Overexpression of BNIP3 in renal carcinoma cells can promote apoptosis of renal carcinoma cells through HIF-1α-BNIP3-mediated autophagy

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

Abstract This research aimed to examine the function of BNIP3(BCL2/adenovirus E1B 19 kDa interacting protein 3) overexpression in mediating autophagy and promoting apoptosis in renal cell carcinoma (RCC) and its possible molecular mechanism. The expressions of BNIP3 mRNA, BNIP3 and HIF-1α proteins in A498, 786-O, CAKI-1, ACHN, and GRC were detected by RT-qPCR (real-time quantitative polymerase chain reaction) and Western Blot, respectively. BNIP3 was overexpressed using pcDNA-BNIP3. The effects of overexpression of BNIP3 on the proliferation, invasion, and apoptosis of RCC cells was examined through various techniques including CCK-8 assay (cell counting kit-8), cloning assays, Transwell migration assays, flow cytometry analysis, and Western Blot analysis. The interaction between BNIP3, Beclin1, and BCL-2 was assessed using co-immunoprecipitation to determine their binding affinity. Immunofluorescence, transmission electron microscopy, ELISA and Western Blot were used to study the effect of BNIP3 overexpression on autophagy in RCC under normal and hypoxia conditions. The flow cytometry and Western Blot techniques were employed to assess the RCC apoptosis following administration of the autophagy inhibitor 3-MA. The impact of BNIP3 overexpression on RCC growth was measured in vitro. Subcutaneous tumor xenograft experiments were conducted by injecting 786-O cells into BALB/c nude mice. The size and weight of xenograft tumors were measured. HE staining and immunohistochemistry to analyze the cell morphology and the expression of BNIP3 and Ki67 proteins in tumors. TUNEL staining was used to observe tumor cell apoptosis. LC3-Ⅱ/Ⅰ, p62, caspase3, cleaved caspase3, and Bax proteins expression were detected by Western blot. The results showed that BNIP3 overexpressed RCC proliferation activity and invasion ability decreased, and apoptosis ability increased. Under hypoxic conditions, the activation of RCC autophagy was induced by BNIP3 through its ability to disrupt the interaction between BCL-2 and Beclin1. Activation of autophagy induced by BNIP3 was found to promote apoptosis in RCC cells, thereby expediting the progression of tumorigenesis in vivo. Collectively, these findings provide evidence for the suppressive impact of BNIP3 overexpression on tumor growth in hypoxic conditions by inducing autophagy and facilitating apoptosis in RCC cells. Moreover, this study identifies potential targets for therapeutic interventions against RCC.
Full text 131,345 characters · extracted from preprint-html · click to expand
Overexpression of BNIP3 in renal carcinoma cells can promote apoptosis of renal carcinoma cells through HIF-1α-BNIP3-mediated autophagy | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Overexpression of BNIP3 in renal carcinoma cells can promote apoptosis of renal carcinoma cells through HIF-1α-BNIP3-mediated autophagy Long Huang, Lin Wang, Dan Yuan, Yan Xu, Yu Wang, Kai Yao, Xiao Zhong, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5095557/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract This research aimed to examine the function of BNIP3(BCL2/adenovirus E1B 19 kDa interacting protein 3) overexpression in mediating autophagy and promoting apoptosis in renal cell carcinoma (RCC) and its possible molecular mechanism. The expressions of BNIP3 mRNA, BNIP3 and HIF-1α proteins in A498, 786-O, CAKI-1, ACHN, and GRC were detected by RT-qPCR (real-time quantitative polymerase chain reaction) and Western Blot, respectively. BNIP3 was overexpressed using pcDNA-BNIP3. The effects of overexpression of BNIP3 on the proliferation, invasion, and apoptosis of RCC cells was examined through various techniques including CCK-8 assay (cell counting kit-8), cloning assays, Transwell migration assays, flow cytometry analysis, and Western Blot analysis. The interaction between BNIP3, Beclin1, and BCL-2 was assessed using co-immunoprecipitation to determine their binding affinity. Immunofluorescence, transmission electron microscopy, ELISA and Western Blot were used to study the effect of BNIP3 overexpression on autophagy in RCC under normal and hypoxia conditions. The flow cytometry and Western Blot techniques were employed to assess the RCC apoptosis following administration of the autophagy inhibitor 3-MA. The impact of BNIP3 overexpression on RCC growth was measured in vitro. Subcutaneous tumor xenograft experiments were conducted by injecting 786-O cells into BALB/c nude mice. The size and weight of xenograft tumors were measured. HE staining and immunohistochemistry to analyze the cell morphology and the expression of BNIP3 and Ki67 proteins in tumors. TUNEL staining was used to observe tumor cell apoptosis. LC3-Ⅱ/Ⅰ, p62, caspase3, cleaved caspase3, and Bax proteins expression were detected by Western blot. The results showed that BNIP3 overexpressed RCC proliferation activity and invasion ability decreased, and apoptosis ability increased. Under hypoxic conditions, the activation of RCC autophagy was induced by BNIP3 through its ability to disrupt the interaction between BCL-2 and Beclin1. Activation of autophagy induced by BNIP3 was found to promote apoptosis in RCC cells, thereby expediting the progression of tumorigenesis in vivo. Collectively, these findings provide evidence for the suppressive impact of BNIP3 overexpression on tumor growth in hypoxic conditions by inducing autophagy and facilitating apoptosis in RCC cells. Moreover, this study identifies potential targets for therapeutic interventions against RCC. Health sciences/Urology Health sciences/Oncology/Cancer/Urological cancer/Renal cancer Health sciences/Oncology/Cancer/Cancer genomics Renal cell carcinoma BNIP3 B-cell lymphoma-2 HIF-1α autophagy apoptosis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Kidney cancer is a prevalent form of malignant neoplasm, accounting for approximately 3–5% of all adult malignant tumors. Its incidence rate ranks second among male urological malignancies, following only prostate and bladder cancers, with a notably higher prevalence in males compared to females 1 , 2 . Kidney cancer, which has imposed a significant burden on the health and well-being of individuals globally, currently has an undefined etiology, with smoking, obesity, and hypertension acknowledged as established risk factors 3 , 4 . Histologically, renal cell carcinoma (RCC) accounts for the vast majority (90%) of kidney cancer cases, mainly including clear cell renal carcinoma (70%), papillary renal cell carcinoma (10%~15%), and chromophobe renal cell carcinoma (5%) 5 . Nephrectomy alone is an ineffective treatment, so systemic therapy is imperative for these advanced and metastatic kidney cancers 6 . Therefore, there is a need for a deeper understanding of the molecular biological basis of renal cell carcinoma providing new goals for the purpose of diagnosis and treatment of clear cell renal carcinoma. Hence, it is imperative to investigate the mechanisms underlying the progression of renal cell carcinoma and discover novel targets for therapeutic intervention. BNIP3, a protein involved in promoting cell death, is subject to regulation by hypoxia-inducible factor 1 (HIF-1) 7 . Under hypoxic circumstances, BNIP3 could potentially be activated by HIF and subsequently play a role in hypoxia-induced cell death via mechanisms like apoptosis, necrosis, and autophagy 8 . It has been pointed out that upregulation of BNIP3 can trigger autophagy 9 . BNIP3, via its BH3 domain, exhibits competitive interaction with binding sites on BCL-2 proteins, thereby facilitating the liberation of Beclin-1 molecules 10 . Under hypoxia conditions, this process initiates the autophagy mechanism, which in turn affects the survival state of cells. Autophagy is a highly conserved process that maintains cell homeostasis during evolution, which has a two-sided effect on tumorigenesis and development: on the one hand, autophagy can improve the tolerance of tumor cells to external stress; conversely, triggering autophagy may lead to the promotion of tumor cell death, thereby inhibiting the growth of tumor cells 11 – 13 . By affecting the expression of autophagy signaling pathway-related proteins, the programmed cell death of cancerous cells can be regulated, and the proliferation of tumor cells can be inhibited 14 . In the current study of RCC, the improvement in autophagy has an inhibitory effect on the malignant biological behavior of tumors 15 . Based on the previous findings of this study, the expression level of BNIP3 is low in kidney cancer cell lines 8 , and based on this, this project intends to construct BNIP3-overexpressing kidney cancer cells to explore whether HIF can interact with BNIP3 to mediate the occurrence of autophagy and affect the growth and programmed cell death of malignant cells. Materials and Methods Cell culture and transfection Human RCC cell lines A498, 786-O, CAKI-1, ACHN, and GRC were purchased from KeyGEN Company (Nanjing, China). Cells were cultured in Roswell Park Memorial Institute (RPMI) medium using 1640 complete medium (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA). Under hypoxic conditions, the cells were placed in a 3131 Thermo Forma Water-Jacketed CO 2 incubator and exposed to a gas mixture consisting of 1% oxygen, 5% CO 2 , and 94% N 2 for 48 hours. PCR was employed to enhance the entire coding segment of BNIP3. The DNA segment was incorporated into the pcDNA3.1 vector (Invitrogen, USA) to produce pcDNA3.1-BNIP3 (pc-BNIP3). An unoccupied pcDNA3.1 vector was employed as a reference (pc-NC) for transfection objectives. Cell transfection was carried out using Lipofectamine® 2000 transfection reagent (Invitrogen, USA). A498 and 786-O cells were seeded into 6 well plates and transfected when they reached a confluence of 70%-80%. To overexpress genes, pc-BNIP3 (2 µg/well) or pc-NC (2 µg/well) along with the transfection reagent (12 µL/well) were mixed separately in serum-free Opti-MEM for 5 minutes. The diluted plasmid and transfection reagent were then combined and incubated at 37°C for half an hour. The resulting mixture was added to the cell culture medium, followed by replacement with fresh RPMI 1640 after six hours of transfection. Culture continued for another two days thereafter. A498 and 786-O cells were divided into 6 groups: OE-NC (pc-NC); OE-BNIP3 (pc-BNIP3); OE-NC Normoxia; OE-NC Hypoxia; OE-BNIP3 Normoxia; OE-BNIP3 Hypoxia. A498 and 786-O cells were subjected to an additional experiment involving the introduction of pc-BNIP3, either with or without 3-MA, an autophagy inhibitor, and cultured under hypoxia (OE-BNIP3 + 3-MA Normoxia and OE-BNIP3 + 3-MA Hypoxia groups). Each experiment was performed in triplicate. Real-time fluorescent quantitative polymerase chain reaction (RT-qPCR) assay The Trizol Total RNA Extraction Kit (9108, TaKaRa, Japan) was utilized to extract the total cellular RNA, followed by reverse transcription into cDNA using the Reverse Transcription Kit (2690S, TaKaRa, Japan). SYBR Premix Ex TaqTM II kit (RR037Q, TaKaRa, Japan) was used for real-time fluorescence quantification. The real-time qPCR system was performed in a 20 µL system under the conditions of 95°C for 30s pre-denaturation, 95°C for 5s, 55°C for 30s, 45 cycles, and 72°C for 30s extension. The comparative CT method (2 − ddCT method) was used to calculate BNIP3 and HIF-1α mRNA expression with β-actin as the internal reference control. Primers were designed using Primer 5.0 Fast software and the sequences are shown in Table 1 as follows. Table 1 Primers used in this study Primer forward primer(5’→3’) reverse primer(5’→3’) β-actin tgacttcaacagcgacaccca caccctgttgctgtagccaaa BNIP3 agggctcctgggtagaact ctccattataaatagaaaccgaggc HIF-1α tgctcatcagttgccacttccac caccagcatccagaagtttcctcac Cell Counting Kit-8 (CCK-8) assay Cell proliferation was quantified with the Cell CCK-8 kit (BS350B, Biosharp, Shanghai, China), following the manufacturer's guidelines. The renal carcinoma cells that underwent transfection were plated and left to incubate for a duration of 24 hours. Following this, 10 µL of CCK-8 reagent was added to each well, extending the incubation for three hours. Absorbance at 450 nm was then measured using a microplate reader (ELx800, Buchi Instruments, USA). Cell Cloning assay Cells were transfected using a lentiviral vector overexpressing BNIP3. The BNIP3 overexpression lentiviral vector was purchased from GeneChem (Shanghai, China). The cell concentration was adjusted to 2 × 10 5 /mL 100 µL of cell suspension was inoculated into each well and the culture medium was replenished. The cells were mixed well and incubated until clones were visible. When clones first became visible, the culture medium was disposed of and the plate was rinsed with PBS. The cells were treated with a 4% volume of polymethanol for a duration of 30 minutes and subjected to staining using a solution containing 0.1% crystal violet for a period of 15 minutes. The plate was dried after removing the staining solution. Photographs were taken, images were recorded, the number of clones visible was counted, and the results were analyzed. Transwell assay After trypsin digestion of transfected cells, a 1 × 10 5 cells/mL concentration was achieved with the medium. Before the experiment, matrix gels were preincubated in Transwell chambers at 37°C for 3 hours. Post-solidification of the Matrigel, serum-free medium was replenished. A cell suspension was then added to Transwell chambers in a 24-well plate, with culture solution outside. The Transwell was washed with PBS after 24 hours of incubation. Fixation was performed using 4% paraformaldehyde, followed by crystal violet staining for 30 minutes. Six random visual fields were selected from each well, and the number of invasive cells was observed with a light microscopic camera system (DMI1, LEICA, Germany). Apoptosis assay The A498 and 786-O cells in the logarithmic growth phase were inoculated into 12-well plates at a density of 1×10 5 cells per well. Once the cells had adhered to the plate, transfection or intervention was carried out. After 48 hours, all cells from the 6-well plates were collected and washed with PBS to eliminate any background interference. The cells were then resuspended in 100 µl of 1×Binding Buffer and incubated with AnnexinV-FITC and PE-PI dual fluorescent probes (KGA1107, KeyGEN, China) for a duration of 15 minutes at room temperature under light protection. Subsequently, the samples were immediately analyzed using flow cytometry (Cytoflex, Beckman Coulter, USA) through the FITC/PI channel to determine the percentage of apoptotic cells. Western blot analysis The