The Role of C1orf50 in Breast Cancer Progression and Prognosis

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

Abstract Although the prognosis of breast cancer has significantly improved compared to other types of cancer, there are still some patients who expire due to recurrence or metastasis. Therefore, it is necessary to develop a method to identify patients with poor prognosis at the early stages of cancer. In the process of discovering new prognostic markers from genes of unknown function, we found that the expression of C1orf50 determines the prognosis of breast cancer patients, especially for those with Luminal A breast cancer. This study aims to elucidate the molecular role of C1orf50 in breast cancer progression. Bioinformatic analyses of the breast cancer dataset of TCGA, and in vitro analyses, reveal the molecular pathways influenced by C1orf50 expression. C1orf50 knockdown suppressed the cell cycle of breast cancer cells and weakened their ability to maintain the undifferentiated state and self-renewal capacity. Interestingly, upregulation of C1orf50 increased sensitivity to CDK4/6 inhibition. In addition, C1orf50 was found to be more abundant in breast cancer cells than in normal breast epithelium, suggesting C1orf50 involvement in breast cancer pathogenesis. Furthermore, the mRNA expression level of C1orf50 was positively correlated with the expression of PD-L1 and its related factors. These results suggest that C1orf50 promotes breast cancer progression through cell cycle upregulation, maintenance of cancer stemness and immune evasion mechanisms. Our study uncovers the biological functions of C1orf50 in Luminal breast cancer progression, a finding not previously reported in any type of cancer.
Full text 107,514 characters · extracted from preprint-html · click to expand
The Role of C1orf50 in Breast Cancer Progression and Prognosis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article The Role of C1orf50 in Breast Cancer Progression and Prognosis Yusuke Otani, Atsushi Tanaka, Masaki Maekawa, Tirso Peña, Shinichi Toyooka, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4660291/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 28 Nov, 2024 Read the published version in Breast Cancer → Version 1 posted 5 You are reading this latest preprint version Abstract Although the prognosis of breast cancer has significantly improved compared to other types of cancer, there are still some patients who expire due to recurrence or metastasis. Therefore, it is necessary to develop a method to identify patients with poor prognosis at the early stages of cancer. In the process of discovering new prognostic markers from genes of unknown function, we found that the expression of C1orf50 determines the prognosis of breast cancer patients, especially for those with Luminal A breast cancer. This study aims to elucidate the molecular role of C1orf50 in breast cancer progression. Bioinformatic analyses of the breast cancer dataset of TCGA, and in vitro analyses, reveal the molecular pathways influenced by C1orf50 expression. C1orf50 knockdown suppressed the cell cycle of breast cancer cells and weakened their ability to maintain the undifferentiated state and self-renewal capacity. Interestingly, upregulation of C1orf50 increased sensitivity to CDK4/6 inhibition. In addition, C1orf50 was found to be more abundant in breast cancer cells than in normal breast epithelium, suggesting C1orf50 involvement in breast cancer pathogenesis. Furthermore, the mRNA expression level of C1orf50 was positively correlated with the expression of PD-L1 and its related factors. These results suggest that C1orf50 promotes breast cancer progression through cell cycle upregulation, maintenance of cancer stemness and immune evasion mechanisms. Our study uncovers the biological functions of C1orf50 in Luminal breast cancer progression, a finding not previously reported in any type of cancer. C1orf50 Luminal A breast cancer Cell cycle Immune evasion YAP/TAZ Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 (3) Introduction Breast cancer is the most common cancer in women, and one of the first cancers for which pathological classification based on molecular phenotype was introduced [ 1 , 2 ]. The molecular characteristics of each subtype have been widely and deeply understood, but the heterogeneity of the subtypes is not commonly reviewed [ 3 , 4 ]. Defined as a subtype of hormone receptor positive cancer, estrogen receptor (ER)-positive breast cancer accounts for approximately 70 percent of all breast cancers [ 5 , 6 ]. Since ER-positive breast cancer cells depend on endogenous estrogen for their growth, selective estrogen receptor modulators (SERMs), such as tamoxifen or aromatase inhibitors, have improved prognosis [ 7 , 8 ]. However, it is known that approximately 20% of patients with ER-positive breast cancer have a poor prognosis and develop metastasis or recurrence even after hormone therapy [ 9 , 10 ]. Various attempts have been made to improve the prognosis of these patients, including extending the duration of postoperative hormone therapy from 5 to 10 years and adding postoperative chemotherapy [ 11 , 12 ]. Studies have proposed increasingly popular methods in risk classification via multi-gene expression assays as novel predictors for poor prognostic factors in hormone receptor-positive and human epidermal growth factor receptor 2 (HER2)-negative breast cancer patients [ 13 , 14 ]. Yet, no single gene has been found as a sole predictor for these patient groups nor for drug indication. We searched the Cancer Genome Atlas-Breast Invasive Carcinoma (TCGA-BRCA) dataset for genes of unknown function that may be involved in the prognosis of early stage ER-positive breast cancer. We found that the gene, Chromosome 1 Open Reading Frame 50 (C1orf50), is strongly correlated with the prognosis of stage II Luminal A breast cancer, which is considered to have a low biological malignancy among ER-positive breast cancers. In this study, we used biological, biochemical, and bioinformatic analyses to examine the role of C1orf50 in breast cancer progression. These analyses help to improve treatment outcomes by identifying new prognostic factors in breast cancer, while simultaneously identifying new potential drug targets for breast cancer therapies. (4) Material and Methods Immunofluorescent analysis and confocal microscopy : Immunofluorescent analysis on the breast cancer tissue array was performed as previously described [ 15 ]. The breast cancer tissue array was purchased from TissueArray.com (catalog number: BRM961a). After deparaffinization with xylene, the section was incubated with HistoVT One (Nacalai Tesque) for antigen retrieval following the manufacturer’s instructions, blocked with 1% bovine serum albumin (BSA) (Sigma-Aldrich) in phosphate buffered saline with 0.05% Trion X-100 (PBST) for 1h at room temperature (~ 25°C). The section was incubated with primary antibodies in BSA-PBST at 4°C overnight. After washing with PBST three times, the section was then incubated with secondary antibodies in BSA-PBST at room temperature for 1h and mounted with DAPI-Fluoromount-G (SouthernBiotech). The section was observed using a confocal microscope, LSM780 (Carl Zeiss AG). Details of the antibodies are described in Table S1 . Cell cultures and treatments : Human breast cancer cell line MCF7 was obtained from the Japanese Collection of Research Bioresources (JCRB), and BT474, SK-BR-3, and MDA-MB-231 were from the American Type Culture Collection (ATCC). All cells were cultured at 37°C containing 5% CO2 in high glucose Dulbecco’s modified Eagle’s medium (DMEM, Fujifilm-Wako) supplemented with 10% fetal bovine serum (FBS, Corning) and 1% penicillin/streptomycin/L-glutamine (Fujifilm-Wako). RNAi experiments were performed using siRNA, Lipofectamine RNAiMAX (Thermo Fisher Scientific), and Opti-MEM (Thermo Fisher Scientific). The following siRNAs were used in this study, listed as [Target gene/Source/Identifier]: [negative control/Thermo Fisher Scientific/4390844]; [human C1orf50/Thermo Fisher Scientific/s35534]; [human C1orf50/Thermo Fisher Scientific/s35535]; [human C1orf50/Thermo Fisher Scientific/s35536]. Lentiviral preparation and infection were performed as previously reported [ 16 ]. Briefly, 293FT cells were transfected with viral backbone plasmids (pLKO.1-puro for shRNA and pTomo for overexpression), psPAX2, and pMD2.G using TransIT-LT1 transfection reagent (TaKaRa Bio) and Opti-MEM. The virus containing medium was harvested and filtered with polysulfone membrane. The following target sequences of shRNA were used in this study: Human C1orf50 #1 [CTGCACCATGTAGCTTGTAAT]; Human C1orf50 #2 [GTCAGTCAGTTTCAGAGTATT]; Control [CCTAAGGTTAAGTCGCCCTCG]. The sphere-formation assay experiments were performed as previously reported [ 17 ]. Immunoblotting analysis Immunoblotting experiments were performed as previously described [ 18 ]. The cell lysate was prepared using cell lysis buffer (20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1 mM ethylenediaminetetraacetic acid, 1 mM ethylene glycol-bis(2-aminoethylether)-N,N,N',N'-tetraacetic acid, 1% Triton X-100, cOmplete Protease Inhibitor Cocktail tablets (Roche), PhosSTOP phosphatase inhibitor cocktail tablets (Roche) and boiled in sodium dodecyl sulfate (SDS) sample buffer (50 mM Tris-HCl (pH 6.5), 100 mM dithiothreitol, 2% SDS, 1.5 mM bromophenol blue, 1.075 M glycerol). Equivalent amounts of each protein were loaded into acrylamide gel and transferred onto polyvinylidene fluoride (PVDF) membranes (Immobilon-P, 0.45 µm, Millipore). The membranes were then subjected to immunodetection using the antibodies listed below. The signals were detected using a ChemiDoc Touch Imaging System (Bio-Rad). Details of the antibodies are described in Table S2. For the other materials and methods regarding bioinformatics analyses and statistics, see Doc. S1 and Table S1 –2. (5) Results Discovery of C1orf50 as a prognostic marker for Luminal A breast cancer We investigated whether C1orf50 mRNA expression plays a prognostic role using the TCGA-BRCA dataset, in which RNAseq data is accompanied by survival information. For the analysis, we included 747 cases of primary tumor and infiltrating ductal carcinoma (IDC) in the TCGA-BRCA dataset. When comparing the expression levels of C1orf50 by IDC subtype, it was found that Luminal A breast cancer showed significantly higher expression levels of C1orf50 than non-Luminal A breast cancer (Fig. 1 A). When examining the primary IDC breast cancer patient population registered in TCGA, it was found that there were many patients with stage II breast cancer (Fig. 1 B). Since the prognosis for stage I breast cancer is widely known, this analysis focused primarily on patients with stage II breast cancer. Using the median of C1orf50 mRNA expression values, we divided stage II breast cancer patients into C1orf50-high and C1orf50-low groups and performed survival analysis of stage II breast cancer patients, finding a significant ( p = 0.045) difference in 10-year survival (Fig. 1 B). In particular, a trend towards a greater divergence in the survival curve was observed from 5 years. In the analysis of stage II breast cancer patients by histological subtype, a significant difference in 10-year survival was observed in patients with Luminal-type breast cancer ( p = 0.044), which is characterized by estrogen receptor expression (Fig. 1 C). This difference was particularly significant ( p = 0.01) in the group of patients with Luminal A breast cancer (Fig. 1 D). There was no significant difference in 10-year survival rates among patients with triple negative, HER2, and Luminal B stage II breast cancer (Fig. 1 E and Fig. S1 ). This data suggest that the expression level of C1orf50 mRNA is a prognostic marker, especially in patients with stage II luminal A breast cancer. In addition, we investigated whether C1orf50 has different effects in premenopausal and postmenopausal breast cancer. In this study, we re-categorized women aged 50 years or older as postmenopausal, and found that C1orf50 may be a factor involved in survival in stage II breast cancer in postmenopausal patients (Fig. S1 C-F). Next, we determined whether C1orf50 is expressed at the protein level in breast cancer tissues. Using a cohort of breast cancer patients from the Clinical Proteomic Tumor Analysis Consortium (CPTAC), we analyzed whether C1orf50 mRNA and C1orf50 protein expression were correlated ( r = 0.49, p < 0.001) , and found a positive correlation (Fig. 2 A). Furthermore, immunostaining with anti-C1orf50 antibody in tissue arrays composed of normal mammary