003cem\u003eSj\u003c/em\u003e): \u003cem\u003eP\u003c/em\u003e\u0026lt;0.001, TFL-H(\u003cem\u003eSj\u003c/em\u003e): \u003cem\u003eP\u003c/em\u003e\u0026lt;0.001). Masson\u0026apos;s trichrome staining results showed that in the \u003cem\u003eSj\u003c/em\u003e group, there was high-density collagen staining around the central vein, with fibrotic septa and evident collagen fiber proliferation (Figures 3C, D). TFL treatment significantly reduced collagen deposition and alleviated liver fibrosis, especially noticeable in the TFL-H treatment group (one-way ANOVA, \u003cem\u003eF\u003c/em\u003e\u003csub\u003e(3,4)\u003c/sub\u003e=412.867,\u003cem\u003e\u0026nbsp;P\u003c/em\u003e \u0026lt; 0.001, followed by LSD\u0026apos;s multiple comparison test: NC(\u003cem\u003eSj\u003c/em\u003e): \u003cem\u003eP\u003c/em\u003e\u0026lt;0.001, TFL-L(\u003cem\u003eSj\u003c/em\u003e): \u003cem\u003eP\u003c/em\u003e\u0026lt;0.001, TFL-H(\u003cem\u003eSj\u003c/em\u003e):\u003cem\u003e\u0026nbsp;P\u003c/em\u003e\u0026lt;0.001).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTFL reduced the expression of \u0026alpha;-SMA, Collagen I and Collagen III in liver tissue\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eImmunohistochemical staining results showed that the expressions of \u0026alpha;-SMA, Collagen I and Collagen III were significantly increased in the \u003cem\u003eSj\u003c/em\u003e group, with a noticeable increase in brown-yellow stained areas. In contrast, TFL treatment groups showed a significant reduction in positive expression and a decrease in the brown-yellow staining, making the staining lighter (Figures 4A, C, E). Using Image J to analyze the staining and expression of \u0026alpha;-SMA, Collagen I and Collagen III, it was found that their expression was significantly elevated in the \u003cem\u003eSj\u003c/em\u003e group and significantly decreased after TFL treatment, with statistically significant differences (one-way ANOVA, \u0026alpha;-SMA: \u003cem\u003eF\u003c/em\u003e\u003csub\u003e(3,4)\u003c/sub\u003e=253.217, \u003cem\u003eP\u003c/em\u003e\u0026lt; 0.001; Collagen I: \u003cem\u003eF\u003c/em\u003e\u003csub\u003e(3,4)\u003c/sub\u003e=86.471, \u003cem\u003eP\u003c/em\u003e\u0026lt; 0.001; Collagen III: \u003cem\u003eF\u003c/em\u003e\u003csub\u003e(3,4)\u003c/sub\u003e=444.144, \u003cem\u003eP\u003c/em\u003e\u0026lt; 0.001, followed by LSD\u0026apos;s multiple comparison test: NC(\u003cem\u003eSj\u003c/em\u003e): \u003cem\u003eP\u003c/em\u003e\u0026lt;0.001, TFL-L(\u003cem\u003eSj\u003c/em\u003e): \u003cem\u003eP\u003c/em\u003e\u0026lt;0.001, TFL-H(\u003cem\u003eSj\u003c/em\u003e): \u003cem\u003eP\u003c/em\u003e\u0026lt;0.001). These results indicate that TFL can significantly inhibit the inflammatory response and liver fibrosis and has a protective effect on liver tissue.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTFL inhibits the activation of HSC-T6 cells in vitro\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTGF-\u0026beta;1 is a major fibrogenic growth factor in liver fibrosis. TGF-\u0026beta;1 was used to promote the proliferation and activation of HSCs, followed by treatment with TFL on these activated cells (Figure 5). When cells were co-stimulated with TGF-\u0026beta;1 (10 ng/ml) and TFL (450, 600 ng/ml) for 48 hours, we measured the expression of \u0026alpha;-SMA mRNA. It was found that TFL inhibited the expression of \u0026alpha;-SMA mRNA to varying degrees, and this inhibitory effect was concentration-dependent (one-way ANOVA, \u003cem\u003eF\u003c/em\u003e\u003csub\u003e(3,4)\u003c/sub\u003e=14.460, \u003cem\u003eP\u003c/em\u003e = 0.001, followed by LSD\u0026apos;s multiple comparison test: NC(\u003cem\u003eSj\u003c/em\u003e): \u003cem\u003eP\u003c/em\u003e=0.005, TFL-L(\u003cem\u003eSj\u003c/em\u003e): \u003cem\u003eP\u003c/em\u003e=0.015, TFL-H(\u003cem\u003eSj\u003c/em\u003e):\u003cem\u003e\u0026nbsp;P\u003c/em\u003e\u0026lt;0.001).This \u003cu\u003ei\u003c/u\u003endicated that TFL played a similar inhibitory role in the activation model of other HSCs.