Effects of Moxibustion on Amygdala -HPA Axis in Rats with Kidney-Yang Deficiency Syndrome Induced by Hydrocortisone Injection

Effects of Moxibustion on Amygdala -HPA Axis in Rats with Kidney-Yang Deficiency Syndrome Induced by Hydrocortisone Injection | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Effects of Moxibustion on Amygdala -HPA Axis in Rats with Kidney-Yang Deficiency Syndrome Induced by Hydrocortisone Injection Wen-guo Ye, Hai-hua Yao, You-jiang Min, Kai-tao Luo, Jie Sun, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-86968/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background: The syndrome of kidney-yang deficiency is one of the main syndromes in traditional Chinese medicine. Modern evidences prove that the hypothalamus - pituitary - adrenal axis (HPA axis) function disorder is the main material basis of kidney-yang deficiency syndrome. The upper regulating center, such as hippocampus and amygdala can affected HPA axis. Although moxibustion have a therapeutic effect for kidney-yang deficiency syndromes, the underlying mechanism remains unclear. This study investigated the effect of suspended moxibustion on amygdala and HPA axis and elucidated the possible molecular mechanism of moxibustion in improving kidney-yang deficiency syndrome. Methods: 60 male Sprague-Dawley rats were randomly divided into the normal group ( n=12) and the model-building group (n=48). Rats in the model-building group were given intramuscular injection of hydrocortisone to establish the model of kidney-yang deficiency. The 48 rats successfully modeled were then randomly divided into model group (model, n=12) , carbenoxolone intraperitoneal injection group (CBX, n=12), moxibustion group (moxi, n=12) and moxibustion plus carbenoxolone intraperitoneal injection group (moxi+CBX, n=12). In the moxibustion group, Shenshu (BL23) and Guanyuan (CV4) points were treated with moxibustion for 14 days. After treatment, the level of corticostesone (CORT), adrenocorticotropic hormone (ACTH) and corticotropin-releasing hormone (CRH) in serum, the expressions of mineralocorticoid receptor (MR), glucocorticoid receptor (GR), 11 beta-hydroxysteroid dehydrogenase type 1 (11β-HSD1), corticotropin releasing factor (CRF) and ACTH in rats’ amygdala and (or) hypothalamus, pituitary were detected. Data were analyzed by one-way analysis of variance. Results: Compared with the normal group, the level of CRH, ACTH and CORT in serum, and the mRNA and protein expressions of MR, GR and 11β-HSD1in amygdala, the mRNA and protein expressions of 11β-HSD1 in hypothalamus and CRF mRNA expression in amygdala and hypothalamus, and ACTH mRNA expression in pituitary of rats in the model group were all significantly decreased (P < 0.05 or 0.01). After treatment with moxibustion, except for 11β-HSD1 mRNA expression, the observation index mentioned above were increased to different degrees compared with those in the model group (P < 0.05 or 0.01). Conclusion : Suspended moxibustion can effectively improve the serum levels of ACTH, CRH and CORT, and can up-regulate the mRNA and protein expression of MR, GR , 11β-HSD1, CRF and ACTH in amygdala and hypothalamus of kidney-yang deficiency rats, which may be one of the molecular mechanisms of moxibustion in improving kidney-yang deficiency syndrome. Urology & Nephrology moxibustion Kidney-yang deficiency amygdala hypothalamus mineralocorticoid receptor glucocorticoid receptor 11 beta-hydroxysteroid dehydrogenase type 1 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Background Hypothalamic-pituitary-adrenocortical axis (HPA axis), an important part of the neuroendocrine system, is involved in the control of stress reaction and the regulation of many physical activities, such as digestion, immune system, mood and emotion, sexual behavior, energy storage and consumption [ 1 ]. The HPA axis is not only affected by the negative feedback of hormones secreted by each organ, but also affected by the upper regulating center, such as hippocampus and amygdala. Amygdala is a part of the limbic system, which is composed of the amygdala central nucleus, medial nucleus and cortical nucleus. Stimulation of these three nuclei in rats can induce corticosterone secretion, while damage to the amygdala can reduce the secretion of ACTH and corticosterone caused by fracture, and also reduce the secretion of ACTH after adrenalectomy [ 2 ]. Study has shown that the activation of CRH peptide in the central amygdala can positively respond to cortisol, leading to anxiety, fear and stimulate the stress system [ 3 ]. In addition, the amygdala also contains high concentrations of CRF, CRH, CRH receptors, CRH binding proteins and corticosteroid receptors [ 4 ]. This suggests that the amygdala may have the ability to synthesize and secrete CRH, which may directly activate the HPA axis and be regulated by the feedback of CRH and corticosteroid. Further studies suggest that CRH systems from hypothalamus and amygdala jointly constitute the neural circuits of stress responsiveness and anxiety generation in chronic stress [ 4 ]. Glucocorticoid (GC) is the terminal product of the HPA axis, which plays a key role in the amygdala-HPA axis and stress response [ 5 ]. Mineralocorticoid receptor (MR) and glucocorticoid receptor (GR) participate in the regulation of the HPA axis through the combination with GC [ 6 ]. The negative feedback regulating effect of GC on target tissue (including HPA axis) depends on the content of GR and MR in the upper regulating center and the concentration of GC in target tissue cells. Besides the influence of the concentration of GC in the plasma, the concentration of GC in the target tissue is mainly adjusted by the preglucocorticosteroid metabolase 11 beta-hydroxysteroid dehydrogenase (11β-HSD) [ 7 , 8 ]. 11β-HSD is a microzyme complex, a metabolic rate-limiting enzyme of glucocorticoid, which catalyzes the REDOX reaction between the ketone group (inactive) and the hydroxyl group (active) at the position 11 of glucocorticoid [ 9 ]. 11β-HSD1 is more expressed in hippocampus, amygdala, neocortical and cerebellum in adult rats, which is helpful to maintain the level of corticosterone in inner part and plays an important role in promoting the growth and maturation of tissues [ 10 ]. Carbenoxolone (CBX), a derivative of glycyrrhizae, is a non-selective inhibitor of 11β-HSD, which can inhibit both 11β-HSD1 and 11β-HSD2 [ 11 ]. The inhibition of 11β-HSD1 by CBX was similar to that of 11β-HSD1 knockout mice [ 12 ]. Kidney-yang deficiency syndrome, one of the main syndromes in traditional Chinese medicine, is a type of deficiency-cold syndrome caused by deficiency and decline of kidney-yang . Modern studies have confirmed that the low function of HPA axis is the main material basis of kidney-Yang deficiency syndrome [ 13 ]. Literature research and clinical observation [ 14 – 17 ] showed that moxibustion therapy in traditional Chinese medicine has a good effect on kidney-Yang deficiency syndrome. Our previous studies have also shown that moxibustion on shenshu and guanyuan with moxa sticks can effectively improve the dysfunction of HPA axis [ 18 ]. Can moxibustion with moxa stick affect the expression of MR, GR, 11β-HSD1, CRH and ACTH in the amygdala-HPA axis to treat kidney-yang deficiency syndrome? Therefore, its therapeutic mechanism is worthy of further study. Methods Experimental animals Sixty healthy, clean, male, Sprague Dawley (SD) rats aged 8 weeks (weighing 200 ± 20 g) were purchased from the Experimental Animal Center of Jiangxi University of Traditional Chinese Medicine, of Jiangxi Province, China (certificate no. JZLLSC (jiangxi) 2018-0033). The rats were fed with standard fodder and with food and water freely available in a controlled environment with a constant temperature of 20 ~ 25℃ and a 12/12-hr light/dark cycle. All procedures were conducted in accordance with guidelines reviewed and approved by the Institutional Animal Care and Use Committee of Jiangxi University of Traditional Chinese Medicine, China. Modeling Sixty rats were randomly divided into the normal group (norm, n = 12) and the model-building group (n = 48). Referring to literature [ 19 ] and making improvements, each rat in the model-building group was given intramuscular injection of hydrocortisone( Huazhong pharmaceutical co., LTD., national drug approval no. H420201507) at a dose of 0.03 mg/g·bw in left and right hind limbs of the rat alternately, and the modeling was carried out continuously for 14 days. Each rat in the normal group was given an intramuscular injection of 0.9% normal saline at a dose of 0.03 mg/g·bw for 14 days. During this period, natural light and free eating and drinking will be adopted. Criteria for model success [20[: decreases in body weight, withered clothing hair, hunched back, aversion cold, tendency to cluster, slowed reaction, weakness, decreased activity, scrotal shrinkage, and significantly increased urine output. Grouping and treatment The 48 rats successfully modeled were then randomly subdivided into model group (model, n = 12), carbenoxolone intraperitoneal injection group (CBX, n = 12), moxibustion group (moxi, n = 12) and moxibustion + carbenoxolone intraperitoneal injection group (moxi + CBX, n = 12). In the moxibustion treatment group, guanyuan (CV4) and shenshu(BL25) (double laterals) were selected, and acupoints locating according to the experimental acupuncture [ 21 ]. Moxibustion treatment began on the 1st day after modeling finished. Before the treatment, the hair on the acupoints was cut off to expose the skin in advance. guanyuan (CV4) and shenshu (BL25) points were heated by suspended moxibustion using a moxa-stick produced from mugwort (custom-made for use with animals, length 12 cm, diameter 0.6 cm, made in the Affiliated Hospital of Jiangxi University of Traditional Chinese Medicine, Nanchang, China) at a height of approximately 3 cm over a hairless area of the skin for 20 min, once a day for 14 days. Rats in the CBX group were given intraperitoneal injection of carbenoxolone at a dose of 10 mg /( kg·d) (11) once a day for 14 days. Fixation was performed as in the moxibustion group for a total of 14 times. Rats in the moxi + CBX group were received moxibustion as in the moxibustion group. After moxibustion treatment, the rats were given intraperitoneal injection of carbenoxolone as in the CBX group. Rats in the normal group and model group were fixed in the same way as the moxibustion group did, and were given intraperitoneal injection of normal saline (10 mg /( kg·d) once a day for 14 days. Sampling After 14 days of treatment, rats were anesthetized with an intraperitoneal injection of sodium pentobarbital 3% (weight/volume) at a dose of 40 mg/kg. Arterial blood is extracted and centrifuged to extract the supernatant, and stored in the − 20℃ refrigerator for later use. Tissues such as amygdala, hypothalamus and pituitary were extracted and stored in the − 80℃ refrigerator for later use. Enzyme linked immunosorbent assay (ELISA) assessment The levels of CORT, ACTH and CRH were determined using an ELISA kit purchased from Shanghai bogu biotechnology co., LTD (Shanghai, China). The ELISA-based method was conducted according to protocol provided by manufacturer. Reverse transcription real-time quantitative polymerase chain reaction (RT-qPCR) RT-qPCR was performed as described previously with minor modifications [ 22 ]. Total RNA was isolated from amygdala, hypothalamus and pituitary of rats in each group using TRIZOL reagent (Invitrogen, Carlsbad, CA, USA). The mRNA expression levels of MR, GR, 11β-HSD1,CRH and ACTH were measured using an RT-qPCR system with SYBR Green (Thermo Fisher Scientific, Waltham, MA, USA). cDNA was amplified by PCR using primers for each target gene. cDNA was synthesized from each RNA using a random primer and RevertAid™ M-MuLV reverse transcriptase (Fermentas), according to the manufacturer's instructions. PCR was performed in a final volume of 25 µL, containing 12.5 µL 2 × PCR master mix, 2 µL cDNA, 1 µL forward primer, 1 µL reverse primer, and 8.5 µL sterilized DEPC water. RT-qPCR conditions were as follows: 94 °C for 5 minutes, followed by 40 cycles of 95 °C for 15 seconds, 60 °C for 45 seconds and 72 °C for 30 seconds. The fluorescence signal was detected at 60 °C, and the samples were finally extended at 72 °C for 7 minutes. The amplification efficiency was compared between the target and reference control glyceraldehyde 3-phosphate dehydrogenase (GAPDH) using the delta-delta Ct (∆∆Ct) method [ 23 ]. The primers employed are listed in Table 1 . Table 1 Primer sequences for real-time quantitative polymerase chain reaction Gene Full name Sequences (5–3′) Product size (bp) 11β-HSD1 MR 11 beta- hydroxysteroid dehydrogenase type 1 mineralocorticoid receptor Sense primer: AAA ATA CCT CCT CCC CGT CC antisense primer: AGG CAG CGA GAC ACC ACC Sense primer: AGA AGC TGG GGA AGT TAA AAG G antisense primer: TCG GAG CGA TGT ATG TGG TC 219 102 GR glucocorticoid receptor Sense primer: CAT TAC CAC AGC TCA CCC CTA C antisense primer: GCA ATC ACT TGA CGC CCA C 148 CRH ACTH GAPDH corticotropin-releasing hormone adrenocorticotrophic hormone glyceraldehyde 3-phosphate dehydrogenase Sense primer: TGG CTC TGT CGC CCT GTC antisense primer: CAG CGG GAC TTC TGT TGA GG Sense primer: CTC CTG CTT CAG ACC TCC ATA G antisense primer: GGC TGT TCA TCT CCG TTG C Sense primer: GGA GTC TAC TGG CGT CTT CAC antisense primer: ATG AGC CCT TCC ACG ATG C 186 161 237 Western blot assay Western blot analysis was performed as described previously with minor modifications [ 24 ]. All amygdala and hypothalamus tissues obtained in each group were homogenized in lysis buffer (JRDUN Biotechnology, Shanghai, China). The sample was centrifuged at 12,000 r/min for 20 minutes at 4 °C, and an aliquot of the supernatant was taken for protein concentration estimation using the BCA assay. Equal amounts of proteins were separated by sodium dodecyl sulfate- polyacrylamide gel electrophoresis (SDS-PAGE), and then the resolved proteins were transferred to polyvinylidene fluoride (PVDF) membranes (Millipore, Bedford, MA, USA). The membranes were incubated with primary antibodies overnight at 4 °C. Monoclonal antibodies used for Western blotting included a rat monoclonal anti-MR antibody (1:1000; Santa Cruz Biotechnology, Santa Cruz, CA, USA). The antibodies used in this study were rat monoclonal antibodies, 1:1000 and were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA), except for those specifically indicated. The other antibodies included anti-GR, anti-11β-HSD1 and anti-GAPDH. The membranes were washed 5 minutes with Tris-buffered saline Tween 3 times and incubated with goat anti-rabbit IgG-HRP (1:1000; Beyotime Biotechnology, Shanghai, China) and goat anti-mouse IgG-HRP PS1 (C-20) (1:1000; Beyotime Biotechnology, Shanghai, China) antibodies at 37 °C for 1 hour. The immunoreactive bands were visualized using an enhanced chemiluminescence reagent (Beyotime Biotechnology, Shanghai, China). The grayscale values of bands were quantified using Image J software (Fujifilm, Tokyo, Japan). The