tissues and breast cancer tissues showed that C1orf50 protein expression was low in normal mammary tissue (Fig. 2 B), whereas the expression of C1orf50 protein was high in breast cancer tissues of all subtypes (Figs. 2 C, 2 D upper panels). Importantly, C1orf50 expression was found to be maintained at high levels not only in primary lesions but also in metastatic lesions of the lymph nodes (Figs. 2 C, 2 D lower panels). This data suggests that C1orf50 expression is upregulated in cancer cells compared to normal cells and that its expression is independent of the environment in which the cancer cells are located. In addition, the positive correlation between C1orf50 mRNA and C1orf50 protein expression suggests that it is reasonable to evaluate C1orf50 protein as a prognostic marker in pathological specimens by immunostaining or other methods. Pathway analyses of C1orf50 in Luminal A breast cancer The data above shows that stage II breast cancer patients with high C1orf50 expression have a significantly worse prognosis (Fig. 1 ). The function of C1orf50 has not been previously reported, and its physiological and pathological roles and association with cancer biology remain completely unknown. To elucidate the molecular mechanisms of how C1orf50 promotes cancer progression, we performed pathway analysis focusing on C1orf50 mRNA expression levels using the TCGA-BRCA dataset. First, we divided the TCGA data of stage II Luminal A breast cancer patients into C1orf50-high and C1orf50-low groups and performed Gene Set Enrichment Analysis (GSEA) using the Molecular Signatures Database (MSigDB) hallmark gene sets, and found a significant increase in the MITOTIC_SPINDLE gene set, which is related to the cell cycle. We also found a decrease in the OXIDATIVE_PHOSPHORYLATION gene set, which is related to mitochondrial function, as well as a decrease in INTERFERON_ALPHA_RESPONSE, INTERFERON_GAMMA_RESPONSE, and ALLOGRAFT_REJECTION, which are related to immune response (Fig. 3 A). Interestingly, we observed a decrease in the ESTROGEN_RESPONSE_LATE gene set: it has been reported that the value of this pathway correlates with estrogen reactivity [ 19 ], suggesting that a decrease in estrogen reactivity occurs in the C1orf50-high patient group. Furthermore, the Gene Set Variation Analysis (GSVA) confirmed a similar trend to the GSEA results, as well as stronger association with transforming growth factor (TGF) beta signaling in the C1orf50-high group (Fig. 3 B). This data suggests that in stage II Luminal A breast cancer patients with higher levels of C1orf50 expression are associated with an increased cell cycle activity, while lower levels of C1orf50 expression are associated with decreased expression of immunoreactive and estrogen responsive gene groups. Next, we performed the same analysis on the MsigDB C6 (Oncogenic signature) gene sets and found that the MEL18 gene signature and the BMI1 gene signature were decreased in the C1orf50-high group (Fig. S1 A). MEL18 and BMI1 are Polycomb proteins involved in gene silencing [ 20 ]. In addition, since it has been reported that MEL18 deficiency leads to the reduction of estrogen receptors, which results in hormone-sensitive breast cancer cells acquiring the ability to grow in a hormone-independent manner [ 21 ], C1orf50 may have a strong role in hormone insensitivity in Luminal breast cancer patients. In the C6 gene set, several KRAS-related pathways have been shown to be upregulated; previous studies have shown that increased expression of KRAS in the TCGA-BRCA dataset is associated with an increase in PD-L1 [ 22 ], suggesting that C1orf50 may indirectly contribute to immune reactivity or immune evasion. The Gene Ontology Biological Process (GOBP) gene sets showed a trend toward decreased pathways related to mitochondrial function, as well as decreased pathways related to immune response (Fig. S1 B). Further analysis using the Kyoto Encyclopedia of Genes and Genomes (KEGG) gene sets, revealed decreased oxidative phosphorylation and decreased antigen processing and presentation (Fig. S1 C). This data suggests that C1orf50 is widely implicated in cancer signaling, regulation of mitochondrial function, and immune evasion. Expression levels of C1orf50 determine cell cycle and response to CDK4/6 inhibitors of Luminal breast cancer Since the C1orf50-high group had enhanced cell cycle gene sets in both GSEA and GSVA, we analyzed the correlation between the expression level of C1orf50 and that of cell cycle-related factors. We found a positive correlation with components of the cyclin D:CDK4/6 complex and the cyclin E:CDK2 complex (Fig. 4 A). The cyclin D:CDK4/6 complex is a factor that promotes breast cancer progression [ 23 , 24 ], and CDK4/6 inhibitors have recently been administered to patients with unresectable or recurrent Luminal breast cancer [ 25 , 26 ]. The cyclin E:CDK2 complex has been reported to be involved in breast cancer progression [ 27 , 28 ]. Interestingly, BT474 cells exogenously transfected with C1orf50 showed increased sensitivity to abemaciclib, a CDK4/6 inhibitor drug (Fig. 4 B). We compared the relationship between the expression levels of C1orf50 and eight CDKs in the dataset and found that the expression of CDK2, CDK4, CDK6, CDK7, and CDK8 was significantly higher in the C1orf50-high group (Fig. 4 C). CDK7 forms a complex with cyclin H and MAT1 and acts as a CDK-activating kinase that phosphorylates and activates CDK2 and CDK4/6 [ 29 ]. It has been reported that when CDK8 expression is high in various carcinomas, especially breast cancer, a poor prognosis is found [ 30 ]. This data suggests that high levels of C1orf50 expression contribute to cell cycle acceleration. To confirm that C1orf50 is indeed associated with cell cycle progression, we transfected siRNAs against C1orf50 mRNA into Luminal-type BT474 cells and tested whether the proliferative capacity of the cells would be affected. Two unique siRNAs against C1orf50 mRNA each attenuated the protein level of C1orf50 in BT474 cells (Fig. 4 D). This indicates that the anti-C1orf50 antibodies used in this study accurately recognize the C1orf50 protein. After siRNA transfection at 24, 48, 72, and 96 hours, cell numbers were assessed using the MTS assay and showed that the proliferation of siC1orf50-transfected cells was significantly attenuated compared to siControl-transfected cells (Fig. 4 E). This data indicates that C1orf50 protein is indeed expressed in breast cancer cells and is imperative to cell cycle progression. C1orf50 promotes Luminal breast cancer stemness properties Cancer stem cell populations have been implicated in the poor prognosis of various cancers [ 31 – 33 ]. We confirmed that C1orf50 expression levels correlate with cancer stem cell-related signatures. Pathway analysis of the association between C1orf50 expression levels and cancer stemness showed that the stemness-related REACTOME_YAP1_AND_WWTR1_TAZ_STIMULATED_GENE_EXPRESS, and RAMALHO_STEMNESS_UP scores were positively correlated with C1orf50 expression, and RAMALHO_STEMNESS_DN scores were negatively correlated with C1orf50 expression (Fig. 5 A). The Hippo signal transducers, YAP/TAZ, are one of the most important factors in the molecular mechanisms that promote cancer stem cells [ 16 , 17 , 34 ]. Many reports have shown that the expression level of YAP/TAZ defines cancer stemness [ 35 ]. Our data suggests that C1orf50 progresses breast cancer stemness through YAP/TAZ signaling. Immunostaining with anti-YAP/TAZ, anti-C1orf50, and anti-NANOG antibodies in tissue arrays showed that C1orf50-high breast cancer cells express YAP/TAZ and NANOG at high levels in Luminal breast cancer cells (Fig. 5 B). Having examined 48 human breast cancer samples, the C1orf50 mean fluorescence intensity (MFI) strongly correlates with both YAP/TAZ ( r = 0.80, p < 0.001 ), and NANOG ( r = 0.77, p < 0.001) MFI scores (Fig. 5 C). We investigated the effect of C1orf50 on breast cancer cell stemness in vitro. First, we infected Luminal-type MCF7 and BT474 cell lines with lentiviruses expressing shRNA against C1orf50 mRNA and performed Western blotting of cell extracts. We observed that C1orf50 protein deficiency results in decreased YAP/TAZ proteins. We confirmed that the expression levels of AXL and CYR61, target proteins of YAP/TAZ signaling, as well as the expression levels of c-MYC and KLF4, factors representing the cancer cell undifferentiated state, were similarly decreased (Fig. 5 D). Since stemness is generally assessed by self-renewal capacity, we evaluated C1orf50-depleted breast cancer cells and confirmed C1orf50 expression is imperative to the self-renewal capacity in breast cancer cells (Fig. 5 E). This was not restricted to Luminal breast cancer cell lines, but also in other breast cancer molecular subtypes (Fig. S3). This suggests that C1orf50 is essential for maintenance of breast cancer stemness. C1orf50 associates with immune evasion signatures in Luminal breast cancer We have shown that C1orf50 expression levels are particularly detrimental to prognosis in a subset of patients with Luminal A stage II breast cancer. The results of the Hallmark pathway analysis suggest that the patients with high C1orf50 expression may have suppressed immunity, but it remains unclear whether there is a patient population in Luminal breast cancer for whom immune checkpoint inhibitors, currently widely used in triple-negative breast cancer, are effective. Therefore, we performed in silico analysis to examine whether the use of immune checkpoint inhibitors may be applicable in patients with high C1orf50 expression. The Hallmark pathway analyses showed that immune response-related pathways were downregulated in the C1orf50-high group (Fig. 3 A-B, Fig S2). We then found that C1orf50 expression negatively correlated with T-cell mediated cytotoxicity (Fig. 6 A). To further investigate the mechanisms behind these findings, we examined the mRNA expression levels of immunosuppressive molecules. As shown in Fig. 6 A-C, the expression levels of PD-L1 (CD274) and PD-L2 (PDCD1LG2) were positively correlated with the expression level of C1orf50, and the expression levels of CMTM4 and CMTM6, regulators of PD-L1 [ 36 ], were also positively correlated with that of C1orf50. This data suggests that the expression level of C1orf50 may have a suppressive effect on immune checkpoint mechanisms regulated by PD-1/PD-L1. Therefore, the expression level of C1orf50 may be a useful marker when considering the application of PD-L1 inhibitors in the Luminal breast cancer patient population. (6) Discussion In this study, we investigated the role of the C1orf50 gene, whose function was previously unknown in breast cancer progression, and confirmed that the prognosis is significantly worse in the group with high C1orf50 mRNA expression by in silico analysis based on data from TCGA stage II breast cancer patients (Fig. 1 B). Interestingly, this trend was more pronounced in patients with Luminal A breast cancer (Fig. 1 D,E). The clinicopathological significance of C1orf50 is that it may aid in improving prognosis of Luminal A breast cancer patients according to C1orf50 expression levels. Current postoperative treatment of resectable hormone-positive HER2-negative breast cancer patients at risk of high recurrence, is considered for CDK4/6 inhibitors in combination with endocrine therapy [ 25 , 26 ]. Increased sensitivity to CDK4/6 inhibitors in breast cancer cell lines with C1orf50 high expression (Fig. 4 B), and given that patients with high levels of C1orf50 expression have a worse prognosis (Fig. 1 D), aggressive administration of CDK4/6 inhibitors may be considered in Luminal breast cancer patients with high C1orf50 expression. Since C1orf50 mRNA has a coding sequence, it was predicted to be translated and expressed as a protein. Immunostaining and Western blot analysis confirmed that it can indeed be detected at the protein level in breast cancer tissues and cell lines (Fig. 2 , 4 D, 5 B). To elucidate the molecular mechanism by which C1orf50 mRNA expression affects Luminal breast cancer progression, we performed pathway analyses and found that the expression level of C1orf50 mRNA is highly correlated with cell cycle and cancer stemness related factors (Fig. 3 – 5 ). In breast cancer cell lines in which C1orf50 expression was knocked down by RNAi, cell proliferation was suppressed and cancer stemness was significantly attenuated (Figs. 4 and 5 ). Importantly, in immunostaining analysis of normal breast tissues and breast cancer tissues, the latter tended to show higher C1orf50 staining (Fig. 2 ). This data shows that C1orf50 expression has a promoting