extraction of total protein from tissues and cells involved the use of lysis buffer, followed by a 30-minute incubation on ice to collect the cells. The supernatant was collected, and the protein concentration was determined by the BCA (P0009, Beyotime, Shanghai, China) method. A 30 µg protein sample was taken and denatured in a boiling water bath and uploaded, proteins were separated by 10% SDS-PAGE and transferred to a PVDF membrane (ISEQ00010, Sigma-Aldrich, USA), and blocked with 5% skimmed milk for 1h at room temperature. The BNIP3 antibody (1:1000, A19593, ABclonal, USA), HIF-1α antibody (1:1000, A7684, ABclonal, USA), caspase3 antibody (1:500, 9662, Cell Signaling Technology, USA), cleaved caspase3 antibody (1:1000, 9661, Cell Signaling Technology, USA), Bax antibody (1:1000, A0207, ABclonal, USA), LC3B antibody (1:1000, A19665, ABclonal, USA), p62 antibody (1:1000, A19700, ABclonal, USA), and β-actin antibody (1:50000, AC026, ABclonal, USA) were incubated at 4°C overnight. The membrane was washed 3 times with TBST, incubated with HRP-labeled secondary antibody (1:7000, S0001, Affbiotech, Jiangsu, China) for 1h at room temperature, washed 3 times with TBST, and developed dropwise with a chemiluminescent solution. Quantitative analysis was performed using Image-ProPlus 6.0 software. Co-immunoprecipitation(Co-IP) Pretreated cells were lysed in a lysis buffer containing 50 mM Tris-HCl (pH 7.5), 100 mM NaCl, 1% Triton X-100, 0.1 mM EDTA, 0.5 mM MgCl 2 , and supplemented with 10% glycerol, protease inhibitor cocktail (Roche), phosphatase inhibitor cocktail (Roche), and 10 µM pervanadate (NEB). The cell lysates were incubated with Bc1-2 antibody (diluted at a ratio of 1:50; A0208, ABclonal, USA) for one hour at a temperature of 4°C followed by overnight incubation with Protein-A/G Sepharose beads (Abcam, UK) also at a temperature of 4°C. The agarose beads were then collected through centrifugation at a speed of 500 g for five minutes. Subsequently, the beads were thoroughly washed three times in the lysis buffer and heated to a temperature of 95°C for five minutes. Finally, proteins were probed using antibodies against Beclin1(1:30, A7353, ABclonal, USA) and BNIP3 (1:30, A19593, ABclonal, USA). Immunofluorescence staining The cell crawl sections were stained. The sections were immersed in 5% film breaker for 10 min. After PBS washing, goat serum sealing solution was added and sealed for 20 minutes at room temperature. Primary antibodies (1:100, LC3B, 14600-1-AP, Proteintech, USA) were added and incubated overnight at 4°C. After washing again with PBS, the second antibody (1:100, FITC-labeled goat anti-rabbit, GB22303, Servicebio, Wuhan, China) was added and incubated for 30 min. After washing with PBS, 4’,6-diamidino-2-phenylindole (DAPI) was added and incubated. After a final wash with PBS, the slices were sealed with an anti-fluorescence attenuating sealer. The images were a3-MAuired using a microscopic camera system (OlyVIA, OLYMPUS, Tokyo, Japan). The fluorescence intensity and area of all images were measured using ImageJ6 (National Institutes of Health, Bethesda, MD, USA), and the mean fluorescence intensity of each image was calculated. Flow cytometry for ROS A498 and 786-O cells were cultured in 6-well plates, and a total of 1 × 10 5 cells from each group underwent two washes with PBS. The cells were then loaded with probes, resulting in a suspension containing 5 mol/L DCFH-DA (MCE). After incubating for 30 minutes at 37°C in the absence of light, the cells were washed twice with PBS. The fluorescence intensity detected using the FITC channel was utilized to quantify the variations in ROS levels among different experimental groups. Tumor xenograft assay Twelve 6-week-old BALB/c nude mice (18 ~ 22 g) were used for subcutaneous tumor xenograft experiments. The animals in this study were purchased from Chengdu Dashuo Experimental Animal Co., Ltd. (Chengdu, China) (SCXK(Chuan)2019-031). BALB/c nude mice were randomly divided into two groups (OE-NC group and OE-BNIP3 group, n = 6). In the subcutaneous carcinogenic experiment, the right axillas of nude mice in the OE-NC group and OE-BNIP3 group were subcutaneously injected with stably transfected pcDNA-NC 786-O and pcDNA-BNIP3 786-O cells. The density of 786-O cells was adjusted to 1.0 × 10 6 cells /mL, and the right axillary side of nude mice was injected subcutaneously to construct tumorigenesis of nude mice for 30 days. Starting on day 20, the tumor volume was measured every 3 days for a total of 10 measurements. After 26 days, the mice were anesthetized (sodium pentobarbital, 100 mg/kg, 200-323-9, Sigma-Aldrich, St. Louis, MO, USA) and sacrificed via cervical dislocation, and all 12 subcutaneous tumors were isolated and weighed. Tumor tissue was then stored in a − 80°C freezer for subsequent studies. The Ethics Committee of 363 Hospital (IRB number: 2022035) approved all experimental protocols conducted in this study. Hematoxylin and eosin (H&E) staining assay After completing the experiment, the mice were sacrificed, and part of the tumor tissue was collected, fixed with 4% paraformaldehyde, embedded in paraffin, and sectioned at 4 µm. After dewaxing and rehydration, the histological morphology was observed with hematoxylin-eosin (H&E, C0105M, Beyotime, Shanghai, China) staining. Transmission electron microscopy (TEM) analysis Tumor tissue samples of mice in each group were fixed with 5% glutaraldehyde for up to 5 hours. After fixation, samples were washed three separate times using neutral phosphate buffer, each wash lasting 10 min intervals. Brain tissue samples were fixed with 0.1 mol/L osmic acid for 3 h and washed three times with phosphate buffer, every 10 min. Gradient dehydration was then performed at 50%, 70%, 80%, 90%, 95%, and 100% alcohol concentrations every 15 minutes. The tissue blocks were embedded in resin for ultrathin sectioning (50 ~ 70nm), and then stained with uranyl acetate (1261209, SPI), and the ultrastructure of cells and autophagy were observed under a transmission electron microscope. Terminal deoxynucleotidyl transferase (TdT) dUTP Nick-End Labeling (TUNEL) assay TUNEL (Terminal deoxynucleotide transferase (TdT) dUTP notch terminal marker) was used to detect apoptosis in tumor tissue cells. Paraffin sections were dewaxed and hydrated with PBS 3 times. The remaining steps of the procedure are conducted by the TUNEL kit (1168479590, Roche Group). Cells with green nuclei under the light microscope were apoptotic positive cells. Three regions were randomly selected from each mouse brain tissue section, and the number of positive cells was used as the apoptotic index. Immunohistochemical experiment After the standard preparation of tumor tissue sections, antigen retrieval was performed using citrate buffers followed by treatment with 3% hydrogen peroxide to suppress endogenous peroxidase activity. Afterward, the sections were securely closed using serum derived from goats (AR1009, BOSTER) and incubated overnight with primary antibodies of BNIP3 (1:400, bs-4239R, Bioss, USA) and Ki67 (1:400, HA721115, HUABIO, Shanghai, China) at 4°C, followed by another round of PBS washing. A secondary antibody (1:100, GB22303, Servicebio, Shanghai, China) was added and incubated at 37℃ for 30 min. Tissues were visualized using a DAB (36201ES03, YEASEN) staining solution, and hematoxylin restaining was performed before dehydration and sealing. Image analysis was performed using a digital trimoscope (BA210Digital, Meiji Technology Co., LTD., China) and a data image analysis system (Halo 101-WL-HALO-1, Indica Labs, USA). Statistical Analysis The statistical analysis was conducted using GraphPad Prism 9.0 software. The mean ( ) ± standard mean (SD) were used to represent the experimental statistics. To compare multiple groups, a one-way analysis of variance (ANOVA) was employed, and statistical analysis was performed post hoc by Tukey. The T-test was used for comparison between the two groups. P < 0.05 was statistically significant. Results Expression of BNIP3 and HIF-1α in renal cell carcinoma cell lines Initially, we investigated the protein expression of BNIP3 and HIF-1α in renal cell carcinoma cell lines A498, 786-O, CAKI-1, ACHN, and GRC. As depicted in Fig. 1 A, elevated levels of BNIP3 and HIF-1α were observed in CAKI-1, ACHN, and GRC, whereas these proteins exhibited minimal expression in A498 and 786-O. Consequently, A498 and 786-O were chosen as the subjects of investigation. WB and RT PCR were used to detect the expression of BNIP3 protein and mRNA in A498 and 786-O cells with overexpression of BNIP3. As shown in Figs. 1 B and C, the level of BNIP3 protein expression was notably elevated in the OE BNIP3 group (BNIP3 expression group) compared to the OE-NC group (negative control group). Furthermore, BNIP3 mRNA was significantly increased in the OE BNIP3 group compared to the OE-NC group ( P < 0.01) (Fig. 1 D). Effect of overexpression of BNIP3 on the proliferation, invasion, and apoptosis of renal cell carcinoma cells A498 and 786-O cells were transfected and divided into the OE-NC and OE-BNIP3 groups. According to the data presented in Fig. 2 A, there was a significant decrease in the proliferative activity of the OE-BNIP3 cells compared to that of the OE-NC group. We obtained comparable findings from the cell cloning assay, with the number of clones formed by A498 and 786-O cells in the OE-BNIP3 group being significantly less than that in the OE-NC group ( P < 0.01) (Fig. 2 B, C). Furthermore, the Transwell invasion assay indicated that the OE-BNIP3 group had a significantly lower number of A498 and 786-O cells crossing the Transwell compartment than the OE-NC group ( P < 0.01) (Fig. 2 D, E). Flow cytometry showed that OE-BNIP3 had increased A498 and 786-O cell death compared to OE-NC ( P < 0.01) (Fig. 2 F, G). In addition, OE-BNIP3 increased the expression of caspase3, cleaved caspase3, and Bax compared with OE-NC (Fig. 2 H–K). Based on the above results, overexpression of BNIP3 suppressed the proliferation and invasion and promoted apoptosis in renal cell carcinoma cells. Overexpression of BNIP3 promotes the dissociation of the Bcl-2/Beclin1 complex through competitive binding of Bcl-2 under hypoxia conditions In the following step, our objective is to determine whether the overexpression of BNIP3 can definitively bind to BCL-2 and induce the dissociation of Beclin-1 from Bcl-2. By performing co-immunoprecipitation experiments, we successfully co-precipitated Bcl-2. Analysis using the Western Blot technique demonstrated that under hypoxic conditions, BNIP3 overexpression significantly increased the co-precipitation of Bcl-2 with BNIP3, while simultaneously reducing the co-precipitation of Bcl-2 with Beclin1 (refer to Fig. 3 A, B). This indicates an enhanced binding capacity between BNIP3 and Bcl-2, and a weakened binding capacity between Bcl-2 and Beclin1. This change led to the dissociation of the Bcl-2/Beclin1 complex, thereby promoting the process of protective autophagy in RCC cells under hypoxic conditions. Overexpression of BNIP3 promotes autophagy and mitochondrial damage in renal carcinoma cells under hypoxia To explore the effect of overexpression of BNIP3 on autophagy under hypoxia. LC3B is a key protein involved in autophagy and is crucial in regulating cellular processes and responses to stress. The results of immunofluorescence staining confirmed that A498 and 786-O cells exposed to hypoxia exhibited elevated levels of LC3B compared to those cultured under normoxic conditions. Moreover, additional treatment with OE-BNIP3 further enhanced the effects induced by hypoxia. (Fig. 4 A and B). In the context of TEM analysis, it was observed that the number of autophagosomes in A498 and 786-O cells exhibited an elevation upon undergoing hypoxia treatment. Notably, the augmentation in the count of autophagosomes was more pronounced in cells that had undergone BNIP3 overexpression (Fig. 4 C). Western blot analysis revealed that when compared to A498 and 786-O cells under normoxic conditions, the expression of p62 in 786-O cells under hypoxic conditions experienced a decrease, and the ratio of LC3-II to LC3-I exhibited an elevation in A498 and 786-O cells. However, the presence of BNIP3 overexpression contributed to the facilitation of these hypoxia-induced effects (Figure. 4D-F). Under hypoxia conditions, ROS levels increased in A498 and 786-O cells, and overexpression of BNIP3 increased ROS levels compared to the OE-NC hypoxia and the OE-BNIP3 normoxia groups ( P < 0.01) (Fig. 4 G and H). Additionally, under hypoxic conditions, the extent of mitochondrial damage was exacerbated in A498 and 786-O cells, and this damage was further exacerbated upon transfection with BNIP3 overexpression (Fig. 4 I). Overexpression of BNIP3 promotes apoptosis of renal cancer cells by mediating autophagy under hypoxia To explore the effect of autophagy inhibitor 3-MA combined with OE-BNIP3 on apoptosis of renal cell carcinoma cells by mediating autophagy under hypoxia conditions. Flow cytometry results showed that BNIP3 overexpression promoted apoptosis in A498 and 786-O cells under hypoxic conditions, and the addition of autophagy inhibitor 3-MA could inhibit this promotion and reduce apoptosis (Fig. 5 A and B). As shown in Fig. 5 C and D, ROS production is more likely to be promoted by BNIP3 overexpression in a hypoxic environment, and the autophagy inhibitor 3-MA can effectively inhibit this promoting effect. The findings from WB analysis indicated that the level of expression for autophagy-related regulator LC3-II /LC3-I increased and p62 protein decreased in the OE-BNIP3 hypoxic group. In contrast, the addition of autophagy regulator 3-MA reversed the expression of LC3-II /LC3-I and p62 proteins (Fig. 5 E–G). For the increase of the protein expression associated with programmed cell death cleaved caspase3 and Bax in the OE-BNIP3 hypoxic group, the addition of autophagy regulator 3-MA had a certain inhibitory effect, and the protein expression of cleaved caspase3 and Bax in the OE-BNIP3 + 3-MA hypoxic group decreased (Fig. 5 E and H-J). Based on the above results, it was found that BNIP3 overexpression promoted the apoptosis of renal cancer cells by mediating autophagy under hypoxic conditions. Overexpression of BNIP3 inhibits tumor growth in tumor-bearing mice After 26 days, the mice were euthanized under anesthesia via cervical dislocation, and all 12 subcutaneous tumors were removed and their weights were measured (Fig. 6 A). The tumor sizes in each group of mice were measured. The OE-NC group experienced a significantly faster increase in tumor volume (Fig. 6 B). Upon completion of the experiments, the dissected and isolated tumors were weighed. In comparison to the OE-NC group (Fig. 6 C), the OE-BNIP3 group