Protein disulfide isomerase family is a potential therapeutic target in acute myeloid leukemia | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Protein disulfide isomerase family is a potential therapeutic target in acute myeloid leukemia Li Lin, Yue Lu, Yingkun Zhang, Nannan Qi, Shuyi Huang, Meinan Peng, and 7 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5764412/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Acute myeloid leukemia (AML) as the second most common hematological malignancy remains currently incurable. In this study, we found the protein disulphide isomerase family (PDIs) was expressed in primary leukemia cells, with particular emphasis on ERP5 and ERP57. The compound PACMA31 demonstrated the ability to inhibit proliferation, enhance differentiation, exacerbate oxidative stress, and induce apoptosis in AML cells. RNA sequencing analysis revealed that PACMA31 impeded the proliferation of AML cells by modulating the unfolded protein response (UPR). Notably, Western blot results indicated that the antiproliferative effects of PACMA31 were mediated through the PERK/eIF2α signaling pathway. The selective inhibition of PDIs activity collectively induces apoptosis and differentiation in AML cells by activating the UPR via the PERK/eIF2α pathway. Consequently, PDIs inhibitors may represent promising candidates for the development of antitumor therapeutics against AML. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Highlights PDI is a promising and selective therapeutic target in AML. Introduction Acute myeloid leukemia (AML) is a clonal malignant proliferative disorder of the hematopoietic system, characterized by significant heterogeneity and marked by uncontrolled proliferation of myeloid precursor cells and disturbances in differentiation [ 1 ]. Over the past decade, advancements in novel therapeutic agents and the implementation of hematopoietic stem cell transplantation (HSCT) have led to a significant improvement in overall survival (OS) for AML patients [ 2 , 3 ]. Yet, the 5-year OS rate for AML patients under the age of 60 was approximately 40%, conversely, for individuals aged 65 and older, the median OS is only 4 months. Furthermore, even in cases where complete remission was achieved, approximately 70% of patients experience relapse within 5 years. This phenomenon could be attributed to the protective role of the bone marrow microenvironment (BMM) for AML cells and the clonal selection that facilitates the emergence of therapy-resistant clones [ 4 – 6 ] Consequently, there was an urgent need to identify novel therapeutic targets and develop innovative treatment strategies for AML patients and healthcare providers [ 7 ]. The endoplasmic reticulum (ER), recognized as the largest organelle within the cell, primarily functions in protein folding, post-translational modification, maturation of proteins, calcium metabolism, and lipid synthesis [ 8 – 9 ]. Nonetheless, various intrinsic and extrinsic factors, including oxidative stress, hypoxia, and deprivation of calcium or glucose, can disrupt ER functionality, thereby triggering a cytoprotective signaling pathway known as the ER stress response or unfolded protein response (UPR) [ 10 ]. This response involved the activation of three key signaling pathways: pancreatic eukaryotic initiation factor 2B kinase (PERK), inositol-requiring enzyme 1α (IRE1α), and activating transcription factor 6 (ATF6), which aimed to mitigate ER stress by reducing protein synthesis, enhancing the levels of chaperones to facilitate proper protein folding, and promoting protein degradation [ 11 ]. The unfolded protein response (UPR) was particularly significant in the context of leukemogenesis, as it supported the survival of leukemic cells and their resistance to chemotherapy, influenced by the production of mutated proteins and the surrounding bone marrow microenvironment [ 12 ]. Previous studies had indicated that markers indicative of activated UPR signaling, such as sXBP1 and elevated expression of UPR-activated genes like p-IRE1α and protein disulphide isomerase (PDI), were present in approximately 25% of samples from patients with AML [ 13 ]. The PDI family, classified as endoplasmic ER-thiodisulfide oxidoreductases, comprised 21 enzymes that possess a conserved thioredoxin-like catalytic redox center characterized by pairs of reactive cysteine residues [ 14 ]. These enzymes facilitated the formation, cleavage, and rearrangement of disulfide bonds while also exhibiting chaperone protein activity. Due to their dual functionality as oxidoreductases and molecular chaperones, PDIs were integral to the processes of protein folding and oxidation. Given that proteotoxic and oxidative stress are increasingly recognized as phenotypic markers of cancer, recent studies have demonstrated that proteins within the PDI family are significantly overexpressed in both cancerous tissues and cancer cell lines [ 15 ]. Members PDI family function as oncogenes and play significant roles in the development and progression of various cancers, encompassing processes such as cellular proliferation, invasion, metastasis, and resistance to chemotherapy. For instance, PDI had been shown to influence the onset and advancement of colorectal cancer by modulating the apoptosis signaling pathway and the oxidative stress within the endoplasmic reticulum [ 16 ]; PDIA4 facilitated the development of renal cell carcinoma through the regulation of the ATF4/SLC7A11 pathway, which serves to inhibit ferroptosis [ 17 ]. The upregulation of PDIA3 had been implicated in the progression of renal cell carcinoma by initiating a feedback loop involving STAT3; Furthermore, PDIA4 was considered to be associated with the tumorigenesis of triple-negative breast cancer and the resistance to radiotherapy, primarily through the modulation of the JNK signaling pathway [ 18 ]. In chronic myeloid leukemia (CML), Chevet et al. found that the overexpression of PDIA5 in CML was associated with increased resistance to imatinib [ 19 ]. Nevertheless, the connection between the expression of PDIs and AML remains largely unexplored. Propynoic acid carbamoylmethyl amide (PACMA31), an irreversible inhibitor of PDIs, had demonstrated efficacy against ERP5, ERP57, PDI, and ERP46 [ 20 ]. Recent researches indicated that PACMA31 might disrupt proteostasis and induce cell death through various pathways in ovarian cancer cells [ 21 ], as well as enhance sensitivity to sorafenib in sorafenib-resistant hepatocellular carcinoma [ 22 ]. However, the effects of PACMA31 on the proliferation and differentiation of AML cells have yet to be clarified. Moreover, the relationship between PDIs and chemotherapy resistance, as well as relapse in AML, remains ambiguous. Therefore, the objective of this study was to target PDI family proteins in order to disrupt ER protein homeostasis, thereby facilitating the transition from an adaptive UPR to a pro-apoptotic UPR, with the aim of enhancing treatment efficacy in AML. Materials and methods Patients Clinical data were obtained from the medical records of patients diagnosed with AML at the Department of Hematology, The Second Hospital of Hebei Medical University in Shijiazhuang, China. Between February 2023 and December 2023, a total of 29 patients were enrolled in this study, each with comprehensive diagnostic information. Additionally, 9 healthy individuals, matched for age and sex, were included as a control group. Gene mutations in NPM1, FLT3-ITD, CEBPA, DNMT3A, IDH1, and IDH2 were assessed through whole-genome sequencing. Patient characteristics are presented in Table 1 and 2, utilizing descriptive statistical methods. This study received approval from the Medical Ethics Committee of the Second Hospital of Hebei Medical University, and all participants provided written informed consent. Cell culture The cell lines Kasumi-1, SKNO-1, MOLM-13, NB4, and HL-60 were generously provided by P. H. Chen Suning. THP-1 cells were sourced from the American Type Culture Collection. Leukemia blast cells (BMMNCs) were isolated from the bone marrow of patients diagnosed with AML and were characterized by flow cytometry, achieving a purity exceeding 95%. Peripheral blood mononuclear cells (PBMNCs) were obtained from venous blood samples collected from healthy donors, as previously documented. All cell lines were maintained in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin sulfate. RT-PCR Total RNA was extracted from BMMNCs or healthy control PBMNCs (HC-PBMNCs) utilizing Trizol reagent (Life Technologies) in accordance with the manufacturer's protocol. Subsequently, 500 ng of the isolated RNA was reverse transcribed into complementary DNA (cDNA) employing the Superscript II cDNA synthesis kit (Invitrogen). The expression levels of PDI genes were analyzed using the SYBR Green method (Finnzymes F410L, Thermo Scientific, Rockford, IL, USA). The primers specific to the PDI genes were detailed in Table 3. The cycle threshold (Ct) values were normalized against the ACTB gene, and the relative fold changes in expression were determined using the 2-ΔΔCt method. Cell viability assays Kasumi-1, SKNO-1, MOLM-13, NB4, HL-60, and THP-1 cell lines were cultured in a 96-well plate at a density of 5×10 3 cells per well. Following the specified treatment, the cells were incubated for an additional 1.5 hours with 10 µL of Cell Counting Kit-8 solution. The absorbance was subsequently measured at 450nm using a SpectraMax M5 spectrophotometer (Molecular Devices, USA). Flow cytometric analysis Kasumi-1 cells were cultured in 6-well plates at a density of 3×10 6 cells per well and subsequently treated with PACMA31 for durations of 6, 12, and 24 h. Following the treatment, the cells were harvested by centrifugation at 300 g for 5 minutes and washed three times with phosphate-buffered saline (PBS). Apoptosis was evaluated using an Annexin V-PE/7-AAD Apoptosis Detection Kit (Yeasen Biotechnology, Shanghai, China), while cell cycle analysis was conducted utilizing a Cell Cycle and Apoptosis Analysis Kit. Oxidative stress measurement Following treatment, cells were harvested, washed with PBS, and incubated in the dark at 37°C for 30 minutes with the cell-permeable probe 2',7'-dichlorofluorescein diacetate (DCFH-DA). Subsequently, DCF fluorescence was quantified using flow cytometry, with an excitation wavelength set at 488 nm and an emission wavelength at 535 nm. Lipid peroxidation within the cells was assessed using the C11 BODIPY 581/591 fluorescent probe, also incubated at 37°C for 30 minutes, and measurements were taken under the Texas Red (590 nm) and FITC (510 nm) channels. Additionally, inhibitors were utilized to elucidate the relationship between reactive oxygen species (ROS), mitochondrial function, and apoptosis. Cells were treated with 5 mM N-acetyl-L-cysteine (NAC) and 10 μM Z-VAD-FMK, respectively, prior to exposure to PACMA31 for the specified duration. The alterations in apoptosis were evaluated as previously described. Determination of intracellular Free Ca2+ and MMP KASUMI-1 cells cultured in 6-well plates were subjected to varying concentrations of PACMA31 (0.3125, 0.625, 1.25, and 2.5 μM) for a duration of 6 h. Following the treatment, the cells were rinsed twice with PBS and subsequently stained with Fluo-4 AM in accordance with the manufacturer's protocol. The fluorescence of the stained cells was then quantified using a microplate reader. For the assessment of MMP, cells were harvested after PACMA31 treatment for different time intervals and incubated with 10 nM tetramethylrhodamine methyl ester perchlorate (TMRE) for 30 minutes at 37°C. TMRE, a cationic fluorophore commonly employed for staining cellular mitochondria and mitochondrial matrices, was utilized to evaluate the percentage of cells exhibiting MMP, which was also analyzed using a microplate reader. Transcriptome sequencing In the context of RNA sequencing (RNA-seq) experiments, KASUMI-1 cells were subjected to treatment with PACMA31 or a control vehicle for a duration of six hours. Total RNA was extracted from the cells utilizing TRIzol reagent (Invitrogen). The RNA expression profiles of KASUMI-1 AML cells, following treatment with PACMA31 or the vector control, were subsequently submitted to a specialized testing facility (Wei Huan, Shanghai, China) for high-throughput transcriptome sequencing. The DESeq2 R package was employed to identify differentially expressed genes (DEGs) between the two experimental groups. Genes exhibiting a log2 fold change greater than 1.0 and a p-value of less than 0.05 were classified as differentially expressed, with the absolute value of the log2 fold change utilized for ranking purposes. Furthermore, the ClusterProfiler R package was utilized to assess the statistical enrichment of the DEGs within Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways. Western blot analysis Protein levels in KASUMI-1 cell extracts were evaluated using a Western blot assay to investigate the effects of varying concentrations of PACMA31. The protein samples were transferred to nitrocellulose membranes and subsequently incubated with primary antibodies diluted to a concentration of 1:1000. Following this, secondary antibodies were applied for additional incubation. The standard protocol for Western blotting was adhered to, with comprehensive procedures outlined in prior publications. The primary antibodies utilized included PARP, Caspase3, γH2AX, Bip, PERK, P-PERK, CHOP, eIF2α, P-eIF2α, XBP1, XBP1S, and ATF6, all sourced from Cell Signaling Technology (Shanghai, China). GAPDH and Tubulin antibodies served as internal controls. Statistical analysis The data utilized in this study were analyzed using GraphPad Prism 8 software. Protein quantification was performed with ImageJ, and all protein levels were normalized against a loading control. Each experimental procedure was conducted in triplicate. Mean values and standard deviations (SDs) were computed. Comparisons between two groups were conducted using an unpaired t-test, while comparisons among multiple groups were performed using one-way analysis of variance (ANOVA) followed by Tukey’s post hoc test. A p-value of less than 0.05 was considered indicative of a statistically significant difference. Results PDI genes expression positively correlated with clinical characteristics In a preliminary investigation of PDI gene expression in AML, we assessed the expression levels of 21 PDI genes in primary BMMNCs obtained from 25 AML patients, as well as in PBMNCs from 9 healthy donors. Additionally, we evaluated AML-derived cell lines, specifically KASUMI-1, NB4, and THP-1. Our findings indicated that the expression of PDI genes was significantly elevated in the BMMNCs of AML patients when compared to the healthy control PBMNCs (Fig1A). PACMA31 has a significant cytotoxicity on AML and demonstrate synergistic anti-leukemia efficacy Given the structural and active site similarities among members of the PDI family, our prior study had