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, the anti-liver fibrosis effect of TFL was investigated in \u003cem\u003eS. japonicum\u0026nbsp;\u003c/em\u003einfected mice, and its possible mechanism was explored. Our results showed that TFL treatment led to weight resotration in \u003cem\u003eS. japonicum\u003c/em\u003e-infected mice, a decrease in liver and spleen indexes, and a reduction in inflammation caused by \u003cem\u003eS. japonicum\u003c/em\u003e infection. Pathological results showed that TFL alleviated \u003cem\u003eS. japonicum\u003c/em\u003e-induced granuloma and liver fibrosis, and reduced the expression of \u0026alpha;-SMA, Collagen I and Collagen III in liver tissue. \u003cem\u003eIn vitro\u003c/em\u003e studies found that TFL inhibited the activation of HSC-T6 cells induced by TGF-\u0026beta;. This suggested that TFL alleviated \u003cem\u003eS. japonicum\u003c/em\u003e-induced liver fibrosis by inhibiting the activation of hepatic stellate cells.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eLiver fibrosis is recognized as a reversible pathological process, which lends both theoretical feasibility and significant clinical relevance to its treatment. In recent years, there has been a growing focus on the extraction of efficient, low-toxicity compounds from natural sources to mitigate liver fibrosis. TFL is one such group of compounds extracted from litchi seeds, known for their anti-inflammatory, antioxidant, and anti-fibrotic properties[23]. Research had indicated that TFL effectively reduced liver fibrosis induced by carbon tetrachloride (CCl\u003csub\u003e4\u003c/sub\u003e) in rats. The underlying mechanism appeared to involve the upregulation of retinol metabolism, which impacted both lipid metabolism and the degradation of the ECM[24]. Additionally, TFL had shown promise in improving liver fibrosis caused by dimethylnitrosamine (DMN), potentially through the upregulation of Bcl-2 and the downregulation of Bax expression[25]. CCl\u003csub\u003e4\u0026nbsp;\u003c/sub\u003eand DMN are artificial chemical reagents that inflict quick damage to liver and induce actue liver fibrosis. However, in clinical practice, liver fibrosis caused by chronic liver damage is also very common, such as fatty liver, alcoholic liver, viral hepatitis, or parasitic infections, etc. It remained unclear whether TFL would exert a similar protective effect in the context of actual disease. Our study addressed this gap by demonstrating, for the first time, that TFL indeed ameliorated liver fibrosis in mice \u003cu\u003einflicted with\u003c/u\u003e schistosomiasis. Moreover, our laboratory observed comparable effects of TFL in alleviating liver fibrosis in rats infected with \u003cem\u003eClonorchis sinensis\u003c/em\u003e (unpublished data). These results suggested that TFL had a protective effect against liver fibrosis in authentic disease models, highlighting its potential for future clinical applications.\u003c/p\u003e\n\u003cp\u003eSchistosomiasis \u003cem\u003ejaponica\u003c/em\u003e is a typical chronic infectious disease[26]. Both humoral immunity and cellular immunity are involved in the formation and development of schistosome egg granulomas and fibrosis. The survival of \u003cem\u003eSchistosoma japonicum\u003c/em\u003e within the host requires active modulation of the host\u0026apos;s immune system and evasion of harmful immune responses. CD4\u003csup\u003e+\u0026nbsp;\u003c/sup\u003eT cells play an important role in the onset, development, and immunoregulation of the disease. Studies show that Th1 cells, which act early in the infection, release SEA slowly from eggs deposited in the liver, and the expression of a series of pro-inflammatory cytokines secreted by