Analysis of Intracellular Communication Reveals Consistent Gene Changes Associated with Early-Stage Acne Skin | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Analysis of Intracellular Communication Reveals Consistent Gene Changes Associated with Early-Stage Acne Skin Min Deng, Woodvine O. Odhiambo, Min Qin, Thao Tam To, Gregory M. Brewer, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4402048/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 14 Aug, 2024 Read the published version in Cell Communication and Signaling → Version 1 posted 9 You are reading this latest preprint version Abstract A comprehensive understanding of the intricate cellular and molecular changes governing the complex interactions between cells within acne lesions is currently lacking. Herein, we analyzed early papules from six subjects with active acne vulgaris, utilizing single-cell and high-resolution spatial RNA sequencing. We observed significant changes in signaling pathways across seven different cell types when comparing lesional skin samples (LSS) to healthy skin samples (HSS). Using CellChat, we constructed an atlas of signaling pathways for the HSS, identifying key signal distributions and cell-specific genes within individual clusters. Further, our comparative analysis revealed changes in 49 signaling pathways across all cell clusters in the LSS— 4 exhibited decreased activity, whereas 45 were upregulated, suggesting that acne significantly alters cellular dynamics. We identified ten molecules, including GRN, IL-13RA1 and SDC1 that were consistently altered in all donors. Subsequently, we focused on the function of GRN and IL-13RA1 in TREM2 macrophages and keratinocytes as these cells participate in inflammation and hyperkeratinization in the early stages of acne development. We evaluated their function in TREM2 macrophages and the HaCaT cell line. We found that GRN increased the expression of proinflammatory cytokines and chemokines, including IL-18, CCL5, and CXCL2 in TREM2 macrophages. Additionally, the activation of IL-13RA1 by IL-13 in HaCaT cells promoted the dysregulation of genes associated with hyperkeratinization, including KRT17, KRT16, and FLG. These findings suggest that modulating the GRN-SORT1 and IL-13-IL-13RA1 signaling pathways could be a promising approach for developing new acne treatments. Cell-cell communication acne vulgaris signal distribution Cutibacterium acnes single cell and spatial transcriptomic sequencing inflammation TREM2 macrophages GRN hyperkeratinization IL-13RA1 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Acne vulgaris, the most common dermatological condition worldwide, presents as a chronic inflammatory and recurrent disease marked by a spectrum of lesions, including non-inflamed (both open and closed comedones) and inflamed (macules, papules, pustules, and nodules). Approximately 95% of boys and 85% of girls experience acne during adolescence, with nearly half of them experiencing it to adulthood 1 . The scarring and post-inflammatory hyperpigmentation caused by acne can severely affect an individual's quality of life, highlighting the importance of early and effective therapy. The development of acne is driven by four key processes within the pilosebaceous unit (PSU): inflammation, epithelial hyperkeratinization, hyperseborrhea accompanied by proinflammatory lipids, and colonization by Cutibacterium acnes ( C. acnes) bacteria 1 . Despite significant progress in elucidating the pathophysiology and treatment mechanisms of acne, it is important to identify the shared dysregulated signaling pathways in individuals with acne. Targeting these shared signaling pathways can significantly improve the effectiveness of current acne treatments in affected patients. Skin homeostasis relies on a sophisticated network of resident cells, each performing unique biological functions and engaging in complex signaling pathways mediated by intricate ligand-receptor interactions 2–5 . The epidermis hosts various cells such as keratinocytes, melanocytes, Langerhans cells and merkel cells. Among them, basal keratinocytes serve as epithelial stem cells, crucial for proliferation and differentiation, ensuring the daily renewal of the epidermis. In the dermis and hypodermis, a diverse array of cells including fibroblasts, immune cells, endothelial cells, nerves, and adipocytes form a harmonized network. Dysregulated signaling among these cells has been implicated in various skin disorders such as vitiligo, impaired wound healing, aging, psoriasis, and dermatitis 2–5 . In acne lesions, excessive squalene production by keratinocytes and sebocytes triggers TREM2 macrophage differentiation, enhancing immune cell migration and fueling the inflammatory cascade 6 . Moreover, sebocytes adjacent to the PSU in acne lesions release CXCL8, attracting neutrophils, monocytes, and T cells, in addition to secreting IL-6, TGF‐β, and IL-1β, which drive the differentiation of T helper 17 cells (Th17 cells) 7 . Our previous studies demonstrated that C. acnes ribotypes differentially regulate the fate of Th17 responses in the skin 8, 9 . However, the comprehensive and conserved changes in intercellular communication within acne-affected skin are yet to be thoroughly investigated. In this study, we examined global changes in intercellular communication by analyzing single cell RNA sequencing (scRNA-seq) and spatial transcriptomic data from six patients with papular acne. Our findings reveal that acne triggers significant alterations in 49 signaling pathways across all skin cell clusters compared to nonlesional areas. We also identified 10 genes related to these signaling pathways that were consistently dysregulated in all donors. Our focus was primarily drawn to genes that were enriched and upregulated in keratinocytes and immune cells, particularly myeloid cells and lymphocytes, as they play key roles in inflammation and hyperkeratinization during the onset of acne. Among these genes, we observed significant upregulation of GRN and IL-13RA1 within TREM2-expressing macrophages and basal keratinocytes, respectively. Furthermore, we found that GRN and its receptor SORT1 were upregulated in IL-4-induced TREM2 macrophages, and treatment with GRN led to increased expression of proinflammatory cytokines and chemokines from these cells. Concurrently, treating human HaCaT cells with IL-13 to activate IL-13RA1 signaling resulted in dysregulation of KRT16, KRT17 , and FLG expression, which are associated with hyperproliferation-associated phenotypes in acne. Our findings suggest that GRN and IL-13RA1 are key players in the inflammation and hyperkeratinization process during acne development, highlighting their potential as novel therapeutic targets for acne treatment. Results Overall cell-cell communications and signal distributions in normal skin To investigate the cell-cell communication in acne-affected skin, we first sought to display the overall signal distributions in normal skin samples as a reference point. Although several studies have explored the cell-cell interactions in aging, wound healing, psoriasis, and dermatitis in both mice and humans, there remains a gap in understanding the overall signal distribution in distinct cell types in normal human skin, which can be used as a baseline to compare with various skin diseases 2, 3 . To bridge this gap, we leveraged our previously published dataset, which sampled normal skin from the back of six individuals with active early-stage acne vulgaris, approximately 24 hours of onset. The dataset consists of 29,202 cells of 8 different types: endothelial cells (ECs), fibroblasts, lymphoid cells, smooth muscle, myeloid cells, two populations of keratinocytes (KCs) (Keratinocyte 1 and Keratinocyte 2), and melanocytes ( Fig. 1 A and Figure S1 A) . In our analysis, we identified KC1s as typical epithelial cells based on their specific expression of KRT14, KRT10, and KRT5. Conversely, KC2 was classified as sweat gland cells due to their high expression of cell markers such as KRT18, KRT19, KRT7, AQP5, and CEACAM5 (Figure S1 B) 10, 11 . Using CellChat, we further analyzed this dataset to infer the cell-cell communication network, which revealed that all cell groups actively engage in mutual signaling with each other. Notably, ECs, fibroblasts, and myeloid cells showed the most significant number of interactions and the largest weights of cell interactions, which likely correlates with the high abundance of these cell types in the skin ( Fig. 1 B and S1C ) . To understand the signal pathway distributions in each cell cluster and where these signals target, we analyzed the key incoming and outgoing signal patterns, detecting a total of 55 distinct signals. Outgoing patterns illustrate the distribution of signals secreted by sender cells and how the weights are distributed, whereas the incoming patterns reflect the reception of signals sent from others ( Fig. 1 C ) . Within these signaling pathways, some featured the expression of both ligands and receptors within the same cell type. We categorized these autocrine pathways as follows: I) IL-6, LIFR, OSM, CSF3, BMP, TRAIL, and FASLG; II) FGF, MSTN, GDNF, EPO, GH, PRL, and FLT3; III) LT and IL-2; IV) EGF, PARs, NMU, IL-10, HGF, BAFF, and WNT; V) NT and ANGPT; VI) IL-1, IL-4, CSF, and NPR2; VII) KIT, and BTLA. Each pathway operates within endothelial cells, fibroblasts, lymphocytes, keratinocytes, smooth muscle cells, myeloid cells, and melanocytes, respectively, serving diverse functions and establishing signaling circuits that support processes such as tissue development, cell survival, regulation of inflammation, immune response, and cell death 12–15 . Simultaneously, every cell type communicates with others in a paracrine manner. ECs have long been known to maintain vascular homeostasis and provide paracrine support to surrounding non-vascular cells, as well as modulating inflammation by regulating immune cell trafficking, activation status, and function 16, 17 . Compared to other cell types, we particularly observed that ECs sent the strongest CD40 signaling out while receiving signals such as CCL, CXCL, VEGF, TGFβ, SEMA3, CALCR, and NGF signals from other cell types (Fig. 1 C). Fibroblasts were identified as the strongest source of signals such as PTN, IGF, COMPLEMENT, PERIOSTIN, ACTIVIN, PSAP, and NGF to other cell types, and they predominantly received PDGF, IFN-II and GRN signals, highlighting their role in tissue homeostasis and disease through growth factors/hormone production and extracellular matrix formation 18, 19 . Smooth muscle cells were notable for sending signals like CCL, MIF, PDGF, GAS and EDN, which are crucial for involuntary muscle contractions and in regulating physiological processes such as blood flow 20 . As predominant immune cells in the skin, lymphocytes and myeloid cells were identified as strong sources of TGFβ, VEGI, CXCL, VISFATIN, VEGF, IFN-II, and GRN signals, while primarily receiving MIF and COMPLEMENT signals. Keratinocytes are key component of the skin barrier and structural cells. They were the strongest source of CALCR signals, receiving various strong signals including PTN, PERIOSTIN, NRG, ACTIVIN, LIGHT, PSAP, and VEGI. Lastly, melanocytes, which are responsible for skin and hair pigmentation, sent out the strongest SEMA3, NRG and LIGHT signals, and received the strongest VISFATIN, IGF, EDN and CD40 signals, underlining their critical role in determining skin color and hair characteristics. As every signal pathway consists of numerous ligand-receptor pairs, we further narrowed down our scope and focused on identifying key ligand and receptor genes that were not only from the strongest pathways but also exhibited unique expression within specific cell clusters. To achieve this, we analyzed all ligand-receptor pairs and their relative contribution within each cluster (Figure S2-S9). Through this comprehensive approach, we identified specific ligand and receptor genes by compiling them from the top three outgoing and incoming signals (Table 1 ), as well as the top ten ligand-receptor pairs contributed by each cluster (Figs. 1 D and S10A). Subsequent validation of these gene expression patterns against two additional skin datasets confirmed the consistency of our findings (Figs. 1 F- 1 E, Figures S10B-S10C, and Figures S11-S17 ) 21, 22 . In endothelial cells, we identified ligands (FLT1 23 , CCL14 24 , CSF3 25 ) and receptors (ACKR1 26 , LIFR 14 , TGFBR2 27 ), that are either known cell markers for endothelial cells or are involved in processes such as angiogenesis, migration, immune cell recruitment, vascular integrity ( Figures S11 ). We found ligands (CXCL12 28 , PTN 29 , C3 30 , FGF7 31 ) and receptors (PDGFRA 32 , SDC2 33 , ACVR1 34 , FGFR1 35 ) were mainly expressed in fibroblasts ( Figures S12-S13 ). Ligands TGFB1, CCL5 and receptors CXCR4, IL-7R, LTB, IL-2RG, and ITGB2 were found to be highly expressed in lymphocytes ( Figures S14 ). In myeloid cells, enriched ligands (NAMPT, CXCL8, IL1B, VEGFA, and CXCL3) and the receptors (CD74, CD44, IL-1R2 and ITGAX) were identified ( Figures S15-S16 ). KC1 showed enrichment for ligand AREG and receptors (EGFR and ERBB2) ( Figures S17A-S17B ). Smooth muscle cells showed distinct expression of ligand PDGFA ( Figures S17C ). No signaling pathway-associated genes specific to KC2 and melanocytes were identified. These findings suggest that genes derived from signaling pathways could serve as additional markers for cell cluster annotation in the skin. Table 1 Top 3 outgoing and incoming signals from each cell type in normal skin samples Outgoing signal Incoming signal Sender L-R pair Receiver Receiver L-R pair Sender Endothelial cell CCL2 − ACKR1 Endothelial cell Endothelial cell CXCL8 − ACKR1 Myeloid cell CCL14 − ACKR1 Endothelial cell CCL2 − ACKR1 Smooth muscle CXCL2 − ACKR1 Endothelial cell CXCL2 − ACKR1 (F-E) Fibroblast Fibroblast CXCL2 − ACKR1 Endothelial cell Fibroblast NAMPT − (ITGA5 + ITGB1) Myeloid cell CXCL3 − ACKR1 Endothelial cell NAMPT − (ITGA5 + ITGB1) Endothelial cell CCL2 − ACKR1 Endothelial cell NAMPT − (ITGA5 + ITGB1) Smooth muscle Lymphocyte CXCL12 − CXCR4 Lymphoid Lymphocyte NAMPT − (ITGA5 + ITGB1) Myeloid cell MIF − (CD74 + CD44) Myeloid cell CXCL12 − CXCR4 Lymphocyte IL7 − (IL7R + IL2RG) Lymphoid NAMPT − (ITGA5 + ITGB1) Endothelial cell KC1 CCL27 − CCR2 Smooth muscle KC1 PTN − SDC1 Fibroblast CCL27 − CCR2 Endothelial cell PTN − SDC4 Fibroblast MIF − (CD74 + CD44) Myeloid cell PTN − NCL Fibroblast Smooth muscle CCL2 − ACKR1 Endothelial cell Smooth muscle CCL2 − CCR2 Smooth muscle CCL2 − CCR2 Smooth muscle CCL27 − CCR2, Keratinocyte 1 CXCL2 − ACKR1 Endothelial cell CCL2 − CCR2 Endothelial cell Myeloid cell CXCL8 − ACKR1 Endothelial cell Myeloid cell MIF − (CD74 + CD44) Smooth muscle CXCL2 − ACKR1 Endothelial cell MIF − (CD74 + CD44) Melanocytes CXCL3 − ACKR1 Endothelial cell MIF − (CD74 + CD44) Keratinocyte 2 KC2 CCL2 − ACKR1 Endothelial cell KC2 CXCL8 − ACKR1 Myeloid cell CXCL2 − ACKR1 Endothelial cell CCL2 − ACKR1 Smooth muscle MIF − (CD74 + CD44) Myeloid cell CXCL2 − ACKR1 Fibroblast Melanocyte CCL2 − ACKR1 Endothelial cell Melanocyte NAMPT − (ITGA5 + ITGB1) Myeloid cell MIF − (CD74 + CD44) Myeloid cell NAMPT − (ITGA5 + ITGB1) Endothelial cell CCL2 − CCR2 Smooth muscle NAMPT − (ITGA5 + ITGB1) Smooth muscle Table 2 q-PCR primers Gene name sequence (5' -> 3') GAPDH -F CTGGGCTACACTGAGCACC GAPDH -R AAGTGGTCGTTGAGGGCAATG TREM2 -F GGTCAGCACGCACAACTTG TREM2 -R CGCAGCGTAATGGTGAGAGT GRN -F1 CCCTGGCAAAGAAGCTCCC GRN -R1 AGCTCACAGCAGGTAGAACCA SORT1 -F GGGGACACATGGAGCATGG SORT1 -R GGAATAGACAATGCCTCGATCAT IL13RA1 -F GTCCCAGTGTAGCACCAATGA IL13RA1 -R GCTCAGGTTGTGCCAAATGC KRT16 -F GACCGGCGGAGATGTGAAC KRT16 -R CTGCTCGTACTGGTCACGC KRT17 -F GCCGCATCCTCAACGAGAT KRT17 -R CGCGGTTCAGTTCCTCTGTC IL4R -F ACACCAATGTCTCCGACACTC IL4R -R TGTTGACTGCATAGGTGAGATGA KRT6A -F CTGAATGGCGAAGGCGTT KRT6A -R CTGCCGACACCACTGGC Filaggrin -F GGCACTGAAAGGCAAAAAGG Filaggrin -R AGCTGCCATGTCTCCAAACTA Acne triggers significant signaling pathway changes across all cell clusters within the skin. To elucidate the changes of cell-cell interactions from nonlesional to lesional samples, we initially integrated the datasets of nonlesional and lesional samples ( Fig. 2 A ) , and as demonstrated by Tran et al. we also observed significant changes in cellular compositions, especially in KC2 and fibroblasts 6 ( Fig. 2 B ) . Further analysis of each signaling pathways revealed an increase in both the strength and number of signaling pathways in lesional compared to nonlesional samples (Figure S18A-S18B) . We identified changes in 49 signal distributions: (i) one signal was turned off (MSTN), (ii) three signals were decreased (CCL, FLT3, NT), (iii) ten signals were turned on (IL-17, CX3C, TAC, NPR1, TWEAK, PROS, ANGPTL, GALECTIN, MK and SPP1), and (iv) thirty-five signals were increased (including BAFF, NGF, WNT) ( Fig. 2 C ) . We found that these signal changes involved all cell clusters, indicating the possibility that immune responses within acne skin trigger responses across every cell type ( Fig. 2 D- 2 E ) . Of the ten signaling pathways that were turned on, IL-17, NPR1, GALECTIN and SPP1 mainly derived from myeloid cells and targeted KC2, endothelial cells, lymphocytes, and fibroblasts, respectively. The presence of IL-17 signaling in acne, is consistent with our previous findings 36 . PROS and TWEAK signals originated from melanocytes and can target both smooth muscle and melanocytes. A case-controlled study of 100 acne vulgaris patients reported that acne patients had significant elevation in TWEAK serum levels when compared to the control subjects, which is consistent with our findings 37 . TAC and CX3C signals interact in an autocrine way in endothelial cells and KC2. MK signals mainly from fibroblasts target melanocytes, whereas ANGPTL signals from KC1 target fibroblasts. These changes occurred across all cell types were further supported by the observed significant increase in the expression level of ligands and receptors associated with the ten turn-on signaling pathways in lesional samples of acne (Fig. 2 F- 2 G ) . Activation of GRN and IL-13RA1-related signals. To account for the diversity in signaling pathway alterations observed across different donors and the impact of outliers, we aimed to identify significant differences in gene expression within each matched pair of nonlesional and lesional samples from six donors. We performed a differential analysis on all 232 genes associated with the 49 altered signaling pathways, these genes exhibited seven distinct expression profiles ( Fig. 3 A). Among them, 26 genes (11.2%) displayed significant differences between nonlesional and lesional samples within each patient ( Fig. 3 B and Figure S19 ). Conversely, 52 genes (22.4%) showed no differences across all six individuals, while 27 (11.6%), 24 (10.3%), 27 (11.6%), 37 (16%), and 39 (16.8%) genes exhibited significant differences in 1, 2, 3, 4, and 5 matched nonlesional and lesional sample pairs, respectively ( Fig. 3 A ) . Previous studies have indicated that papules can form in under 6 hours and exhibit a profound inflammatory response as evidenced by increased levels of CD4 T cells, neutrophils, and CD68 + macrophages in acne biopsies. However, KC did not exhibit abnormal proliferation compared to normal skin at that time point 38 . Given that