demonstrated that the PDI inhibitor PACMA31 significantly inhibits various PDI family members, including PDI, ERP46, ERP5, and ERP57, which are notably overexpressed in tumors, particularly ERP5 and ERP57. This inhibitory effect was also shown to be significantly dose-dependent in leukemic cell lines. Following this, we conducted a comprehensive investigation to assess the anti-leukemic properties of PACMA31 in five primary BMMNC samples obtained from patients diagnosed with AML (Fig1C), as well as in three PBMNC samples sourced from healthy donors (Fig1D). The results indicated that PACMA31 effectively inhibited cell proliferation in samples from patients, while no such effect was observed in samples from healthy individuals. To evaluate the anti-leukemia efficacy of PACMA31, chemotherapy, and a targeted drug as monotherapies or in combination, we conducted in vitro experiments examining their impact on the viability of six AML cell lines. The median inhibitory concentration (IC50) values for each single agent were established through dose-response assessments utilizing CCK8 assays following a 48-hour treatment period which values for PACMA31 ranged from 0.002 mM to 3.0 Mm (Fig2A). To investigate the pharmacological interactions between PACMA31 and either chemotherapy or a targeted agent, incremental doses were administered based on the IC50 values of the respective drugs. In two of the six cell lines, the combination of PACMA31 with either VEL or Deci resulted in synergistic growth inhibition, as determined by the Chou-Talalay method of analysis (combination index [CI] < 1.0). Notably, synergy was also observed when PACMA31 was combined with Ara-C (Fig2B, 2C). PACMA31 induced apoptosis of AML cells To investigate the potential mechanisms underlying the growth inhibition of AML cell lines mediated by PACMA31, we initially assessed the impact of PACMA31 on the cell cycle following a 6-hour exposure. Notable accumulation in the G2/M phase and a reduction in the G0/G1 peak were observed post-treatment with PACMA31(Fig3B). Additionally, PACMA31 treatment led to a significant increase in apoptosis when compared to the control group (Fig. 3A,3G). Subsequently, we investigated key molecules involved in the apoptosis pathway, specifically caspase-3, PARP, and γH2AX. Our findings revealed a marked increase in the expression of cleaved-PARP and γH2AX protein levels in the PACMA31-treated group, which was observed to be concentration-dependent (Fig5A). Following this, through the utilization of a microplate reader, we observed that the reduction of PDI activity, along with the resultant increase in cytosolic calcium levels (calcium overload) (Fig3C), could lead to mitochondrial impairment, a decrease in mitochondrial membrane potential(Fig3D), and ultimately, apoptosis in KASUMI-1 cells. In addition, PACMA31 was found to induce apoptosis in AML cells through mechanisms related to oxidative stress. To explore the role of oxidative stress in PACMA31-induced apoptosis, we employed flow cytometry with the redox-sensitive dye CM-H2DCFDA, which demonstrated that treatment of KASUMI-1 cells with PACMA31 resulted in a rapid increase in ROS levels (Fig3E). Subsequently, we investigated whether N-acetylcysteine (NAC) could confer protection to AML cells against ROS-induced apoptosis. The results from Annexin V-PE/7-AAD staining indicated that NAC effectively inhibited the apoptotic effects of PACMA31 in KASUMI-1 cells (Fig3H). As lipid peroxidation was a key parameter to evaluate the oxidative stress, then, BODIPY581/591C11 staining, a lipid peroxidation probe, was applied to measure the level of intracellular lipid oxidation. The lipid peroxidation level of KASUMI-1 cells increased, as the concentration of PACMA31 increased (Fig3F). Potential mechanism of PACMA31 by RNAseq In order to elucidate the impact of PDI activity on global transcription, an RNA sequencing analysis was conducted on KASUMI-1 cells treated with PACMA31. The results revealed that PACMA31 treatment led to significant alterations in the expression of 496 genes, indicating that this compound induces substantial genome-wide changes in gene expression (Fig4A). Furthermore, gene set enrichment analysis (GSEA) of the transcriptional data indicated a significant activation of the UPR pathway in cells treated with PACMA31(Fig4B, 4C,4D). The link between PACMA31 and UPR in AML PACMA31 was found to inhibit the activity of enzymes belonging to the PDI family, which subsequently disrupts the redox potential within the cell, leading to the activation of the UPR. To ascertain whether the apoptosis induced by PACMA31 is contingent upon the ER stress pathway, we conducted an analysis of the protein levels of IRE1, ATF6, and PERK-key sensors of ER stress-along with their downstream effectors in AML cell models following a 6-hour treatment with PACMA31, utilizing western blotting techniques. The findings indicated that PACMA31 significantly elevated the expression of PERK and its downstream targets, including phosphorylated eIF2α (P-eIF2α) and phosphorylated PERK (P-PERK), in a dose-dependent manner. Conversely, no alterations were detected in the protein levels of XBP1u, XBP1s, or ATF6. Collectively, these results suggest that PACMA31 induces apoptosis associated with ER stress through the PERK/eIF2α signaling pathway (Fig5B). Discussion For several decades, the basic treatment for AML had involved repeated cycles of intensive chemotherapy utilizing anthracycline and cytarabine. Nonetheless, the development of therapy-resistant clones and the protective role of the bone marrow microenvironment for AML cells had resulted in approximately 50% of AML patients experiencing disease recurrence, with a correspondingly poor prognosis for this population[ 23 ]. Consequently, it is imperative to investigate treatment options that demonstrate high efficacy while minimizing toxicity for AML patients. In the present study, we first reported that the use of the PDI inhibitor PACMA31 was found to significantly inhibit cell proliferation and induce apoptosis in AML cells. Initially, an analysis of gene expression alterations of PDIs in patients with AML was conducted. The results indicated a significant increase in the expression levels of ERP5 and ERP57 in the BMMC of AML patients when compared to healthy individuals. As ER chaperones, PDIs play a crucial role in protecting cells from apoptosis and mediating treatment resistance in solid tumors[ 24 ]. In vitro studies have demonstrated that the knockdown of PDIs via short hairpin RNA (shRNA) can induce terminal differentiation in leukemia cells, resulting in cell cycle arrest followed by cell death. Furthermore, PDIs have the capacity to bind to the stem-loop region of CEBPA mRNA, thereby inhibiting CEBPA expression and ultimately obstructing myeloid differentiation in AML patients experiencing activation of the UPR [ 25 ]. Previous researches had indicated that elevated levels of ERP57 expression are associated with chemoresistance in AML cell lines, and the knockdown of ERP57 enhances the susceptibility of AML cells to chemotherapy agents [ 26 ]. Furthermore, as noted by Arisa et al., the PDIA5/ATF6α signaling pathway plays a significant role in the resistance of leukemia cells to imatinib[ 20 ]. Additionally, our study demonstrated that a small molecule inhibitor (PACMA31) of PDIs effectively reduced the viability of AML cells and induces cell cycle arrest and enhanced efficacy of combination therapy was observed in vitro. Recent studies had indicated that the irreversible PDI inhibitor PACMA31 efficiently induces apoptosis in a variety of human cancer cell lines [ 27 – 28 ]. Homoplastically, our findings also indicated that PACMA31 decreased the MMP in the KASUMI-1 cell line. Subsequently, PACMA31 was shown to promote the activation of both Caspase-3 and PARP, suggesting the involvement of the intrinsic apoptotic pathway in PACMA31-induced apoptosis. Moreover, the apoptosis induced by PACMA31 was determined to be caspase-dependent, as this process was partially reversed by pretreatment with Z-VAD-FMK, a compound that irreversibly bind to the catalytic site of caspase proteases and inhibits apoptosis induction. Recent researches had established that diminished levels of ROS are essential for preserving the pluripotent potential of stem cells[ 29 – 30 ]. A multitude of studies had suggested that the inhibition of thioredoxin reductase (TrxR) activity leads to elevated intracellular ROS levels, subsequently inducing apoptosis in various cancer cell lines [ 31 ]. The chemical compound PACMA31, identified as a TrxR inhibitor, has been shown to facilitate the accumulation of ROS and initiate apoptosis in cancer cells through mechanisms associated with oxidative stress. In our investigation, KASUMI-1 cells were subjected to PACMA31 treatment for a duration of 6 hours, resulting in a concentration-dependent increase in intracellular ROS levels and lipid peroxidation. Furthermore, the application of the ROS scavenger NAC significantly attenuated the apoptosis induced by PACMA31. Further, we conducted an in-depth mechanistic investigation and discovered that PACMA31, have the capacity to activate the UPR through the activation of the PERK/eIF2α pathway, which constitutes a significant component of the UPR signaling network. Conclusion In summary, our study elucidated a molecular mechanism by which PDIs contributed to the pathogenesis and progression of AML through the activation of the PERK/eIF2α signaling pathway. Notably, the irreversible PDI inhibitor PACMA31 induces apoptosis in AML cell lines by modulating oxidative stress and mitochondrial apoptosis signaling pathways. These findings offer valuable insights into potential therapeutic strategies for AML, positioning PDIs as a promising target for treatment. However, further clinical investigations and animal experiments are necessary to validate the therapeutic efficacy of this approach in AML. Declarations Disclosures The authors have no conflicts of interest to disclose. Contributions JZ and YW designed the study. LL, YL, YZ, SH, MP, ZZ and AY performed the experiments. NQ, ZN, YW and YH provided clinical data and case samples. LL, JZ and YW drafted and revised the manuscript which was finalized with input from all authors. Funding This work was supported by Hebei Natural Science Foundation (H2022206395) and S & T Program of Hebei (216Z7705G). References Cai YH, Wang J, Jin DQ, Liu Q, Chen XL, Pan LL, et al. Dhx15 regulates zebrafish definitive hematopoiesis through the unfolded protein response pathway. Cancer Sci. 2021;112:3884-94. Siegel RL, Miller KD, Wagle NS, Jemal A. Cancer statistics, 2023. CA Cancer J Clin. 2023;73:17-48. Zi J, Han Q, Gu SY, McGrath M, Kane S, Song CH, et al. Targeting NAT10 induces apoptosis associated with enhancing endoplasmic reticulum stress in acute myeloid leukemia cells. Front Oncol. 2020;10:598107. van Gils N, Denkers F, Smit L. Escape from treatment; The different faces of leukemic stem cells and therapy resistance in acute myeloid leukemia. Front Oncol. 2021;11:659253. McMahon CM, Ferng T, Canaani J, Wang ES, Morrissette JJD, Eastburn DJ, et al. Clonal selection with RAS pathway activation mediates secondary clinical resistance to selective FLT3 inhibition in acute myeloid leukemia. Cancer Discov. 2019;9:1050-63. Forte D, García-Fernández M, Sánchez-Aguilera A, Stavropoulou V, Fielding C, Martín-Pérez D, et al. Bone marrow mesenchymal stem cells support acute myeloid leukemia bioenergetics and enhance antioxidant defense and escape from chemotherapy. Cell Metab. 2020;32:829-43.e9. Long HD, Hou Y, Li J, Song CH, Ge Z. Azacitidine is synergistically lethal with XPO1 inhibitor selinexor in acute myeloid leukemia by targeting XPO1/eIF4E/c-MYC signaling. Int J Mol Sci. 2023;24:6816. Almanza A, Carlesso A, Chintha C, Creedican S, Doultsinos D, Leuzzi B, et al. Endoplasmic reticulum stress signalling-from basic mechanisms to clinical applications. Febs J. 2019;286:241-78. Papp B, Launay S, Gélébart P, Arbabian A, Enyedi A, Brouland JP, et al. Endoplasmic reticulum calcium pumps and tumor cell differentiation. Int J Mol Sci. 2020;21:3351. Hetz C, Papa FR. The unfolded protein response and cell fate control. Mol Cell. 2018;69:169-81. Zhou C, Martinez E, Di Marcantonio D, Solanki-Patel N, Aghayev T, Peri S, et al. JUN is a key transcriptional regulator of the unfolded protein response in acute myeloid leukemia. Leukemia. 2017;31:1196-205. Khateb A, Ronai ZA. Unfolded protein response in leukemia: From basic understanding to therapeutic opportunities. Trends Cancer. 2020;6:960-73. Śniegocka M, Liccardo F, Fazi F, Masciarelli S. Understanding ER homeostasis and the UPR to enhance treatment efficacy of acute myeloid leukemia. Drug Resist Updat. 2022;64:100853. Rahman NSA, Zahari S, Syafruddin SE, Firdaus-Raih M, Low TY, Mohtar MA. Functions and mechanisms of protein disulfide isomerase family in cancer emergence. Cell Biosci. 2022;12:129. Powell LE, Foster PA. Protein disulphide isomerase inhibition as a potential cancer therapeutic strategy. Cancer Med. 2021;10:2812-25. Ma YS, Feng S, Lin L, Zhang H, Wei GH, Liu YS, et al. Protein disulfide isomerase inhibits endoplasmic reticulum stress response and apoptosis via its oxidoreductase activity in colorectal cancer. Cell Signal. 2021;86:110076. Kang LC, Wang DK, Shen TY, Liu X, Dai B, Zhou DH, et al. PDIA4 confers resistance to ferroptosis via induction of ATF4/SLC7A11 in renal cell carcinoma. Cell Death Dis. 2023;14:193. Yang SH, Jackson C, Karapetyan E, Dutta P, Kermah D, Wu Y, et al. Roles of protein disulfide isomerase in breast cancer. Cancers (Basel). 2022;14:745. Higa A, Taouji S, Lhomond S, Jensen D, Fernandez-Zapico ME, Simpson JC, et al. Endoplasmic reticulum stress-activated transcription factor ATF6α requires the disulfide isomerase PDIA5 to modulate chemoresistance. Mol Cell Biol. 2014;34:1839-49. Xu QH, Zhang JM, Zhao ZJ, Chu YJ, Fang JG. Revealing PACMA 31 as a new chemical type TrxR inhibitor to promote cancer cell apoptosis. Biochim Biophys Acta Mol Cell Res. 2022;1869:119323. Xu SL, Butkevich AN, Yamada R, Zhou Y, Debnath B, Duncan R, et al. Discovery of an orally active small-molecule irreversible inhibitor of protein disulfide isomerase for ovarian cancer treatment. Proc Natl Acad Sci U S A. 2012;109:16348-53. Won JK, Yu SJ, Hwang CY, Cho SH, Park SM, Kim K, et al. Protein disulfide isomerase inhibition synergistically enhances the efficacy of sorafenib for hepatocellular carcinoma. Hepatology. 2017;66:855-68. Long LY, Assaraf YG, Lei ZN, Peng HW, Yang L, Chen ZS, et al. Genetic biomarkers of drug resistance: A compass of prognosis and targeted therapy in acute myeloid leukemia. Drug Resist Updat. 2020;52:100703. Ye ZW, Zhang J, Aslam M, Blumental-Perry A, Tew KD, Townsend DM. Protein disulfide isomerase family mediated redox regulation in cancer. Adv Cancer Res. 2023;160:83-106. Haefliger S, Klebig C, Schaubitzer K, Schardt J, Timchenko N, Mueller BU, et al. Protein disulfide isomerase blocks CEBPA translation and is up-regulated during the unfolded protein response in AML. Blood. 