Th1 cells increases, including IFN-\u0026gamma;, tumor necrosis factor-a (TNF-a), IL-1, and IL-6[27]. As the infection progresses, Th2 immune responses begin to dominate, with a significant increase in the expression of fibrosis-promoting cytokines such as IL-4, IL-5, IL-13[28]. Among them, IL-4 and IL-13 are the most well-studied Th2 cytokines, with IL-13 being the main cytokine driving fibrosis, and IL-4 enhancing the fibrogenic effect of IL-13[29]. At the same time, Th17/IL-17, Th9/IL-9, Tfh/IL-21 are also involved, promoting the development of egg granulomas to their maximum extent about 7 weeks after infection, and studies have shown that blocking IL-17/ IL-9/ IL-21 can reduce the degree of fibrosis[30-35]. In the chronic phase of the infection, the volume of egg granulomas gradually decreases, due to the negative feedback regulation by Treg cells and their secretion of IL-10[36-38]. It is clear that the development of schistosomiasis is the result of mutual regulation between various Th subgroups and cytokines. This study found that intervention with TFL significantly reduced the expression of pro-inflammatory cytokines such as IL-1, TNF-a, and IL-6 in the serum of mice with schistosomiasis \u003cem\u003ejaponica\u003c/em\u003e. HE staining results also showed that after TFL treatment, the degree of liver egg granulomas in mice was significantly reduced, especially with increased TFL concentration. These results suggested that TFL inhibited schistosomiasis. In addition, Masson staining results showed that TFL intervention significantly improved the degree of liver fibrosis in schistosomiasis, which was consistent with the results of previous research. However, serological results showed that although the expression of IL-13 in the serum of mice with schistosomiasis \u003cem\u003ejaponica\u003c/em\u003e decreased after TFL intervention, the\u003cu\u003e\u0026nbsp;\u003c/u\u003echange was notignificant.\u003c/p\u003e\n\u003cp\u003ePrevious studies indicated that TFL treatment significantly replenished 9-cis retinoic acid (RA) levels in CCl4-induced liver fibrosis in rats[24]. The increase of retinol and (RA) in rat liver tissue after TFL treatment was associated with the increased expression of acetaldehyde dehydrogenase 2(ALDH2), ALDH1a7, and Aox3, which promoted retinol to RA convertion. The mechanism of TFL in treating liver fibrosis might be associated with the Rxra-mediated lipid metabolism pathway which regulated steatosis and lipid deposition[24]. TGM2 and TLR4 signaling are crucial in \u003cem\u003eS. japonicum\u003c/em\u003e induced liver fibrosis. In HSC-LX-2 cells, all-trans-retinoic acid (ATRA) enhanced TLR4 signaling at low concentrations by increasing TGM2 expression, while at high concentrations it inhibited TLR4 signaling and reduced \u0026alpha;-SMA expression[39]. This indicated that ATRA was also closely related to liver fibrosis caused by \u003cem\u003eS. japonicum\u0026nbsp;\u003c/em\u003einfection. Similarly, ATRA ameliorates inflammatory response mediated by TLR4/NF-\u0026kappa;B during initiation of diabetic nephropathy, reducing, and \u0026nbsp;improved the increase of pro-inflammatory factors such as IL-1, IL-2, IL-13, IL-16, TNF-\u0026alpha;, TGF-\u0026beta;1 induced by inflammation, which was similar to the results of our current study[40, 41]. ATRA can only bind to RARs, while 9-cis retinoic acid can bind to both RARs and RXRs, indicating that both ATRA and 9-cis retinoic acid can transmit signals through RARs to downstream regulatory effects[42]. The effect of RA on IL-13 may be tissue-specific. On the one hand, RA can prevent dendritic cells in the mesenteric lymph nodes (MLN-DCs) from inducing the production of IL-13 by inflammatory Th2 cells[43, 44]. However, it was also found that ATRA and 9-cis RA promote the synthesis of IL-4, IL-5, and IL-13 in PBMC cells[42]. This might also explain why IL-13 in the serum was not significantly reduced after TFL treatment while the fibrosis was alleviated in this study.