Identification of Viral Activators of the HSV-2 UL13 Protein Kinase

25 Although p revious studies reported that the herpes simplex virus 2 (HSV -2) 26 UL13 protein kinase mediates the phosphorylation of elongation factor 1  (EF-1) in 27 infected cells, we show here that individual expression of UL13 was insufficient to induce 28 phosphorylation of EF-1 in mammalian cells . This led us to hypothesize that HSV -2 29 UL13 requires viral cofactors for full kinase activity and prompted us to identify such 30 cofactors. Our results were as follows. (i) Co-expression of UL13 with UL55 or Us10 31 significantly enhanced phosphorylation of EF-1 compared to UL13 alone. (ii) UL13 was 32 co-precipitated with UL55 or Us10 upon co -expression, and its kinase activity was 33 significantly increased in their presence, as demonstrated by in vitro kinase assays. (iii) 34 In HSV-2-infected cells, UL13 was specifically co-precipitated with Us10 and UL55. (iv) 35 The UL55 -null mutation significantly reduced phosphorylation of EF -1 in HSV -2-36 infected cells, whereas the Us10-null mutation had little effect; however, the double-null 37 mutation further decreased the phosphorylation compared to the UL55 -null mutation 38 alone. (v) The UL55-null mutation, but not the Us10-null mutation, significantly reduced 39 HSV-2 replication and cell -cell spread in U2OS cells to levels comparable to those 40 observed with the UL13 kinase-dead mutation. These results suggest that UL55 acts as a 41 principal activator of UL13 in HSV-2-infected cells, whereas Us10 serves as an auxiliary 42 activator. Moreover, the role of UL13 kinase activity in HSV -2 replication and cell-cell 43 spread in U2OS cells appears to be largely dependent on UL55. 44 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint 3 Importance 45 Herpesviruses encode conserved protein kinases (CHPKs) that often target 46 cellular cyclin-dependent kinase (CDK) phosphorylation sites. CHPKs from beta - and 47 gammaherpesviruses can exhibit these CDK-like functions even when individually 48 expressed in mammalian cells. In contrast, CHPKs from alphaherpesviruses display these 49 CDK-like functions in infected cells, but not upon individual expression, suggesting that 50 they require additional viral factors to exhibit full kinase activity . In this study, we 51 focused on HSV-2 UL13, an alphaherpesvirus CHPK, and identified HSV-2 UL55 and 52 Us10 as viral activators of UL13. In HSV-2-infected cells, UL55 functions as a principal 53 activator of UL13, while Us10 serves as an auxiliary activator . I mportantly, the 54 contribution of UL13 kinase activity to HSV-2 replication and cell-cell spread appears to 55 be largely dependent on the presence of UL55. Our find ings uncover a previously 56 unrecognized mechanism of CHPK regulation in alphaherpesviruses and provide new 57 insights into the evolutionary diversification of viral kinase control. 58 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint 4

59 Viruses in the family Herpesviridae (herpesviruses) are subclassified into three 60 subfamilies, Alphaherpesvirinae, Betaherpesvirinae, and Gammaherpesvirinae, based on 61 molecular and biological pr operties (1). Although members of the se subfamilies exhibit 62 a wide range of pathogenicity, clinical manifestations, and biological characteristics (1), 63 their genomes encode a number of conserved viral proteins (1). This conservation 64 suggests that these viral proteins play fundamental and universal roles in the life cycle s 65 of herpesviruses . Herpes simplex virus 2 (HSV-2), a member of the subfamily 66 Alphaherpesvirinae, encodes UL13 protein kinase, a serine/threonine protein kinase that 67 is one of the conserved viral proteins throughout the Herpesviridae family (2, 3). These 68 conserved viral protein kinases , designated conserved herpesvirus protein kinases 69 (CHPKs) (2, 3), include UL13 of HSV-1 and open reading frame 47 (ORF47) of varicella-70 zoster virus (VZV ) in the Alphaherpesvirinae subfamily; UL97 of human 71 cytomegalovirus (HCMV), and U69 of human herpesvirus 6A (HHV-6A) and 6B (HHV-72 6B), and 7 ( HHV-7) in the Betaherpesvirinae subfamily; and BGLF4 of Epstein-Barr 73 virus (EBV) and ORF36 of Kaposi's sarcoma -associated herpesvirus (KSHV) in the 74 Gammaherpesvirinae subfamily. CHPKs have been implicated in various aspects of viral 75 replication and pathogenicity, underscoring their importance in the life cycles of 76 herpesviruses (2, 3). 77 CHPKs have been reported to share functional and regulatory similarities with 78 cellular cyclin-dependent kinases (CDKs) and are therefore also referred to as viral CDK-79 like kinases (2-12). Accumulating evidence suggests that CHPKs target a number of CDK 80 phosphorylation sites (4-9, 12-15) and that phosphorylation of conserved tyrosine 81 residues within the GxGxxG motifs of representative CHPKs from the three subfamilies 82 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint 5 of the Herpesviridae family negatively regulates their kinase activities (16) similar to the 83 regulatory phosphorylation observed in CDKs (17). However, previous studies on the 84 CDK-like function s of CHPKs have led to conflicting interpretations, particularly for 85 CHPKs of alphaherpesviruses. Thus, it has been reported that , in HSV-1 or HSV-2-86 infected cells, UL13 phosphorylates CDK1 phosphorylation site (Ser -133) of cellular 87 translation elongation factor 1 (EF-1) (4, 18). The ability to phosphorylate EF-1 Ser-88 133 was also demonstrated for HCMV UL97 and EBV BGLF4, based on the observations 89 that individual expression of these viral protein kinases in mammalian cells induces 90 phosphorylation of this site (19, 20). These findings suggest that the CDK-like functions 91 of CHPKs are conserved among CHPKs from all subfamilies of the Herpesviridae family. 92 In contrast, the ability to phosphorylate CDK target sites in cellular retinoblastoma protein 93 (Rb) and sterile alpha motif and HD domain 1 (SAMHD1) upon individual CHPK 94 expression in mammalian cells is shared by CHPKs from beta- and gammaherpesviruses, 95 but not by CHPKs from alphaherpesviruses (12, 21). It remains unclear whether these 96 discrepancies arise from differences in CHPK substrate specificity or from variations in 97 experimental systems, such as CHPK expression in the context of viral infection versus 98 transient expression in mammalian cells. 99 In this study, we sought to address these discrepancies. Whereas phosphorylation 100 of EF-1 at Ser-133 in HSV-2-infected cells has been reported (18), we demonstrated here 101 that individual expression of HSV-2 UL13 in mammalian cells was insufficient to induce 102 phosphorylation of EF-1 at Ser-133, similar to what was previously observed for Rb and 103 SAMHD1, which were also not phosphorylated upon individual ex pression of CHPKs 104 from alphaherpesviruses in mammalian ce lls (12, 21). These findings led us to 105 hypothesize that HSV-2 UL13 may require one or more viral cofactors to exhibit full 106 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint 6 kinase activity. To identify such cofactors, we screened HSV -2 tegument proteins and 107 found that UL55 and Us10 act as viral activators of HSV-2 UL13. 108 109 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint 7

110 Individual expression of HSV-2 UL13 and VZV ORF47 in COS-7 cells was 111 insufficient to induce phosphorylation of EF -1 at Ser -133. To examine whether 112 individual expression of CHPKs in mammalian cells can induce phosphorylation of EF-113 1 at Ser -133, simian kidney epithelial COS -7 cells were transfected with a plasmid 114 expressing Flag -tagged EF -1δ fused to enhanced green fluorescen t protein (EGFP) 115 [EGFP-EF-1δ(F)] (18) in combination with each of the plasmids expressing wild -type 116 CHPKs tagged with Strep-tag (SE-CHPKs) (16), and then subjected to immunoblotting 117 with a monoclonal antibody specific for EF-1 phosphorylated at Ser-133 (EF-1δ-S133P) 118 (18). Phosphorylation of EGFP-EF-1δ(F) at Ser -133 was increased upon individual 119 expression of SE-CHPKs from beta- and gammaherpesviruses, including HCMV SE-120 UL97, HHV -6B SE-U69, EBV SE-BGLF4 and KSHV SE-ORF36, but not from 121 alphaherpesviruses, namely HSV-2 SE-UL13 and VZV SE-ORF47 (Fig. 1A). Notably, 122 the expression level of HSV-2 SE-UL13 appeared higher than those of HCMV SE-UL97, 123 EBV SE-BGLF4 and KSHV SE-ORF36, and th e expression level of VZV SE-ORF47 124 was comparable to that of HCMV SE-UL97 (Fig. 1 A). Nevertheless, these 125 alphaherpesvirus SE-CHPKs were insufficient to induce phosphorylation of EF-1 at Ser-126 133 upon individual expression. These results are in agreement with earlier observations 127 that CHPKs from beta- and gammaherpesviruses, but not from alphaherpesviruses, can 128 induce phosphorylation of CDK target sites in Rb and SAMHD1 when individually 129 expressed in mammalian cells (12, 21). These results, together with earlier observations 130 that HSV-2 UL13 can induce phosphorylation of EF-1 at Ser-133 in infected cells (18), 131 led us to hypothesize that UL13 may require a viral cofactor(s) to exhibit full kinase 132 activity and prompted us to identify such cofactors. 133 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint 8 Identification of viral activators of HSV-2 UL13. CHPKs have been reported 134 to be packaged into the tegument of virions (22-27), an amorphous compartment located 135 between the nucleocapsid and the envelope that contains more than 20 different viral 136 proteins (28). It has been suggested that CHPKs in the tegument are released into the 137 cytoplasm of newly infected cells , where they contribute to establishing conditions 138 favorable for viral replication immediately after viral entry (26, 29). Given this, a viral 139 cofactor(s) for HSV-2 is likely to reside within the tegument compartment. Based on these 140 observations, we focused on HSV-2 tegument proteins and screened them in an attempt 141 to identify viral cofactors that activate UL13. 142 COS-7 cells were transfected with a plasmid expressing EGFP-EF-1δ(F) 143 together with a plasmid expressing SE -UL13 in combination with each of the plasmids 144 expressing 22 different tegument proteins fused to EGFP , and then subjected to 145 immunoblotting with an anti-EF-1δ-S133P antibody. Among the tegument proteins tested, 146 only UL55 and Us10 significantly enhanced phosphorylation of EGFP-EF-1δ(F) at Ser-147 133 when co-expressed with SE-UL13 (Fig. 1B). 