2011;117:5931-40. Trivedi R, Müller GA, Rathore MS, Mishra DP, Dihazi H. Anti-leukemic activity of shikonin: Role of ERP57 in shikonin induced apoptosis in acute myeloid leukemia. Cell Physiol Biochem. 2016;39:604-16. Yamada R, Cao XF, Butkevich AN, Millard M, Odde S, Mordwinkin N, et al. Discovery and preclinical evaluation of a novel class of cytotoxic propynoic acid carbamoyl methyl amides (PACMAs). J Med Chem. 2011;54:2902-14. Vatolin S, Phillips JG, Jha BK, Govindgari S, Hu J, Grabowski D, et al. Novel protein disulfide isomerase inhibitor with anticancer activity in multiple myeloma. Cancer Res. 2016;76:3340-50. Samimi A, Khodayar MJ, Alidadi H, Khodadi E. The dual role of ROS in hematological malignancies: Stem cell protection and cancer cell metastasis. Stem Cell Rev Rep. 2020;16:262-75. Cheung EC, Vousden KH. The role of ROS in tumour development and progression. Nat Rev Cancer. 2022;22:280-97. Bian ML, Fan R, Zhao S, Liu WK. Targeting the thioredoxin system as a strategy for cancer therapy: Miniperspective. J Med Chem. 2019;62:7309-21. Tables Table 1. Patients characteristics of de novo AML patients samples. Patient No Age(ys) Gender WBC(*109) Blasts purity(%) FAB subtype Cytogenetics Gene mutation 1 47 M 93.6 28 M2 46,XY,t(6;9)(p22;q34)[15] NA 2 70 F 7 60.5 M2 45,X,-X,t(8;21)(q22;q22)[8]/46,XX[2] ASXL1,TET2 3 54 M 19.8 23 M2 45,XY,i(3)(?q10),-5,add(6)(?p25),+8,del(9)(?q34),-12,-17,+mar1[cp19] TP53 4 61 F 251.3 80 M2 46,XX[20] KRAS 5 60 M 269.7 87.5 M2 46,XY[10] FLT3,NPM1,TET2 6 83 F 181.9 79.2 M2 46,XY[20] NA 7 84 M 2.4 64 M2 46,XY,add(14)(p10)[10] CEBPA double mutation,TET2 double mutation,STAG2 8 69 M 25.3 12.8 M4 44,XY,del(5)(q12q23),add(8)(q24),-13,-16,-17,del(20)(q10),+r[5] DNMT3A,NF1,TP53 9 76 F 30.3 54.4 M4 46,XX[35] NRAS,KIT 10 67 M 42.7 71.5 M4 46,XY[4] CEBPA double mutation,WT1 11 70 F 3.1 53 M4 43,XX,del(5)(q23q35),-8,add(9)(q34),add(9)(q34),add(10)(q21),-11,add(11)(p11),-17,-18,-18,+22,+mar[10] CEBPA,IDH2,SRSF2,DNMT3A 12 47 M 3.1 67 M4 45,XY,+10,-13,del(20)(q12),-21[2]/46,XY[6] CSF3R.p.Y787* CEBPAp.155Mfs*52 ASXL2p.E433* 13 22 M 4.5 50 M4 46,XY, inv(16)(p13q22)[10] NRAS,CSF3R 14 40 F 5.2 27 M4 46,XX,del[7](q31)[4]/47,XX,+22[3]/46,XX[3] KRAS,FLT3-TKD 15 68 M 4.6 40 M4 46,XY[20] CSF3R,CEBPA double mutation, RUNX11,TET2,EP300 16 66 F 55 31.5 M4 46,XX, inv(16)(p13;1q22) NRAS,ATM,PML,CHD2 17 60 F 14.8 53 M4 NA NA 18 74 M 175 91 M5 46,XY[19] NA 19 64 M 189.3 81 M5 45,XY,-7,t(9;22)(q34.1;q11.2)[17]/46,XY[3]) IKZF1 20 73 F 117.6 86.5 M5 46,XX[20] NA 21 60 M 11.1 66.5 M5 47-53,XY,del(4)(q31),del(5)(q33),-7,+8,+10,add(10)(q26),+11,+11,+13,+14,-18,+21,+21,+22,.inc[cp10] IKZF1,RUNX1,TP53 22 32 M 7.88 69.5 M5 49,XY,+8,del(10)(p12),+del(10)(p12),add(11)(q25),+21[20] RUNX1,MYC,NRAS 23 29 F 5.8 30 M5 45,XX,-7[10] TP53,NF1 24 51 F 274.9 64 M5 46,XX[20] FLT3-ITD,NPM1 25 70 M 151.7 67.5 M5 46,XY[20] FLT3-ITD,DNMT3A,NPM1 Table 2. Clinical information for de novo AML patients. No Age(ys) Gender WBC(*109) Blasts purity(%) FAB subtype Samples source Cytogenetics Gene mutation PACMA31 IC50(μM) AML26 52 M 19.89 61 M5 BM 46,XY[20] DNMT3A,FLT3-ITD,FLT3-TKD 15.35 AML27 49 M 11.3 49 M5 BM 46,XY[20] CEBPA double mutation 0.1949 AML28 45 M 2.3 48 M2 BM 46,XY,t(8;21)(q22;q22)[2]/46,XY[8] IDH2,CHD8 0.2874 AML29 64 M 59.1 54 M5 BM 46,XY,t(11;19)(q23;p13)[8]/46,XY[2] KRAS,NRAS 0.073 AML30 15 M 8.75 20 M4 BM 46,XY[18] FLT3,NRAS 0.2793 PBMC1 24 M PB >200 PBMC2 46 M PB >200 PBMC3 34 F PB >200 Half maximal inhibitory concentration(IC50) values were calculated on the basis of the number of viable cells quantified by CCK-8 assay. Table 3. The primer pairs used in RT-PCR. Gene Prime Sequence(5'-3') β-actin F TGTTACCAACTGGGACGA R GGGGTGTTGAAGGTCTCAAA PDIA2 F GCTGCTGTTTGTCAACCAGACG R CCTCAGCCTTGAGTCCAAAGTAC CASQ1 F CTGGTAGACTCTGAGAAGGATGC R GCAGAAACTCCACGATGGTGTC AGR3 F GCCTCCTCAGACACTCTCAAGA R GAGAGTATTGACAATCCTCCAGG ERP27 F GGAACACCATCTGCCTCTTTCG R ACTCTGTCACCATGTGGAGGCT TMX1 F GAAGACCTTGGATTGCCAGTGTG R GAAGGACAAAGGCAATCTGCCAC TMX2 F TTGGGAAGGTGGATGTTGGACG R CTTGCCACCTTGGAACAGGATC ERP46 F GTAGACTGCACTGCTGAACGGA R TCGTCTTTCGCTTGGCTCAGGA ERP29 F GCAGGATGAGTTCAAGCGTCTTG R GCTCCATGTTCAGCTTGTCACC ERDJ5 F TCGTTTGGCTCATCATCGGTGG R CAGAGGAACAGTCAAACCTGCC TMX4 F CCATCCTGCCAGCAGACTGATT R GAGAGTGGTGACAAAGAAGCGG ERP57 F GTCAGCCACTTGAAGAAGCAGG R TAGGAACTCGGAGTGAGCCTCA ERP5 F TCAGAAAGGCGAGTCTCCTGTG R CCTCTTGGCAATGTCCTCGTTG PDI F TCACCAAGGAGAACCTGCTGGA R GGCAAGAACAGCAGGATGTGAG ERP18 F GGACATAATGGGCTTGGAAAGGG R CTTTGCAAGCTCCACACCAGGA ERP44 F AGTAGTGTTTGCCAGAGTTGATTG R CTGCCAATGCTTTCACTGATCGC ERP72 F CCAGCAGGTTTGATGTGAGTGG R GGAGACTTCTCTGACCTTGGCA TMX3 F CATTTTGGATGGCACAGTAGAAGC R GAGAAAGCAGCCCATCAGTGGT PDIR F GGAGCCAAAGATGTTGTCCACC R GAAATGCGGCATCATCCTCTTGC AGR2 F GGTGACCAACTCATCTGGACTC R TGACTGTGTGGGCACTCATCCA CASQ2 F GCAGCAAACTGGAAGTCCAAGC R GATGTAAGGCTGGAAGTGTTCAG PDIA7 F GAGCTTCAGCAGGAGTTTGGGA R CGTCTCAACCAAACGACTAAGGC Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5764412","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":398354447,"identity":"62c5c157-b3f4-4873-b636-6ff4b0a3c94f","order_by":0,"name":"Li Lin","email":"","orcid":"","institution":"The Second Hospital of Hebei Medical University","correspondingAuthor":false,"prefix":"","firstName":"Li","middleName":"","lastName":"Lin","suffix":""},{"id":398354453,"identity":"060e43c5-599f-4379-8593-5423aae42ba9","order_by":1,"name":"Yue Lu","email":"","orcid":"","institution":"Cyrus Tang Medical Institute, Soochow University","correspondingAuthor":false,"prefix":"","firstName":"Yue","middleName":"","lastName":"Lu","suffix":""},{"id":398354455,"identity":"4e47ab15-5375-46c3-bbf9-e632a1028393","order_by":2,"name":"Yingkun Zhang","email":"","orcid":"","institution":"The Second Hospital of Hebei Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yingkun","middleName":"","lastName":"Zhang","suffix":""},{"id":398354456,"identity":"631d5d01-25be-4e35-acc7-e3e169f9e38c","order_by":3,"name":"Nannan Qi","email":"","orcid":"","institution":"The Second Hospital of Hebei Medical University","correspondingAuthor":false,"prefix":"","firstName":"Nannan","middleName":"","lastName":"Qi","suffix":""},{"id":398354458,"identity":"4aa89657-331b-4e6a-b160-68c91bfa1ba0","order_by":4,"name":"Shuyi Huang","email":"","orcid":"","institution":"The Second Hospital of Hebei Medical University","correspondingAuthor":false,"prefix":"","firstName":"Shuyi","middleName":"","lastName":"Huang","suffix":""},{"id":398354461,"identity":"a224f26b-1a8f-4c98-80ad-4f1bc5b3a05e","order_by":5,"name":"Meinan Peng","email":"","orcid":"","institution":"Cyrus Tang Medical Institute, Soochow University","correspondingAuthor":false,"prefix":"","firstName":"Meinan","middleName":"","lastName":"Peng","suffix":""},{"id":398354462,"identity":"194e2b6c-2b3e-47c6-8e89-a99bd25f71ca","order_by":6,"name":"Zhenzhen Zhao","email":"","orcid":"","institution":"Cyrus Tang Medical Institute, Soochow University","correspondingAuthor":false,"prefix":"","firstName":"Zhenzhen","middleName":"","lastName":"Zhao","suffix":""},{"id":398354463,"identity":"f300c054-2a10-4387-8aa4-d81482042014","order_by":7,"name":"Aizhen Yang","email":"","orcid":"","institution":"Cyrus Tang Medical Institute, Soochow University","correspondingAuthor":false,"prefix":"","firstName":"Aizhen","middleName":"","lastName":"Yang","suffix":""},{"id":398354464,"identity":"de424d58-5feb-4762-a67d-40cce747804b","order_by":8,"name":"Zhiyun Niu","email":"","orcid":"","institution":"The Second Hospital of Hebei Medical University","correspondingAuthor":false,"prefix":"","firstName":"Zhiyun","middleName":"","lastName":"Niu","suffix":""},{"id":398354466,"identity":"f4755fcc-e659-440d-9465-1e1269178330","order_by":9,"name":"Yan Wang","email":"","orcid":"","institution":"The Second Hospital of Hebei Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yan","middleName":"","lastName":"Wang","suffix":""},{"id":398354467,"identity":"8a7c3a0c-85cb-4110-854b-f641cdb8d25d","order_by":10,"name":"Yue Han","email":"","orcid":"","institution":"The First Affiliated Hospital of Soochow University","correspondingAuthor":false,"prefix":"","firstName":"Yue","middleName":"","lastName":"Han","suffix":""},{"id":398354468,"identity":"0d9d2038-5d74-4884-831e-382b897bd55a","order_by":11,"name":"Yi Wu","email":"","orcid":"","institution":"The Second Hospital of Hebei Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yi","middleName":"","lastName":"Wu","suffix":""},{"id":398354469,"identity":"bbbfd9e5-8c93-4fff-b8a6-705bb239087b","order_by":12,"name":"Jingyu Zhang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA8klEQVRIiWNgGAWjYBACfvbmAwcSDP7z8EswsEGEDhDQItlzLPHBhwJmOckZxGoxuOFjbDjjA7OxwQ1itTDc4DGT5jFgS9x8u/nYo5ttDHJ8NxIYPxfg0cE4u60MqIUncdudY+nGuW0MxpI3EpilZ+DRwixzeBtQi0Tiths5ZtJALYkbbiSwMfPg0cImkQBymEHi5hn530Ba6glq4ZFIAXrfIMHYQCKHDaQlwYCQFgkeUCAbHJCTuJFmbpxzTsJw5pmHzdL4tNgfB0XlnwM8/DOSnz3OKbOR5zuefPAzPi0YtgIxYwMJGkbBKBgFo2AUYAMAOKZOsXpsbOQAAAAASUVORK5CYII=","orcid":"","institution":"The Second Hospital of Hebei Medical University","correspondingAuthor":true,"prefix":"","firstName":"Jingyu","middleName":"","lastName":"Zhang","suffix":""}],"badges":[],"createdAt":"2025-01-04 15:38:16","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5764412/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5764412/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":73279167,"identity":"8a660097-f4ee-4396-a2e1-d32e0ef914e3","added_by":"auto","created_at":"2025-01-08 12:18:09","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":89019,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe gene expression of PDIs family and effects of PDIs inhibitor PACMA31 on cell viabliy of the primary AML patients sample and PBMC from healthy donors.\u003c/strong\u003eA. PDIs family mRNA levels measured by qRT-PCR from peripheral blood or BM samples of the AML patients, with β-actin levels as control. B. The chemical structure of PACMA31. C. Measurement of growth inhibition of PDIs with PACMA31 in primary AML patients samples. Primary AML patient samples were left untreated or treated with increasing doses of PACMA31 for 48 h, Prism 8 software was used to calculate the median inhibitory concentration(IC50) values. D. Shows the results of PBMC from three healthy donor treated with different concentration of PACMA31 at 48 h in vitro, the viability of PBMC was calculated by prism 8 software.\u003c/p\u003e","description":"","filename":"Slide1.png","url":"https://assets-eu.researchsquare.com/files/rs-5764412/v1/e644fc7393a4ff0273ebe3f9.png"},{"id":73278813,"identity":"22bf15c4-86dc-4b0c-ac26-79af70438950","added_by":"auto","created_at":"2025-01-08 12:10:09","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":121019,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAnti-leukemia efficacy of PACMA31 and other therapeutic drugs on AML cell lines. \u003c/strong\u003eA. Six AML cell lines were left untreated or treated with PACMA31 or BCL-2 inhibitor(BCL-2i)venetoclax or hypomethylating agent(azacitidine)as single agents for 48h. Prism8 software was used to calculate the median inhibitory concentration (IC50) values. Combinations of the PACMA31 with BCL-2i and/or AZA then tested on the same cell lines in the ratio of 1:1. Calcusyn software was used to calculate the combination index(CI). CI \u0026lt; 1, CI=1, and CI\u0026gt;1 represent synergism, additivity, and antagonism of these 2 agents, respectively. B. A CI \u0026lt; 1 indicates a synergistic drug interaction among PACMA31, BCL-2i and AZA. Then the KASUMI-1 and NB4 cells were treated with various concentrations of PACMA31 in combination with 3+7 induction chemtherapy with daunorubicin, aclarubicin and cytarabine. C. The CI for drug–drug interaction was calculated.\u003c/p\u003e","description":"","filename":"Slide2.png","url":"https://assets-eu.researchsquare.com/files/rs-5764412/v1/ad47b11c82298116e5fa2fbb.png"},{"id":73280249,"identity":"1e25a019-a1ab-4ea0-b684-01eaba620793","added_by":"auto","created_at":"2025-01-08 12:26:09","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":104411,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePACMA31 induce apoptosis and cell cycle arrest of AML KASUMI-1 cells. \u003c/strong\u003eAfter cells were exposed to PACMA31 for indicated hours, a series of independent experiments were conducted as followes: A\u003cstrong\u003e. \u003c/strong\u003eThe type of cell death was identified using Annexin V-7AAD/PE staining and analyzed using flow cytometry. B. The distribution of cell cycle was analyzed by flow cytometry. C. Live intracellular Ca2+ measurement in KASUMI-1 cells loaded with Fluo-4 AM Ca2+ indicator, indicator by microplate Reader. D. Representative overlapping histograms showing mitochondrial depolarization evaluated by TMRE measurement 6 h after treatment with PACMA31.\u003cstrong\u003e \u003c/strong\u003eE.\u003cstrong\u003e \u003c/strong\u003eKASUMI-1 cells were treated with PACMA31 as indicated hours. ROS level was determined by flow cytometry with DCFH-DA as probe. F.\u003cstrong\u003e \u003c/strong\u003eAnalysis of lipid peroxidation in the KASUMI-1 cells after treatment with PACMA31 for 6 h.\u003cstrong\u003e G.\u003c/strong\u003eKASUMI-1 cells were treated with PACMA31, with or without pretreatment of apoptosis inhibitor (Z-VAD-FMK), and the Annexin V-7AAD/PE-stained treated cells were analyzed through flow cytometry. H.\u003cstrong\u003e \u003c/strong\u003eKASUMI-1 cells wre treated with PACMA31, with or without pretreatment of antioxidant(N-acetyl-L-Cysteine, NAC), the percentage of apoptotic cells were analyzed by flow cytometry. Data are represented as the mean ± SD of three independent experiment. \u003csup\u003e*\u003c/sup\u003eP\u0026lt;0.05, \u003csup\u003e**\u003c/sup\u003eP\u0026lt;0.01, \u003csup\u003e***\u003c/sup\u003eP\u0026lt;0.001, \u003csup\u003e****\u003c/sup\u003eP\u0026lt;0.0001.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e","description":"","filename":"Slide3.png","url":"https://assets-eu.researchsquare.com/files/rs-5764412/v1/a97665e6499198348473da4b.png"},{"id":73278819,"identity":"c1c781e9-6ec7-471a-8488-a43dded0cf58","added_by":"auto","created_at":"2025-01-08 12:10:09","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":368381,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAnalysis of potential targets for PACMA31 against AML.\u003c/strong\u003e A. Volcano plots of RNA sequencing data after PACMA31 treatment in KASUMI-1 cells(up-regulated genes are in red, down-regulated genes are in green, fold change \u0026gt;1.5, P value \u0026lt;0.05). B. The PPI network between halociline and the most likely GC targets. C. Top 20 significant biological processes (BP) terms and top 20 significant KEGG pathwys, terms of interest were highlighted with red box. D.Molecular docking of Bip, PERK and ATF6.