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eHSCs activation is a critical point in triggering liver fibrosis. In various models of liver fibrosis, the elevated expression of \u0026alpha;-SMA is an important indicator of HSC activation. In this study, an increase in \u0026alpha;-SMA expression was detected both in the livers of rats infected with schistosomiasis and in T6 cells stimulated with TGF-\u0026beta; in vitro. Similarly, after TFL treatment, the expression of \u0026alpha;-SMA in both cases significantly decreased, suggesting that there is a similar mechanism of liver fibrosis across different disease models, and that TFL can alleviate the harm by inhibiting \u0026alpha;-SMA expression, a common node of liver fibrosis.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eIn this study, results from morphological, serological, pathological analysis and cellular experiments all demonstrate that TFL has a significant anti-liver fibrosis effect in mice infected with \u003cem\u003eS. japonicum,\u003c/em\u003e showing its potential in future clinical application. The mechanism of anti-liver fibrosis of TFL in different disease models likely shares a commonality in inhibiting the activation of HSCs by suppressing the expression of \u0026alpha;-SMA. Future research should attempt to apply TFL to more fibrosis models to further verify its efficacy, and use various high-throughput analyses including transcriptomics and proteomics to identify and verify genes and pathways that represent the common alterations after TFL intervention across various disease models, in order to better elucidate the mechanism of liver fibrosis and the anti-fibrotic mechanism of TFL.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eJH, QC, QL and TZ conceived and designed the study and drafted the manuscript. JW, ZT, and SX performed the experiments and collected data, and handled statistical analysis. LL, LT, and SH participated in the study design and revised the draft version of the paper. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the National Natural Science Foundation of China (No. 82260407 and 81860358), the Guangxi Natural Science Foundation of China (No. 2018GXNSFAA281059), Guangxi Natural Science Foundation for Youth Fund of China (No.2023GXNSFBA026068), Guangxi Zhuang National Health Commission Administration (No. Z-A20230160) and National College Students’ innovation and entrepreneurship training program (202210598014). The funders had no role in study design, data collection, analysis, publication decision, or manuscript preparation.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data supporting the conclusions of this study are included in the article.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll animal experiments were approved by the ethical committee for animal research at the Guangxi Medical University (approval no. 202212005) and strictly performed following the guidelines of the National Laboratory Animal Center in China.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor details\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e1\u0026nbsp;\u003c/sup\u003eDepartment of Parasitology, Guangxi Medical University, Nanning 530021, Guangxi, China.\u003csup\u003e\u0026nbsp;2\u003c/sup\u003eDepartment of Gastroenterology, the People's Hospital of Guangxi Zhuang Autonomous Region, Guangxi Academy of Medical Sciences, Nanning 530021, Guangxi, China. \u003csup\u003e3\u003c/sup\u003eSchool of Pre-clinical Medicine, Guangxi Medical University, Nanning, China. \u003csup\u003e4\u003c/sup\u003eDepartment of Clinical Laboratory, Liuzhou People′s Hospital, Liuzhou 545006, Guangxi, China. \u003csup\u003e5\u003c/sup\u003eDepartment of Cell Biology and Genetics, Guangxi Medical University, Nanning 530021, Guangxi, China. \u003csup\u003e6\u003c/sup\u003eKey Laboratory of Longevity and Aging-Related Diseases of Chinese Ministry of Education, Guangxi Medical University, Nanning 530021, Guangxi, China. \u003csup\u003e7\u003c/sup\u003eKey Laboratory of Basic Research on Regional Diseases (Guangxi Medical University), Education Department of Guangxi Zhuang Autonomous Region, Nanning 530021, Guangxi, China.