148 To verify whether Us10 enhances phosphorylation of EGFP-EF-1δ(F) at Ser-133 149 mediated by UL13, COS-7 cells were transfected with a plasmid expressing EGFP-EF-150 1δ(F), together with a plasmid expressing either SE-UL13 or SE-UL13-K176M, a kinase-151 dead mutant of UL13 (30), in combination with a plasmid expressing HA -tagged Us10 152 (HA-Us10), and then subjected to immunoblotting with an anti-EF-1δ-S133P antibody. 153 Phosphorylation of EGFP-EF-1δ(F) at Ser -133 was significantly enhanced by co-154 expression of SE -UL13 with HA -Us10, but not by co -expression of SE -UL13-K176M 155 with HA -Us10 (Fig. 1C and D). To determine whether UL55 similarly enhanced 156 phosphorylation of EGFP-EF-1δ(F) at Ser-133 mediated by UL13, we attempted similar 157 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint 9 experiments using a plasmid expressing HA -UL55. However, we noted that expression 158 of HA-UL55 was barely detectable. This suggested that expression of HA-UL55 in COS-159 7 cells may be unstable, possibly due to proteasome -mediated degradation of the viral 160 protein. Therefore, COS-7 cells were transfected with a plasmid expressing EGFP-EF-161 1δ(F), together with a plasmid expressing SE-UL13 or SE-UL13-K176M, in combination 162 with a plasmid expressing HA-UL55, and treated with either the prote asome inhibitor 163 MG132 or its solvent control DMSO. The cells were then subjected to immunoblotting 164 with an anti-EF-1δ-S133P antibody. Phosphorylation of EGFP-EF-1δ(F) at Ser-133 was 165 significantly enhanced by co-expression of SE -UL13 with HA -UL55, but not by co -166 expression of SE-UL13-K176M with HA-UL55, regardless of MG132 treatment (Fig. 1E 167 to G). Notably, MG132 treatment led to a marked accumulation of HA-UL55 (Fig. 1E). 168 These results indicate that UL55 and Us10 can enhance the ability of UL13 to 169 phosphorylate EF -1 at Ser-133. Furthermore, our findings demonstrate that UL55 is 170 inherently unstable when expressed alone in COS -7 cells, likely due to its susceptibility 171 to proteasome-mediated degradation. 172 To examine whether Us10 or UL55 can activate UL13 kinase activity, human 173 embryonic kidney 293T (HEK293T) cells were transfected with a plasmid expressing SE-174 UL13 or its kinase-dead mutant SE-UL13-K176M, together with a plasmid expressing 175 Us10 fused to EGFP (Us10-EGFP), UL55 fused to EGFP (UL55-EGFP) or EGFP. Cells 176 were harvested, solubilized , and subjected to pulldown using Strep-Tactin Sepharose 177 beads. The precipitates were incubated in kinase buffer with purified maltose binding 178 protein (MBP) fused to a domain of EF -1δ containing Ser-133 {MBP-EF-1δ(107-146)} 179 or its mutant version MBP-EF-1δ(107-146)-S133A, in which Ser-133 in MBP-EF-180 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint 10 1δ(107-146) was substituted with alanine (4), and then analyzed by immunoblotting with 181 an anti-EF-1δ-S133P antibody. 182 As shown in Fig. 2A, Us10-EGFP was co-precipitated with both SE-UL13 and 183 SE-UL13-K176M. Phosphorylation of MBP-EF-1δ(107-146) at Ser-133, but not that of 184 the S133A mutant, was detected when SE-UL13 was co-expressed with Us10-EGFP. No 185 phosphorylation of MBP-EF-1δ(107-146) at Ser -133 was observed when SE-UL13-186 K176M was co-expressed with Us10-EGFP or when SE-UL13 was co -expressed with 187 EGFP (Fig. 2A). In contrast to the co-precipitation with Us10-EGFP, UL55-EGFP was 188 co-precipitated with SE-UL13 but not with SE-UL13-K176M (Fig. 2B). Phosphorylation 189 of MBP-EF-1δ(107-146) at Ser-133, but not that of the S133A mutant, was detected when 190 SE-UL13 was co-expressed with UL55-EGFP (Fig. 2B). In contrast, no phosphorylation 191 of MBP-EF-1δ(107-146) at Ser -133 was observed when SE -UL13-K176M was co -192 expressed with Us10-EGFP or when SE-UL13 was co-expressed with EGFP (Fig. 2B). 193 These results indicate that both Us10 and UL55 can enhance the kinase activity of UL13 194 and function as viral cofactors that activate UL13, thereby enabling efficient 195 phosphorylation of specific substrates such as EF -1. Notably, while SE-UL13 co-196 expressed with Us10-EGFP was detected as a single band in immunoblotting (Fig. 2A), 197 SE-UL13 co-expressed with UL55-EGFP was detected as two bands with different 198 mobilities in immunoblotting (Fig. 2B): one appeared to correspond to the band observed 199 with Us10-EGFP, and the other exhibited slower mobility. The slower-migrating band of 200 UL13 was previously reported to result from autophosphorylation (18), supporting our 201

that UL55 activates UL13. 202 Construction and characterization of recombinant viruses. To investigate the 203 effects of UL55 and/or Us10 on UL13 in HSV-2-infected cells, we constructed a series 204 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint 11 of recombinant viruses including the following: a recombinant virus YK873 (UL13-HA) 205 expressing HA-tagged UL13 (UL13-HA); a UL55-null mutant virus YK874 (ΔUL55); a 206 Us10-null mutant virus YK 876 (ΔUs10); and a UL55/Us10-double null mutant virus 207 YK878 (ΔUL55/ΔUs10) (Fig. 3). In addition, we generated recombinant viruses in which 208 each of these null mutations w as repaired: YK875 (ΔUL55-repair), YK 877 (ΔUs10-209 repair) and YK879 (ΔUL55/ΔUs10-repair) (Fig. 3). 210 The recombinant viruses were characterized as follows . (i) UL13-HA w as 211 detected in lysates of simian kidney epithelial Vero cells infected with YK873 (UL13-212 HA), but not in those infected with wild-type HSV-2 186 (Fig. 4A). (ii) Vero cells infected 213 with wild -type HSV-2 186 or YK875 (ΔUL55-repair) expressed UL 55, whereas cells 214 infected with YK 874 (ΔUL55) did not ( Fig. 4B), confirming that the UL55 gene was 215 successfully disrupted in YK874 (ΔUL55). (iii) Vero cells infected with wild-type HSV-216 2 186, YK874 (ΔUL55) or YK875 (ΔUL55-repair) produced comparable levels of UL56 217 and of ICP27, which is encoded by the UL54 gene (Fig. 4C), indicating that the UL55-218 null mutation had little effect on the expression of its neighboring genes. Notably, UL56 219 in YK874 (ΔUL55)-infected cells was predominantly detected as a single band in 220 immunoblotting, whereas UL56 in wild-type HSV-2 186 - or YK875 (ΔUL55-repair)-221 infected cells was detected as two bands with different mobilities (Fig. 4C), suggesting 222 that UL55 is required for efficient post-translational modification(s) of UL56 in HSV-2-223 infected cells. (iv) Vero cells infected with wild -type HSV-2 186 or YK877 (ΔUs10-224 repair) expressed Us10, whereas cells infected with YK 876 (ΔUs10) did not ( Fig. 4D), 225 confirming that the Us10 gene was successfully disrupted in YK876 (ΔUs10). (v) Vero 226 cells infected with wild -type HSV-2 186 , YK876 (ΔUs10) or YK877 (ΔUs10-repair) 227 produced comparable levels of Us9 and Us11 (Fig. 4E), indicating that the null mutation 228 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint 12 in YK876 (ΔUs10) has little effect on expression of its neighboring genes. (vi) Vero cells 229 infected with wild -type HSV-2 186 or YK879 (ΔUL55/ΔUs10-repair) expressed both 230 UL55 and Us10, whereas those infected with YK878 (ΔUL55/ΔUs10) did not (Fig. 4F), 231 confirming that both genes were successfully disrupted in YK878 (ΔUL55/ΔUs10). (vii) 232 Vero cells infected with wild -type HSV -2 186, YK878 ( ΔUL55/ΔUs10) or YK879 233 (ΔUL55/ΔUs10-repair) produced comparable levels of ICP27, UL56, Us9 and Us11 (Fig. 234 4G), indicating that the null mutation in YK878 (ΔUL55/ΔUs10) had little effect on the 235 expression of genes neighboring the UL55 and Us10 loci. 236 Association of UL13 with UL55 and Us10 in HSV -2-infected cells. To 237 investigate whether UL13 interacts with UL55 or Us10 in HSV-2-infected cells, Vero 238 cells were infected with wild -type HSV -2 186 or YK 873 (UL13-HA), lysed and 239 immunoprecipitated with an anti-HA antibody. The immunoprecipit ates were then 240 analyzed by immunoblotting. As shown in Fig. 5, the anti-HA antibody co-precipitated 241 UL55 and Us10 with UL13-HA from lysates of YK873 (UL13-HA)-infected cells but did 242 not co -precipitate the capsid protein VP23. No such co -precipitation was observed in 243 lysates of wild-type HSV-2 186-infected cells (Fig. 5). These results indicate that UL13 244 specifically interacts with UL55 and Us10 in HSV-2-infected cells and are in agreement 245 with our findings above that UL55 and Us10 were co -precipitated with UL13 when co -246 expressed individually with UL13. 247 Effects of UL13 on accumulation of UL55 and Us10 in HSV-2-infected cells. 248 To examine the effects of UL13 on UL55 and Us10 in HSV -2-infected cells, Vero cells 249 were mock-infected or infected with wild -type HSV-2 186, a UL13 -null mutant virus 250 YK862 (UL13) (18), its repaired virus YK863 (UL13-repair), YK864 (UL13-K176M) 251 encoding an enzymatically inactive mutant of UL13 (18) or its repaired virus YK865 252 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint 13 (UL13-K176M-repair), lysed and subjected to immunoblotting. As shown in Fig. 6A, 253 UL55 and Us10 were barely detectable in cells infected with YK862 (UL13), although 254 they accumulated in cells infected with wild-type HSV-2 186 or YK863 (UL13-repair). 255 Similarly, Us10 was barely detectable in cells infected with YK864 (UL13 -K176M), 256 although it accumulated in cells infected with wild-type HSV-2 186 or YK865 (UL13-257 K176M-repair) (Fig. 6B). In contrast, UL55 accumulated in cells infected with YK864 258 (UL13-K176M) at levels comparable to those in cells infected with wild-type HSV-2 186 259 or YK865 (UL13-K176M-repair) (Fig. 6B). As previously reported (18) and shown in Fig. 260 9A below, the K176M mutation in UL13 does not decrease the accumulation level of 261 UL13 in HSV-2-infected Vero cells. These results indicate that the presence of UL13, but 262 not its kinase activity, is required for efficient accumulation of UL55 in HSV -2-infected 263 cells, whereas UL13 kinase activity is required for efficient accumulation of Us10. 264 Similarly, the CHPK of Marek’s disease herpesvirus has been reported to stabilize Us10 265 in infected cells (31). 266 Effects of UL 55 and/or Us10 on UL13 -mediated phosphorylation of its 267 substrates in HSV-2 infected cells. To examine the effect s of UL55 and/or Us10 on 268 UL13 substrates in HSV-2-infected cells, Vero or human osteosarcoma U2OS cells were 269 mock-infected or infected with wild-type HSV-2 186, YK874 (ΔUL55), YK875 (ΔUL55-270 repair), YK876 (ΔUs10), YK877 (ΔUs10-repair), YK878 (ΔUL55/ΔUs10), YK879 271 (ΔUL55/ΔUs10-repair) or YK86 4 (UL13-K176M), lysed and subjected to 272 immunoblotting. 