\u003c/p\u003e","description":"","filename":"Slide4.png","url":"https://assets-eu.researchsquare.com/files/rs-5764412/v1/a283c489c13af5ff51f619c8.png"},{"id":73279168,"identity":"cc1ee8f0-316f-440d-9d05-791522f22da2","added_by":"auto","created_at":"2025-01-08 12:18:09","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":96562,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eValidation of possible mechanisms for PACMA31 against acute myeloid leukemia. \u003c/strong\u003eA. PACMA31 increased expression of apoptotic-associated proteins such as P-PARP and γH2AX., downregulated expression of caspase3. B. PERK/eIF2α/UPR activation, but not ATF6 and XBP1 signaling, is required for leukemia cells apoptosis after PACMA3 intervation.\u003c/p\u003e","description":"","filename":"Slide5.png","url":"https://assets-eu.researchsquare.com/files/rs-5764412/v1/87ef38309c396bd4931ede0a.png"},{"id":73583862,"identity":"51f34b97-263f-4925-8c9c-8cf0c7405e8c","added_by":"auto","created_at":"2025-01-12 05:01:28","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1783040,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5764412/v1/aebb0df0-6828-412a-ab59-c80c4bf1f01b.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Protein disulfide isomerase family is a potential therapeutic target in acute myeloid leukemia","fulltext":[{"header":"Highlights","content":"\u003cp\u003ePDI is a promising and selective therapeutic target in AML.\u003c/p\u003e"},{"header":"Introduction","content":"\u003cp\u003eAcute myeloid leukemia (AML) is a clonal malignant proliferative disorder of the hematopoietic system, characterized by significant heterogeneity and marked by uncontrolled proliferation of myeloid precursor cells and disturbances in differentiation [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Over the past decade, advancements in novel therapeutic agents and the implementation of hematopoietic stem cell transplantation (HSCT) have led to a significant improvement in overall survival (OS) for AML patients [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Yet, the 5-year OS rate for AML patients under the age of 60 was approximately 40%, conversely, for individuals aged 65 and older, the median OS is only 4 months. Furthermore, even in cases where complete remission was achieved, approximately 70% of patients experience relapse within 5 years. This phenomenon could be attributed to the protective role of the bone marrow microenvironment (BMM) for AML cells and the clonal selection that facilitates the emergence of therapy-resistant clones [\u003cspan additionalcitationids=\"CR5\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e] Consequently, there was an urgent need to identify novel therapeutic targets and develop innovative treatment strategies for AML patients and healthcare providers [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe endoplasmic reticulum (ER), recognized as the largest organelle within the cell, primarily functions in protein folding, post-translational modification, maturation of proteins, calcium metabolism, and lipid synthesis [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Nonetheless, various intrinsic and extrinsic factors, including oxidative stress, hypoxia, and deprivation of calcium or glucose, can disrupt ER functionality, thereby triggering a cytoprotective signaling pathway known as the ER stress response or unfolded protein response (UPR) [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. This response involved the activation of three key signaling pathways: pancreatic eukaryotic initiation factor 2B kinase (PERK), inositol-requiring enzyme 1α (IRE1α), and activating transcription factor 6 (ATF6), which aimed to mitigate ER stress by reducing protein synthesis, enhancing the levels of chaperones to facilitate proper protein folding, and promoting protein degradation [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. The unfolded protein response (UPR) was particularly significant in the context of leukemogenesis, as it supported the survival of leukemic cells and their resistance to chemotherapy, influenced by the production of mutated proteins and the surrounding bone marrow microenvironment [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Previous studies had indicated that markers indicative of activated UPR signaling, such as sXBP1 and elevated expression of UPR-activated genes like p-IRE1α and protein disulphide isomerase (PDI), were present in approximately 25% of samples from patients with AML [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe PDI family, classified as endoplasmic ER-thiodisulfide oxidoreductases, comprised 21 enzymes that possess a conserved thioredoxin-like catalytic redox center characterized by pairs of reactive cysteine residues [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. These enzymes facilitated the formation, cleavage, and rearrangement of disulfide bonds while also exhibiting chaperone protein activity. Due to their dual functionality as oxidoreductases and molecular chaperones, PDIs were integral to the processes of protein folding and oxidation. Given that proteotoxic and oxidative stress are increasingly recognized as phenotypic markers of cancer, recent studies have demonstrated that proteins within the PDI family are significantly overexpressed in both cancerous tissues and cancer cell lines [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Members PDI family function as oncogenes and play significant roles in the development and progression of various cancers, encompassing processes such as cellular proliferation, invasion, metastasis, and resistance to chemotherapy. For instance, PDI had been shown to influence the onset and advancement of colorectal cancer by modulating the apoptosis signaling pathway and the oxidative stress within the endoplasmic reticulum [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]; PDIA4 facilitated the development of renal cell carcinoma through the regulation of the ATF4/SLC7A11 pathway, which serves to inhibit ferroptosis [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. The upregulation of PDIA3 had been implicated in the progression of renal cell carcinoma by initiating a feedback loop involving STAT3; Furthermore, PDIA4 was considered to be associated with the tumorigenesis of triple-negative breast cancer and the resistance to radiotherapy, primarily through the modulation of the JNK signaling pathway [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. In chronic myeloid leukemia (CML), Chevet et al. found that the overexpression of PDIA5 in CML was associated with increased resistance to imatinib [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Nevertheless, the connection between the expression of PDIs and AML remains largely unexplored.\u003c/p\u003e \u003cp\u003ePropynoic acid carbamoylmethyl amide (PACMA31), an irreversible inhibitor of PDIs, had demonstrated efficacy against ERP5, ERP57, PDI, and ERP46 [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Recent researches indicated that PACMA31 might disrupt proteostasis and induce cell death through various pathways in ovarian cancer cells [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e], as well as enhance sensitivity to sorafenib in sorafenib-resistant hepatocellular carcinoma [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. However, the effects of PACMA31 on the proliferation and differentiation of AML cells have yet to be clarified. Moreover, the relationship between PDIs and chemotherapy resistance, as well as relapse in AML, remains ambiguous. Therefore, the objective of this study was to target PDI family proteins in order to disrupt ER protein homeostasis, thereby facilitating the transition from an adaptive UPR to a pro-apoptotic UPR, with the aim of enhancing treatment efficacy in AML.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003e\u003cstrong\u003ePatients\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eClinical data were obtained from the medical records of patients diagnosed with AML at the Department of Hematology, The Second Hospital of Hebei Medical University in Shijiazhuang, China. Between February 2023 and December 2023, a total of 29 patients were enrolled in this study, each with comprehensive diagnostic information. Additionally, 9 healthy individuals, matched for age and sex, were included as a control group. Gene mutations in NPM1, FLT3-ITD, CEBPA, DNMT3A, IDH1, and IDH2 were assessed through whole-genome sequencing. Patient characteristics are presented in Table 1 and 2, utilizing descriptive statistical methods. This study received approval from the Medical Ethics Committee of the Second Hospital of Hebei Medical University, and all participants provided written informed consent.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell culture\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe cell lines Kasumi-1, SKNO-1, MOLM-13, NB4, and HL-60 were generously provided by P. H. Chen Suning. THP-1 cells were sourced from the American Type Culture Collection. Leukemia blast cells (BMMNCs) were isolated from the bone marrow of patients diagnosed with AML and were characterized by flow cytometry, achieving a purity exceeding 95%. Peripheral blood mononuclear cells (PBMNCs) were obtained from venous blood samples collected from healthy donors, as previously documented. All cell lines were maintained in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin sulfate.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRT-PCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted from BMMNCs or healthy control PBMNCs (HC-PBMNCs) utilizing Trizol reagent (Life Technologies) in accordance with the manufacturer\u0026apos;s protocol. Subsequently, 500 ng of the isolated RNA was reverse transcribed into complementary DNA (cDNA) employing the Superscript II cDNA synthesis kit (Invitrogen). The expression levels of PDI genes were analyzed using the SYBR Green method (Finnzymes F410L, Thermo Scientific, Rockford, IL, USA). The primers specific to the PDI genes were detailed in Table 3. The cycle threshold (Ct) values were normalized against the ACTB gene, and the relative fold changes in expression were determined using the 2-\u0026Delta;\u0026Delta;Ct method.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell viability assays\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eKasumi-1, SKNO-1, MOLM-13, NB4, HL-60, and THP-1 cell lines were cultured in a 96-well plate at a density of 5\u0026times;10\u003csup\u003e3\u003c/sup\u003e cells per well. Following the specified treatment, the cells were incubated for an additional 1.5 hours with 10 \u0026micro;L of Cell Counting Kit-8 solution. The absorbance was subsequently measured at 450nm using a SpectraMax M5 spectrophotometer (Molecular Devices, USA).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFlow cytometric analysis\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eKasumi-1 cells were cultured in 6-well plates at a density of 3\u0026times;10\u003csup\u003e6\u0026nbsp;\u003c/sup\u003ecells per well and subsequently treated with PACMA31 for durations of 6, 12, and 24 h. Following the treatment, the cells were harvested by centrifugation at 300 g for 5 minutes and washed three times with phosphate-buffered saline (PBS). Apoptosis was evaluated using an Annexin V-PE/7-AAD Apoptosis Detection Kit (Yeasen Biotechnology, Shanghai, China), while cell cycle analysis was conducted utilizing a Cell Cycle and Apoptosis Analysis Kit. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eOxidative stress measurement\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFollowing treatment, cells were harvested, washed with PBS, and incubated in the dark at 37\u0026deg;C for 30 minutes with the cell-permeable probe 2\u0026apos;,7\u0026apos;-dichlorofluorescein diacetate (DCFH-DA). Subsequently, DCF fluorescence was quantified using flow cytometry, with an excitation wavelength set at 488 nm and an emission wavelength at 535 nm. Lipid peroxidation within the cells was assessed using the C11 BODIPY 581/591 fluorescent probe, also incubated at 37\u0026deg;C for 30 minutes, and measurements were taken under the Texas Red (590 nm) and FITC (510 nm) channels. Additionally, inhibitors were utilized to elucidate the relationship between reactive oxygen species (ROS), mitochondrial function, and apoptosis. Cells were treated with 5 mM N-acetyl-L-cysteine (NAC) and 10 \u0026mu;M Z-VAD-FMK, respectively, prior to exposure to PACMA31 for the specified duration. The alterations in apoptosis were evaluated as previously described.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDetermination of intracellular Free Ca2+ and MMP\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eKASUMI-1 cells cultured in 6-well plates were subjected to varying concentrations of PACMA31 (0.3125, 0.625, 1.25, and 2.5 \u0026mu;M) for a duration of 6 h. Following the treatment, the cells were rinsed twice with PBS and subsequently stained with Fluo-4 AM in accordance with the manufacturer\u0026apos;s protocol. The fluorescence of the stained cells was then quantified using a microplate reader. For the assessment of MMP, cells were harvested after PACMA31 treatment for different time intervals and incubated with 10 nM tetramethylrhodamine methyl ester perchlorate (TMRE) for 30 minutes at 37\u0026deg;C. TMRE, a cationic fluorophore commonly employed for staining cellular mitochondria and mitochondrial matrices, was utilized to evaluate the percentage of cells exhibiting MMP, which was also analyzed using a microplate reader. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTranscriptome sequencing\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn the context of RNA sequencing (RNA-seq) experiments, KASUMI-1 cells were subjected to treatment with PACMA31 or a control vehicle for a duration of six hours. Total RNA was extracted from the cells utilizing TRIzol reagent (Invitrogen). The RNA expression profiles of KASUMI-1 AML cells, following treatment with PACMA31 or the vector control, were subsequently submitted to a specialized testing facility (Wei Huan, Shanghai, China) for high-throughput transcriptome sequencing. The DESeq2 R package was employed to identify differentially expressed genes (DEGs) between the two experimental groups. Genes exhibiting a log2 fold change greater than 1.0 and a p-value of less than 0.05 were classified as differentially expressed, with the absolute value of the log2 fold change utilized for ranking purposes. Furthermore, the ClusterProfiler R package was utilized to assess the statistical enrichment of the DEGs within Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWestern blot analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eProtein levels in KASUMI-1 cell extracts were evaluated using a Western blot assay to investigate the effects of varying concentrations of PACMA31. The protein samples were transferred to nitrocellulose membranes and subsequently incubated with primary antibodies diluted to a concentration of 1:1000. Following this, secondary antibodies were applied for additional incubation. The standard protocol for Western blotting was adhered to, with comprehensive procedures outlined in prior publications. The primary antibodies utilized included PARP, Caspase3, \u0026gamma;H2AX, Bip, PERK, P-PERK, CHOP, eIF2\u0026alpha;, P-eIF2\u0026alpha;, XBP1, XBP1S, and ATF6, all sourced from Cell Signaling Technology (Shanghai, China). GAPDH and Tubulin antibodies served as internal controls.