relative expression of protein was calculated based on the ratio of target grayscale values to loading control grayscale values. in situ hybridization in situ hybridization was performed as described previously with minor modifications [ 25 ]. Six paraffin blocks were selected randomly and placed into a refrigerator at -20℃ for at least 30 minutes. Then, the blocks were cut into 4-7-µm-thick serial sections. After being dewaxed and dehydrated, each section was incubated in 50 µl hybridization buffer containing 10 µM oligonucleotide probe at 95℃ for 5 minutes and 37–40℃ for 12 hours, washed three times with 5×, 1 × and 0.2 × saline sodium citrate, and treated with blocking buffer at 37℃ for 15 minutes. Then, the blocking buffer was blotted with paper. Each section was then incubated in 30 µl biotinylated anti-digoxin antibody (1:50) at 37℃ for 1 hour, washed four times with 0.5 M PBS, incubated in streptavidin-biotin-peroxidase complex at 37℃ for 30 minutes, and rinsed four times in 0.5 M PBS. Subsequently, the sections were developed in 3, 3, diaminobenzidine, counterstained with hematoxylin, dehydrated in alcohol, permeabilized in xylene, mounted with proof quench mounting agent, and photographed with a fluorescence microscope [ 26 ]. The upper, middle, lower, left and right visual fields were randomly selected for each section and the image-pro Plus 6.0 software was used to detect the integrated optical density (IOD) of positive cells, the average value was used for statistical analysis. The negative control was incubated in 0.01M PBS without primary antibody. The primers employed are shown in Table 2 . Table 2 Primer sequences for Hybridization in situ Gene Full name Sequences (5–3′) 11β-HSD1 CRF MR 11 beta- hydroxysteroid dehydrogenase type 1 corticotropin-releasing factor mineralocorticoid receptor CAGAUGCCAGGUUUGUGCUCAAGUAAAUCCAAAAUGGAUAGCCUUACUCA CAAUACAAAUAACGCUGUUUUGUUACUACAAAGAAACACACUUUGUGCA GGAUGGAGAGGAUAGCAAUCCCGGCAGUCGCCCUACUGACGGUGGG GR glucocorticoid receptor UGCUUGUGGAGCCUUUCGAGAAAUCAAGGAGAAUCCUCUGCUGCUU Statistical analyses All data are presented as the mean ± SD. Data were analyzed by one-way analysis of variance followed by a post hoc Student-Newman-Keuls (SNK) test using SPSS 19.0 software (SPSS, Chicago, IL, USA). A value of P < 0.05 was considered statistically significant. Results The level of CORT, ACTH and CRH in serum by ELISA Compared with the normal group, the level of CORT, ACTH and CRH in serum of rats in the model group was significantly decreased (P < 0.01). After treatment, except for the CBX group, the serum level of CORT and ACTH in the other two groups were significantly increased compared with those in the model group (P < 0.05 or 0.01). And the serum levels of CRH were significantly increased compared with that in the model group (P < 0.05 or 0.01). Compared with the CBX group, the serum level of CORT and CRH in the moxibustion group was significantly higher (P < 0.01), and the serum level of ACTH in the moxibustion and moxi + CBX group were significantly higher (P < 0.01or 0.05). Compared with the moxibustion group, the serum level of CORT, ACTH and CRH in the moxi + CBX group was significantly lower (P < 0.01 or 0.05). As shown in Fig. 1 . The mRNA expression of MR, GR, 11β-HSD1, CRH and ACTH by qRT-PCR Compared with the normal group, the mRNA expressions of MR and GR in the amygdala of rats in the model group were both significantly decreased (P < 0.01). After treatment, except for the CBX and moxi + CBX group, the mRNA expressions of MR and GR in the amygdala of rats in the moxibustion group were significantly higher than those in the model group (P > 0.01). Except for GR, the mRNA expressions of MR and GR in the amygdala were not significantly different among CBX, moxibustion and moxi + CBX group (P > 0.05). As shown in Fig. 2 A. Compared with the normal group, the mRNA expressions of 11β-HSD1 and CRH in the amygdala of rats in the model group were both significantly decreased(P < 0.01). After treatment, except for CBX group and CRH in the CBX group, the mRNA expressions of CRH in the amygdala of rats in the moxibustion group and moxi + CBX group were significantly higher than those in the model group (P < 0.01 or 0.05). Compared with CBX, the mRNA expressions of 11β-HSD1 and CRH in the amygdala of rats in the moxibustion group were significantly increased (P 0.05). As shown in Fig. 2 B. Compared with the normal group, the mRNA expressions of 11β-HSD1 and CRH in the hypothalamus of rats in the model group were both significantly decreased(P < 0.01). After treatment, except for 11β-HSD1 in the CBX and moxi + CBX group, the mRNA expressions of 11β-HSD1 and CRH in the hypothalamus of rats in the CBX, moxibustion and moxi + CBX group were significantly higher than those in the model group (P < 0.01 or 0.05). Compared with the CBX group, except for CRH in the moxi + CBX group, the mRNA expressions of 11β-HSD1 and CRH in the hypothalamus of rats in the moxibustion and moxi + CBX group were both significantly increased (P 0.05). As shown in Fig. 2 C. Compared with the normal group, the ACTH mRNA expression in the pituitary of rats in the model group was significantly decreased (P < 0.01). After treatment, except for the CBX group, the ACTH mRNA expressions in the pituitary of rats in the moxibustion and moxi + CBX group were significantly higher than that in the model group (P < 0.01 or 0.05). Compared with the CBX, the ACTH mRNA expressions in the moxibustion group was significantly higher(P 0.05). As shown in Fig. 2 D. The protein expression of MR, GR and 11β-HSD1 by Western blotting Compared with the normal group, the protein expressions of MR, GR and 11β-HSD1 in the amygdala of rats in the model group were all decreased to different degrees (P < 0.05 or 0.01). After moxibustion treatment, the protein expression of MR, GR and 11β-HSD1 in the amygdala of rats were increased to different degrees compared with those in the model group (P 0.05).As shown in Fig. 3 A and B. Compared with the normal group, the 11β-HSD1protein expression in the hypothalamus of rats in the model group was significantly decreased (P < 0.01). After treatment, the 11β-HSD1 protein expression in the hypothalamus of rats were significantly increased compared with that in the model group (P 0.05). As shown in Fig. 3 C and D. mRNA expressions of MR, GR, 11β-HSD1 and CRF in amygdala, and 11β-HSD1 and CRF in hypothalamus by in situ hybridization In situ hybridization-positive cells contained brown spots or particles, as indicated by the arrows. In the normal group, a large number of mRNA expressions of MR, GR, 11β-HSD1 and CRF in amygdala, and 11β-HSD1 and CRF in hypothalamus were observed (Fig. 4 , 5 , 6 ). After modeling induced by hydrocortisone injection, rare mRNA expressions of MR, GR, 11β-HSD1 and CRF in amygdala, and 11β-HSD1 and CRF in hypothalamus were observed, and the integral optical density (IOD) values of mRNA expressions of MR, GR, 11β-HSD1 and CRF in amygdala, and 11β-HSD1 and CRF in hypothalamus of rats in the model group were significantly decreased (P < 0.01) compared with those in the normal group (Fig. 4 , 5 , 6 and Fig. 7 ). Treatment with moxibustion could increase the mRNA expressions of MR, GR, 11β-HSD1 and CRF, and the IOD values of their positive cells in the amygdala of rats in the moxibustion group were significantly higher than those in the model group and in the CBX group (P < 0.01 or 0.05) (Fig. 4 , 5 and Fig. 7 A, 7 B). As for MR mRNA expressions, the IOD values of its positive cells in the moxibustion group was significantly higher than that in the moxi + CBX group (P < 0.05) (Fig. 4 and Fig. 7 A). As for 11β-HSD1 mRNA expression,the IOD values of its positive cells in the moxi + CBX group was higher than that in the CBX group (P < 0.05). And as for CRF mRNA expression༌the IOD values of its positive cells in the moxi + CBX group was higher than that in the model group (Fig. 5 and Fig. 7 B). Treatment with moxibustion could increase the mRNA expressions of 11β-HSD1, and the IOD values of its positive cells in the hypothalamus of rats in the moxibustion group and in the moxi + CBX group were significantly higher than those in the CBX group (P 0.05). Treatment with moxibustion could increase the mRNA expressions of CRF, and the IOD values of its positive cells in the hypothalamus of rats in the moxibustion group and in the moxi + CBX group were significantly higher than those in the model group (P 0.05) (Fig. 6 and Fig. 7 C). Discussion Corticotropin releasing hormone (CRH) is one of the primary regulator of the hypothalamus - pituitary - adrenal (HPA) axis [ 4 ]. CRH, released from a central bump in the hypothalamus, is transported to the anterior pituitary via portal vein system, and stimulates the secretion of adrenocorticotropic hormone (ACTH), then ACTH stimulate adrenal cortical synthesis to secret glucocorticoid (GC) [ 4 ]. GC can also inhibit the generation of ACTH and CRH by feedback, thus forming the feedback regulating loop of HPA axis [ 27 , 28 ]. In addition, the amygdala can also synthesized and secreted CRH, then directly activate the HPA axis and be regulated by the feedback of CRH and GC [ 29 – 32 ]. The feedback regulation of GC to the amygdala and the hypothalamus may be related to the combination of GC with GR and (or) with MR. When the level of GC was within the basis range, GC almost completely binds to MR, and only when GC’s concentration higher than the basis level will bind to GR [ 33 ]. When GC combines with GR in the amygdala, it gives feedback information to the neurons in small cell group of paraventricular nucleus of hypothalamus, thus reducing the secretion of CRH. Through top-down regulation, the activity of HPA axis is further inhibited, so as to reduce the excessive GC level in the body, thus maintaining the hormone level homeostasis of the body [ 32 ]. Before GC binds to GR and MR, its activity and concentration are affected by the regulator 11β-HSD1, which converts inactive 11-dehydrocorticosterone / cortisone into active corticosterone / cortisol [ 34 ]. When a large amount of exogenous corticosteroids are used in the body for a long time, GC leads to excessive activation of GR, which eventually leads to the damage of nerve cells in the upper regulatory center, such as hippocampus and amygdala, and the HPA axis function is inhibited by the feedback. When the use of exogenous corticosteroids is stopped, the inhibition of HPA axis is exposed. The stress and adaptability of the body to the changes of the external environment significantly decrease, and a series of yang deficiency manifestations of deficiency and cold appear [ 35 , 36 ]. Just as the treatment for some autoimmune diseases requires long-term use of a large number of hormones, when the disease improves, the patient develops hormone-dependent symptoms, showing the symptoms of yang deficiency of traditional Chinese medicine [ 37 , 38 ]. The most commonly used rat model of corticosterone kidney-yang deficiency was prepared according to this pathological factor. In this study, after modeling the rats took on a series of deficiency manifestations such as withered clothing hair, decreases in body weight, slowed reaction, aversion cold, weakness, tendency to cluster, and decreased activity. In this study, detected by PCR, WB and in situ hybridization, we found that there was a lower expression of MR, GR, 11β-HSD1, CRH or CRF in the amygdala of rats in the model group than those in the normal group. And the expression of 11β-HSD1, CRH or CRF in the hypothalamus of rats in the model group has the same tendency as those in the amygdala. Compared with the normal group, the level of CORT, ACTH and CRH in serum, the mRNA expression of ACTH in pituitary in the model group rats were significantly decreased, which was the same as the results in our previous study [ 18 ]. 11β-HSD has two isoenzymes, i.e. 11β-HSD1 and 11β-HSD2. 11β-HSD1 is a primary reductase that converts inactive 11-dehydrocorticosterone/cortisone into active corticosterone / cortisol. But the action of 11β-HSD2 is opposite to that of 11β-HSD1 [ 10 ]. When the concentration or activity of GC is high in vivo, 11β-HSD2 outweighs 11β-HSD1 in the role of conversion, in contrast, when GC low, 11β-HSD1 outweighs 11β-HSD2. Together, they assist MR and GR to maintain the relative stability of hormone levels. CBX can inhibit both 11β-HSD1 and 11β-HSD2 [ 11 ]. After modeling in this study, GC was always at a low level in rats, 11β-HSD1 was activated and played an important role, and MR was also activated and combined with GC. Therefore, as the results of this study showed, the mRNA expression of MR in the amygdala was about three times that of GR. As a blocking agent, CBX mainly inhibits 11β-HSD1, so in this study 11β-HSD1 was selected as the observation index instead of 11β-HSD2. In this study, the expression of 11β-HSD1 in the amygdala and hypothalamus of rats in the CBX group was lower than that in the model group. Due to the effect of 11β- HSD1 was blocked by CBX, the concentration or activity of GC is lower in the CBX group, thus causing increased expression of MR in the amygdala by feedback regulation. Just as the experiment results showing that the MR expression of amygdala in rats in the CBX group is higher than that in the model group, correspondingly, CRF expession in the amygdala and hypothalamus, CRH expression in hypothalamus and ACTH expression in the pituitary of rats in the CBX group are higher than those in the model group, and the levels of CORT, ACTH and CRH in serum of rats in the CBX group is higher than that in the model group. Literature research found that there was no similar studies have been reported, but there were still some experiments that use the expressions of CRH, MR, GR, etc. in the amygdala and hypothalamus as observation indicators to study the effect of GC on the body. For example, when pregnant Wistar rats were injected with CBX (12.5 mg s.c.) daily throughout pregnancy, Welberg, et al. [ 39 ] found that CBX treatment reduced birth weight, and adult offspring of CBX-treated dams had persistently reduced body weight, showed less grooming and rearing,and reduced immobility in a forced swim test. In addition, they found that these animals had increased basal CORT levels, increased CRH and reduced GR mRNA in the hypothalamus, increased GR mRNA expression in the amygdala, with unaltered MR mRNA. The effect of CBX on the expression of CRH, MR and GR in the offspring amygdala and hypothalamus of pregnant rats was inconsistent with the results of this study. The reason mainly maybe that the observing subjects or animal models were different in the two experiments. For the treatment of kidney-yang deficiency syndrome, the introduction to medicine ,a classic work of traditional Chinese medicine, has the theory that moxibustion treating the deficiency syndrome, so as to help restoring the yuan yang ; moxibustion treating the cold syndrome, so as to help re-warming the qi . Moxibustion is a traditional Chinese medical therapy using the burning of dried mugwort (moxa) and is widely used in China for the treatment of various diseases and symptoms of “deficient conditions” (weakness) [ 40 ]. Suspended moxibustion is an indirect form of moxibustion in which the moxa-stick is placed on an acupoint without skin contact to stimulate circulation by warming the acupoints and inducing smoother flow of blood and qi , to improve health and facilitate recovery from disease [ 40 ]. In our previous study, moxibustion on shenshu and guanyuan points could positively regulate the dysfunction of pituitary-adrenal and pituitary-thyroid axis in rats with kidney-yang deficiency syndrome [ 18 ]. In this study, compared with the model group, the mRNA and protein expressions of MR, GR and 11β-HSD1 in the amygdala of rats were significantly up-regulated after the treatment on shenshu and guanyuan point with suspended moxibustion. After moxibustion, the mRNA expressions of 11β-HSD1 and CRF(or CRH) in the hypothalamus, ACTH in the pituitary and the level of CRH, ACTH and CORT in serum of rats were all significantly increased compared with those in the model group. According to the theory of tradition Chinese medicine, shenshu is mainly used to repair yang , guanyuan is mainly used to repair qi , and the two acupoints are in harmony with each other, so as to cultivate yuan qi , and to improve the function of tonifying kidney and warming yang [ 41 ]. One possible reason is that, according to the theory from the Golden mirror of medicine (YiZong Jin Jian) , another classic work of traditional Chinese medicine, shenshu point belongs to the bladder meridian , which is the back shu point of the kidney༌and guanyuan point belonging to ren meridian , is the small intestine collection point , and is the commonly used point for the treatment of all kinds of deficiency. Another reason may be that, according to modern neuroanatomical theory, Shenshu point, innervated by the 1st ~ 3rd lumbar ganglion segment, was related with genitalia by ilioinguinal nerve and genital nerve of lumbar plexus, and was closely related to the kidney, adrenal gland, internal genitalia, etc. through the traffic branch of the lumbar sympathetic trunk and the lumbar visceral nerve [ 18 ]. And guanyuan point is connected to the liver, spleen, kidney and other substantial organs through the twelfth thoracic nerve and related small visceral nerves. Zhou et al. [ 42 ] using HRP nerve tract tracking technology, found that the afferent projection of guanyuan and uterus had convergence and overlap in the spinal ganglia between lumbar 3 and sacral 5. In this study, treatment with suspended moxibustion on shenshu and guanyuan has not only a strong theoretical basis, but also a wide range of experimental basis. For example, Zhao et al. [ 43 ] found that the symptoms of kidney-yang deficiency were improved after a period of mild moxibustion treatment on guanyuan and shenshu point in elderly patients. Ren et al. [ 41 ] found that the treatment of moxibustion on shenshu and guanyuan could significantly improved the inhibitory state of the HPA axis in rats with kidney-yang deficiency, and the therapeutic effect of combination of shenshu and guanyuan was significantly better than that of combination of shenshu and zusanli or combination of zusanli and guanyuan . This was one of the reasons that shenshu and guanyuan were selected in this study. Conclusion In this study, we demonstrated that suspended moxibustion can effectively improve the serum levels of ACTH, CRH and CORT, and can up-regulate the mRNA and protein expression of MR, GR, 11β-HSD1, CRF and ACTH in amygdala and hypothalamus of kidney-yang deficiency rats. Considering the experimental model of kidney-yang deficiency syndrome used in this study shares several pathologic similarities to human, then MR, GR and 11β-HSD 1 could represent a novel therapeutic target in the treatment of kidney-yang deficiency syndrome. List Of Abbreviations 11β-HSD1 11 beta-hydroxysteroid dehydrogenase type 1 ACTH adrenocorticotropic hormone CBX carbenoxolone CORT corticosterone CRF corticotropin releasing factor CRH corticotropin releasing hormone ELISA enzyme linked immunosorbent assay GAPDH glyceraldehyde 3-phosphate dehydrogenase GC glucocorticoid GR glucocorticoid receptor HPA axis hypothalamus - pituitary - adrenal axis MR mineralocorticoid receptor PBS phosphate buffered solution RT-qPCR Reverse transcription real-time quantitative polymerase chain reaction SD Sprague Dawley SNK Student–Newman–Keuls Declarations Ethical approval All procedures were conducted in accordance with guidelines reviewed and approved by the Institutional Animal Care and Use Committee of Jiangxi University of Traditional Chinese Medicine, China. Availability of data and materials The datasets analyzed during the current study are available from the corresponding author on reasonable request. Disclosure of interest The authors have no conflicts of interest to declare. We confirm that this article is the authors’ original work and has not been published elsewhere nor is it currently under consideration for publication elsewhere. Funding This work was supported by the National Natural Science Foundation of China (No. 81660817). Authors’ contributions YJM conceived and designed the study and KTL revised the paper. WGY and HHY wrote the paper, provided data and revised the paper. JS, ZY, HQW, LHC participated the experiment. All authors approved the final version of the paper. Acknowledgment Not applicable References Yang Q. Central control of the hypothalamic-pituitary-adrenocortical axis for stress response [J]. Advances in Physiological Science, 2000, 31(3):222-226. Li LA, Yang XJ, Du GM, Jin TM, Xu J. The central regulatory mechanism of HPA axis for stress response [J]. Chinese journal of veterinary medicine, 2010, 46 (6):65-67. Thompson BL, Erickson K, Schulkin J, Rosen JB．Corticosterone facilitates retention of contextually conditioned fear and increases CRH mRNA expression in the amygdala [J]. Behav Brain Res，2004，149(2): 209-213． Makino S，Hasmoto K，Gold PW．Multiple feedback mechanisms activating corticotrophin-releasing hormone system in the brain during stress [J]. Pharmocol Biochem Bebav，2002，73(1):147-152． Oitzl MS，Champagne DL，Van Der Veen R， Ronald de Kloet E. Brain development under stress：hypotheses of glucocorticoid actions revisited [J]. Neurosci Biobehav Rev，2010，34（6）：853-866. He WB，Zhang JL, Chen NH. Analysis of relationship between brain and kidney of TCM based on negative feedback regulation in the hippocampus-HPA axis [J]. China Journal of Traditional Chinese Medicine and Pharmacy, 2016，31(9):3426-3428. De Kloet ER, Vreugdenhil E, Oitzl MS, Joëls M. Brain corticosteroid receptor balance in health and disease [J]. Endocr Rev, 1998, 19(3):269-301. Harris HJ, Kotelevtsev Y, Mullins JJ, Seckl JR, Holmes MC. Intracellular regeneration of glucocorticoids by 11β-hydroxysteroid (11β-HSD)-1 plays a key role in regulation hypothalamic-pituitary-adrenal axis: analysis of 11 beat-HSD-1 deficient mice. Endocrinology, 2001,142(1):114-120. Li XR, Zhong LY. 11β-HSD1 is involved in neuroendocrine regulation of the hippocampus and hypothalamic-pituitary-adrenal axis [J]. J southeast Univ (MedSci Edi)，2009，8(4)：358-360. Mattsson C, Lai M, Noble J, Mckinney E, Yau JL, Seckl JR, Walker BR. Obese Zucker rats have reduced mineralocorticoid receptor and 11 beta-hydroxysteroid dehydrogenase type1 expression in the hippocampus：implications for dysregulation of the hypothalamic-pituitary-adrenal axis in obesity [J]．Endocrinology，2003，144(7)：2997-3003． Zeng YB, Liu YM. Expression of connexin 32 in brain tissue of epileptic rats and the effect of carbenoxolone on it [J]. J Clin Neurol，2013，26(2) ：115-117. Yau JL, Noble J, Kenyon CJ, Hibberd C, Kotelevtsev Y, Mullins JJ, Seckl JR. Lack of tissue glucocorticoid reactivation in 11β-hydroxysteriod dehydrogenase type 1 knockout mice ameliorates age-related learning impairments [J]．Proc Nat1 Acad Sci USA，2001，98(8)：4716-4721． Shen ZY. Study on localization of kidney-yang deficiency syndrome [J]. Chinese journal of integrated traditional and western medicine, 1997, 17(1)：50-52. Ye R, Zhang AX, Jiang RR, Chen H, Zhou LN, Xu LF, Cai QM. Clinical study of moxibustion in the treatment of female sexual dysfunction with kidney-yang deficiency [J]. Shizhen guoyi guoyao, 2014, 25 (11) : 2700-2702. Zhu W. Moxibustion with ginger to treat 55 cases of low sperm motility of kidney-yang deficiency [J]. Beijing traditional Chinese medicine, 2000, 19(2):48-49. Wang Y, Xu JH, Hu ZH, Wang SS, Xiong ZM, Bai ZJ, Gu L. Observations on the therapeutic effect of du meridian moxibustion on polycystic ovarian syndrome of spleen-kidney yang deficiency type [J]. Shanghai J Acu-mox, 2015, 34(1): 35-37. Wen Y, Ren AL, Deng LW. Discussion on auricular acupuncture point combined with warm box moxibustion in the treatment of ovulation disorders with kidney-yang deficiency [J]. Hunan Journal of Traditional Chinese Medicine, 2013，29(2)：72-73. Min YJ, Yao HH, Cheng LH. The effect of suspended moxa stick moxibustion on points shenshu (BL23) and guanyuan (CV4) on the pituitary-adrenal axis and the pituitary-thyroid axis in rats with kidney-yang deficiency [J]. Shanghai J Acu-mox, 2016，35（12）：1469-1452. Min YJ, Yan ZG, Yang HY, Yang XM, Guo CX. Qualitative and quantitative experiment study on influential factors of acupuncture efficacy [J]. Liaoning Journal of Traditional Chinese Medicine，2008，35(12)：1923-1927. Zhang Y, Xu SY, Liu MN, Jia TY, Qu WJ, Han T, Jia Z, Xu XF, Li XR. Comparative studies on chemical contents and effect in kidney-yang deficiency rats of salt-processed product and wine-processed product of cuscutae semen [J]. Evidence-Based Complementary and Alternative Medicine, 2019, doi: 10.1155/2019/2049497. Lin WZ, Wang P. Experimental acupuncture [M]. China: Shanghai science and technology press, 1999, (9) : 288-289. Hong ES, Yao HH, Min YJ, Sun J, Zhou X, Zeng XB, Yu W. The mechanism of electroacupuncture for treating spinal cord injury rats by mediating Rho/Rho-associated kinase signaling pathway [J]. JSCM, DOI:10.1080/10790268. 2019.1665612 Min YJ, Deng L, Hong ES. Orthogonal study on different acupuncture factors based on hypothalamic- pituitary-adrenal axis in rats with kindey-yang deficiency [J]. Shanghai J Acu-mox，2016，35（3）：355-359. Min YJ, Dingli LQ, Cheng LH, Xiao WP, He XW, Zhang H, Min ZY, Pei J. Effect of electroacupuncture on the mRNA and protein expression of Rho-A and Rho-associated kinase II in spinal cord injury rats [J]. Neural Regen Res, 2017, 12(2): 276-282. doi: 10.4103/1673-5374.200811. Xiao WP, Ding Li LQ, Min YJ, Yang HY, Yao HH, Sun J, Zhou X, Zeng XB, Yu W. Electroacupuncture promoting axonal regeneration in spinal cord Injury rats via suppression of Nogo/ NgR and Rho/ROCK signaling pathway [J]. Neuropsychiatric Disease and Treatment，2019:15 3429–3442. Zhang L, Ni YQ, Li YF. Ligustrazine facilitates hair cell regeneration in the cochlea following gentamicin ototoxicity [J]. Neural Regen Res, 2010, 5 (5): 735-740. Azuma K, Zhou Q, Niwa M，Kubo KY. Association between mastication, the hippocampus, and the HPA Axis: A comprehensive review [J]. Int J Mol Sci，2017, 18(8): 1687. Herman JP, Mcklveen JM, Ghosal S, Kopp B, Wulsin A, Makinson R, Scheimann J, Myers B. Regulation of the hypothalamic-pituitary-adrenocortical stress response [J]. Compr Physiol，2016，6(2):603-621. Kolber BJ, Roberts MS, Howell MP, Wozniak DF, Sands MS, Muglia LJ. Central amygdala glucocorticoid receptor action promotes fear associated CRH activation and conditioning [J]. Proc Natl Acad Sci, 2008, 105(33):12004-12009. Silverman MN，Sternberg EM. Glucocorticoid regulation of inflammation and its functional correlates: from HPA axis to glucocorticoid receptor dysfunction [J]. Ann NYAcad Sci，2012，12(61): 55-63. Anacker C, Zunszain PA，Carvalho LA，Pariante CM. The glucocorticoid receptor: pivot of depression and of antidepressant treatment [J]. Psychoneuroendocrinology，2011，36(3): 415-425. Yang SJ，Yu HY，Kang DY，Ma ZQ, Qu R, Ma SP. Antidepressant-like effects of salidroside on olfactory bulbectomy-induced pro-inflammatory cytokine production and hyperactivity of HPA axis in rats [J]. Pharmacol Biochem Behav，2014，124:451-457. Iudicibus SD, Franca R, Martelossi S, Ventura A, Decorti G. Molecular mechanism of glucocorticoid resistance in inflammatory bowel disease [J]. World Journal of Gastroenterology, 2011, 17(9): 1095-1108. Seckl JR，Walker BR．Minireview：11β-hydroxysteroid dehydrogenase type1：a tissue-specific amplifier of glucocorticoid action [J]. Endocrinology，2001, 142 (4)：1371-1376． Chen XY. Animal modeling of practical TCM syndromes [M]. China: Beijing medical university, China union medical university joint press, 1993:100-117. Chen Q. Methodology of pharmacology research of traditional Chinese medicine [M]. China: The people's medical publishing house, 1993:982-1001. Wu PY, Yu ZY. Yougui wan in the treatment of 30 cases of spleen-kidney yang deficiency syndrome caused by hormone withdrawal in patients with nephrotic syndrome [J]. Jiangxi Journal of Traditional Chinese Medicine, 2010, 41 (7):43-44. Kou WW, Zhang MF. Clinical observation of wenshentianjing pill in the treatment of 100 cases of hormone-dependent nephropathy with kidney-yang deficiency [J]. China disability medicine, 2014,22(10):131-132. Welberg LA, Seckl JR, Holmes MC. Inhibition of 11beta-hydroxysteroid dehydrogenase, the foeto-placental barrier to maternal glucocorticoids, permanently programs amygdala GR mRNA expression and anxiety-like behaviour in the offspring [J]. Eur J Neurosci, 2000, 12(3):1047-54. Xiao AJ, He L, Ouyang X, Liu JM, Chen MR. Comparison of the anti-apoptotic effects of 15- and 35-minute suspended moxibustion after focal cerebral ischemia / reperfusion injury [J]. Neural Regen Res, 2018, 13(2):257-264. Ren DW, Pei JC. Randomized controlled study on effect of moxibustion of different acupoint groups on the hypothalamic-pituitary-adrenal axis in rat [J]. Journal of practical traditional Chinese internal medicine, 2014，28(5):80-81. Zhou JS, Jin ZG,Tao ZL. The segmental distribution of the primary sensory neuron of the acupoint guanyuan in the spinal ganglion [J]. Shanghai J Acu-mox，2001，20(3): 40-41. Zhao C，Shi Y，Cui YH，Wang XM，Ma XP，Wu BL，Wu LY，Liu HR. Effect of suspended moxibustion on the pRb expression of peripheral blood in the kidney-yang deficiency aged people [J]. Global Traditional Chinese Medicine，2012, 5(5):350-353. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-86968","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research","associatedPublications":[],"authors":[{"id":3063012,"identity":"3f73a114-788a-4703-a676-558c97a093c1","order_by":0,"name":"Wen-guo Ye","email":"","orcid":"","institution":"Jiangxi university of traditional Chinese medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Wen-guo","middleName":"","lastName":"Ye","suffix":""},{"id":3063013,"identity":"e0f0cf5b-712f-4cd9-9b91-2e0dffedad94","order_by":1,"name":"Hai-hua Yao","email":"","orcid":"","institution":"Shanghai eighth people's hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Hai-hua","middleName":"","lastName":"Yao","suffix":""},{"id":3063014,"identity":"627805d5-872f-4c14-8961-dc78a6c2ca26","order_by":2,"name":"You-jiang Min","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAvElEQVRIiWNgGAWjYHCCxAcJBjZybOzNB4jWkmzwoSLNmI/nWALRWtgkZ5w5nDhPIkeBOPW6MxIeSPO2Mae3MeQwMPyo2EZYi9mNhARj3ja23DaGswcYe87cJk5LMm8bT24bY18CM2MbkVoO87ZJpLMx8xgQrSWxccYZgwQ2NqK1nHmQzPChIsGwjYct4SBxfjmek/4jweC/vPz8xwcf/KggQguDQE4CnH2ACPVAwH+cSIWjYBSMglEwcgEAEA8/cBDvftcAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0002-4258-5196","institution":"Shanghai eighth people's hospital","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"You-jiang","middleName":"","lastName":"Min","suffix":""},{"id":3063015,"identity":"8e26cd2d-bc29-4bca-85a5-08208ae490bb","order_by":3,"name":"Kai-tao Luo","email":"","orcid":"","institution":"Jiaxing hospital of traditional Chinese medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Kai-tao","middleName":"","lastName":"Luo","suffix":""},{"id":3063016,"identity":"1f8356f0-e7e1-4ad1-b0cd-448048feac65","order_by":4,"name":"Jie Sun","email":"","orcid":"","institution":"Jiangxi university of traditional Chinese medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jie","middleName":"","lastName":"Sun","suffix":""},{"id":3063017,"identity":"22a4075c-da7d-4fcf-859d-34e646e7ec8c","order_by":5,"name":"Zheng Yuan","email":"","orcid":"","institution":"Shanghai eighth people's hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Zheng","middleName":"","lastName":"Yuan","suffix":""},{"id":3063018,"identity":"103e3366-57d3-4804-ae70-0780149f8f8d","order_by":6,"name":"Hui-qi Wu","email":"","orcid":"","institution":"Jiangxi university of traditional Chinese medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Hui-qi","middleName":"","lastName":"Wu","suffix":""},{"id":3063019,"identity":"09865da2-f51a-4b24-8976-bdf835ecc745","order_by":7,"name":"Li-hong Cheng","email":"","orcid":"","institution":"Jiangxi university of traditional Chinese medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Li-hong","middleName":"","lastName":"Cheng","suffix":""}],"badges":[],"createdAt":"2020-10-02 13:12:35","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-86968/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-86968/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":2871994,"identity":"04d7988c-0e0f-4bfb-b035-0cc37a639303","added_by":"auto","created_at":"2020-10-08 22:26:51","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":205696,"visible":true,"origin":"","legend":"Comparison of the level of CORT, ACTH and CRH in serum. Compiled results in a bar graph for the level (A) of CORT, (B) of ACTH, (C) of CRH. ①P \u003c 0.01, ②P \u003c 0.05 versus norm； ③P \u003c 0.01, ④P \u003c 0.05 versus model；⑤P \u003c 0.01, ⑥P \u003c 0.05 versus CBX；⑦P \u003c 0.01, ⑧P \u003c 0.05 versus moxi. Data are shown as the mean ± standard error of the mean (1-way analysis of variance and Student-Newman-Keuls post hoc test, n = 6 rats/group). norm: normal group; model: model group; CBX: carbenoxolone intraperitoneal injection group; moxi: moxibustion group; moxi + CBX: moxibustion plus carbenoxolone intraperitoneal injection group. CORT: corticosterone; ACTH: adrenocorticotrophic hormone; CRH: corticotropin-releasing hormone.","description":"","filename":"Onlinefig1.CORTACTHCRHinserum.Png","url":"https://assets-eu.researchsquare.com/files/rs-86968/v1/25bab1320ebd60e37e84a720.Png"},{"id":2871995,"identity":"e75535e3-5d67-45a2-93d6-31c7b4fda6db","added_by":"auto","created_at":"2020-10-08 22:26:51","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":316581,"visible":true,"origin":"","legend":"Comparison of the relative mRNA expressions of MR, GR, 11β-HSD1, CRH and ACTH. Compiled results in a bar graph for the relative mRNA expression (A) of MR and GR / GAPDH in amygdala, (B) of 11β-HSD1 and CRH / GAPDH in amygdala, (C) of 11β-HSD1 and CRH / GAPDH in hypothalamus, (D) of ACTH / GAPDH in pituitary. ①P \u003c 0.01, ②P \u003c 0.05 versus norm；③P \u003c 0.01, ④P \u003c 0.05 versus model；⑤P \u003c 0.01, ⑥P \u003c 0.05 versus CBX；⑦P \u003c 0.01, ⑧P \u003c 0.05 versus moxi. Data are shown as the mean±standard error of the mean (1-way analysis of variance and Student-Newman-Keuls post hoc test, n = 6 rats/group). norm: normal group; model: model group; CBX: carbenoxolone intraperitoneal injection group; moxi: moxibustion group; moxi + CBX: moxibustion plus carbenoxolone intraperitoneal injection group. MR: mineralocorticoid receptor; GR: glucocorticoid receptor; 11β-HSD1: 11 beta-hydroxysteroid dehydrogenase type 1; CRH: corticotropin-releasing hormone; ACTH: adrenocorticotrophic hormone; GAPDH: glyceraldehyde-3- phosphate dehydrogenase.","description":"","filename":"Onlinefig.2MRGRHSDACTHCRHmRNA.Png","url":"https://assets-eu.researchsquare.com/files/rs-86968/v1/b5de9b810ecd4022a61b3957.Png"},{"id":2871996,"identity":"cdcf9dbf-1c7a-4d9b-8ef4-79de2d24b6f5","added_by":"auto","created_at":"2020-10-08 22:26:52","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":305960,"visible":true,"origin":"","legend":"MR, GR and 11β-HSD1 activation in the amygdala and hypothalamus following treatment. (A) Western blotting bands for MR, GR, 11β-HSD1 and GAPDH expression in the amygdala. (B) Compiled results in a bar graph for the ratio of MR, GR and 11β-HSD1 / GAPDH expression. (C) Western blotting bands for 11β-HSD1 and GAPDH expression in hypothalamus. (D) Compiled results in a bar graph for the ratio of 11β-HSD1 / GAPDH expression. ①P \u003c 0.01, ②P \u003c 0.05 versus norm；③P \u003c 0.01, ④P \u003c 0.05 versus model. Data are shown as the mean±standard error of the mean (1-way analysis of variance and Student-Newman-Keuls post hoc test, n = 4 rats/group). norm: normal group; model: model group; CBX: carbenoxolone intraperitoneal injection group; moxi: moxibustion group; moxi + CBX: moxibustion plus carbenoxolone intraperitoneal injection group. MR: mineralocorticoid receptor; GR: glucocorticoid receptor; 11β-HSD1: 11 beta-hydroxysteroid dehydrogenase type 1; GAPDH: glyceraldehyde-3-phosphate dehydrogenase.","description":"","filename":"Onlinefig.3MRGRHSDprotein.Png","url":"https://assets-eu.researchsquare.com/files/rs-86968/v1/d6fc2f86bef0b00ea4f109b9.Png"},{"id":2871997,"identity":"0854407b-7627-4f37-93a3-029aeb3b891f","added_by":"auto","created_at":"2020-10-08 22:26:52","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1338014,"visible":true,"origin":"","legend":"mRNA expression of MR and GR in the amygdala following treatment (in situ hybridization, × 200). Bar = 50 µm. norm: normal group; model: model group; CBX: carbenoxolone intraperitoneal injection group; moxi: moxibustion group; moxi + CBX: moxibustion plus carbenoxolone intraperitoneal injection group. MR: mineralocorticoid receptor; GR: glucocorticoid receptor.","description":"","filename":"Onlinefig4.MRGRmRNAinsitu.Png","url":"https://assets-eu.researchsquare.com/files/rs-86968/v1/7144ae632a9312f54875262b.Png"},{"id":2871998,"identity":"2e8724e3-9665-48da-906e-ec949915a2d4","added_by":"auto","created_at":"2020-10-08 22:26:52","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1230658,"visible":true,"origin":"","legend":"mRNA expression of 11β-HSD1 and CRF in the amygdala following treatment (in situ hybridization, × 200). Bar = 50 µm. norm: normal group; model: model group; CBX: carbenoxolone intraperitoneal injection group; moxi: moxibustion group; moxi + CBX: moxibustion plus carbenoxolone intraperitoneal injection group. 11β-HSD1: 11 beta- hydroxysteroid dehydrogenase type 1; CRF: corticotropin releasing factor.","description":"","filename":"Onlinefig5.HSDCRFmRNAinsituamyglada.Png","url":"https://assets-eu.researchsquare.com/files/rs-86968/v1/99ac5110a12690a466721d6f.Png"},{"id":2871999,"identity":"fa4033d4-e6ee-4114-910a-ca0acb32724b","added_by":"auto","created_at":"2020-10-08 22:26:52","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1248123,"visible":true,"origin":"","legend":"mRNA expression of 11β-HSD1 and CRF in the hypothalamus following treatment (in situ hybridization, × 200). Bar = 50 µm. norm: normal group; model: model group; CBX: carbenoxolone intraperitoneal injection group; moxi: moxibustion group; moxi + CBX: moxibustion plus carbenoxolone intraperitoneal injection group. 11β-HSD1: 11 beta- hydroxysteroid dehydrogenase type 1; CRF: corticotropin releasing factor.","description":"","filename":"Onlinefig6.HSDCRFmRNAinsituhypothalamus.Png","url":"https://assets-eu.researchsquare.com/files/rs-86968/v1/bf04db2baf385c770070f799.Png"},{"id":2872000,"identity":"81e0d744-a531-493a-9dca-ca3e2cb598c8","added_by":"auto","created_at":"2020-10-08 22:26:53","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":262328,"visible":true,"origin":"","legend":"Compiled results in a bar graph for IOD values of MR, GR, 11β-HSD1 and CRF mRNA-positive cells. Compiled results in a bar graph for IOD values (A) of MR and GR in the amygdala, (B) of 11β-HSD1 and CRF in the amygdala, (C) of 11β-HSD1 and CRF in the hypothalamus. ①P \u003c 0.01, ②P \u003c 0.05 versus norm；③P \u003c 0.01, ④P \u003c 0.05 versus model；⑤P \u003c 0.01, ⑥P \u003c 0.05 versus CBX；⑦P \u003c 0.01, ⑧P \u003c 0.05 versus moxi. Data are shown as the mean±standard error of the mean (1-way analysis of variance and Student-Newman-Keuls post hoc test, n = 6 rats/group). norm: normal group; model: model group; CBX: carbenoxolone intraperitoneal injection group; moxi: moxibustion group; moxi + CBX: moxibustion plus carbenoxolone intraperitoneal injection group. MR: mineralocorticoid receptor; GR: glucocorticoid receptor; 11β-HSD1: 11 beta-hydroxysteroid dehydrogenase ","description":"","filename":"Onlinefig7.IODofMRGRHSD.Png","url":"https://assets-eu.researchsquare.com/files/rs-86968/v1/d8f17c7fdcf9117d577bc01e.Png"},{"id":13600860,"identity":"2e5703de-76e7-47da-8f43-106cdbd67d81","added_by":"auto","created_at":"2021-09-17 05:45:36","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4103971,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-86968/v1/b7ece3a0-5299-4af8-b612-31a1c5dcf2ba.pdf"}],"financialInterests":"","formattedTitle":"\u003cp\u003eEffects of Moxibustion on Amygdala -HPA Axis in Rats with Kidney-Yang Deficiency Syndrome Induced by Hydrocortisone Injection\u003c/p\u003e","fulltext":[{"header":"Background","content":" \u003cp\u003eHypothalamic-pituitary-adrenocortical axis (HPA axis), an important part of the neuroendocrine system, is involved in the control of stress reaction and the regulation of many physical activities, such as digestion, immune system, mood and emotion, sexual behavior, energy storage and consumption [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. The HPA axis is not only affected by the negative feedback of hormones secreted by each organ, but also affected by the upper regulating center, such as hippocampus and amygdala. Amygdala is a part of the limbic system, which is composed of the amygdala central nucleus, medial nucleus and cortical nucleus. Stimulation of these three nuclei in rats can induce corticosterone secretion, while damage to the amygdala can reduce the secretion of ACTH and corticosterone caused by fracture, and also reduce the secretion of ACTH after adrenalectomy [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Study has shown that the activation of CRH peptide in the central amygdala can positively respond to cortisol, leading to anxiety, fear and stimulate the stress system [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. In addition, the amygdala also contains high concentrations of CRF, CRH, CRH receptors, CRH binding proteins and corticosteroid receptors [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. This suggests that the amygdala may have the ability to synthesize and secrete CRH, which may directly activate the HPA axis and be regulated by the feedback of CRH and corticosteroid. Further studies suggest that CRH systems from hypothalamus and amygdala jointly constitute the neural circuits of stress responsiveness and anxiety generation in chronic stress [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eGlucocorticoid (GC) is the terminal product of the HPA axis, which plays a key role in the amygdala-HPA axis and stress response [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Mineralocorticoid receptor (MR) and glucocorticoid receptor (GR) participate in the regulation of the HPA axis through the combination with GC [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. The negative feedback regulating effect of GC on target tissue (including HPA axis) depends on the content of GR and MR in the upper regulating center and the concentration of GC in target tissue cells. Besides the influence of the concentration of GC in the plasma, the concentration of GC in the target tissue is mainly adjusted by the preglucocorticosteroid metabolase 11 beta-hydroxysteroid dehydrogenase (11β-HSD) [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. 11β-HSD is a microzyme complex, a metabolic rate-limiting enzyme of glucocorticoid, which catalyzes the REDOX reaction between the ketone group (inactive) and the hydroxyl group (active) at the position 11 of glucocorticoid [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. 11β-HSD1 is more expressed in hippocampus, amygdala, neocortical and cerebellum in adult rats, which is helpful to maintain the level of corticosterone in inner part and plays an important role in promoting the growth and maturation of tissues [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Carbenoxolone (CBX), a derivative of glycyrrhizae, is a non-selective inhibitor of 11β-HSD, which can inhibit both 11β-HSD1 and 11β-HSD2 [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. The inhibition of 11β-HSD1 by CBX was similar to that of 11β-HSD1 knockout mice [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003cem\u003eKidney-yang\u003c/em\u003e deficiency syndrome, one of the main syndromes in traditional Chinese medicine, is a type of deficiency-cold syndrome caused by deficiency and decline of \u003cem\u003ekidney-yang\u003c/em\u003e. Modern studies have confirmed that the low function of HPA axis is the main material basis of \u003cem\u003ekidney-Yang\u003c/em\u003e deficiency syndrome [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Literature research and clinical observation [\u003cspan additionalcitationids=\"CR15 CR16\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e] showed that moxibustion therapy in traditional Chinese medicine has a good effect on \u003cem\u003ekidney-Yang\u003c/em\u003e deficiency syndrome. Our previous studies have also shown that moxibustion on \u003cem\u003eshenshu\u003c/em\u003e and \u003cem\u003eguanyuan\u003c/em\u003e with moxa sticks can effectively improve the dysfunction of HPA axis [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Can moxibustion with moxa stick affect the expression of MR, GR, 11β-HSD1, CRH and ACTH in the amygdala-HPA axis to treat \u003cem\u003ekidney-yang\u003c/em\u003e deficiency syndrome? Therefore, its therapeutic mechanism is worthy of further study.