effect in breast carcinogenesis and progression, proving that the molecular mechanisms associated with C1orf50 are worthy of investigation as future drug targets. A limitation of this study is that the details of the molecular mechanisms by which C1orf50 affects the cell cycle and immune checkpoint are not yet known. To clarify this, future analyses focusing on the regulatory mechanism of the YAP/TAZ pathway by C1orf50 should be urgently performed. This is because the YAP/TAZ pathway has been shown to be a cell cycle driver in cancer cells [ 34 ], and there are reports that YAP/TAZ enhances PD-L1 expression and promotes immune evasion [ 37 ]. Our study is important because it is the first report worldwide of the role of a functionally unknown gene, C1orf50, in cancer progression. It also provides clinically important insights in that further analysis of C1orf50 expression may change therapeutic intervention decisions in breast cancer. Abbreviations ER: estrogen receptor SERMs: selective estrogen receptor modulators HER2: human epidermal growth factor receptor 2 C1orf50: Chromosome 1 Open Reading Frame 50 TCGA: The Cancer Genome Atlas TCGA-BRCA: TCGA Breast Invasive Carcinoma CPTAC: Clinical Proteomic Tumor Analysis Consortium MSigDB: the Molecular Signatures Database GSVA: gene set variation analysis IDC: infiltrating ductal carcinoma GSEA: Gene Set Enrichment Analysis YAP: Yes-associated protein TAZ: Transcriptional co-activator with PDZ-binding motif MFI: mean fluorescence intensity Declarations (7) Acknowledgments: We are grateful to the Central Research Laboratory, Okayama University Medical School for their support with confocal microscopy. We thank all members of our laboratory for their valuable commitments to this study. The results published here are in whole, or part, based upon data generated by the TCGA Research Network (https://www.cancer.gov/tcga). Funding Information This work was supported by a Grant-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Sciences, and Technology of Japan (grant numbers: JP23K06676 to A.F.), the Japan Agency for Medical Research and Development (grant numbers: JP19cm0106143 and JP22cm0106179 to A.F.), and the Naito Foundation (A.F.). Conflict of Interest MHR is a member of the Scientific Advisory Board of Universal DX. This company had no influence on support, design, execution, data analysis, or other aspects of this study. The other authors have no conflict of interest. Author Contributions Y.O., A.T. : Data Analysis; visualization; writing – review and editing. M.M. : Data analysis; methodology; writing – review and editing. T.P . ; Data analysis; writing – review and editing. S.T., H.D., M.H.R. : Project administration; writing – review and editing. A.F. : Conceptualization; data curation; formal analysis; funding acquisition; investigation; methodology; project administration; resources; supervision; validation; writing – original draft; writing – review and editing. Ethics Statement -Approval of the research protocol by an Institutional Reviewer Board. The human breast cancer tissue microarray was purchased from TissueArray.com (catalog number: BRM961a). The Ethics Committee of Okayama University concluded that individual review is not required for analyses using commercially available tissue arrays. - Informed Consent. N/A. - Registry and the Registration No. of the study/trial. N/A. - Animal Studies. N/A. References Prat A, Pineda E, Adamo B, Galván P, Fernández A, Gaba L, Díez M, Viladot M, Arance A, Muñoz M. Clinical implications of the intrinsic molecular subtypes of breast cancer. Breast. 2015 Nov;24 Suppl 2:S26-35. doi: 10.1016/j.breast.2015.07.008. Waks AG, Winer EP. Breast Cancer Treatment: A Review. JAMA. 2019 Jan 22;321(3):288-300. doi: 10.1001/jama.2018.19323. Yeo SK, Guan JL. Breast Cancer: Multiple Subtypes within a Tumor? Trends Cancer. 2017 Nov;3(11):753-760. doi: 10.1016/j.trecan.2017.09.001. Roulot A, Héquet D, Guinebretière JM, Vincent-Salomon A, Lerebours F, Dubot C, Rouzier R. Tumoral heterogeneity of breast cancer. Ann Biol Clin (Paris). 2016 Dec 1;74(6):653-660. English. doi: 10.1684/abc.2016.1192. Huber KE, Carey LA, Wazer DE. Breast cancer molecular subtypes in patients with locally advanced disease: impact on prognosis, patterns of recurrence, and response to therapy. Semin Radiat Oncol. 2009 Oct;19(4):204-10. doi: 10.1016/j.semradonc.2009.05.004. Mouabbi JA, Hassan A, Lim B, Hortobagyi GN, Tripathy D, Layman RM. Invasive lobular carcinoma: an understudied emergent subtype of breast cancer. Breast Cancer Res Treat. 2022 Jun;193(2):253-264. doi: 10.1007/s10549-022-06572-w. Saji S, Kuroi K. Application of selective estrogen receptor modulators for breast cancer treatment according to their intrinsic nature. Breast Cancer. 2008;15(4):262-9. doi: 10.1007/s12282-008-0063-y. Takei H, Kurosumi M, Yoshida T, Hayashi Y, Higuchi T, Uchida S, Ninomiya J, Oba H, Inoue K, Nagai S, Tabei T. Neoadjuvant endocrine therapy of breast cancer: which patients would benefit and what are the advantages? Breast Cancer. 2011 Apr;18(2):85-91. doi: 10.1007/s12282-010-0239-0. Prat A, Pineda E, Adamo B, Galván P, Fernández A, Gaba L, Díez M, Viladot M, Arance A, Muñoz M. Clinical implications of the intrinsic molecular subtypes of breast cancer. Breast. 2015 Nov;24 Suppl 2:S26-35. doi: 10.1016/j.breast.2015.07.008. Araki K, Miyoshi Y. Mechanism of resistance to endocrine therapy in breast cancer: the important role of PI3K/Akt/mTOR in estrogen receptor-positive, HER2-negative breast cancer. Breast Cancer. 2018 Jul;25(4):392-401. doi: 10.1007/s12282-017-0812-x. Munzone E, Colleoni M. Optimal management of luminal breast cancer: how much endocrine therapy is long enough? Ther Adv Med Oncol. 2018 Jun 18;10:1758835918777437. doi: 10.1177/1758835918777437. Qian X, Li Z, Ruan G, Tu C, Ding W. Efficacy and toxicity of extended aromatase inhibitors after adjuvant aromatase inhibitors-containing therapy for hormone-receptor-positive breast cancer: a literature-based meta-analysis of randomized trials. Breast Cancer Res Treat. 2020 Jan;179(2):275-285. doi: 10.1007/s10549-019-05464-w. Finetti P, Cervera N, Charafe-Jauffret E, Chabannon C, Charpin C, Chaffanet M, Jacquemier J, Viens P, Birnbaum D, Bertucci F. Sixteen-kinase gene expression identifies luminal breast cancers with poor prognosis. Cancer Res. 2008 Feb 1;68(3):767-76. doi: 10.1158/0008-5472.CAN-07-5516. Gao H, Yang M, Zhang X. Investigating a multigene prognostic assay based on significant pathways for Luminal A breast cancer through gene expression profile analysis. Oncol Lett. 2018 Apr;15(4):5027-5033. doi: 10.3892/ol.2018.7940. Huang R, Yamamoto T, Nakata E, Ozaki T, Kurozumi K, Wei F, Tomizawa K, Fujimura A. CDKAL1 Drives the Maintenance of Cancer Stem-Like Cells by Assembling the eIF4F Translation Initiation Complex. Adv Sci (Weinh). 2023 Apr;10(12):e2206542. doi: 10.1002/advs.202206542. Katayama H, Fujimura A, Huang R, Otani Y, Itano T, Fujiwara T, Kunisada T, Nakata E, Ozaki T. Role of catecholamine synthases in the maintenance of cancer stem-like cells in malignant peripheral nerve sheath tumors. Cancer Sci. 2024 Mar;115(3):871-882. doi: 10.1111/cas.16077. Otani Y, Katayama H, Zhu Y, Huang R, Shigehira T, Shien K, Suzawa K, Yamamoto H, Shien T, Toyooka S, Fujimura A. Adrenergic microenvironment driven by cancer-associated Schwann cells contributes to chemoresistance in patients with lung cancer. Cancer Sci. 2024 Apr 27. doi: 10.1111/cas.16164. Fujimura A, Yasui S, Igawa K, Ueda A, Watanabe K, Hanafusa T, Ichikawa Y, Yoshihashi S, Tsuchida K, Kamiya A, Furuya S. In Vitro Studies to Define the Cell-Surface and Intracellular Targets of Polyarginine-Conjugated Sodium Borocaptate as a Potential Delivery Agent for Boron Neutron Capture Therapy. Cells. 2020 Sep 23;9(10):2149. doi: 10.3390/cells9102149. Takeshita T, Tokumaru Y, Oshi M, Wu R, Patel A, Tian W, Hatanaka Y, Hatanaka KC, Yan L, Takabe K. Clinical Relevance of Estrogen Reactivity in the Breast Cancer Microenvironment. Front Oncol. 2022 May 23;12:865024. doi: 10.3389/fonc.2022.865024. Golbabapour S, Majid NA, Hassandarvish P, Hajrezaie M, Abdulla MA, Hadi AH. Gene silencing and Polycomb group proteins: an overview of their structure, mechanisms and phylogenetics. OMICS. 2013 Jun;17(6):283-96. doi: 10.1089/omi.2012.0105. Lee JY, Won HY, Park JH, Kim HY, Choi HJ, Shin DH, Kang JH, Woo JK, Oh SH, Son T, Choi JW, Kim S, Kim HY, Yi K, Jang KS, Oh YH, Kong G. MEL-18 loss mediates estrogen receptor-α downregulation and hormone independence. J Clin Invest. 2015 May;125(5):1801-14. doi: 10.1172/JCI73743. Liang H, Zhou G, Lv L, Lu J, Peng J. KRAS expression is a prognostic indicator and associated with immune infiltration in breast cancer. Breast Cancer. 2021. Mar;28(2):379-386. doi: 10.1007/s12282-020-01170-4. Ito Y, Kobayashi T, Takeda T, Komoike Y, Wakasugi E, Tamaki Y, Umeshita K, Monden T, Monden M. Immunohistochemical study of Cell Cycle Modulators in G(1)-S Transition in Clinical Breast Cancer Tissue. Breast Cancer . 1996 Jun 28;3(2):93-104. doi: 10.1007/BF02966969. Yu Q, Geng Y, Sicinski P. Specific protection against breast cancers by cyclin D1 ablation. nature . 2001 Jun 28;411(6841):1017-21. doi: 10.1038/ Nature. 2001 Jun 28;411(6841):1017-21. doi: 10.1038/ 35082500. Iwata H. Clinical development of CDK4/6 inhibitor for breast cancer. Breast Cancer . 2018 Jul;25(4):402-406. doi: 10.1007/s12282-017-0827-3. Fassl A, Geng Y, Sicinski P. CDK4 and CDK6 kinases: From basic science to cancer therapy. Science . 2022 Jan 14;375(6577):eabc1495. doi: 10.1126/science .abc1495. Keyomarsi K, Tucker SL, Buchholz TA, Callister M, Ding Y, Hortobagyi GN, Bedrosian I, Knickerbocker C, Toyofuku W, Lowe M, Herliczek TW, Bacus SS. Cyclin E and survival in patients with breast cancer. N Engl J Med. 2002 Nov 14;347(20):1566-75. doi: 10.1056/NEJMoa021153. Erratum in: N Engl J Med 2003 Jan 9;348 (2):186. Li M, Tsavachidis S, Wang F, Bui T, Nguyen TDT, Luo L, Multani AS, Bondy ML, Hunt KK, Keyomarsi K. Low-molecular-weight cyclin E deregulates DNA replication and damage repair to promote genomic instability in breast cancer. Oncogene. 2022 Dec;41(50):5331-5346. doi: 10.1038/s41388-022-02527-z. Song X, Fang C, Dai Y, Sun Y, Qiu C, Lin X, Xu R. Cyclin-dependent kinase 7 (CDK7) inhibitors as a novel therapeutic strategy for different molecular types of Br J Cancer. 2024 May;130(8):1239-1248. doi: 10.1038/s41416-024-02589-8. Broude EV, Győrffy B, Chumanevich AA, Chen M, McDermott MS, Shtutman M, Catroppo JF, Roninson IB. Expression of CDK8 and CDK8-interacting Genes as Potential Biomarkers in Breast Cancer. Curr Cancer Drug Targets. 2015;15(8):739-49. doi: 10.2174/156800961508151001105814. PMID: 26452386; PMCID: PMC4755306. Kai K, Arima Y, Kamiya T, Saya H. Breast cancer stem cells. Breast Cancer. 2010 Apr;17(2):80-5. doi: 10.1007/s12282-009-0176-y. Yamamoto T, Fujimura A, Wei FY, Shinojima N, Kuroda JI, Mukasa A, Tomizawa K. 2-Methylthio Conversion of N6-Isopentenyladenosine in Mitochondrial tRNAs by CDK5RAP1 Promotes the Maintenance of Glioma-Initiating Cells. iScience. 2019 Nov 22;21:42-56. doi: 10.1016/j.isci.2019.10.012. Nogami T, Shien T, Tanaka T, Doihara H, Taira N, Takabatake D, Nishimura R, Nishiyama K, Mizoo T, Ohsumi S. The discordance between primary breast cancer lesions and pulmonary metastatic lesions in expression of aldehyde dehydrogenase 1-positive cancer cells. Breast Cancer. 2014 Nov;21(6):698-702. doi: 10.1007/s12282-013-0445-7. Zanconato F, Cordenonsi M, Piccolo S. YAP/TAZ at the Roots of Cancer. Cancer Cell. 2016 Jun 13;29(6):783-803. doi: 10.1016/j.ccell.2016.05.005. Cordenonsi M, Zanconato F, Azzolin L, Forcato M, Rosato A, Frasson C, Inui M, Montagner M, Parenti AR, Poletti A, Daidone MG, Dupont S, Basso G, Bicciato S, Piccolo S. The Hippo transducer TAZ confers cancer stem cell-related traits on breast cancer cells. Cell. 2011 Nov 11;147(4):759-72. doi: 10.1016/j.cell.2011.09.048. Mezzadra R, Sun C, Jae LT, Gomez-Eerland R, de Vries E, Wu W, Logtenberg MEW, Slagter M, Rozeman EA, Hofland I, Broeks A, Horlings HM, Wessels LFA, Blank CU Xiao Y, Heck AJR, Borst J, Brummelkamp TR, Schumacher TNM. Identification of CMTM6 and CMTM4 as PD-L1 protein regulators Nature. 