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data utilized in this study were analyzed using GraphPad Prism 8 software. Protein quantification was performed with ImageJ, and all protein levels were normalized against a loading control. Each experimental procedure was conducted in triplicate. Mean values and standard deviations (SDs) were computed. Comparisons between two groups were conducted using an unpaired t-test, while comparisons among multiple groups were performed using one-way analysis of variance (ANOVA) followed by Tukey\u0026rsquo;s post hoc test. A p-value of less than 0.05 was considered indicative of a statistically significant difference.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003ePDI genes expression positively correlated with clinical characteristics\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn a preliminary investigation of PDI gene expression in AML, we assessed the expression levels of 21 PDI genes in primary BMMNCs obtained from 25 AML patients, as well as in PBMNCs from 9 healthy donors. Additionally, we evaluated AML-derived cell lines, specifically KASUMI-1, NB4, and THP-1. Our findings indicated that the expression of PDI genes was significantly elevated in the BMMNCs of AML patients when compared to the healthy control PBMNCs (Fig1A). \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePACMA31 has a significant cytotoxicity on AML and demonstrate synergistic anti-leukemia efficacy\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGiven the structural and active site similarities among members of the PDI family, our prior study had demonstrated that the PDI inhibitor PACMA31 significantly inhibits various PDI family members, including PDI, ERP46, ERP5, and ERP57, which are notably overexpressed in tumors, particularly ERP5 and ERP57. This inhibitory effect was also shown to be significantly dose-dependent in leukemic cell lines. Following this, we conducted a comprehensive investigation to assess the anti-leukemic properties of PACMA31 in five primary BMMNC samples obtained from patients diagnosed with AML (Fig1C), as well as in three PBMNC samples sourced from healthy donors (Fig1D). The results indicated that PACMA31 effectively inhibited cell proliferation in samples from patients, while no such effect was observed in samples from healthy individuals.\u003c/p\u003e\n\u003cp\u003eTo evaluate the anti-leukemia efficacy of PACMA31, chemotherapy, and a targeted drug as monotherapies or in combination, we conducted in vitro experiments examining their impact on the viability of six AML cell lines. The median inhibitory concentration (IC50) values for each single agent were established through dose-response assessments utilizing CCK8 assays following a 48-hour treatment period which values for PACMA31 ranged from 0.002 mM to 3.0 Mm (Fig2A). To investigate the pharmacological interactions between PACMA31 and either chemotherapy or a targeted agent, incremental doses were administered based on the IC50 values of the respective drugs. In two of the six cell lines, the combination of PACMA31 with either VEL or Deci resulted in synergistic growth inhibition, as determined by the Chou-Talalay method of analysis (combination index [CI] \u0026lt; 1.0). Notably, synergy was also observed when PACMA31 was combined with Ara-C (Fig2B, 2C).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePACMA31 induced apoptosis of AML cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;To investigate the potential mechanisms underlying the growth inhibition of AML cell lines mediated by PACMA31, we initially assessed the impact of PACMA31 on the cell cycle following a 6-hour exposure. Notable accumulation in the G2/M phase and a reduction in the G0/G1 peak were observed post-treatment with PACMA31(Fig3B). Additionally, PACMA31 treatment led to a significant increase in apoptosis when compared to the control group (Fig. 3A,3G). Subsequently, we investigated key molecules involved in the apoptosis pathway, specifically caspase-3, PARP, and \u0026gamma;H2AX. Our findings revealed a marked increase in the expression of cleaved-PARP and \u0026gamma;H2AX protein levels in the PACMA31-treated group, which was observed to be concentration-dependent (Fig5A). Following this, through the utilization of a microplate reader, we observed that the reduction of PDI activity, along with the resultant increase in cytosolic calcium levels (calcium overload) (Fig3C), could lead to mitochondrial impairment, a decrease in mitochondrial membrane potential(Fig3D), and ultimately, apoptosis in KASUMI-1 cells.\u003c/p\u003e\n\u003cp\u003eIn addition, PACMA31 was found to induce apoptosis in AML cells through mechanisms related to oxidative stress. To explore the role of oxidative stress in PACMA31-induced apoptosis, we employed flow cytometry with the redox-sensitive dye CM-H2DCFDA, which demonstrated that treatment of KASUMI-1 cells with PACMA31 resulted in a rapid increase in ROS levels (Fig3E). Subsequently, we investigated whether N-acetylcysteine (NAC) could confer protection to AML cells against ROS-induced apoptosis. The results from Annexin V-PE/7-AAD staining indicated that NAC effectively inhibited the apoptotic effects of PACMA31 in KASUMI-1 cells (Fig3H). As lipid peroxidation was a key parameter to evaluate the oxidative stress, then, BODIPY581/591C11 staining, a lipid peroxidation probe, was applied to measure the level of intracellular lipid oxidation. The lipid peroxidation level of KASUMI-1 cells increased, as the concentration of PACMA31 increased (Fig3F).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePotential mechanism of PACMA31 by RNAseq\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn order to elucidate the impact of PDI activity on global transcription, an RNA sequencing analysis was conducted on KASUMI-1 cells treated with PACMA31. The results revealed that PACMA31 treatment led to significant alterations in the expression of 496 genes, indicating that this compound induces substantial genome-wide changes in gene expression (Fig4A). Furthermore, gene set enrichment analysis (GSEA) of the transcriptional data indicated a significant activation of the UPR pathway in cells treated with PACMA31(Fig4B, 4C,4D).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eThe link between PACMA31 and UPR in AML\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePACMA31 was found to inhibit the activity of enzymes belonging to the PDI family, which subsequently disrupts the redox potential within the cell, leading to the activation of the UPR. To ascertain whether the apoptosis induced by PACMA31 is contingent upon the ER stress pathway, we conducted an analysis of the protein levels of IRE1, ATF6, and PERK-key sensors of ER stress-along with their downstream effectors in AML cell models following a 6-hour treatment with PACMA31, utilizing western blotting techniques. The findings indicated that PACMA31 significantly elevated the expression of PERK and its downstream targets, including phosphorylated eIF2\u0026alpha; (P-eIF2\u0026alpha;) and phosphorylated PERK (P-PERK), in a dose-dependent manner. Conversely, no alterations were detected in the protein levels of XBP1u, XBP1s, or ATF6. Collectively, these results suggest that PACMA31 induces apoptosis associated with ER stress through the PERK/eIF2\u0026alpha; signaling pathway (Fig5B). \u0026nbsp;\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eFor several decades, the basic treatment for AML had involved repeated cycles of intensive chemotherapy utilizing anthracycline and cytarabine. Nonetheless, the development of therapy-resistant clones and the protective role of the bone marrow microenvironment for AML cells had resulted in approximately 50% of AML patients experiencing disease recurrence, with a correspondingly poor prognosis for this population[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Consequently, it is imperative to investigate treatment options that demonstrate high efficacy while minimizing toxicity for AML patients. In the present study, we first reported that the use of the PDI inhibitor PACMA31 was found to significantly inhibit cell proliferation and induce apoptosis in AML cells.\u003c/p\u003e \u003cp\u003eInitially, an analysis of gene expression alterations of PDIs in patients with AML was conducted. The results indicated a significant increase in the expression levels of ERP5 and ERP57 in the BMMC of AML patients when compared to healthy individuals. As ER chaperones, PDIs play a crucial role in protecting cells from apoptosis and mediating treatment resistance in solid tumors[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. In vitro studies have demonstrated that the knockdown of PDIs via short hairpin RNA (shRNA) can induce terminal differentiation in leukemia cells, resulting in cell cycle arrest followed by cell death. Furthermore, PDIs have the capacity to bind to the stem-loop region of CEBPA mRNA, thereby inhibiting CEBPA expression and ultimately obstructing myeloid differentiation in AML patients experiencing activation of the UPR [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Previous researches had indicated that elevated levels of ERP57 expression are associated with chemoresistance in AML cell lines, and the knockdown of ERP57 enhances the susceptibility of AML cells to chemotherapy agents [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Furthermore, as noted by Arisa et al., the PDIA5/ATF6α signaling pathway plays a significant role in the resistance of leukemia cells to imatinib[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Additionally, our study demonstrated that a small molecule inhibitor (PACMA31) of PDIs effectively reduced the viability of AML cells and induces cell cycle arrest and enhanced efficacy of combination therapy was observed in vitro. Recent studies had indicated that the irreversible PDI inhibitor PACMA31 efficiently induces apoptosis in a variety of human cancer cell lines [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Homoplastically, our findings also indicated that PACMA31 decreased the MMP in the KASUMI-1 cell line. Subsequently, PACMA31 was shown to promote the activation of both Caspase-3 and PARP, suggesting the involvement of the intrinsic apoptotic pathway in PACMA31-induced apoptosis. Moreover, the apoptosis induced by PACMA31 was determined to be caspase-dependent, as this process was partially reversed by pretreatment with Z-VAD-FMK, a compound that irreversibly bind to the catalytic site of caspase proteases and inhibits apoptosis induction.\u003c/p\u003e \u003cp\u003eRecent researches had established that diminished levels of ROS are essential for preserving the pluripotent potential of stem cells[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. A multitude of studies had suggested that the inhibition of thioredoxin reductase (TrxR) activity leads to elevated intracellular ROS levels, subsequently inducing apoptosis in various cancer cell lines [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. The chemical compound PACMA31, identified as a TrxR inhibitor, has been shown to facilitate the accumulation of ROS and initiate apoptosis in cancer cells through mechanisms associated with oxidative stress. In our investigation, KASUMI-1 cells were subjected to PACMA31 treatment for a duration of 6 hours, resulting in a concentration-dependent increase in intracellular ROS levels and lipid peroxidation. Furthermore, the application of the ROS scavenger NAC significantly attenuated the apoptosis induced by PACMA31. Further, we conducted an in-depth mechanistic investigation and discovered that PACMA31, have the capacity to activate the UPR through the activation of the PERK/eIF2α pathway, which constitutes a significant component of the UPR signaling network.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn summary, our study elucidated a molecular mechanism by which PDIs contributed to the pathogenesis and progression of AML through the activation of the PERK/eIF2α signaling pathway. Notably, the irreversible PDI inhibitor PACMA31 induces apoptosis in AML cell lines by modulating oxidative stress and mitochondrial apoptosis signaling pathways. These findings offer valuable insights into potential therapeutic strategies for AML, positioning PDIs as a promising target for treatment. However, further clinical investigations and animal experiments are necessary to validate the therapeutic efficacy of this approach in AML.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eDisclosures\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no conflicts of interest to disclose.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eContributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eJZ and YW designed the study. LL, YL, YZ, SH, MP, ZZ and AY performed the experiments. NQ, ZN, YW and YH provided clinical data and case samples. LL, JZ and YW drafted and revised the manuscript which was finalized with input from all authors.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by Hebei Natural Science Foundation (H2022206395) and S \u0026amp; T Program of Hebei (216Z7705G).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eCai YH, Wang J, Jin DQ, Liu Q, Chen XL, Pan LL, et al. Dhx15 regulates zebrafish definitive hematopoiesis through the unfolded protein response pathway. Cancer Sci. 2021;112:3884-94.\u003c/li\u003e\n\u003cli\u003eSiegel RL, Miller KD, Wagle NS, Jemal A. Cancer statistics, 2023. CA Cancer J Clin. 2023;73:17-48.\u003c/li\u003e\n\u003cli\u003eZi J, Han Q, Gu SY, McGrath M, Kane S, Song CH, et al. Targeting NAT10 induces apoptosis associated with enhancing endoplasmic reticulum stress in acute myeloid leukemia cells. Front Oncol. 2020;10:598107.\u003c/li\u003e\n\u003cli\u003evan Gils N, Denkers F, Smit L. Escape from treatment; The different faces of leukemic stem cells and therapy resistance in acute myeloid leukemia. Front Oncol. 2021;11:659253.\u003c/li\u003e\n\u003cli\u003eMcMahon CM, Ferng T, Canaani J, Wang ES, Morrissette JJD, Eastburn DJ, et al. Clonal selection with RAS pathway activation mediates secondary clinical resistance to selective FLT3 inhibition in acute myeloid leukemia. Cancer Discov. 2019;9:1050-63.\u003c/li\u003e\n\u003cli\u003eForte D, Garc\u0026iacute;a-Fern\u0026aacute;ndez M, S\u0026aacute;nchez-Aguilera A, Stavropoulou V, Fielding C, Mart\u0026iacute;n-P\u0026eacute;rez D, et al. Bone marrow mesenchymal stem cells support acute myeloid leukemia bioenergetics and enhance antioxidant defense and escape from chemotherapy. Cell Metab. 