\u003c/p\u003e "},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n\u003ch2\u003eExperimental animals\u003c/h2\u003e\n\u003cp\u003eSixty healthy, clean, male, Sprague Dawley (SD) rats aged 8 weeks (weighing 200\u0026thinsp;\u0026plusmn;\u0026thinsp;20\u0026nbsp;g) were purchased from the Experimental Animal Center of Jiangxi University of Traditional Chinese Medicine, of Jiangxi Province, China (certificate no. JZLLSC (jiangxi) 2018-0033). The rats were fed with standard fodder and with food and water freely available in a controlled environment with a constant temperature of 20\u0026thinsp;~\u0026thinsp;25℃ and a 12/12-hr light/dark cycle. All procedures were conducted in accordance with guidelines reviewed and approved by the Institutional Animal Care and Use Committee of Jiangxi University of Traditional Chinese Medicine, China.\u003c/p\u003e\n\u003c/div\u003e\n\u003ch2\u003eModeling\u003c/h2\u003e\n\u003cp\u003eSixty rats were randomly divided into the normal group (norm, n\u0026thinsp;=\u0026thinsp;12) and the model-building group (n\u0026thinsp;=\u0026thinsp;48). Referring to literature [\u003cspan class=\"CitationRef\"\u003e19\u003c/span\u003e] and making improvements, each rat in the model-building group was given intramuscular injection of hydrocortisone(\u003cem\u003eHuazhong\u003c/em\u003e pharmaceutical co., LTD., national drug approval no. H420201507) at a dose of 0.03\u0026nbsp;mg/g\u0026middot;bw in left and right hind limbs of the rat alternately, and the modeling was carried out continuously for 14 days. Each rat in the normal group was given an intramuscular injection of 0.9% normal saline at a dose of 0.03\u0026nbsp;mg/g\u0026middot;bw for 14 days. During this period, natural light and free eating and drinking will be adopted. Criteria for model success [20[: decreases in body weight, withered clothing hair, hunched back, aversion cold, tendency to cluster, slowed reaction, weakness, decreased activity, scrotal shrinkage, and significantly increased urine output.\u003c/p\u003e\n\u003ch2\u003eGrouping and treatment\u003c/h2\u003e\n\u003cp\u003eThe 48 rats successfully modeled were then randomly subdivided into model group (model, n\u0026thinsp;=\u0026thinsp;12), carbenoxolone intraperitoneal injection group (CBX, n\u0026thinsp;=\u0026thinsp;12), moxibustion group (moxi, n\u0026thinsp;=\u0026thinsp;12) and moxibustion\u0026thinsp;+\u0026thinsp;carbenoxolone intraperitoneal injection group (moxi\u0026thinsp;+\u0026thinsp;CBX, n\u0026thinsp;=\u0026thinsp;12).\u003c/p\u003e\n\u003cp\u003eIn the moxibustion treatment group, \u003cem\u003eguanyuan (CV4)\u003c/em\u003e and \u003cem\u003eshenshu(BL25)\u003c/em\u003e (double laterals) were selected, and acupoints locating according to the \u003cem\u003eexperimental acupuncture\u003c/em\u003e [\u003cspan class=\"CitationRef\"\u003e21\u003c/span\u003e]. Moxibustion treatment began on the 1st day after modeling finished. Before the treatment, the hair on the acupoints was cut off to expose the skin in advance. \u003cem\u003eguanyuan (CV4)\u003c/em\u003e and \u003cem\u003eshenshu (BL25)\u003c/em\u003e points were heated by suspended moxibustion using a moxa-stick produced from mugwort (custom-made for use with animals, length 12\u0026nbsp;cm, diameter 0.6\u0026nbsp;cm, made in the Affiliated Hospital of Jiangxi University of Traditional Chinese Medicine, Nanchang, China) at a height of approximately 3\u0026nbsp;cm over a hairless area of the skin for 20\u0026nbsp;min, once a day for 14 days.\u003c/p\u003e\n\u003cp\u003eRats in the CBX group were given intraperitoneal injection of carbenoxolone at a dose of 10\u0026nbsp;mg /( kg\u0026middot;d) (11) once a day for 14 days. Fixation was performed as in the moxibustion group for a total of 14 times.\u003c/p\u003e\n\u003cp\u003eRats in the moxi\u0026thinsp;+\u0026thinsp;CBX group were received moxibustion as in the moxibustion group. After moxibustion treatment, the rats were given intraperitoneal injection of carbenoxolone as in the CBX group.\u003c/p\u003e\n\u003cp\u003eRats in the normal group and model group were fixed in the same way as the moxibustion group did, and were given intraperitoneal injection of normal saline (10\u0026nbsp;mg /( kg\u0026middot;d) once a day for 14 days.\u003c/p\u003e\n\u003ch2\u003eSampling\u003c/h2\u003e\n\u003cp\u003eAfter 14 days of treatment, rats were anesthetized with an intraperitoneal injection of sodium pentobarbital 3% (weight/volume) at a dose of 40\u0026nbsp;mg/kg. Arterial blood is extracted and centrifuged to extract the supernatant, and stored in the \u0026minus;\u0026thinsp;20℃ refrigerator for later use. Tissues such as amygdala, hypothalamus and pituitary were extracted and stored in the \u0026minus;\u0026thinsp;80℃ refrigerator for later use.\u003c/p\u003e\n\u003ch2\u003eEnzyme linked immunosorbent assay (ELISA) assessment\u003c/h2\u003e\n\u003cp\u003eThe levels of CORT, ACTH and CRH were determined using an ELISA kit purchased from Shanghai \u003cem\u003ebogu\u003c/em\u003e biotechnology co., LTD (Shanghai, China). The ELISA-based method was conducted according to protocol provided by manufacturer.\u003c/p\u003e\n\u003ch2\u003eReverse transcription real-time quantitative polymerase chain reaction (RT-qPCR)\u003c/h2\u003e\n\u003cp\u003eRT-qPCR was performed as described previously with minor modifications [\u003cspan class=\"CitationRef\"\u003e22\u003c/span\u003e]. Total RNA was isolated from amygdala, hypothalamus and pituitary of rats in each group using TRIZOL reagent (Invitrogen, Carlsbad, CA, USA). The mRNA expression levels of MR, GR, 11\u0026beta;-HSD1,CRH and ACTH were measured using an RT-qPCR system with SYBR Green (Thermo Fisher Scientific, Waltham, MA, USA). cDNA was amplified by PCR using primers for each target gene. cDNA was synthesized from each RNA using a random primer and RevertAid\u0026trade; M-MuLV reverse transcriptase (Fermentas), according to the manufacturer's instructions. PCR was performed in a final volume of 25 \u0026micro;L, containing 12.5 \u0026micro;L 2\u0026thinsp;\u0026times;\u0026thinsp;PCR master mix, 2 \u0026micro;L cDNA, 1 \u0026micro;L forward primer, 1 \u0026micro;L reverse primer, and 8.5 \u0026micro;L sterilized DEPC water. RT-qPCR conditions were as follows: 94\u0026nbsp;\u0026deg;C for 5 minutes, followed by 40 cycles of 95\u0026nbsp;\u0026deg;C for 15 seconds, 60\u0026nbsp;\u0026deg;C for 45 seconds and 72\u0026nbsp;\u0026deg;C for 30 seconds. The fluorescence signal was detected at 60\u0026nbsp;\u0026deg;C, and the samples were finally extended at 72\u0026nbsp;\u0026deg;C for 7 minutes. The amplification efficiency was compared between the target and reference control glyceraldehyde 3-phosphate dehydrogenase (GAPDH) using the delta-delta Ct (∆∆Ct) method [\u003cspan class=\"CitationRef\"\u003e23\u003c/span\u003e]. The primers employed are listed in Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003ctable id=\"Tab1\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003ePrimer sequences for real-time quantitative polymerase chain reaction\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eGene\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eFull name\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eSequences (5\u0026ndash;3\u0026prime;)\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eProduct size (bp)\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e11\u0026beta;-HSD1\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eMR\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e11 beta- hydroxysteroid dehydrogenase type 1\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003emineralocorticoid receptor\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eSense primer: AAA ATA CCT CCT CCC CGT CC\u003c/p\u003e\n\u003cp\u003eantisense primer: AGG CAG CGA GAC ACC ACC\u003c/p\u003e\n\u003cp\u003eSense primer: AGA AGC TGG GGA AGT TAA AAG G\u003c/p\u003e\n\u003cp\u003eantisense primer: TCG GAG CGA TGT ATG TGG TC\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e219\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e102\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eGR\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eglucocorticoid receptor\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eSense primer: CAT TAC CAC AGC TCA CCC CTA C\u003c/p\u003e\n\u003cp\u003eantisense primer: GCA ATC ACT TGA CGC CCA C\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e148\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCRH\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eACTH\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eGAPDH\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ecorticotropin-releasing hormone\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eadrenocorticotrophic hormone\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eglyceraldehyde 3-phosphate dehydrogenase\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eSense primer: TGG CTC TGT CGC CCT GTC\u003c/p\u003e\n\u003cp\u003eantisense primer: CAG CGG GAC TTC TGT TGA GG\u003c/p\u003e\n\u003cp\u003eSense primer: CTC CTG CTT CAG ACC TCC ATA G\u003c/p\u003e\n\u003cp\u003eantisense primer: GGC TGT TCA TCT CCG TTG C\u003c/p\u003e\n\u003cp\u003eSense primer: GGA GTC TAC TGG CGT CTT CAC\u003c/p\u003e\n\u003cp\u003eantisense primer: ATG AGC CCT TCC ACG ATG C\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e186\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e161\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e237\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/div\u003e\n\u003ch2\u003eWestern blot assay\u003c/h2\u003e\n\u003cp\u003eWestern blot analysis was performed as described previously with minor modifications [\u003cspan class=\"CitationRef\"\u003e24\u003c/span\u003e]. All amygdala and hypothalamus tissues obtained in each group were homogenized in lysis buffer (JRDUN Biotechnology, Shanghai, China). The sample was centrifuged at 12,000 r/min for 20 minutes at 4\u0026nbsp;\u0026deg;C, and an aliquot of the supernatant was taken for protein concentration estimation using the BCA assay. Equal amounts of proteins were separated by sodium dodecyl sulfate- polyacrylamide gel electrophoresis (SDS-PAGE), and then the resolved proteins were transferred to polyvinylidene fluoride (PVDF) membranes (Millipore, Bedford, MA, USA). The membranes were incubated with primary antibodies overnight at 4\u0026nbsp;\u0026deg;C. Monoclonal antibodies used for Western blotting included a rat monoclonal anti-MR antibody (1:1000; Santa Cruz Biotechnology, Santa Cruz, CA, USA). The antibodies used in this study were rat monoclonal antibodies, 1:1000 and were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA), except for those specifically indicated. The other antibodies included anti-GR, anti-11\u0026beta;-HSD1 and anti-GAPDH. The membranes were washed 5 minutes with Tris-buffered saline Tween 3 times and incubated with goat anti-rabbit IgG-HRP (1:1000; Beyotime Biotechnology, Shanghai, China) and goat anti-mouse IgG-HRP PS1 (C-20) (1:1000; Beyotime Biotechnology, Shanghai, China) antibodies at 37\u0026nbsp;\u0026deg;C for 1 hour. The immunoreactive bands were visualized using an enhanced chemiluminescence reagent (Beyotime Biotechnology, Shanghai, China). The grayscale values of bands were quantified using Image J software (Fujifilm, Tokyo, Japan). The relative expression of protein was calculated based on the ratio of target grayscale values to loading control grayscale values.\u003c/p\u003e\n\u003ch2\u003e\u003cem\u003ein situ\u003c/em\u003e hybridization\u003c/h2\u003e\n\u003cp\u003e\u003cem\u003ein situ\u003c/em\u003e hybridization was performed as described previously with minor modifications [\u003cspan class=\"CitationRef\"\u003e25\u003c/span\u003e]. Six paraffin blocks were selected randomly and placed into a refrigerator at -20℃ for at least 30 minutes. Then, the blocks were cut into 4-7-\u0026micro;m-thick serial sections. After being dewaxed and dehydrated, each section was incubated in 50\u0026nbsp;\u0026micro;l hybridization buffer containing 10\u0026nbsp;\u0026micro;M oligonucleotide probe at 95℃ for 5 minutes and 37\u0026ndash;40℃ for 12 hours, washed three times with 5\u0026times;, 1\u0026thinsp;\u0026times;\u0026thinsp;and 0.2\u0026thinsp;\u0026times;\u0026thinsp;saline sodium citrate, and treated with blocking buffer at 37℃ for 15 minutes. Then, the blocking buffer was blotted with paper. Each section was then incubated in 30\u0026nbsp;\u0026micro;l biotinylated anti-digoxin antibody (1:50) at 37℃ for 1 hour, washed four times with 0.5\u0026nbsp;M PBS, incubated in streptavidin-biotin-peroxidase complex at 37℃ for 30 minutes, and rinsed four times in 0.5\u0026nbsp;M PBS. Subsequently, the sections were developed in 3, 3, diaminobenzidine, counterstained with hematoxylin, dehydrated in alcohol, permeabilized in xylene, mounted with proof quench mounting agent, and photographed with a fluorescence microscope [\u003cspan class=\"CitationRef\"\u003e26\u003c/span\u003e]. The upper, middle, lower, left and right visual fields were randomly selected for each section and the image-pro Plus 6.0 software was used to detect the integrated optical density (IOD) of positive cells, the average value was used for statistical analysis. The negative control was incubated in 0.01M PBS without primary antibody. The primers employed are shown in Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003ctable id=\"Tab2\" style=\"width: 788px;\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003ePrimer sequences for Hybridization in situ\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth style=\"width: 51px;\" align=\"left\"\u003e\n\u003cp\u003eGene\u003c/p\u003e\n\u003c/th\u003e\n\u003cth style=\"width: 275px;\" align=\"left\"\u003e\n\u003cp\u003eFull name\u003c/p\u003e\n\u003c/th\u003e\n\u003cth style=\"width: 440px;\" align=\"left\"\u003e\n\u003cp\u003eSequences (5\u0026ndash;3\u0026prime;)\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 51px;\" align=\"left\"\u003e\n\u003cp\u003e11\u0026beta;-HSD1\u003c/p\u003e\n\u003cp\u003eCRF\u003c/p\u003e\n\u003cp\u003eMR\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 275px;\" align=\"left\"\u003e\n\u003cp\u003e11 beta- hydroxysteroid dehydrogenase type 1\u003c/p\u003e\n\u003cp\u003ecorticotropin-releasing factor\u003c/p\u003e\n\u003cp\u003emineralocorticoid receptor\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 440px;\" align=\"left\"\u003e\n\u003cp\u003eCAGAUGCCAGGUUUGUGCUCAAGUAAAUCCAAAAUGGAUAGCCUUACUCA\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eCAAUACAAAUAACGCUGUUUUGUUACUACAAAGAAACACACUUUGUGCA\u003c/p\u003e\n\u003cp\u003eGGAUGGAGAGGAUAGCAAUCCCGGCAGUCGCCCUACUGACGGUGGG\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 51px;\" align=\"left\"\u003e\n\u003cp\u003eGR\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 275px;\" align=\"left\"\u003e\n\u003cp\u003eglucocorticoid receptor\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 440px;\" align=\"left\"\u003e\n\u003cp\u003eUGCUUGUGGAGCCUUUCGAGAAAUCAAGGAGAAUCCUCUGCUGCUU\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/div\u003e\n\u003ch2\u003eStatistical analyses\u003c/h2\u003e\n\u003cp\u003eAll data are presented as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD. Data were analyzed by one-way analysis of variance followed by a post hoc Student-Newman-Keuls (SNK) test using SPSS 19.0 software (SPSS, Chicago, IL, USA). A value of P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n\u003ch2\u003eThe level of CORT, ACTH and CRH in serum by ELISA\u003c/h2\u003e\n\u003cp\u003eCompared with the normal group, the level of CORT, ACTH and CRH in serum of rats in the model group was significantly decreased (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). After treatment, except for the CBX group, the serum level of CORT and ACTH in the other two groups were significantly increased compared with those in the model group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 or 0.01). And the serum levels of CRH were significantly increased compared with that in the model group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 or 0.01).