2017 Sep 7;549(7670): 106-110. doi: 10.1038/nature23669. Janse van Rensburg HJ, Azad T, Ling M, Hao Y, Snetsinger B, Khanal P, Minassian LM, Graham CH, Rauh MJ, Yang X. The Hippo Pathway Component TAZ Promotes Immune Evasion in Human Cancer through PD-L1. Cancer Res. 2018 Mar 15;78(6):1457-1470. doi: 10.1158/0008-5472.CAN-17-3139. Supplementary Files OtaniSupplemental240630.pdf List of Supporting Information: Doc. S1. Supplemental Materials and Methods Supplementary figure 1. Kaplan-Meier curves for overall survival in (A) stage II Luminal B breast cancer patients, (B) stage II HER2 breast cancer patients, (C) stage II breast cancer patients (≥ 50 y/o), (D) stage II breast cancer patients (< 50 y/o), (E) stage II Luminal A breast cancer (≥ 50 y/o), (F) stage II Luminal A breast cancer (< 50 y/o). Supplementary figure 2. Gene set terms with an FDR value of less than 0.05 when comparing the C1orf50-high group and the C1orf50-low group in GSEA are shown. (A) C6 (Oncogenic signature) gene sets, (B) Gene Ontology Biological Process (GOBP) gene sets, (C) Kyoto Encyclopedia of Genes and Genomes (KEGG) gene sets. Supplementary figure 3. C1orf50 depletion leads to the loss of self-renewal capacity in breast cancer cells ( n = 4 ; error bars indicate mean ± SD). (A) SK-Br-3; HER2-subtype cell line, (B) MDA-MB-231; triple negative-subtype cell line. *: p < 0.05, **: p < 0.01, ***: p < 0.001. Analysis was performed using one-way ANOVA with Bonferroni's multiple comparisons. Supplementary table 1. Antibodies used for immunostaining. Supplementary table 2. Antibodies used for western blotting. Cite Share Download PDF Status: Published Journal Publication published 28 Nov, 2024 Read the published version in Breast Cancer → Version 1 posted Editorial decision: Major Revision 19 Aug, 2024 Reviewers agreed at journal 10 Jul, 2024 Reviewers invited by journal 07 Jul, 2024 Editor assigned by journal 02 Jul, 2024 First submitted to journal 29 Jun, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4660291","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":323859334,"identity":"f91d3e9d-7023-4688-8ca9-48eb5ae578a9","order_by":0,"name":"Yusuke Otani","email":"","orcid":"","institution":"Beth Israel Deaconess Medical Center","correspondingAuthor":false,"prefix":"","firstName":"Yusuke","middleName":"","lastName":"Otani","suffix":""},{"id":323859335,"identity":"05fabfbc-a942-4d85-9e74-a13f2d479783","order_by":1,"name":"Atsushi Tanaka","email":"","orcid":"","institution":"Beth Israel Deaconess Medical Center","correspondingAuthor":false,"prefix":"","firstName":"Atsushi","middleName":"","lastName":"Tanaka","suffix":""},{"id":323859336,"identity":"24add8e5-a382-4980-93f8-5b751cc92f8d","order_by":2,"name":"Masaki Maekawa","email":"","orcid":"","institution":"Beth Israel Deaconess Medical Center","correspondingAuthor":false,"prefix":"","firstName":"Masaki","middleName":"","lastName":"Maekawa","suffix":""},{"id":323859337,"identity":"43574911-44b9-4826-94bb-6462c3f82258","order_by":3,"name":"Tirso Peña","email":"","orcid":"","institution":"Beth Israel Deaconess Medical Center","correspondingAuthor":false,"prefix":"","firstName":"Tirso","middleName":"","lastName":"Peña","suffix":""},{"id":323859338,"identity":"945e8912-2461-4e31-8444-9aa924be540c","order_by":4,"name":"Shinichi Toyooka","email":"","orcid":"","institution":"Okayama University Graduate School of Medicine Dentistry and Pharmaceutical Sciences: Okayama Daigaku Daigakuin Ishiyakugaku Sogo Kenkyuka Igakubu","correspondingAuthor":false,"prefix":"","firstName":"Shinichi","middleName":"","lastName":"Toyooka","suffix":""},{"id":323859339,"identity":"d6adc6af-a2f9-4094-949a-fac283921065","order_by":5,"name":"Hiroyoshi Doihara","email":"","orcid":"","institution":"Kawasaki Medical School: Kawasaki Ika Daigaku","correspondingAuthor":false,"prefix":"","firstName":"Hiroyoshi","middleName":"","lastName":"Doihara","suffix":""},{"id":323859340,"identity":"b8dfac0b-44dc-4e3a-89e6-498c30c6be8d","order_by":6,"name":"Michael H Roehrl","email":"","orcid":"","institution":"Beth Israel Deaconess Medical Center","correspondingAuthor":false,"prefix":"","firstName":"Michael","middleName":"H","lastName":"Roehrl","suffix":""},{"id":323859341,"identity":"f6b61e23-5bc9-4a7a-b113-133a5f407d59","order_by":7,"name":"Atsushi Fujimura","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABSUlEQVRIie2RMUvDQBSAXxQuy4tdrwTav5BSKBYp/SsvBNoluhTEociBcF2Krl3EvyAIxc1g4LoU55SA2MXJQShIS0FM2lptUsRRMB8Hd+/ufbx3dwAZGX8VTXDQBZAXBzlgG4cslc5WCnorJS9+p0CsLLG8dNIGuavOc352uw/IaXw/ko/F8kDaE2z3i8BJe53C3lFC4QorpjHksUL+oWyV+kPlm6jCkuC0m+8CayXLKGSmJjnUlwpp/aApTGShdhcQmFHnttg0ikqPGpPrKlS/6TXP5vge1uMq8y2KpaDCjW+Kfc0byjRkaEcK21alpNzyQaQg4hP57gM5vaFqVC/PQ0fgWFa7VuouBX8wHs3kaQF115m4x1S76Mhy8PIW1oTu+MH0RCVf7BOMBq2jHVxM8X9ZirYKC3RvvdSmX9vtH5SMjIyM/8EH51hxHNsQ6BMAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0002-8638-5460","institution":"Okayama University Graduate School of Medicine Dentistry and Pharmaceutical Sciences Cellular Physiology: Okayama Daigaku Daigakuin Ishiyakugaku Sogo Kenkyuka Igakubu","correspondingAuthor":true,"prefix":"","firstName":"Atsushi","middleName":"","lastName":"Fujimura","suffix":""}],"badges":[],"createdAt":"2024-06-29 17:45:54","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4660291/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4660291/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s12282-024-01653-8","type":"published","date":"2024-11-28T15:58:20+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":62134165,"identity":"e78d1b96-f366-4e34-96f2-ca3160777849","added_by":"auto","created_at":"2024-08-09 16:03:42","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":440621,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eC1orf50 is a prognostic marker for Luminal A breast cancer.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(\u003cstrong\u003eA\u003c/strong\u003e) The difference of the \u003cem\u003eC1orf50 \u003c/em\u003eexpression value between subtypes in primary IDC (all stages).\u003c/p\u003e\n\u003cp\u003e(\u003cstrong\u003eB\u003c/strong\u003e) Number of samples of stage I to IV primary IDC by subtype, in the TCGA database.\u003c/p\u003e\n\u003cp\u003e(\u003cstrong\u003eC-F\u003c/strong\u003e) The Kaplan-Meier curves for 10-year overall survival in the C1orf50-high and C1orf50-low groups of stage II: all (\u003cstrong\u003eC\u003c/strong\u003e), Luminal (\u003cstrong\u003eD\u003c/strong\u003e), Luminal A (\u003cstrong\u003eE\u003c/strong\u003e), and Basal (\u003cstrong\u003eF\u003c/strong\u003e) subtype breast cancer patients.\u003c/p\u003e","description":"","filename":"Fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-4660291/v1/f74a598aaf5c3225fcc162c0.png"},{"id":62134162,"identity":"0b5055e6-7eb3-444f-a11f-d4bcfb815f5a","added_by":"auto","created_at":"2024-08-09 16:03:41","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":4161958,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eC1orf50 is abundantly expressed in breast cancer tissues.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(\u003cstrong\u003eA\u003c/strong\u003e) \u003cem\u003eC1orf50\u003c/em\u003emRNA and C1orf50 protein expression are positively correlated in the CPTAC dataset. Spearman’s rank correlation coefficient assesses the strength and direction of association between two ranked variables.\u003c/p\u003e\n\u003cp\u003e(\u003cstrong\u003eB\u003c/strong\u003e) Representative image of normal breast tissue immunostained with anti-C1orf50 antibody (red). Nuclei are stained with DAPI (blue). Scale bar, 50 μm.\u003c/p\u003e\n\u003cp\u003e(\u003cstrong\u003eC\u003c/strong\u003e) Using mean fluorescence intensity (MFI), C1orf50 expression is shown to be significantly higher in primary and metastatic breast cancer tissues compared to normal breast tissue. *: \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05. Analysis was performed using one-way ANOVA with Tukey-Kramer's multiple comparisons.\u003c/p\u003e\n\u003cp\u003e(\u003cstrong\u003eD\u003c/strong\u003e) Representative immunostaining images using anti-C1orf50 antibody in primary breast cancer lesion (top) and metastatic lesion in lymph node (bottom) with Luminal A, Luminal B, HER2, and triple negative subtypes. Nuclei are stained with DAPI (blue). Scale bar, 50 μm.\u003c/p\u003e","description":"","filename":"Fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-4660291/v1/f4975faeb34ee67bad1d8faf.png"},{"id":62134163,"identity":"8daf883a-028e-4325-906d-0f4513b457b3","added_by":"auto","created_at":"2024-08-09 16:03:41","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":334600,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePathway analyses show C1orf50 expression is associated with cell cycle activity, immunoreactive and estrogen-responsive gene groups in Luminal A breast cancer.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(\u003cstrong\u003eA\u003c/strong\u003e) Gene set enrichment analysis (GSEA) of Hallmark gene sets, focusing on the C1orf50-high group of stage II Luminal A breast cancer.\u003c/p\u003e\n\u003cp\u003e(\u003cstrong\u003eB\u003c/strong\u003e) Hallmark gene set terms with an FDR value of less than 0.01 when comparing the C1orf50-high group and the C1orf50-low group in Gene Set Variation Analysis are shown.\u003c/p\u003e","description":"","filename":"Fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-4660291/v1/dc91acb67d61eb0ad180130c.png"},{"id":62134161,"identity":"2ec2b786-0440-4375-b03f-4dd2bf27f666","added_by":"auto","created_at":"2024-08-09 16:03:41","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":486643,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHigh expression levels of C1orf50 are pertinent to increased cell cycle signatures.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(\u003cstrong\u003eA\u003c/strong\u003e) Heatmap of cell cycle-related genes and pathways focusing on\u003cem\u003e C1orf50\u003c/em\u003e expression levels.\u003c/p\u003e\n\u003cp\u003e(\u003cstrong\u003eB\u003c/strong\u003e) Cell survival analysis with serially diluted abemaciclib in BT474-control and -myc C1orf50-transfected cells. IC\u003csub\u003e50\u003c/sub\u003e values are shown in the table (\u003cem\u003en = 6\u003c/em\u003e).\u003c/p\u003e\n\u003cp\u003e(\u003cstrong\u003eC\u003c/strong\u003e) A box plot comparing RNA levels of \u003cem\u003eCDK1–9\u003c/em\u003e in the C1orf50-low and C1orf50-high groups. \u003cem\u003eCDK3\u003c/em\u003e is not shown because of the lack of expression data in the cohort. Comparisons between the two groups were performed using the Wilcoxon test.\u003c/p\u003e\n\u003cp\u003e(\u003cstrong\u003eD\u003c/strong\u003e) Immunoblotting image of BT474 cells transfected with siRNA. Both \u003cem\u003eC1orf50\u003c/em\u003e #1 and #2 siRNA successfully attenuated the C1orf50 protein. Histone H3 serves as a loading control.\u003c/p\u003e\n\u003cp\u003e(\u003cstrong\u003eE\u003c/strong\u003e) Growth curve of BT474 cells transfected with siRNA. C1orf50 depletion significantly attenuated cell growth (\u003cem\u003en = 6\u003c/em\u003e, error bars indicate mean ± SD). **: \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.01, ***: \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.001. Analysis was performed using one-way ANOVA with Bonferroni's multiple comparisons.\u003c/p\u003e","description":"","filename":"Fig4.png","url":"https://assets-eu.researchsquare.com/files/rs-4660291/v1/fe429cf2dacf29635cbd357c.png"},{"id":62134167,"identity":"61c3af83-ba69-41d7-97ad-d112d4abea0f","added_by":"auto","created_at":"2024-08-09 16:03:42","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":3499878,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe expression of C1orf50 is essential to cancer stemness in Luminal breast cancer.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(\u003cstrong\u003eA\u003c/strong\u003e) Heatmap of cancer stem cell-related genes and pathways focusing on \u003cem\u003eC1orf50\u003c/em\u003e expression levels. The word \"BCSCs\" was used as an abbreviation for “Breast Cancer Stem Cells.\"\u003c/p\u003e\n\u003cp\u003e(\u003cstrong\u003eB\u003c/strong\u003e) Representative immunostaining images with anti-YAP/TAZ (green), anti-C1orf50 (red), and anti-NANOG (gray) antibodies in normal breast tissue and Luminal A breast cancer tissue. Nuclei are stained with DAPI (blue). Scale bar, 100 μm.\u003c/p\u003e\n\u003cp\u003e(\u003cstrong\u003eC\u003c/strong\u003e) C1orf50 MFI correlates with YAP/TAZ (\u003cem\u003er = 0.80, p \u0026lt; 0.001\u003c/em\u003e) and NANOG (\u003cem\u003er = 0.77, p \u0026lt; 0.001) \u003c/em\u003eMFI. Spearman’s rank correlation coefficient assesses the strength and direction of association between two ranked variables.\u003c/p\u003e\n\u003cp\u003e(\u003cstrong\u003eD\u003c/strong\u003e) C1orf50 knockdown attenuated the protein levels of YAP and TAZ, as well as their target genes AXL and CYR61. Loss of C1orf50 also decreases the expression levels of c-MYC and KLF4. Alpha tubulin serves as a loading control.