2020;32:829-43.e9.\u003c/li\u003e\n\u003cli\u003eLong HD, Hou Y, Li J, Song CH, Ge Z. Azacitidine is synergistically lethal with XPO1 inhibitor selinexor in acute myeloid leukemia by targeting XPO1/eIF4E/c-MYC signaling. Int J Mol Sci. 2023;24:6816.\u003c/li\u003e\n\u003cli\u003eAlmanza A, Carlesso A, Chintha C, Creedican S, Doultsinos D, Leuzzi B, et al. Endoplasmic reticulum stress signalling-from basic mechanisms to clinical applications. Febs J. 2019;286:241-78.\u003c/li\u003e\n\u003cli\u003ePapp B, Launay S, G\u0026eacute;l\u0026eacute;bart P, Arbabian A, Enyedi A, Brouland JP, et al. Endoplasmic reticulum calcium pumps and tumor cell differentiation. Int J Mol Sci. 2020;21:3351.\u003c/li\u003e\n\u003cli\u003eHetz C, Papa FR. The unfolded protein response and cell fate control. Mol Cell. 2018;69:169-81.\u003c/li\u003e\n\u003cli\u003eZhou C, Martinez E, Di Marcantonio D, Solanki-Patel N, Aghayev T, Peri S, et al. JUN is a key transcriptional regulator of the unfolded protein response in acute myeloid leukemia. Leukemia. 2017;31:1196-205.\u003c/li\u003e\n\u003cli\u003eKhateb A, Ronai ZA. Unfolded protein response in leukemia: From basic understanding to therapeutic opportunities. Trends Cancer. 2020;6:960-73.\u003c/li\u003e\n\u003cli\u003eŚniegocka M, Liccardo F, Fazi F, Masciarelli S. Understanding ER homeostasis and the UPR to enhance treatment efficacy of acute myeloid leukemia. Drug Resist Updat. 2022;64:100853.\u003c/li\u003e\n\u003cli\u003eRahman NSA, Zahari S, Syafruddin SE, Firdaus-Raih M, Low TY, Mohtar MA. Functions and mechanisms of protein disulfide isomerase family in cancer emergence. Cell Biosci. 2022;12:129.\u003c/li\u003e\n\u003cli\u003ePowell LE, Foster PA. Protein disulphide isomerase inhibition as a potential cancer therapeutic strategy. Cancer Med. 2021;10:2812-25.\u003c/li\u003e\n\u003cli\u003eMa YS, Feng S, Lin L, Zhang H, Wei GH, Liu YS, et al. Protein disulfide isomerase inhibits endoplasmic reticulum stress response and apoptosis via its oxidoreductase activity in colorectal cancer. Cell Signal. 2021;86:110076.\u003c/li\u003e\n\u003cli\u003eKang LC, Wang DK, Shen TY, Liu X, Dai B, Zhou DH, et al. PDIA4 confers resistance to ferroptosis via induction of ATF4/SLC7A11 in renal cell carcinoma. Cell Death Dis. 2023;14:193.\u003c/li\u003e\n\u003cli\u003eYang SH, Jackson C, Karapetyan E, Dutta P, Kermah D, Wu Y, et al. Roles of protein disulfide isomerase in breast cancer. Cancers (Basel). 2022;14:745.\u003c/li\u003e\n\u003cli\u003eHiga A, Taouji S, Lhomond S, Jensen D, Fernandez-Zapico ME, Simpson JC, et al. Endoplasmic reticulum stress-activated transcription factor ATF6\u0026alpha; requires the disulfide isomerase PDIA5 to modulate chemoresistance. Mol Cell Biol. 2014;34:1839-49.\u003c/li\u003e\n\u003cli\u003eXu QH, Zhang JM, Zhao ZJ, Chu YJ, Fang JG. Revealing PACMA 31 as a new chemical type TrxR inhibitor to promote cancer cell apoptosis. Biochim Biophys Acta Mol Cell Res. 2022;1869:119323.\u003c/li\u003e\n\u003cli\u003eXu SL, Butkevich AN, Yamada R, Zhou Y, Debnath B, Duncan R, et al. Discovery of an orally active small-molecule irreversible inhibitor of protein disulfide isomerase for ovarian cancer treatment. Proc Natl Acad Sci U S A. 2012;109:16348-53.\u003c/li\u003e\n\u003cli\u003eWon JK, Yu SJ, Hwang CY, Cho SH, Park SM, Kim K, et al. Protein disulfide isomerase inhibition synergistically enhances the efficacy of sorafenib for hepatocellular carcinoma. Hepatology. 2017;66:855-68.\u003c/li\u003e\n\u003cli\u003eLong LY, Assaraf YG, Lei ZN, Peng HW, Yang L, Chen ZS, et al. Genetic biomarkers of drug resistance: A compass of prognosis and targeted therapy in acute myeloid leukemia. Drug Resist Updat. 2020;52:100703.\u003c/li\u003e\n\u003cli\u003eYe ZW, Zhang J, Aslam M, Blumental-Perry A, Tew KD, Townsend DM. Protein disulfide isomerase family mediated redox regulation in cancer. Adv Cancer Res. 2023;160:83-106.\u003c/li\u003e\n\u003cli\u003eHaefliger S, Klebig C, Schaubitzer K, Schardt J, Timchenko N, Mueller BU, et al. Protein disulfide isomerase blocks CEBPA translation and is up-regulated during the unfolded protein response in AML. Blood. 2011;117:5931-40.\u003c/li\u003e\n\u003cli\u003eTrivedi R, M\u0026uuml;ller GA, Rathore MS, Mishra DP, Dihazi H. Anti-leukemic activity of shikonin: Role of ERP57 in shikonin induced apoptosis in acute myeloid leukemia. Cell Physiol Biochem. 2016;39:604-16.\u003c/li\u003e\n\u003cli\u003eYamada R, Cao XF, Butkevich AN, Millard M, Odde S, Mordwinkin N, et al. Discovery and preclinical evaluation of a novel class of cytotoxic propynoic acid carbamoyl methyl amides (PACMAs). J Med Chem. 2011;54:2902-14.\u003c/li\u003e\n\u003cli\u003eVatolin S, Phillips JG, Jha BK, Govindgari S, Hu J, Grabowski D, et al. Novel protein disulfide isomerase inhibitor with anticancer activity in multiple myeloma. Cancer Res. 2016;76:3340-50.\u003c/li\u003e\n\u003cli\u003eSamimi A, Khodayar MJ, Alidadi H, Khodadi E. The dual role of ROS in hematological malignancies: Stem cell protection and cancer cell metastasis. Stem Cell Rev Rep. 2020;16:262-75.\u003c/li\u003e\n\u003cli\u003eCheung EC, Vousden KH. The role of ROS in tumour development and progression. Nat Rev Cancer. 2022;22:280-97.\u003c/li\u003e\n\u003cli\u003eBian ML, Fan R, Zhao S, Liu WK. Targeting the thioredoxin system as a strategy for cancer therapy: Miniperspective. J Med Chem. 2019;62:7309-21.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003e\u003cstrong\u003eTable 1.\u0026nbsp;\u003c/strong\u003ePatients characteristics of de novo AML patients samples.\u0026nbsp;\u003c/p\u003e\n\u003cdiv align=\"center\"\u003e\n \u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"715\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 32px;\"\u003e\n \u003cp\u003ePatient No\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 36px;\"\u003e\n \u003cp\u003eAge(ys)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 33px;\"\u003e\n \u003cp\u003eGender\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 55px;\"\u003e\n \u003cp\u003eWBC(*109)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 44px;\"\u003e\n \u003cp\u003eBlasts purity(%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 35px;\"\u003e\n \u003cp\u003eFAB subtype\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 277px;\"\u003e\n \u003cp\u003eCytogenetics\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 203px;\"\u003e\n \u003cp\u003eGene mutation\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 32px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 36px;\"\u003e\n \u003cp\u003e47\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 33px;\"\u003e\n \u003cp\u003eM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 55px;\"\u003e\n \u003cp\u003e93.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 44px;\"\u003e\n \u003cp\u003e28\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 35px;\"\u003e\n \u003cp\u003eM2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 277px;\"\u003e\n \u003cp\u003e46,XY,t(6;9)(p22;q34)[15]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 203px;\"\u003e\n \u003cp\u003eNA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 32px;\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 36px;\"\u003e\n \u003cp\u003e70\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 33px;\"\u003e\n \u003cp\u003eF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 55px;\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 44px;\"\u003e\n \u003cp\u003e60.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 35px;\"\u003e\n \u003cp\u003eM2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 277px;\"\u003e\n \u003cp\u003e45,X,-X,t(8;21)(q22;q22)[8]/46,XX[2]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 203px;\"\u003e\n \u003cp\u003eASXL1,TET2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 32px;\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 36px;\"\u003e\n \u003cp\u003e54\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 33px;\"\u003e\n \u003cp\u003eM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 55px;\"\u003e\n \u003cp\u003e19.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 44px;\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 35px;\"\u003e\n \u003cp\u003eM2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 277px;\"\u003e\n \u003cp\u003e45,XY,i(3)(?q10),-5,add(6)(?p25),+8,del(9)(?q34),-12,-17,+mar1[cp19]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 203px;\"\u003e\n \u003cp\u003eTP53\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 32px;\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 36px;\"\u003e\n \u003cp\u003e61\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 33px;\"\u003e\n \u003cp\u003eF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 55px;\"\u003e\n \u003cp\u003e251.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 44px;\"\u003e\n \u003cp\u003e80\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 35px;\"\u003e\n \u003cp\u003eM2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 277px;\"\u003e\n \u003cp\u003e46,XX[20]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 203px;\"\u003e\n \u003cp\u003eKRAS\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 32px;\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 36px;\"\u003e\n \u003cp\u003e60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 33px;\"\u003e\n \u003cp\u003eM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 55px;\"\u003e\n \u003cp\u003e269.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 44px;\"\u003e\n \u003cp\u003e87.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 35px;\"\u003e\n \u003cp\u003eM2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 277px;\"\u003e\n \u003cp\u003e46,XY[10]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 203px;\"\u003e\n \u003cp\u003eFLT3,NPM1,TET2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 32px;\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 36px;\"\u003e\n \u003cp\u003e83\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 33px;\"\u003e\n \u003cp\u003eF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 55px;\"\u003e\n \u003cp\u003e181.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 44px;\"\u003e\n \u003cp\u003e79.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 35px;\"\u003e\n \u003cp\u003eM2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 277px;\"\u003e\n \u003cp\u003e46,XY[20]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 203px;\"\u003e\n \u003cp\u003eNA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 32px;\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 36px;\"\u003e\n \u003cp\u003e84\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 33px;\"\u003e\n \u003cp\u003eM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 55px;\"\u003e\n \u003cp\u003e2.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 44px;\"\u003e\n \u003cp\u003e64\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 35px;\"\u003e\n \u003cp\u003eM2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 277px;\"\u003e\n \u003cp\u003e46,XY,add(14)(p10)[10]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 203px;\"\u003e\n \u003cp\u003eCEBPA \u0026nbsp;double mutation,TET2 double mutation,STAG2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 32px;\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 36px;\"\u003e\n \u003cp\u003e69\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 33px;\"\u003e\n \u003cp\u003eM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 55px;\"\u003e\n \u003cp\u003e25.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 44px;\"\u003e\n \u003cp\u003e12.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 35px;\"\u003e\n \u003cp\u003eM4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 277px;\"\u003e\n \u003cp\u003e44,XY,del(5)(q12q23),add(8)(q24),-13,-16,-17,del(20)(q10),+r[5]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 203px;\"\u003e\n \u003cp\u003eDNMT3A,NF1,TP53\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 32px;\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 36px;\"\u003e\n \u003cp\u003e76\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 33px;\"\u003e\n \u003cp\u003eF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 55px;\"\u003e\n \u003cp\u003e30.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 44px;\"\u003e\n \u003cp\u003e54.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 35px;\"\u003e\n \u003cp\u003eM4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 277px;\"\u003e\n \u003cp\u003e46,XX[35]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 203px;\"\u003e\n \u003cp\u003eNRAS,KIT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 32px;\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 36px;\"\u003e\n \u003cp\u003e67\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 33px;\"\u003e\n \u003cp\u003eM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 55px;\"\u003e\n \u003cp\u003e42.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 44px;\"\u003e\n \u003cp\u003e71.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 35px;\"\u003e\n \u003cp\u003eM4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 277px;\"\u003e\n \u003cp\u003e46,XY[4]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 203px;\"\u003e\n \u003cp\u003eCEBPA double mutation,WT1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 32px;\"\u003e\n \u003cp\u003e11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 36px;\"\u003e\n \u003cp\u003e70\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 33px;\"\u003e\n \u003cp\u003eF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 55px;\"\u003e\n \u003cp\u003e3.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 44px;\"\u003e\n \u003cp\u003e53\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 35px;\"\u003e\n \u003cp\u003eM4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 277px;\"\u003e\n \u003cp\u003e43,XX,del(5)(q23q35),-8,add(9)(q34),add(9)(q34),add(10)(q21),-11,add(11)(p11),-17,-18,-18,+22,+mar[10]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 203px;\"\u003e\n \u003cp\u003eCEBPA,IDH2,SRSF2,DNMT3A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 32px;\"\u003e\n \u003cp\u003e12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 36px;\"\u003e\n \u003cp\u003e47\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 33px;\"\u003e\n \u003cp\u003eM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 55px;\"\u003e\n \u003cp\u003e3.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 44px;\"\u003e\n \u003cp\u003e67\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 35px;\"\u003e\n \u003cp\u003eM4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 277px;\"\u003e\n \u003cp\u003e45,XY,+10,-13,del(20)(q12),-21[2]/46,XY[6]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 203px;\"\u003e\n \u003cp\u003eCSF3R.p.Y787*\u0026nbsp;\u003cbr\u003e\u0026nbsp;CEBPAp.155Mfs*52\u003cbr\u003e\u0026nbsp;ASXL2p.E433*\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 32px;\"\u003e\n \u003cp\u003e13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 36px;\"\u003e\n \u003cp\u003e22\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 33px;\"\u003e\n \u003cp\u003eM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 55px;\"\u003e\n \u003cp\u003e4.