showed notably reduced tumor volume. Meanwhile, the OE-BNIP3 group exhibited significantly reduced levels of Ki67 expression in tumor tissues compared to the OE-NC group (Fig. 6 D, and E). The Tunel staining technique was employed to assess tumor cell apoptosis, revealing a significant increase in apoptosis within the OE-BNIP3 group (Fig. 6 F, and G). In addition, the protein expression levels of LC3-II/LC3-I, caspase 3, cleaved caspase 3, and Bax were found to be significantly elevated in the OE-BNIP3 group compared to the OE-NC group. Conversely, the protein expression levels of p62 were observed to be lower in the OE-BNIP3 group as compared to the OE-NC group (Fig. 6 H-J). This part of the experiment showed that overexpression of BNIP3 can inhibit tumor growth in vivo and promote the occurrence of autophagy and apoptosis of tumor cells. Discussion RCC arises from the epithelial cells of the renal tubules and is among the frequently occurring malignant tumors within the urinary system, with an incidence about 3% of all malignant tumors and a mortality rate of 30 ~ 40%, ranking first among urinary tract tumors, much higher than bladder cancer and prostate cancer (mortality rate of about 20%) 16,17 . Although targeted therapies (e.g., tyrosine kinase inhibitors, vascular endothelial growth factor inhibitors, and mTOR inhibitors) and new immunotherapy strategies have been applied to some clinical treatments, the heterogeneity of RCC, the relative resistance to radiotherapy and chemotherapy, and other side effects make it difficult to achieve the expected efficacy, so it has become a top priority to explore new treatment strategies and intervention options 18 . BNIP3 (Bcl-2/adenovirus E1B 19KDa interacting protein 3) is a pro-apoptotic member of the Bcl-2 family proteins 19 . There exists a hypoxia response element (HRE) in the gene promoter of BNIP3 and it is directly regulated by the hypoxia-inducible factor (HIF) 20 . The expression of BNIP3 in different tumors is inconsistent 8 . Its high expression in tumors such as lung cancer, prostate cancer, breast cancer, and endometrial cancer is associated with a bleak prognosis for patients diagnosed with tumors. Still, its level of expression is minimal in cases of pancreatic cancer, colorectal cancer, liver cancer, and other tumors, and is associated with drug resistance in tumor patients 21 . Studies have shown that the expression level of BNIP3 in RCC tumor tissues is low, and overexpression of BNIP3 will promote apoptosis and autophagy in RCC cells 22 . On this basis, the expression of BNIP3 protein and mRNA in renal cell carcinoma cell lines A498, 786-O, CAKI-1, ACHN, and GRC was analyzed, and A498 and 786-O cells with lower expression were selected to be transfected with BNIP3 overexpression plasmid to construct overexpressing BNIP3. In this research, the increased expression of BNIP3 resulted in a notable elevation of both BNIP3 protein and mRNA levels. Additionally, the spread and infiltration of cancer cells are defining traits of tumor cells, and the metastasis of tumors is a multifaceted procedure that encompasses cell movement, infiltration, and attachment 23 . The outcomes of this experimental investigation revealed that the overexpression of BNIP3 led to a notable reduction in cell survival and a diminished capacity for both colony formation and cell migration across RCC cell lines, thereby suggesting that BNIP3 overexpression has the potential to suppress the proliferative and metastatic capabilities of renal cancer cells. Moreover, the apoptosis assays demonstrated that the upregulation of BNIP3 significantly accelerated the process of apoptosis in A498 and 786-O cell lines, and concurrently elevated the expression levels of key apoptosis marker proteins, including caspase3, cleaved caspase3, and Bax. Autophagy constitutes a cellular mechanism of self-degradation, wherein lysosomes are employed to break down impaired or unfolded macromolecular components or organelles in response to extrinsic environmental stimuli 24 . The Bcl-2/Beclin1 complex is a major autophagy modulator 25 . The ULK1 complex is required for autophagy initiation, and the assembly of the Bcl-2/Beclin1 complex prevents Beclin-1 from activating ULK1, thereby initiating the autophagy process 26 . Studies have shown that BNIP3 can promote the occurrence of autophagy by releasing Beclin1, which may be related to preventing Bcl-2 from binding to Beclin1 to activate autophagy 27 . Hypoxia is one of the signs of cancer and can induce autophagy in tumor cells 28 . Under hypoxic conditions, the oxygen content in the cells decreases and energy metabolism is affected, at which point autophagy is activated to help the cells cope with energy crises and metabolic stress 29 . In this study, CO-IP experiments showed that the overexpressed BNIP3 competitively binds to Bcl-2 and dissociates Beclin1, triggering autophagy. Hypoxia has been reported to activate autophagy, accompanied by increased BNIP3 expression 10 . This experiment found that the dissociation ability of the Bcl-2/Beclin1 complex was stronger under the promotion of overexpression of BNIP3 under hypoxic conditions, which was consistent with the above conclusions. BNIP3 is a protein localized to the outer membrane of mitochondria, acting as a autophagy receptor, and is thought to be an important signaling molecule for hypoxia-induced autophagy 30 . BNIP3 is a downstream target gene of HIF-1α and can be activated by HIF-1α 31,32 . The HIF-1α/BNIP3 pathway is a key mechanism regulating autophagy, in which HIF-1α plays a key role in hypoxia-induced autophagy, and BNIP3 acts as a direct downstream regulator of HIF-1α under hypoxic conditions, promoting the expression of BNIP3 and thereby inducing the occurrence of autophagy 33 . LC3, a protein associated with microtubules and known as light chain 1 of microtubule-associated protein 1, acts as a marker for autophagy and is present on lysosomal and mitochondrial autophagosome membranes. During autophagy, LC3 protein is cleaved by autophagic protein 4 (Atg4) to produce LC3-I, which is subsequently processed and modified by a ubiquitin-like system to form LC3-II, and the content of LC3-II is directly proportional to the degree of autophagy 34 . BNIP3 can bind directly to LC3 to induce the occurrence of autophagy 35 . Our results suggest that overexpression of BNIP3 under hypoxic conditions induces an increase in LC3B levels, an increase in ROS release, an increase in autophagosomes, an increase in LC3-II protein expression, a decrease in p62 protein expression, and an enhancement of autophagy. In addition, the potential of overexpression of BNIP3 to suppress cancer and promote autophagy has also been demonstrated in nude mice. Apoptosis is the mode of programmed cell death, in which the mitochondrial permeability transition pore (mPTP) opens up and the mitochondrial membrane potential (MMP) decreases when stimulated by intracellular signaling, and mitochondrial damage leads to the activation of autophagy 36 . At the same time, the reduction of MMP can swell the mitochondrial matrix, release cytochrome C and apoptosis-inducing factors into the cytosol, and initiate cysteine aspartate-specific protease (caspase)-dependent or independent apoptosis 37 . The depolarization of MMP is a common process between autophagy and apoptosis initiation, suggesting that there is an internal correlation between the two. Studies have shown that key proteins involved in autophagy, such as PINK1, Parkin, BNIP3, and NIX, are important intermediates of various physiological processes in cells, and the genes encoding these proteins are tumor suppressor genes that promote apoptosis 38 , 39 . In addition, aberrant autophagy can disrupt mitochondrial homeostasis, thereby inducing apoptosis 40 , 41 . In this study, overexpression of BNIP3 promoted apoptosis in kidney cancer cells under hypoxic conditions, while the addition of autophagy inhibitor 3-MA reduced apoptosis, indicating that BNIP3 overexpression promoted apoptosis in cancer cells by mediating autophagy under hypoxic conditions, and autophagy was tumor suppressor. Conclusion In conclusion, our study has demonstrated that the overexpression of BNIP3 effectively suppresses the proliferation, cloning, and migratory capacity of RCC cells while inducing apoptosis. Moreover, overexpression of BNIP3 in hypoxic conditions induces autophagy by disrupting the interaction between BCL-2 and Beclin1, thereby facilitating apoptosis in RCC cells through the regulation of autophagy. Therefore, this study contributes to identifying the impact of BNIP3 overexpression on cell proliferation and apoptosis in hypoxia-induced autophagy in RCC cells, offering a novel therapeutic target for impeding RCC progression. Declarations Competing interests The authors declare no competing interests. Ethics statement All animal experiments were approved by the 363 Hospital Ethics Committee (2022035) and were performed in accordance with relevant guidelines and regulations. All animal research reported in this paper was in accordance with the ARRIVE guidelines. Funding This study was supported by the Research Fund Project of General Technology Group Medical Health Co.LTD. (no. TYYLKYJJ-2022-045), the Medical research project of Chengdu Health Commission (no. 2022219), the Medical research project of 363 Hospital (no. 2021FH028). Author Contribution DL designed the study, guided experiments, carried out analysis and reviewed the manuscript. LH contributed to the study design, performed experiments with cell lines, collected and analyzed data, and wrote the manuscript. LW contributed to the study design, performed experiments (sample collection and cell lines) and wrote the manuscript. DY and YX contributed to the study design, performed experiments of cell lines and reviewed the manuscript. YW and KY participated in the study design, animal experiments, and reviewed the manuscript. XZ, QL, KJ, LL and HW contributed to the study design, helped with sample collection and the preparation of cell lines, analyzed data and reviewed the manuscript. Acknowledgement We would like to thank Professor Xiang Li, Dr Yangxiang Shao, Dr Yaohui Wang and Dr Mengni Zhang for their support with techniques and equipment. Data Availability The datasets used and/or analysed during the current study available from the corresponding author on reasonable request. References Xia, C. et al. Cancer statistics in China and United States, 2022: profiles, trends, and determinants. Chin. Med. J. 135 , 584–590. 10.1097/cm9.0000000000002108 (2022). Siegel, R. L., Giaquinto, A. N., Jemal, A. & Cancer statistics CA: a cancer journal for clinicians 74, 12–49, doi: (2024). 10.3322/caac.21820 (2024). Wang, Z., Wang, L., Wang, S. & Xie, L. Burden of kidney cancer and attributed risk factors in China from 1990 to 2019. Front. public. health . 10 , 1062504. 10.3389/fpubh.2022.1062504 (2022). Scelo, G. & Larose, T. L. Epidemiology and Risk Factors for Kidney Cancer. J. Clin. oncology: official J. Am. Soc. Clin. Oncol. 36 (Jco2018791905). 10.1200/jco.2018.79.1905 (2018). Bukavina, L. et al. Epidemiology of Renal Cell Carcinoma: 2022 Update. Eur. Urol. 82 , 529–542. 10.1016/j.eururo.2022.08.019 (2022). Emberley, E. et al. The glutaminase inhibitor telaglenastat enhances the antitumor activity of signal transduction inhibitors everolimus and cabozantinib in models of renal cell carcinoma. PloS one . 16 , e0259241. 10.1371/journal.pone.0259241 (2021). Koop, E. A. et al. Expression of BNIP3 in invasive breast cancer: correlations with the hypoxic response and clinicopathological features. BMC cancer . 9 , 175. 10.1186/1471-2407-9-175 (2009). Shao, Y. et al. Expression and epigenetic regulatory mechanism of BNIP3 in clear cell renal cell carcinoma. Int. J. Oncol. 54 , 348–360. 10.3892/ijo.2018.4603 (2019). Wang, Y., Han, C., Lu, L., Magliato, S. & Wu, T. Hedgehog signaling pathway regulates autophagy in human hepatocellular carcinoma cells. Hepatol. (Baltimore Md) . 58 , 995–1010. 10.1002/hep.26394 (2013). Bellot, G. et al. Hypoxia-induced autophagy is mediated through hypoxia-inducible factor induction of BNIP3 and BNIP3L via their BH3 domains. Mol. Cell. Biol. 29 , 2570–2581. 10.1128/mcb.00166-09 (2009). Li, L. & Hu, F. Mitophagy in tumor: foe or friend༟. Endokrynologia Polska . 74 , 511–519. 10.5603/ep.95652 (2023). Liu, Y. et al. Caveolin-1 knockdown increases the therapeutic sensitivity of lung cancer to cisplatin-induced apoptosis by repressing Parkin-related mitophagy and activating the ROCK1 pathway. J. Cell. Physiol. 235 , 1197–1208. 10.1002/jcp.29033 (2020). Rao, S. et al. A dual role for autophagy in a murine model of lung cancer. Nat. Commun. 5 , 3056. 10.1038/ncomms4056 (2014). Song, C. et al. A novel perspective for insighting into cancer and cancer treatment. Cell Prolif. 55 , e13327. 10.1111/cpr.13327 (2022). Concolino, G. et al. Human renal cell carcinoma as a hormone-dependent tumor. Cancer Res. 38 , 4340–4344 (1978). Yamamoto, H. et al. The Intrinsically Disordered Protein Atg13 Mediates Supramolecular Assembly of Autophagy Initiation Complexes. Dev. Cell . 38 , 86–99. 10.1016/j.devcel.2016.06.015 (2016). Li, Z. & Nakatogawa, H. Degradation of nuclear components via different autophagy pathways. Trends Cell Biol. 32 , 574–584. 10.1016/j.tcb.2021.12.008 (2022). Taheriazam, A. et al. Graphene oxide nanoarchitectures in cancer biology: Nano-modulators of autophagy and apoptosis. J. controlled release: official J. Controlled Release Soc. 354 , 503–522. 10.1016/j.jconrel.2023.01.028 (2023). Cai, Y., Liu, Y., Yu, D. & Zhang, X. Down-regulation of transcription of the proapoptotic gene BNip3 in cultured astrocytes by murine coronavirus infection. Virology . 316 , 104–115. 10.1016/j.virol.2003.07.007 (2003). Kothari, S. et al. BNIP3 plays a role in hypoxic cell death in human epithelial cells that is inhibited by growth factors EGF and IGF. Oncogene . 22 , 4734–4744. 10.1038/sj.onc.1206666 (2003). Burton, T. R. & Gibson, S. B. The role of Bcl-2 family member BNIP3 in cell death and disease: NIPping at the heels of cell death. Cell Death Differ. 16 , 515–523. 10.1038/cdd.2008.185 (2009). Wang, X. et al. Increased expression of PSME2 is associated with clear cell renal cell carcinoma invasion by regulating BNIP3–mediated autophagy. Int. J. Oncol. 59 10.3892/ijo.2021.5286 (2021). Zhang, Q. et al. MYT1L promotes the migration and invasion of glioma cells through activation of Notch signaling pathway. ScienceAsia . 48 , 711. 10.2306/scienceasia1513-1874.2022.100 (2022). Wang, C. et al. Phosphorylation of ULK1 affects autophagosome fusion and links chaperone-mediated autophagy to macroautophagy. Nat. Commun. 9 , 3492. 