our samples were collected from patients at approximately 24 hours into the disease course, later than the 6 hour-mark, we focused on genes linked to signaling pathways in lymphocytes, myeloid cells, and basal cells in KC. These genes may be associated with inflammation and hyperkeratinization during this period. In these three cell types, only 5 genes ( GRN , IL13RA1 , IL4R , FAS and SDC1 ) showed consistent expression patterns across all matched pairs in all patients ( Fig. 3 C ) . Among these, GRN, also known as the granulin precursor and a multifunctional growth factor, has been identified in macrophages across various organs, including the lung and brain 39, 40 . GRN plays a dual function in regulating inflammation and is associated with processes such as tumorigenesis, neurodegeneration, wound healing, and early embryogenesis. In our dataset, GRN primarily originates from myeloid cells including TREM2 macrophages, M1 and M2 macrophages, CD1C dendritic cells (DCs), Langerhans and LAMP3 DCs (Figure S20A-S20B). Notably, we observed higher expression of GRN in TREM2 macrophages and M2-like macrophages in lesional skin compared to nonlesional skin ( Fig. 3 D ) . Given that TREM2 macrophages have been implicated in driving inflammation in acne 6 , our subsequent analyses focused on the function of GRN within these cells. IL-13RA1 was also upregulated in lesional skin, primarily originating from myeloid cells ( Fig. 3 C ) . However, it was either downregulated or showed no significant difference in subsets of myeloid cells, implying that increased expression levels of IL-13RA1 came from other cell types in lesional skin ( Fig. 3 E ) . Therefore, our focus shifted to the second largest source of IL-13RA1 , which was KC1. Specifically, we focused on basal cells from KC1 given their critical role in skin self-renewal and their significant involvement in hyperkeratinization within the epidermis. We found that IL-13RA1 was markedly upregulated in lesional basal cells compared to nonlesional ones ( Fig. 3 F, Figure S20C-S20D) . This observation aligns with a study suggesting that IL-13, produced by group 2 innate lymphoid cells in the crypt niche, interacts with IL-13RA1 on Lgr5 + intestinal stem cells 41 , suggesting potential involvement of IL-13RA1 in hyperkeratinization during acne development. Additionally, SDC1 was highly expressed in KC1, but showed no significant difference in basal cells between the two conditions (Fig. 3 G). IL-4R and FAS were predominantly expressed in lymphocytes; however further analysis revealed that neither IL-4R nor FAS showed significant changes in lymphocytes subsets ( Fig. 3 H and Figure S20E-S20F) . Consequently, we chose not to investigate these three genes further. Next, to spatially localize GRN and IL-13RA1 expression in acne skin, we used the Seq-Scope sequencing dataset obtained from acne lesions and segmented the histological area using 10 µm-sided square grids 6 . The analyzed specimen featured a hair follicle surrounded by an inflammatory infiltrate. Each grid detected an average of 145 genes across 3558 grids, enabling the identification of eight distinct cell populations including KRT5 and KRT16 keratinocytes, fibroblasts, endothelial cells, TREM2 macrophages, B cells, other macrophages, and various other cell types. ( Fig. 4 A ). Our initial focus on GRN expression revealed its prominence in TREM2 macrophage where it co-localized with TREM2 macrophage marker, APOE , both in scRNA-seq and Seq-Scope dataset ( Fig. 4 B- 4 C ). To identify the receptor for GRN, we analyzed the contribution of all ligand-receptor (L-R) pairs in GRN signaling. Our findings revealed that only one receptor, Sortilin ( SORT1 ), was detected and significantly upregulated in TREM2 macrophages. Furthermore, SORT1 was found to colocalize with GRN in acne lesions ( Fig. 4 D- 4 F ). This L-R binding was first identified in the brain, underscores SORT1’s role in mediating rapid endocytosis and lysosomal localization of GRN, central in the development of inherited frontotemporal lobar degeneration 42 . Other studies have also shown that both GRN and SORT1 are key regulators of inflammation 43, 44 . Our findings showing GRN + cells also expressing SORT1 in lesions, suggest that the GRN-SORT1 axis functions in an autocrine manner within TREM2 macrophages. Additionally, IL-13RA1 was co-localized with basal KCs, marked by KRT14 and KRT5 45, 46 , consistent with the scRNA-seq data ( Fig. 4 G- 4 H). Subsequent analysis of the relative contribution of each L-R pair revealed that both IL-4 and IL-13 ligands can interact with IL-13RA1 ( Fig. 4 I ) . Subsequently, IL-13RA1 may be regulated by IL-4 and IL-13 in the basal KCs of the skin. Activation of GRN and IL-13RA1 exacerbates inflammation and hyperkeratinization both of which are critical in acne progression. Next, to explore the function of GRN in TREM2 macrophages, we induced TREM2 macrophage differentiation in vitro using macrophage colony-stimulating factor (M-CSF) and IL-4 as previously described ( Fig. 5 A ) 6, 47 . We observed that the combination of M-CSF/IL-4 induced higher TREM2 expression compared to M-CSF alone ( Fig. 5 B ) . Further analysis revealed that both GRN and SORT1 were upregulated in MCSF/IL-4-induced TREM2 macrophages, suggesting that GRN may play a significant role in TREM2 macrophages activation through its interaction with SORT1 ( Fig. 5 C ). Tran et al . reported that TREM2 macrophages elicit a proinflammatory response by increasing the expression of proinflammatory cytokines and chemokines, such as IL-18, CCL5, and CXCL2 6 . To investigate the involvement of GRN in the proinflammatory activity of TREM2 macrophages, we treated these cells with recombinant GRN protein, which induced SORT1 expression ( Fig. 5 D ) . Our results demonstrated that treatment with 10 ng/ml of GRN activated the upregulation of SORT1 . Intriguingly, higher concentrations of GRN did not enhance the SORT1 response, prompting the selection of 10 ng/ml of GRN as the optimal concentration for further studies ( Fig. 5 E ) . This treatment also elevated levels of proinflammatory cytokines (IL-18, CCL5, and CXCL2) known to activate the canonical inflammatory NF-kB pathway, recruiting T cells, mast cells, and natural killer cells, as well as promoting neutrophil infiltration 48–50 ( Fig. 5 F ) . These observations were corroborated by the colocalization of GRN + cells with IL-18, CCL5, and CXCL2-expressing cells in acne lesions ( Fig. 5 G- 5 H ). Additionally, we observed that GRN promotes the expression of proinflammatory cytokines ( TNFA , IL-1B , and IL-6 ) in TREM2 macrophages (Fig. 5 I ) , and the coexpression of TNFA and IL-1B can be found within GRN + cells ( Figure S21A-S21B). Altogether, these data suggest that GRN amplifies the inflammatory response in TREM2 macrophages. Hyperkeratinization, a key initial event in microcomedone formation, can be caused by anomalies in the differentiation, adhesion, and proliferation within the follicular infundibulum. Molecular markers such as KRT6, KRT16 and KRT17 are upregulated, whereas filaggrin (FLG), a marker for keratinocyte differentiation, is downregulated in established microcomedones 51–53 . To investigate the role of IL-13RA1 in hyperkeratinization, we activated IL-13RA1 in the keratinocyte cell line (HaCaT) with its ligands IL-13 and IL-4. Our findings revealed that compared to the control group, IL-13 treatment significantly upregulated the expression of both IL-13RA1 and IL-4R in HaCaT cells ( Fig. 5 J- 5 K ) . In contrast, IL-4 treatment either did not alter or downregulate IL-13RA1 and IL-4R expression (Figure S21C) , indicating that only IL-13 activate IL-13RA1 in keratinocytes, which is consistent with the findings in intestinal epithelial cells and bone marrow-derived macrophage 41 54 . Subsequent analysis showed that IL-13 treatment led to increased expression of KRT16 and KRT17 , accompanied by reduced FLG expression, these gene expression patterns were consistent with our scRNA-seq data ( Fig. 5 L- 5 M ) . However, no significant change was observed in KRT6A expression (Figure S21D) . Collectively, these data suggest that IL-13RA1 signaling may play a significant role in driving the dysregulation of genes related to hyperkeratinization, contributing to the development of acne in human skin. Discussion In our study, we first investigated the distribution of signaling pathways within different cell types in both normal and acne skin. Through detailed analysis, we identified 49 signaling pathways that were altered in acne, along with genes showing consistent expression changes across all donors. Our subsequent focus centered on examining the roles of GRN in TREM2 macrophages and IL-13RA1 in keratinocyte basal cells given their consistent alterations across donors and potential importance in acne development. Using spatial-seq datasets, we confirmed the expression and colocalization of these genes with their respective cell types in acne samples. Further exploration of their functional roles in vitro revealed that GRN may exacerbate acne progression by enhancing inflammation in TREM2 macrophages, as demonstrated by its induction of inflammatory cytokines and chemokine expression. Conversely, the upregulation of IL-13RA1 in basal cells suggests its potential involvement in hyperkeratinization. We activated IL-13RA1 by IL-13 in the HaCaT cell line, which resulted in the dysregulation of genes associated with hyperkeratinization, further implicating its role in acne development. Together, our findings shed light on the complex interplay between inflammation and hyperkeratinization in acne pathogenesis, while also highlighting GRN and IL-13RA1 as promising therapeutic targets for acne (Fig. 6 ) . The initial phase of acne is characterized by the presence of microcomedones, which progresses into papules, pustules, nodules, and cysts as the severity worsens. Studies have indicated the involvement of various innate and adaptive immune cells, including Th1 55 , Th17 56 , Foxp3 + , CD1 + , CD83 + DCs 57 , CD68 + macrophages, and activated mast cells in the early events, along with the secretion of proinflammatory cytokines and chemokines. Limited studies have comprehensively explored dysregulated signaling pathways in different skin cell clusters. In our study, we detected 49 altered signaling pathways encompassing 232 genes in lesional samples compared to nonlesional samples across all cell clusters. Subsequent analysis revealed that not all these genes exhibit significant changes in all donors. However, we identified 10 genes that were consistently dysregulated in all donors and specifically expressed in lymphocytes, myeloid cells, keratinocytes, fibroblasts, and smooth muscle. Among these, Dahl et al. observed C3 presence at the dermo-epidermal junction in the majority of inflammatory acne lesions, contrasting with non-inflammatory samples 58 . This observation was further supported by Scott et al ., who associated early complement activation with acne inflammation 59 , and these findings also align with our results that fibroblast-derived C3 is upregulated in acne. The A > G polymorphism in the IL-4R gene has been associated with heightened allergic and immune-mediated disorders 60 . In a study by Robaee et al ., a comparison of genetic polymorphisms in IL-4R between 95 acne patients and 87 unrelated healthy controls revealed a significant difference in IL-4R (Q551R A/G) genotypes between the two groups 61 , yet its role in acne remains unknown. In our data, IL-4R was mainly expressed in lymphocytes, but no significant difference was found in lymphocyte subsets, so further investigation is needed to understand its function in other cell types. Moreover, the function of the other genes, including FAS, SDC1, ANGPTL2, IL-15RA, INHBA, and OSMR in lymphocytes, keratinocytes, fibroblasts, and smooth muscle, are yet to be explored, suggesting that acne involves not only the skin’s surface but also a wider systemic dysregulation. Future studies should focus on these genes to advance our understanding of acne pathogenesis. Recent research has extensively investigated the specific expression of GRN and TREM2 on microglia, the brain-resident macrophages, revealing their links to neurodegenerative disorders such as frontotemporal lobar degeneration and Alzheimer's disease 62, 63 . However, Götzl et al . discovered that microglia isolated from GRN −/− mice exhibited a hyperactivated state of the neurodegenerative phenotype molecular signature and suppression of genes characteristic of homeostatic microglia. Conversely, loss of TREM2 enhanced the expression of genes associated with a homeostatic state but reduced glucose metabolism in both conditions. This suggests that opposite microglial phenotypes lead to similar widespread brain dysfunction 64 . Our in vivo data initially revealed GRN expression predominantly in myeloid cells, with a significantly higher expression in TREM2 macrophages in lesional compared to nonlesional samples. Additionally, colocalization of GRN and TREM2 macrophages was observed in spatial-seq data. Further investigation detected higher expression of GRN in IL-4-induced TREM2 macrophages compared to non-IL-4-treated cells, indicating a strong correlation between GRN and TREM2 macrophages. The role of GRN in inflammation is diverse, showing variability across different disease conditions, tissues, and even cell types. A wealth of evidence from in vitro and animal models suggests that GRN possesses anti-inflammatory properties. GRN competitively binds with TNFR1/2 to disrupt TNF-α function, which in turn leads to increased IL-10 production in T regulatory cells in conditions such as rheumatoid arthritis and inflammatory bowel disease 65, 66 . Additionally, GRN can selectively inhibit the release of TNF-α and IFN-γ-induced CXCL9 and CXCL10 in CD4 + T cells 67, 68 . However, the interaction between GRN and TNFR1/2 appears to be complex, with some studies suggesting that GRN does not bind to TNF receptors, thus not directly influencing TNF signaling in various cell lines 69–71 . On the contrary, GRN can exhibit a pro-inflammatory effect by promoting the expression of proinflammatory cytokines such as IL-6 and IL-8 in different diseases such as psoriasis, obesity, and systemic lupus erythematosus 72–76 . These contradictory findings suggest that GRN possesses characteristics of a double-edged sword in inflammation, acting both as a protector and provocateur depending on the condition. Our studies on the effect of recombinant GRN on TREM2 macrophages indicate that GRN activates its receptor SORT1 and promotes the expression of proinflammatory cytokines and chemokines from TREM2 macrophages, thereby activating downstream NF-kB signaling pathways 48–50 . These findings suggest that the proinflammatory function of TREM2 macrophages can be driven through the GRN-SORT1 axis. IL-13RA1 serves as the receptor or coreceptor for IL-13 and IL-4, playing a critical role in type 2 immunity, which encompasses both host-protective and pathogenic functions 77 . Our data revealed that IL-13RA1 levels were either downregulated or remained unchanged in certain myeloid subsets, a trend contrary to that observed in whole-sample analyses. Therefore, we redirected our focus towards its role in keratinocytes and observed that IL-13RA1 was notably upregulated in basal cells. Previously, studies have demonstrated that IL-13 promotes the self-renewal of intestinal stem cells solely through IL-13RA1 but not IL-4R, underscoring the proliferative function of the IL13-IL13RA1 axis 41 . In the skin, IL-13 activation of IL-13RA1 disrupts the skin’s barrier function and facilitates terminal differentiation by downregulating the expression levels of epidermal barrier proteins such as FLG, loricrin (LOR), and involucrin in primary human epidermal keratinocytes 78–80 . Our findings align with these observations, as we discovered that IL-13 activation of IL-13RA1 resulted in the downregulation of FLG expression and upregulation of hyperproliferation-associated keratins KRT16 and KRT17 81, 82 . Thus, our data suggests that the IL-13-IL-13RA1 axis significantly influences keratinocyte proliferation and plays a key role in acne pathogenesis. Interestingly, TREM2 macrophages-recruited mast cell, NKT cell, T cell and neutrophils, all capable of secreting IL-13 83, 84 , this connection bridges inflammation and hyperkeratinization processes in acne, indicating that inflammation precedes and triggers hyperkeratinization. Our data collectively suggest that inflammation and hyperkeratinization, driven by common dysregulated GRN and IL13RA1 may be pivotal in acne development. Targeting these pathways holds promise for more effective acne treatments. Materials and Methods PBMC and monocyte isolation PBMCs were obtained from the blood of healthy donors after signed written informed consent as approved by the Institutional Review Board at UCLA following the Helsinki Guidelines. PBMCs were then isolated using Ficoll–Paque density gradients (GE Healthcare) as previously described 36 . Monocytes were isolated from PBMC by positive selection with CD14 MicroBead (Miltenyi Biotec, Cat#130-050-201), then seeded at 800,000 cells per well in 12-well plates. TREM2 macrophage differentiation and evaluation via flow cytometry CD14 positive cells were differentiated in M-CSF (50 ng/ml) (R&D Systems, Cat#216MC025/CF) for 5 days in RPMI 1640 with 10% FBS at 37°C. To differentiate to TREM2 macrophage, IL-4 (100 ng/ml) (R&D Systems, Cat#204-IL-020/CF) was added from day 5. On day 7, TREM2 expression was evaluated via flow cytometry. Briefly, adherent cells were detached with 1 mM EDTA in PBS and stained with mAbs against TREM2 (R&D Systems, Cat# FAB17291A). Isotype control staining was performed in parallel. Cells were acquired with an LSR II flow cytometer (BD) and analyzed with FlowJo (BD). RNA isolation, cDNA synthesis, and real-time PCR Total RNA was isolated using Trizol reagent (Thermo Fisher, Cat#15596018) following manufacturer’s protocol. RNA samples were reverse transcribed to cDNA using Script Reverse Transcription Supermix (Bio-Rad, Cat#1708841). Reactions were performed at 25°C for 5 min, 46°C for 20 min and 95°C for 1 min. Real-time PCR was applied using SensiFAST SYBR & Fluorescein Kit (Thomas Scientific, Cat#C755H99). 