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eColley DG, Bustinduy AL, Secor WE, King CH. Human schistosomiasis. Lancet (London, England).\u003cem\u003e \u003c/em\u003e2014;383:2253-64.\u003c/li\u003e\n\u003cli\u003eGryseels B, Polman K, Clerinx J, Kestens L. Human schistosomiasis. Lancet (London, England).\u003cem\u003e \u003c/em\u003e2006;368:1106-18.\u003c/li\u003e\n\u003cli\u003eMcManus DP, Dunne DW, Sacko M, Utzinger J, Vennervald BJ, Zhou XN. Schistosomiasis. Nature reviews Disease primers.\u003cem\u003e \u003c/em\u003e2018;4:13.\u003c/li\u003e\n\u003cli\u003eRoss AG, Bartley PB, Sleigh AC, Olds GR, Li Y, Williams GM, et al. Schistosomiasis. The New England journal of medicine.\u003cem\u003e \u003c/em\u003e2002;346:1212-20.\u003c/li\u003e\n\u003cli\u003eMcManus DP, Gray DJ, Li Y, Feng Z, Williams GM, Stewart D, et al. Schistosomiasis in the People\u0026apos;s Republic of China: the era of the Three Gorges Dam. Clinical microbiology reviews.\u003cem\u003e \u003c/em\u003e2010;23:442-66.\u003c/li\u003e\n\u003cli\u003eBurke ML, Jones MK, Gobert GN, Li YS, Ellis MK, McManus DP. Immunopathogenesis of human schistosomiasis. Parasite immunology.\u003cem\u003e \u003c/em\u003e2009;31:163-76.\u003c/li\u003e\n\u003cli\u003eKong D, Zhang F, Zhang Z, Lu Y, Zheng S. Clearance of activated stellate cells for hepatic fibrosis regression: molecular basis and translational potential. Biomedicine \u0026amp; pharmacotherapy = Biomedecine \u0026amp; pharmacotherapie.\u003cem\u003e \u003c/em\u003e2013;67:246-50.\u003c/li\u003e\n\u003cli\u003eIredale JP. Models of liver fibrosis: exploring the dynamic nature of inflammation and repair in a solid organ. The Journal of clinical investigation.\u003cem\u003e \u003c/em\u003e2007;117:539-48.\u003c/li\u003e\n\u003cli\u003eZhou WC, Zhang QB, Qiao L. Pathogenesis of liver cirrhosis. World journal of gastroenterology.\u003cem\u003e \u003c/em\u003e2014;20:7312-24.\u003c/li\u003e\n\u003cli\u003eElpek G. Cellular and molecular mechanisms in the pathogenesis of liver fibrosis: An update. World journal of gastroenterology.\u003cem\u003e \u003c/em\u003e2014;20:7260-76.\u003c/li\u003e\n\u003cli\u003eAnthony B, Allen JT, Li YS, McManus DP. Hepatic stellate cells and parasite-induced liver fibrosis. Parasites \u0026amp; vectors.\u003cem\u003e \u003c/em\u003e2010;3:60.\u003c/li\u003e\n\u003cli\u003eOtogawa K, Ogawa T, Shiga R, Ikeda K, Kawada N. Induction of tropomyosin during hepatic stellate cell activation and the progression of liver fibrosis. Hepatology international.\u003cem\u003e \u003c/em\u003e2009;3:378-83.\u003c/li\u003e\n\u003cli\u003eWang Y, Fan X, Lei N, He X, Wang X, Luo X, et al. A MicroRNA Derived From Schistosoma japonicum Promotes Schistosomiasis Hepatic Fibrosis by Targeting Host Secreted Frizzled-Related Protein 1. Frontiers in cellular and infection microbiology.\u003cem\u003e \u003c/em\u003e2020;10:101.\u003c/li\u003e\n\u003cli\u003eLiu P, Wang M, Lu XD, Zhang SJ, Tang WX. Schistosoma japonicum egg antigen up-regulates fibrogenesis and inhibits proliferation in primary hepatic stellate cells in a concentration-dependent manner. World journal of gastroenterology.\u003cem\u003e \u003c/em\u003e2013;19:1230-8.\u003c/li\u003e\n\u003cli\u003eChen L, Ji X, Wang M, Liao X, Liang C, Tang J, et al. Involvement of TLR4 signaling regulated-COX2/PGE2 axis in liver fibrosis induced by Schistosoma japonicum infection. Parasites \u0026amp; vectors.\u003cem\u003e \u003c/em\u003e2021;14:279.