273 Previous studies have reported that infection with wild -type HSV-2 enhances 274 phosphorylation of EF-1δ at Ser-133, detected by an anti -EF-1δ-S133P monoclonal 275 antibody and leads to the accumulation of the hyperphosphorylated form of EF-1δ, 276 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint 14 detected as a slower migrating band by immunoblotting with anti -EF-1δ polyclonal 277 antibodies, compared to mock-infection (18). In contrast, such changes are not observed 278 upon infection with YK865 (UL13 -K176M) (18). The increase in the 279 hyperphosphorylated form of EF-1δ results from EF-1δ phosphorylation at Ser-133 (4), 280 indicating that enhanced phosphorylation of EF-1δ at this site in HSV-2-infected cells is 281 dependent on UL13 (18). As shown in Fig. 7A, E, and I, EF-1δ phosphorylation at Ser-282 133 and accumulation of its hyperphosphorylated form in Vero cells infected with YK874 283 (ΔUL55) were significantly reduced compared to those in cells infected with wild -type 284 HSV-2 186 or YK875 (ΔUL55-repair). In contrast, phosphorylation levels and 285 hyperphosphorylated EF-1δ accumulation in cells infected with YK876 (ΔUs10) were 286 comparable to those in cells infected with wild-type HSV-2 186 or YK877 (ΔUs10-repair) 287 (Fig. 7B, F , and J ). Vero cells infected with YK878 (ΔUL55/ΔUs10) e xhibited a 288 phosphorylation profile similar to that of YK874 (ΔUL55)-infected cells, although 289 phosphorylation appeared to be further reduced (Fig. 7A, C, E, G, I, and K). Indeed, EF-290 1δ phosphorylation at Ser-133 and accumulation of its hyperphosphorylated form in cells 291 infected with YK878 (ΔUL55/ΔUs10) were significantly lower than those in cells 292 infected with YK874 (ΔUL55) and were comparable to those observed in cells infected 293 with YK864 (UL13-K176M) (Fig. 8D, H, and L). Similar results were also obtained in 294 U2OS cells (Fig. 8); however, while the difference in the accumulation of 295 hyperphosphorylated EF -1δ between YK878 (ΔUL55/ΔUs10) - and YK86 4 (UL13-296 K176M)-infected cells was similarly small as in Vero cells, it was statistically significant 297 only in U2OS cells (Fig. 8L). These results indicate that both UL55 and Us10 are required 298 for optimal UL13 activity to induce phosphorylation of EF -1 at Ser -133 in HSV-2-299 infected cells. 300 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint 15 Previous studies have reported that auto -phosphorylated UL13 is detected as a 301 slower-migrating band in immunoblotting with an anti-UL13 monoclonal antibody (18). 302 As previously shown (18), UL13 in Vero cells infected with wild-type HSV-2 186 or each 303 of the repaired viruses was detected as two bands with different mobilities (Fig. 9A). In 304 contrast, the slower migrating band corresponding to auto -phosphorylated UL13 was 305 barely detectable in cells infected with YK864 (UL13-K176M) (18). Similarly, auto-306 phosphorylated UL13 was barely detectable in cells infected with YK874 (ΔUL55) or 307 YK878 (ΔUL55/ΔUs10) (Fig. 9A). The ratio of auto-phosphorylated UL13 to total UL13 308 in cells infected with YK874 (ΔUL55) was comparable to that in cells infected with 309 YK878 (ΔUL55/ΔUs10) and YK864 (UL13-K176M) (Fig. 9B). In contrast, cells infected 310 with YK876 (ΔUs10) exhibited a phosphorylation profile similar to that of wild -type 311 HSV-2 186-infected cells, and the ratio of auto-phosphorylated UL13 to total UL13 was 312 comparable to that in wild-type HSV-2 186-infected cells (Fig. 9A and B). Similar results 313 were also obtained in U2OS cells (Fig. 9C and D). These results indicate that UL55, but 314 not Us10, is required for optimal UL13 auto-phosphorylation activity in HSV-2-infected 315 cells and are in agreement with our findings above that auto -phosphorylated UL13 was 316 detected only in the presence of UL55 but not Us10 in the in vitro kinase assays (Fig. 2B). 317 Effects of UL55 and/or Us10 on HSV-2 replication and cell-cell spread. It 318 has been reported that the kinase activity of UL13 is required for efficient HSV -2 319 replication and cell-cell spread in a manner dependent on multiplicity of infection (MOI) 320 and/or cell type (16, 18). To examine the effect s of UL55 and/or Us10 on HSV -2 321 replication and cell-cell spread in cell cultures, we analyzed progeny virus yields and 322 plaque sizes in U2OS and Vero cells infected with wild-type HSV-2 186, YK864 (UL13-323 K176M), YK865 (UL13 -K176M-repair), YK874 (ΔUL55), YK875 (ΔUL55-repair), 324 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint 16 YK876 (ΔUs10), YK877 (ΔUs10-repair), YK878 (ΔUL55/ΔUs10), or YK879 325 (ΔUL55/ΔUs10-repair). As reported previously (18), progeny virus yields of YK864 326 (UL13-K176M) were significantly lower than those of wild -type HSV-2 186 or YK865 327 (UL13-K176M-repair) in U2OS cells at an MOI of 0.01, but not at an MOI of 3 (Fig. 10A 328 and B). No significant differences in virus yield were observed in Vero cells at either MOI 329 (Fig. 1 0C and D ). In addition, YK864 (UL13-K176M) formed significantly smaller 330 plaques than wild-type HSV-2 186 or YK865 (UL13-K176M-repair) in U2OS cells, but 331 not in Vero cells (Fig. 1 0E and F). Similarly, YK874 (ΔUL55) exhibited significantly 332 reduced progeny virus yields in U2OS cells at an MOI of 0.01 , comparable to those of 333 YK864 (UL13-K176M), and significantly lower than those of wild-type HSV-2 186 and 334 YK875 (ΔUL55-repair) (Fig. 10A). However, this reduction was not observed at an MOI 335 of 3 in U2OS cells, nor at either MOI in Vero cells (Fig. 10B to D). YK874 (ΔUL55) also 336 produced significantly smaller plaques in U2OS cells, again comparable to those formed 337 by YK864 (UL13-K176M), than those formed by wild-type HSV -2 186 or YK875 338 (ΔUL55-repair), whereas plaque sizes of these strains were comparable in Vero cells (Fig. 339 10E and F). In contrast, YK876 (ΔUs10) showed progeny virus yields and plaque sizes 340 comparable to those of wild -type HSV-2 186 and YK877 (ΔUs10-repair) in both U2OS 341 and Vero cells (Fig. 1 0). The progeny virus yields and plaque sizes of YK878 342 (ΔUL55/ΔUs10) were similar to those of YK874 (ΔUL55), indicating that deletion of 343 Us10 in addition to UL55 did not further impair viral replication and cell -cell spread 344 under the conditions tested. These results indicate that UL55 , but not Us10 , is required 345 for efficient HSV-2 replication and cell-cell spread in cell culture, to an extent comparable 346 to that of UL13 kinase activity. 347 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint 17 Effects of VZV homologs of HSV-2 UL55 and U s10 on EF-1 348 phosphorylation mediated by VZV ORF47. HSV-2 UL55 and Us10 are conserved in 349 the subfamily Alphaherpesvirinae (Fig. 11), but not in the Beta- and 350 Gammaherpesvirinae subfamilies. To investigate whether the effects of HSV-2 UL55 and 351 Us10 on UL13 are conserved in other alphaherpesviruses, we examined whether the VZV 352 homologs of UL55 and Us10 , ORF3 and ORF64, respectively, exert similar effects on 353 EF-1 phosphorylation mediated by VZV ORF47, the homolog of HSV-2 UL13. COS-7 354 cells were transfected with a plasmid expressing EGFP-EF-1δ(F), together with a plasmid 355 expressing SE -ORF47 or SE -ORF47-K157M, a kinase -dead mutant of ORF47 (3), in 356 combination with a plasmid expressing HA -tagged ORF3 (HA-ORF3) or HA -tagged 357 ORF64 (HA-ORF64), and then subjected to immunoblotting with an anti-EF-1δ-S133P 358 antibody. Phosphorylation of EGFP-EF-1δ(F) at Ser-133 was significantly enhanced by 359 co-expression of SE -ORF47 with HA-ORF3, but not by co -expression of SE -ORF47-360 K157M with HA-ORF3 (Fig. 12A and B). In contrast, co-expression of SE-ORF47 with 361 HA-ORF64 had little effect on phosphorylation of EGFP-EF-1δ(F) at Ser-133 (Fig. 12C, 362 D). These results indicate that VZV ORF3, but not ORF64, can enhance the ability of 363 ORF47 to phosphorylate EF-1 at Ser-133. 364 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint 18

365 In this study, we identified HSV-2 UL55 and Us10 as viral activators of UL13. 366 Co-expression of UL13 with either UL55 or Us10 significantly enhanced phosphorylation 367 of EF-1 at Ser-133 compared to the expression of UL13 alone. Moreover, UL13 was co-368 precipitated with either UL55 or Us10 upon co-expression, and its kinase activity was 369 substantially increased in the presence of either of these viral proteins . These findings 370 suggest that UL55 and Us10 interact with UL13 and act as activators of this viral protein 371 kinase. In HSV-2-infected cells, UL13 was specifically co -precipitated with UL55 and 372 Us10. Notably, the UL55-null mutation markedly reduced phosphorylation of EF -1 at 373 Ser-133, whereas the Us10 -null mutation had little effect. However, the double -null 374 mutation further decreased the phosphorylation compared to the UL55 -null mutation 375 alone. Similarly, UL13 autophosphorylation was reduced by the UL55 -null mutation, 376 while the Us10 -null mutation had minimal effect. However, no further reduction was 377 observed in the double-null mutant compared to the UL55-null mutant. In agreement with 378 this, auto-phosphorylated UL13 was detected only in the presence of UL55, but not Us10, 379 in vitro. These results suggest that UL55 acts as a principal activator of UL13 in HSV-2-380 infected cells, while Us10 serves as an auxiliary activator. To our knowledge, the 381 functions of HSV UL55 and Us10 in infected cells have remained unclear, and this study 382 represents the first to elucidate their functional roles. 383 We showed that the UL55-null mutation reduced UL13 autophosphorylation to 384 a level comparable to that observed with the kinase -dead mutation in UL13 in HSV -2-385 infected cells, and that individually expressed UL13 in COS-7 cells was unable to induce 386 phosphorylation of EF -1 at Ser-133. In contrast, previous studies have reported that 387 highly purified UL13 , when expressed individually using a baculovirus expression 388 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint 19 system, has intrinsic kinase activity capable of both auto-phosphorylation and substrate 389 trans-phosphorylation in vitro (4). Collectively, these observations suggest that , while 390 UL55 is not essential for the intrinsic kinase activity of UL13, it is crucial for the 391 functional expression of UL13 activity in HSV-2-infected cells. In agreement with this, 392 the UL55-null mutation reduced HSV-2 replication and cell-cell spread in U2OS cells to 393 levels comparable to those observed with the kinase-dead mutation in UL13, suggesting 394 that the role of the UL13 kinase activity in HSV-2 replication and cell-cell spread in these 395 cells is largely dependent on UL55. 