40 cycles were carried out at 95°C for 5 min, then 95°C for 10 sec, 60°C for 12 sec, 72°C for 12 sec. GAPDH was used as a control. The gene expression level was quantified by the comparative method 2 −ΔΔCT . The primers used for gene assessment are summarized in Supplementary Table 2. HaCaT cell culture and treatment DMEM + GlutaMAX TM -I (Gibco, Cat#10566-016) containing Penicillin/Streptomycin, 10% FBS was used to culture the HaCaT cell line. HaCaT cells were seeded and grown in 12-well plates to ~ 60% confluent then using various concentrations of IL-4 (R&D Systems, Cat#204-IL-020/CF) and IL-13 (Thermo Scientific, 200-12-2UG) were then added. Cells were harvested after 24 hours and used for further experiments. Data and code availability For the scRNA-seq data, the sample processing and analysis for this dataset were described in a previous study 6 , and downstream analysis (Data visualization, clustering, cell type mapping, subsetting) was performed according to the Seurat tutorial series ( https://satijalab.org/seurat/articles/visualization_vignette ), and cell-cell interaction and comparison analysis according to the CellChat tutorial series ( https://github.com/jinworks/CellChat ). The sample processing and analysis for the Seq-Scope spatial dataset were conducted as previously described 6 85 . Briefly, this dataset included a 6 mm punch biopsy from a back acne papule. This sample was frozen in OCT medium and stored at -80°C until sectioning. For the Seq-Scope array, HISEQ2500 flow cells were used instead of the usual MISEQ flow cells. The distinctions between these two types of flow cells can be found in 6 . Published seq-scope datasets, step-by-step protocol, and data processing tools of Seq-ScopeMISEQ and Seq-ScopeHISEQ will be available at http://www.seq-scope.com and updated regularly. Statistical analysis Statistical analyses were performed using GraphPad Prism version 9.0, with P values ≤ 0.05 were assigned as significant. For comparisons between two groups, an unpaired Student’s t test with two-tailed p -value analysis was performed, unless otherwise stated in the figure legend. Study approval This study was conducted according to the principles expressed in the Declaration of Helsinki. The study was approved by the UCLA IRB (no. 22–000400). Declarations Declaration of interests The authors state no conflict of interest. Funding This work was supported by NIH R01AR081337 and American Association of Immunologist Intersect Fellowship (GWA). Author Contribution Author contributions. MD designed and performed the most of experiments, interpreted data, and wrote the manuscript. WO performed TREM-2 experiments; MQ cultured the HaCaT cell line, GB processed the PBMCs and conducted RNA extraction, AK created the graphical summary, and T To assisted with processing the scRNA-seq dataset. CC provided valuable suggestions and participated in discussions throughout the study, GWA conceived, designed the experiments, supervised the study and provided critical suggestions throughout the study.Declaration of interestsThe authors state no conflict of interest. Acknowledgement AcknowledgmentsWe thank Yiqian Gu at UCLA Life Sciences for assistance with Seq-scope dataset access. We also appreciate the support of Xiaofeng Huang, Sanlan Li and Tao Liu at Weill Cornell Medicine for assistance with scRNA-seq analyses. References Reynolds RV et al. Guidelines of care for the management of acne vulgaris. J Am Acad Dermatol (2024). Vu R, et al. Wound healing in aged skin exhibits systems-level alterations in cellular composition and cell-cell communication. Cell Rep. 2022;40:111155. Thrane K, et al. Single-Cell and Spatial Transcriptomic Analysis of Human Skin Delineates Intercellular Communication and Pathogenic Cells. J Invest Dermatol. 2023;143:2177–e21922113. Xu Z, et al. Anatomically distinct fibroblast subsets determine skin autoimmune patterns. Nature. 2022;601:118–24. Jin S, et al. Inference and analysis of cell-cell communication using CellChat. Nat Commun. 2021;12:1088. Do TH, et al. TREM2 macrophages induced by human lipids drive inflammation in acne lesions. Sci Immunol. 2022;7:eabo2787. Mattii M, et al. Sebocytes contribute to skin inflammation by promoting the differentiation of T helper 17 cells. Br J Dermatol. 2018;178:722–30. Agak GW, et al. Phenotype and Antimicrobial Activity of Th17 Cells Induced by Propionibacterium acnes Strains Associated with Healthy and Acne Skin. J Invest Dermatol. 2018;138:316–24. Agak GW et al. Extracellular traps released by antimicrobial TH17 cells contribute to host defense. J Clin Invest 131 (2021). Klaka P, et al. A novel organotypic 3D sweat gland model with physiological functionality. PLoS ONE. 2017;12:e0182752. Wang Y, et al. Notch4 participates in mesenchymal stem cell-induced differentiation in 3D-printed matrix and is implicated in eccrine sweat gland morphogenesis. Burns Trauma. 2023;11:tkad032. Kotowicz K, Dixon GL, Klein NJ, Peters MJ, Callard RE. Biological function of CD40 on human endothelial cells: costimulation with CD40 ligand and interleukin-4 selectively induces expression of vascular cell adhesion molecule-1 and P-selectin resulting in preferential adhesion of lymphocytes. Immunology. 2000;100:441–8. van Keulen D, et al. Inflammatory cytokine oncostatin M induces endothelial activation in macro- and microvascular endothelial cells and in APOE*3Leiden.CETP mice. PLoS ONE. 2018;13:e0204911. Wu HX, et al. LIFR promotes tumor angiogenesis by up-regulating IL-8 levels in colorectal cancer. Biochim Biophys Acta Mol Basis Dis. 2018;1864:2769–84. Kang S, Kishimoto T. Interplay between interleukin-6 signaling and the vascular endothelium in cytokine storms. Exp Mol Med. 2021;53:1116–23. Amersfoort J, Eelen G, Carmeliet P. Immunomodulation by endothelial cells - partnering up with the immune system? Nat Rev Immunol. 2022;22:576–88. Trimm E, Red-Horse K. Vascular endothelial cell development and diversity. Nat Rev Cardiol. 2023;20:197–210. Plikus MV, et al. Fibroblasts: Origins, definitions, and functions in health and disease. Cell. 2021;184:3852–72. Xu J, et al. Secreted stromal protein ISLR promotes intestinal regeneration by suppressing epithelial Hippo signaling. EMBO J. 2020;39:e103255. Brozovich FV, et al. Mechanisms of Vascular Smooth Muscle Contraction and the Basis for Pharmacologic Treatment of Smooth Muscle Disorders. Pharmacol Rev. 2016;68:476–532. Ma F, et al. The cellular architecture of the antimicrobial response network in human leprosy granulomas. Nat Immunol. 2021;22:839–50. Karlsson M et al. A single-cell type transcriptomics map of human tissues. Sci Adv 7 (2021). Lee HK, Chauhan SK, Kay E, Dana R. Flt-1 regulates vascular endothelial cell migration via a protein tyrosine kinase-7-dependent pathway. Blood. 2011;117:5762–71. Choudhury RH, et al. Extravillous Trophoblast and Endothelial Cell Crosstalk Mediates Leukocyte Infiltration to the Early Remodeling Decidual Spiral Arteriole Wall. J Immunol. 2017;198:4115–28. Liu D, et al. Activation of the NFkappaB signaling pathway in IL6 + CSF3 + vascular endothelial cells promotes the formation of keloids. Front Bioeng Biotechnol. 2022;10:917726. Guo X, et al. Endothelial ACKR1 is induced by neutrophil contact and down-regulated by secretion in extracellular vesicles. Front Immunol. 2023;14:1181016. Allinson KR, Lee HS, Fruttiger M, McCarty JH, Arthur HM. Endothelial expression of TGFbeta type II receptor is required to maintain vascular integrity during postnatal development of the central nervous system. PLoS ONE. 2012;7:e39336. Ahirwar DK, et al. Fibroblast-derived CXCL12 promotes breast cancer metastasis by facilitating tumor cell intravasation. Oncogene. 2018;37:4428–42. Lin C, et al. Single-cell RNA sequencing reveals the mediatory role of cancer-associated fibroblast PTN in hepatitis B virus cirrhosis-HCC progression. Gut Pathog. 2023;15:26. Deng M, et al. Lepr(+) mesenchymal cells sense diet to modulate intestinal stem/progenitor cells via Leptin-Igf1 axis. Cell Res. 2022;32:670–86. Niu J, et al. Keratinocyte growth factor/fibroblast growth factor-7-regulated cell migration and invasion through activation of NF-kappaB transcription factors. J Biol Chem. 2007;282:6001–11. Greicius G, et al. PDGFRalpha(+) pericryptal stromal cells are the critical source of Wnts and RSPO3 for murine intestinal stem cells in vivo. Proc Natl Acad Sci U S A. 2018;115:E3173–81. Loftus PG, et al. Targeting stromal cell Syndecan-2 reduces breast tumour growth, metastasis and limits immune evasion. Int J Cancer. 2021;148:1245–59. Lees-Shepard JB, et al. Activin-dependent signaling in fibro/adipogenic progenitors causes fibrodysplasia ossificans progressiva. Nat Commun. 2018;9:471. Dombrowski C, et al. FGFR1 signaling stimulates proliferation of human mesenchymal stem cells by inhibiting the cyclin-dependent kinase inhibitors p21(Waf1) and p27(Kip1). Stem Cells. 2013;31:2724–36. Agak GW, et al. Propionibacterium acnes Induces an IL-17 Response in Acne Vulgaris that Is Regulated by Vitamin A and Vitamin D. J Invest Dermatol. 2014;134:366–73. El-Taweel AEI, Salem RM, Abdelrahman AMN, Mohamed BAE. Serum TWEAK in acne vulgaris: An unknown soldier. J Cosmet Dermatol. 2020;19:514–8. Jeremy AH, Holland DB, Roberts SG, Thomson KF, Cunliffe WJ. Inflammatory events are involved in acne lesion initiation. J Invest Dermatol. 2003;121:20–7. Zhang J, et al. Neurotoxic microglia promote TDP-43 proteinopathy in progranulin deficiency. Nature. 2020;588:459–65. Choi JP, et al. Macrophage-derived progranulin promotes allergen-induced airway inflammation. Allergy. 2020;75:1133–45. Zhu P, et al. IL-13 secreted by ILC2s promotes the self-renewal of intestinal stem cells through circular RNA circPan3. Nat Immunol. 2019;20:183–94. Hu F, et al. Sortilin-mediated endocytosis determines levels of the frontotemporal dementia protein, progranulin. Neuron. 2010;68:654–67. Horinokita I et al. Involvement of Progranulin and Granulin Expression in Inflammatory Responses after Cerebral Ischemia. Int J Mol Sci 20 (2019). Mortensen MB, et al. Targeting sortilin in immune cells reduces proinflammatory cytokines and atherosclerosis. J Clin Invest. 2014;124:5317–22. Song Y, et al. The Msi1-mTOR pathway drives the pathogenesis of mammary and extramammary Paget's disease. Cell Res. 2020;30:854–72. Zhang X, Yin M, Zhang LJ, Keratin. 17-Critical Barrier Alarmin Molecules in Skin Wounds and Psoriasis. Cells. 2019;6:16. Turnbull IR, et al. Cutting edge: TREM-2 attenuates macrophage activation. J Immunol. 2006;177:3520–4. Ullah A, et al. A narrative review: CXC chemokines influence immune surveillance in obesity and obesity-related diseases: Type 2 diabetes and nonalcoholic fatty liver disease. Rev Endocr Metab Disord. 2023;24:611–31. Zeng Z, Lan T, Wei Y, Wei X. CCL5/CCR5 axis in human diseases and related treatments. Genes Dis. 2022;9:12–27. Yasuda K, Nakanishi K, Tsutsui H. Interleukin-18 in Health and Disease. Int J Mol Sci 20 (2019). Akaza N, et al. Effects of Propionibacterium acnes on various mRNA expression levels in normal human epidermal keratinocytes in vitro. J Dermatol. 2009;36:213–23. Freedberg IM, Tomic-Canic M, Komine M, Blumenberg M. Keratins and the keratinocyte activation cycle. J Invest Dermatol. 2001;116:633–40. Kurokawa I, Nakase K. Recent advances in understanding and managing acne. F1000Res 9 (2020). Sheikh F, et al. The Interleukin-13 Receptor-alpha1 Chain Is Essential for Induction of the Alternative Macrophage Activation Pathway by IL-13 but Not IL-4. J Innate Immun. 2015;7:494–505. Mouser PE, Baker BS, Seaton ED, Chu AC. Propionibacterium acnes-reactive T helper-1 cells in the skin of patients with acne vulgaris. J Invest Dermatol. 2003;121:1226–8. Eliasse Y, et al. IL-17(+) Mast Cell/T Helper Cell Axis in the Early Stages of Acne. Front Immunol. 2021;12:740540. Kelhala HL, et al. IL-17/Th17 pathway is activated in acne lesions. PLoS ONE. 2014;9:e105238. Dahl MG, McGibbon DH. Complement C3 and immunoglobulin in inflammatory acne vulgaris. Br J Dermatol. 1979;101:633–40. Scott DG, Cunliffe WJ, Gowland G. Activation of complement-a mechanism for the inflammation in acne. Br J Dermatol. 1979;101:315–20. Ueta M, et al. Association of combined IL-13/IL-4R signaling pathway gene polymorphism with Stevens-Johnson syndrome accompanied by ocular surface complications. Invest Ophthalmol Vis Sci. 2008;49:1809–13. Al Robaee AA, AlZolibani A, Shobaili A, H., Settin A. Association of interleukin 4 (-590 T/C) and interleukin 4 receptor (Q551R A/G) gene polymorphisms with acne vulgaris. Ann Saudi Med. 2012;32:349–54. Ulrich JD, Holtzman DM. TREM2 Function in Alzheimer's Disease and Neurodegeneration. ACS Chem Neurosci. 2016;7:420–7. Baker M, et al. Mutations in progranulin cause tau-negative frontotemporal dementia linked to chromosome 17. Nature. 2006;442:916–9. Gotzl JK et al. Opposite microglial activation stages upon loss of PGRN or TREM2 result in reduced cerebral glucose metabolism. EMBO Mol Med 11 (2019). Wei F, et al. PGRN protects against colitis progression in mice in an IL-10 and TNFR2 dependent manner. Sci Rep. 2014;4:7023. Tang W, et al. The growth factor progranulin binds to TNF receptors and is therapeutic against inflammatory arthritis in mice. Science. 2011;332:478–84. Lan YJ, Sam NB, Cheng MH, Pan HF, Gao J. Progranulin as a Potential Therapeutic Target in Immune-Mediated Diseases. J Inflamm Res. 2021;14:6543–56. Mundra JJ, Jian J, Bhagat P, Liu CJ. Progranulin inhibits expression and release of chemokines CXCL9 and CXCL10 in a TNFR1 dependent manner. Sci Rep. 2016;6:21115. Lang I, Fullsack S, Wajant H. Lack of Evidence for a Direct Interaction of Progranulin and Tumor Necrosis Factor Receptor-1 and Tumor Necrosis Factor Receptor-2 From Cellular Binding Studies. Front Immunol. 2018;9:793. Chen X, et al. Progranulin does not bind tumor necrosis factor (TNF) receptors and is not a direct regulator of TNF-dependent signaling or bioactivity in immune or neuronal cells. J Neurosci. 2013;33:9202–13. Etemadi N, Webb A, Bankovacki A, Silke J, Nachbur U. Progranulin does not inhibit TNF and lymphotoxin-alpha signalling through TNF receptor 1. Immunol Cell Biol. 2013;91:661–4. Qiu F, et al. Expression level of the growth factor progranulin is related with development of systemic lupus erythematosus. Diagn Pathol. 2013;8:88. Jing C, Zhang X, Song Z, Zheng Y, Yin Y. Progranulin Mediates Proinflammatory Responses in Systemic Lupus Erythematosus: Implications for the Pathogenesis of Systemic Lupus Erythematosus. J Interferon Cytokine Res. 2020;40:33–42. Tanaka A, et al. Serum progranulin levels are elevated in patients with systemic lupus erythematosus, reflecting disease activity. Arthritis Res Ther. 2012;14:R244. Matsubara T, et al. PGRN is a key adipokine mediating high fat diet-induced insulin resistance and obesity through IL-6 in adipose tissue. Cell Metab. 2012;15:38–50. Farag AGA, et al. Progranulin and beta-catenin in psoriasis: An immunohistochemical study. J Cosmet Dermatol. 2019;18:2019–26. Wynn TA. Type 2 cytokines: mechanisms and therapeutic strategies. Nat Rev Immunol. 2015;15:271–82. Howell MD, et al. Cytokine modulation of atopic dermatitis filaggrin skin expression. J Allergy Clin Immunol. 2007;120:150–5. Kim BE, Leung DY, Boguniewicz M, Howell MD. Loricrin and involucrin expression is down-regulated by Th2 cytokines through STAT-6. Clin Immunol. 2008;126:332–7. Zeng YP, Nguyen GH, Jin HZ. MicroRNA-143 inhibits IL-13-induced dysregulation of the epidermal barrier-related proteins in skin keratinocytes via targeting to IL-13Ralpha1. Mol Cell Biochem. 2016;416:63–70. Leigh IM, et al. Keratins (K16 and K17) as markers of keratinocyte hyperproliferation in psoriasis in vivo and in vitro. Br J Dermatol. 1995;133:501–11. Yang L, Fan X, Cui T, Dang E, Wang G. Nrf2 Promotes Keratinocyte Proliferation in Psoriasis through Up-Regulation of Keratin 6, Keratin 16, and Keratin 17. J Invest Dermatol. 2017;137:2168–76. Sun B, et al. Characterization and allergic role of IL-33-induced neutrophil polarization. Cell Mol Immunol. 2018;15:782–93. Rael EL, Lockey RF. Interleukin-13 signaling and its role in asthma. World Allergy Organ J. 2011;4:54–64. Cho CS, et al. Microscopic examination of spatial transcriptome using Seq-Scope. Cell. 2021;184:3559–e35723522. Additional Declarations No competing interests reported. Supplementary Files DengetalSupplementaryfigure.pdf Cite Share Download PDF Status: Published Journal Publication published 14 Aug, 2024 Read the published version in Cell Communication and Signaling → Version 1 posted Editorial decision: Revision requested 29 May, 2024 Reviews received at journal 26 May, 2024 Reviews received at journal 16 May, 2024 Reviewers agreed at journal 16 May, 2024 Reviewers agreed at journal 14 May, 2024 Reviewers invited by journal 14 May, 2024 Submission checks completed at journal 13 May, 2024 Editor assigned by journal 13 May, 2024 First submitted to journal 10 May, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4402048","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":304215786,"identity":"7de72cfc-8710-4601-8332-03d0e0a433ba","order_by":0,"name":"Min Deng","email":"","orcid":"","institution":"University of California (UCLA)","correspondingAuthor":false,"prefix":"","firstName":"Min","middleName":"","lastName":"Deng","suffix":""},{"id":304215788,"identity":"d35c4cc1-0034-48eb-9a73-9c2f53cee52f","order_by":1,"name":"Woodvine O. Odhiambo","email":"","orcid":"","institution":"University of California (UCLA)","correspondingAuthor":false,"prefix":"","firstName":"Woodvine","middleName":"O.","lastName":"Odhiambo","suffix":""},{"id":304215789,"identity":"25e069d8-f7c1-441d-bcc7-891cfe15fcb0","order_by":2,"name":"Min Qin","email":"","orcid":"","institution":"University of California (UCLA)","correspondingAuthor":false,"prefix":"","firstName":"Min","middleName":"","lastName":"Qin","suffix":""},{"id":304215790,"identity":"823a2b5d-2d2d-4809-a7d2-b163a2f7c115","order_by":3,"name":"Thao Tam To","email":"","orcid":"","institution":"University of California (UCLA)","correspondingAuthor":false,"prefix":"","firstName":"Thao","middleName":"Tam","lastName":"To","suffix":""},{"id":304215793,"identity":"5659a4e4-a651-410c-880c-49ee12257398","order_by":4,"name":"Gregory M. Brewer","email":"","orcid":"","institution":"University of California (UCLA)","correspondingAuthor":false,"prefix":"","firstName":"Gregory","middleName":"M.","lastName":"Brewer","suffix":""},{"id":304215795,"identity":"70a30794-0ab6-4080-97ec-0dc469e473e1","order_by":5,"name":"Alexander R. Kheshvadjian","email":"","orcid":"","institution":"University of California (UCLA)","correspondingAuthor":false,"prefix":"","firstName":"Alexander","middleName":"R.","lastName":"Kheshvadjian","suffix":""},{"id":304215796,"identity":"56b57978-bc7a-4a72-8485-98b37de682de","order_by":6,"name":"Carol Cheng","email":"","orcid":"","institution":"University of California (UCLA)","correspondingAuthor":false,"prefix":"","firstName":"Carol","middleName":"","lastName":"Cheng","suffix":""},{"id":304215799,"identity":"872e01c3-5628-4eb8-97a8-bc9009168633","order_by":7,"name":"George W. Agak","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABAElEQVRIiWNgGAWjYBAC/gYGBsaGCiDrAERABkRI4NMicQCk5QxYCyNQOwMPQS0GQMzY2EaSFvbjFz/OnLdNju928/EHjG12PPwNzAdv8+DTwpNTLLlx221jyTvHEhsY25J5JA6wJVvj02J4ICdB8uG224kbbuQYArUc4GE4wGMmjdeW82+Sfz6cc7t+w438j2At8gf4v+HXciP9mOTGhtsJBjdyGMFaDA7wsOHVInHjDZvljGO3DWfeSDOckXAumcfwMJux5Rw8Wvj70x/f7Km5Lc93I/nBhw9ldnJyx5sf3niDRwswIgwQ7AQQwYxXOQiwPyCoZBSMglEwCkY4AADLylYeJjyZRgAAAABJRU5ErkJggg==","orcid":"","institution":"University of California (UCLA)","correspondingAuthor":true,"prefix":"","firstName":"George","middleName":"W.","lastName":"Agak","suffix":""}],"badges":[],"createdAt":"2024-05-10 17:24:03","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4402048/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4402048/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12964-024-01725-4","type":"published","date":"2024-08-14T15:57:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":57307837,"identity":"94f6af1f-ac51-4416-be9d-f90e76eeef85","added_by":"auto","created_at":"2024-05-29 02:20:32","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":836889,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eOverall Distribution of signaling pathway across cell clusters in normal skin.