\u003c/p\u003e\n\u003cp\u003e(\u003cstrong\u003eE\u003c/strong\u003e) C1orf50 depletion leads to the loss of self-renewal capacity on Luminal breast cancer cells (\u003cem\u003en = 4\u003c/em\u003e, error bars indicate mean ± SD). *: \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05, **: \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.01, ***: \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.001. Analysis was performed using one-way ANOVA with Bonferroni's multiple comparisons.\u003c/p\u003e","description":"","filename":"Fig5.png","url":"https://assets-eu.researchsquare.com/files/rs-4660291/v1/ccd22cf20f47a126277f87c1.png"},{"id":62134164,"identity":"3ae47ce4-f803-435b-9ee0-c7b817e4c36d","added_by":"auto","created_at":"2024-08-09 16:03:41","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":316566,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCorrelation of C1orf50 expression with PD-1/PD-L1 related molecules in Luminal A stage II breast cancer.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(\u003cstrong\u003eA\u003c/strong\u003e) Heatmap of PD-1/PD-L1 related genes and the GOBP_T_CELL_CYTOTOXICITY pathway compared across C1orf50 expression levels. The word \"T_CELL_CYTOTOXICITY\" in the heatmap was used as an abbreviation for “GOBP_T_CELL_MEDIATED_CYTOTOXICITY\".\u003c/p\u003e\n\u003cp\u003e(\u003cstrong\u003eB\u003c/strong\u003e) Co-occurrence and mutual exclusiveness analysis of the immune related genes and the GOBP_T_CELL_CYTOTOXICITY pathway. *: \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05, **: \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.01, ***: \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.001. Correlation tests were performed based on Pearson's product-moment correlation coefficient\u003c/p\u003e\n\u003cp\u003e(\u003cstrong\u003eC\u003c/strong\u003e) A box plot comparing RNA levels of PD-1/PD-L1 related genes between the C1orf50-low and C1orf50-high groups. Comparisons between the two groups were performed using the Wilcoxon test.\u003c/p\u003e","description":"","filename":"Fig6.png","url":"https://assets-eu.researchsquare.com/files/rs-4660291/v1/151b8c333adbc1428d8e3afb.png"},{"id":70388759,"identity":"37e12f88-40c1-4857-a984-1dab80c2cbd5","added_by":"auto","created_at":"2024-12-02 17:27:05","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":11924810,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4660291/v1/ae1e27e2-a012-4dec-90f0-9196c8fd7472.pdf"},{"id":62134807,"identity":"d8c2f12f-15fa-41cf-ba85-c1c87cc68725","added_by":"auto","created_at":"2024-08-09 16:11:41","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":1136164,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eList of Supporting Information\u003c/strong\u003e:\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDoc. S1\u003c/strong\u003e. Supplemental Materials and Methods\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSupplementary figure 1.\u003c/strong\u003e Kaplan-Meier curves for overall survival in (\u003cstrong\u003eA\u003c/strong\u003e) stage II Luminal B breast cancer patients, (\u003cstrong\u003eB\u003c/strong\u003e) stage II HER2 breast cancer patients, (\u003cstrong\u003eC\u003c/strong\u003e) stage II breast cancer patients (≥ 50 y/o), (D) stage II breast cancer patients (\u0026lt; 50 y/o), (E) stage II Luminal A breast cancer (≥ 50 y/o), (F) stage II Luminal A breast cancer (\u0026lt; 50 y/o).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSupplementary figure 2\u003c/strong\u003e. Gene set terms with an FDR value of less than 0.05 when comparing the C1orf50-high group and the C1orf50-low group in GSEA are shown. (\u003cstrong\u003eA\u003c/strong\u003e) C6 (Oncogenic signature) gene sets, (\u003cstrong\u003eB\u003c/strong\u003e) Gene Ontology Biological Process (GOBP) gene sets, (\u003cstrong\u003eC\u003c/strong\u003e) Kyoto Encyclopedia of Genes and Genomes (KEGG) gene sets.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSupplementary figure 3\u003c/strong\u003e. C1orf50 depletion leads to the loss of self-renewal capacity in breast cancer cells (\u003cem\u003en = 4\u003c/em\u003e; error bars indicate mean ± SD). (\u003cstrong\u003eA\u003c/strong\u003e) SK-Br-3; HER2-subtype cell line, (\u003cstrong\u003eB\u003c/strong\u003e) MDA-MB-231; triple negative-subtype cell line. *: \u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05, **: \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, ***: \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001. Analysis was performed using one-way ANOVA with Bonferroni's multiple comparisons.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSupplementary table 1. \u003c/strong\u003eAntibodies used for immunostaining.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSupplementary table 2. \u003c/strong\u003eAntibodies used for western blotting.\u003c/p\u003e","description":"","filename":"OtaniSupplemental240630.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4660291/v1/8fe972f159f8dcc4f7e92af8.pdf"}],"financialInterests":"","formattedTitle":"The Role of C1orf50 in Breast Cancer Progression and Prognosis","fulltext":[{"header":"(3) Introduction","content":"\u003cp\u003eBreast cancer is the most common cancer in women, and one of the first cancers for which pathological classification based on molecular phenotype was introduced [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. The molecular characteristics of each subtype have been widely and deeply understood, but the heterogeneity of the subtypes is not commonly reviewed [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Defined as a subtype of hormone receptor positive cancer, estrogen receptor (ER)-positive breast cancer accounts for approximately 70 percent of all breast cancers [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Since ER-positive breast cancer cells depend on endogenous estrogen for their growth, selective estrogen receptor modulators (SERMs), such as tamoxifen or aromatase inhibitors, have improved prognosis [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. However, it is known that approximately 20% of patients with ER-positive breast cancer have a poor prognosis and develop metastasis or recurrence even after hormone therapy [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Various attempts have been made to improve the prognosis of these patients, including extending the duration of postoperative hormone therapy from 5 to 10 years and adding postoperative chemotherapy [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Studies have proposed increasingly popular methods in risk classification via multi-gene expression assays as novel predictors for poor prognostic factors in hormone receptor-positive and human epidermal growth factor receptor 2 (HER2)-negative breast cancer patients [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Yet, no single gene has been found as a sole predictor for these patient groups nor for drug indication.\u003c/p\u003e \u003cp\u003eWe searched the Cancer Genome Atlas-Breast Invasive Carcinoma (TCGA-BRCA) dataset for genes of unknown function that may be involved in the prognosis of early stage ER-positive breast cancer. We found that the gene, Chromosome 1 Open Reading Frame 50 (C1orf50), is strongly correlated with the prognosis of stage II Luminal A breast cancer, which is considered to have a low biological malignancy among ER-positive breast cancers. In this study, we used biological, biochemical, and bioinformatic analyses to examine the role of C1orf50 in breast cancer progression. These analyses help to improve treatment outcomes by identifying new prognostic factors in breast cancer, while simultaneously identifying new potential drug targets for breast cancer therapies.\u003c/p\u003e"},{"header":"(4) Material and Methods","content":"\u003cp\u003e \u003cb\u003eImmunofluorescent analysis and confocal microscopy\u003c/b\u003e: Immunofluorescent analysis on the breast cancer tissue array was performed as previously described [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. The breast cancer tissue array was purchased from TissueArray.com (catalog number: BRM961a). After deparaffinization with xylene, the section was incubated with HistoVT One (Nacalai Tesque) for antigen retrieval following the manufacturer\u0026rsquo;s instructions, blocked with 1% bovine serum albumin (BSA) (Sigma-Aldrich) in phosphate buffered saline with 0.05% Trion X-100 (PBST) for 1h at room temperature (~\u0026thinsp;25\u0026deg;C). The section was incubated with primary antibodies in BSA-PBST at 4\u0026deg;C overnight. After washing with PBST three times, the section was then incubated with secondary antibodies in BSA-PBST at room temperature for 1h and mounted with DAPI-Fluoromount-G (SouthernBiotech). The section was observed using a confocal microscope, LSM780 (Carl Zeiss AG). Details of the antibodies are described in Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cb\u003eCell cultures and treatments\u003c/b\u003e: Human breast cancer cell line MCF7 was obtained from the Japanese Collection of Research Bioresources (JCRB), and BT474, SK-BR-3, and MDA-MB-231 were from the American Type Culture Collection (ATCC). All cells were cultured at 37\u0026deg;C containing 5% CO2 in high glucose Dulbecco\u0026rsquo;s modified Eagle\u0026rsquo;s medium (DMEM, Fujifilm-Wako) supplemented with 10% fetal bovine serum (FBS, Corning) and 1% penicillin/streptomycin/L-glutamine (Fujifilm-Wako). RNAi experiments were performed using siRNA, Lipofectamine RNAiMAX (Thermo Fisher Scientific), and Opti-MEM (Thermo Fisher Scientific). The following siRNAs were used in this study, listed as [Target gene/Source/Identifier]: [negative control/Thermo Fisher Scientific/4390844]; [human C1orf50/Thermo Fisher Scientific/s35534]; [human C1orf50/Thermo Fisher Scientific/s35535]; [human C1orf50/Thermo Fisher Scientific/s35536]. Lentiviral preparation and infection were performed as previously reported [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Briefly, 293FT cells were transfected with viral backbone plasmids (pLKO.1-puro for shRNA and pTomo for overexpression), psPAX2, and pMD2.G using TransIT-LT1 transfection reagent (TaKaRa Bio) and Opti-MEM. The virus containing medium was harvested and filtered with polysulfone membrane. The following target sequences of shRNA were used in this study: Human C1orf50 #1 [CTGCACCATGTAGCTTGTAAT]; Human C1orf50 #2 [GTCAGTCAGTTTCAGAGTATT]; Control [CCTAAGGTTAAGTCGCCCTCG]. The sphere-formation assay experiments were performed as previously reported [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003cstrong\u003eImmunoblotting analysis\u003c/strong\u003e \u003cp\u003eImmunoblotting experiments were performed as previously described [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. The cell lysate was prepared using cell lysis buffer (20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1 mM ethylenediaminetetraacetic acid, 1 mM ethylene glycol-bis(2-aminoethylether)-N,N,N',N'-tetraacetic acid, 1% Triton X-100, cOmplete Protease Inhibitor Cocktail tablets (Roche), PhosSTOP phosphatase inhibitor cocktail tablets (Roche) and boiled in sodium dodecyl sulfate (SDS) sample buffer (50 mM Tris-HCl (pH 6.5), 100 mM dithiothreitol, 2% SDS, 1.5 mM bromophenol blue, 1.075 M glycerol). Equivalent amounts of each protein were loaded into acrylamide gel and transferred onto polyvinylidene fluoride (PVDF) membranes (Immobilon-P, 0.45 \u0026micro;m, Millipore). The membranes were then subjected to immunodetection using the antibodies listed below. The signals were detected using a ChemiDoc Touch Imaging System (Bio-Rad). Details of the antibodies are described in Table S2.\u003c/p\u003e \u003c/p\u003e \u003cp\u003eFor the other materials and methods regarding bioinformatics analyses and statistics, see Doc. S1 and Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e\u0026ndash;2.