396 We demonstrated that individual expression of VZV CHPK ORF47 was 397 insufficient to induce phosphorylation of EF -1 at Ser-133, whereas co-expression of 398 VZV ORF47 with ORF3, the HSV-2 UL55 homolog, but not with ORF64, the HSV-2 399 Us10 homolog, significantly enhanced phosphorylation of EF -1 at this site . These 400 findings suggest that the function of HSV -2 UL55 in activating UL13 is conserved in 401 VZV ORF3, and potentially in other alphaherpesvirus UL55 homologs. In agreement with 402 this, it has been reported that VZV ORF47 mediates phosphorylation of IRF3 in VZV -403 infected cells, whereas individual expression of ORF47 alone fails to do so, suggesting 404 that a viral cofactor(s) is required for ORF47-mediated phosphorylation of IRF3 in VZV-405 infected cells (32). Although our results do not support a role for VZV ORF64 as a 406 coactivator of ORF47, we cannot entirely rule out this possibility, given that HSV-2 Us10 407 exhibited only modest coactivator activity. Further studies will be necessary to clarify 408 whether ORF64 contributes to the regulation of ORF47. As shown in Fig. 11, 409 alphaherpesviruses can be categorized into three groups based on conservation of UL55 410 and/or Us10 homologs: (i) viruses encoding both UL55 and Us10 such as HSV-1 (human 411 alphaherpesvirus 1) and HSV-2 (human alphaherpesvirus 2) ; (ii) viruses lacking both 412 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint 20 genes such as suid alphaherpesvirus 1 (pseudorabies virus , PRV) and bovine 413 alphaherpesvirus 1; and (iii) viruses encoding only one of the two such as saimiriine 414 alphaherpesvirus 1 and gallid alphaherpesvirus 1. In contrast to the CHPKs of HSV-2 and 415 VZV that require viral cofactors for activation, PRV UL13 appears to possess sufficient 416 intrinsic kinase activity without viral cofactors, effectively phosphorylating its substrates 417 when expressed alone in mammalian cells, similarly to what is observed in PRV-infected 418 cells (33, 34), despite the absence of UL55 and Us10 homologs. These observations 419 suggest that PRV UL13 has evolved self-sufficient activation mechanisms, comparable to 420 those of CHPKs in beta - and gammaherpesviruses. Notably, phylogenic analyses based 421 on amino acid sequences of six genes of alphaherpesviruses conserved thoughout the 422 family Herpesviridae revealed that viruses lacking both UL55 and Us10 genes form a 423 monophyletic clade within the Varicellovirus genus, while viruses encoding Us10 but not 424 UL55 cluster in the Itovirus genus (Fig. 11). By contrast, viruses encoding UL55 but not 425 Us10 form two distinct monophyletic clades within the Simplexvirus genus (Fig. 11). 426 These phylogenetic patterns suggest that the gain or loss of specific CHPK cofactors 427 might have occurred independently in different alphaherpesvirus lineages, potentially as 428 part of their adaptation to distinct host environments and replication strategies. Taken 429 together, these observations suggest that alphaherpesvirus CHPKs have evolved diverse 430 regulatory strategies, ranging from intrinsic activity to reliance on specific viral cofactors 431 such as UL55 and Us10. This mechanistic diversity is mirrored in their phylogenetic 432 separation, offering new insight into the evolutionary trajectories and functional 433 specialization of CHPK regulation among herpesviruses. 434 At present, the precise mechanisms by which HSV -2 UL55 and Us10 activate 435 UL13 remain to be elucidated. Protein kinases are known to be regulated by a variety of 436 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint 21 cofactor proteins that modulate their activity through diverse mechanisms, including 437 conformational changes, promotion of dimerization or oligomerization, subcellular 438 localization, substrate recruitment, or stabilization of the kinase itself (35, 36). Notably, 439 our study revealed a reciprocal regulatory relationship between these viral proteins. 440 Specifically, although the kinase activity of UL13 was not required for UL55 441 accumulation, the absence of UL13 protein resulted in markedly reduced UL55 442 accumulation in HSV-2-infected cells, suggesting that UL13 stabilizes UL55 in a kinase-443 independent manner. In contrast, Us10 accumulation was markedly reduced in the 444 absence of UL13 kinase activity, suggesting that UL13 -mediated phosphorylation may 445 contribute to Us10 stabilization in infected cells. These bidirectional regulatory 446 relationships appear to parallel the activation and stabilization dynamics observed in 447 CDK-cyclin systems, in which cyclins activate CDKs and, in turn, are stabilized through 448 binding to CDKs (37-39), with their stability further modulated by CDK phosphorylation 449 (38). UL13 and other CHPKs are classified as CDK-like kinases, as they mimic both the 450 substrate specificity and negative regulatory mechanisms of CDKs (4-9, 12-16). Our data 451 raise the intriguing possibility that HSV-2 UL55 and/or Us10 might function in a manner 452 analogous to cyclins. Binding of cyclins to CDKs induces a conformational change in the 453 CDK activation loop, leading to kinase activation (39). Further studies, including 454 structural and biochemical analyses, will be necessary to clarify the mechanisms by which 455 UL55 and Us10 activate UL13. In particular, investigating whether UL55 or Us10 456 binding induces conformational changes in the activation loop of UL13 would be of great 457 interest. 458 459 460 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint 22

461 Cells and viruses. Simian kidney epithelial Vero and COS-7 cells, rabbit skin 462 cells, human osteosarcoma U2OS cells, human embryonic kidney epithelial HEK293T 463 cells, and HSV-2 w ild-type strain HSV -2 186 were described previously (4, 40-43). 464 Recombinant virus HSV-2 ΔUL13 (YK862) in which the UL13 gene was disrupted by 465 deleting UL13 codons 159 -417, r ecombinant virus HSV-2 ΔUL13-repair (YK863) in 466 which the UL13 -null mutation was repaired, recombinant virus HSV -2 UL13-K176M 467 (YK864) encoding an enzymatically inactive UL13 mutant in which lysine at UL13 468 residue 176 was replaced with methionine, r ecombinant virus HSV-2 UL13-K176M-469 repair (YK865) in which the K176M mutation was repaired, were described previously 470 (18) (Fig. 3). 471 Plasmids. pcDNA-SE-UL13 or pcDNA-SE-UL13-K176M were constructed 472 by amplifying the entire coding sequence of HSV-2 UL13 from pYEbac861 or the UL13-473 K176M genome, respectively, by PCR using the primers listed in Table 1, and cloning it 474 into pcDNA -SE (16, 44) in frame with a Strep -tag sequence. pcDNA-SE-ORF47, 475 pcDNA-SE-UL97, pcDNA -SE-BGLF4, and pcDNA -SE-ORF36 were constructed by 476 amplifying the entire coding sequence of VZV ORF47 from pOka BAC DNA (a generous 477 gift from Y. Mori) , HCMV UL97 from cDNA synthesized from the total RNA of H EL 478 cells infected with HCMV ADsubUL21.5 (a generous gift from T. Shenk), EBV BGLF4 479 from pME-BGLF4 (20), or KSHV ORF36 from KSHV DNA isolated from BJAB-480 BAC36 cells (a generous gift from K. Ueda ), respectively, by PCR using the primers 481 listed in Table 1, and cloning it into pcDNA-SE (16) in frame with a Strep-tag sequence. 482 pcDNA-SE-ORF47-K157M, in which Lys-157 of ORF47 was replaced with methionine, 483 was constructed by PCR from pcDNA-SE-ORF47 using the primers listed in Table 1, and 484 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint 23 cloning it into pcDNA-SE (16) in frame with a Strep-tag sequence as described previously 485 (45). pcDNA-SE-U69 was described previously (16). 486 pUL7-EGFP, pUL11 -EGFP, pUL14-EGFP, pUL16-EGFP, pTk-EGFP, pVHS-487 EGFP, pUL47-EGFP, pVP16-EGFP, pVP22-EGFP, pvdUTPase -EGFP, pUL51 -EGFP, 488 pICP27-EGFP, pUL55-EGFP, pUs2-EGFP, pUs3-EGFP, pUs10-EGFP, or pUs11-EGFP 489 were constructed by amplifying the entire coding sequence of each HSV-2 ORF from 490 pYEbac861 by PCR using the primers listed in Table 1, and cloning it into pEGFP-N2 491 (Clontech) in frame with the EGFP sequence. Based on the genome information of HSV-492 2 strain HG52, p UL37-EGFP, pICP0-EGFP, pICP4-EGFP, or pICP34.5-EGFP were 493 synthesized by GenScript. pUL36-EGFP was constructed based on the genomic sequence 494 of HSV-2 strain HG52 by synthesizing the N-terminal region of UL36 and cloning it in -495 frame with the EGFP sequence in the pEGFP -N2 vector (Clontech) by GenScript, 496 followed by insertion of the synthesized C -terminal region of UL36 between the N -497 terminal region of UL36 and the EGFP sequence. pEGFP-EF-1δ(F), in which EF-1δ was 498 tagged with the Flag epitope and EGFP, as described previously (18). 499 pcDNA-HA, a hemagglutinin (HA) tag with an influenza virus HA epitope, was 500 constructed by annealing the oligonucleotides listed in Table 1 and cloning it into 501 pcDNA3.1/myc-His(-) A (Thermo Fisher Scientific). pcDNA-HA-UL55 or pcDNA-HA-502 Us10 were constructed by amplifying the entire coding sequence of HSV-2 UL55 or Us10 503 from pYEbac861 genome by PCR using the primers listed in Table 1, and cloning it into 504 pcDNA-HA in frame with an HA -tag sequence. pcDNA-HA-ORF3 or p cDNA-HA-505 ORF64 were constructed by amplifying the entire coding sequence of VZV ORF3 or 506 ORF64 from pOka BAC genome by PCR using the primers listed in Table 1, and cloning 507 it into pcDNA-HA in frame with an HA-tag sequence. 508 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint 24 pMAL-UL55-P1, pMAL-Us10-P1, or pMAL-Us9-P1 were constructed by 509 amplifying the domains of HSV -2 UL 55 (encoded by UL 55 codons 1 to 100), Us10 510 (encoded by U s10 codons 33 to 132), or Us9 (encoded by U s9 codons 1 to 50) from 511 pYEbac861 by PCR using the primers listed in Table 1, and cloning it into pMAL-c (New 512 England BioLabs) in frame with MBP. pMAL-EF-1δ(107-146) or pMAL -EF-1δ(107-513 146)-S133A were described previously (4). 514 To construct the transfer plasmid pYEbac861/UL55+KanS, used for generating 515 recombinant viruses YK 875 (ΔUL55-repair) and YK 879 (ΔUL55/ΔUs10-repair) in 516 which the UL55-null mutation in YK874 (ΔUL55) and the UL55/Us10-null mutations in 517 YK878 (ΔUL55/ΔUs10), respectively, were repaired (Fig. 3), linear fragments containing 518 a gene encoding the I-SceI site, kanamycin resistance, and 83 bp of UL55 sequences were 519 generated by PCR using the primers listed in Table 1 with pEP-KanS (46) as the template. 520 The linear PCR-generated fragments were electroporated into the electrocompetent cells 521 of Escherichia coli (E. coli) GS1783 containing pYEbac 861 (18). These bacteria were 522 then plated on LB agar plates containing 20 μg/ml of chloramphenicol and 40 μg/ml of 523 kanamycin to select E. coli clones harboring the kanamycin resistance gene inserted into 524 the UL55 locus. After 36 h, kanamycin-resistant colonies were screened by PCR with 525 appropriate primers, which led to the identification of pYEbac861/UL55+KanS, a E. 526 coli GS1783 strain harboring the HSV-2-BAC plasmid pYEbac861/UL55+KanS. 527 Mutagenesis of viral genomes and generation of recombinant HSV -2. 