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003e) UMAP visualization identifies eight cell subpopulations from six donors. \u003cstrong\u003eB\u003c/strong\u003e)\u003cstrong\u003e \u0026nbsp;\u003c/strong\u003eCircle plots show the number of interactions (left) and the weights of these interactions weights (right) in all cell clusters. \u003cstrong\u003eC\u003c/strong\u003e) Heatmap illustrates the relative contribution of each cell group to outgoing or incoming signals. P: Paracrine manner; A: Autocrine manner. Endo: Endothelial cell, Fib: Fibroblast, Lym: Lymphocyte, KC1: Keratinocyte 1, Smo: Smooth muscle cell, Mye: Myeloid cell, Mel: Melanocyte. \u003cstrong\u003eD\u003c/strong\u003e) The top 10 L-R pairs from each cell type based on their relative contribution under incoming patterns. \u003cstrong\u003eE-F\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eDot plot showing three datasets shared specific ligands (E) and receptors (F) genes for each cell type. The color scale represents the scaled expression average of each gene, while the dot size represents the percentage of cells expressing each gene.\u003c/p\u003e","description":"","filename":"DengetalMainfigure1.png","url":"https://assets-eu.researchsquare.com/files/rs-4402048/v1/98e9a09606c11fa082cabb1d.png"},{"id":57307839,"identity":"b011e72b-7795-42d3-b84a-0b4560052bca","added_by":"auto","created_at":"2024-05-29 02:20:32","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":891977,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAcne triggers signaling pathway changes within the skin across all cell clusters.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA)\u003c/strong\u003e UMAP plot for nonlesional and lesional cells colored by lesional types, nonlesional cells are shown in light blue, and lesional cells are shown in red. \u003cstrong\u003eB)\u003c/strong\u003e UMAP plot showing the nonlesional and lesional samples split by lesional types. \u003cstrong\u003eC)\u003c/strong\u003e All detected signaling pathways were ranked based on the differences of overall information flow within the inferred networks between nonlesional and lesional samples. The signaling pathways in green show higher enrichment in nonlesional samples, those in black have similar enrichment in both conditions, and those in red are more prevalent in lesional samples. Bar graphs are displayed in both non-stacked (left) and stacked (right) formats. \u003cstrong\u003eD-E) \u003c/strong\u003eHeatmap show the comparison of outgoing (D) or incoming (E) signaling associated with each cell type between nonlesional and lesional samples.\u003cstrong\u003e F-G) \u003c/strong\u003eDot plot showing the representative ligands (F) or receptors (G) genes from ten signaling pathway which were turned on in lesional compared with nonlesional samples. The color scale represents the scaled expression average of each gene, and the dot size represents the percentage of cells expressing each gene.\u003c/p\u003e","description":"","filename":"DengetalMainfigure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4402048/v1/0794aa93748e6e6526a21780.png"},{"id":57307838,"identity":"3ebf77e2-eb3a-4c4f-8f92-7e74a5182176","added_by":"auto","created_at":"2024-05-29 02:20:32","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":650340,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGRN and IL-13RA1-related signals are activated among individuals.\u003c/strong\u003e \u003cstrong\u003eA\u003c/strong\u003e) Histogram showing the percentage and number of altered signaling pathways in lesional compared with nonlesional samples (left). Pie chart showing the seven distribution possibilities and percentage of 232 genes in six donors, with numbers 0 to 6 and corresponding percentiles indicating certain percentage of genes that are significantly changed in 0 to 6 donors. Violin plots illustrate the expression changes of representative genes (\u003cem\u003eEGF\u003c/em\u003e, \u003cem\u003eACVR1B\u003c/em\u003e, \u003cem\u003eADM\u003c/em\u003e, \u003cem\u003eBMP2\u003c/em\u003e, \u003cem\u003eITGAV\u003c/em\u003e, \u003cem\u003eVEGFB\u003c/em\u003e), which are significantly altered in 0 to 5 donors in lesional compared to nonlesional samples. Wilcoxon test was used to perform the statistical analysis (right), ns (not significant), *P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001, ****P \u0026lt; 0.001. \u003cstrong\u003eB\u003c/strong\u003e) Dot plot shows 26 genes significantly altered across six donors; 10 genes highlighted in red indicate consistent expression trends across all matched pairs in all patients. Among these, 5 are bolded to indicate their specific expression in keratinocytes, lymphocytes, and myeloid cells. The color scale indicates the average scaled expression of each gene, and the dot size reflects the percentage of cells expressing each gene. \u003cstrong\u003eC\u003c/strong\u003e) Violin plots reveal five genes (\u003cem\u003eIL-4R\u003c/em\u003e, \u003cem\u003eIL-13RA1\u003c/em\u003e, \u003cem\u003eFAS\u003c/em\u003e, \u003cem\u003eGRN\u003c/em\u003e, \u003cem\u003eSDC1\u003c/em\u003e) consistently and significantly changed among the six donors, analyzed using the Wilcoxon test, *P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001, ****P \u0026lt; 0.001. \u003cstrong\u003eD-E)\u003c/strong\u003e Violin plot\u003cstrong\u003e \u003c/strong\u003eshowing the \u003cem\u003eGRN\u003c/em\u003e (D) and \u003cem\u003eIL-13RA1\u003c/em\u003e(E) expression in subsets of myeloid cells. Wilcoxon test was used to perform the statistical method, ns (not significant), *P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001. \u003cstrong\u003eF-G)\u003c/strong\u003e Violin plot\u003cstrong\u003e \u003c/strong\u003eshowing the \u003cem\u003eIL-13RA1\u003c/em\u003e(F) and \u003cem\u003eSDC1 \u003c/em\u003e(G) expression in subsets of keratinocytes. Wilcoxon test was used to perform the statistical method, ns (not significant), **P \u0026lt; 0.01, ***P \u0026lt; 0.001.\u003cstrong\u003e H\u003c/strong\u003e) Violin plots\u003cstrong\u003e \u003c/strong\u003eshowing the \u003cem\u003eIL-4R\u003c/em\u003e and \u003cem\u003eFAS\u003c/em\u003eexpression in subsets of lymphocytes. Wilcoxon test was used to perform the statistical method, ns (not significant).\u003c/p\u003e","description":"","filename":"DengetalMainfigure3.png","url":"https://assets-eu.researchsquare.com/files/rs-4402048/v1/f69845b0ca2bf72e8f23e2c4.png"},{"id":57308379,"identity":"267a6b87-7d0c-4037-83bf-2c49bda2d726","added_by":"auto","created_at":"2024-05-29 02:28:32","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1918094,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSpatial transcriptome sequencing reveals the localization of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eGRN\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e and \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eIL-13RA1\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e in skin biopsy. A)\u003c/strong\u003e H\u0026amp;E staining image of the acne biopsy used for Seq-Scope sequencing (left) alongside a spatial plot that identifies eight cell clusters in acne lesion (right). \u003cstrong\u003eB\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eSpatial feature plot showing overlay of \u003cem\u003eGRN\u003c/em\u003e in red, \u003cem\u003eAPOE\u003c/em\u003e in green, and \u003cem\u003eKRT5\u003c/em\u003e in blue with 2-µm intervals between grids; boxed region showing the magnified spatial plot. \u003cstrong\u003eC\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eUMAP plot showing the co-expression of \u003cem\u003eGRN\u003c/em\u003e in red and \u003cem\u003eAPOE\u003c/em\u003e in green in scRNA-seq dataset. \u003cstrong\u003eD\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eAnalysis of the relative contribution of the \u003cem\u003eGRN-SORT1\u003c/em\u003eligand-receptor (L-R) pair within the GRN signaling communication network. \u003cstrong\u003eE)\u003c/strong\u003eViolin plot\u003cstrong\u003e \u003c/strong\u003eshowing the \u003cem\u003eSORT1\u003c/em\u003e expression in subsets of myeloid cells. \u003cstrong\u003eF) \u003c/strong\u003eSpatial feature plot showing the overlay of \u003cem\u003eGRN\u003c/em\u003e in red, \u003cem\u003eSORT1\u003c/em\u003e in green, and \u003cem\u003eAPOE\u003c/em\u003e in blue with 2-µm intervals between grids; boxed region shows the magnified spatial plot. \u003cstrong\u003eG\u003c/strong\u003e) Spatial feature plot showing the overlay of \u003cem\u003eIL-13RA1 \u003c/em\u003ein green, \u003cem\u003eKRT14\u003c/em\u003e in red, and \u003cem\u003eKRT5\u003c/em\u003ein blue with 2-µm intervals between grids; boxed region showing the magnified spatial plot. \u003cstrong\u003eH) \u003c/strong\u003eUMAP plot showing the co-expression of \u003cem\u003eIL-13RA1 \u003c/em\u003ein red and \u003cem\u003eKRT14\u003c/em\u003e in green in the scRNA-seq dataset. \u003cstrong\u003eI) \u003c/strong\u003eRelative contribution of each L-R pair to the overall communication network of IL-4 signaling pathway.\u003c/p\u003e","description":"","filename":"DengetalMainfigure4.png","url":"https://assets-eu.researchsquare.com/files/rs-4402048/v1/f1def626c9b3149a3a7f9ca1.png"},{"id":57307840,"identity":"9a13072e-c33e-40fe-ac3b-215d89f15aa0","added_by":"auto","created_at":"2024-05-29 02:20:32","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1271484,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eActivation of GRN and IL-13RA1 exacerbates inflammation and hyperkeratinization. A\u003c/strong\u003e) Schematic diagram showing the process of generating TREM2 macrophages from human blood and detection by qRT-PCR and Flow cytometry. \u003cstrong\u003eB\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eFlow cytometry (left) and\u003cstrong\u003e \u003c/strong\u003eqRT-PCR (right) analysis for the expression level of \u003cem\u003eTREM2\u003c/em\u003e, ***P \u0026lt; 0.001 (Student’s t-test), n = 3 donors. \u003cstrong\u003eC\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eqRT-PCR analysis for the expression level of \u003cem\u003eGRN\u003c/em\u003eand \u003cem\u003eSORT1\u003c/em\u003e in CD14 positive cells treated with or without recombinant IL-4 protein from day 5 to day 7, *P \u0026lt; 0.05, ***P \u0026lt; 0.001 (Student’s t-test), n = 3 donors. \u003cstrong\u003eD\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eSchematic diagram showing the treatment of TREM2 macrophages with GRN and PBS. \u003cstrong\u003eE)\u003c/strong\u003e qRT-PCR analysis for the expression level of \u003cem\u003eSORT1\u003c/em\u003e in TREM2 macrophages treated with different concentration of GRN and PBS for 24 hrs, **P \u0026lt; 0.01, ***P \u0026lt; 0.001 (Student’s t-test), n = 3 donors. \u003cstrong\u003eF and I\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eqRT-PCR analysis for the expression level of proinflammatory cytokines \u003cem\u003eIL-18\u003c/em\u003e, \u003cem\u003eCCL5\u003c/em\u003e, \u003cem\u003eCXCL2\u003c/em\u003e (F)\u003cstrong\u003e \u003c/strong\u003eand \u003cem\u003eTNF-α\u003c/em\u003e, \u003cem\u003eIL-6\u003c/em\u003e, \u003cem\u003eIL-1β\u003c/em\u003e (I)\u003cstrong\u003e \u003c/strong\u003ein TREM2 macrophages treated with 10 ng/ml GRN and PBS for 24 hrs, *P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001 (Student’s t-test), n = 3 donors. \u003cstrong\u003eG-H)\u003c/strong\u003e Spatial feature plot showing the overlay of \u003cem\u003eCXCL2\u003c/em\u003e, \u003cem\u003eCCL5\u003c/em\u003e, \u003cem\u003eIL-18 \u003c/em\u003ein green, and \u003cem\u003eGRN\u003c/em\u003ein red with 2-µm intervals between grids in acne lesion, with arrows indicating the colocalization of double positive spots, boxed region showing the magnified spatial plot. \u003cstrong\u003eJ\u003c/strong\u003e) Schematic diagram showing the treatment of PBS, IL-4, and IL-13 in HaCaT cell line. \u003cstrong\u003eK-L\u003c/strong\u003e) qRT-PCR analysis for the expression level of \u003cem\u003eIL4R, IL13RA1\u003c/em\u003e (K) and\u003cem\u003e KRT16, KRT17, FLG\u003c/em\u003e (L)\u003cstrong\u003e \u003c/strong\u003ein HaCaT cell line treated with PBS and IL-13, *P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001 (Student’s t-test), n=3 technical replicates. \u003cstrong\u003eM\u003c/strong\u003e) Violin plots\u003cstrong\u003e \u003c/strong\u003eshowing \u003cem\u003eKRT16, KRT17, \u003c/em\u003eand \u003cem\u003eFLG\u003c/em\u003e expression in HaCaT cell line treated with PBS and IL-13. Wilcoxon test was used to perform the statistical method, ***P \u0026lt; 0.001, ****P \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"DengetalMainfigure5.png","url":"https://assets-eu.researchsquare.com/files/rs-4402048/v1/2489c66cb191be878098b940.png"},{"id":57307842,"identity":"e56a23f0-0024-47d8-9d57-e52d583339fb","added_by":"auto","created_at":"2024-05-29 02:20:32","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1165037,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA schematic overview highlighting the critical role of GRN in promoting inflammatory responses in TREM2 macrophages and IL-13RA1 in modulating the expression of genes associated with hyperkeratinization in acne skin. \u003c/strong\u003eIn acne lesions, resident TREM-2 macrophages release granulin precursor (GRN) (1), which binds to their surface receptor SORT1 and (2) stimulates the release of proinflammatory cytokines such as IL-18, CXCL2, CCL5, TNF-α, IL-6, and IL-1β. (3) These cytokines recruit inflammatory cells such as mast cells, T cells, NKT cells, and neutrophils. Besides its role in inflammation, this figure also depicts GRN’s possible role in hyperkeratinization. (A) Recruited inflammatory cells together with ILC2s, secrete IL-13, which binds to the IL-13RA1 receptor on keratinocytes (B), leading to the upregulation of K16 and K17—markers associated with keratinocyte hyperproliferation—as well as the downregulation of FLG.\u003c/p\u003e","description":"","filename":"DengetalMainfigure6.png","url":"https://assets-eu.researchsquare.com/files/rs-4402048/v1/1de04130310fdef1bcc8743f.png"},{"id":63070781,"identity":"0bfd1c8d-d2cf-436f-8169-e9878c26a19a","added_by":"auto","created_at":"2024-08-22 19:54:06","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":7884272,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4402048/v1/e31b7c24-3a5f-4b2a-92f0-d0f98d5db645.pdf"},{"id":57307843,"identity":"a3108741-7543-476d-8be4-5e9cc78efaf0","added_by":"auto","created_at":"2024-05-29 02:20:32","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":3993585,"visible":true,"origin":"","legend":"","description":"","filename":"DengetalSupplementaryfigure.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4402048/v1/7065b385c1ebd4a61c41dffe.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Analysis of Intracellular Communication Reveals Consistent Gene Changes Associated with Early-Stage Acne Skin","fulltext":[{"header":"Introduction","content":"\u003cp\u003eAcne vulgaris, the most common dermatological condition worldwide, presents as a chronic inflammatory and recurrent disease marked by a spectrum of lesions, including non-inflamed (both open and closed comedones) and inflamed (macules, papules, pustules, and nodules). Approximately 95% of boys and 85% of girls experience acne during adolescence, with nearly half of them experiencing it to adulthood \u003csup\u003e1\u003c/sup\u003e. The scarring and post-inflammatory hyperpigmentation caused by acne can severely affect an individual's quality of life, highlighting the importance of early and effective therapy. The development of acne is driven by four key processes within the pilosebaceous unit (PSU): inflammation, epithelial hyperkeratinization, hyperseborrhea accompanied by proinflammatory lipids, and colonization by \u003cem\u003eCutibacterium acnes\u003c/em\u003e (\u003cem\u003eC. acnes)\u003c/em\u003e bacteria\u003csup\u003e1\u003c/sup\u003e. Despite significant progress in elucidating the pathophysiology and treatment mechanisms of acne, it is important to identify the shared dysregulated signaling pathways in individuals with acne. Targeting these shared signaling pathways can significantly improve the effectiveness of current acne treatments in affected patients.\u003c/p\u003e \u003cp\u003eSkin homeostasis relies on a sophisticated network of resident cells, each performing unique biological functions and engaging in complex signaling pathways mediated by intricate ligand-receptor interactions \u003csup\u003e2\u0026ndash;5\u003c/sup\u003e. The epidermis hosts various cells such as keratinocytes, melanocytes, Langerhans cells and merkel cells. Among them, basal keratinocytes serve as epithelial stem cells, crucial for proliferation and differentiation, ensuring the daily renewal of the epidermis. In the dermis and hypodermis, a diverse array of cells including fibroblasts, immune cells, endothelial cells, nerves, and adipocytes form a harmonized network. Dysregulated signaling among these cells has been implicated in various skin disorders such as vitiligo, impaired wound healing, aging, psoriasis, and dermatitis \u003csup\u003e2\u0026ndash;5\u003c/sup\u003e. In acne lesions, excessive squalene production by keratinocytes and sebocytes triggers TREM2 macrophage differentiation, enhancing immune cell migration and fueling the inflammatory cascade \u003csup\u003e6\u003c/sup\u003e. Moreover, sebocytes adjacent to the PSU in acne lesions release CXCL8, attracting neutrophils, monocytes, and T cells, in addition to secreting IL-6, TGF‐β, and IL-1β, which drive the differentiation of T helper 17 cells (Th17 cells) \u003csup\u003e7\u003c/sup\u003e. Our previous studies demonstrated that \u003cem\u003eC. acnes\u003c/em\u003e ribotypes differentially regulate the fate of Th17 responses in the skin \u003csup\u003e8, 9\u003c/sup\u003e. However, the comprehensive and conserved changes in intercellular communication within acne-affected skin are yet to be thoroughly investigated.\u003c/p\u003e \u003cp\u003eIn this study, we examined global changes in intercellular communication by analyzing single cell RNA sequencing (scRNA-seq) and spatial transcriptomic data from six patients with papular acne. Our findings reveal that acne triggers significant alterations in 49 signaling pathways across all skin cell clusters compared to nonlesional areas. We also identified 10 genes related to these signaling pathways that were consistently dysregulated in all donors. Our focus was primarily drawn to genes that were enriched and upregulated in keratinocytes and immune cells, particularly myeloid cells and lymphocytes, as they play key roles in inflammation and hyperkeratinization during the onset of acne. Among these genes, we observed significant upregulation of GRN and IL-13RA1 within TREM2-expressing macrophages and basal keratinocytes, respectively. Furthermore, we found that GRN and its receptor SORT1 were upregulated in IL-4-induced TREM2 macrophages, and treatment with GRN led to increased expression of proinflammatory cytokines and chemokines from these cells. Concurrently, treating human HaCaT cells with IL-13 to activate IL-13RA1 signaling resulted in dysregulation of \u003cem\u003eKRT16, KRT17\u003c/em\u003e, and \u003cem\u003eFLG\u003c/em\u003e expression, which are associated with hyperproliferation-associated phenotypes in acne. Our findings suggest that GRN and IL-13RA1 are key players in the inflammation and hyperkeratinization process during acne development, highlighting their potential as novel therapeutic targets for acne treatment.