\u003c/p\u003e"},{"header":"(5) Results","content":"\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eDiscovery of C1orf50 as a prognostic marker for Luminal A breast cancer\u003c/h2\u003e \u003cp\u003eWe investigated whether \u003cem\u003eC1orf50\u003c/em\u003e mRNA expression plays a prognostic role using the TCGA-BRCA dataset, in which RNAseq data is accompanied by survival information. For the analysis, we included 747 cases of primary tumor and infiltrating ductal carcinoma (IDC) in the TCGA-BRCA dataset. When comparing the expression levels of \u003cem\u003eC1orf50\u003c/em\u003e by IDC subtype, it was found that Luminal A breast cancer showed significantly higher expression levels of \u003cem\u003eC1orf50\u003c/em\u003e than non-Luminal A breast cancer (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). When examining the primary IDC breast cancer patient population registered in TCGA, it was found that there were many patients with stage II breast cancer (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Since the prognosis for stage I breast cancer is widely known, this analysis focused primarily on patients with stage II breast cancer. Using the median of \u003cem\u003eC1orf50\u003c/em\u003e mRNA expression values, we divided stage II breast cancer patients into C1orf50-high and C1orf50-low groups and performed survival analysis of stage II breast cancer patients, finding a significant (\u003cem\u003ep\u003c/em\u003e = 0.045) difference in 10-year survival (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). In particular, a trend towards a greater divergence in the survival curve was observed from 5 years. In the analysis of stage II breast cancer patients by histological subtype, a significant difference in 10-year survival was observed in patients with Luminal-type breast cancer (\u003cem\u003ep\u003c/em\u003e = 0.044), which is characterized by estrogen receptor expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). This difference was particularly significant (\u003cem\u003ep\u003c/em\u003e = 0.01) in the group of patients with Luminal A breast cancer (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). There was no significant difference in 10-year survival rates among patients with triple negative, HER2, and Luminal B stage II breast cancer (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE and Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). This data suggest that the expression level of \u003cem\u003eC1orf50\u003c/em\u003e mRNA is a prognostic marker, especially in patients with stage II luminal A breast cancer. In addition, we investigated whether C1orf50 has different effects in premenopausal and postmenopausal breast cancer. In this study, we re-categorized women aged 50 years or older as postmenopausal, and found that C1orf50 may be a factor involved in survival in stage II breast cancer in postmenopausal patients (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eC-F).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eNext, we determined whether C1orf50 is expressed at the protein level in breast cancer tissues. Using a cohort of breast cancer patients from the Clinical Proteomic Tumor Analysis Consortium (CPTAC), we analyzed whether \u003cem\u003eC1orf50\u003c/em\u003e mRNA and C1orf50 protein expression were correlated (\u003cem\u003er = 0.49, p \u0026lt; 0.001)\u003c/em\u003e, and found a positive correlation (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Furthermore, immunostaining with anti-C1orf50 antibody in tissue arrays composed of normal mammary tissues and breast cancer tissues showed that C1orf50 protein expression was low in normal mammary tissue (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB), whereas the expression of C1orf50 protein was high in breast cancer tissues of all subtypes (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC, \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD upper panels). Importantly, C1orf50 expression was found to be maintained at high levels not only in primary lesions but also in metastatic lesions of the lymph nodes (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC, \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD lower panels). This data suggests that C1orf50 expression is upregulated in cancer cells compared to normal cells and that its expression is independent of the environment in which the cancer cells are located. In addition, the positive correlation between \u003cem\u003eC1orf50\u003c/em\u003e mRNA and C1orf50 protein expression suggests that it is reasonable to evaluate C1orf50 protein as a prognostic marker in pathological specimens by immunostaining or other methods.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003ePathway analyses of C1orf50 in Luminal A breast cancer\u003c/h2\u003e \u003cp\u003eThe data above shows that stage II breast cancer patients with high C1orf50 expression have a significantly worse prognosis (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The function of C1orf50 has not been previously reported, and its physiological and pathological roles and association with cancer biology remain completely unknown. To elucidate the molecular mechanisms of how C1orf50 promotes cancer progression, we performed pathway analysis focusing on \u003cem\u003eC1orf50\u003c/em\u003e mRNA expression levels using the TCGA-BRCA dataset. First, we divided the TCGA data of stage II Luminal A breast cancer patients into C1orf50-high and C1orf50-low groups and performed Gene Set Enrichment Analysis (GSEA) using the Molecular Signatures Database (MSigDB) hallmark gene sets, and found a significant increase in the MITOTIC_SPINDLE gene set, which is related to the cell cycle. We also found a decrease in the OXIDATIVE_PHOSPHORYLATION gene set, which is related to mitochondrial function, as well as a decrease in INTERFERON_ALPHA_RESPONSE, INTERFERON_GAMMA_RESPONSE, and ALLOGRAFT_REJECTION, which are related to immune response (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Interestingly, we observed a decrease in the ESTROGEN_RESPONSE_LATE gene set: it has been reported that the value of this pathway correlates with estrogen reactivity [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e], suggesting that a decrease in estrogen reactivity occurs in the C1orf50-high patient group. Furthermore, the Gene Set Variation Analysis (GSVA) confirmed a similar trend to the GSEA results, as well as stronger association with transforming growth factor (TGF) beta signaling in the C1orf50-high group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). This data suggests that in stage II Luminal A breast cancer patients with higher levels of C1orf50 expression are associated with an increased cell cycle activity, while lower levels of C1orf50 expression are associated with decreased expression of immunoreactive and estrogen responsive gene groups.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eNext, we performed the same analysis on the MsigDB C6 (Oncogenic signature) gene sets and found that the MEL18 gene signature and the BMI1 gene signature were decreased in the C1orf50-high group (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eA). MEL18 and BMI1 are Polycomb proteins involved in gene silencing [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. In addition, since it has been reported that MEL18 deficiency leads to the reduction of estrogen receptors, which results in hormone-sensitive breast cancer cells acquiring the ability to grow in a hormone-independent manner [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e], C1orf50 may have a strong role in hormone insensitivity in Luminal breast cancer patients. In the C6 gene set, several KRAS-related pathways have been shown to be upregulated; previous studies have shown that increased expression of KRAS in the TCGA-BRCA dataset is associated with an increase in PD-L1 [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e], suggesting that C1orf50 may indirectly contribute to immune reactivity or immune evasion. The Gene Ontology Biological Process (GOBP) gene sets showed a trend toward decreased pathways related to mitochondrial function, as well as decreased pathways related to immune response (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eB). Further analysis using the Kyoto Encyclopedia of Genes and Genomes (KEGG) gene sets, revealed decreased oxidative phosphorylation and decreased antigen processing and presentation (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eC). This data suggests that C1orf50 is widely implicated in cancer signaling, regulation of mitochondrial function, and immune evasion.\u003c/p\u003e \u003cp\u003e \u003cb\u003eExpression levels of C1orf50 determine cell cycle and response to CDK4/6 inhibitors of Luminal breast cancer\u003c/b\u003e \u003c/p\u003e \u003cp\u003eSince the C1orf50-high group had enhanced cell cycle gene sets in both GSEA and GSVA, we analyzed the correlation between the expression level of C1orf50 and that of cell cycle-related factors. We found a positive correlation with components of the cyclin D:CDK4/6 complex and the cyclin E:CDK2 complex (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). The cyclin D:CDK4/6 complex is a factor that promotes breast cancer progression [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e], and CDK4/6 inhibitors have recently been administered to patients with unresectable or recurrent Luminal breast cancer [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. The cyclin E:CDK2 complex has been reported to be involved in breast cancer progression [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Interestingly, BT474 cells exogenously transfected with C1orf50 showed increased sensitivity to abemaciclib, a CDK4/6 inhibitor drug (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). We compared the relationship between the expression levels of C1orf50 and eight CDKs in the dataset and found that the expression of CDK2, CDK4, CDK6, CDK7, and CDK8 was significantly higher in the C1orf50-high group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). CDK7 forms a complex with cyclin H and MAT1 and acts as a CDK-activating kinase that phosphorylates and activates CDK2 and CDK4/6 [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. It has been reported that when CDK8 expression is high in various carcinomas, especially breast cancer, a poor prognosis is found [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. This data suggests that high levels of C1orf50 expression contribute to cell cycle acceleration.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo confirm that C1orf50 is indeed associated with cell cycle progression, we transfected siRNAs against \u003cem\u003eC1orf50\u003c/em\u003e mRNA into Luminal-type BT474 cells and tested whether the proliferative capacity of the cells would be affected. Two unique siRNAs against \u003cem\u003eC1orf50\u003c/em\u003e mRNA each attenuated the protein level of C1orf50 in BT474 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). This indicates that the anti-C1orf50 antibodies used in this study accurately recognize the C1orf50 protein. After siRNA transfection at 24, 48, 72, and 96 hours, cell numbers were assessed using the MTS assay and showed that the proliferation of siC1orf50-transfected cells was significantly attenuated compared to siControl-transfected cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). This data indicates that C1orf50 protein is indeed expressed in breast cancer cells and is imperative to cell cycle progression.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eC1orf50 promotes Luminal breast cancer stemness properties\u003c/h2\u003e \u003cp\u003eCancer stem cell populations have been implicated in the poor prognosis of various cancers [\u003cspan additionalcitationids=\"CR32\" citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e–\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. We confirmed that C1orf50 expression levels correlate with cancer stem cell-related signatures. Pathway analysis of the association between C1orf50 expression levels and cancer stemness showed that the stemness-related REACTOME_YAP1_AND_WWTR1_TAZ_STIMULATED_GENE_EXPRESS, and RAMALHO_STEMNESS_UP scores were positively correlated with C1orf50 expression, and RAMALHO_STEMNESS_DN scores were negatively correlated with C1orf50 expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). The Hippo signal transducers, YAP/TAZ, are one of the most important factors in the molecular mechanisms that promote cancer stem cells [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Many reports have shown that the expression level of YAP/TAZ defines cancer stemness [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Our data suggests that C1orf50 progresses breast cancer stemness through YAP/TAZ signaling.