\u003c/p\u003e\n\u003cp\u003eCompared with the CBX group, the serum level of CORT and CRH in the moxibustion group was significantly higher (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01), and the serum level of ACTH in the moxibustion and moxi\u0026thinsp;+\u0026thinsp;CBX group were significantly higher (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01or 0.05). Compared with the moxibustion group, the serum level of CORT, ACTH and CRH in the moxi\u0026thinsp;+\u0026thinsp;CBX group was significantly lower (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01 or 0.05). As shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\n\u003ch2\u003eThe mRNA expression of MR, GR, 11\u0026beta;-HSD1, CRH and ACTH by qRT-PCR\u003c/h2\u003e\n\u003cp\u003eCompared with the normal group, the mRNA expressions of MR and GR in the amygdala of rats in the model group were both significantly decreased (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). After treatment, except for the CBX and moxi\u0026thinsp;+\u0026thinsp;CBX group, the mRNA expressions of MR and GR in the amygdala of rats in the moxibustion group were significantly higher than those in the model group (P\u0026thinsp;\u0026gt;\u0026thinsp;0.01). Except for GR, the mRNA expressions of MR and GR in the amygdala were not significantly different among CBX, moxibustion and moxi\u0026thinsp;+\u0026thinsp;CBX group (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05). As shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eA.\u003c/p\u003e\n\u003cp\u003eCompared with the normal group, the mRNA expressions of 11\u0026beta;-HSD1 and CRH in the amygdala of rats in the model group were both significantly decreased(P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). After treatment, except for CBX group and CRH in the CBX group, the mRNA expressions of CRH in the amygdala of rats in the moxibustion group and moxi\u0026thinsp;+\u0026thinsp;CBX group were significantly higher than those in the model group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01 or 0.05). Compared with CBX, the mRNA expressions of 11\u0026beta;-HSD1 and CRH in the amygdala of rats in the moxibustion group were significantly increased (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01 or 0.05). As for the mRNA expressions of 11\u0026beta;-HSD1 and CRH, therer were no significantly different between moxibustion and moxi\u0026thinsp;+\u0026thinsp;CBX group (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05). As shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eB.\u003c/p\u003e\n\u003cp\u003eCompared with the normal group, the mRNA expressions of 11\u0026beta;-HSD1 and CRH in the hypothalamus of rats in the model group were both significantly decreased(P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). After treatment, except for 11\u0026beta;-HSD1 in the CBX and moxi\u0026thinsp;+\u0026thinsp;CBX group, the mRNA expressions of 11\u0026beta;-HSD1 and CRH in the hypothalamus of rats in the CBX, moxibustion and moxi\u0026thinsp;+\u0026thinsp;CBX group were significantly higher than those in the model group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01 or 0.05). Compared with the CBX group, except for CRH in the moxi\u0026thinsp;+\u0026thinsp;CBX group, the mRNA expressions of 11\u0026beta;-HSD1 and CRH in the hypothalamus of rats in the moxibustion and moxi\u0026thinsp;+\u0026thinsp;CBX group were both significantly increased (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). As for the mRNA expressions of 11\u0026beta;-HSD1 and CRH, there were no significantly different between moxibustion group and moxi\u0026thinsp;+\u0026thinsp;CBX group (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05). As shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eC.\u003c/p\u003e\n\u003cp\u003eCompared with the normal group, the ACTH mRNA expression in the pituitary of rats in the model group was significantly decreased (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). After treatment, except for the CBX group, the ACTH mRNA expressions in the pituitary of rats in the moxibustion and moxi\u0026thinsp;+\u0026thinsp;CBX group were significantly higher than that in the model group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01 or 0.05). Compared with the CBX, the ACTH mRNA expressions in the moxibustion group was significantly higher(P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). As for the ACTH mRNA expressions, there were no significantly different between moxibustion group and moxi\u0026thinsp;+\u0026thinsp;CBX group (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05). As shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eD.\u003c/p\u003e\n\u003ch2\u003eThe protein expression of MR, GR and 11\u0026beta;-HSD1 by Western blotting\u003c/h2\u003e\n\u003cp\u003eCompared with the normal group, the protein expressions of MR, GR and 11\u0026beta;-HSD1 in the amygdala of rats in the model group were all decreased to different degrees (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 or 0.01). After moxibustion treatment, the protein expression of MR, GR and 11\u0026beta;-HSD1 in the amygdala of rats were increased to different degrees compared with those in the model group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). As for the protein expressions of MR, GR and 11\u0026beta;-HSD1, there were no significantly different among the CBX, moxibustion and moxi\u0026thinsp;+\u0026thinsp;CBX group (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05).As shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eA and B.\u003c/p\u003e\n\u003cp\u003eCompared with the normal group, the 11\u0026beta;-HSD1protein expression in the hypothalamus of rats in the model group was significantly decreased (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). After treatment, the 11\u0026beta;-HSD1 protein expression in the hypothalamus of rats were significantly increased compared with that in the model group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). As for the 11\u0026beta;-HSD1 protein expression in the hypothalamus of rats, there were no significantly different among the CBX, moxibustion and moxi\u0026thinsp;+\u0026thinsp;CBX group (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05). As shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e\u0026nbsp;C and D.\u003c/p\u003e\n\u003ch2\u003emRNA expressions of MR, GR, 11\u0026beta;-HSD1 and CRF in amygdala, and 11\u0026beta;-HSD1 and CRF in hypothalamus by \u003cem\u003ein situ \u003c/em\u003ehybridization\u003c/h2\u003e\n\u003cp\u003e\u003cem\u003eIn situ\u003c/em\u003e hybridization-positive cells contained brown spots or particles, as indicated by the arrows. In the normal group, a large number of mRNA expressions of MR, GR, 11\u0026beta;-HSD1 and CRF in amygdala, and 11\u0026beta;-HSD1 and CRF in hypothalamus were observed (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e, \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e, \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e). After modeling induced by hydrocortisone injection, rare mRNA expressions of MR, GR, 11\u0026beta;-HSD1 and CRF in amygdala, and 11\u0026beta;-HSD1 and CRF in hypothalamus were observed, and the integral optical density (IOD) values of mRNA expressions of MR, GR, 11\u0026beta;-HSD1 and CRF in amygdala, and 11\u0026beta;-HSD1 and CRF in hypothalamus of rats in the model group were significantly decreased (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01) compared with those in the normal group (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e, \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e, \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e and Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eTreatment with moxibustion could increase the mRNA expressions of MR, GR, 11\u0026beta;-HSD1 and CRF, and the IOD values of their positive cells in the amygdala of rats in the moxibustion group were significantly higher than those in the model group and in the CBX group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01 or 0.05) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e, \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e and Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eA, \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eB).\u003c/p\u003e\n\u003cp\u003eAs for MR mRNA expressions, the IOD values of its positive cells in the moxibustion group was significantly higher than that in the moxi\u0026thinsp;+\u0026thinsp;CBX group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e and Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eA). As for 11\u0026beta;-HSD1 mRNA expression,the IOD values of its positive cells in the moxi\u0026thinsp;+\u0026thinsp;CBX group was higher than that in the CBX group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). And as for CRF mRNA expression༌the IOD values of its positive cells in the moxi\u0026thinsp;+\u0026thinsp;CBX group was higher than that in the model group (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e and Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eB).\u003c/p\u003e\n\u003cp\u003eTreatment with moxibustion could increase the mRNA expressions of 11\u0026beta;-HSD1, and the IOD values of its positive cells in the hypothalamus of rats in the moxibustion group and in the moxi\u0026thinsp;+\u0026thinsp;CBX group were significantly higher than those in the CBX group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01 or 0.05), but not higher than those in the model group (P \u0026gt; 0.05). Treatment with moxibustion could increase the mRNA expressions of CRF, and the IOD values of its positive cells in the hypothalamus of rats in the moxibustion group and in the moxi\u0026thinsp;+\u0026thinsp;CBX group were significantly higher than those in the model group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01 or 0.05), but not higher than those in the CBX group (P \u0026gt; 0.05) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e and Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eC).\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":" \u003cp\u003eCorticotropin releasing hormone (CRH) is one of the primary regulator of the hypothalamus - pituitary - adrenal (HPA) axis [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. CRH, released from a central bump in the hypothalamus, is transported to the anterior pituitary via portal vein system, and stimulates the secretion of adrenocorticotropic hormone (ACTH), then ACTH stimulate adrenal cortical synthesis to secret glucocorticoid (GC) [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. GC can also inhibit the generation of ACTH and CRH by feedback, thus forming the feedback regulating loop of HPA axis [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. In addition, the amygdala can also synthesized and secreted CRH, then directly activate the HPA axis and be regulated by the feedback of CRH and GC [\u003cspan additionalcitationids=\"CR30 CR31\" citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. The feedback regulation of GC to the amygdala and the hypothalamus may be related to the combination of GC with GR and (or) with MR. When the level of GC was within the basis range, GC almost completely binds to MR, and only when GC\u0026rsquo;s concentration higher than the basis level will bind to GR [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. When GC combines with GR in the amygdala, it gives feedback information to the neurons in small cell group of paraventricular nucleus of hypothalamus, thus reducing the secretion of CRH. Through top-down regulation, the activity of HPA axis is further inhibited, so as to reduce the excessive GC level in the body, thus maintaining the hormone level homeostasis of the body [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Before GC binds to GR and MR, its activity and concentration are affected by the regulator 11β-HSD1, which converts inactive 11-dehydrocorticosterone / cortisone into active corticosterone / cortisol [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eWhen a large amount of exogenous corticosteroids are used in the body for a long time, GC leads to excessive activation of GR, which eventually leads to the damage of nerve cells in the upper regulatory center, such as hippocampus and amygdala, and the HPA axis function is inhibited by the feedback. When the use of exogenous corticosteroids is stopped, the inhibition of HPA axis is exposed. The stress and adaptability of the body to the changes of the external environment significantly decrease, and a series of \u003cem\u003eyang\u003c/em\u003e deficiency manifestations of deficiency and cold appear [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Just as the treatment for some autoimmune diseases requires long-term use of a large number of hormones, when the disease improves, the patient develops hormone-dependent symptoms, showing the symptoms of \u003cem\u003eyang\u003c/em\u003e deficiency of traditional Chinese medicine [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. The most commonly used rat model of corticosterone \u003cem\u003ekidney-yang\u003c/em\u003e deficiency was prepared according to this pathological factor. In this study, after modeling the rats took on a series of deficiency manifestations such as withered clothing hair, decreases in body weight, slowed reaction, aversion cold, weakness, tendency to cluster, and decreased activity. In this study, detected by PCR, WB and \u003cem\u003ein situ\u003c/em\u003e hybridization, we found that there was a lower expression of MR, GR, 11β-HSD1, CRH or CRF in the amygdala of rats in the model group than those in the normal group. And the expression of 11β-HSD1, CRH or CRF in the hypothalamus of rats in the model group has the same tendency as those in the amygdala. Compared with the normal group, the level of CORT, ACTH and CRH in serum, the mRNA expression of ACTH in pituitary in the model group rats were significantly decreased, which was the same as the results in our previous study [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e11β-HSD has two isoenzymes, i.e. 11β-HSD1 and 11β-HSD2. 