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eOverall cell-cell communications and signal distributions in normal skin\u003c/h2\u003e \u003cp\u003eTo investigate the cell-cell communication in acne-affected skin, we first sought to display the overall signal distributions in normal skin samples as a reference point. Although several studies have explored the cell-cell interactions in aging, wound healing, psoriasis, and dermatitis in both mice and humans, there remains a gap in understanding the overall signal distribution in distinct cell types in normal human skin, which can be used as a baseline to compare with various skin diseases\u003csup\u003e2, 3\u003c/sup\u003e. To bridge this gap, we leveraged our previously published dataset, which sampled normal skin from the back of six individuals with active early-stage acne vulgaris, approximately 24 hours of onset. The dataset consists of 29,202 cells of 8 different types: endothelial cells (ECs), fibroblasts, lymphoid cells, smooth muscle, myeloid cells, two populations of keratinocytes (KCs) (Keratinocyte 1 and Keratinocyte 2), and melanocytes \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA \u003cb\u003eand Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eA)\u003c/b\u003e. In our analysis, we identified KC1s as typical epithelial cells based on their specific expression of KRT14, KRT10, and KRT5. Conversely, KC2 was classified as sweat gland cells due to their high expression of cell markers such as KRT18, KRT19, KRT7, AQP5, and CEACAM5 \u003cb\u003e(Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eB)\u003c/b\u003e \u003csup\u003e10, 11\u003c/sup\u003e. Using CellChat, we further analyzed this dataset to infer the cell-cell communication network, which revealed that all cell groups actively engage in mutual signaling with each other. Notably, ECs, fibroblasts, and myeloid cells showed the most significant number of interactions and the largest weights of cell interactions, which likely correlates with the high abundance of these cell types in the skin \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB and S1C\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo understand the signal pathway distributions in each cell cluster and where these signals target, we analyzed the key incoming and outgoing signal patterns, detecting a total of 55 distinct signals. Outgoing patterns illustrate the distribution of signals secreted by sender cells and how the weights are distributed, whereas the incoming patterns reflect the reception of signals sent from others \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC\u003cb\u003e)\u003c/b\u003e. Within these signaling pathways, some featured the expression of both ligands and receptors within the same cell type. We categorized these autocrine pathways as follows: I) IL-6, LIFR, OSM, CSF3, BMP, TRAIL, and FASLG; II) FGF, MSTN, GDNF, EPO, GH, PRL, and FLT3; III) LT and IL-2; IV) EGF, PARs, NMU, IL-10, HGF, BAFF, and WNT; V) NT and ANGPT; VI) IL-1, IL-4, CSF, and NPR2; VII) KIT, and BTLA. Each pathway operates within endothelial cells, fibroblasts, lymphocytes, keratinocytes, smooth muscle cells, myeloid cells, and melanocytes, respectively, serving diverse functions and establishing signaling circuits that support processes such as tissue development, cell survival, regulation of inflammation, immune response, and cell death \u003csup\u003e12\u0026ndash;15\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eSimultaneously, every cell type communicates with others in a paracrine manner. ECs have long been known to maintain vascular homeostasis and provide paracrine support to surrounding non-vascular cells, as well as modulating inflammation by regulating immune cell trafficking, activation status, and function \u003csup\u003e16, 17\u003c/sup\u003e. Compared to other cell types, we particularly observed that ECs sent the strongest CD40 signaling out while receiving signals such as CCL, CXCL, VEGF, TGFβ, SEMA3, CALCR, and NGF signals from other cell types (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). Fibroblasts were identified as the strongest source of signals such as PTN, IGF, COMPLEMENT, PERIOSTIN, ACTIVIN, PSAP, and NGF to other cell types, and they predominantly received PDGF, IFN-II and GRN signals, highlighting their role in tissue homeostasis and disease through growth factors/hormone production and extracellular matrix formation \u003csup\u003e18, 19\u003c/sup\u003e. Smooth muscle cells were notable for sending signals like CCL, MIF, PDGF, GAS and EDN, which are crucial for involuntary muscle contractions and in regulating physiological processes such as blood flow \u003csup\u003e20\u003c/sup\u003e. As predominant immune cells in the skin, lymphocytes and myeloid cells were identified as strong sources of TGFβ, VEGI, CXCL, VISFATIN, VEGF, IFN-II, and GRN signals, while primarily receiving MIF and COMPLEMENT signals. Keratinocytes are key component of the skin barrier and structural cells. They were the strongest source of CALCR signals, receiving various strong signals including PTN, PERIOSTIN, NRG, ACTIVIN, LIGHT, PSAP, and VEGI. Lastly, melanocytes, which are responsible for skin and hair pigmentation, sent out the strongest SEMA3, NRG and LIGHT signals, and received the strongest VISFATIN, IGF, EDN and CD40 signals, underlining their critical role in determining skin color and hair characteristics.\u003c/p\u003e \u003cp\u003eAs every signal pathway consists of numerous ligand-receptor pairs, we further narrowed down our scope and focused on identifying key ligand and receptor genes that were not only from the strongest pathways but also exhibited unique expression within specific cell clusters. To achieve this, we analyzed all ligand-receptor pairs and their relative contribution within each cluster \u003cb\u003e(Figure S2-S9).\u003c/b\u003e Through this comprehensive approach, we identified specific ligand and receptor genes by compiling them from the top three outgoing and incoming signals (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), as well as the top ten ligand-receptor pairs contributed by each cluster (Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD and S10A). Subsequent validation of these gene expression patterns against two additional skin datasets confirmed the consistency of our findings (Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF-\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE, \u003cb\u003eFigures S10B-S10C, and Figures S11-S17\u003c/b\u003e) \u003csup\u003e21, 22\u003c/sup\u003e. In endothelial cells, we identified ligands (FLT1 \u003csup\u003e23\u003c/sup\u003e, CCL14 \u003csup\u003e24\u003c/sup\u003e, CSF3 \u003csup\u003e25\u003c/sup\u003e) and receptors (ACKR1 \u003csup\u003e26\u003c/sup\u003e, LIFR \u003csup\u003e14\u003c/sup\u003e, TGFBR2 \u003csup\u003e27\u003c/sup\u003e), that are either known cell markers for endothelial cells or are involved in processes such as angiogenesis, migration, immune cell recruitment, vascular integrity (\u003cb\u003eFigures S11\u003c/b\u003e). We found ligands (CXCL12 \u003csup\u003e28\u003c/sup\u003e, PTN \u003csup\u003e29\u003c/sup\u003e, C3 \u003csup\u003e30\u003c/sup\u003e, FGF7 \u003csup\u003e31\u003c/sup\u003e) and receptors (PDGFRA \u003csup\u003e32\u003c/sup\u003e, SDC2 \u003csup\u003e33\u003c/sup\u003e, ACVR1 \u003csup\u003e34\u003c/sup\u003e, FGFR1 \u003csup\u003e35\u003c/sup\u003e) were mainly expressed in fibroblasts (\u003cb\u003eFigures S12-S13\u003c/b\u003e). Ligands TGFB1, CCL5 and receptors CXCR4, IL-7R, LTB, IL-2RG, and ITGB2 were found to be highly expressed in lymphocytes (\u003cb\u003eFigures S14\u003c/b\u003e). In myeloid cells, enriched ligands (NAMPT, CXCL8, IL1B, VEGFA, and CXCL3) and the receptors (CD74, CD44, IL-1R2 and ITGAX) were identified (\u003cb\u003eFigures S15-S16\u003c/b\u003e). KC1 showed enrichment for ligand AREG and receptors (EGFR and ERBB2) (\u003cb\u003eFigures S17A-S17B\u003c/b\u003e). Smooth muscle cells showed distinct expression of ligand PDGFA (\u003cb\u003eFigures S17C\u003c/b\u003e). No signaling pathway-associated genes specific to KC2 and melanocytes were identified. These findings suggest that genes derived from signaling pathways could serve as additional markers for cell cluster annotation in the skin.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eTop 3 outgoing and incoming signals from each cell type in normal skin samples\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c3\" namest=\"c1\"\u003e \u003cp\u003eOutgoing signal\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c6\" namest=\"c4\"\u003e \u003cp\u003eIncoming signal\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSender\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eL-R pair\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReceiver\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eReceiver\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eL-R pair\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eSender\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eEndothelial cell\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCL2\u0026thinsp;\u0026minus;\u0026thinsp;ACKR1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eEndothelial cell\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eEndothelial cell\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCXCL8\u0026thinsp;\u0026minus;\u0026thinsp;ACKR1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMyeloid cell\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCL14\u0026thinsp;\u0026minus;\u0026thinsp;ACKR1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eEndothelial cell\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCCL2\u0026thinsp;\u0026minus;\u0026thinsp;ACKR1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eSmooth muscle\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCXCL2\u0026thinsp;\u0026minus;\u0026thinsp;ACKR1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eEndothelial cell\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCXCL2\u0026thinsp;\u0026minus;\u0026thinsp;ACKR1 (F-E)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eFibroblast\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eFibroblast\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCXCL2\u0026thinsp;\u0026minus;\u0026thinsp;ACKR1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eEndothelial cell\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eFibroblast\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eNAMPT \u0026minus; (ITGA5\u0026thinsp;+\u0026thinsp;ITGB1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMyeloid cell\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCXCL3\u0026thinsp;\u0026minus;\u0026thinsp;ACKR1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eEndothelial cell\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eNAMPT \u0026minus; (ITGA5\u0026thinsp;+\u0026thinsp;ITGB1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eEndothelial cell\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCL2\u0026thinsp;\u0026minus;\u0026thinsp;ACKR1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eEndothelial cell\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eNAMPT \u0026minus; (ITGA5\u0026thinsp;+\u0026thinsp;ITGB1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eSmooth muscle\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eLymphocyte\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCXCL12\u0026thinsp;\u0026minus;\u0026thinsp;CXCR4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLymphoid\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eLymphocyte\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eNAMPT \u0026minus; (ITGA5\u0026thinsp;+\u0026thinsp;ITGB1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMyeloid cell\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMIF \u0026minus; (CD74\u0026thinsp;+\u0026thinsp;CD44)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMyeloid cell\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCXCL12\u0026thinsp;\u0026minus;\u0026thinsp;CXCR4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eLymphocyte\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eIL7 \u0026minus; (IL7R\u0026thinsp;+\u0026thinsp;IL2RG)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLymphoid\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eNAMPT \u0026minus; (ITGA5\u0026thinsp;+\u0026thinsp;ITGB1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eEndothelial cell\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eKC1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCL27\u0026thinsp;\u0026minus;\u0026thinsp;CCR2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSmooth muscle\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eKC1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003ePTN\u0026thinsp;\u0026minus;\u0026thinsp;SDC1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eFibroblast\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCL27\u0026thinsp;\u0026minus;\u0026thinsp;CCR2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eEndothelial cell\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003ePTN\u0026thinsp;\u0026minus;\u0026thinsp;SDC4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eFibroblast\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMIF \u0026minus; (CD74\u0026thinsp;+\u0026thinsp;CD44)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMyeloid cell\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003ePTN\u0026thinsp;\u0026minus;\u0026thinsp;NCL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eFibroblast\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eSmooth muscle\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCL2\u0026thinsp;\u0026minus;\u0026thinsp;ACKR1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eEndothelial cell\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eSmooth muscle\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCCL2\u0026thinsp;\u0026minus;\u0026thinsp;CCR2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eSmooth muscle\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCL2\u0026thinsp;\u0026minus;\u0026thinsp;CCR2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSmooth muscle\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCCL27\u0026thinsp;\u0026minus;\u0026thinsp;CCR2,\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eKeratinocyte 1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCXCL2\u0026thinsp;\u0026minus;\u0026thinsp;ACKR1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eEndothelial cell\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCCL2\u0026thinsp;\u0026minus;\u0026thinsp;CCR2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eEndothelial cell\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eMyeloid cell\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCXCL8\u0026thinsp;\u0026minus;\u0026thinsp;ACKR1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eEndothelial cell\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eMyeloid cell\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eMIF \u0026minus; (CD74\u0026thinsp;+\u0026thinsp;CD44)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eSmooth muscle\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCXCL2\u0026thinsp;\u0026minus;\u0026thinsp;ACKR1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eEndothelial cell\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eMIF \u0026minus; (CD74\u0026thinsp;+\u0026thinsp;CD44)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMelanocytes\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCXCL3\u0026thinsp;\u0026minus;\u0026thinsp;ACKR1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eEndothelial cell\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eMIF \u0026minus; (CD74\u0026thinsp;+\u0026thinsp;CD44)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eKeratinocyte 2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eKC2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCL2\u0026thinsp;\u0026minus;\u0026thinsp;ACKR1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eEndothelial cell\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eKC2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCXCL8\u0026thinsp;\u0026minus;\u0026thinsp;ACKR1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMyeloid cell\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCXCL2\u0026thinsp;\u0026minus;\u0026thinsp;ACKR1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eEndothelial cell\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCCL2\u0026thinsp;\u0026minus;\u0026thinsp;ACKR1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eSmooth muscle\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMIF \u0026minus; (CD74\u0026thinsp;+\u0026thinsp;CD44)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMyeloid cell\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCXCL2\u0026thinsp;\u0026minus;\u0026thinsp;ACKR1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eFibroblast\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eMelanocyte\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCL2\u0026thinsp;\u0026minus;\u0026thinsp;ACKR1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eEndothelial cell\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eMelanocyte\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eNAMPT \u0026minus; (ITGA5\u0026thinsp;+\u0026thinsp;ITGB1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMyeloid cell\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMIF \u0026minus; (CD74\u0026thinsp;+\u0026thinsp;CD44)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMyeloid cell\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eNAMPT \u0026minus; (ITGA5\u0026thinsp;+\u0026thinsp;ITGB1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eEndothelial cell\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCL2\u0026thinsp;\u0026minus;\u0026thinsp;CCR2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSmooth muscle\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eNAMPT \u0026minus; (ITGA5\u0026thinsp;+\u0026thinsp;ITGB1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eSmooth muscle\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eq-PCR primers\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003esequence\u0026nbsp;(5'\u0026nbsp;-\u0026gt;\u0026nbsp;3')\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eGAPDH\u003c/em\u003e-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGGGCTACACTGAGCACC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eGAPDH\u003c/em\u003e-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAGTGGTCGTTGAGGGCAATG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eTREM2\u003c/em\u003e-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGTCAGCACGCACAACTTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eTREM2\u003c/em\u003e-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGCAGCGTAATGGTGAGAGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eGRN\u003c/em\u003e-F1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCCTGGCAAAGAAGCTCCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eGRN\u003c/em\u003e-R1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGCTCACAGCAGGTAGAACCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eSORT1\u003c/em\u003e-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGGGACACATGGAGCATGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eSORT1\u003c/em\u003e-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGAATAGACAATGCCTCGATCAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eIL13RA1\u003c/em\u003e-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTCCCAGTGTAGCACCAATGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eIL13RA1\u003c/em\u003e-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCTCAGGTTGTGCCAAATGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eKRT16\u003c/em\u003e-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGACCGGCGGAGATGTGAAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eKRT16\u003c/em\u003e-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGCTCGTACTGGTCACGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eKRT17\u003c/em\u003e-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCCGCATCCTCAACGAGAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eKRT17\u003c/em\u003e-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGCGGTTCAGTTCCTCTGTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eIL4R\u003c/em\u003e-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACACCAATGTCTCCGACACTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eIL4R\u003c/em\u003e-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGTTGACTGCATAGGTGAGATGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eKRT6A\u003c/em\u003e-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGAATGGCGAAGGCGTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eKRT6A\u003c/em\u003e-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGCCGACACCACTGGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eFilaggrin\u003c/em\u003e-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGCACTGAAAGGCAAAAAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eFilaggrin\u003c/em\u003e-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGCTGCCATGTCTCCAAACTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eAcne triggers significant signaling pathway changes across all cell clusters within the skin.