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eImmunostaining with anti-YAP/TAZ, anti-C1orf50, and anti-NANOG antibodies in tissue arrays showed that C1orf50-high breast cancer cells express YAP/TAZ and NANOG at high levels in Luminal breast cancer cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). Having examined 48 human breast cancer samples, the C1orf50 mean fluorescence intensity (MFI) strongly correlates with both YAP/TAZ (\u003cem\u003er = 0.80, p \u0026lt; 0.001\u003c/em\u003e), and NANOG (\u003cem\u003er = 0.77, p \u0026lt; 0.001)\u003c/em\u003e MFI scores (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). We investigated the effect of C1orf50 on breast cancer cell stemness in vitro. First, we infected Luminal-type MCF7 and BT474 cell lines with lentiviruses expressing shRNA against \u003cem\u003eC1orf50\u003c/em\u003e mRNA and performed Western blotting of cell extracts. We observed that C1orf50 protein deficiency results in decreased YAP/TAZ proteins. We confirmed that the expression levels of AXL and CYR61, target proteins of YAP/TAZ signaling, as well as the expression levels of c-MYC and KLF4, factors representing the cancer cell undifferentiated state, were similarly decreased (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). Since stemness is generally assessed by self-renewal capacity, we evaluated C1orf50-depleted breast cancer cells and confirmed C1orf50 expression is imperative to the self-renewal capacity in breast cancer cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE). This was not restricted to Luminal breast cancer cell lines, but also in other breast cancer molecular subtypes (Fig. S3). This suggests that C1orf50 is essential for maintenance of breast cancer stemness.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eC1orf50 associates with immune evasion signatures in Luminal breast cancer\u003c/h2\u003e \u003cp\u003eWe have shown that C1orf50 expression levels are particularly detrimental to prognosis in a subset of patients with Luminal A stage II breast cancer. The results of the Hallmark pathway analysis suggest that the patients with high C1orf50 expression may have suppressed immunity, but it remains unclear whether there is a patient population in Luminal breast cancer for whom immune checkpoint inhibitors, currently widely used in triple-negative breast cancer, are effective. Therefore, we performed in silico analysis to examine whether the use of immune checkpoint inhibitors may be applicable in patients with high C1orf50 expression.\u003c/p\u003e \u003cp\u003eThe Hallmark pathway analyses showed that immune response-related pathways were downregulated in the C1orf50-high group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-B, Fig S2). We then found that C1orf50 expression negatively correlated with T-cell mediated cytotoxicity (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). To further investigate the mechanisms behind these findings, we examined the mRNA expression levels of immunosuppressive molecules. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA-C, the expression levels of PD-L1 (CD274) and PD-L2 (PDCD1LG2) were positively correlated with the expression level of C1orf50, and the expression levels of CMTM4 and CMTM6, regulators of PD-L1 [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e], were also positively correlated with that of C1orf50. This data suggests that the expression level of C1orf50 may have a suppressive effect on immune checkpoint mechanisms regulated by PD-1/PD-L1. Therefore, the expression level of C1orf50 may be a useful marker when considering the application of PD-L1 inhibitors in the Luminal breast cancer patient population.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e "},{"header":"(6) Discussion","content":"\u003cp\u003eIn this study, we investigated the role of the \u003cem\u003eC1orf50\u003c/em\u003e gene, whose function was previously unknown in breast cancer progression, and confirmed that the prognosis is significantly worse in the group with high \u003cem\u003eC1orf50\u003c/em\u003e mRNA expression by in silico analysis based on data from TCGA stage II breast cancer patients (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Interestingly, this trend was more pronounced in patients with Luminal A breast cancer (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD,E). The clinicopathological significance of C1orf50 is that it may aid in improving prognosis of Luminal A breast cancer patients according to C1orf50 expression levels. Current postoperative treatment of resectable hormone-positive HER2-negative breast cancer patients at risk of high recurrence, is considered for CDK4/6 inhibitors in combination with endocrine therapy [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Increased sensitivity to CDK4/6 inhibitors in breast cancer cell lines with C1orf50 high expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB), and given that patients with high levels of \u003cem\u003eC1orf50\u003c/em\u003e expression have a worse prognosis (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD), aggressive administration of CDK4/6 inhibitors may be considered in Luminal breast cancer patients with high C1orf50 expression.\u003c/p\u003e\u003cp\u003eSince \u003cem\u003eC1orf50\u003c/em\u003e mRNA has a coding sequence, it was predicted to be translated and expressed as a protein. Immunostaining and Western blot analysis confirmed that it can indeed be detected at the protein level in breast cancer tissues and cell lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD, \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). To elucidate the molecular mechanism by which \u003cem\u003eC1orf50\u003c/em\u003e mRNA expression affects Luminal breast cancer progression, we performed pathway analyses and found that the expression level of \u003cem\u003eC1orf50\u003c/em\u003e mRNA is highly correlated with cell cycle and cancer stemness related factors (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e–\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). In breast cancer cell lines in which C1orf50 expression was knocked down by RNAi, cell proliferation was suppressed and cancer stemness was significantly attenuated (Figs.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e and \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). Importantly, in immunostaining analysis of normal breast tissues and breast cancer tissues, the latter tended to show higher C1orf50 staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). This data shows that C1orf50 expression has a promoting effect in breast carcinogenesis and progression, proving that the molecular mechanisms associated with C1orf50 are worthy of investigation as future drug targets.\u003c/p\u003e\u003cp\u003eA limitation of this study is that the details of the molecular mechanisms by which C1orf50 affects the cell cycle and immune checkpoint are not yet known. To clarify this, future analyses focusing on the regulatory mechanism of the YAP/TAZ pathway by C1orf50 should be urgently performed. This is because the YAP/TAZ pathway has been shown to be a cell cycle driver in cancer cells [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e], and there are reports that YAP/TAZ enhances PD-L1 expression and promotes immune evasion [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Our study is important because it is the first report worldwide of the role of a functionally unknown gene, C1orf50, in cancer progression. It also provides clinically important insights in that further analysis of C1orf50 expression may change therapeutic intervention decisions in breast cancer.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eER: estrogen receptor\u003c/p\u003e\n\u003cp\u003eSERMs: selective estrogen receptor modulators\u003c/p\u003e\n\u003cp\u003eHER2: human epidermal growth factor receptor 2\u003c/p\u003e\n\u003cp\u003eC1orf50: Chromosome 1 Open Reading Frame 50\u003c/p\u003e\n\u003cp\u003eTCGA: The Cancer Genome Atlas\u003c/p\u003e\n\u003cp\u003eTCGA-BRCA: TCGA Breast Invasive Carcinoma\u003c/p\u003e\n\u003cp\u003eCPTAC: Clinical Proteomic Tumor Analysis Consortium\u003c/p\u003e\n\u003cp\u003eMSigDB: the Molecular Signatures Database\u003c/p\u003e\n\u003cp\u003eGSVA: gene set variation analysis\u003c/p\u003e\n\u003cp\u003eIDC: infiltrating ductal carcinoma\u003c/p\u003e\n\u003cp\u003eGSEA: Gene Set Enrichment Analysis\u003c/p\u003e\n\u003cp\u003eYAP: Yes-associated protein\u003c/p\u003e\n\u003cp\u003eTAZ: Transcriptional co-activator with PDZ-binding motif\u003c/p\u003e\n\u003cp\u003eMFI: mean fluorescence intensity\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003e(7) Acknowledgments:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe are grateful to the Central Research Laboratory, Okayama University Medical School for their support with confocal microscopy. We thank all members of our laboratory for their valuable commitments to this study. \u0026nbsp;The results \u0026nbsp; published here are in whole, or part, based upon data generated by the TCGA Research Network (https://www.cancer.gov/tcga).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding Information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by a Grant-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Sciences, and Technology of Japan (grant numbers: JP23K06676 to A.F.), the Japan Agency for Medical Research and Development (grant numbers: JP19cm0106143 and JP22cm0106179 to A.F.), and the Naito Foundation (A.F.).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMHR is a member of the Scientific Advisory Board of Universal DX. This company had no influence on support, design, execution, data analysis, or other aspects of this study. The other authors have no conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eY.O., A.T.\u003c/strong\u003e: Data Analysis; visualization; writing \u0026ndash; review and editing. \u003cstrong\u003eM.M.\u003c/strong\u003e: Data analysis; methodology; writing \u0026ndash; review and editing. \u003cstrong\u003eT.P\u003c/strong\u003e. ; Data analysis; writing \u0026ndash; review and editing. \u003cstrong\u003eS.T., H.D., M.H.R.\u003c/strong\u003e : Project administration; writing \u0026ndash; review and editing. \u003cstrong\u003eA.F.\u003c/strong\u003e: Conceptualization; data curation; formal analysis; funding acquisition; investigation; methodology; project administration; resources; supervision; validation; writing \u0026ndash; original draft; writing \u0026ndash; review and editing.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e-Approval of the research protocol by an Institutional Reviewer Board. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe human breast cancer tissue microarray was purchased from TissueArray.com (catalog number: BRM961a). The Ethics Committee of Okayama University concluded that individual review is not required for analyses using commercially available tissue arrays.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e- Informed Consent.\u003c/p\u003e\n\u003cp\u003eN/A.\u003c/p\u003e\n\u003cp\u003e\u003cbr\u003e\u0026nbsp;- Registry and the Registration No. of the study/trial.\u003c/p\u003e\n\u003cp\u003eN/A.\u003c/p\u003e\n\u003cp\u003e\u003cbr\u003e\u0026nbsp;- Animal Studies.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eN/A.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003ePrat A, Pineda E, Adamo B, Galv\u0026aacute;n P, Fern\u0026aacute;ndez A, Gaba L, D\u0026iacute;ez M, Viladot M, Arance A, Mu\u0026ntilde;oz M. Clinical implications of the intrinsic molecular subtypes of breast cancer. Breast. 2015 Nov;24 Suppl 2:S26-35. doi: 10.1016/j.breast.2015.07.008.\u003c/li\u003e\n\u003cli\u003eWaks AG, Winer EP. Breast Cancer Treatment: A Review. JAMA. 2019 Jan 22;321(3):288-300. doi: 10.1001/jama.2018.19323.\u003c/li\u003e\n\u003cli\u003eYeo SK, Guan JL. Breast Cancer: Multiple Subtypes within a Tumor? Trends Cancer. 2017 Nov;3(11):753-760. doi: 10.1016/j.trecan.2017.09.001.\u003c/li\u003e\n\u003cli\u003eRoulot A, H\u0026eacute;quet D, Guinebreti\u0026egrave;re JM, Vincent-Salomon A, Lerebours F, Dubot C, Rouzier R. Tumoral heterogeneity of breast cancer. Ann Biol Clin (Paris). 2016 Dec 1;74(6):653-660. English. doi: 10.1684/abc.2016.1192.\u003c/li\u003e\n\u003cli\u003eHuber KE, Carey LA, Wazer DE. Breast cancer molecular subtypes in patients with locally advanced disease: impact on prognosis, patterns of recurrence, and response to therapy. Semin Radiat Oncol. 2009 Oct;19(4):204-10. doi: 10.1016/j.semradonc.2009.05.004. \u003c/li\u003e\n\u003cli\u003eMouabbi JA, Hassan A, Lim B, Hortobagyi GN, Tripathy D, Layman RM. Invasive lobular carcinoma: an understudied emergent subtype of breast cancer. Breast Cancer Res Treat. 2022 Jun;193(2):253-264. doi: 10.1007/s10549-022-06572-w.\u003c/li\u003e\n\u003cli\u003eSaji S, Kuroi K. Application of selective estrogen receptor modulators for breast cancer treatment according to their intrinsic nature. Breast Cancer. 2008;15(4):262-9. doi: 10.1007/s12282-008-0063-y.\u003c/li\u003e\n\u003cli\u003eTakei H, Kurosumi M, Yoshida T, Hayashi Y, Higuchi T, Uchida S, Ninomiya J, Oba H, Inoue K, Nagai S, Tabei T. Neoadjuvant endocrine therapy of breast cancer: which patients would benefit and what are the advantages? Breast Cancer. 