11β-HSD1 is a primary reductase that converts inactive 11-dehydrocorticosterone/cortisone into active corticosterone / cortisol. But the action of 11β-HSD2 is opposite to that of 11β-HSD1 [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. When the concentration or activity of GC is high in vivo, 11β-HSD2 outweighs 11β-HSD1 in the role of conversion, in contrast, when GC low, 11β-HSD1 outweighs 11β-HSD2. Together, they assist MR and GR to maintain the relative stability of hormone levels. CBX can inhibit both 11β-HSD1 and 11β-HSD2 [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. After modeling in this study, GC was always at a low level in rats, 11β-HSD1 was activated and played an important role, and MR was also activated and combined with GC. Therefore, as the results of this study showed, the mRNA expression of MR in the amygdala was about three times that of GR. As a blocking agent, CBX mainly inhibits 11β-HSD1, so in this study 11β-HSD1 was selected as the observation index instead of 11β-HSD2. In this study, the expression of 11β-HSD1 in the amygdala and hypothalamus of rats in the CBX group was lower than that in the model group. Due to the effect of 11β- HSD1 was blocked by CBX, the concentration or activity of GC is lower in the CBX group, thus causing increased expression of MR in the amygdala by feedback regulation. Just as the experiment results showing that the MR expression of amygdala in rats in the CBX group is higher than that in the model group, correspondingly, CRF expession in the amygdala and hypothalamus, CRH expression in hypothalamus and ACTH expression in the pituitary of rats in the CBX group are higher than those in the model group, and the levels of CORT, ACTH and CRH in serum of rats in the CBX group is higher than that in the model group. Literature research found that there was no similar studies have been reported, but there were still some experiments that use the expressions of CRH, MR, GR, etc. in the amygdala and hypothalamus as observation indicators to study the effect of GC on the body. For example, when pregnant Wistar rats were injected with CBX (12.5\u0026nbsp;mg s.c.) daily throughout pregnancy, Welberg, et al. [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e] found that CBX treatment reduced birth weight, and adult offspring of CBX-treated dams had persistently reduced body weight, showed less grooming and rearing,and reduced immobility in a forced swim test. In addition, they found that these animals had increased basal CORT levels, increased CRH and reduced GR mRNA in the hypothalamus, increased GR mRNA expression in the amygdala, with unaltered MR mRNA. The effect of CBX on the expression of CRH, MR and GR in the offspring amygdala and hypothalamus of pregnant rats was inconsistent with the results of this study. The reason mainly maybe that the observing subjects or animal models were different in the two experiments.\u003c/p\u003e \u003cp\u003eFor the treatment of \u003cem\u003ekidney-yang\u003c/em\u003e deficiency syndrome, \u003cem\u003ethe introduction to medicine\u003c/em\u003e,a classic work of traditional Chinese medicine, has the theory that moxibustion treating the deficiency syndrome, so as to help restoring the \u003cem\u003eyuan yang\u003c/em\u003e; moxibustion treating the cold syndrome, so as to help re-warming the \u003cem\u003eqi\u003c/em\u003e. Moxibustion is a traditional Chinese medical therapy using the burning of dried mugwort (moxa) and is widely used in China for the treatment of various diseases and symptoms of \u0026ldquo;deficient conditions\u0026rdquo; (weakness) [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Suspended moxibustion is an indirect form of moxibustion in which the moxa-stick is placed on an acupoint without skin contact to stimulate circulation by warming the acupoints and inducing smoother flow of \u003cem\u003eblood\u003c/em\u003e and \u003cem\u003eqi\u003c/em\u003e, to improve health and facilitate recovery from disease [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. In our previous study, moxibustion on \u003cem\u003eshenshu\u003c/em\u003e and \u003cem\u003eguanyuan\u003c/em\u003e points could positively regulate the dysfunction of pituitary-adrenal and pituitary-thyroid axis in rats with \u003cem\u003ekidney-yang\u003c/em\u003e deficiency syndrome [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. In this study, compared with the model group, the mRNA and protein expressions of MR, GR and 11β-HSD1 in the amygdala of rats were significantly up-regulated after the treatment on \u003cem\u003eshenshu\u003c/em\u003e and \u003cem\u003eguanyuan\u003c/em\u003e point with suspended moxibustion. After moxibustion, the mRNA expressions of 11β-HSD1 and CRF(or CRH) in the hypothalamus, ACTH in the pituitary and the level of CRH, ACTH and CORT in serum of rats were all significantly increased compared with those in the model group. According to the theory of tradition Chinese medicine, \u003cem\u003eshenshu\u003c/em\u003e is mainly used to repair \u003cem\u003eyang\u003c/em\u003e, \u003cem\u003eguanyuan\u003c/em\u003e is mainly used to repair \u003cem\u003eqi\u003c/em\u003e, and the two acupoints are in harmony with each other, so as to cultivate \u003cem\u003eyuan qi\u003c/em\u003e, and to improve the function of tonifying kidney and warming \u003cem\u003eyang\u003c/em\u003e [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. One possible reason is that, according to the theory from \u003cem\u003ethe Golden mirror of medicine (YiZong Jin Jian)\u003c/em\u003e, another classic work of traditional Chinese medicine, \u003cem\u003eshenshu\u003c/em\u003e point belongs to the \u003cem\u003ebladder meridian\u003c/em\u003e, which is the \u003cem\u003eback shu point\u003c/em\u003e of the kidney༌and \u003cem\u003eguanyuan\u003c/em\u003e point belonging to \u003cem\u003eren meridian\u003c/em\u003e, is the \u003cem\u003esmall intestine collection point\u003c/em\u003e, and is the commonly used point for the treatment of all kinds of deficiency. Another reason may be that, according to modern neuroanatomical theory, \u003cem\u003eShenshu\u003c/em\u003e point, innervated by the 1st\u0026thinsp;~\u0026thinsp;3rd lumbar ganglion segment, was related with genitalia by ilioinguinal nerve and genital nerve of lumbar plexus, and was closely related to the kidney, adrenal gland, internal genitalia, etc. through the traffic branch of the lumbar sympathetic trunk and the lumbar visceral nerve [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. And \u003cem\u003eguanyuan\u003c/em\u003e point is connected to the liver, spleen, kidney and other substantial organs through the twelfth thoracic nerve and related small visceral nerves. Zhou et al. [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e] using HRP nerve tract tracking technology, found that the afferent projection of \u003cem\u003eguanyuan\u003c/em\u003e and uterus had convergence and overlap in the spinal ganglia between lumbar 3 and sacral 5. In this study, treatment with suspended moxibustion on \u003cem\u003eshenshu\u003c/em\u003e and \u003cem\u003eguanyuan\u003c/em\u003e has not only a strong theoretical basis, but also a wide range of experimental basis. For example, Zhao et al. [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e] found that the symptoms of \u003cem\u003ekidney-yang\u003c/em\u003e deficiency were improved after a period of mild moxibustion treatment on \u003cem\u003eguanyuan\u003c/em\u003e and \u003cem\u003eshenshu\u003c/em\u003e point in elderly patients. Ren et al. [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e] found that the treatment of moxibustion on \u003cem\u003eshenshu\u003c/em\u003e and \u003cem\u003eguanyuan\u003c/em\u003e could significantly improved the inhibitory state of the HPA axis in rats with \u003cem\u003ekidney-yang\u003c/em\u003e deficiency, and the therapeutic effect of combination of \u003cem\u003eshenshu\u003c/em\u003e and \u003cem\u003eguanyuan\u003c/em\u003e was significantly better than that of combination of \u003cem\u003eshenshu\u003c/em\u003e and \u003cem\u003ezusanli\u003c/em\u003e or combination of \u003cem\u003ezusanli\u003c/em\u003e and \u003cem\u003eguanyuan\u003c/em\u003e. This was one of the reasons that \u003cem\u003eshenshu\u003c/em\u003e and \u003cem\u003eguanyuan\u003c/em\u003e were selected in this study.\u003c/p\u003e "},{"header":"Conclusion","content":" \u003cp\u003eIn this study, we demonstrated that suspended moxibustion can effectively improve the serum levels of ACTH, CRH and CORT, and can up-regulate the mRNA and protein expression of MR, GR, 11β-HSD1, CRF and ACTH in amygdala and hypothalamus of \u003cem\u003ekidney-yang\u003c/em\u003e deficiency rats. Considering the experimental model of \u003cem\u003ekidney-yang\u003c/em\u003e deficiency syndrome used in this study shares several pathologic similarities to human, then MR, GR and 11β-HSD 1 could represent a novel therapeutic target in the treatment of \u003cem\u003ekidney-yang\u003c/em\u003e deficiency syndrome.\u003c/p\u003e "},{"header":"List Of Abbreviations","content":"\u003ctable border=\"1\"\u003e\n\u003ctbody\u003e\n\u003ctr style=\"height: 35px;\"\u003e\n\u003ctd style=\"height: 35px;\" width=\"91\"\u003e\n\u003cp\u003e11\u0026beta;-HSD1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"height: 35px;\" width=\"477\"\u003e\n\u003cp\u003e11 beta-hydroxysteroid dehydrogenase type 1\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 35px;\"\u003e\n\u003ctd style=\"height: 35px;\" width=\"91\"\u003e\n\u003cp\u003eACTH\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"height: 35px;\" width=\"477\"\u003e\n\u003cp\u003eadrenocorticotropic hormone\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 35px;\"\u003e\n\u003ctd style=\"height: 35px;\" width=\"91\"\u003e\n\u003cp\u003eCBX\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"height: 35px;\" width=\"477\"\u003e\n\u003cp\u003ecarbenoxolone\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 35px;\"\u003e\n\u003ctd style=\"height: 35px;\" width=\"91\"\u003e\n\u003cp\u003eCORT\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"height: 35px;\" width=\"477\"\u003e\n\u003cp\u003ecorticosterone\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 35px;\"\u003e\n\u003ctd style=\"height: 35px;\" width=\"91\"\u003e\n\u003cp\u003eCRF\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"height: 35px;\" width=\"477\"\u003e\n\u003cp\u003ecorticotropin releasing factor\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 35px;\"\u003e\n\u003ctd style=\"height: 35px;\" width=\"91\"\u003e\n\u003cp\u003eCRH\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"height: 35px;\" width=\"477\"\u003e\n\u003cp\u003ecorticotropin releasing hormone\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 35px;\"\u003e\n\u003ctd style=\"height: 35px;\" width=\"91\"\u003e\n\u003cp\u003eELISA\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"height: 35px;\" width=\"477\"\u003e\n\u003cp\u003eenzyme linked immunosorbent assay\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 35px;\"\u003e\n\u003ctd style=\"height: 35px;\" width=\"91\"\u003e\n\u003cp\u003eGAPDH\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"height: 35px;\" width=\"477\"\u003e\n\u003cp\u003eglyceraldehyde 3-phosphate dehydrogenase\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 35px;\"\u003e\n\u003ctd style=\"height: 35px;\" width=\"91\"\u003e\n\u003cp\u003eGC\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"height: 35px;\" width=\"477\"\u003e\n\u003cp\u003eglucocorticoid\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 35px;\"\u003e\n\u003ctd style=\"height: 35px;\" width=\"91\"\u003e\n\u003cp\u003eGR\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"height: 35px;\" width=\"477\"\u003e\n\u003cp\u003eglucocorticoid receptor\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 35px;\"\u003e\n\u003ctd style=\"height: 35px;\" width=\"91\"\u003e\n\u003cp\u003eHPA axis\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"height: 35px;\" width=\"477\"\u003e\n\u003cp\u003ehypothalamus - pituitary - adrenal axis\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 35px;\"\u003e\n\u003ctd style=\"height: 35px;\" width=\"91\"\u003e\n\u003cp\u003eMR\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"height: 35px;\" width=\"477\"\u003e\n\u003cp\u003emineralocorticoid receptor\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 35px;\"\u003e\n\u003ctd style=\"height: 35px;\" width=\"91\"\u003e\n\u003cp\u003ePBS\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"height: 35px;\" width=\"477\"\u003e\n\u003cp\u003ephosphate buffered solution\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 35px;\"\u003e\n\u003ctd style=\"height: 35px;\" width=\"91\"\u003e\n\u003cp\u003eRT-qPCR\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"height: 35px;\" width=\"477\"\u003e\n\u003cp\u003eReverse transcription real-time quantitative polymerase chain reaction\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 35px;\"\u003e\n\u003ctd style=\"height: 35px;\" width=\"91\"\u003e\n\u003cp\u003eSD\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"height: 35px;\" width=\"477\"\u003e\n\u003cp\u003eSprague Dawley\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 35px;\"\u003e\n\u003ctd style=\"height: 35px;\" width=\"91\"\u003e\n\u003cp\u003eSNK\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"height: 35px;\" width=\"477\"\u003e\n\u003cp\u003eStudent\u0026ndash;Newman\u0026ndash;Keuls\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthical approval \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll procedures were conducted in accordance with guidelines reviewed and approved by the Institutional Animal Care and Use Committee of Jiangxi University of Traditional Chinese Medicine, China.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets analyzed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDisclosure of interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no conflicts of interest to declare. We confirm that this article is the authors\u0026rsquo; original work and has not been published elsewhere nor is it currently under consideration for publication elsewhere.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the National Natural Science Foundation of China (No. 81660817).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eYJM conceived and designed the study and KTL revised the paper. WGY and HHY wrote the paper, provided data and revised the paper. JS, ZY, HQW, LHC participated the experiment. All authors approved the final version of the paper.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgment\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eYang Q. Central control of the hypothalamic-pituitary-adrenocortical axis for stress response [J]. Advances in Physiological Science, 2000, 31(3):222-226.