10.1038/s41467-018-05449-1 (2018). Dong, X. et al. Novel Bcl-2 Inhibitors Selectively Disrupt the Autophagy-Specific Bcl-2-Beclin 1 Protein-Protein Interaction. ACS Med. Chem. Lett. 13 , 1510–1516. 10.1021/acsmedchemlett.2c00309 (2022). You, F. F. et al. ATG 4B Serves a Crucial Role in RCE-4-Induced Inhibition of the Bcl-2-Beclin 1 Complex in Cervical Cancer Ca Ski Cells. Int. J. Mol. Sci. 22 10.3390/ijms222212302 (2021). Lin, Y. F. et al. The role of hypoxia-inducible factor-1α in zinc oxide nanoparticle-induced nephrotoxicity in vitro and in vivo. Part. Fibre Toxicol. 13 10.1186/s12989-016-0163-3 (2016). Multhoff, G. & Vaupel, P. Hypoxia Compromises Anti-Cancer Immune Responses. Adv. Exp. Med. Biol. 1232 , 131–143. 10.1007/978-3-030-34461-0_18 (2020). Zhang, G., Xu, Z., Yu, M. & Gao, H. Bcl-2 interacting protein 3 (BNIP3) promotes tumor growth in breast cancer under hypoxic conditions through an autophagy-dependent pathway. Bioengineered . 13 , 6280–6292. 10.1080/21655979.2022.2036399 (2022). Wang, X., Ma, S. & Qi, G. Effect of hypoxia-inducible factor 1-alpha on hypoxia/reoxygenation-induced apoptosis in primary neonatal rat cardiomyocytes. Biochem. Biophys. Res. Commun. 417 , 1227–1234. 10.1016/j.bbrc.2011.12.115 (2012). Yang, L. et al. Deferoxamine Treatment Combined With Sevoflurane Postconditioning Attenuates Myocardial Ischemia-Reperfusion Injury by Restoring HIF-1/BNIP3-Mediated Mitochondrial Autophagy in GK Rats. Front. Pharmacol. 11 , 6. 10.3389/fphar.2020.00006 (2020). Jimenez, R. E., Kubli, D. A. & Gustafsson, Å. Autophagy and mitophagy in the myocardium: therapeutic potential and concerns. Br. J. Pharmacol. 171 , 1907–1916. 10.1111/bph.12477 (2014). Mazure, N. M. & Pouysségur, J. Hypoxia-induced autophagy: cell death or cell survival? Curr. Opin. Cell Biol. 22 , 177–180. 10.1016/j.ceb.2009.11.015 (2010). Kang, R., Zeh, H. J., Lotze, M. T. & Tang, D. The Beclin 1 network regulates autophagy and apoptosis. Cell Death Differ. 18 , 571–580. 10.1038/cdd.2010.191 (2011). Hanna, R. A. et al. Microtubule-associated protein 1 light chain 3 (LC3) interacts with Bnip3 protein to selectively remove endoplasmic reticulum and mitochondria via autophagy. J. Biol. Chem. 287 , 19094–19104. 10.1074/jbc.M111.322933 (2012). Lemasters, J. J. Selective mitochondrial autophagy, or mitophagy, as a targeted defense against oxidative stress, mitochondrial dysfunction, and aging. Rejuven. Res. 8 , 3–5. 10.1089/rej.2005.8.3 (2005). Bernardi, P. et al. The mitochondrial permeability transition from in vitro artifact to disease target. FEBS J. 273 , 2077–2099. 10.1111/j.1742-4658.2006.05213.x (2006). Chourasia, A. H. et al. Mitophagy defects arising from BNip3 loss promote mammary tumor progression to metastasis. EMBO Rep. 16 , 1145–1163. 10.15252/embr.201540759 (2015). O'Flanagan, C. H. & O'Neill, C. PINK1 signalling in cancer biology. Biochim. Biophys. Acta . 1846 , 590–598. 10.1016/j.bbcan.2014.10.006 (2014). Chen, Y. et al. Ketoconazole exacerbates mitophagy to induce apoptosis by downregulating cyclooxygenase-2 in hepatocellular carcinoma. J. Hepatol. 70 , 66–77. 10.1016/j.jhep.2018.09.022 (2019). Ding, Q. et al. The role of the apoptosis-related protein BCL-B in the regulation of mitophagy in hepatic stellate cells during the regression of liver fibrosis. Exp. Mol. Med. 51 , 1–13. 10.1038/s12276-018-0199-6 (2019). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5095557","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":376575893,"identity":"65b0c385-e290-4f29-a1f1-d319437e3e12","order_by":0,"name":"Long Huang","email":"","orcid":"","institution":"363 Hospital","correspondingAuthor":false,"prefix":"","firstName":"Long","middleName":"","lastName":"Huang","suffix":""},{"id":376575895,"identity":"9b1269a3-45e0-4396-8328-a46eb01ea915","order_by":1,"name":"Lin Wang","email":"","orcid":"","institution":"363 Hospital","correspondingAuthor":false,"prefix":"","firstName":"Lin","middleName":"","lastName":"Wang","suffix":""},{"id":376575897,"identity":"59c2e550-a187-4d56-b0b6-50e81367d8e7","order_by":2,"name":"Dan Yuan","email":"","orcid":"","institution":"363 Hospital","correspondingAuthor":false,"prefix":"","firstName":"Dan","middleName":"","lastName":"Yuan","suffix":""},{"id":376575898,"identity":"cda24a08-cf99-4b2d-8911-103e55375f21","order_by":3,"name":"Yan Xu","email":"","orcid":"","institution":"363 Hospital","correspondingAuthor":false,"prefix":"","firstName":"Yan","middleName":"","lastName":"Xu","suffix":""},{"id":376575899,"identity":"fd514d5f-6708-4aa9-a3ff-87ce93011797","order_by":4,"name":"Yu Wang","email":"","orcid":"","institution":"363 Hospital","correspondingAuthor":false,"prefix":"","firstName":"Yu","middleName":"","lastName":"Wang","suffix":""},{"id":376575900,"identity":"7e9c8f18-2623-4d26-82da-34d6b896bbff","order_by":5,"name":"Kai Yao","email":"","orcid":"","institution":"363 Hospital","correspondingAuthor":false,"prefix":"","firstName":"Kai","middleName":"","lastName":"Yao","suffix":""},{"id":376575901,"identity":"af55c60c-f326-4892-a1f2-ddbf4b6f801a","order_by":6,"name":"Xiao Zhong","email":"","orcid":"","institution":"363 Hospital","correspondingAuthor":false,"prefix":"","firstName":"Xiao","middleName":"","lastName":"Zhong","suffix":""},{"id":376575902,"identity":"7b000b24-67b9-459e-93b6-3561efe0d165","order_by":7,"name":"Quanda Liu","email":"","orcid":"","institution":"363 Hospital","correspondingAuthor":false,"prefix":"","firstName":"Quanda","middleName":"","lastName":"Liu","suffix":""},{"id":376575903,"identity":"a6301137-4c9f-4d02-a64b-8aaf132c3878","order_by":8,"name":"Kang Jia","email":"","orcid":"","institution":"363 Hospital","correspondingAuthor":false,"prefix":"","firstName":"Kang","middleName":"","lastName":"Jia","suffix":""},{"id":376575904,"identity":"06bb8e9a-80bc-45d5-989f-2e755bcebf53","order_by":9,"name":"Lei Lei","email":"","orcid":"","institution":"363 Hospital","correspondingAuthor":false,"prefix":"","firstName":"Lei","middleName":"","lastName":"Lei","suffix":""},{"id":376575905,"identity":"07bfd961-f7b0-4b7a-a867-1ea6e351258a","order_by":10,"name":"Haiyan Wang","email":"","orcid":"","institution":"363 Hospital","correspondingAuthor":false,"prefix":"","firstName":"Haiyan","middleName":"","lastName":"Wang","suffix":""},{"id":376575906,"identity":"35275b69-5339-48ef-9309-e3bcc1073279","order_by":11,"name":"Dongliang Liu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA6ElEQVRIiWNgGAWjYDCCA0D8wADGq5CQkydKSwJcyxkLY8MGorTAOIxtFYlgEXyA73jv4RcJBXZ58g48Zh8+zpNIYGxgfvjoBh4tkmfOpVkkGCQXGx7gMZ45c5tEHjsDm7FxDh4tBjdyzAwSDJgTNzbwGDPzbpMoZmzgYZMmQks9VMscicSGA4S1GD9IMDicOJ8BpKWBCC2SZ86YAQP5eOIGBrZixhnHJIwNmwn4he94j/GHD3+qE+c3MG9m+FBTJyfP3vzwMT4tQMAmAXbh/QdQPjN+5WAlH0CkfANhlaNgFIyCUTBCAQDatkqIf/ZgwgAAAABJRU5ErkJggg==","orcid":"","institution":"363 Hospital","correspondingAuthor":true,"prefix":"","firstName":"Dongliang","middleName":"","lastName":"Liu","suffix":""}],"badges":[],"createdAt":"2024-09-16 07:16:42","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5095557/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5095557/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":70746344,"identity":"de30b90c-901c-4043-b091-dde2469322fa","added_by":"auto","created_at":"2024-12-06 08:36:07","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":209295,"visible":true,"origin":"","legend":"\u003cp\u003eExpression levels of BNIP3 and HIF-1α in renal cell carcinoma (RCC) cell lines. (A) Western blot analysis of BNIP3 and HIF-1α expression levels in A498,786-O, CAKI-1, ACHN, and GRC cell lines. (B) and (C) Western blot analysis of BNIP3 expression levels in A498 and 786-O cell lines. (D) mRNA expression levels of BNIP3 in A498 and 786-O cell lines were examined using reverse transcription-quantitative PCR. Data are mean±SD, * \u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05, ** \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-5095557/v1/cbf393e1bb3eb60ef1f765ef.png"},{"id":70745990,"identity":"18ec246c-0e45-40ed-94d0-c214779ec4cc","added_by":"auto","created_at":"2024-12-06 08:28:07","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":679515,"visible":true,"origin":"","legend":"\u003cp\u003eThe impact of overexpression of BNIP3 on renal cell carcinoma (RCC) cells’ proliferative activity, invasion, and apoptosis ability. (A) Results of cell counting kit-8 (CCK-8) assay to detect proliferation activity. (B) and (C) Plate clone formation assay to detect the ability of RCC cells to form clones. (D) and (E) Transwell assay for assessing the invasiveness of RCC cells (×40). (F)and (G) Revealing cell apoptosis in different cell groups using flow cytometry. (H-K) Western blot detection of caspase3, cleaved caspase3, and Bax. Data are mean±SD, * \u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05, ** \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-5095557/v1/06e272986082cbf6564c1e8f.png"},{"id":70746342,"identity":"edebdccc-df82-41b8-a3d1-8a44b4c73a59","added_by":"auto","created_at":"2024-12-06 08:36:07","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":549503,"visible":true,"origin":"","legend":"\u003cp\u003eOverexpression of BNIP3 promotes the dissociation of the Bcl-2/Beclin1 complex through competitive binding of Bcl-2 under hypoxia conditions.(A) and (B) The dissociation of Bcl-2/Beclin1 complex in BNIP3-overexpressing A498 and 786-O cells was indicated by the Co-IP experiment with Beclin1 antibody and Bcl-2 antibody.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-5095557/v1/8291aa0282fe37969d03da56.png"},{"id":70746343,"identity":"e6e40a9a-7f97-4f6a-96cd-4c144e517c7b","added_by":"auto","created_at":"2024-12-06 08:36:07","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1644313,"visible":true,"origin":"","legend":"\u003cp\u003eOverexpression of BNIP3 promotes autophagy in renal cancer cells under hypoxia. (A) and (B) Immunofluorescence for LC3B (×40). (C)The autophagosomes in A498 and 786-O cells were visualized using transmission electron microscopy (TEM) at a magnification of ×20000 after exposure to hypoxia. (D-F) Western blot detection of LC3-I, LC3-II, and p62. (G) and (H) Overexpression of BNIP3 affecting A498 and 786-O cells ROS. (I) Concentration of mitochondrial membrane permeability transition pore (mPTP). Data are mean±SD, * \u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05, ** \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-5095557/v1/c039a8c2837002ad896c4658.png"},{"id":70745996,"identity":"d9d24a40-27cb-410f-ba24-22a83558d4fb","added_by":"auto","created_at":"2024-12-06 08:28:07","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1287768,"visible":true,"origin":"","legend":"\u003cp\u003eOverexpression of BNIP3 promotes apoptosis of cancer cells by mediating autophagy under hypoxia. (A) and (B) Apoptosis was detected by flow cytometry. (C) and (D) Overexpression of BNIP3 affecting A498 and 786-O cells ROS. (E-J) Western blot detection of LC3-I, LC3-II, p62, caspase3, cleaved caspase3 and Bax. Data are mean±SD, * \u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05, ** \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, \u003csup\u003e#\u003c/sup\u003e \u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05, \u003csup\u003e##\u003c/sup\u003e \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-5095557/v1/8673bd57467766c6f65e3807.png"},{"id":70745992,"identity":"0054dfc6-35b7-46ab-b8e9-bea767a281cb","added_by":"auto","created_at":"2024-12-06 08:28:07","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1741996,"visible":true,"origin":"","legend":"\u003cp\u003eOverexpression of BNIP3 suppresses tumor growth in mice with established tumors. (A) Tumor plot of dissected xenograft tumors. (B) Tumor volume growth curve. (C) Tumor weight.(D) and(E) Microscopic observation of HE and immunohistochemical detection of ki-67 expression level of tumors (×40). (F)and (G) Apoptosis of tumor tissue was detected by TUNEL staining (×40). (H-J) Western blot detection of LC3-I, LC3-II, p62, caspase3, cleaved caspase3, and Bax proteins. Data are mean±SD, * \u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05, ** \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-5095557/v1/35b0123f9953b3b480ec7159.png"},{"id":83628723,"identity":"4711bef3-ad97-405b-b327-9ef0d2824c3d","added_by":"auto","created_at":"2025-05-29 18:01:33","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":7221206,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5095557/v1/44a16b26-0fdb-4a4d-aa65-9c95f043982e.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Overexpression of BNIP3 in renal carcinoma cells can promote apoptosis of renal carcinoma cells through HIF-1α-BNIP3-mediated autophagy","fulltext":[{"header":"Introduction","content":"\u003cp\u003eKidney cancer is a prevalent form of malignant neoplasm, accounting for approximately 3\u0026ndash;5% of all adult malignant tumors. Its incidence rate ranks second among male urological malignancies, following only prostate and bladder cancers, with a notably higher prevalence in males compared to females\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e,\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. Kidney cancer, which has imposed a significant burden on the health and well-being of individuals globally, currently has an undefined etiology, with smoking, obesity, and hypertension acknowledged as established risk factors\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e,\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. Histologically, renal cell carcinoma (RCC) accounts for the vast majority (90%) of kidney cancer cases, mainly including clear cell renal carcinoma (70%), papillary renal cell carcinoma (10%~15%), and chromophobe renal cell carcinoma (5%)\u003csup\u003e5\u003c/sup\u003e. Nephrectomy alone is an ineffective treatment, so systemic therapy is imperative for these advanced and metastatic kidney cancers\u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. Therefore, there is a need for a deeper understanding of the molecular biological basis of renal cell carcinoma providing new goals for the purpose of diagnosis and treatment of clear cell renal carcinoma. Hence, it is imperative to investigate the mechanisms underlying the progression of renal cell carcinoma and discover novel targets for therapeutic intervention.\u003c/p\u003e \u003cp\u003eBNIP3, a protein involved in promoting cell death, is subject to regulation by hypoxia-inducible factor 1 (HIF-1)\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. Under hypoxic circumstances, BNIP3 could potentially be activated by HIF and subsequently play a role in hypoxia-induced cell death via mechanisms like apoptosis, necrosis, and autophagy\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. It has been pointed out that upregulation of BNIP3 can trigger autophagy\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. BNIP3, via its BH3 domain, exhibits competitive interaction with binding sites on BCL-2 proteins, thereby facilitating the liberation of Beclin-1 molecules\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. Under hypoxia conditions, this process initiates the autophagy mechanism, which in turn affects the survival state of cells.