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo elucidate the changes of cell-cell interactions from nonlesional to lesional samples, we initially integrated the datasets of nonlesional and lesional samples \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA\u003cb\u003e)\u003c/b\u003e, and as demonstrated by Tran \u003cem\u003eet al.\u003c/em\u003e we also observed significant changes in cellular compositions, especially in KC2 and fibroblasts \u003csup\u003e6\u003c/sup\u003e \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB\u003cb\u003e)\u003c/b\u003e. Further analysis of each signaling pathways revealed an increase in both the strength and number of signaling pathways in lesional compared to nonlesional samples \u003cb\u003e(Figure S18A-S18B)\u003c/b\u003e. We identified changes in 49 signal distributions: (i) one signal was turned off (MSTN), (ii) three signals were decreased (CCL, FLT3, NT), (iii) ten signals were turned on (IL-17, CX3C, TAC, NPR1, TWEAK, PROS, ANGPTL, GALECTIN, MK and SPP1), and (iv) thirty-five signals were increased (including BAFF, NGF, WNT) \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC\u003cb\u003e)\u003c/b\u003e. We found that these signal changes involved all cell clusters, indicating the possibility that immune responses within acne skin trigger responses across every cell type \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD-\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE\u003cb\u003e)\u003c/b\u003e. Of the ten signaling pathways that were turned on, IL-17, NPR1, GALECTIN and SPP1 mainly derived from myeloid cells and targeted KC2, endothelial cells, lymphocytes, and fibroblasts, respectively. The presence of IL-17 signaling in acne, is consistent with our previous findings \u003csup\u003e36\u003c/sup\u003e. PROS and TWEAK signals originated from melanocytes and can target both smooth muscle and melanocytes. A case-controlled study of 100 acne vulgaris patients reported that acne patients had significant elevation in TWEAK serum levels when compared to the control subjects, which is consistent with our findings \u003csup\u003e37\u003c/sup\u003e. TAC and CX3C signals interact in an autocrine way in endothelial cells and KC2. MK signals mainly from fibroblasts target melanocytes, whereas ANGPTL signals from KC1 target fibroblasts. These changes occurred across all cell types were further supported by the observed significant increase in the expression level of ligands and receptors associated with the ten turn-on signaling pathways in lesional samples of acne (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF-\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eActivation of GRN and IL-13RA1-related signals.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo account for the diversity in signaling pathway alterations observed across different donors and the impact of outliers, we aimed to identify significant differences in gene expression within each matched pair of nonlesional and lesional samples from six donors. We performed a differential analysis on all 232 genes associated with the 49 altered signaling pathways, these genes exhibited seven distinct expression profiles \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Among them, 26 genes (11.2%) displayed significant differences between nonlesional and lesional samples within each patient \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB \u003cb\u003eand Figure S19\u003c/b\u003e). Conversely, 52 genes (22.4%) showed no differences across all six individuals, while 27 (11.6%), 24 (10.3%), 27 (11.6%), 37 (16%), and 39 (16.8%) genes exhibited significant differences in 1, 2, 3, 4, and 5 matched nonlesional and lesional sample pairs, respectively \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA\u003cb\u003e)\u003c/b\u003e. Previous studies have indicated that papules can form in under 6 hours and exhibit a profound inflammatory response as evidenced by increased levels of CD4 T cells, neutrophils, and CD68\u003csup\u003e+\u003c/sup\u003e macrophages in acne biopsies. However, KC did not exhibit abnormal proliferation compared to normal skin at that time point \u003csup\u003e38\u003c/sup\u003e. Given that our samples were collected from patients at approximately 24 hours into the disease course, later than the 6 hour-mark, we focused on genes linked to signaling pathways in lymphocytes, myeloid cells, and basal cells in KC. These genes may be associated with inflammation and hyperkeratinization during this period. In these three cell types, only 5 genes (\u003cem\u003eGRN\u003c/em\u003e, \u003cem\u003eIL13RA1\u003c/em\u003e, \u003cem\u003eIL4R\u003c/em\u003e, \u003cem\u003eFAS\u003c/em\u003e and \u003cem\u003eSDC1\u003c/em\u003e) showed consistent expression patterns across all matched pairs in all patients \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC\u003cb\u003e)\u003c/b\u003e. Among these, GRN, also known as the granulin precursor and a multifunctional growth factor, has been identified in macrophages across various organs, including the lung and brain \u003csup\u003e39, 40\u003c/sup\u003e. GRN plays a dual function in regulating inflammation and is associated with processes such as tumorigenesis, neurodegeneration, wound healing, and early embryogenesis. In our dataset, \u003cem\u003eGRN\u003c/em\u003e primarily originates from myeloid cells including TREM2 macrophages, M1 and M2 macrophages, CD1C dendritic cells (DCs), Langerhans and LAMP3 DCs \u003cb\u003e(Figure S20A-S20B).\u003c/b\u003e Notably, we observed higher expression of \u003cem\u003eGRN\u003c/em\u003e in TREM2 macrophages and M2-like macrophages in lesional skin compared to nonlesional skin \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD\u003cb\u003e)\u003c/b\u003e. Given that TREM2 macrophages have been implicated in driving inflammation in acne \u003csup\u003e6\u003c/sup\u003e, our subsequent analyses focused on the function of GRN within these cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cem\u003eIL-13RA1\u003c/em\u003e was also upregulated in lesional skin, primarily originating from myeloid cells \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC\u003cb\u003e)\u003c/b\u003e. However, it was either downregulated or showed no significant difference in subsets of myeloid cells, implying that increased expression levels of \u003cem\u003eIL-13RA1\u003c/em\u003e came from other cell types in lesional skin \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE\u003cb\u003e)\u003c/b\u003e. Therefore, our focus shifted to the second largest source of \u003cem\u003eIL-13RA1\u003c/em\u003e, which was KC1. Specifically, we focused on basal cells from KC1 given their critical role in skin self-renewal and their significant involvement in hyperkeratinization within the epidermis. We found that \u003cem\u003eIL-13RA1\u003c/em\u003e was markedly upregulated in lesional basal cells compared to nonlesional ones \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF, \u003cb\u003eFigure S20C-S20D)\u003c/b\u003e. This observation aligns with a study suggesting that IL-13, produced by group 2 innate lymphoid cells in the crypt niche, interacts with IL-13RA1 on Lgr5\u003csup\u003e+\u003c/sup\u003e intestinal stem cells \u003csup\u003e41\u003c/sup\u003e, suggesting potential involvement of IL-13RA1 in hyperkeratinization during acne development. Additionally, \u003cem\u003eSDC1\u003c/em\u003e was highly expressed in KC1, but showed no significant difference in basal cells between the two conditions (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG). \u003cem\u003eIL-4R\u003c/em\u003e and \u003cem\u003eFAS\u003c/em\u003e were predominantly expressed in lymphocytes; however further analysis revealed that neither \u003cem\u003eIL-4R\u003c/em\u003e nor \u003cem\u003eFAS\u003c/em\u003e showed significant changes in lymphocytes subsets \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eH \u003cb\u003eand Figure S20E-S20F)\u003c/b\u003e. Consequently, we chose not to investigate these three genes further.\u003c/p\u003e \u003cp\u003eNext, to spatially localize GRN and IL-13RA1 expression in acne skin, we used the Seq-Scope sequencing dataset obtained from acne lesions and segmented the histological area using 10 \u0026micro;m-sided square grids \u003csup\u003e6\u003c/sup\u003e. The analyzed specimen featured a hair follicle surrounded by an inflammatory infiltrate. Each grid detected an average of 145 genes across 3558 grids, enabling the identification of eight distinct cell populations including KRT5 and KRT16 keratinocytes, fibroblasts, endothelial cells, TREM2 macrophages, B cells, other macrophages, and various other cell types. \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA\u003cb\u003e).\u003c/b\u003e Our initial focus on \u003cem\u003eGRN\u003c/em\u003e expression revealed its prominence in TREM2 macrophage where it co-localized with TREM2 macrophage marker, \u003cem\u003eAPOE\u003c/em\u003e, both in scRNA-seq and Seq-Scope dataset \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB-\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC\u003cb\u003e).\u003c/b\u003e To identify the receptor for GRN, we analyzed the contribution of all ligand-receptor (L-R) pairs in GRN signaling. Our findings revealed that only one receptor, Sortilin (\u003cem\u003eSORT1\u003c/em\u003e), was detected and significantly upregulated in TREM2 macrophages. Furthermore, SORT1 was found to colocalize with \u003cem\u003eGRN\u003c/em\u003e in acne lesions \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD-\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF\u003cb\u003e).\u003c/b\u003e This L-R binding was first identified in the brain, underscores SORT1\u0026rsquo;s role in mediating rapid endocytosis and lysosomal localization of GRN, central in the development of inherited frontotemporal lobar degeneration \u003csup\u003e42\u003c/sup\u003e. Other studies have also shown that both GRN and SORT1 are key regulators of inflammation \u003csup\u003e43, 44\u003c/sup\u003e. Our findings showing \u003cem\u003eGRN\u003c/em\u003e\u003csup\u003e+\u003c/sup\u003e cells also expressing \u003cem\u003eSORT1\u003c/em\u003e in lesions, suggest that the GRN-SORT1 axis functions in an autocrine manner within TREM2 macrophages. Additionally, \u003cem\u003eIL-13RA1\u003c/em\u003e was co-localized with basal KCs, marked by \u003cem\u003eKRT14\u003c/em\u003e and \u003cem\u003eKRT5\u003c/em\u003e \u003csup\u003e45, 46\u003c/sup\u003e, consistent with the scRNA-seq data \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG-\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eH). Subsequent analysis of the relative contribution of each L-R pair revealed that both IL-4 and IL-13 ligands can interact with IL-13RA1 \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eI\u003cb\u003e)\u003c/b\u003e. Subsequently, IL-13RA1 may be regulated by IL-4 and IL-13 in the basal KCs of the skin.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eActivation of\u003c/b\u003e \u003cb\u003eGRN\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003eIL-13RA1\u003c/b\u003e \u003cb\u003eexacerbates inflammation and hyperkeratinization both of which are critical in acne progression.\u003c/b\u003e\u003c/p\u003e \u003cp\u003eNext, to explore the function of GRN in TREM2 macrophages, we induced TREM2 macrophage differentiation \u003cem\u003ein vitro\u003c/em\u003e using macrophage colony-stimulating factor (M-CSF) and IL-4 as previously described \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA\u003cb\u003e)\u003c/b\u003e \u003csup\u003e6, 47\u003c/sup\u003e. We observed that the combination of M-CSF/IL-4 induced higher TREM2 expression compared to M-CSF alone \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB\u003cb\u003e)\u003c/b\u003e. Further analysis revealed that both \u003cem\u003eGRN\u003c/em\u003e and \u003cem\u003eSORT1\u003c/em\u003e were upregulated in MCSF/IL-4-induced TREM2 macrophages, suggesting that GRN may play a significant role in TREM2 macrophages activation through its interaction with SORT1 \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC\u003cb\u003e).\u003c/b\u003e Tran \u003cem\u003eet al\u003c/em\u003e. reported that TREM2 macrophages elicit a proinflammatory response by increasing the expression of proinflammatory cytokines and chemokines, such as IL-18, CCL5, and CXCL2 \u003csup\u003e6\u003c/sup\u003e. To investigate the involvement of GRN in the proinflammatory activity of TREM2 macrophages, we treated these cells with recombinant GRN protein, which induced SORT1 expression \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD\u003cb\u003e)\u003c/b\u003e. Our results demonstrated that treatment with 10 ng/ml of GRN activated the upregulation of \u003cem\u003eSORT1\u003c/em\u003e. Intriguingly, higher concentrations of GRN did not enhance the \u003cem\u003eSORT1\u003c/em\u003e response, prompting the selection of 10 ng/ml of GRN as the optimal concentration for further studies \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE\u003cb\u003e)\u003c/b\u003e. This treatment also elevated levels of proinflammatory cytokines (IL-18, CCL5, and CXCL2) known to activate the canonical inflammatory NF-kB pathway, recruiting T cells, mast cells, and natural killer cells, as well as promoting neutrophil infiltration \u003csup\u003e48\u0026ndash;50\u003c/sup\u003e \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF\u003cb\u003e)\u003c/b\u003e. These observations were corroborated by the colocalization of \u003cem\u003eGRN\u003c/em\u003e\u003csup\u003e\u003cem\u003e+\u003c/em\u003e\u003c/sup\u003e cells with IL-18, CCL5, and CXCL2-expressing cells in acne lesions \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eG-\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eH\u003cb\u003e).\u003c/b\u003e Additionally, we observed that GRN promotes the expression of proinflammatory cytokines (\u003cem\u003eTNFA\u003c/em\u003e, \u003cem\u003eIL-1B\u003c/em\u003e, and \u003cem\u003eIL-6\u003c/em\u003e) in TREM2 macrophages (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eI\u003cb\u003e)\u003c/b\u003e, and the coexpression of \u003cem\u003eTNFA\u003c/em\u003e and \u003cem\u003eIL-1B\u003c/em\u003e can be found within \u003cem\u003eGRN\u003c/em\u003e\u003csup\u003e\u003cem\u003e+\u003c/em\u003e\u003c/sup\u003e cells (\u003cb\u003eFigure S21A-S21B).\u003c/b\u003e Altogether, these data suggest that GRN amplifies the inflammatory response in TREM2 macrophages.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eHyperkeratinization, a key initial event in microcomedone formation, can be caused by anomalies in the differentiation, adhesion, and proliferation within the follicular infundibulum. Molecular markers such as KRT6, KRT16 and KRT17 are upregulated, whereas filaggrin (FLG), a marker for keratinocyte differentiation, is downregulated in established microcomedones \u003csup\u003e51\u0026ndash;53\u003c/sup\u003e. To investigate the role of IL-13RA1 in hyperkeratinization, we activated IL-13RA1 in the keratinocyte cell line (HaCaT) with its ligands IL-13 and IL-4. Our findings revealed that compared to the control group, IL-13 treatment significantly upregulated the expression of both \u003cem\u003eIL-13RA1\u003c/em\u003e and \u003cem\u003eIL-4R\u003c/em\u003e in HaCaT cells \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eJ-\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eK\u003cb\u003e)\u003c/b\u003e. In contrast, IL-4 treatment either did not alter or downregulate \u003cem\u003eIL-13RA1\u003c/em\u003e and \u003cem\u003eIL-4R\u003c/em\u003e expression \u003cb\u003e(Figure S21C)\u003c/b\u003e, indicating that only IL-13 activate \u003cem\u003eIL-13RA1\u003c/em\u003e in keratinocytes, which is consistent with the findings in intestinal epithelial cells and bone marrow-derived macrophage \u003csup\u003e41 54\u003c/sup\u003e. Subsequent analysis showed that IL-13 treatment led to increased expression of \u003cem\u003eKRT16\u003c/em\u003e and \u003cem\u003eKRT17\u003c/em\u003e, accompanied by reduced \u003cem\u003eFLG\u003c/em\u003e expression, these gene expression patterns were consistent with our scRNA-seq data \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eL-\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eM\u003cb\u003e)\u003c/b\u003e. However, no significant change was observed in \u003cem\u003eKRT6A\u003c/em\u003e expression \u003cb\u003e(Figure S21D)\u003c/b\u003e. Collectively, these data suggest that IL-13RA1 signaling may play a significant role in driving the dysregulation of genes related to hyperkeratinization, contributing to the development of acne in human skin.