528 Recombinant virus YK873 (UL13-HA), carrying a HA-tag at the C-terminus of the UL13 529 gene in YK861 (UL13-WT) (18) (Fig. 3), was constructed by the two-step Red-mediated 530 mutagenesis procedure using E. coli strain GS1783 containing pYEbac 861 (18), as 531 described previously (46, 47), except using the primers listed in Table 2. Recombinant 532 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint 25 virus YK874 (ΔUL55), in which the entire UL55 ORF was deleted (Fig. 3); and YK876 533 (ΔUs10), in which a tyrosine residue at the position 14 in Us10 was replaced with a stop 534 codon (Fig. 3), were generated by the two -step Red -mediated mutagenesis procedure 535 using E. coli strain GS1783 containing pYEbac861 (18), as described previously (46, 47), 536 except using the primers listed in Table 2. Recombinant virus YK878 (ΔUL55/ΔUs10), 537 carrying both the UL55 and Us10 mutations found in YK 874 (ΔUL55) and YK 876 538 (ΔUs10) (Fig. 3), was constructed by the two-step Red-mediated mutagenesis procedure 539 using E. coli GS1783 carrying the YK874 (ΔUL55) genome as described previously (46, 540 47), except using the primers listed in Table 2. Recombinant virus YK877 (ΔUs10-repair), 541 in which the mutations in YK 876 (ΔUs10) w as repaired (Fig. 3), w as generated as 542 described previously (46, 47), except using the primers listed in Table 2. For generation 543 of recombinant virus YK875 (ΔUL55-repair), in which the mutation in YK874 (ΔUL55) 544 was repaired (Fig. 3), was gen erated as described previously (46, 47), except using the 545 primers listed in Table 2, pYEbac861/UL55+KanS, and E.coli GS1783 containing the 546 YK874 (ΔUL55) genome (Fig. 3). Recombinant virus YK879 (ΔUL55/ΔUs10-repair), in 547 which the mutations in YK878 (ΔUL55/ΔUs10) were repaired (Fig. 3), was generated by 548 sequentially applying the repair procedures used for YK875 (ΔUL55-repair) and YK877 549 (ΔUs10-repair). 550 Production and purification of MBP fusion proteins. MBP-UL55-P1, MBP-551 Us10-P1, and MBP-Us9-P1 were expressed in E. coli Rosetta (Novagen), transformed 552 with pMAL-UL55-P1, pMAL-Us10-P1, or pMAL-Us9-P1 purified using amylose beads 553 (New England Biolabs), respectively, as described previously (4). The MBP fusion 554 proteins were eluted with MBP elution-buffer (50 mM Tris-HCl [pH 8.0], 25 mM EGTA, 555 10 mM D(+) -Maltose Monohydrate) and stored at −80 °C. MBP-EF-1δ(107-146) or 556 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint 26 MBP-EF-1δ(107-146)-S133A were expressed in E. coli Rosetta (Novagen), transformed 557 with pMAL-EF-1δ(107-146) or pMAL-EF-1δ(107-146)-S133A purified amylose beads 558 (New England Biolabs), respectively, as described previously (4). 559 Antibodies. Antibodies and dilutions used in immunoblotting were as follows: 560 commercial mouse monoclonal antibodies to Flag-tag (M2; Sigma, 1:1000), Strep-tag II 561 (4F1; MBL, 1:1000), HA -tag (TANA2; MBL, 1:1000), β-actin (AC15; Sigma, 1:1000), 562 ICP27 (H1142; Santa Cruz, 1:2000) and rabbit polyclonal antibodies to VP23 (CAC-CT-563 HSV-UL18; Cosmo Bio , 1:2000 ), UL37 ( CAC-CT-HSV-UL37; CosmoBio, 1:2000) 564 green fluorescent protein (GFP) (598; MBL; 1:1000) . Mouse monoclonal antibodies to 565 UL13 (1:500) and EF -1δ with phosphorylated Ser -133 (1:5000) and rabbit polyclonal 566 antibodies to UL56 (1:2000), Us11 (1:500), and EF-1δ (1:1000) were reported previously 567 (18, 48-51). To generate mouse polyclonal antibodies to HSV -2 UL55, Us10 or Us9 , 568 BALB/c mice were immunized once with purified MBP -UL55-P1, MBP -Us10-P1 or 569 MBP-Us9-P1, respectively, in combination with TiterMax Gold (TiterMax USA, Inc.). 570 Sera from immunized mice were used as sources of mouse polyclonal antibodies to UL55 571 (1:100), Us10 (1:100), or Us9 (1:100). 572 Transfection. COS-7 or 293T cells were transfected with the indicated plasmid(s) 573 using PEI Max (Polysciences). 574 Immunoblotting. Immunoblotting was performed as described previously (51). 575 Brightness/contrast of raw blots were equally adjusted across the entire image with Image 576 lab software (BioRad) to generate representative images. The amount of protein in 577 immunoblot bands was quantitated using ChemiDoc MP (Bio-Rad) with Image Lab 6.1.0 578 software (Bio-Rad) according to the manufacturer’s instructions. 579 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint 27 In vitro kinase assays. HEK293T cells were transfected with SE -UL13 or SE -580 UL13-K176M in combination with pEGFP-N2, UL55-EGFP or Us10-EGFP. Transfected 581 cells were harvested at 48 h post -transfection and lysed in 0.1% NP -40 buffer (50 mM 582 Tris-HCl [pH 8.0], 150 mM NaCl, 50 mM NaF, and 0.1% NP -40) containing protease 583 inhibitor cocktails (Nacalai Tesque). Supernatants obtained after centrifugation of the cell 584 lysates were pre-cleared by incubation with protein A-Sepharose beads (GE Healthcare) 585 at 4 °C for 30 min. After a brief centrifugation, supernatants were reacted at 4 °C 586 overnight with Strep -Tactin sepharose beads (IBA Lifescience). The s epharose beads 587 were collected by a brief centrifugation and washed once with high-salt buffer (1 M NaCl, 588 10 mM Tris-HCl [pH 8.0], 0.2% NP-40), twice with low-salt buffer (0.1 M NaCl, 10 mM 589 Tris-HCl [pH 8.0], 0.2% NP-40), four times with radioimmunoprecipitation assay buffer 590 (50 mM Tris-HCl [pH 7.5], 150 mM NaCl, 1% NP-40, 0.5% deoxycholate, 0.1% sodium 591 dodecyl sulfate), and finally two times with UL13 kinase buffer (50 mM Tris-HCl [pH 592 8.0], 50 mM NaCl, 15 mM MgCl 2, 0.1% Nonidet P-40, and 1 mM dithiothreitol). For in 593 vitro kinase assays, U L13 kinase buffer containing 10 0 μM ATP and amylose beads 594 containing purified MBP-EF-1δ (107-146) or MBP-EF-1δ (107-146)-S133A were added 595 to the mixture of protein A -Sepharose beads and reacted at 30°C for 30 min. After 596 incubation, the reaction mixture was mixed with 3x SDS sample buffer (187.5 mM Tris–597 HCl pH 6.5, 30% glycerol, 6% SDS, 15% 2 -mercaptoethanol), boil ed for 5 minutes , 598 subjected to electrophoresis in denaturing gels. After electrophoresis, the separated 599 proteins were transferred from the gels to nitrocellulose membranes (Bio -Rad), stained 600 with Ponceau S, visualized on a ChemiDoc MP (Bio -Rad), and subjected to 601 immunoblotting using the anti-Strep, anti-GFP or anti-EF-1δ-S133P antibodies. 602 Immunoprecipitation. Vero cells were infected with wild-type HSV-2 186 or 603 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint 28 YK873 (UL13-HA) at an MOI of 3 for 24 h and lysed in 0.1% NP40 buffer containing a 604 protease inhibitor cocktail (Nacalai Tesque). After centrifugation, the supernatants were 605 precleared by incubation with protein G-Sepharose beads, and then reacted with an anti-606 HA monoclonal antibody at 4°C for 2 h. Protein G-Sepharose beads were added to the 607 supernatants, and the reaction continued for another 2 h. Immunoprecipitates were 608 collected by a brief centrifugation, washed extensively with 0.1% NP-40 buffer , and 609 analyzed by immunoblotting with the indicated antibodies. 610 Inhibitor treatment. The proteasome inhibitor, MG132 (Wako), was added to 611 the indicated COS-7 or HEK293T cells at 24 h after transfection at a final concentration 612 of 10 μM. 613 Determination of plaque size. Vero and U2OS cells were infected with each 614 recombinant virus at an MOI of 0.0001, and plaque sizes were determined as described 615 previously (30). 616 Statistical analysis. Differences in viral replication and plaque size in cell 617 cultures, and relative amounts of phosphorylated UL13 were analyzed statistically by 618 analysis of variance (ANOV A) followed by Tukey’s post-hoc test. Differences in relative 619 amounts of phosphorylated EF-1δ was evaluated by ANOV A followed by Tukey’s post-620 hoc test or one-way ANOV A with Dunnett’s multiple comparisons test comparing to the 621 empty vector. A P value of <0.05 was considered statistically significant. All statistical 622 analyses were performed with GraphPad Prism 8 (GraphPad Software, San Diego, CA). 623 624 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint 29

625 We thank Risa Abe, Tohru Ikegami, and Sachi Fujiwara for their excellent 626 technical assistance. We are grateful to Yasuko Mori, Thomas Shenk, and Keiji Ueda for 627 providing valuable reagents. This study was supported by Grants for Scientific Research 628 and Grant-in-Aid for Scientific Research (S) (20H05692) from the Japan Society for the 629 Promotion of Science, grants for Scientific Research on Innovative Areas (21H00338, 630 21H00417, 22H04803) and a grant for Transformative Research Areas (22H05584) from 631 the Ministry of Education, Culture, Science, Sports and Technology of Japan, Precursory 632 Research for Embryonic Science and Technology (JPMJPR22R5) from Japan Science 633 and Technology Agency, grants (JP20wm0125002, JP22fk0108640, JP22gm1610008, 634 JP223fa627001, JP23wm0225031, JP23wm0225035) from the Japan Agency for Medical 635 Research and Development, grants from the International Joint Research Project of the 636 Institute of Medical Science, the University of Tokyo, grants from the Takeda Science 637 Foundation, the Mitsubishi Foundation, the Uehara Memorial Foundation, and the 638 Waksman Foundation of Japan, and the GlaxoSmithKline Japan Research Grant 2019. 639 640 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint 30