\u003c/p\u003e \u003cp\u003eAutophagy is a highly conserved process that maintains cell homeostasis during evolution, which has a two-sided effect on tumorigenesis and development: on the one hand, autophagy can improve the tolerance of tumor cells to external stress; conversely, triggering autophagy may lead to the promotion of tumor cell death, thereby inhibiting the growth of tumor cells\u003csup\u003e\u003cspan additionalcitationids=\"CR12\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. By affecting the expression of autophagy signaling pathway-related proteins, the programmed cell death of cancerous cells can be regulated, and the proliferation of tumor cells can be inhibited\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. In the current study of RCC, the improvement in autophagy has an inhibitory effect on the malignant biological behavior of tumors\u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eBased on the previous findings of this study, the expression level of BNIP3 is low in kidney cancer cell lines\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e, and based on this, this project intends to construct BNIP3-overexpressing kidney cancer cells to explore whether HIF can interact with BNIP3 to mediate the occurrence of autophagy and affect the growth and programmed cell death of malignant cells.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCell culture and transfection\u003c/h2\u003e \u003cp\u003eHuman RCC cell lines A498, 786-O, CAKI-1, ACHN, and GRC were purchased from KeyGEN Company (Nanjing, China). Cells were cultured in Roswell Park Memorial Institute (RPMI) medium using 1640 complete medium (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA). Under hypoxic conditions, the cells were placed in a 3131 Thermo Forma Water-Jacketed CO\u003csub\u003e2\u003c/sub\u003e incubator and exposed to a gas mixture consisting of 1% oxygen, 5% CO\u003csub\u003e2\u003c/sub\u003e, and 94% N\u003csub\u003e2\u003c/sub\u003e for 48 hours.\u003c/p\u003e \u003cp\u003ePCR was employed to enhance the entire coding segment of BNIP3. The DNA segment was incorporated into the pcDNA3.1 vector (Invitrogen, USA) to produce pcDNA3.1-BNIP3 (pc-BNIP3). An unoccupied pcDNA3.1 vector was employed as a reference (pc-NC) for transfection objectives. Cell transfection was carried out using Lipofectamine\u0026reg; 2000 transfection reagent (Invitrogen, USA). A498 and 786-O cells were seeded into 6 well plates and transfected when they reached a confluence of 70%-80%. To overexpress genes, pc-BNIP3 (2 \u0026micro;g/well) or pc-NC (2 \u0026micro;g/well) along with the transfection reagent (12 \u0026micro;L/well) were mixed separately in serum-free Opti-MEM for 5 minutes. The diluted plasmid and transfection reagent were then combined and incubated at 37\u0026deg;C for half an hour. The resulting mixture was added to the cell culture medium, followed by replacement with fresh RPMI 1640 after six hours of transfection. Culture continued for another two days thereafter.\u003c/p\u003e \u003cp\u003eA498 and 786-O cells were divided into 6 groups: OE-NC (pc-NC); OE-BNIP3 (pc-BNIP3); OE-NC Normoxia; OE-NC Hypoxia; OE-BNIP3 Normoxia; OE-BNIP3 Hypoxia. A498 and 786-O cells were subjected to an additional experiment involving the introduction of pc-BNIP3, either with or without 3-MA, an autophagy inhibitor, and cultured under hypoxia (OE-BNIP3\u0026thinsp;+\u0026thinsp;3-MA Normoxia and OE-BNIP3\u0026thinsp;+\u0026thinsp;3-MA Hypoxia groups). Each experiment was performed in triplicate.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eReal-time fluorescent quantitative polymerase chain reaction (RT-qPCR) assay\u003c/h3\u003e\n\u003cp\u003eThe Trizol Total RNA Extraction Kit (9108, TaKaRa, Japan) was utilized to extract the total cellular RNA, followed by reverse transcription into cDNA using the Reverse Transcription Kit (2690S, TaKaRa, Japan). SYBR Premix Ex TaqTM II kit (RR037Q, TaKaRa, Japan) was used for real-time fluorescence quantification. The real-time qPCR system was performed in a 20 \u0026micro;L system under the conditions of 95\u0026deg;C for 30s pre-denaturation, 95\u0026deg;C for 5s, 55\u0026deg;C for 30s, 45 cycles, and 72\u0026deg;C for 30s extension. The comparative CT method (2\u003csup\u003e\u0026minus;\u0026thinsp;ddCT\u003c/sup\u003e method) was used to calculate BNIP3 and HIF-1α mRNA expression with β-actin as the internal reference control. Primers were designed using Primer 5.0 Fast software and the sequences are shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e as follows.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers used in this study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eforward primer(5\u0026rsquo;\u0026rarr;3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ereverse primer(5\u0026rsquo;\u0026rarr;3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ-actin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003etgacttcaacagcgacaccca\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ecaccctgttgctgtagccaaa\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBNIP3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eagggctcctgggtagaact\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ectccattataaatagaaaccgaggc\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHIF-1α\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003etgctcatcagttgccacttccac\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ecaccagcatccagaagtttcctcac\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e\n\u003ch3\u003eCell Counting Kit-8 (CCK-8) assay\u003c/h3\u003e\n\u003cp\u003eCell proliferation was quantified with the Cell CCK-8 kit (BS350B, Biosharp, Shanghai, China), following the manufacturer's guidelines. The renal carcinoma cells that underwent transfection were plated and left to incubate for a duration of 24 hours. Following this, 10 \u0026micro;L of CCK-8 reagent was added to each well, extending the incubation for three hours. Absorbance at 450 nm was then measured using a microplate reader (ELx800, Buchi Instruments, USA).\u003c/p\u003e\n\u003ch3\u003eCell Cloning assay\u003c/h3\u003e\n\u003cp\u003eCells were transfected using a lentiviral vector overexpressing BNIP3. The BNIP3 overexpression lentiviral vector was purchased from GeneChem (Shanghai, China). The cell concentration was adjusted to 2 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e/mL 100 \u0026micro;L of cell suspension was inoculated into each well and the culture medium was replenished. The cells were mixed well and incubated until clones were visible. When clones first became visible, the culture medium was disposed of and the plate was rinsed with PBS. The cells were treated with a 4% volume of polymethanol for a duration of 30 minutes and subjected to staining using a solution containing 0.1% crystal violet for a period of 15 minutes. The plate was dried after removing the staining solution. Photographs were taken, images were recorded, the number of clones visible was counted, and the results were analyzed.\u003cb\u003eTranswell assay\u003c/b\u003e\u003c/p\u003e \u003cp\u003eAfter trypsin digestion of transfected cells, a 1 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e cells/mL concentration was achieved with the medium. Before the experiment, matrix gels were preincubated in Transwell chambers at 37\u0026deg;C for 3 hours. Post-solidification of the Matrigel, serum-free medium was replenished. A cell suspension was then added to Transwell chambers in a 24-well plate, with culture solution outside. The Transwell was washed with PBS after 24 hours of incubation. Fixation was performed using 4% paraformaldehyde, followed by crystal violet staining for 30 minutes. Six random visual fields were selected from each well, and the number of invasive cells was observed with a light microscopic camera system (DMI1, LEICA, Germany).\u003c/p\u003e\n\u003ch3\u003eApoptosis assay\u003c/h3\u003e\n\u003cp\u003eThe A498 and 786-O cells in the logarithmic growth phase were inoculated into 12-well plates at a density of 1\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells per well. Once the cells had adhered to the plate, transfection or intervention was carried out. After 48 hours, all cells from the 6-well plates were collected and washed with PBS to eliminate any background interference. The cells were then resuspended in 100 \u0026micro;l of 1\u0026times;Binding Buffer and incubated with AnnexinV-FITC and PE-PI dual fluorescent probes (KGA1107, KeyGEN, China) for a duration of 15 minutes at room temperature under light protection. Subsequently, the samples were immediately analyzed using flow cytometry (Cytoflex, Beckman Coulter, USA) through the FITC/PI channel to determine the percentage of apoptotic cells.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eWestern blot analysis\u003c/h2\u003e \u003cp\u003eThe extraction of total protein from tissues and cells involved the use of lysis buffer, followed by a 30-minute incubation on ice to collect the cells. The supernatant was collected, and the protein concentration was determined by the BCA (P0009, Beyotime, Shanghai, China) method. A 30 \u0026micro;g protein sample was taken and denatured in a boiling water bath and uploaded, proteins were separated by 10% SDS-PAGE and transferred to a PVDF membrane (ISEQ00010, Sigma-Aldrich, USA), and blocked with 5% skimmed milk for 1h at room temperature. The BNIP3 antibody (1:1000, A19593, ABclonal, USA), HIF-1α antibody (1:1000, A7684, ABclonal, USA), caspase3 antibody (1:500, 9662, Cell Signaling Technology, USA), cleaved caspase3 antibody (1:1000, 9661, Cell Signaling Technology, USA), Bax antibody (1:1000, A0207, ABclonal, USA), LC3B antibody (1:1000, A19665, ABclonal, USA), p62 antibody (1:1000, A19700, ABclonal, USA), and β-actin antibody (1:50000, AC026, ABclonal, USA) were incubated at 4\u0026deg;C overnight. The membrane was washed 3 times with TBST, incubated with HRP-labeled secondary antibody (1:7000, S0001, Affbiotech, Jiangsu, China) for 1h at room temperature, washed 3 times with TBST, and developed dropwise with a chemiluminescent solution. Quantitative analysis was performed using Image-ProPlus 6.0 software.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eCo-immunoprecipitation(Co-IP)\u003c/h3\u003e\n\u003cp\u003ePretreated cells were lysed in a lysis buffer containing 50 mM Tris-HCl (pH 7.5), 100 mM NaCl, 1% Triton X-100, 0.1 mM EDTA, 0.5 mM MgCl\u003csub\u003e2\u003c/sub\u003e, and supplemented with 10% glycerol, protease inhibitor cocktail (Roche), phosphatase inhibitor cocktail (Roche), and 10 \u0026micro;M pervanadate (NEB). The cell lysates were incubated with Bc1-2 antibody (diluted at a ratio of 1:50; A0208, ABclonal, USA) for one hour at a temperature of 4\u0026deg;C followed by overnight incubation with Protein-A/G Sepharose beads (Abcam, UK) also at a temperature of 4\u0026deg;C. The agarose beads were then collected through centrifugation at a speed of 500 g for five minutes. Subsequently, the beads were thoroughly washed three times in the lysis buffer and heated to a temperature of 95\u0026deg;C for five minutes. Finally, proteins were probed using antibodies against Beclin1(1:30, A7353, ABclonal, USA) and BNIP3 (1:30, A19593, ABclonal, USA).\u003c/p\u003e\n\u003ch3\u003eImmunofluorescence staining\u003c/h3\u003e\n\u003cp\u003eThe cell crawl sections were stained. The sections were immersed in 5% film breaker for 10 min. After PBS washing, goat serum sealing solution was added and sealed for 20 minutes at room temperature. Primary antibodies (1:100, LC3B, 14600-1-AP, Proteintech, USA) were added and incubated overnight at 4\u0026deg;C. After washing again with PBS, the second antibody (1:100, FITC-labeled goat anti-rabbit, GB22303, Servicebio, Wuhan, China) was added and incubated for 30 min. After washing with PBS, 4\u0026rsquo;,6-diamidino-2-phenylindole (DAPI) was added and incubated. After a final wash with PBS, the slices were sealed with an anti-fluorescence attenuating sealer. The images were a3-MAuired using a microscopic camera system (OlyVIA, OLYMPUS, Tokyo, Japan). The fluorescence intensity and area of all images were measured using ImageJ6 (National Institutes of Health, Bethesda, MD, USA), and the mean fluorescence intensity of each image was calculated.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eFlow cytometry for ROS\u003c/h2\u003e \u003cp\u003eA498 and 786-O cells were cultured in 6-well plates, and a total of 1 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e cells from each group underwent two washes with PBS. The cells were then loaded with probes, resulting in a suspension containing 5 mol/L DCFH-DA (MCE). After incubating for 30 minutes at 37\u0026deg;C in the absence of light, the cells were washed twice with PBS. The fluorescence intensity detected using the FITC channel was utilized to quantify the variations in ROS levels among different experimental groups.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eTumor xenograft assay\u003c/h2\u003e \u003cp\u003eTwelve 6-week-old BALB/c nude mice (18\u0026thinsp;~\u0026thinsp;22 g) were used for subcutaneous tumor xenograft experiments. The animals in this study were purchased from Chengdu Dashuo Experimental Animal Co., Ltd. (Chengdu, China) (SCXK(Chuan)2019-031). BALB/c nude mice were randomly divided into two groups (OE-NC group and OE-BNIP3 group, n\u0026thinsp;=\u0026thinsp;6). In the subcutaneous carcinogenic experiment, the right axillas of nude mice in the OE-NC group and OE-BNIP3 group were subcutaneously injected with stably transfected pcDNA-NC 786-O and pcDNA-BNIP3 786-O cells. The density of 786-O cells was adjusted to 1.0 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e cells /mL, and the right axillary side of nude mice was injected subcutaneously to construct tumorigenesis of nude mice for 30 days. Starting on day 20, the tumor volume was measured every 3 days for a total of 10 measurements. After 26 days, the mice were anesthetized (sodium pentobarbital, 100 mg/kg, 200-323-9, Sigma-Aldrich, St. Louis, MO, USA) and sacrificed via cervical dislocation, and all 12 subcutaneous tumors were isolated and weighed. Tumor tissue was then stored in a \u0026minus;\u0026thinsp;80\u0026deg;C freezer for subsequent studies. The Ethics Committee of 363 Hospital (IRB number: 2022035) approved all experimental protocols conducted in this study.