\u003c/li\u003e\n\u003cli\u003eLi LA, Yang XJ, Du GM, Jin TM, Xu J. The central regulatory mechanism of HPA axis for stress response [J]. Chinese journal of veterinary medicine, 2010, 46 (6):65-67.\u003c/li\u003e\n\u003cli\u003eThompson BL, Erickson K, Schulkin J, Rosen JB．Corticosterone facilitates retention of contextually conditioned fear and increases CRH mRNA expression in the amygdala [J]. Behav Brain Res，2004，149(2): 209-213．\u003c/li\u003e\n\u003cli\u003eMakino S，Hasmoto K，Gold PW．Multiple feedback mechanisms activating corticotrophin-releasing hormone system in the brain during stress [J]. Pharmocol Biochem Bebav，2002，73(1):147-152．\u003c/li\u003e\n\u003cli\u003eOitzl MS，Champagne DL，Van Der Veen R，\u003ca href=\"https://pubmed.ncbi.nlm.nih.gov/?term=de+Kloet+ER\u0026amp;cauthor_id=19631685\"\u003e Ronald de Kloet\u003c/a\u003e E. Brain development under stress：hypotheses of glucocorticoid actions revisited [J]. Neurosci Biobehav Rev，2010，34（6）：853-866.\u003c/li\u003e\n\u003cli\u003eHe WB，Zhang JL, Chen NH. Analysis of relationship between brain and kidney of TCM based on negative feedback regulation in the hippocampus-HPA axis [J]. China Journal of Traditional Chinese Medicine and Pharmacy, 2016，31(9):3426-3428.\u003c/li\u003e\n\u003cli\u003eDe Kloet ER, Vreugdenhil E, Oitzl MS, Jo\u0026euml;ls M. Brain corticosteroid receptor balance in health and disease [J]. Endocr Rev, 1998, 19(3):269-301.\u003c/li\u003e\n\u003cli\u003eHarris HJ, Kotelevtsev Y, Mullins JJ, Seckl JR, Holmes MC. Intracellular regeneration of glucocorticoids by 11\u0026beta;-hydroxysteroid (11\u0026beta;-HSD)-1 plays a key role in regulation hypothalamic-pituitary-adrenal axis: analysis of 11 beat-HSD-1 deficient mice. Endocrinology, 2001,142(1):114-120.\u003c/li\u003e\n\u003cli\u003eLi XR, Zhong LY. 11\u0026beta;-HSD1 is involved in neuroendocrine regulation of the hippocampus and hypothalamic-pituitary-adrenal axis [J]. J southeast Univ (MedSci Edi)，2009，8(4)：358-360.\u003c/li\u003e\n\u003cli\u003eMattsson C, Lai M, Noble J, Mckinney E, Yau JL, Seckl JR, Walker BR. Obese Zucker rats have reduced mineralocorticoid receptor and 11 beta-hydroxysteroid dehydrogenase type1 expression in the hippocampus：implications for dysregulation of the hypothalamic-pituitary-adrenal axis in obesity [J]．Endocrinology，2003，144(7)：2997-3003．\u003c/li\u003e\n\u003cli\u003eZeng YB, Liu YM. Expression of connexin 32 in brain tissue of epileptic rats and the effect of carbenoxolone on it [J]. J Clin Neurol，2013，26(2) ：115-117.\u003c/li\u003e\n\u003cli\u003eYau JL, Noble J, Kenyon CJ, Hibberd C, Kotelevtsev Y, Mullins JJ, Seckl JR. Lack of tissue glucocorticoid reactivation in 11\u0026beta;-hydroxysteriod dehydrogenase type 1 knockout mice ameliorates age-related learning impairments [J]．Proc Nat1 Acad Sci USA，2001，98(8)：4716-4721．\u003c/li\u003e\n\u003cli\u003eShen ZY. Study on localization of \u003cem\u003ekidney-yang\u003c/em\u003e deficiency syndrome [J]. Chinese journal of integrated traditional and western medicine, 1997, 17(1)：50-52.\u003c/li\u003e\n\u003cli\u003eYe R, Zhang AX, Jiang RR, Chen H, Zhou LN, Xu LF, Cai QM. Clinical study of moxibustion in the treatment of female sexual dysfunction with \u003cem\u003ekidney-yang\u003c/em\u003e deficiency [J]. Shizhen guoyi guoyao, 2014, 25 (11) : 2700-2702.\u003c/li\u003e\n\u003cli\u003eZhu W. Moxibustion with ginger to treat 55 cases of low sperm motility of \u003cem\u003ekidney-yang\u003c/em\u003e deficiency [J]. Beijing traditional Chinese medicine, 2000, 19(2):48-49.\u003c/li\u003e\n\u003cli\u003eWang Y, Xu JH, Hu ZH, Wang SS, Xiong ZM, Bai ZJ, Gu L. Observations on the therapeutic effect of \u003cem\u003edu\u003c/em\u003e meridian moxibustion on polycystic ovarian syndrome of \u003cem\u003espleen-kidney yang\u003c/em\u003e deficiency type [J]. Shanghai J Acu-mox, 2015, 34(1): 35-37.\u003c/li\u003e\n\u003cli\u003eWen Y, Ren AL, Deng LW. Discussion on auricular acupuncture point combined with warm box moxibustion in the treatment of ovulation disorders with \u003cem\u003ekidney-yang\u003c/em\u003e deficiency [J]. Hunan Journal of Traditional Chinese Medicine, 2013，29(2)：72-73.\u003c/li\u003e\n\u003cli\u003eMin YJ, Yao HH, Cheng LH. The effect of suspended moxa stick moxibustion on points \u003cem\u003eshenshu \u003c/em\u003e(BL23) and \u003cem\u003eguanyuan\u003c/em\u003e (CV4) on the pituitary-adrenal axis and the pituitary-thyroid axis in rats with \u003cem\u003ekidney-yang\u003c/em\u003e deficiency [J]. Shanghai J Acu-mox, 2016，35（12）：1469-1452.\u003c/li\u003e\n\u003cli\u003eMin YJ, Yan ZG, Yang HY, Yang XM, Guo CX. Qualitative and quantitative experiment study on influential factors of acupuncture efficacy [J]. Liaoning Journal of Traditional Chinese Medicine，2008，35(12)：1923-1927.\u003c/li\u003e\n\u003cli\u003eZhang Y, Xu SY, Liu MN, Jia TY, Qu WJ, Han T, Jia Z, Xu XF, Li XR. Comparative studies on chemical contents and effect in \u003cem\u003ekidney-yang\u003c/em\u003e deficiency rats of salt-processed product and wine-processed product of cuscutae semen [J]. Evidence-Based Complementary and Alternative Medicine, 2019, doi: 10.1155/2019/2049497.\u003c/li\u003e\n\u003cli\u003eLin WZ, Wang P. Experimental acupuncture [M]. China: Shanghai science and technology press, 1999, (9) : 288-289.\u003c/li\u003e\n\u003cli\u003eHong ES, Yao HH, Min YJ, Sun J, Zhou X, Zeng XB, Yu W. The mechanism of electroacupuncture for treating spinal cord injury rats by mediating Rho/Rho-associated kinase signaling pathway [J]. JSCM, DOI:10.1080/10790268. 2019.1665612\u003c/li\u003e\n\u003cli\u003eMin YJ, Deng L, Hong ES. Orthogonal study on different acupuncture factors based on hypothalamic- pituitary-adrenal axis in rats with\u003cem\u003e kindey-yang\u003c/em\u003e deficiency [J]. Shanghai J Acu-mox，2016，35（3）：355-359.\u003c/li\u003e\n\u003cli\u003eMin YJ, Dingli LQ, Cheng LH, Xiao WP, He XW, Zhang H, Min ZY, Pei J. Effect of electroacupuncture on the mRNA and protein expression of Rho-A and Rho-associated kinase II in spinal cord injury rats [J]. Neural Regen Res, 2017, 12(2): 276-282. doi: 10.4103/1673-5374.200811.\u003c/li\u003e\n\u003cli\u003eXiao WP, Ding Li LQ, Min YJ, Yang HY, Yao HH, Sun J, Zhou X, Zeng XB, Yu W. Electroacupuncture promoting axonal regeneration in spinal cord Injury rats via suppression of Nogo/ NgR and Rho/ROCK signaling pathway [J]. Neuropsychiatric Disease and Treatment，2019:15 3429\u0026ndash;3442.\u003c/li\u003e\n\u003cli\u003eZhang L, Ni YQ, Li YF. Ligustrazine facilitates hair cell regeneration in the cochlea following gentamicin ototoxicity [J]. Neural Regen Res, 2010, 5 (5): 735-740.\u003c/li\u003e\n\u003cli\u003eAzuma K, Zhou Q, Niwa M，Kubo KY. Association between mastication, the hippocampus, and the HPA Axis: A comprehensive review [J]. Int J Mol Sci，2017, 18(8): 1687.\u003c/li\u003e\n\u003cli\u003eHerman JP, Mcklveen JM, Ghosal S, Kopp B, Wulsin A, Makinson R, Scheimann J, Myers B. Regulation of the hypothalamic-pituitary-adrenocortical stress response [J]. Compr Physiol，2016，6(2):603-621.\u003c/li\u003e\n\u003cli\u003eKolber BJ, Roberts MS, Howell MP, Wozniak DF, Sands MS, Muglia LJ. Central amygdala glucocorticoid receptor action promotes fear associated CRH activation and conditioning [J]. Proc Natl Acad Sci, 2008, 105(33):12004-12009.\u003c/li\u003e\n\u003cli\u003eSilverman MN，Sternberg EM. Glucocorticoid regulation of inflammation and its functional correlates: from HPA axis to glucocorticoid receptor dysfunction [J]. Ann NYAcad Sci，2012，12(61): 55-63.\u003c/li\u003e\n\u003cli\u003eAnacker C, Zunszain PA，Carvalho LA，Pariante CM. The glucocorticoid receptor: pivot of depression and of antidepressant treatment [J]. Psychoneuroendocrinology，2011，36(3): 415-425.\u003c/li\u003e\n\u003cli\u003eYang SJ，Yu HY，Kang DY，Ma ZQ, Qu R, Ma SP. Antidepressant-like effects of salidroside on olfactory bulbectomy-induced pro-inflammatory cytokine production and hyperactivity of HPA axis in rats [J]. Pharmacol Biochem Behav，2014，124:451-457.\u003c/li\u003e\n\u003cli\u003eIudicibus SD, Franca R, Martelossi S, Ventura A, Decorti G. Molecular mechanism of glucocorticoid resistance in inflammatory bowel disease [J]. World Journal of Gastroenterology, 2011, 17(9): 1095-1108.\u003c/li\u003e\n\u003cli\u003eSeckl JR，Walker BR．Minireview：11\u0026beta;-hydroxysteroid dehydrogenase type1：a tissue-specific amplifier of glucocorticoid action [J]. Endocrinology，2001, 142 (4)：1371-1376．\u003c/li\u003e\n\u003cli\u003eChen XY. Animal modeling of practical TCM syndromes [M]. China: Beijing medical university, China union medical university joint press, 1993:100-117.\u003c/li\u003e\n\u003cli\u003eChen Q. Methodology of pharmacology research of traditional Chinese medicine [M]. China: The people's medical publishing house, 1993:982-1001.\u003c/li\u003e\n\u003cli\u003eWu PY, Yu ZY. Yougui wan in the treatment of 30 cases of \u003cem\u003espleen-kidney yang\u003c/em\u003e deficiency syndrome caused by hormone withdrawal in patients with nephrotic syndrome [J]. Jiangxi Journal of Traditional Chinese Medicine, 2010, 41 (7):43-44.\u003c/li\u003e\n\u003cli\u003eKou WW, Zhang MF. Clinical observation of wenshentianjing pill in the treatment of 100 cases of hormone-dependent nephropathy with \u003cem\u003ekidney-yang\u003c/em\u003e deficiency [J]. China disability medicine, 2014,22(10):131-132.\u003c/li\u003e\n\u003cli\u003eWelberg LA, Seckl JR, Holmes MC. Inhibition of 11beta-hydroxysteroid dehydrogenase, the foeto-placental barrier to maternal glucocorticoids, permanently programs amygdala GR mRNA expression and anxiety-like behaviour in the offspring [J]. Eur J Neurosci,\u0026nbsp;2000, 12(3):1047-54.\u003c/li\u003e\n\u003cli\u003eXiao AJ, He L, Ouyang X, Liu JM, Chen MR. Comparison of the anti-apoptotic effects of 15- and 35-minute suspended moxibustion after focal cerebral ischemia / reperfusion injury [J]. Neural Regen Res, 2018, 13(2):257-264.\u003c/li\u003e\n\u003cli\u003eRen DW, Pei JC. Randomized controlled study on effect of moxibustion of different acupoint groups on the hypothalamic-pituitary-adrenal axis in rat [J]. Journal of practical traditional Chinese internal medicine, 2014，28(5):80-81.\u003c/li\u003e\n\u003cli\u003eZhou JS, Jin ZG,Tao ZL. The segmental distribution of the primary sensory neuron of the acupoint \u003cem\u003eguanyuan\u003c/em\u003e in the spinal ganglion [J]. Shanghai J Acu-mox，2001，20(3): 40-41.\u003c/li\u003e\n\u003cli\u003eZhao C，Shi Y，Cui YH，Wang XM，Ma XP，Wu BL，Wu LY，Liu HR. Effect of suspended moxibustion on the pRb expression of peripheral blood in the \u003cem\u003ekidney-yang\u003c/em\u003e deficiency aged people [J]. Global Traditional Chinese Medicine，2012, 5(5):350-353.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"moxibustion, Kidney-yang deficiency, amygdala, hypothalamus, mineralocorticoid receptor, glucocorticoid receptor, 11 beta-hydroxysteroid dehydrogenase type 1","lastPublishedDoi":"10.21203/rs.3.rs-86968/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-86968/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground:\u003c/strong\u003e The syndrome of \u003cem\u003ekidney-yang\u003c/em\u003e deficiency is one of the main syndromes in traditional Chinese medicine. Modern evidences prove that the hypothalamus - pituitary - adrenal axis (HPA axis) function disorder is the main material basis of \u003cem\u003ekidney-yang\u003c/em\u003e deficiency syndrome. The upper regulating center, such as hippocampus and amygdala can affected HPA axis. Although\u0026nbsp;moxibustion have a therapeutic effect for \u003cem\u003ekidney-yang\u003c/em\u003e deficiency syndromes, the underlying mechanism remains unclear. This study investigated the effect of suspended moxibustion on amygdala and HPA axis and elucidated the possible molecular mechanism of moxibustion in improving \u003cem\u003ekidney-yang\u003c/em\u003e deficiency syndrome.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eMethods:\u003c/strong\u003e 60 male Sprague-Dawley rats were randomly divided into the normal group ( n=12) and the model-building group (n=48). Rats in the model-building group were given intramuscular injection of hydrocortisone to establish the model of \u003cem\u003ekidney-yang\u003c/em\u003e deficiency. The 48 rats successfully modeled were then randomly divided into model group (model, n=12) , carbenoxolone intraperitoneal injection group (CBX, n=12), moxibustion group (moxi, n=12) and moxibustion plus carbenoxolone intraperitoneal injection group (moxi+CBX, n=12). In the moxibustion group,\u003cem\u003e Shenshu\u003c/em\u003e (BL23) and \u003cem\u003eGuanyuan \u003c/em\u003e(CV4) points were treated with moxibustion for 14 days. After treatment, the level of corticostesone (CORT), adrenocorticotropic hormone (ACTH) and corticotropin-releasing hormone (CRH) in serum, the expressions of mineralocorticoid receptor (MR), glucocorticoid receptor (GR), 11 beta-hydroxysteroid dehydrogenase type 1 (11β-HSD1), corticotropin releasing factor (CRF) and ACTH in rats’ amygdala \u0026nbsp;and (or) hypothalamus, pituitary were detected. Data were analyzed by one-way analysis of variance.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eResults:\u003c/strong\u003e Compared with the normal group, the level of CRH, ACTH and CORT in serum, and the mRNA and protein expressions of MR, GR and 11β-HSD1in amygdala, the mRNA and protein expressions of 11β-HSD1 in hypothalamus and CRF mRNA expression in amygdala and hypothalamus, and ACTH mRNA expression in pituitary of rats in the model group were all significantly decreased (P \u0026lt; 0.05 or 0.01). After treatment with moxibustion, except for 11β-HSD1 mRNA expression, the observation index mentioned above were increased to different degrees compared with those in the model group (P \u0026lt; 0.05 or 0.01). \u003c/p\u003e\u003cp\u003e\u003cstrong\u003eConclusion\u003c/strong\u003e: Suspended moxibustion can effectively improve the serum levels of ACTH, CRH and CORT, and can up-regulate the mRNA and protein expression of MR, GR , 11β-HSD1, CRF and ACTH in amygdala and hypothalamus of \u003cem\u003ekidney-yang\u003c/em\u003e deficiency rats, which may be one of the molecular mechanisms of moxibustion in improving \u003cem\u003ekidney-yang\u003c/em\u003e deficiency syndrome.\u0026nbsp;\u003c/p\u003e","manuscriptTitle":"Effects of Moxibustion on Amygdala -HPA Axis in Rats with Kidney-Yang Deficiency Syndrome Induced by Hydrocortisone Injection","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2020-10-08 22:26:47","doi":"10.21203/rs.3.rs-86968/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"38cce6e5-7f68-4819-84bb-9a2ae502b660","owner":[],"postedDate":"October 8th, 2020","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":732286,"name":"Urology \u0026 Nephrology"}],"tags":[],"updatedAt":"2020-10-08T22:26:49+00:00","versionOfRecord":[],"versionCreatedAt":"2020-10-08 22:26:47","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-86968","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-86968","identity":"rs-86968","version":["v1"]},"buildId":"WrCJVZZCHTDjtuVLN7oU0","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}