\u003c/li\u003e\n\u003cli\u003eZhao L, Wang K, Wang K, Zhu J, Hu Z. Nutrient components, health benefits, and safety of litchi (Litchi chinensis Sonn.): A review. Comprehensive reviews in food science and food safety.\u003cem\u003e \u003c/em\u003e2020;19:2139-63.\u003c/li\u003e\n\u003cli\u003eKim WJ, Yang S, Choi G, Park I, Noh P, Kim MJ, et al. Accurate and Rapid Identification of Longan Arillus and Litchi Semen by a Multiplex PCR Assay. Plants (Basel, Switzerland).\u003cem\u003e \u003c/em\u003e2020;9:\u003c/li\u003e\n\u003cli\u003eJinato T, Chayanupatkul M, Dissayabutra T, Chutaputti A, Tangkijvanich P, Chuaypen N. Litchi-Derived Polyphenol Alleviates Liver Steatosis and Gut Dysbiosis in Patients with Non-Alcoholic Fatty Liver Disease: A Randomized Double-Blinded, Placebo-Controlled Study. Nutrients.\u003cem\u003e \u003c/em\u003e2022;14:\u003c/li\u003e\n\u003cli\u003eEmanuele S, Lauricella M, Calvaruso G, D\u0026apos;Anneo A, Giuliano M. Litchi chinensis as a Functional Food and a Source of Antitumor Compounds: An Overview and a Description of Biochemical Pathways. Nutrients.\u003cem\u003e \u003c/em\u003e2017;9:\u003c/li\u003e\n\u003cli\u003eMan S, Ma J, Yao J, Cui J, Wang C, Li Y, et al. Systemic Perturbations of Key Metabolites in Type 2 Diabetic Rats Treated by Polyphenol Extracts from Litchi chinensis Seeds. Journal of agricultural and food chemistry.\u003cem\u003e \u003c/em\u003e2017;65:7698-704.\u003c/li\u003e\n\u003cli\u003eTang Y, Yu C, Wu J, Chen H, Zeng Y, Wang X, et al. Lychee seed extract protects against neuronal injury and improves cognitive function in rats with type II diabetes mellitus with cognitive impairment. International journal of molecular medicine.\u003cem\u003e \u003c/em\u003e2018;41:251-63.\u003c/li\u003e\n\u003cli\u003eChung YC, Chen CH, Tsai YT, Lin CC, Chou JC, Kao TY, et al. Litchi seed extract inhibits epidermal growth factor receptor signaling and growth of Two Non-small cell lung carcinoma cells. BMC complementary and alternative medicine.\u003cem\u003e \u003c/em\u003e2017;17:16.\u003c/li\u003e\n\u003cli\u003eCheng Q, Qin W, Zhuo L, Zhao Y, Fan L, Lin W, et al. Comparison of Total Flavone of Litchi Chinensis Son in Two Kinds of Hepatic Fibrosis Model of Rats. Her Med. 2020;39:1179-84.\u003c/li\u003e\n\u003cli\u003eYan J, Feng Y, Fang X, Cui X, Xia X, Li F, et al. Anti-liver fibrosis effects of the total flavonoids of litchi semen on CCl(4)-induced liver fibrosis in rats associated with the upregulation of retinol metabolism. Pharmaceutical biology.\u003cem\u003e \u003c/em\u003e2022;60:1264-77.\u003c/li\u003e\n\u003cli\u003eZhou X, Liu Q. Improving Effect of Total Flavone from Litchi chinensis on the Hepatocyte Injury in Liver Fibrosis Model Rats. China Pharmacy. 2015;26:3099-102.\u003c/li\u003e\n\u003cli\u003ePearce EJ, MacDonald AS. The immunobiology of schistosomiasis. Nature reviews Immunology.\u003cem\u003e \u003c/em\u003e2002;2:499-511.\u003c/li\u003e\n\u003cli\u003eStadecker MJ, Asahi H, Finger E, Hernandez HJ, Rutitzky LI, Sun J. The immunobiology of Th1 polarization in high-pathology schistosomiasis. Immunological reviews.\u003cem\u003e \u003c/em\u003e2004;201:168-79.\u003c/li\u003e\n\u003cli\u003eKaplan MH, Whitfield JR, Boros DL, Grusby MJ. Th2 cells are required for the Schistosoma mansoni egg-induced granulomatous response. Journal of immunology (Baltimore, Md : 1950).\u003cem\u003e \u003c/em\u003e1998;160:1850-6.\u003c/li\u003e\n\u003cli\u003eFallon PG, Richardson EJ, McKenzie GJ, McKenzie AN. Schistosome infection of transgenic mice defines distinct and contrasting pathogenic roles for IL-4 and IL-13: IL-13 is a profibrotic agent. Journal of immunology (Baltimore, Md : 1950).\u003cem\u003e \u003c/em\u003e2000;164:2585-91.\u003c/li\u003e\n\u003cli\u003eZhang Y, Huang D, Gao W, Yan J, Zhou W, Hou X, et al. Lack of IL-17 signaling decreases liver fibrosis in murine schistosomiasis japonica. International immunology.