641 1. Krug LT, Pellett PE. 2022. The Family Herpesviridae: A Brief Introduction, p 212-642 234. In Howley PM, Knipe DM (ed), Fields Virology, 7th ed. Lippincott Williams 643 & Wilkins, Philadelphia, Pennsylvania, USA. 644 2. Jacob T, Van den Broeke C, Favoreel HW. 2011. Viral serine/threonine protein 645 kinases. J Virol 85:1158-73. 646 3. Kawaguchi Y , Kato K. 2003. Protein kinases conserved in herpesviruses 647 potentially share a function mimicking the cellular protein kinase cdc2. Rev Med 648 Virol 13:331-40. 649 4. Kawaguchi Y , Kato K, Tanaka M, Kanamori M, Nishiyama Y , Yamanashi Y . 2003. 650 Conserved protein kinases encoded by herpesviruses and cellular protein kinase 651 cdc2 target the same phosphorylation site in eukaryotic elongation factor 1delta. 652 J Virol 77:2359-68. 653 5. Baek MC, Krosky PM, Pearson A, Coen DM. 2004. Phosphorylation of the RNA 654 polymerase II carboxyl-terminal domain in human cytomegalovirus-infected cells 655 and in vitro by the viral UL97 protein kinase. Virology 324:184-93. 656 6. Kudoh A, Daikoku T, Ishimi Y , Kawaguchi Y , Shirata N, Iwahori S, Isomura H, 657 Tsurumi T. 2006. Phosphorylation of MCM4 at sites inactivating DNA helicase 658 activity of the MCM4 -MCM6-MCM7 complex during Epstein -Barr virus 659 productive replication. J Virol 80:10064-72. 660 7. Hume AJ, Finkel JS, Kamil JP, Coen DM, Culbertson MR, Kalejta RF. 2008. 661 Phosphorylation of retinoblastoma protein by viral protein with cyclin-dependent 662 kinase function. Science 320:797-9. 663 8. Hamirally S, Kamil JP, Ndassa-Colday YM, Lin AJ, Jahng WJ, Baek MC, Noton 664 S, Silva LA, Simpson -Holley M, Knipe DM, Golan DE, Marto JA, Coen DM. 665 2009. Viral mimicry of Cdc2/cyclin -dependent kinase 1 mediates disruption of 666 nuclear lamina during human cytomegalovirus nuclear egress. PLoS Pathog 667 5:e1000275. 668 9. Li R, Zhu J, Xie Z, Liao G, Liu J, Chen MR, Hu S, Woodard C, Lin J, Taverna 669 SD, Desai P, Ambinder RF, Hayward GS, Qian J, Zhu H, Hayward SD. 2011. 670 Conserved herpesvirus kinases target the DNA damage response pathway and 671 TIP60 histone acetyltransferase to promote virus replication. Cell Host Microbe 672 10:390-400. 673 10. Iwahori S, Umana AC, VanDeusen HR, Kalejta RF. 2017. Human 674 cytomegalovirus-encoded viral cyclin -dependent kinase (v -CDK) UL97 675 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint 31 phosphorylates and inactivates the retinoblastoma protein-related p107 and p130 676 proteins. J Biol Chem 292:6583-6599. 677 11. Iwahori S, Kalejta RF. 2017. Phosphorylation of transcriptional regulators in the 678 retinoblastoma protein pathway by UL97, the viral cyclin -dependent kinase 679 encoded by human cytomegalovirus. Virology 512:95-103. 680 12. Zhang K, Lv DW, Li R. 2019. Conserved Herpesvirus Protein Kinases Target 681 SAMHD1 to Facilitate Virus Replication. Cell Rep 28:449-459 e5. 682 13. Izumiya Y , Izumiya C, Van Geelen A, Wang DH, Lam KS, Luciw PA, Kung HJ. 683 2007. Kaposi's sarcoma -associated herpesvirus -encoded protein kinase and its 684 interaction with K-bZIP. J Virol 81:1072-82. 685 14. Iwahori S, Murata T, Kudoh A, Sato Y , Nakayama S, Isomura H, Kanda T, 686 Tsurumi T. 2009. Phosphorylation of p27Kip1 by Epstein -Barr virus protein 687 kinase induces its degradation through SCFSkp2 ubiquitin ligase actions during 688 viral lytic replication. J Biol Chem 284:18923-31. 689 15. Businger R, Deutschmann J, Gruska I, Milbradt J, Wiebusch L, Gramberg T, 690 Schindler M. 2019. Human cytomegalovirus overcomes SAMHD1 restriction in 691 macrophages via pUL97. Nat Microbiol 4:2260-2272. 692 16. Koyanagi N, Hengphasatporn K, Kato A, Nobe M, Takeshima K, Maruzuru Y , 693 Maenaka K, Shigeta Y , Kawaguchi Y . 2025. Regulatory mimicry of cyclin -694 dependent kinases by a conserved herpesvirus protein kinase. Proc Natl Acad Sci 695 U S A 122:e2500264122. 696 17. Wood DJ, Endicott JA. 2018. Structural insights into the functional diversity of 697 the CDK-cyclin family. Open Biol 8. 698 18. Koyanagi N, Kato A, Takeshima K, Maruzuru Y , Kozuka-Hata H, Oyama M, Arii 699 J, Kawaguchi Y . 2018. Regulation of Herpes Simplex Virus 2 Protein Kinase 700 UL13 by Phosphorylation and Its Role in Viral Pathogenesis. J Virol 92:e00807-701 18. 702 19. Kawaguchi Y , Matsumura T, Roizman B, Hirai K. 1999. Cellular elongation factor 703 1delta is modified in cells infected with representative alpha -, beta -, or 704 gammaherpesviruses. J Virol 73:4456-60. 705 20. Kato K, Kawaguchi Y , Tanaka M, Igarashi M, Yokoyama A, Matsuda G, 706 Kanamori M, Nakajima K, Nishimura Y , Shimojima M, Phung HTT, Takahashi E, 707 Hirai K. 2001. Epstein -Barr virus -encoded protein kinase BGLF4 mediates 708 hyperphosphorylation of cellular elongation factor 1delta (EF -1delta): EF-1delta 709 is universally modified by conserved protein kinases of herpesviruses in 710 mammalian cells. J Gen Virol 82:1457-1463. 711 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint 32 21. Kuny CV , Chinchilla K, Culbertson MR, Kalejta RF. 2010. Cyclin -dependent 712 kinase-like function is shared by the beta - and gamma- subset of the conserved 713 herpesvirus protein kinases. PLoS Pathog 6:e1001092. 714 22. Cunningham C, Davison AJ, Dolan A, Frame MC, McGeoch DJ, Meredith DM, 715 Moss HW, Orr AC. 1992. The UL13 virion protein of herpes simplex virus type 1 716 is phosphorylated by a novel virus -induced protein kinase. J Gen Virol 73 ( Pt 717 2):303-11. 718 23. Overton HA, McMillan DJ, Klavinskis LS, Hope L, Ritchie AJ, Wong -kai-in P. 719 1992. Herpes simplex virus type 1 gene UL13 encodes a phosphoprotein that is a 720 component of the virion. Virology 190:184-92. 721 24. Stevenson D, Colman KL, Davison AJ. 1994. Characterization of the putative 722 protein kinases specified by varicella-zoster virus genes 47 and 66. J Gen Virol 75 723 ( Pt 2):317-26. 724 25. van Zeijl M, Fairhurst J, Baum EZ, Sun L, Jones TR. 1997. The human 725 cytomegalovirus UL97 protein is phosphorylated and a component of virions. 726 Virology 231:72-80. 727 26. Asai R, Kato A, Kato K, Kanamori -Koyama M, Sugimoto K, Sairenji T, 728 Nishiyama Y , Kawaguchi Y . 2006. Epstein-Barr virus protein kinase BGLF4 is a 729 virion tegument protein that dissociates from virions in a phosphorylation -730 dependent process and phosphorylates the viral immediate -early protein BZLF1. 731 J Virol 80:5125-34. 732 27. Avey D, Tepper S, Pifer B, Bahga A, Williams H, Gillen J, Li W, Ogden S, Zhu F. 733 2016. Discovery of a Coregulatory Interaction between Kaposi's Sarcoma -734 Associated Herpesvirus ORF45 and the Viral Protein Kinase ORF36. J Virol 735 90:5953-5964. 736 28. Knipe DM, Heldwein EE, Mohr IJ, Sodroski CN. 2022. Herpes simplex viruses: 737 mechanisms of lytic and latent infection, p 235 –296. In Howley PM, Knipe DM 738 (ed), Fields Virology, 7th ed. Lippincott Williams & Wilkins, Philadelphia, 739 Pennsylvania, USA. 740 29. Morrison EE, Wang YF, Meredith DM. 1998. Phosphorylation of structural 741 components promotes dissociation of the herpes simplex virus type 1 tegument. J 742 Virol 72:7108-14. 743 30. Tanaka M, Nishiyama Y , Sata T, Kawaguchi Y . 2005. The role of protein kinase 744 activity expressed by the UL13 gene of herpes simplex virus 1: the activity is not 745 essential for optimal expression of UL41 and ICP0. Virology 341:301-12. 746 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint 33 31. Ponnuraj N, Akbar H, Arrington JV , Spatz SJ, Nagarajan B, Desai UR, Jarosinski 747 KW. 2023. The alphaherpesvirus conserved pUS10 is important for natural 748 infection and its expression is regulated by the conserved Herpesviridae protein 749 kinase (CHPK). PLoS Pathog 19:e1010959. 750 32. Vandevenne P, Lebrun M, El Mjiyad N, Ote I, Di Valentin E, Habraken Y , Dortu 751 E, Piette J, Sadzot -Delvaux C. 2011. The varicella -zoster virus ORF47 kinase 752 interferes with host innate immune response by inhibiting the activation of IRF3. 753 PLoS One 6:e16870. 754 33. Ming X, Bo Z, Miao Y , Chen H, Bao C, Sun L, Xi R, Zhong Q, Zhao P, Jung YS, 755 Qian Y . 2022. Pseudorabies virus kinase UL13 phosphorylates H2AX to foster 756 viral replication. FASEB J 36:e22221. 757 34. Verhamme R, Jansens RJJ, Liu J, Van Raemdonck F, Van Waesberghe C, 758 Nicholson L, Jaffrey SR, Favoreel HW. 2025. The pseudorabies virus UL13 759 protein kinase triggers phosphorylation of the RNA demethylase FTO, which is 760 associated with FTO -dependent suppression of interferon -stimulated gene 761 expression. J Virol 99:e0201924. 762 35. Bertoli C, Skotheim JM, de Bruin RA. 2013. Control of cell cycle transcription 763 during G1 and S phases. Nat Rev Mol Cell Biol 14:518-28. 764 36. Bayer KU, Schulman H. 2019. CaM Kinase: Still Inspiring at 40. Neuron 765 103:380-394. 766 37. Clurman BE, Sheaff RJ, Thress K, Groudine M, Roberts JM. 1996. Turnover of 767 cyclin E by the ubiquitin -proteasome pathway is regulated by cdk2 binding and 768 cyclin phosphorylation. Genes Dev 10:1979-90. 769 38. Welcker M, Singer J, Loeb KR, Grim J, Bloecher A, Gurien-West M, Clurman BE, 770 Roberts JM. 2003. Multisite phosphorylation by Cdk2 and GSK3 controls cyclin 771 E degradation. Mol Cell 12:381-92. 772 39. Brown NR, Korolchuk S, Martin MP, Stanley WA, Moukhametzianov R, Noble 773 MEM, Endicott JA. 2015. CDK1 structures reveal conserved and unique features 774 of the essential cell cycle CDK. Nat Commun 6:6769. 775 40. Tanaka M, Kagawa H, Yamanashi Y , Sata T, Kawaguchi Y . 2003. Construction of 776 an excisable bacterial artificial chromosome containing a full -length infectious 777 clone of herpes simplex virus type 1: viruses reconstituted from the clone exhibit 778 wild-type properties in vitro and in vivo. J Virol 77:1382-91. 779 41. Sato Y , Kato A, Maruzuru Y , Oyama M, Kozuka-Hata H, Arii J, Kawaguchi Y . 780 2016. Cellular Transcriptional Coactivator RanBP10 and Herpes Simplex Virus 1 781 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint 34 ICP0 Interact and Synergistically Promote Viral Gene Expression and Replication. 782 J Virol 90:3173-86. 783 42. Arii J, Uema M, Morimoto T, Sagara H, Akashi H, Ono E, Arase H, Kawaguchi 784 Y. 2009. Entry of herpes simplex virus 1 and other alphaherpesviruses via the 785 paired immunoglobulin-like type 2 receptor alpha. J Virol 83:4520-7. 786 43. Asano S, Honda T, Goshima F, Watanabe D, Miyake Y , Sugiura Y , Nishiyama Y . 787 1999. US3 protein kinase of herpes simplex virus type 2 plays a role in protecting 788 corneal epithelial cells from apoptosis in infected mice. J Gen Virol 80 ( Pt 1):51-789 56. 790 44. Kato A, Adachi S, Kawano S, Takeshima K, Watanabe M, Kitazume S, Sato R, 791 Kusano H, Koyanagi N, Maruzuru Y , Arii J, Hatta T, Natsume T, Kawaguchi Y . 792 2020. Identification of a herpes simplex virus 1 gene encoding neurovirulence 793 factor by chemical proteomics. Nat Commun 11:4894. 794 45. Asai R, Kato A, Kawaguchi Y . 2009. Epstein-Barr virus protein kinase BGLF4 795 interacts with viral transactivator BZLF1 and regulates its transactivation activity. 796 J Gen Virol 90:1575-1581. 797 46. Tischer BK, von Einem J, Kaufer B, Osterrieder N. 2006. Two-step red-mediated 798 recombination for versatile high -efficiency markerless DNA manipulation in 799 Escherichia coli. Biotechniques 40:191-7. 800 47. Kato A, Tsuda S, Liu Z, Kozuka-Hata H, Oyama M, Kawaguchi Y . 2014. Herpes 801 simplex virus 1 protein kinase Us3 phosphorylates viral dUTPase and regulates 802 its catalytic activity in infected cells. J Virol 88:655-66. 803 48. Fujii H, Mugitani M, Koyanagi N, Liu Z, Tsuda S, Arii J, Kato A, Kawaguchi Y . 804 2014. Role of the nuclease activities encoded by herpes simplex virus 1 UL12 in 805 viral replication and neurovirulence. J Virol 88:2359-64. 806 49. Koshizuka T, Goshima F, Takakuwa H, Nozawa N, Daikoku T, Koiwai O, 807 Nishiyama Y . 