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eHematoxylin and eosin (H\u0026amp;E) staining assay\u003c/h2\u003e \u003cp\u003eAfter completing the experiment, the mice were sacrificed, and part of the tumor tissue was collected, fixed with 4% paraformaldehyde, embedded in paraffin, and sectioned at 4 \u0026micro;m. After dewaxing and rehydration, the histological morphology was observed with hematoxylin-eosin (H\u0026amp;E, C0105M, Beyotime, Shanghai, China) staining.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eTransmission electron microscopy (TEM) analysis\u003c/h2\u003e \u003cp\u003eTumor tissue samples of mice in each group were fixed with 5% glutaraldehyde for up to 5 hours. After fixation, samples were washed three separate times using neutral phosphate buffer, each wash lasting 10 min intervals. Brain tissue samples were fixed with 0.1 mol/L osmic acid for 3 h and washed three times with phosphate buffer, every 10 min. Gradient dehydration was then performed at 50%, 70%, 80%, 90%, 95%, and 100% alcohol concentrations every 15 minutes. The tissue blocks were embedded in resin for ultrathin sectioning (50\u0026thinsp;~\u0026thinsp;70nm), and then stained with uranyl acetate (1261209, SPI), and the ultrastructure of cells and autophagy were observed under a transmission electron microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eTerminal deoxynucleotidyl transferase (TdT) dUTP Nick-End Labeling (TUNEL) assay\u003c/h2\u003e \u003cp\u003eTUNEL (Terminal deoxynucleotide transferase (TdT) dUTP notch terminal marker) was used to detect apoptosis in tumor tissue cells. Paraffin sections were dewaxed and hydrated with PBS 3 times. The remaining steps of the procedure are conducted by the TUNEL kit (1168479590, Roche Group). Cells with green nuclei under the light microscope were apoptotic positive cells. Three regions were randomly selected from each mouse brain tissue section, and the number of positive cells was used as the apoptotic index.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eImmunohistochemical experiment\u003c/h2\u003e \u003cp\u003eAfter the standard preparation of tumor tissue sections, antigen retrieval was performed using citrate buffers followed by treatment with 3% hydrogen peroxide to suppress endogenous peroxidase activity. Afterward, the sections were securely closed using serum derived from goats (AR1009, BOSTER) and incubated overnight with primary antibodies of BNIP3 (1:400, bs-4239R, Bioss, USA) and Ki67 (1:400, HA721115, HUABIO, Shanghai, China) at 4\u0026deg;C, followed by another round of PBS washing. A secondary antibody (1:100, GB22303, Servicebio, Shanghai, China) was added and incubated at 37℃ for 30 min. Tissues were visualized using a DAB (36201ES03, YEASEN) staining solution, and hematoxylin restaining was performed before dehydration and sealing. Image analysis was performed using a digital trimoscope (BA210Digital, Meiji Technology Co., LTD., China) and a data image analysis system (Halo 101-WL-HALO-1, Indica Labs, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eStatistical Analysis\u003c/h2\u003e \u003cp\u003eThe statistical analysis was conducted using GraphPad Prism 9.0 software. The mean (\u003cspan class=\"InlineEquation\"\u003e\u003c/span\u003e)\u0026thinsp;\u0026plusmn;\u0026thinsp;standard mean (SD) were used to represent the experimental statistics. To compare multiple groups, a one-way analysis of variance (ANOVA) was employed, and statistical analysis was performed post hoc by Tukey. The T-test was used for comparison between the two groups. \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eExpression of BNIP3 and HIF-1α in renal cell carcinoma cell lines\u003c/h2\u003e \u003cp\u003eInitially, we investigated the protein expression of BNIP3 and HIF-1α in renal cell carcinoma cell lines A498, 786-O, CAKI-1, ACHN, and GRC. As depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, elevated levels of BNIP3 and HIF-1α were observed in CAKI-1, ACHN, and GRC, whereas these proteins exhibited minimal expression in A498 and 786-O. Consequently, A498 and 786-O were chosen as the subjects of investigation. WB and RT PCR were used to detect the expression of BNIP3 protein and mRNA in A498 and 786-O cells with overexpression of BNIP3. As shown in Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB and C, the level of BNIP3 protein expression was notably elevated in the OE BNIP3 group (BNIP3 expression group) compared to the OE-NC group (negative control group). Furthermore, BNIP3 mRNA was significantly increased in the OE BNIP3 group compared to the OE-NC group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eEffect of overexpression of BNIP3 on the proliferation, invasion, and apoptosis of renal cell carcinoma cells\u003c/b\u003e \u003c/p\u003e \u003cp\u003eA498 and 786-O cells were transfected and divided into the OE-NC and OE-BNIP3 groups. According to the data presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, there was a significant decrease in the proliferative activity of the OE-BNIP3 cells compared to that of the OE-NC group. We obtained comparable findings from the cell cloning assay, with the number of clones formed by A498 and 786-O cells in the OE-BNIP3 group being significantly less than that in the OE-NC group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB, C). Furthermore, the Transwell invasion assay indicated that the OE-BNIP3 group had a significantly lower number of A498 and 786-O cells crossing the Transwell compartment than the OE-NC group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD, E). Flow cytometry showed that OE-BNIP3 had increased A498 and 786-O cell death compared to OE-NC (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF, G). In addition, OE-BNIP3 increased the expression of caspase3, cleaved caspase3, and Bax compared with OE-NC (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eH\u0026ndash;K). Based on the above results, overexpression of BNIP3 suppressed the proliferation and invasion and promoted apoptosis in renal cell carcinoma cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eOverexpression of BNIP3 promotes the dissociation of the Bcl-2/Beclin1 complex through competitive binding of Bcl-2 under hypoxia conditions\u003c/b\u003e \u003c/p\u003e \u003cp\u003eIn the following step, our objective is to determine whether the overexpression of BNIP3 can definitively bind to BCL-2 and induce the dissociation of Beclin-1 from Bcl-2. By performing co-immunoprecipitation experiments, we successfully co-precipitated Bcl-2. Analysis using the Western Blot technique demonstrated that under hypoxic conditions, BNIP3 overexpression significantly increased the co-precipitation of Bcl-2 with BNIP3, while simultaneously reducing the co-precipitation of Bcl-2 with Beclin1 (refer to Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, B). This indicates an enhanced binding capacity between BNIP3 and Bcl-2, and a weakened binding capacity between Bcl-2 and Beclin1. This change led to the dissociation of the Bcl-2/Beclin1 complex, thereby promoting the process of protective autophagy in RCC cells under hypoxic conditions.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eOverexpression of BNIP3 promotes autophagy and mitochondrial damage in renal carcinoma cells under hypoxia\u003c/h2\u003e \u003cp\u003eTo explore the effect of overexpression of BNIP3 on autophagy under hypoxia. LC3B is a key protein involved in autophagy and is crucial in regulating cellular processes and responses to stress. The results of immunofluorescence staining confirmed that A498 and 786-O cells exposed to hypoxia exhibited elevated levels of LC3B compared to those cultured under normoxic conditions. Moreover, additional treatment with OE-BNIP3 further enhanced the effects induced by hypoxia. (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA and B). In the context of TEM analysis, it was observed that the number of autophagosomes in A498 and 786-O cells exhibited an elevation upon undergoing hypoxia treatment. Notably, the augmentation in the count of autophagosomes was more pronounced in cells that had undergone BNIP3 overexpression (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). Western blot analysis revealed that when compared to A498 and 786-O cells under normoxic conditions, the expression of p62 in 786-O cells under hypoxic conditions experienced a decrease, and the ratio of LC3-II to LC3-I exhibited an elevation in A498 and 786-O cells. However, the presence of BNIP3 overexpression contributed to the facilitation of these hypoxia-induced effects (Figure. 4D-F). Under hypoxia conditions, ROS levels increased in A498 and 786-O cells, and overexpression of BNIP3 increased ROS levels compared to the OE-NC hypoxia and the OE-BNIP3 normoxia groups (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG and H). Additionally, under hypoxic conditions, the extent of mitochondrial damage was exacerbated in A498 and 786-O cells, and this damage was further exacerbated upon transfection with BNIP3 overexpression (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eI).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eOverexpression of BNIP3 promotes apoptosis of renal cancer cells by mediating autophagy under hypoxia\u003c/h2\u003e \u003cp\u003eTo explore the effect of autophagy inhibitor 3-MA combined with OE-BNIP3 on apoptosis of renal cell carcinoma cells by mediating autophagy under hypoxia conditions. Flow cytometry results showed that BNIP3 overexpression promoted apoptosis in A498 and 786-O cells under hypoxic conditions, and the addition of autophagy inhibitor 3-MA could inhibit this promotion and reduce apoptosis (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA and B). As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC and D, ROS production is more likely to be promoted by BNIP3 overexpression in a hypoxic environment, and the autophagy inhibitor 3-MA can effectively inhibit this promoting effect. The findings from WB analysis indicated that the level of expression for autophagy-related regulator LC3-II /LC3-I increased and p62 protein decreased in the OE-BNIP3 hypoxic group. In contrast, the addition of autophagy regulator 3-MA reversed the expression of LC3-II /LC3-I and p62 proteins (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE\u0026ndash;G). For the increase of the protein expression associated with programmed cell death cleaved caspase3 and Bax in the OE-BNIP3 hypoxic group, the addition of autophagy regulator 3-MA had a certain inhibitory effect, and the protein expression of cleaved caspase3 and Bax in the OE-BNIP3\u0026thinsp;+\u0026thinsp;3-MA hypoxic group decreased (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE and H-J). Based on the above results, it was found that BNIP3 overexpression promoted the apoptosis of renal cancer cells by mediating autophagy under hypoxic conditions.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eOverexpression of BNIP3 inhibits tumor growth in tumor-bearing mice\u003c/h2\u003e \u003cp\u003eAfter 26 days, the mice were euthanized under anesthesia via cervical dislocation, and all 12 subcutaneous tumors were removed and their weights were measured (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). The tumor sizes in each group of mice were measured. The OE-NC group experienced a significantly faster increase in tumor volume (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). Upon completion of the experiments, the dissected and isolated tumors were weighed. In comparison to the OE-NC group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC), the OE-BNIP3 group showed notably reduced tumor volume. Meanwhile, the OE-BNIP3 group exhibited significantly reduced levels of Ki67 expression in tumor tissues compared to the OE-NC group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD, and E). The Tunel staining technique was employed to assess tumor cell apoptosis, revealing a significant increase in apoptosis within the OE-BNIP3 group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eF, and G). In addition, the protein expression levels of LC3-II/LC3-I, caspase 3, cleaved caspase 3, and Bax were found to be significantly elevated in the OE-BNIP3 group compared to the OE-NC group. Conversely, the protein expression levels of p62 were observed to be lower in the OE-BNIP3 group as compared to the OE-NC group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eH-J). This part of the experiment showed that overexpression of BNIP3 can inhibit tumor growth in vivo and promote the occurrence of autophagy and apoptosis of tumor cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eRCC arises from the epithelial cells of the renal tubules and is among the frequently occurring malignant tumors within the urinary system, with an incidence about 3% of all malignant tumors and a mortality rate of 30\u0026thinsp;~\u0026thinsp;40%, ranking first among urinary tract tumors, much higher than bladder cancer and prostate cancer (mortality rate of about 20%)\u003csup\u003e16,17\u003c/sup\u003e. Although targeted therapies (e.g., tyrosine kinase inhibitors, vascular endothelial growth factor inhibitors, and mTOR inhibitors) and new immunotherapy strategies have been applied to some clinical treatments, the heterogeneity of RCC, the relative resistance to radiotherapy and chemotherapy, and other side effects make it difficult to achieve the expected efficacy, so it has become a top priority to explore new treatment strategies and intervention options\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eBNIP3 (Bcl-2/adenovirus E1B 19KDa interacting protein 3) is a pro-apoptotic member of the Bcl-2 family proteins\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. There exists a hypoxia response element (HRE) in the gene promoter of BNIP3 and it is directly regulated by the hypoxia-inducible factor (HIF)\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. The expression of BNIP3 in different tumors is inconsistent\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. Its high expression in tumors such as lung cancer, prostate cancer, breast cancer, and endometrial cancer is associated with a bleak prognosis for patients diagnosed with tumors. Still, its level of expression is minimal in cases of pancreatic cancer, colorectal cancer, liver cancer, and other tumors, and is associated with drug resistance in tumor patients\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. Studies have shown that the expression level of BNIP3 in RCC tumor tissues is low, and overexpression of BNIP3 will promote apoptosis and autophagy in RCC cells\u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e. On this basis, the expression of BNIP3 protein and mRNA in renal cell carcinoma cell lines A498, 786-O, CAKI-1, ACHN, and GRC was analyzed, and A498 and 786-O cells with lower expression were selected to be transfected with BNIP3 overexpression plasmid to construct overexpressing BNIP3. In this research, the increased expression of BNIP3 resulted in a notable elevation of both BNIP3 protein and mRNA levels. Additionally, the spread and infiltration of cancer cells are defining traits of tumor cells, and the metastasis of tumors is a multifaceted procedure that encompasses cell movement, infiltration, and attachment\u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. The outcomes of this experimental investigation revealed that the overexpression of BNIP3 led to a notable reduction in cell survival and a diminished capacity for both colony formation and cell migration across RCC cell lines, thereby suggesting that BNIP3 overexpression has the potential to suppress the proliferative and metastatic capabilities of renal cancer cells. Moreover, the apoptosis assays demonstrated that the upregulation of BNIP3 significantly accelerated the process of apoptosis in A498 and 786-O cell lines, and concurrently elevated the expression levels of key apoptosis marker proteins, including caspase3, cleaved caspase3, and Bax.