2011 Apr;18(2):85-91. doi: 10.1007/s12282-010-0239-0.\u003c/li\u003e\n\u003cli\u003ePrat A, Pineda E, Adamo B, Galv\u0026aacute;n P, Fern\u0026aacute;ndez A, Gaba L, D\u0026iacute;ez M, Viladot M, Arance A, Mu\u0026ntilde;oz M. Clinical implications of the intrinsic molecular subtypes of breast cancer. Breast. 2015 Nov;24 Suppl 2:S26-35. doi: 10.1016/j.breast.2015.07.008.\u003c/li\u003e\n\u003cli\u003eAraki K, Miyoshi Y. Mechanism of resistance to endocrine therapy in breast cancer: the important role of PI3K/Akt/mTOR in estrogen receptor-positive, HER2-negative breast cancer. Breast Cancer. 2018 Jul;25(4):392-401. doi: 10.1007/s12282-017-0812-x.\u003c/li\u003e\n\u003cli\u003eMunzone E, Colleoni M. Optimal management of luminal breast cancer: how much endocrine therapy is long enough? Ther Adv Med Oncol. 2018 Jun 18;10:1758835918777437. doi: 10.1177/1758835918777437.\u003c/li\u003e\n\u003cli\u003eQian X, Li Z, Ruan G, Tu C, Ding W. Efficacy and toxicity of extended aromatase inhibitors after adjuvant aromatase inhibitors-containing therapy for hormone-receptor-positive breast cancer: a literature-based meta-analysis of randomized trials. Breast Cancer Res Treat. 2020 Jan;179(2):275-285. doi: 10.1007/s10549-019-05464-w.\u003c/li\u003e\n\u003cli\u003eFinetti P, Cervera N, Charafe-Jauffret E, Chabannon C, Charpin C, Chaffanet M, Jacquemier J, Viens P, Birnbaum D, Bertucci F. Sixteen-kinase gene expression identifies luminal breast cancers with poor prognosis. Cancer Res. 2008 Feb 1;68(3):767-76. doi: 10.1158/0008-5472.CAN-07-5516.\u003c/li\u003e\n\u003cli\u003eGao H, Yang M, Zhang X. Investigating a multigene prognostic assay based on significant pathways for Luminal A breast cancer through gene expression profile analysis. Oncol Lett. 2018 Apr;15(4):5027-5033. doi: 10.3892/ol.2018.7940.\u003c/li\u003e\n\u003cli\u003eHuang R, Yamamoto T, Nakata E, Ozaki T, Kurozumi K, Wei F, Tomizawa K, Fujimura A. CDKAL1 Drives the Maintenance of Cancer Stem-Like Cells by Assembling the eIF4F Translation Initiation Complex. Adv Sci (Weinh). 2023 Apr;10(12):e2206542. doi: 10.1002/advs.202206542.\u003c/li\u003e\n\u003cli\u003eKatayama H, Fujimura A, Huang R, Otani Y, Itano T, Fujiwara T, Kunisada T, Nakata E, Ozaki T. Role of catecholamine synthases in the maintenance of cancer stem-like cells in malignant peripheral nerve sheath tumors. Cancer Sci. 2024 Mar;115(3):871-882. doi: 10.1111/cas.16077.\u003c/li\u003e\n\u003cli\u003eOtani Y, Katayama H, Zhu Y, Huang R, Shigehira T, Shien K, Suzawa K, Yamamoto H, Shien T, Toyooka S, Fujimura A. Adrenergic microenvironment driven by cancer-associated Schwann cells contributes to chemoresistance in patients with lung cancer. Cancer Sci. 2024 Apr 27. doi: 10.1111/cas.16164.\u003c/li\u003e\n\u003cli\u003eFujimura A, Yasui S, Igawa K, Ueda A, Watanabe K, Hanafusa T, Ichikawa Y, Yoshihashi S, Tsuchida K, Kamiya A, Furuya S. In Vitro Studies to Define the Cell-Surface and Intracellular Targets of Polyarginine-Conjugated Sodium Borocaptate as a Potential Delivery Agent for Boron Neutron Capture Therapy. Cells. 2020 Sep 23;9(10):2149. doi: 10.3390/cells9102149.\u003c/li\u003e\n\u003cli\u003eTakeshita T, Tokumaru Y, Oshi M, Wu R, Patel A, Tian W, Hatanaka Y, Hatanaka KC, Yan L, Takabe K. Clinical Relevance of Estrogen Reactivity in the Breast Cancer Microenvironment. Front Oncol. 2022 May 23;12:865024. doi: 10.3389/fonc.2022.865024.\u003c/li\u003e\n\u003cli\u003eGolbabapour S, Majid NA, Hassandarvish P, Hajrezaie M, Abdulla MA, Hadi AH. Gene silencing and Polycomb group proteins: an overview of their structure, mechanisms and phylogenetics. OMICS. 2013 Jun;17(6):283-96. doi: 10.1089/omi.2012.0105.\u003c/li\u003e\n\u003cli\u003eLee JY, Won HY, Park JH, Kim HY, Choi HJ, Shin DH, Kang JH, Woo JK, Oh SH, Son T, Choi JW, Kim S, Kim HY, Yi K, Jang KS, Oh YH, Kong G. MEL-18 loss mediates estrogen receptor-\u0026alpha; downregulation and hormone independence. J Clin Invest. 2015 May;125(5):1801-14. doi: 10.1172/JCI73743.\u003c/li\u003e\n\u003cli\u003eLiang H, Zhou G, Lv L, Lu J, Peng J. KRAS expression is a prognostic indicator and associated with immune infiltration in breast cancer. Breast Cancer. 2021. Mar;28(2):379-386. doi: 10.1007/s12282-020-01170-4.\u003c/li\u003e\n\u003cli\u003eIto Y, Kobayashi T, Takeda T, Komoike Y, Wakasugi E, Tamaki Y, Umeshita K, Monden T, Monden M. Immunohistochemical study of Cell Cycle Modulators in G(1)-S Transition in Clinical Breast Cancer Tissue. \u003cem\u003eBreast Cancer\u003c/em\u003e. 1996 Jun 28;3(2):93-104. doi: 10.1007/BF02966969.\u003c/li\u003e\n\u003cli\u003eYu Q, Geng Y, Sicinski P. Specific protection against breast cancers by cyclin D1 ablation. \u003cem\u003enature\u003c/em\u003e. 2001 Jun 28;411(6841):1017-21. doi: 10.1038/ Nature. 2001 Jun 28;411(6841):1017-21. doi: 10.1038/ 35082500.\u003c/li\u003e\n\u003cli\u003eIwata H. Clinical development of CDK4/6 inhibitor for breast cancer. \u003cem\u003eBreast Cancer\u003c/em\u003e. 2018 Jul;25(4):402-406. doi: 10.1007/s12282-017-0827-3.\u003c/li\u003e\n\u003cli\u003eFassl A, Geng Y, Sicinski P. CDK4 and CDK6 kinases: From basic science to cancer therapy. \u003cem\u003eScience\u003c/em\u003e. 2022 Jan 14;375(6577):eabc1495. doi: 10.1126/science .abc1495.\u003c/li\u003e\n\u003cli\u003eKeyomarsi K, Tucker SL, Buchholz TA, Callister M, Ding Y, Hortobagyi GN, Bedrosian I, Knickerbocker C, Toyofuku W, Lowe M, Herliczek TW, Bacus SS. Cyclin E and survival in patients with breast cancer. N Engl J Med. 2002 Nov 14;347(20):1566-75. doi: 10.1056/NEJMoa021153. Erratum in: N Engl J Med 2003 Jan 9;348 (2):186.\u003c/li\u003e\n\u003cli\u003eLi M, Tsavachidis S, Wang F, Bui T, Nguyen TDT, Luo L, Multani AS, Bondy ML, Hunt KK, Keyomarsi K. Low-molecular-weight cyclin E deregulates DNA replication and damage repair to promote genomic instability in breast cancer. Oncogene. 2022 Dec;41(50):5331-5346. doi: 10.1038/s41388-022-02527-z.\u003c/li\u003e\n\u003cli\u003eSong X, Fang C, Dai Y, Sun Y, Qiu C, Lin X, Xu R. Cyclin-dependent kinase 7 (CDK7) inhibitors as a novel therapeutic strategy for different molecular types of Br J Cancer. 2024 May;130(8):1239-1248. doi: 10.1038/s41416-024-02589-8.\u003c/li\u003e\n\u003cli\u003eBroude EV, Győrffy B, Chumanevich AA, Chen M, McDermott MS, Shtutman M, Catroppo JF, Roninson IB. Expression of CDK8 and CDK8-interacting Genes as Potential Biomarkers in Breast Cancer. Curr Cancer Drug Targets. 2015;15(8):739-49. doi: 10.2174/156800961508151001105814. PMID: 26452386; PMCID: PMC4755306.\u003c/li\u003e\n\u003cli\u003eKai K, Arima Y, Kamiya T, Saya H. Breast cancer stem cells. Breast Cancer. 2010 Apr;17(2):80-5. doi: 10.1007/s12282-009-0176-y.\u003c/li\u003e\n\u003cli\u003eYamamoto T, Fujimura A, Wei FY, Shinojima N, Kuroda JI, Mukasa A, Tomizawa K. 2-Methylthio Conversion of N6-Isopentenyladenosine in Mitochondrial tRNAs by CDK5RAP1 Promotes the Maintenance of Glioma-Initiating Cells. iScience. 2019 Nov 22;21:42-56. doi: 10.1016/j.isci.2019.10.012.\u003c/li\u003e\n\u003cli\u003eNogami T, Shien T, Tanaka T, Doihara H, Taira N, Takabatake D, Nishimura R, Nishiyama K, Mizoo T, Ohsumi S. The discordance between primary breast cancer lesions and pulmonary metastatic lesions in expression of aldehyde dehydrogenase 1-positive cancer cells. Breast Cancer. 2014 Nov;21(6):698-702. doi: 10.1007/s12282-013-0445-7.\u003c/li\u003e\n\u003cli\u003eZanconato F, Cordenonsi M, Piccolo S. YAP/TAZ at the Roots of Cancer. Cancer Cell. 2016 Jun 13;29(6):783-803. doi: 10.1016/j.ccell.2016.05.005.\u003c/li\u003e\n\u003cli\u003eCordenonsi M, Zanconato F, Azzolin L, Forcato M, Rosato A, Frasson C, Inui M, Montagner M, Parenti AR, Poletti A, Daidone MG, Dupont S, Basso G, Bicciato S, Piccolo S. The Hippo transducer TAZ confers cancer stem cell-related traits on breast cancer cells. Cell. 2011 Nov 11;147(4):759-72. doi: 10.1016/j.cell.2011.09.048.\u003c/li\u003e\n\u003cli\u003eMezzadra R, Sun C, Jae LT, Gomez-Eerland R, de Vries E, Wu W, Logtenberg MEW, Slagter M, Rozeman EA, Hofland I, Broeks A, Horlings HM, Wessels LFA, Blank CU Xiao Y, Heck AJR, Borst J, Brummelkamp TR, Schumacher TNM. Identification of CMTM6 and CMTM4 as PD-L1 protein regulators Nature. 2017 Sep 7;549(7670): 106-110. doi: 10.1038/nature23669.\u003c/li\u003e\n\u003cli\u003eJanse van Rensburg HJ, Azad T, Ling M, Hao Y, Snetsinger B, Khanal P, Minassian LM, Graham CH, Rauh MJ, Yang X. The Hippo Pathway Component TAZ Promotes Immune Evasion in Human Cancer through PD-L1. Cancer Res. 2018 Mar 15;78(6):1457-1470. doi: 10.1158/0008-5472.CAN-17-3139.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"breast-cancer","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"brca","sideBox":"Learn more about [Breast Cancer](http://link.springer.com/journal/12282)","snPcode":"12282","submissionUrl":"https://www.editorialmanager.com/brca/default2.aspx","title":"Breast Cancer","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"C1orf50, Luminal A breast cancer, Cell cycle, Immune evasion, YAP/TAZ","lastPublishedDoi":"10.21203/rs.3.rs-4660291/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4660291/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAlthough the prognosis of breast cancer has significantly improved compared to other types of cancer, there are still some patients who expire due to recurrence or metastasis. Therefore, it is necessary to develop a method to identify patients with poor prognosis at the early stages of cancer. In the process of discovering new prognostic markers from genes of unknown function, we found that the expression of C1orf50 determines the prognosis of breast cancer patients, especially for those with Luminal A breast cancer. This study aims to elucidate the molecular role of C1orf50 in breast cancer progression. Bioinformatic analyses of the breast cancer dataset of TCGA, and in vitro analyses, reveal the molecular pathways influenced by C1orf50 expression. C1orf50 knockdown suppressed the cell cycle of breast cancer cells and weakened their ability to maintain the undifferentiated state and self-renewal capacity. Interestingly, upregulation of C1orf50 increased sensitivity to CDK4/6 inhibition. In addition, C1orf50 was found to be more abundant in breast cancer cells than in normal breast epithelium, suggesting C1orf50 involvement in breast cancer pathogenesis. Furthermore, the mRNA expression level of C1orf50 was positively correlated with the expression of PD-L1 and its related factors. These results suggest that C1orf50 promotes breast cancer progression through cell cycle upregulation, maintenance of cancer stemness and immune evasion mechanisms. Our study uncovers the biological functions of C1orf50 in Luminal breast cancer progression, a finding not previously reported in any type of cancer.\u003c/p\u003e","manuscriptTitle":"The Role of C1orf50 in Breast Cancer Progression and Prognosis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-08-09 16:03:36","doi":"10.21203/rs.3.rs-4660291/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major Revision","date":"2024-08-19T06:01:06+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"","date":"2024-07-11T00:52:12+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-07-08T01:50:12+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-07-02T14:15:01+00:00","index":"","fulltext":""},{"type":"submitted","content":"Breast Cancer","date":"2024-06-29T13:45:01+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"breast-cancer","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"brca","sideBox":"Learn more about [Breast Cancer](http://link.springer.com/journal/12282)","snPcode":"12282","submissionUrl":"https://www.editorialmanager.com/brca/default2.aspx","title":"Breast Cancer","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"4707c701-dd71-4d68-a8fc-3ecebadeb23d","owner":[],"postedDate":"August 9th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-12-02T17:21:29+00:00","versionOfRecord":{"articleIdentity":"rs-4660291","link":"https://doi.org/10.1007/s12282-024-01653-8","journal":{"identity":"breast-cancer","isVorOnly":false,"title":"Breast Cancer"},"publishedOn":"2024-11-28 15:58:20","publishedOnDateReadable":"November 28th, 2024"},"versionCreatedAt":"2024-08-09 16:03:36","video":"","vorDoi":"10.1007/s12282-024-01653-8","vorDoiUrl":"https://doi.org/10.1007/s12282-024-01653-8","workflowStages":[]},"version":"v1","identity":"rs-4660291","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4660291","identity":"rs-4660291","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-22T02:00:06.705733+00:00
License: CC-BY-4.0