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 44px;\"\u003e\n \u003cp\u003e50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 35px;\"\u003e\n \u003cp\u003eM4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 277px;\"\u003e\n \u003cp\u003e46,XY, inv(16)(p13q22)[10]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 203px;\"\u003e\n \u003cp\u003eNRAS,CSF3R\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 32px;\"\u003e\n \u003cp\u003e14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 36px;\"\u003e\n \u003cp\u003e40\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 33px;\"\u003e\n \u003cp\u003eF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 55px;\"\u003e\n \u003cp\u003e5.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 44px;\"\u003e\n \u003cp\u003e27\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 35px;\"\u003e\n \u003cp\u003eM4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 277px;\"\u003e\n \u003cp\u003e46,XX,del[7](q31)[4]/47,XX,+22[3]/46,XX[3]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 203px;\"\u003e\n \u003cp\u003eKRAS,FLT3-TKD\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 32px;\"\u003e\n \u003cp\u003e15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 36px;\"\u003e\n \u003cp\u003e68\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 33px;\"\u003e\n \u003cp\u003eM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 55px;\"\u003e\n \u003cp\u003e4.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 44px;\"\u003e\n \u003cp\u003e40\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 35px;\"\u003e\n \u003cp\u003eM4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 277px;\"\u003e\n \u003cp\u003e46,XY[20]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 203px;\"\u003e\n \u003cp\u003eCSF3R,CEBPA double mutation,\u0026nbsp;RUNX11,TET2,EP300\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 32px;\"\u003e\n \u003cp\u003e16\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 36px;\"\u003e\n \u003cp\u003e66\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 33px;\"\u003e\n \u003cp\u003eF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 55px;\"\u003e\n \u003cp\u003e55\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 44px;\"\u003e\n \u003cp\u003e31.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 35px;\"\u003e\n \u003cp\u003eM4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 277px;\"\u003e\n \u003cp\u003e46,XX, inv(16)(p13;1q22)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 203px;\"\u003e\n \u003cp\u003eNRAS,ATM,PML,CHD2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 32px;\"\u003e\n \u003cp\u003e17\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 36px;\"\u003e\n \u003cp\u003e60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 33px;\"\u003e\n \u003cp\u003eF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 55px;\"\u003e\n \u003cp\u003e14.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 44px;\"\u003e\n \u003cp\u003e53\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 35px;\"\u003e\n \u003cp\u003eM4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 277px;\"\u003e\n \u003cp\u003eNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 203px;\"\u003e\n \u003cp\u003eNA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 32px;\"\u003e\n \u003cp\u003e18\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 36px;\"\u003e\n \u003cp\u003e74\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 33px;\"\u003e\n \u003cp\u003eM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 55px;\"\u003e\n \u003cp\u003e175\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 44px;\"\u003e\n \u003cp\u003e91\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 35px;\"\u003e\n \u003cp\u003eM5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 277px;\"\u003e\n \u003cp\u003e46,XY[19]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 203px;\"\u003e\n \u003cp\u003eNA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 32px;\"\u003e\n \u003cp\u003e19\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 36px;\"\u003e\n \u003cp\u003e64\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 33px;\"\u003e\n \u003cp\u003eM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 55px;\"\u003e\n \u003cp\u003e189.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 44px;\"\u003e\n \u003cp\u003e81\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 35px;\"\u003e\n \u003cp\u003eM5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 277px;\"\u003e\n \u003cp\u003e45,XY,-7,t(9;22)(q34.1;q11.2)[17]/46,XY[3])\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 203px;\"\u003e\n \u003cp\u003eIKZF1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 32px;\"\u003e\n \u003cp\u003e20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 36px;\"\u003e\n \u003cp\u003e73\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 33px;\"\u003e\n \u003cp\u003eF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 55px;\"\u003e\n \u003cp\u003e117.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 44px;\"\u003e\n \u003cp\u003e86.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 35px;\"\u003e\n \u003cp\u003eM5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 277px;\"\u003e\n \u003cp\u003e46,XX[20]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 203px;\"\u003e\n \u003cp\u003eNA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 32px;\"\u003e\n \u003cp\u003e21\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 36px;\"\u003e\n \u003cp\u003e60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 33px;\"\u003e\n \u003cp\u003eM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 55px;\"\u003e\n \u003cp\u003e11.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 44px;\"\u003e\n \u003cp\u003e66.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 35px;\"\u003e\n \u003cp\u003eM5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 277px;\"\u003e\n \u003cp\u003e47-53,XY,del(4)(q31),del(5)(q33),-7,+8,+10,add(10)(q26),+11,+11,+13,+14,-18,+21,+21,+22,.inc[cp10]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 203px;\"\u003e\n \u003cp\u003eIKZF1,RUNX1,TP53\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 32px;\"\u003e\n \u003cp\u003e22\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 36px;\"\u003e\n \u003cp\u003e32\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 33px;\"\u003e\n \u003cp\u003eM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 55px;\"\u003e\n \u003cp\u003e7.88\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 44px;\"\u003e\n \u003cp\u003e69.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 35px;\"\u003e\n \u003cp\u003eM5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 277px;\"\u003e\n \u003cp\u003e49,XY,+8,del(10)(p12),+del(10)(p12),add(11)(q25),+21[20]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 203px;\"\u003e\n \u003cp\u003eRUNX1,MYC,NRAS\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 32px;\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 36px;\"\u003e\n \u003cp\u003e29\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 33px;\"\u003e\n \u003cp\u003eF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 55px;\"\u003e\n \u003cp\u003e5.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 44px;\"\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 35px;\"\u003e\n \u003cp\u003eM5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 277px;\"\u003e\n \u003cp\u003e45,XX,-7[10]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 203px;\"\u003e\n \u003cp\u003eTP53,NF1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 32px;\"\u003e\n \u003cp\u003e24\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 36px;\"\u003e\n \u003cp\u003e51\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 33px;\"\u003e\n \u003cp\u003eF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 55px;\"\u003e\n \u003cp\u003e274.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 44px;\"\u003e\n \u003cp\u003e64\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 35px;\"\u003e\n \u003cp\u003eM5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 277px;\"\u003e\n \u003cp\u003e46,XX[20]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 203px;\"\u003e\n \u003cp\u003eFLT3-ITD,NPM1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 32px;\"\u003e\n \u003cp\u003e25\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 36px;\"\u003e\n \u003cp\u003e70\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 33px;\"\u003e\n \u003cp\u003eM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 55px;\"\u003e\n \u003cp\u003e151.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 44px;\"\u003e\n \u003cp\u003e67.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 35px;\"\u003e\n \u003cp\u003eM5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 277px;\"\u003e\n \u003cp\u003e46,XY[20]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 203px;\"\u003e\n \u003cp\u003eFLT3-ITD,DNMT3A,NPM1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2.\u003c/strong\u003e Clinical information for de novo AML patients.\u0026nbsp;\u003c/p\u003e\n\u003cdiv align=\"\"\u003e\n \u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"651\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 37px;\"\u003e\n \u003cp\u003eNo\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 36px;\"\u003e\n \u003cp\u003eAge(ys)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 33px;\"\u003e\n \u003cp\u003eGender\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 55px;\"\u003e\n \u003cp\u003eWBC(*109)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 44px;\"\u003e\n \u003cp\u003eBlasts purity(%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 35px;\"\u003e\n \u003cp\u003eFAB subtype\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 38px;\"\u003e\n \u003cp\u003eSamples source\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 169px;\"\u003e\n \u003cp\u003eCytogenetics\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 152px;\"\u003e\n \u003cp\u003eGene mutation\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 51px;\"\u003e\n \u003cp\u003ePACMA31 IC50(\u0026mu;M)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 37px;\"\u003e\n \u003cp\u003eAML26\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 36px;\"\u003e\n \u003cp\u003e52\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 33px;\"\u003e\n \u003cp\u003eM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 55px;\"\u003e\n \u003cp\u003e19.89\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 44px;\"\u003e\n \u003cp\u003e61\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 35px;\"\u003e\n \u003cp\u003eM5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 38px;\"\u003e\n \u003cp\u003eBM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 169px;\"\u003e\n \u003cp\u003e46,XY[20]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 152px;\"\u003e\n \u003cp\u003eDNMT3A,FLT3-ITD,FLT3-TKD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 51px;\"\u003e\n \u003cp\u003e15.35\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 37px;\"\u003e\n \u003cp\u003eAML27\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 36px;\"\u003e\n \u003cp\u003e49\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 33px;\"\u003e\n \u003cp\u003eM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 55px;\"\u003e\n \u003cp\u003e11.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 44px;\"\u003e\n \u003cp\u003e49\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 35px;\"\u003e\n \u003cp\u003eM5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 38px;\"\u003e\n \u003cp\u003eBM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 169px;\"\u003e\n \u003cp\u003e46,XY[20]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 152px;\"\u003e\n \u003cp\u003eCEBPA double mutation\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 51px;\"\u003e\n \u003cp\u003e0.1949\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 37px;\"\u003e\n \u003cp\u003eAML28\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 36px;\"\u003e\n \u003cp\u003e45\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 33px;\"\u003e\n \u003cp\u003eM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 55px;\"\u003e\n \u003cp\u003e2.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 44px;\"\u003e\n \u003cp\u003e48\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 35px;\"\u003e\n \u003cp\u003eM2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 38px;\"\u003e\n \u003cp\u003eBM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 169px;\"\u003e\n \u003cp\u003e46,XY,t(8;21)(q22;q22)[2]/46,XY[8]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 152px;\"\u003e\n \u003cp\u003eIDH2,CHD8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 51px;\"\u003e\n \u003cp\u003e0.2874\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 37px;\"\u003e\n \u003cp\u003eAML29\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 36px;\"\u003e\n \u003cp\u003e64\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 33px;\"\u003e\n \u003cp\u003eM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 55px;\"\u003e\n \u003cp\u003e59.