2002. Identification and characterization of the UL56 gene product 808 of herpes simplex virus type 2. J Virol 76:6718-28. 809 50. Koshizuka T, Takakuwa H, Goshima F, Murata T, Nishiyama Y . 2001. The US11 810 gene product of herpes simplex virus has intercellular trafficking activity. 811 Biochem Biophys Res Commun 288:597-602. 812 51. Kawaguchi Y , Bruni R, Roizman B. 1997. Interaction of herpes simplex virus 1 813 alpha regulatory protein ICP0 with elongation factor 1delta: ICP0 affects 814 translational machinery. J Virol 71:1019-24. 815 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint 35 52. Degasperi A, Birtwistle MR, V olinsky N, Rauch J, Kolch W, Kholodenko BN. 816 2014. Evaluating strategies to normalise biological replicates of Western blot data. 817 PLoS One 9:e87293. 818 819 820 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint 36 Figure Legends 821 Fig. 1. Identification of HSV -2 UL55 and Us10 as an activator of HSV-2 UL13 822 kinase activity. A. COS-7 cells were transfected with a plasmid expressing EGFP -EF-823 1δ(F) (lanes 1-7) in combination with an empty plasmid (lane 1), SE-UL13 (lanes 2), SE-824 ORF47 (lane 3), SE-UL97 (lane 4), SE-U69 (lane 5), SE-BGLF4 (lane 6), or SE-ORF36 825 (lane 7), and harvested 48 h post -transfection. Cell lysates were analyzed by 826 immunoblotting with antibodies to Flag-tag, EF-1δ-S133P, Strep-tag, or β-actin. Digital 827 images are representative of three independent experiments. B. COS-7 cells were 828 transfected with plasmids expressing EGFP-EF-1δ(F), SE-UL13 and one of the 22 HSV-829 2 proteins or an empty plasmid, and harvested 48 h post -transfection. Cell lysates were 830 analyzed by immunoblotting with antibodies to Flag -tag or EF-1δ-S133P. Amount of 831 EGFP-EF-1δ(F)-S133P protein detected with anti -EF-1δ-S133P monoclonal antibody 832 relative to that of EGFP-EF-1δ(F) protein detected with anti-Flag antibody in transfected 833 cells. Data were normalized by dividing the sum of the data on the same blot (52). Each 834 value is the mean ± SEM of four experiments. Statistical significance was analyzed by 835 one-way ANOV A with Dunnett’s multiple comparisons test comparing to the empty 836 plasmid. Asterisks indicate statistically significant values (*, P < 0.05; ***, P < 0.001). 837 C. COS-7 cells were transfected with a plasmid expressing EGFP -EF-1δ(F) in 838 combination with a plasmid expressing SE-UL13 (lanes 1, 2) or SE-UL13-K176M (lane 839 3), and an empty plasmid (lane 1) or a plasmid expressing HA-Us10 (lanes 2, 3) , 840 harvested 48 h post-transfection, and lysates were then analyzed by immunoblotting with 841 the indicated antibodies. Digital images are representative of three independent 842 experiments. D. Amount of EGFP -EF-1δ(F)-S133P protein detected with anti -EF-1δ-843 S133P monoclonal antibody ( C, top panel) relative to that of EGFP -EF-1δ(F) protein 844 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint 37 detected with anti-Flag antibody (C, second panel from the top) in transfected cells. Data 845 were normalized by dividing the sum of the data on the same blot (52). Each value is the 846 mean ± SEM of three experiments. Statistical significance was analyzed by ANOV A with 847 Tukey’s test. Asterisks indicate statistically significant values (**, P < 0.01 , ***, P < 848 0.001). n.s., not significant. E. COS-7 cells were transfected with a plasmid expressing 849 EGFP-EF-1δ(F) in combination with a plasmid expressing SE-UL13 (lanes 1, 2, 4, 5) or 850 SE-UL13-K176M (lanes 3, 6), and an empty plasmid (lane 1 or 4) or a plasmid expressing 851 HA-UL55 (lanes 2, 3 , 5, 6). Transfected cells were incubated with DMSO o r 10 μM 852 MG132 24 h post-transfection, harvested 4 8 h post-transfection, and lysates were then 853 analyzed by immunoblotting with the indicated antibodies. Digital images are 854 representative of three independent experiments. F, G. Amount of EGFP-EF-1δ(F)-S133P 855 protein detected with anti -EF-1δ-S133P monoclonal antibody ( E, top panel) relative to 856 that of EGFP -EF-1δ(F) protein detected with anti -Flag antibody ( E, second panel from 857 the top) in transfected cells with DMSO (F) or MG132 (G) . Data were normalized by 858 dividing the sum of the data on the same blot (52). Each value is the mean ± SEM of three 859 experiments. Statistical significance was analyzed by ANOV A with Tukey’s test. 860 Asterisks indicate statistically significant values (***, P < 0.001). n.s., not significant. 861 862 Fig. 2. UL55 and Us10 upregulate UL13 kinase activity. A. HEK293T cells were 863 transfected with a plasmid expressing SE-UL13 (lanes 1, 2, 4) or SE-UL13-K176M (lane 864 3), and an empty plasmid (lane 1) or a plasmid expressing Us10-EGFP (lane 2, 3, 4) . 865 Transfected cells were harvested 48 h post-transfection, precipitated with StrepTactin -866 sepharose. For in vitro kinase assays, the precipitates were incubated in kinase buffer 867 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint 38 containing MBP-EF-1δ (107-146) (lane1, 2, 3) or MBP-EF-1δ (107-146)-S133A (lane 4), 868 separated on a denaturing gel, transferred onto a nitrocellulose membrane, subjected to 869 Ponceau-S staining, and then analyzed by immunoblotting with the indicated antibodies. 870 Digital images are representative of three independent experiments. B. HEK293T cells 871 were transfected with a plasmid expressing SE-UL13 (lanes 1, 2, 4) or SE-UL13-K176M 872 (lane 3), and an empty plasmid (lane 1) or a plasmid expressing UL55-EGFP (lane 2, 3, 873 4). Transfected cells were incubated with 10 μM MG132 24 h post-transfection, harvested 874 48 h post-transfection, precipitated with StrepTactin-sepharos. For in vitro kinase assays, 875 the precipitates were incubated in kinase buffer containing MBP-EF-1δ (107-146) (lane1, 876 2, 3) or MBP-EF-1δ (107-146)-S133A (lane 4), separated on a denaturing gel, transferred 877 onto a nitrocellulose membrane, subjected to Ponceau -S staining, and then analyzed by 878 immunoblotting with the indicated antibodies. Digital images are representative of three 879 independent experiments. 880 881 Fig. 3. Schematic diagrams of the genome structures of wild-type HSV-2 186 and 882 the relevant domains of the recombinant viruses used in this study. Line 1, wild-883 type HSV-2 186 genome; Line 2, domain of the UL12 gene to the UL15 gene; Line 3, 884 domain of the UL13 gene; Lines 4 to 8, recombinant viruses with mutations in the UL13 885 gene; Line 9, domains of UL 54 (ICP27) to UL 56 and Us 9 to Us11 genes; Line 10, 886 domains of the UL55 and Us10 genes; Lines 11 to 16, recombinant viruses with mutations 887 in the UL55 and/or Us10 genes. 888 889 Fig. 4. Characterization of the recombinant viruse s. A. Vero cells were mock 890 infected (lane 1) or infected with wild -type HSV-2 186 (lane 2) or YK873 (UL13-HA) 891 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint 39 (lane 3) at an MOI of 3 for 24 h and then analyzed by immunoblotting with the indicated 892 antibodies. B, C. Vero cells were mock-infected (lane 1) or infected with wild-type HSV-893 2 186 (lane 2), YK 874 (ΔUL55) (lane 3) or YK 875 (ΔUL55-repair) (lane 4) at an MOI 894 of 3, harvested at 24 h post-infection, and lysates were analyzed by immunoblotting with 895 the indicated antibodies. D, E. Vero cells were mock -infected (lane 1) or infected with 896 wild-type HSV-2 186 (lane 2), YK876 (ΔUs10) (lane 3) or YK877 (ΔUs10-repair) (lane 897 4) at an MOI of 3, harvested at 24 h post -infection, and lysates were analyzed by 898 immunoblotting with the indicated antibodies. F, G. Vero cells were mock-infected (lane 899 1) or infected with wild -type HSV-2 186 (lane 2) , YK878 (ΔUL55/ΔUs10) (lane 3) or 900 YK879 (ΔUL55/ΔUs10-repair) (lane 4) at an MOI of 3, harvested at 24 h post-infection, 901 and lysates were analyzed by immunoblotting with the indicated antibodies. Digital 902 images are representative of three independent experiments. 903 904 Fig. 5. Interactions of UL13 with UL55 and Us10 in HSV-2-infected cells. Vero cells 905 were infected with wild-type HSV-2 186 (lane 1, 3) or YK873 (UL13-HA) (lane 2, 4) at 906 an MOI of 3 for 24 h, lysed, immunoprecipitated with anti-HA antibody, and analyzed by 907 immunoblotting with the indicated antibodies. WC L, whole-cell lysate. Digital images 908 are representative of three independent experiments. 909 910 Fig. 6. Effects of mutation(s) in UL13 on expression of UL5 5 and Us10. A. Vero 911 cells were mock-infected (lane 1) or infected with wild-type HSV-2 186 (lane 2), YK862 912 (ΔUL13) (lane 3) or YK 863 (ΔUL13-repair) (lane 4) at an MOI of 3, harvested at 24 h 913 post-infection, and lysates were analyzed by immunoblotting with the indicated 914 antibodies. B. Vero cells were mock-infected (lane 1) or infected with wild-type HSV-2 915 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint 40 186 (lane 2), YK864 (UL13-K176M) (lane 3) or YK865 (UL13-K176M-repair) (lane 4) 916 at an MOI of 3, harvested at 24 h post -infection, and lysates were analyzed by 917 immunoblotting with the indicated antibodies. Digital images are representative of three 918 independent experiments. 919 920 Fig. 7. Effects of mutation(s) in UL55 and/or Us10 on phosphorylation of EF -1δ 921 Ser-133 in Vero cells. A-D. U2OS cells were infected with wild-type HSV-2 186 (A-C), 922 YK874 (ΔUL55) (A, D), YK875 (ΔUL55-repair) (A), YK876 (ΔUs10) (B), YK877 923 (ΔUs10-repair) (B), YK878 (ΔUL55/ΔUs10) (C, D), YK879 (ΔUL55/ΔUs10-repair) (C), 924 or YK864 (UL13-K176M) (D) for 24 h at an MOI of 3 were analyzed by immunoblotting 925 with the indicated antibodies. Digital images are representative of three (A-C) or five (D) 926 independent experiments. E-H. Amount of EF-1δ-S133P protein detected with anti-EF-927 1δ-S133P monoclonal antibody (Fig. 7A-D, top panel) relative to that of β-actin protein 928 detected with anti-β-actin antibody (Fig. 7A-D, bottom panel) in HSV -2-infected cells. 929 Data were normalized by dividing the sum of the data on the s ame blot (52). Each value 930 is the mean ± SEM of three (E-G) or five (H) experiments. Statistical significance was 931 analyzed by ANOV A with the Tukey’s test. Asterisks indicate statistically significant 932 values (*, P < 0.05; **, P < 0.01; ***, P < 0.001). n.s., not significant. I-L. Amount of 933 hyperphosphorylated form of EF-1δ protein detected with anti-EF-1δ polyclonal antibody 934 (Fig. 7A-D, upper band in second panel from the top) relative to that of total EF-1δ protein 935 (hyperphosphorylated and hypophosphorylated forms of EF -1δ) detected with anti -EF-936 1δ polyclonal antibody (Fig. 7A-D, both bands in second panel from the top) in HSV-2-937 infected cells. Data were normalized by dividing the sum of the data on the same blot 938 (52). Each value i s the mean ± SEM of three (I-K) or five ( L) experiments. Statistical 939 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint 41 significance was analyzed by ANOV A with the Tukey’s test. Asterisks indicate 940 statistically significant values (*, P < 0.05; **, P < 0.01; ***, P < 0.001). n.s., not 941 significant. 