\u003cem\u003e \u003c/em\u003e2015;27:317-25.\u003c/li\u003e\n\u003cli\u003eChen D, Luo X, Xie H, Gao Z, Fang H, Huang J. Characteristics of IL-17 induction by Schistosoma japonicum infection in C57BL/6 mouse liver. Immunology.\u003cem\u003e \u003c/em\u003e2013;139:523-32.\u003c/li\u003e\n\u003cli\u003eWang B, Liang S, Wang Y, Zhu XQ, Gong W, Zhang HQ, et al. Th17 down-regulation is involved in reduced progression of schistosomiasis fibrosis in ICOSL KO mice. PLoS neglected tropical diseases.\u003cem\u003e \u003c/em\u003e2015;9:e0003434.\u003c/li\u003e\n\u003cli\u003eZhan T, Zhang T, Wang Y, Wang X, Lin C, Ma H, et al. Dynamics of Th9 cells and their potential role in immunopathogenesis of murine schistosomiasis. Parasites \u0026amp; vectors.\u003cem\u003e \u003c/em\u003e2017;10:305.\u003c/li\u003e\n\u003cli\u003eZhan T, Ma H, Jiang S, Zhong Z, Wang X, Li C, et al. Interleukin-9 blockage reduces early hepatic granuloma formation and fibrosis during Schistosoma japonicum infection in mice. Immunology.\u003cem\u003e \u003c/em\u003e2019;158:296-303.\u003c/li\u003e\n\u003cli\u003eWang Y, Lin C, Cao Y, Duan Z, Guan Z, Xu J, et al. Up-regulation of Interleukin-21 Contributes to Liver Pathology of Schistosomiasis by Driving GC Immune Responses and Activating HSCs in Mice. Scientific reports.\u003cem\u003e \u003c/em\u003e2017;7:16682.\u003c/li\u003e\n\u003cli\u003eHesse M, Piccirillo CA, Belkaid Y, Prufer J, Mentink-Kane M, Leusink M, et al. The pathogenesis of schistosomiasis is controlled by cooperating IL-10-producing innate effector and regulatory T cells. Journal of immunology (Baltimore, Md : 1950).\u003cem\u003e \u003c/em\u003e2004;172:3157-66.\u003c/li\u003e\n\u003cli\u003eHoffmann KF, Cheever AW, Wynn TA. IL-10 and the dangers of immune polarization: excessive type 1 and type 2 cytokine responses induce distinct forms of lethal immunopathology in murine schistosomiasis. Journal of immunology (Baltimore, Md : 1950).\u003cem\u003e \u003c/em\u003e2000;164:6406-16.\u003c/li\u003e\n\u003cli\u003eRoh YS, Park S, Lim CW, Kim B. Depletion of Foxp3+ Regulatory T Cells Promotes Profibrogenic Milieu of Cholestasis-Induced Liver Injury. Digestive diseases and sciences.\u003cem\u003e \u003c/em\u003e2015;60:2009-18.\u003c/li\u003e\n\u003cli\u003eWen Z, Ji X, Tang J, Lin G, Xiao L, Liang C, et al. Positive Feedback Regulation between Transglutaminase 2 and Toll-Like Receptor 4 Signaling in Hepatic Stellate Cells Correlates with Liver Fibrosis Post Schistosoma japonicum Infection. Frontiers in immunology.\u003cem\u003e \u003c/em\u003e2017;8:1808.\u003c/li\u003e\n\u003cli\u003eSierra-Mondragon E, Rodr\u0026iacute;guez-Mu\u0026ntilde;oz R, Namorado-Tonix C, Molina-Jijon E, Romero-Trejo D, Pedraza-Chaverri J, et al. All-Trans Retinoic Acid Attenuates Fibrotic Processes by Downregulating TGF-\u0026beta;1/Smad3 in Early Diabetic Nephropathy. Biomolecules.\u003cem\u003e \u003c/em\u003e2019;9:\u003c/li\u003e\n\u003cli\u003eSierra-Mondragon E, Molina-Jijon E, Namorado-Tonix C, Rodr\u0026iacute;guez-Mu\u0026ntilde;oz R, Pedraza-Chaverri J, Reyes JL. All-trans retinoic acid ameliorates inflammatory response mediated by TLR4/NF-\u0026kappa;B during initiation of diabetic nephropathy. The Journal of nutritional biochemistry.\u003cem\u003e \u003c/em\u003e2018;60:47-60.\u003c/li\u003e\n\u003cli\u003eDawson HD, Collins G, Pyle R, Key M, Taub DD. The Retinoic Acid Receptor-alpha mediates human T-cell activation and Th2 cytokine and chemokine production. BMC immunology.\u003cem\u003e \u003c/em\u003e2008;9:16.\u003c/li\u003e\n\u003cli\u003eYokota-Nakatsuma A. [Retinoic Acid Prevents Dendritic Cells from Inducing Novel Inflammatory T Cells That Produce Abundant Interleukin-13]. Yakugaku zasshi : Journal of the Pharmaceutical Society of Japan.\u003cem\u003e \u003c/em\u003e2017;137:1491-6.