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 44px;\"\u003e\n \u003cp\u003e54\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 35px;\"\u003e\n \u003cp\u003eM5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 38px;\"\u003e\n \u003cp\u003eBM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 169px;\"\u003e\n \u003cp\u003e46,XY,t(11;19)(q23;p13)[8]/46,XY[2]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 152px;\"\u003e\n \u003cp\u003eKRAS,NRAS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 51px;\"\u003e\n \u003cp\u003e0.073\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 37px;\"\u003e\n \u003cp\u003eAML30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 36px;\"\u003e\n \u003cp\u003e15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 33px;\"\u003e\n \u003cp\u003eM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 55px;\"\u003e\n \u003cp\u003e8.75\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 44px;\"\u003e\n \u003cp\u003e20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 35px;\"\u003e\n \u003cp\u003eM4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 38px;\"\u003e\n \u003cp\u003eBM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 169px;\"\u003e\n \u003cp\u003e46,XY[18]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 152px;\"\u003e\n \u003cp\u003eFLT3,NRAS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 51px;\"\u003e\n \u003cp\u003e0.2793\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 37px;\"\u003e\n \u003cp\u003ePBMC1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 36px;\"\u003e\n \u003cp\u003e24\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 33px;\"\u003e\n \u003cp\u003eM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 44px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 35px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 38px;\"\u003e\n \u003cp\u003ePB\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 169px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 152px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 51px;\"\u003e\n \u003cp\u003e>200\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 37px;\"\u003e\n \u003cp\u003ePBMC2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 36px;\"\u003e\n \u003cp\u003e46\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 33px;\"\u003e\n \u003cp\u003eM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 44px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 35px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 38px;\"\u003e\n \u003cp\u003ePB\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 169px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 152px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 51px;\"\u003e\n \u003cp\u003e>200\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 37px;\"\u003e\n \u003cp\u003ePBMC3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 36px;\"\u003e\n \u003cp\u003e34\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 33px;\"\u003e\n \u003cp\u003eF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 55px;\"\u003e\n \u003cp\u003e \u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 44px;\"\u003e\n \u003cp\u003e \u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 35px;\"\u003e\n \u003cp\u003e \u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 38px;\"\u003e\n \u003cp\u003ePB\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 169px;\"\u003e\n \u003cp\u003e \u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 152px;\"\u003e\n \u003cp\u003e \u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 51px;\"\u003e\n \u003cp\u003e>200\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003eHalf maximal inhibitory concentration(IC50) values were calculated on the basis of the number of viable cells quantified by CCK-8 assay.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 3.\u003c/strong\u003e The primer pairs used in RT-PCR.\u0026nbsp;\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"368\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 45px;\"\u003e\n \u003cp\u003eGene\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003e \u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 285px;\"\u003e\n \u003cp\u003ePrime Sequence(5\u0026apos;-3\u0026apos;)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 45px;\"\u003e\n \u003cp\u003e\u0026beta;-actin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003eF\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 285px;\"\u003e\n \u003cp\u003eTGTTACCAACTGGGACGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 45px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003eR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 285px;\"\u003e\n \u003cp\u003eGGGGTGTTGAAGGTCTCAAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 45px;\"\u003e\n \u003cp\u003ePDIA2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003eF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 285px;\"\u003e\n \u003cp\u003eGCTGCTGTTTGTCAACCAGACG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 45px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003eR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 285px;\"\u003e\n \u003cp\u003eCCTCAGCCTTGAGTCCAAAGTAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 45px;\"\u003e\n \u003cp\u003eCASQ1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003eF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 285px;\"\u003e\n \u003cp\u003eCTGGTAGACTCTGAGAAGGATGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 45px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003eR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 285px;\"\u003e\n \u003cp\u003eGCAGAAACTCCACGATGGTGTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 45px;\"\u003e\n \u003cp\u003eAGR3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003eF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 285px;\"\u003e\n \u003cp\u003eGCCTCCTCAGACACTCTCAAGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 45px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003eR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 285px;\"\u003e\n \u003cp\u003eGAGAGTATTGACAATCCTCCAGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 45px;\"\u003e\n \u003cp\u003eERP27\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003eF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 285px;\"\u003e\n \u003cp\u003eGGAACACCATCTGCCTCTTTCG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 45px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003eR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 285px;\"\u003e\n \u003cp\u003eACTCTGTCACCATGTGGAGGCT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 45px;\"\u003e\n \u003cp\u003eTMX1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003eF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 285px;\"\u003e\n \u003cp\u003eGAAGACCTTGGATTGCCAGTGTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 45px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003eR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 285px;\"\u003e\n \u003cp\u003eGAAGGACAAAGGCAATCTGCCAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 45px;\"\u003e\n \u003cp\u003eTMX2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003eF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 285px;\"\u003e\n \u003cp\u003eTTGGGAAGGTGGATGTTGGACG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 45px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003eR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 285px;\"\u003e\n \u003cp\u003eCTTGCCACCTTGGAACAGGATC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 45px;\"\u003e\n \u003cp\u003eERP46\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003eF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 285px;\"\u003e\n \u003cp\u003eGTAGACTGCACTGCTGAACGGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 45px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003eR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 285px;\"\u003e\n \u003cp\u003eTCGTCTTTCGCTTGGCTCAGGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 45px;\"\u003e\n \u003cp\u003eERP29\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003eF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 285px;\"\u003e\n \u003cp\u003eGCAGGATGAGTTCAAGCGTCTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 45px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003eR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 285px;\"\u003e\n \u003cp\u003eGCTCCATGTTCAGCTTGTCACC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 45px;\"\u003e\n \u003cp\u003eERDJ5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003eF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 285px;\"\u003e\n \u003cp\u003eTCGTTTGGCTCATCATCGGTGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 45px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003eR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 285px;\"\u003e\n \u003cp\u003eCAGAGGAACAGTCAAACCTGCC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 45px;\"\u003e\n \u003cp\u003eTMX4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003eF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 285px;\"\u003e\n \u003cp\u003eCCATCCTGCCAGCAGACTGATT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 45px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003eR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 285px;\"\u003e\n \u003cp\u003eGAGAGTGGTGACAAAGAAGCGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 45px;\"\u003e\n \u003cp\u003eERP57\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003eF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 285px;\"\u003e\n \u003cp\u003eGTCAGCCACTTGAAGAAGCAGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 45px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003eR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 285px;\"\u003e\n \u003cp\u003eTAGGAACTCGGAGTGAGCCTCA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 45px;\"\u003e\n \u003cp\u003eERP5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003eF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 285px;\"\u003e\n \u003cp\u003eTCAGAAAGGCGAGTCTCCTGTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 45px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003eR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 285px;\"\u003e\n \u003cp\u003eCCTCTTGGCAATGTCCTCGTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 45px;\"\u003e\n \u003cp\u003ePDI\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003eF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 285px;\"\u003e\n \u003cp\u003eTCACCAAGGAGAACCTGCTGGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 45px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003eR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 285px;\"\u003e\n \u003cp\u003eGGCAAGAACAGCAGGATGTGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 45px;\"\u003e\n \u003cp\u003eERP18\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003eF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 285px;\"\u003e\n \u003cp\u003eGGACATAATGGGCTTGGAAAGGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 45px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003eR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 285px;\"\u003e\n \u003cp\u003eCTTTGCAAGCTCCACACCAGGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 45px;\"\u003e\n \u003cp\u003eERP44\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003eF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 285px;\"\u003e\n \u003cp\u003eAGTAGTGTTTGCCAGAGTTGATTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 45px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003eR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 285px;\"\u003e\n \u003cp\u003eCTGCCAATGCTTTCACTGATCGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 45px;\"\u003e\n \u003cp\u003eERP72\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003eF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 285px;\"\u003e\n \u003cp\u003eCCAGCAGGTTTGATGTGAGTGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 45px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003eR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 285px;\"\u003e\n \u003cp\u003eGGAGACTTCTCTGACCTTGGCA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 45px;\"\u003e\n \u003cp\u003eTMX3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003eF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 285px;\"\u003e\n \u003cp\u003eCATTTTGGATGGCACAGTAGAAGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 45px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003eR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 285px;\"\u003e\n \u003cp\u003eGAGAAAGCAGCCCATCAGTGGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 45px;\"\u003e\n \u003cp\u003ePDIR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003eF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 285px;\"\u003e\n \u003cp\u003eGGAGCCAAAGATGTTGTCCACC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 45px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003eR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 285px;\"\u003e\n \u003cp\u003eGAAATGCGGCATCATCCTCTTGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 45px;\"\u003e\n \u003cp\u003eAGR2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003eF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 285px;\"\u003e\n \u003cp\u003eGGTGACCAACTCATCTGGACTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 45px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003eR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 285px;\"\u003e\n \u003cp\u003eTGACTGTGTGGGCACTCATCCA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 45px;\"\u003e\n \u003cp\u003eCASQ2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003eF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 285px;\"\u003e\n \u003cp\u003eGCAGCAAACTGGAAGTCCAAGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 45px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003eR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 285px;\"\u003e\n \u003cp\u003eGATGTAAGGCTGGAAGTGTTCAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 45px;\"\u003e\n \u003cp\u003ePDIA7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003eF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 285px;\"\u003e\n \u003cp\u003eGAGCTTCAGCAGGAGTTTGGGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 45px;\"\u003e\n \u003cp\u003e \u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003eR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 285px;\"\u003e\n \u003cp\u003eCGTCTCAACCAAACGACTAAGGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-5764412/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5764412/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAcute myeloid leukemia (AML) as the second most common hematological malignancy remains currently incurable. In this study, we found the protein disulphide isomerase family (PDIs) was expressed in primary leukemia cells, with particular emphasis on ERP5 and ERP57. The compound PACMA31 demonstrated the ability to inhibit proliferation, enhance differentiation, exacerbate oxidative stress, and induce apoptosis in AML cells. RNA sequencing analysis revealed that PACMA31 impeded the proliferation of AML cells by modulating the unfolded protein response (UPR). Notably, Western blot results indicated that the antiproliferative effects of PACMA31 were mediated through the PERK/eIF2α signaling pathway. The selective inhibition of PDIs activity collectively induces apoptosis and differentiation in AML cells by activating the UPR via the PERK/eIF2α pathway. Consequently, PDIs inhibitors may represent promising candidates for the development of antitumor therapeutics against AML.\u003c/p\u003e","manuscriptTitle":"Protein disulfide isomerase family is a potential therapeutic target in acute myeloid leukemia","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-01-08 12:10:05","doi":"10.21203/rs.3.rs-5764412/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"d98a5d31-86a8-4b72-b337-f4b212b3bf24","owner":[],"postedDate":"January 8th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-01-12T04:53:08+00:00","versionOfRecord":[],"versionCreatedAt":"2025-01-08 12:10:05","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5764412","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5764412","identity":"rs-5764412","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.