\u003c/p\u003e \u003cp\u003eAutophagy constitutes a cellular mechanism of self-degradation, wherein lysosomes are employed to break down impaired or unfolded macromolecular components or organelles in response to extrinsic environmental stimuli\u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. The Bcl-2/Beclin1 complex is a major autophagy modulator\u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e. The ULK1 complex is required for autophagy initiation, and the assembly of the Bcl-2/Beclin1 complex prevents Beclin-1 from activating ULK1, thereby initiating the autophagy process\u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. Studies have shown that BNIP3 can promote the occurrence of autophagy by releasing Beclin1, which may be related to preventing Bcl-2 from binding to Beclin1 to activate autophagy\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. Hypoxia is one of the signs of cancer and can induce autophagy in tumor cells\u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e. Under hypoxic conditions, the oxygen content in the cells decreases and energy metabolism is affected, at which point autophagy is activated to help the cells cope with energy crises and metabolic stress\u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. In this study, CO-IP experiments showed that the overexpressed BNIP3 competitively binds to Bcl-2 and dissociates Beclin1, triggering autophagy. Hypoxia has been reported to activate autophagy, accompanied by increased BNIP3 expression\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. This experiment found that the dissociation ability of the Bcl-2/Beclin1 complex was stronger under the promotion of overexpression of BNIP3 under hypoxic conditions, which was consistent with the above conclusions.\u003c/p\u003e \u003cp\u003eBNIP3 is a protein localized to the outer membrane of mitochondria, acting as a autophagy receptor, and is thought to be an important signaling molecule for hypoxia-induced autophagy\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e. BNIP3 is a downstream target gene of HIF-1α and can be activated by HIF-1α\u003csup\u003e31,32\u003c/sup\u003e. The HIF-1α/BNIP3 pathway is a key mechanism regulating autophagy, in which HIF-1α plays a key role in hypoxia-induced autophagy, and BNIP3 acts as a direct downstream regulator of HIF-1α under hypoxic conditions, promoting the expression of BNIP3 and thereby inducing the occurrence of autophagy\u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e. LC3, a protein associated with microtubules and known as light chain 1 of microtubule-associated protein 1, acts as a marker for autophagy and is present on lysosomal and mitochondrial autophagosome membranes. During autophagy, LC3 protein is cleaved by autophagic protein 4 (Atg4) to produce LC3-I, which is subsequently processed and modified by a ubiquitin-like system to form LC3-II, and the content of LC3-II is directly proportional to the degree of autophagy\u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e. BNIP3 can bind directly to LC3 to induce the occurrence of autophagy\u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e. Our results suggest that overexpression of BNIP3 under hypoxic conditions induces an increase in LC3B levels, an increase in ROS release, an increase in autophagosomes, an increase in LC3-II protein expression, a decrease in p62 protein expression, and an enhancement of autophagy. In addition, the potential of overexpression of BNIP3 to suppress cancer and promote autophagy has also been demonstrated in nude mice.\u003c/p\u003e \u003cp\u003eApoptosis is the mode of programmed cell death, in which the mitochondrial permeability transition pore (mPTP) opens up and the mitochondrial membrane potential (MMP) decreases when stimulated by intracellular signaling, and mitochondrial damage leads to the activation of autophagy\u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e. At the same time, the reduction of MMP can swell the mitochondrial matrix, release cytochrome C and apoptosis-inducing factors into the cytosol, and initiate cysteine aspartate-specific protease (caspase)-dependent or independent apoptosis\u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. The depolarization of MMP is a common process between autophagy and apoptosis initiation, suggesting that there is an internal correlation between the two. Studies have shown that key proteins involved in autophagy, such as PINK1, Parkin, BNIP3, and NIX, are important intermediates of various physiological processes in cells, and the genes encoding these proteins are tumor suppressor genes that promote apoptosis\u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e,\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e. In addition, aberrant autophagy can disrupt mitochondrial homeostasis, thereby inducing apoptosis\u003csup\u003e\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e,\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e. In this study, overexpression of BNIP3 promoted apoptosis in kidney cancer cells under hypoxic conditions, while the addition of autophagy inhibitor 3-MA reduced apoptosis, indicating that BNIP3 overexpression promoted apoptosis in cancer cells by mediating autophagy under hypoxic conditions, and autophagy was tumor suppressor.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn conclusion, our study has demonstrated that the overexpression of BNIP3 effectively suppresses the proliferation, cloning, and migratory capacity of RCC cells while inducing apoptosis. Moreover, overexpression of BNIP3 in hypoxic conditions induces autophagy by disrupting the interaction between BCL-2 and Beclin1, thereby facilitating apoptosis in RCC cells through the regulation of autophagy. Therefore, this study contributes to identifying the impact of BNIP3 overexpression on cell proliferation and apoptosis in hypoxia-induced autophagy in RCC cells, offering a novel therapeutic target for impeding RCC progression.\u003c/p\u003e "},{"header":"Declarations","content":"\u003cp\u003e \u003cstrong\u003eCompeting interests\u003c/strong\u003e \u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e \u003c/p\u003e\u003cp\u003e \u003ch2\u003eEthics statement\u003c/h2\u003e \u003cp\u003e All animal experiments were approved by the 363 Hospital Ethics Committee (2022035) and were performed in accordance with relevant guidelines and regulations. All animal research reported in this paper was in accordance with the ARRIVE guidelines.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis study was supported by the Research Fund Project of General Technology Group Medical Health Co.LTD. (no. TYYLKYJJ-2022-045), the Medical research project of Chengdu Health Commission (no. 2022219), the Medical research project of 363 Hospital (no. 2021FH028).\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eDL designed the study, guided experiments, carried out analysis and reviewed the manuscript. LH contributed to the study design, performed experiments with cell lines, collected and analyzed data, and wrote the manuscript. LW contributed to the study design, performed experiments (sample collection and cell lines) and wrote the manuscript. DY and YX contributed to the study design, performed experiments of cell lines and reviewed the manuscript. YW and KY participated in the study design, animal experiments, and reviewed the manuscript. XZ, QL, KJ, LL and HW contributed to the study design, helped with sample collection and the preparation of cell lines, analyzed data and reviewed the manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eWe would like to thank Professor Xiang Li, Dr Yangxiang Shao, Dr Yaohui Wang and Dr Mengni Zhang for their support with techniques and equipment.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eThe datasets used and/or analysed during the current study available from the corresponding author on reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eXia, C. et al. Cancer statistics in China and United States, 2022: profiles, trends, and determinants. \u003cem\u003eChin. Med. J.\u003c/em\u003e \u003cb\u003e135\u003c/b\u003e, 584\u0026ndash;590. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1097/cm9.0000000000002108\u003c/span\u003e\u003cspan address=\"10.1097/cm9.0000000000002108\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSiegel, R. L., Giaquinto, A. N., Jemal, A. \u0026amp; Cancer statistics \u003cem\u003eCA: a cancer journal for clinicians\u003c/em\u003e 74, 12\u0026ndash;49, doi: (2024). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3322/caac.21820\u003c/span\u003e\u003cspan address=\"10.3322/caac.21820\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, Z., Wang, L., Wang, S. \u0026amp; Xie, L. Burden of kidney cancer and attributed risk factors in China from 1990 to 2019. \u003cem\u003eFront. public. health\u003c/em\u003e. \u003cb\u003e10\u003c/b\u003e, 1062504. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fpubh.2022.1062504\u003c/span\u003e\u003cspan address=\"10.3389/fpubh.2022.1062504\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eScelo, G. \u0026amp; Larose, T. L. Epidemiology and Risk Factors for Kidney Cancer. \u003cem\u003eJ. Clin. oncology: official J. Am. Soc. Clin. Oncol.\u003c/em\u003e \u003cb\u003e36\u003c/b\u003e (Jco2018791905). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1200/jco.2018.79.1905\u003c/span\u003e\u003cspan address=\"10.1200/jco.2018.79.1905\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBukavina, L. et al. Epidemiology of Renal Cell Carcinoma: 2022 Update. \u003cem\u003eEur. Urol.\u003c/em\u003e \u003cb\u003e82\u003c/b\u003e, 529\u0026ndash;542. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.eururo.2022.08.019\u003c/span\u003e\u003cspan address=\"10.1016/j.eururo.2022.08.019\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEmberley, E. et al. The glutaminase inhibitor telaglenastat enhances the antitumor activity of signal transduction inhibitors everolimus and cabozantinib in models of renal cell carcinoma. \u003cem\u003ePloS one\u003c/em\u003e. \u003cb\u003e16\u003c/b\u003e, e0259241. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0259241\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0259241\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKoop, E. A. et al. Expression of BNIP3 in invasive breast cancer: correlations with the hypoxic response and clinicopathological features. \u003cem\u003eBMC cancer\u003c/em\u003e. \u003cb\u003e9\u003c/b\u003e, 175. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/1471-2407-9-175\u003c/span\u003e\u003cspan address=\"10.1186/1471-2407-9-175\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShao, Y. et al. Expression and epigenetic regulatory mechanism of BNIP3 in clear cell renal cell carcinoma. \u003cem\u003eInt. J. Oncol.\u003c/em\u003e \u003cb\u003e54\u003c/b\u003e, 348\u0026ndash;360. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3892/ijo.2018.4603\u003c/span\u003e\u003cspan address=\"10.3892/ijo.2018.4603\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, Y., Han, C., Lu, L., Magliato, S. \u0026amp; Wu, T. Hedgehog signaling pathway regulates autophagy in human hepatocellular carcinoma cells. \u003cem\u003eHepatol. (Baltimore Md)\u003c/em\u003e. \u003cb\u003e58\u003c/b\u003e, 995\u0026ndash;1010. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/hep.26394\u003c/span\u003e\u003cspan address=\"10.1002/hep.26394\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBellot, G. et al. Hypoxia-induced autophagy is mediated through hypoxia-inducible factor induction of BNIP3 and BNIP3L via their BH3 domains. \u003cem\u003eMol. Cell. Biol.\u003c/em\u003e \u003cb\u003e29\u003c/b\u003e, 2570\u0026ndash;2581. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/mcb.00166-09\u003c/span\u003e\u003cspan address=\"10.1128/mcb.00166-09\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi, L. \u0026amp; Hu, F. Mitophagy in tumor: foe or friend༟. \u003cem\u003eEndokrynologia Polska\u003c/em\u003e. \u003cb\u003e74\u003c/b\u003e, 511\u0026ndash;519. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.5603/ep.95652\u003c/span\u003e\u003cspan address=\"10.5603/ep.95652\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu, Y. et al. Caveolin-1 knockdown increases the therapeutic sensitivity of lung cancer to cisplatin-induced apoptosis by repressing Parkin-related mitophagy and activating the ROCK1 pathway. \u003cem\u003eJ. Cell. Physiol.\u003c/em\u003e \u003cb\u003e235\u003c/b\u003e, 1197\u0026ndash;1208. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/jcp.29033\u003c/span\u003e\u003cspan address=\"10.1002/jcp.29033\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRao, S. et al. A dual role for autophagy in a murine model of lung cancer. \u003cem\u003eNat. Commun.\u003c/em\u003e \u003cb\u003e5\u003c/b\u003e, 3056. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/ncomms4056\u003c/span\u003e\u003cspan address=\"10.1038/ncomms4056\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSong, C. et al. A novel perspective for insighting into cancer and cancer treatment. \u003cem\u003eCell Prolif.\u003c/em\u003e \u003cb\u003e55\u003c/b\u003e, e13327. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/cpr.13327\u003c/span\u003e\u003cspan address=\"10.1111/cpr.13327\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eConcolino, G. et al. Human renal cell carcinoma as a hormone-dependent tumor. \u003cem\u003eCancer Res.\u003c/em\u003e \u003cb\u003e38\u003c/b\u003e, 4340\u0026ndash;4344 (1978).