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn our study, we first investigated the distribution of signaling pathways within different cell types in both normal and acne skin. Through detailed analysis, we identified 49 signaling pathways that were altered in acne, along with genes showing consistent expression changes across all donors. Our subsequent focus centered on examining the roles of GRN in TREM2 macrophages and IL-13RA1 in keratinocyte basal cells given their consistent alterations across donors and potential importance in acne development. Using spatial-seq datasets, we confirmed the expression and colocalization of these genes with their respective cell types in acne samples. Further exploration of their functional roles \u003cem\u003ein vitro\u003c/em\u003e revealed that GRN may exacerbate acne progression by enhancing inflammation in TREM2 macrophages, as demonstrated by its induction of inflammatory cytokines and chemokine expression. Conversely, the upregulation of IL-13RA1 in basal cells suggests its potential involvement in hyperkeratinization. We activated IL-13RA1 by IL-13 in the HaCaT cell line, which resulted in the dysregulation of genes associated with hyperkeratinization, further implicating its role in acne development. Together, our findings shed light on the complex interplay between inflammation and hyperkeratinization in acne pathogenesis, while also highlighting GRN and IL-13RA1 as promising therapeutic targets for acne (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe initial phase of acne is characterized by the presence of microcomedones, which progresses into papules, pustules, nodules, and cysts as the severity worsens. Studies have indicated the involvement of various innate and adaptive immune cells, including Th1 \u003csup\u003e55\u003c/sup\u003e, Th17 \u003csup\u003e56\u003c/sup\u003e, Foxp3\u003csup\u003e+\u003c/sup\u003e, CD1\u003csup\u003e+\u003c/sup\u003e, CD83\u003csup\u003e+\u003c/sup\u003e DCs \u003csup\u003e57\u003c/sup\u003e, CD68\u003csup\u003e+\u003c/sup\u003e macrophages, and activated mast cells in the early events, along with the secretion of proinflammatory cytokines and chemokines. Limited studies have comprehensively explored dysregulated signaling pathways in different skin cell clusters. In our study, we detected 49 altered signaling pathways encompassing 232 genes in lesional samples compared to nonlesional samples across all cell clusters. Subsequent analysis revealed that not all these genes exhibit significant changes in all donors. However, we identified 10 genes that were consistently dysregulated in all donors and specifically expressed in lymphocytes, myeloid cells, keratinocytes, fibroblasts, and smooth muscle. Among these, Dahl \u003cem\u003eet al.\u003c/em\u003e observed C3 presence at the dermo-epidermal junction in the majority of inflammatory acne lesions, contrasting with non-inflammatory samples \u003csup\u003e58\u003c/sup\u003e. This observation was further supported by Scott \u003cem\u003eet al\u003c/em\u003e., who associated early complement activation with acne inflammation \u003csup\u003e59\u003c/sup\u003e, and these findings also align with our results that fibroblast-derived C3 is upregulated in acne. The A\u0026thinsp;\u0026gt;\u0026thinsp;G polymorphism in the IL-4R gene has been associated with heightened allergic and immune-mediated disorders \u003csup\u003e60\u003c/sup\u003e. In a study by Robaee \u003cem\u003eet al\u003c/em\u003e., a comparison of genetic polymorphisms in IL-4R between 95 acne patients and 87 unrelated healthy controls revealed a significant difference in IL-4R (Q551R A/G) genotypes between the two groups \u003csup\u003e61\u003c/sup\u003e, yet its role in acne remains unknown. In our data, \u003cem\u003eIL-4R\u003c/em\u003e was mainly expressed in lymphocytes, but no significant difference was found in lymphocyte subsets, so further investigation is needed to understand its function in other cell types. Moreover, the function of the other genes, including FAS, SDC1, ANGPTL2, IL-15RA, INHBA, and OSMR in lymphocytes, keratinocytes, fibroblasts, and smooth muscle, are yet to be explored, suggesting that acne involves not only the skin\u0026rsquo;s surface but also a wider systemic dysregulation. Future studies should focus on these genes to advance our understanding of acne pathogenesis.\u003c/p\u003e \u003cp\u003eRecent research has extensively investigated the specific expression of GRN and TREM2 on microglia, the brain-resident macrophages, revealing their links to neurodegenerative disorders such as frontotemporal lobar degeneration and Alzheimer's disease \u003csup\u003e62, 63\u003c/sup\u003e. However, G\u0026ouml;tzl \u003cem\u003eet al\u003c/em\u003e. discovered that microglia isolated from GRN\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice exhibited a hyperactivated state of the neurodegenerative phenotype molecular signature and suppression of genes characteristic of homeostatic microglia. Conversely, loss of TREM2 enhanced the expression of genes associated with a homeostatic state but reduced glucose metabolism in both conditions. This suggests that opposite microglial phenotypes lead to similar widespread brain dysfunction \u003csup\u003e64\u003c/sup\u003e. Our \u003cem\u003ein vivo\u003c/em\u003e data initially revealed GRN expression predominantly in myeloid cells, with a significantly higher expression in TREM2 macrophages in lesional compared to nonlesional samples. Additionally, colocalization of \u003cem\u003eGRN\u003c/em\u003e and TREM2 macrophages was observed in spatial-seq data. Further investigation detected higher expression of \u003cem\u003eGRN\u003c/em\u003e in IL-4-induced TREM2 macrophages compared to non-IL-4-treated cells, indicating a strong correlation between GRN and TREM2 macrophages.\u003c/p\u003e \u003cp\u003eThe role of GRN in inflammation is diverse, showing variability across different disease conditions, tissues, and even cell types. A wealth of evidence from \u003cem\u003ein vitro\u003c/em\u003e and animal models suggests that GRN possesses anti-inflammatory properties. GRN competitively binds with TNFR1/2 to disrupt TNF-α function, which in turn leads to increased IL-10 production in T regulatory cells in conditions such as rheumatoid arthritis and inflammatory bowel disease \u003csup\u003e65, 66\u003c/sup\u003e. Additionally, GRN can selectively inhibit the release of TNF-α and IFN-γ-induced CXCL9 and CXCL10 in CD4\u003csup\u003e+\u003c/sup\u003e T cells \u003csup\u003e67, 68\u003c/sup\u003e. However, the interaction between GRN and TNFR1/2 appears to be complex, with some studies suggesting that GRN does not bind to TNF receptors, thus not directly influencing TNF signaling in various cell lines \u003csup\u003e69\u0026ndash;71\u003c/sup\u003e. On the contrary, GRN can exhibit a pro-inflammatory effect by promoting the expression of proinflammatory cytokines such as IL-6 and IL-8 in different diseases such as psoriasis, obesity, and systemic lupus erythematosus \u003csup\u003e72\u0026ndash;76\u003c/sup\u003e. These contradictory findings suggest that GRN possesses characteristics of a double-edged sword in inflammation, acting both as a protector and provocateur depending on the condition. Our studies on the effect of recombinant GRN on TREM2 macrophages indicate that GRN activates its receptor SORT1 and promotes the expression of proinflammatory cytokines and chemokines from TREM2 macrophages, thereby activating downstream NF-kB signaling pathways \u003csup\u003e48\u0026ndash;50\u003c/sup\u003e. These findings suggest that the proinflammatory function of TREM2 macrophages can be driven through the GRN-SORT1 axis.\u003c/p\u003e \u003cp\u003eIL-13RA1 serves as the receptor or coreceptor for IL-13 and IL-4, playing a critical role in type 2 immunity, which encompasses both host-protective and pathogenic functions \u003csup\u003e77\u003c/sup\u003e. Our data revealed that IL-13RA1 levels were either downregulated or remained unchanged in certain myeloid subsets, a trend contrary to that observed in whole-sample analyses. Therefore, we redirected our focus towards its role in keratinocytes and observed that IL-13RA1 was notably upregulated in basal cells. Previously, studies have demonstrated that IL-13 promotes the self-renewal of intestinal stem cells solely through IL-13RA1 but not IL-4R, underscoring the proliferative function of the IL13-IL13RA1 axis \u003csup\u003e41\u003c/sup\u003e. In the skin, IL-13 activation of IL-13RA1 disrupts the skin\u0026rsquo;s barrier function and facilitates terminal differentiation by downregulating the expression levels of epidermal barrier proteins such as FLG, loricrin (LOR), and involucrin in primary human epidermal keratinocytes \u003csup\u003e78\u0026ndash;80\u003c/sup\u003e. Our findings align with these observations, as we discovered that IL-13 activation of IL-13RA1 resulted in the downregulation of \u003cem\u003eFLG\u003c/em\u003e expression and upregulation of hyperproliferation-associated keratins KRT16 and KRT17 \u003csup\u003e81, 82\u003c/sup\u003e. Thus, our data suggests that the IL-13-IL-13RA1 axis significantly influences keratinocyte proliferation and plays a key role in acne pathogenesis. Interestingly, TREM2 macrophages-recruited mast cell, NKT cell, T cell and neutrophils, all capable of secreting IL-13\u003csup\u003e83, 84\u003c/sup\u003e, this connection bridges inflammation and hyperkeratinization processes in acne, indicating that inflammation precedes and triggers hyperkeratinization. Our data collectively suggest that inflammation and hyperkeratinization, driven by common dysregulated GRN and IL13RA1 may be pivotal in acne development. Targeting these pathways holds promise for more effective acne treatments.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003ePBMC and monocyte isolation\u003c/h2\u003e \u003cp\u003ePBMCs were obtained from the blood of healthy donors after signed written informed consent as approved by the Institutional Review Board at UCLA following the Helsinki Guidelines. PBMCs were then isolated using Ficoll\u0026ndash;Paque density gradients (GE Healthcare) as previously described \u003csup\u003e36\u003c/sup\u003e. Monocytes were isolated from PBMC by positive selection with CD14 MicroBead (Miltenyi Biotec, Cat#130-050-201), then seeded at 800,000 cells per well in 12-well plates.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eTREM2 macrophage differentiation and evaluation via flow cytometry\u003c/h2\u003e \u003cp\u003eCD14 positive cells were differentiated in M-CSF (50 ng/ml) (R\u0026amp;D Systems, Cat#216MC025/CF) for 5 days in RPMI 1640 with 10% FBS at 37\u0026deg;C. To differentiate to TREM2 macrophage, IL-4 (100 ng/ml) (R\u0026amp;D Systems, Cat#204-IL-020/CF) was added from day 5. On day 7, TREM2 expression was evaluated via flow cytometry. Briefly, adherent cells were detached with 1 mM EDTA in PBS and stained with mAbs against TREM2 (R\u0026amp;D Systems, Cat# FAB17291A). Isotype control staining was performed in parallel. Cells were acquired with an LSR II flow cytometer (BD) and analyzed with FlowJo (BD).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eRNA isolation, cDNA synthesis, and real-time PCR\u003c/h2\u003e \u003cp\u003eTotal RNA was isolated using Trizol reagent (Thermo Fisher, Cat#15596018) following manufacturer\u0026rsquo;s protocol. RNA samples were reverse transcribed to cDNA using Script Reverse Transcription Supermix (Bio-Rad, Cat#1708841). Reactions were performed at 25\u0026deg;C for 5 min, 46\u0026deg;C for 20 min and 95\u0026deg;C for 1 min. Real-time PCR was applied using SensiFAST SYBR \u0026amp; Fluorescein Kit (Thomas Scientific, Cat#C755H99). 40 cycles were carried out at 95\u0026deg;C for 5 min, then 95\u0026deg;C for 10 sec, 60\u0026deg;C for 12 sec, 72\u0026deg;C for 12 sec. GAPDH was used as a control. The gene expression level was quantified by the comparative method 2\u003csup\u003e\u0026minus;ΔΔCT\u003c/sup\u003e. The primers used for gene assessment are summarized in Supplementary Table\u0026nbsp;2.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eHaCaT cell culture and treatment\u003c/h2\u003e \u003cp\u003eDMEM\u0026thinsp;+\u0026thinsp;GlutaMAX\u003csup\u003eTM\u003c/sup\u003e-I (Gibco, Cat#10566-016) containing Penicillin/Streptomycin, 10% FBS was used to culture the HaCaT cell line. HaCaT cells were seeded and grown in 12-well plates to ~\u0026thinsp;60% confluent then using various concentrations of IL-4 (R\u0026amp;D Systems, Cat#204-IL-020/CF) and IL-13 (Thermo Scientific, 200-12-2UG) were then added. Cells were harvested after 24 hours and used for further experiments.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eData and code availability\u003c/h2\u003e \u003cp\u003eFor the scRNA-seq data, the sample processing and analysis for this dataset were described in a previous study \u003csup\u003e6\u003c/sup\u003e, and downstream analysis (Data visualization, clustering, cell type mapping, subsetting) was performed according to the Seurat tutorial series (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://satijalab.org/seurat/articles/visualization_vignette\u003c/span\u003e\u003cspan address=\"https://satijalab.org/seurat/articles/visualization_vignette\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), and cell-cell interaction and comparison analysis according to the CellChat tutorial series (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://github.com/jinworks/CellChat\u003c/span\u003e\u003cspan address=\"https://github.com/jinworks/CellChat\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The sample processing and analysis for the Seq-Scope spatial dataset were conducted as previously described \u003csup\u003e6 85\u003c/sup\u003e. Briefly, this dataset included a 6 mm punch biopsy from a back acne papule. This sample was frozen in OCT medium and stored at -80\u0026deg;C until sectioning. For the Seq-Scope array, HISEQ2500 flow cells were used instead of the usual MISEQ flow cells. The distinctions between these two types of flow cells can be found in \u003csup\u003e6\u003c/sup\u003e. Published seq-scope datasets, step-by-step protocol, and data processing tools of Seq-ScopeMISEQ and Seq-ScopeHISEQ will be available at \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.seq-scope.com\u003c/span\u003e\u003cspan address=\"http://www.seq-scope.com\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e and updated regularly.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eStatistical analyses were performed using GraphPad Prism version 9.0, with \u003cem\u003eP\u003c/em\u003e values\u0026thinsp;\u0026le;\u0026thinsp;0.05 were assigned as significant. For comparisons between two groups, an unpaired Student\u0026rsquo;s \u003cem\u003et\u003c/em\u003e test with two-tailed \u003cem\u003ep\u003c/em\u003e-value analysis was performed, unless otherwise stated in the figure legend.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eStudy approval\u003c/h2\u003e \u003cp\u003eThis study was conducted according to the principles expressed in the Declaration of Helsinki. The study was approved by the UCLA IRB (no. 22\u0026ndash;000400).\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":" \u003ch2\u003eDeclaration of interests\u003c/h2\u003e \u003cp\u003eThe authors state no conflict of interest.\u003c/p\u003e \u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis work was supported by NIH R01AR081337 and American Association of Immunologist Intersect Fellowship (GWA).\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eAuthor contributions. MD designed and performed the most of experiments, interpreted data, and wrote the manuscript. WO performed TREM-2 experiments; MQ cultured the HaCaT cell line, GB processed the PBMCs and conducted RNA extraction, AK created the graphical summary, and T To assisted with processing the scRNA-seq dataset. CC provided valuable suggestions and participated in discussions throughout the study, GWA conceived, designed the experiments, supervised the study and provided critical suggestions throughout the study.Declaration of interestsThe authors state no conflict of interest.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eAcknowledgmentsWe thank Yiqian Gu at UCLA Life Sciences for assistance with Seq-scope dataset access. We also appreciate the support of Xiaofeng Huang, Sanlan Li and Tao Liu at Weill Cornell Medicine for assistance with scRNA-seq analyses.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eReynolds RV et al. Guidelines of care for the management of acne vulgaris. J Am Acad Dermatol (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVu R, et al. Wound healing in aged skin exhibits systems-level alterations in cellular composition and cell-cell communication. Cell Rep. 2022;40:111155.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThrane K, et al. Single-Cell and Spatial Transcriptomic Analysis of Human Skin Delineates Intercellular Communication and Pathogenic Cells. J Invest Dermatol. 2023;143:2177\u0026ndash;e21922113.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu Z, et al. Anatomically distinct fibroblast subsets determine skin autoimmune patterns. Nature. 2022;601:118\u0026ndash;24.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJin S, et al. Inference and analysis of cell-cell communication using CellChat. Nat Commun. 2021;12:1088.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDo TH, et al. TREM2 macrophages induced by human lipids drive inflammation in acne lesions. Sci Immunol. 2022;7:eabo2787.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMattii M, et al. Sebocytes contribute to skin inflammation by promoting the differentiation of T helper 17 cells. Br J Dermatol. 2018;178:722\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAgak GW, et al. Phenotype and Antimicrobial Activity of Th17 Cells Induced by Propionibacterium acnes Strains Associated with Healthy and Acne Skin. J Invest Dermatol. 2018;138:316\u0026ndash;24.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAgak GW et al. Extracellular traps released by antimicrobial TH17 cells contribute to host defense. J Clin Invest 131 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKlaka P, et al. A novel organotypic 3D sweat gland model with physiological functionality. PLoS ONE. 2017;12:e0182752.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Y, et al. Notch4 participates in mesenchymal stem cell-induced differentiation in 3D-printed matrix and is implicated in eccrine sweat gland morphogenesis. Burns Trauma. 2023;11:tkad032.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKotowicz K, Dixon GL, Klein NJ, Peters MJ, Callard RE. Biological function of CD40 on human endothelial cells: costimulation with CD40 ligand and interleukin-4 selectively induces expression of vascular cell adhesion molecule-1 and P-selectin resulting in preferential adhesion of lymphocytes. Immunology. 2000;100:441\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003evan Keulen D, et al. Inflammatory cytokine oncostatin M induces endothelial activation in macro- and microvascular endothelial cells and in APOE*3Leiden.CETP mice. PLoS ONE. 2018;13:e0204911.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu HX, et al. LIFR promotes tumor angiogenesis by up-regulating IL-8 levels in colorectal cancer. Biochim Biophys Acta Mol Basis Dis. 2018;1864:2769\u0026ndash;84.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKang S, Kishimoto T. Interplay between interleukin-6 signaling and the vascular endothelium in cytokine storms. Exp Mol Med. 2021;53:1116\u0026ndash;23.