\u003c/li\u003e\n\u003cli\u003eYokota-Nakatsuma A, Takeuchi H, Ohoka Y, Kato C, Song SY, Hoshino T, et al. Retinoic acid prevents mesenteric lymph node dendritic cells from inducing IL-13-producing inflammatory Th2 cells. Mucosal immunology.\u003cem\u003e \u003c/em\u003e2014;7:786-801.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Total Flavonoids of Litchi Seed, Schistosoma japonicum, Liver fibrosis, Hepatic stellate cells, α-smooth muscle actin ","lastPublishedDoi":"10.21203/rs.3.rs-3673443/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3673443/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground\u003c/strong\u003e Infection with\u003cem\u003e Schistosoma japonicum\u003c/em\u003e (\u003cem\u003eS. japonicum\u003c/em\u003e) can lead to liver fibrosis. The activation of hepatic stellate cells (HSCs) is a crucial phase in the development of liver fibrosis, and inhibiting their activation can alleviate this progression. Total Flavonoids of Litchi Seed (TFL) is a naturally extracted drug, and modern pharmacological studies have shown its anti-fibrotic and liver-protective effects. However, the role of TFL in schistosomiasis liver fibrosis still unclear. This study investigates the functions of TFL on liver fibrosis caused by \u003cem\u003eS. japonicum\u003c/em\u003e infection and explores its potential mechanisms.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods:\u003c/strong\u003e \u003cem\u003eS. japonicum\u003c/em\u003e-induced murine models were generated by abdominal infection with 20 cercariae. The mice were divided into an infection group and a treatment group. The treatment group were treated with TFL (300 and 450 mg/kg). Inflammatory-related cytokines were measured using the Enzyme-Linked Immunosorbent Assay (ELISA) method. Hematoxylin and Eosin (H\u0026amp;E) and Masson's trichrome staining were used to observe pathological changes in the liver. Immunohistochemistry was employed to detect the expressions of α-Smooth Muscle Actin (α-SMA), Collagen I, and Collagen III in the liver tissues. For the cell experiments, a model of HSCs activation induced by Transforming Growth Factor-β1 (TGF-β1) was established, and the effects of TFL on the activation of HSCs were examined using qPCR.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults\u003c/strong\u003e TFL significantly reduced the levels of Interleukin-1β (IL-1β), Tumor Necrosis Factor-α (TNF-α), and Interleukin-6 (IL-6) in the serum of \u003cem\u003eS. japonicum\u003c/em\u003e infected mice. TFL reduced the liver and spleen index of mice and markedly improved the pathological changes in liver tissues induced by \u003cem\u003eSj\u003c/em\u003e, decreasing the expression of α-SMA, Collagen I protein and Collagen III protein in liver tissues. In vitro studies indicated that TFL apparently inhibited the activation of HCSs induced by TGF-β1 and reduced the levels of α-SMA.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion\u003c/strong\u003e TFL could alleviate granulomatous lesions and improve liver fibrosis caused by \u003cem\u003eS. japonicum\u003c/em\u003e by inhibiting the activation of HSCs.\u003c/p\u003e","manuscriptTitle":"Total Flavonoids of Litchi Seed alleviates schistosomiasis liver fibrosis by suppressing hepatic stellate cells activation","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-11-30 18:35:59","doi":"10.21203/rs.3.rs-3673443/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"ba0dfa6c-acd8-4cf6-9324-ee6a3b677e96","owner":[],"postedDate":"November 30th, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2023-12-08T16:30:02+00:00","versionOfRecord":[],"versionCreatedAt":"2023-11-30 18:35:59","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3673443","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3673443","identity":"rs-3673443","version":["v1"]},"buildId":"_2-kVJe1T_tPrBINL-cwx","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00
unpaywall
last seen: 2026-05-21T05:10:58.409756+00:00
License: CC-BY-4.0