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYamamoto, H. et al. The Intrinsically Disordered Protein Atg13 Mediates Supramolecular Assembly of Autophagy Initiation Complexes. \u003cem\u003eDev. Cell\u003c/em\u003e. \u003cb\u003e38\u003c/b\u003e, 86\u0026ndash;99. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.devcel.2016.06.015\u003c/span\u003e\u003cspan address=\"10.1016/j.devcel.2016.06.015\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi, Z. \u0026amp; Nakatogawa, H. Degradation of nuclear components via different autophagy pathways. \u003cem\u003eTrends Cell Biol.\u003c/em\u003e \u003cb\u003e32\u003c/b\u003e, 574\u0026ndash;584. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.tcb.2021.12.008\u003c/span\u003e\u003cspan address=\"10.1016/j.tcb.2021.12.008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTaheriazam, A. et al. Graphene oxide nanoarchitectures in cancer biology: Nano-modulators of autophagy and apoptosis. \u003cem\u003eJ. controlled release: official J. Controlled Release Soc.\u003c/em\u003e \u003cb\u003e354\u003c/b\u003e, 503\u0026ndash;522. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.jconrel.2023.01.028\u003c/span\u003e\u003cspan address=\"10.1016/j.jconrel.2023.01.028\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCai, Y., Liu, Y., Yu, D. \u0026amp; Zhang, X. Down-regulation of transcription of the proapoptotic gene BNip3 in cultured astrocytes by murine coronavirus infection. \u003cem\u003eVirology\u003c/em\u003e. \u003cb\u003e316\u003c/b\u003e, 104\u0026ndash;115. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.virol.2003.07.007\u003c/span\u003e\u003cspan address=\"10.1016/j.virol.2003.07.007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2003).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKothari, S. et al. BNIP3 plays a role in hypoxic cell death in human epithelial cells that is inhibited by growth factors EGF and IGF. \u003cem\u003eOncogene\u003c/em\u003e. \u003cb\u003e22\u003c/b\u003e, 4734\u0026ndash;4744. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/sj.onc.1206666\u003c/span\u003e\u003cspan address=\"10.1038/sj.onc.1206666\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2003).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBurton, T. R. \u0026amp; Gibson, S. B. The role of Bcl-2 family member BNIP3 in cell death and disease: NIPping at the heels of cell death. \u003cem\u003eCell Death Differ.\u003c/em\u003e \u003cb\u003e16\u003c/b\u003e, 515\u0026ndash;523. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/cdd.2008.185\u003c/span\u003e\u003cspan address=\"10.1038/cdd.2008.185\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, X. et al. Increased expression of PSME2 is associated with clear cell renal cell carcinoma invasion by regulating BNIP3\u0026ndash;mediated autophagy. \u003cem\u003eInt. J. Oncol.\u003c/em\u003e \u003cb\u003e59\u003c/b\u003e \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3892/ijo.2021.5286\u003c/span\u003e\u003cspan address=\"10.3892/ijo.2021.5286\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang, Q. et al. MYT1L promotes the migration and invasion of glioma cells through activation of Notch signaling pathway. \u003cem\u003eScienceAsia\u003c/em\u003e. \u003cb\u003e48\u003c/b\u003e, 711. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.2306/scienceasia1513-1874.2022.100\u003c/span\u003e\u003cspan address=\"10.2306/scienceasia1513-1874.2022.100\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, C. et al. Phosphorylation of ULK1 affects autophagosome fusion and links chaperone-mediated autophagy to macroautophagy. \u003cem\u003eNat. Commun.\u003c/em\u003e \u003cb\u003e9\u003c/b\u003e, 3492. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41467-018-05449-1\u003c/span\u003e\u003cspan address=\"10.1038/s41467-018-05449-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDong, X. et al. Novel Bcl-2 Inhibitors Selectively Disrupt the Autophagy-Specific Bcl-2-Beclin 1 Protein-Protein Interaction. \u003cem\u003eACS Med. Chem. Lett.\u003c/em\u003e \u003cb\u003e13\u003c/b\u003e, 1510\u0026ndash;1516. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1021/acsmedchemlett.2c00309\u003c/span\u003e\u003cspan address=\"10.1021/acsmedchemlett.2c00309\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYou, F. F. et al. ATG 4B Serves a Crucial Role in RCE-4-Induced Inhibition of the Bcl-2-Beclin 1 Complex in Cervical Cancer Ca Ski Cells. \u003cem\u003eInt. J. Mol. Sci.\u003c/em\u003e \u003cb\u003e22\u003c/b\u003e \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms222212302\u003c/span\u003e\u003cspan address=\"10.3390/ijms222212302\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin, Y. F. et al. The role of hypoxia-inducible factor-1α in zinc oxide nanoparticle-induced nephrotoxicity in vitro and in vivo. \u003cem\u003ePart. Fibre Toxicol.\u003c/em\u003e \u003cb\u003e13\u003c/b\u003e \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12989-016-0163-3\u003c/span\u003e\u003cspan address=\"10.1186/s12989-016-0163-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMulthoff, G. \u0026amp; Vaupel, P. Hypoxia Compromises Anti-Cancer Immune Responses. \u003cem\u003eAdv. Exp. Med. Biol.\u003c/em\u003e \u003cb\u003e1232\u003c/b\u003e, 131\u0026ndash;143. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/978-3-030-34461-0_18\u003c/span\u003e\u003cspan address=\"10.1007/978-3-030-34461-0_18\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang, G., Xu, Z., Yu, M. \u0026amp; Gao, H. Bcl-2 interacting protein 3 (BNIP3) promotes tumor growth in breast cancer under hypoxic conditions through an autophagy-dependent pathway. \u003cem\u003eBioengineered\u003c/em\u003e. \u003cb\u003e13\u003c/b\u003e, 6280\u0026ndash;6292. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1080/21655979.2022.2036399\u003c/span\u003e\u003cspan address=\"10.1080/21655979.2022.2036399\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, X., Ma, S. \u0026amp; Qi, G. Effect of hypoxia-inducible factor 1-alpha on hypoxia/reoxygenation-induced apoptosis in primary neonatal rat cardiomyocytes. \u003cem\u003eBiochem. Biophys. Res. Commun.\u003c/em\u003e \u003cb\u003e417\u003c/b\u003e, 1227\u0026ndash;1234. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.bbrc.2011.12.115\u003c/span\u003e\u003cspan address=\"10.1016/j.bbrc.2011.12.115\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang, L. et al. Deferoxamine Treatment Combined With Sevoflurane Postconditioning Attenuates Myocardial Ischemia-Reperfusion Injury by Restoring HIF-1/BNIP3-Mediated Mitochondrial Autophagy in GK Rats. \u003cem\u003eFront. Pharmacol.\u003c/em\u003e \u003cb\u003e11\u003c/b\u003e, 6. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fphar.2020.00006\u003c/span\u003e\u003cspan address=\"10.3389/fphar.2020.00006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJimenez, R. E., Kubli, D. A. \u0026amp; Gustafsson, \u0026Aring;. Autophagy and mitophagy in the myocardium: therapeutic potential and concerns. \u003cem\u003eBr. J. Pharmacol.\u003c/em\u003e \u003cb\u003e171\u003c/b\u003e, 1907\u0026ndash;1916. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/bph.12477\u003c/span\u003e\u003cspan address=\"10.1111/bph.12477\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMazure, N. M. \u0026amp; Pouyss\u0026eacute;gur, J. Hypoxia-induced autophagy: cell death or cell survival? \u003cem\u003eCurr. Opin. Cell Biol.\u003c/em\u003e \u003cb\u003e22\u003c/b\u003e, 177\u0026ndash;180. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ceb.2009.11.015\u003c/span\u003e\u003cspan address=\"10.1016/j.ceb.2009.11.015\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKang, R., Zeh, H. J., Lotze, M. T. \u0026amp; Tang, D. The Beclin 1 network regulates autophagy and apoptosis. \u003cem\u003eCell Death Differ.\u003c/em\u003e \u003cb\u003e18\u003c/b\u003e, 571\u0026ndash;580. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/cdd.2010.191\u003c/span\u003e\u003cspan address=\"10.1038/cdd.2010.191\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHanna, R. A. et al. Microtubule-associated protein 1 light chain 3 (LC3) interacts with Bnip3 protein to selectively remove endoplasmic reticulum and mitochondria via autophagy. \u003cem\u003eJ. Biol. Chem.\u003c/em\u003e \u003cb\u003e287\u003c/b\u003e, 19094\u0026ndash;19104. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1074/jbc.M111.322933\u003c/span\u003e\u003cspan address=\"10.1074/jbc.M111.322933\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLemasters, J. J. Selective mitochondrial autophagy, or mitophagy, as a targeted defense against oxidative stress, mitochondrial dysfunction, and aging. \u003cem\u003eRejuven. Res.\u003c/em\u003e \u003cb\u003e8\u003c/b\u003e, 3\u0026ndash;5. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1089/rej.2005.8.3\u003c/span\u003e\u003cspan address=\"10.1089/rej.2005.8.3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2005).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBernardi, P. et al. The mitochondrial permeability transition from in vitro artifact to disease target. \u003cem\u003eFEBS J.\u003c/em\u003e \u003cb\u003e273\u003c/b\u003e, 2077\u0026ndash;2099. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/j.1742-4658.2006.05213.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1742-4658.2006.05213.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2006).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChourasia, A. H. et al. Mitophagy defects arising from BNip3 loss promote mammary tumor progression to metastasis. \u003cem\u003eEMBO Rep.\u003c/em\u003e \u003cb\u003e16\u003c/b\u003e, 1145\u0026ndash;1163. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.15252/embr.201540759\u003c/span\u003e\u003cspan address=\"10.15252/embr.201540759\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eO'Flanagan, C. H. \u0026amp; O'Neill, C. PINK1 signalling in cancer biology. \u003cem\u003eBiochim. Biophys. Acta\u003c/em\u003e. \u003cb\u003e1846\u003c/b\u003e, 590\u0026ndash;598. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.bbcan.2014.10.006\u003c/span\u003e\u003cspan address=\"10.1016/j.bbcan.2014.10.006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen, Y. et al. Ketoconazole exacerbates mitophagy to induce apoptosis by downregulating cyclooxygenase-2 in hepatocellular carcinoma. \u003cem\u003eJ. Hepatol.\u003c/em\u003e \u003cb\u003e70\u003c/b\u003e, 66\u0026ndash;77. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.jhep.2018.09.022\u003c/span\u003e\u003cspan address=\"10.1016/j.jhep.2018.09.022\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDing, Q. et al. The role of the apoptosis-related protein BCL-B in the regulation of mitophagy in hepatic stellate cells during the regression of liver fibrosis. \u003cem\u003eExp. Mol. Med.\u003c/em\u003e \u003cb\u003e51\u003c/b\u003e, 1\u0026ndash;13. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s12276-018-0199-6\u003c/span\u003e\u003cspan address=\"10.1038/s12276-018-0199-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2019).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Renal cell carcinoma, BNIP3, B-cell lymphoma-2, HIF-1α, autophagy, apoptosis","lastPublishedDoi":"10.21203/rs.3.rs-5095557/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5095557/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThis research aimed to examine the function of BNIP3(BCL2/adenovirus E1B 19 kDa interacting protein 3) overexpression in mediating autophagy and promoting apoptosis in renal cell carcinoma (RCC) and its possible molecular mechanism. The expressions of BNIP3 mRNA, BNIP3 and HIF-1α proteins in A498, 786-O, CAKI-1, ACHN, and GRC were detected by RT-qPCR (real-time quantitative polymerase chain reaction) and Western Blot, respectively. BNIP3 was overexpressed using pcDNA-BNIP3. The effects of overexpression of BNIP3 on the proliferation, invasion, and apoptosis of RCC cells was examined through various techniques including CCK-8 assay (cell counting kit-8), cloning assays, Transwell migration assays, flow cytometry analysis, and Western Blot analysis. The interaction between BNIP3, Beclin1, and BCL-2 was assessed using co-immunoprecipitation to determine their binding affinity. Immunofluorescence, transmission electron microscopy, ELISA and Western Blot were used to study the effect of BNIP3 overexpression on autophagy in RCC under normal and hypoxia conditions. The flow cytometry and Western Blot techniques were employed to assess the RCC apoptosis following administration of the autophagy inhibitor 3-MA. The impact of BNIP3 overexpression on RCC growth was measured in vitro. Subcutaneous tumor xenograft experiments were conducted by injecting 786-O cells into BALB/c nude mice. The size and weight of xenograft tumors were measured. HE staining and immunohistochemistry to analyze the cell morphology and the expression of BNIP3 and Ki67 proteins in tumors. TUNEL staining was used to observe tumor cell apoptosis. LC3-Ⅱ/Ⅰ, p62, caspase3, cleaved caspase3, and Bax proteins expression were detected by Western blot. The results showed that BNIP3 overexpressed RCC proliferation activity and invasion ability decreased, and apoptosis ability increased. Under hypoxic conditions, the activation of RCC autophagy was induced by BNIP3 through its ability to disrupt the interaction between BCL-2 and Beclin1. Activation of autophagy induced by BNIP3 was found to promote apoptosis in RCC cells, thereby expediting the progression of tumorigenesis in vivo. Collectively, these findings provide evidence for the suppressive impact of BNIP3 overexpression on tumor growth in hypoxic conditions by inducing autophagy and facilitating apoptosis in RCC cells. Moreover, this study identifies potential targets for therapeutic interventions against RCC.\u003c/p\u003e","manuscriptTitle":"Overexpression of BNIP3 in renal carcinoma cells can promote apoptosis of renal carcinoma cells through HIF-1α-BNIP3-mediated autophagy","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-12-06 08:28:02","doi":"10.21203/rs.3.rs-5095557/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"578a8cb1-9e2f-4645-9cb2-fb2084882f7f","owner":[],"postedDate":"December 6th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":40083232,"name":"Health sciences/Urology"},{"id":40083233,"name":"Health sciences/Oncology/Cancer/Urological cancer/Renal cancer"},{"id":40083234,"name":"Health sciences/Oncology/Cancer/Cancer genomics"}],"tags":[],"updatedAt":"2025-05-29T17:53:15+00:00","versionOfRecord":[],"versionCreatedAt":"2024-12-06 08:28:02","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5095557","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5095557","identity":"rs-5095557","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-22T02:00:06.705733+00:00
License: CC-BY-4.0