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAmersfoort J, Eelen G, Carmeliet P. Immunomodulation by endothelial cells - partnering up with the immune system? Nat Rev Immunol. 2022;22:576\u0026ndash;88.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTrimm E, Red-Horse K. Vascular endothelial cell development and diversity. Nat Rev Cardiol. 2023;20:197\u0026ndash;210.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePlikus MV, et al. Fibroblasts: Origins, definitions, and functions in health and disease. Cell. 2021;184:3852\u0026ndash;72.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu J, et al. Secreted stromal protein ISLR promotes intestinal regeneration by suppressing epithelial Hippo signaling. EMBO J. 2020;39:e103255.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrozovich FV, et al. Mechanisms of Vascular Smooth Muscle Contraction and the Basis for Pharmacologic Treatment of Smooth Muscle Disorders. Pharmacol Rev. 2016;68:476\u0026ndash;532.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMa F, et al. The cellular architecture of the antimicrobial response network in human leprosy granulomas. Nat Immunol. 2021;22:839\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKarlsson M et al. A single-cell type transcriptomics map of human tissues. Sci Adv 7 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee HK, Chauhan SK, Kay E, Dana R. Flt-1 regulates vascular endothelial cell migration via a protein tyrosine kinase-7-dependent pathway. Blood. 2011;117:5762\u0026ndash;71.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChoudhury RH, et al. Extravillous Trophoblast and Endothelial Cell Crosstalk Mediates Leukocyte Infiltration to the Early Remodeling Decidual Spiral Arteriole Wall. J Immunol. 2017;198:4115\u0026ndash;28.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu D, et al. Activation of the NFkappaB signaling pathway in IL6\u0026thinsp;+\u0026thinsp;CSF3\u0026thinsp;+\u0026thinsp;vascular endothelial cells promotes the formation of keloids. Front Bioeng Biotechnol. 2022;10:917726.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo X, et al. Endothelial ACKR1 is induced by neutrophil contact and down-regulated by secretion in extracellular vesicles. Front Immunol. 2023;14:1181016.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAllinson KR, Lee HS, Fruttiger M, McCarty JH, Arthur HM. Endothelial expression of TGFbeta type II receptor is required to maintain vascular integrity during postnatal development of the central nervous system. PLoS ONE. 2012;7:e39336.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAhirwar DK, et al. Fibroblast-derived CXCL12 promotes breast cancer metastasis by facilitating tumor cell intravasation. Oncogene. 2018;37:4428\u0026ndash;42.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin C, et al. Single-cell RNA sequencing reveals the mediatory role of cancer-associated fibroblast PTN in hepatitis B virus cirrhosis-HCC progression. Gut Pathog. 2023;15:26.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeng M, et al. Lepr(+) mesenchymal cells sense diet to modulate intestinal stem/progenitor cells via Leptin-Igf1 axis. Cell Res. 2022;32:670\u0026ndash;86.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNiu J, et al. Keratinocyte growth factor/fibroblast growth factor-7-regulated cell migration and invasion through activation of NF-kappaB transcription factors. J Biol Chem. 2007;282:6001\u0026ndash;11.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGreicius G, et al. PDGFRalpha(+) pericryptal stromal cells are the critical source of Wnts and RSPO3 for murine intestinal stem cells in vivo. Proc Natl Acad Sci U S A. 2018;115:E3173\u0026ndash;81.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLoftus PG, et al. Targeting stromal cell Syndecan-2 reduces breast tumour growth, metastasis and limits immune evasion. Int J Cancer. 2021;148:1245\u0026ndash;59.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLees-Shepard JB, et al. Activin-dependent signaling in fibro/adipogenic progenitors causes fibrodysplasia ossificans progressiva. Nat Commun. 2018;9:471.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDombrowski C, et al. FGFR1 signaling stimulates proliferation of human mesenchymal stem cells by inhibiting the cyclin-dependent kinase inhibitors p21(Waf1) and p27(Kip1). Stem Cells. 2013;31:2724\u0026ndash;36.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAgak GW, et al. Propionibacterium acnes Induces an IL-17 Response in Acne Vulgaris that Is Regulated by Vitamin A and Vitamin D. J Invest Dermatol. 2014;134:366\u0026ndash;73.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEl-Taweel AEI, Salem RM, Abdelrahman AMN, Mohamed BAE. Serum TWEAK in acne vulgaris: An unknown soldier. J Cosmet Dermatol. 2020;19:514\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJeremy AH, Holland DB, Roberts SG, Thomson KF, Cunliffe WJ. Inflammatory events are involved in acne lesion initiation. J Invest Dermatol. 2003;121:20\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang J, et al. Neurotoxic microglia promote TDP-43 proteinopathy in progranulin deficiency. Nature. 2020;588:459\u0026ndash;65.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChoi JP, et al. Macrophage-derived progranulin promotes allergen-induced airway inflammation. Allergy. 2020;75:1133\u0026ndash;45.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu P, et al. IL-13 secreted by ILC2s promotes the self-renewal of intestinal stem cells through circular RNA circPan3. Nat Immunol. 2019;20:183\u0026ndash;94.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu F, et al. Sortilin-mediated endocytosis determines levels of the frontotemporal dementia protein, progranulin. Neuron. 2010;68:654\u0026ndash;67.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHorinokita I et al. Involvement of Progranulin and Granulin Expression in Inflammatory Responses after Cerebral Ischemia. Int J Mol Sci 20 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMortensen MB, et al. Targeting sortilin in immune cells reduces proinflammatory cytokines and atherosclerosis. J Clin Invest. 2014;124:5317\u0026ndash;22.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSong Y, et al. The Msi1-mTOR pathway drives the pathogenesis of mammary and extramammary Paget's disease. Cell Res. 2020;30:854\u0026ndash;72.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang X, Yin M, Zhang LJ, Keratin. 17-Critical Barrier Alarmin Molecules in Skin Wounds and Psoriasis. Cells. 2019;6:16.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTurnbull IR, et al. Cutting edge: TREM-2 attenuates macrophage activation. J Immunol. 2006;177:3520\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUllah A, et al. A narrative review: CXC chemokines influence immune surveillance in obesity and obesity-related diseases: Type 2 diabetes and nonalcoholic fatty liver disease. Rev Endocr Metab Disord. 2023;24:611\u0026ndash;31.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZeng Z, Lan T, Wei Y, Wei X. CCL5/CCR5 axis in human diseases and related treatments. Genes Dis. 2022;9:12\u0026ndash;27.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYasuda K, Nakanishi K, Tsutsui H. Interleukin-18 in Health and Disease. Int J Mol Sci 20 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAkaza N, et al. Effects of Propionibacterium acnes on various mRNA expression levels in normal human epidermal keratinocytes in vitro. J Dermatol. 2009;36:213\u0026ndash;23.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFreedberg IM, Tomic-Canic M, Komine M, Blumenberg M. Keratins and the keratinocyte activation cycle. J Invest Dermatol. 2001;116:633\u0026ndash;40.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKurokawa I, Nakase K. Recent advances in understanding and managing acne. \u003cem\u003eF1000Res\u003c/em\u003e 9 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSheikh F, et al. The Interleukin-13 Receptor-alpha1 Chain Is Essential for Induction of the Alternative Macrophage Activation Pathway by IL-13 but Not IL-4. J Innate Immun. 2015;7:494\u0026ndash;505.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMouser PE, Baker BS, Seaton ED, Chu AC. Propionibacterium acnes-reactive T helper-1 cells in the skin of patients with acne vulgaris. J Invest Dermatol. 2003;121:1226\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEliasse Y, et al. IL-17(+) Mast Cell/T Helper Cell Axis in the Early Stages of Acne. Front Immunol. 2021;12:740540.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKelhala HL, et al. IL-17/Th17 pathway is activated in acne lesions. PLoS ONE. 2014;9:e105238.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDahl MG, McGibbon DH. Complement C3 and immunoglobulin in inflammatory acne vulgaris. Br J Dermatol. 1979;101:633\u0026ndash;40.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eScott DG, Cunliffe WJ, Gowland G. Activation of complement-a mechanism for the inflammation in acne. Br J Dermatol. 1979;101:315\u0026ndash;20.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUeta M, et al. Association of combined IL-13/IL-4R signaling pathway gene polymorphism with Stevens-Johnson syndrome accompanied by ocular surface complications. Invest Ophthalmol Vis Sci. 2008;49:1809\u0026ndash;13.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAl Robaee AA, AlZolibani A, Shobaili A, H., Settin A. Association of interleukin 4 (-590 T/C) and interleukin 4 receptor (Q551R A/G) gene polymorphisms with acne vulgaris. Ann Saudi Med. 2012;32:349\u0026ndash;54.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUlrich JD, Holtzman DM. TREM2 Function in Alzheimer's Disease and Neurodegeneration. ACS Chem Neurosci. 2016;7:420\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaker M, et al. Mutations in progranulin cause tau-negative frontotemporal dementia linked to chromosome 17. Nature. 2006;442:916\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGotzl JK et al. Opposite microglial activation stages upon loss of PGRN or TREM2 result in reduced cerebral glucose metabolism. EMBO Mol Med 11 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWei F, et al. PGRN protects against colitis progression in mice in an IL-10 and TNFR2 dependent manner. Sci Rep. 2014;4:7023.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTang W, et al. The growth factor progranulin binds to TNF receptors and is therapeutic against inflammatory arthritis in mice. Science. 2011;332:478\u0026ndash;84.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLan YJ, Sam NB, Cheng MH, Pan HF, Gao J. Progranulin as a Potential Therapeutic Target in Immune-Mediated Diseases. J Inflamm Res. 2021;14:6543\u0026ndash;56.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMundra JJ, Jian J, Bhagat P, Liu CJ. Progranulin inhibits expression and release of chemokines CXCL9 and CXCL10 in a TNFR1 dependent manner. Sci Rep. 2016;6:21115.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLang I, Fullsack S, Wajant H. Lack of Evidence for a Direct Interaction of Progranulin and Tumor Necrosis Factor Receptor-1 and Tumor Necrosis Factor Receptor-2 From Cellular Binding Studies. Front Immunol. 2018;9:793.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen X, et al. Progranulin does not bind tumor necrosis factor (TNF) receptors and is not a direct regulator of TNF-dependent signaling or bioactivity in immune or neuronal cells. J Neurosci. 2013;33:9202\u0026ndash;13.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEtemadi N, Webb A, Bankovacki A, Silke J, Nachbur U. Progranulin does not inhibit TNF and lymphotoxin-alpha signalling through TNF receptor 1. Immunol Cell Biol. 2013;91:661\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQiu F, et al. Expression level of the growth factor progranulin is related with development of systemic lupus erythematosus. Diagn Pathol. 2013;8:88.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJing C, Zhang X, Song Z, Zheng Y, Yin Y. Progranulin Mediates Proinflammatory Responses in Systemic Lupus Erythematosus: Implications for the Pathogenesis of Systemic Lupus Erythematosus. J Interferon Cytokine Res. 2020;40:33\u0026ndash;42.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTanaka A, et al. Serum progranulin levels are elevated in patients with systemic lupus erythematosus, reflecting disease activity. Arthritis Res Ther. 2012;14:R244.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMatsubara T, et al. PGRN is a key adipokine mediating high fat diet-induced insulin resistance and obesity through IL-6 in adipose tissue. Cell Metab. 2012;15:38\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFarag AGA, et al. Progranulin and beta-catenin in psoriasis: An immunohistochemical study. J Cosmet Dermatol. 2019;18:2019\u0026ndash;26.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWynn TA. Type 2 cytokines: mechanisms and therapeutic strategies. Nat Rev Immunol. 2015;15:271\u0026ndash;82.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHowell MD, et al. Cytokine modulation of atopic dermatitis filaggrin skin expression. J Allergy Clin Immunol. 2007;120:150\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim BE, Leung DY, Boguniewicz M, Howell MD. Loricrin and involucrin expression is down-regulated by Th2 cytokines through STAT-6. Clin Immunol. 2008;126:332\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZeng YP, Nguyen GH, Jin HZ. MicroRNA-143 inhibits IL-13-induced dysregulation of the epidermal barrier-related proteins in skin keratinocytes via targeting to IL-13Ralpha1. Mol Cell Biochem. 2016;416:63\u0026ndash;70.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLeigh IM, et al. Keratins (K16 and K17) as markers of keratinocyte hyperproliferation in psoriasis in vivo and in vitro. Br J Dermatol. 1995;133:501\u0026ndash;11.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang L, Fan X, Cui T, Dang E, Wang G. Nrf2 Promotes Keratinocyte Proliferation in Psoriasis through Up-Regulation of Keratin 6, Keratin 16, and Keratin 17. J Invest Dermatol. 2017;137:2168\u0026ndash;76.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun B, et al. Characterization and allergic role of IL-33-induced neutrophil polarization. Cell Mol Immunol. 2018;15:782\u0026ndash;93.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRael EL, Lockey RF. Interleukin-13 signaling and its role in asthma. World Allergy Organ J. 2011;4:54\u0026ndash;64.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCho CS, et al. Microscopic examination of spatial transcriptome using Seq-Scope. Cell. 2021;184:3559\u0026ndash;e35723522.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"cell-communication-and-signaling","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ccas","sideBox":"Learn more about [Cell Communication and Signaling](http://biosignaling.biomedcentral.com/)","snPcode":"12964","submissionUrl":"https://submission.nature.com/new-submission/12964/3","title":"Cell Communication and Signaling","twitterHandle":"@bmc","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Cell-cell communication, acne vulgaris, signal distribution, Cutibacterium acnes, single cell and spatial transcriptomic sequencing, inflammation, TREM2 macrophages, GRN, hyperkeratinization, IL-13RA1","lastPublishedDoi":"10.21203/rs.3.rs-4402048/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4402048/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eA comprehensive understanding of the intricate cellular and molecular changes governing the complex interactions between cells within acne lesions is currently lacking. Herein, we analyzed early papules from six subjects with active acne vulgaris, utilizing single-cell and high-resolution spatial RNA sequencing. We observed significant changes in signaling pathways across seven different cell types when comparing lesional skin samples (LSS) to healthy skin samples (HSS). Using CellChat, we constructed an atlas of signaling pathways for the HSS, identifying key signal distributions and cell-specific genes within individual clusters. Further, our comparative analysis revealed changes in 49 signaling pathways across all cell clusters in the LSS\u0026mdash; 4 exhibited decreased activity, whereas 45 were upregulated, suggesting that acne significantly alters cellular dynamics. We identified ten molecules, including GRN, IL-13RA1 and SDC1 that were consistently altered in all donors. Subsequently, we focused on the function of GRN and IL-13RA1 in TREM2 macrophages and keratinocytes as these cells participate in inflammation and hyperkeratinization in the early stages of acne development. We evaluated their function in TREM2 macrophages and the HaCaT cell line. We found that GRN increased the expression of proinflammatory cytokines and chemokines, including IL-18, CCL5, and CXCL2 in TREM2 macrophages. Additionally, the activation of IL-13RA1 by IL-13 in HaCaT cells promoted the dysregulation of genes associated with hyperkeratinization, including KRT17, KRT16, and FLG. These findings suggest that modulating the GRN-SORT1 and IL-13-IL-13RA1 signaling pathways could be a promising approach for developing new acne treatments.\u003c/p\u003e","manuscriptTitle":"Analysis of Intracellular Communication Reveals Consistent Gene Changes Associated with Early-Stage Acne Skin","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-05-29 02:20:27","doi":"10.21203/rs.3.rs-4402048/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-05-29T23:00:51+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-05-26T15:11:13+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-05-16T15:04:41+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"4592299566883320243893296077727589004","date":"2024-05-16T13:42:18+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"196387719475951962509244629748654996504","date":"2024-05-14T15:23:22+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-05-14T14:16:36+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-05-14T00:59:50+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-05-14T00:59:50+00:00","index":"","fulltext":""},{"type":"submitted","content":"Cell Communication and Signaling","date":"2024-05-10T17:21:29+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"cell-communication-and-signaling","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ccas","sideBox":"Learn more about [Cell Communication and Signaling](http://biosignaling.biomedcentral.com/)","snPcode":"12964","submissionUrl":"https://submission.nature.com/new-submission/12964/3","title":"Cell Communication and Signaling","twitterHandle":"@bmc","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"198734e1-7bc7-42ce-8b27-98081e34efad","owner":[],"postedDate":"May 29th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-08-22T19:26:09+00:00","versionOfRecord":{"articleIdentity":"rs-4402048","link":"https://doi.org/10.1186/s12964-024-01725-4","journal":{"identity":"cell-communication-and-signaling","isVorOnly":false,"title":"Cell Communication and Signaling"},"publishedOn":"2024-08-14 15:57:00","publishedOnDateReadable":"August 14th, 2024"},"versionCreatedAt":"2024-05-29 02:20:27","video":"","vorDoi":"10.1186/s12964-024-01725-4","vorDoiUrl":"https://doi.org/10.1186/s12964-024-01725-4","workflowStages":[]},"version":"v1","identity":"rs-4402048","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4402048","identity":"rs-4402048","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.