942 943 Fig. 8. Effects of mutation(s) in UL55 and/or Us10 on phosphorylation of EF -1δ 944 Ser-133 in U2OS cells. A-D. U2OS cells were infected with wild -type HSV-2 186 (A-945 C), YK874 (ΔUL55) (A, D), YK875 (ΔUL55-repair) (A), YK876 (ΔUs10) (B), YK877 946 (ΔUs10-repair) (B), YK878 (ΔUL55/ΔUs10) (C, D), YK879 (ΔUL55/ΔUs10-repair) (C), 947 or YK864 (UL13-K176M) (D) for 24 h at an MOI of 3 were analyzed by immunoblotting 948 the indicated antibodies. Digital images are representative of four (A-C) or seven (D) 949 independent experiments. E-H. Amount of EF-1δ-S133P protein detected with anti-EF-950 1δ-S133P monoclonal antibody (Fig. 8A-D, top panel) relative to that of β-actin protein 951 detected with anti-β-actin antibody (Fig. 8A-D, bottom panel) in HSV -2-infected cells. 952 Data were normalized by dividing the sum of the data on the s ame blot (52). Each value 953 is the mean ± SEM of four (E-G) or seven (H) experiments. Statistical significance was 954 analyzed by ANOV A with the Tukey’s test. Asterisks indicate statistically significant 955 values (*, P < 0.05; **, P < 0.01; ***, P < 0.001). n.s., not significant. I-L. Amount of 956 hyperphosphorylated form of EF-1δ protein detected with anti-EF-1δ polyclonal antibody 957 (Fig. 8A-D, upper band in second panel from the top) relative to that of total EF-1δ protein 958 (hyperphosphorylated and hypophosphorylated forms of EF -1δ) detected with anti -EF-959 1δ polyclonal antibody (Fig. 8A-D, both bands in second panel from the top) in HSV-2-960 infected cells. Data were normalized by dividing the sum of the data on the same blot 961 (52). Each value is the mean ± SEM of four (I-K) or seven ( L) experiments. Statistical 962 significance was analyzed by ANOV A with the Tukey’s test. Asterisks indicate 963 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint 42 statistically significant values (*, P < 0.05; **, P < 0.01; ***, P < 0.001). n.s., not 964 significant. 965 966 Fig. 9. Effects of mutation(s) in UL55 and/or Us10 on expression of UL13 proteins. 967 A, C. Vero cells (A) or U2OS cells (C) were mock-infected (lane 1) or infected with wild-968 type HSV -2 186 (lane 2), YK864 (UL13-K176M) (lane 3), YK865 (UL13-K176M-969 repair) (lane 4), YK874 (ΔUL55) (lane 5), YK875 (ΔUL55-repair) (lane 6), YK876 970 (ΔUs10) (lane 7), YK877 (ΔUs10-repair) (lane 8), YK878 (ΔUL55/ΔUs10) (lane 9), or 971 YK879 (ΔUL55/ΔUs10-repair) (lane 10) at an MOI of 3, harvested at 24 h post-infection, 972 and lysates were analyzed by immunoblotting with the indicated antibodies. Digital 973 images are representative of four independent experiments. B, D . Amount of 974 hyperphosphorylated form of UL13 protein detected with anti-UL13 monoclonal 975 antibody (Fig. 9A, C , upper band in top panel ) relative to that of total UL13 protein 976 (hyperphosphorylated and hypophosphorylated forms of UL13) detected with anti-UL13 977 monoclonal antibody (Fig. 9A, C, both bands in top panel) in HSV-2-infected cells. Each 978 value is the mean ± SEM of four experiments. Statistical significance was analyzed by 979 ANOV A with the Tukey’s test. Asterisks indicate statistically significant values (***, P < 980 0.0001). n.s., not significant. 981 982 Fig. 10. Effects of mutation(s) in UL5 5 and/or Us10 on viral replication and cell -983 cell spread in U2OS or Vero cells. A-D. U2OS cells (A, B) or Vero cells (C, D) were 984 infected with wild -type HSV-2 186, YK864 (UL13-K176M), YK865 (UL13-K176M-985 repair), YK874 (ΔUL55), YK875 (ΔUL55-repair), YK876 (ΔUs10), YK877 (ΔUs10-986 repair), YK878 (ΔUL55/ΔUs10), or YK879 (ΔUL55/ΔUs10-repair) at an MOI of 0.01 987 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint 43 (A, C) or 3 (B , D). Total virus titers in cell culture supernatants and infected cells were 988 harvested at 24 h (A, C) or 12 h (B, D) post-infection and assayed. Each value is the mean 989 ± standard error of the mean (SEM) of seven (A, B) or four (C, D) experiments. Statistical 990 significance was analyzed by ANOV A with the Tukey’s test. Asterisks indicate 991 statistically significant values (*, P < 0.05; **, P < 0.01; ***, P < 0.001). n.s., not 992 significant. E, F. U2OS cells (E) or Vero cells (F) were infected with wild -type HSV-2 993 186, YK864 (UL13-K176M), YK865 (UL13-K176M-repair), YK874 (ΔUL55), YK875 994 (ΔUL55-repair), YK876 (ΔUs10), YK877 (ΔUs10-repair), YK878 (ΔUL55/ΔUs10), or 995 YK879 (ΔUL55/ΔUs10-repair) at an MOI of 0.0001 under plaque assay conditions. 996 Diameters of 20 single plaques for each virus were measured at 48 h post-infection. Each 997 data point is the mean ± SEM of the measured plaque sizes. Statistical significance was 998 analyzed by ANOV A with Tukey’s test. Asterisks indicate statistically significant values 999 (***, P < 0.0 001). n.s., not significant. Data are representative of three independent 1000 experiments. 1001 1002 Figure 11. Conservation and phylogenetic distribution of HSV -1 UL55 and Us10 1003 homologs among alphaherpesviruses. A , B. Multiple-sequence alignments of Us10 1004 homologs from phylogenetically adjacent taxa (see panel C). Multiple -sequence 1005 alignment of annotated ORF4 proteins (Us10 homologs) from Equid alphaherpesvirus 8 1006 and Equid alphaherpesvirus 9 together with the as -yet-unannotated Us10 homolog 1007 encoded by Equid alphaherpesvirus 1 (A). Multiple -sequence alignment of annotated 1008 ORF3 proteins (Us10 homologs) from Human alphaherpesvirus 3 aligned with the as -1009 yet-unannotated Us10 homolog of Cercopithecine alphaherpesvirus 9 (B). Residues 1010 conserved in every sequence are shaded black; methionines that may serve as translational 1011 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint 44 start codons are colored red and indicated with red arrowheads. These alignments indicate 1012 the presence of Us10 homolog genes in Equid alphaherpesvirus 1and Cercopithecine 1013 alphaherpesvirus 9. C. Phylogenetic tree of alphaherpesviruses inferred from 1014 concatenated amino-acid sequences of six core genes conserved throughout the family 1015 Herpesviridae—uracil-DNA glycosylase, helicase -primase helicase subunit, DNA -1016 packaging terminase subunit 1, major capsid protein, envelope glycoprotein B, and DNA 1017 polymerase catalytic subunit. The topology was visualized in iTOL (https://itol.embl.de/) 1018 after importing a pre -computed Newick tree 1019 (https://ictv.global/sites/default/files/report_files/Alpha_Feb21_treefile.txt) obtained 1020 from the ICTV Online Report, Subfamily Alphaherpesvirinae 1021 (https://ictv.global/report/chapter/orthoherpesviridae/orthoherpesviridae/alphaherpesviri1022 nae); licensed under CC BY -SA 4.0). A table to the right of each taxon denotes the 1023 presence (+) or absence (–) of homologs of HSV-1 UL55 and Us10, as determined from 1024 NCBI annotations or alignment-based curation in panels (A) and (B). Accession numbers 1025 and corresponding NCBI hyperlinks are listed in Table S1. 1026 1027 Fig. 12. VZV ORF3 interacts with ORF47 and functions as an activator of ORF47. 1028 A. COS-7 cells were transfected with a plasmid expressing EGFP -EF-1δ(F) in 1029 combination with a plasmid expressing SE -ORF47 (lanes 1, 2) or SE -ORF47-K157M 1030 (lane 3), and an empty plasmid (lane 1) or a plasmid expressing HA -ORF3 (lanes 2, 3), 1031 harvested 48 h post-transfection, and lysates were then analyzed by immunoblotting with 1032 the indicated antibodies. Digital images are representative of four independent 1033 experiments. B. Amount of EGFP -EF-1δ(F)-S133P protein detected with anti -EF-1δ-1034 S133P monoclonal antibody (Fig. 12A, top panel) relative to that of EGFP -EF-1δ(F) 1035 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint 45 protein detected with anti -Flag antibody (Fig. 12A, second panel from the top) in 1036 transfected cells. Data were normalized by dividing the sum of the data on the same blot 1037 (52). Each value is the mean ± SEM of four experiments. Statistical significance was 1038 analyzed by ANOV A with Tukey’s test. Asterisks indicate statistically significant values 1039 (*, P < 0.05; **, P < 0.01). n.s., not significant. C. COS-7 cells were transfected with a 1040 plasmid expressing EGFP -EF-1δ(F) in combination with a plasmid expressing SE -1041 ORF47 (lanes 1, 2) or SE - ORF47-K157M (lane 3), and an empty plasmid (lane 1) or a 1042 plasmid expressing HA-ORF64 (lanes 2, 3), harvested 48 h post-transfection, and lysates 1043 were then analyzed by immunoblotting with the indicated antibodies. Digital images are 1044 representative of three independent experiments. D. Amount of EGFP -EF-1δ(F)-S133P 1045 protein detected with anti -EF-1δ-S133P monoclonal antibody (Fig. 12C, top panel) 1046 relative to that of EGFP -EF-1δ(F) protein detected with anti -Flag antibody (Fig. 12C, 1047 second panel from the top) in transfected cells. Data were normalized by dividing the sum 1048 of the data on the same blot (52). Each value is the mean ± SEM of three experiments. 1049 Statistical significance was analyzed by ANOV A with Tukey’s test. n.s., not significant. 1050 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint Table. 1 Oligonucleotide sequences for the construction of plasmids. Constructed plasmid Oligonucleotide sequence pcDNA-SE-UL13 pcDNA-SE-UL13-K176M 5'-CAGGAATTCATGGATGAGTCCGGGCGACA-3' 5'-GGCTCTAGATCACGACAGAGAGTGGCGCG-3' pcDNA-SE-ORF47 5'-CCTGCGGCCGCTCATGGATGCTGACGACACACCCCCCAACCTC-3' 5'-CTGTCTAGATTATGTCGATCCTATCCAATCCCGATCGTG-3' pcDNA-SE-UL97 5'-ATCGAATTCATGTCCTCCGCACTTCGGTCTCGGGCTCGC-3' 5'-TATGCGGCCGCTTACTCGGGGAACAGTTGGCGGCAGTCACC-3' pcDNA-SE-BGLF4 5'-GGTGAATTCATGGATGTGAATATGGCTGCG-3' 5'-CGAGCGGCCGCTCATCCACGTCGGCCATCTG-3' pcDNA-SE-ORF36 5'-ATCGAATTCATGCGCTGGAAGAGAATGGAGAGGAGACCC-3' 5'-TATGCGGCCGCTCAGAAAACAAGTCCGCGGGTGTGGGGGTG-3' pcDNA-SE-ORF47-K157M (1st PCR-A) 5'-CAAAAATAGCTGTAATGACCATGGACAGTCGT-3' 5'-CTGTCTAGATTATGTCGATCCTATCCAATCCCGATCGTG-3' pcDNA-SE-ORF47-K157M (1st PCR-B) 5'-CCTGCGGCCGCTCATGGATGCTGACGACACACCCCCCAACCTC-3' 5'-ACGACTGTCCATGGTCATTACAGCTATTTTTG-3' pcDNA-SE-ORF47-K157M (2nd PCR) 5'-CCTGCGGCCGCTCATGGATGCTGACGACACACCCCCCAACCTC-3' 5'-CTGTCTAGATTATGTCGATCCTATCCAATCCCGATCGTG-3' pUL7-EGFP 5'-GCCTCGAGACCATGGCCGACCCCACGCCCGC-3' 5'-GCGGTACCAGCAAAACCGATAGAAAAGC-3' pUL11-EGFP 5'-CGAGAATTCGCCACCATGGGCCTCGCGTTCTCCGG-3' 5'-AGTGGTACCGTTCGCTATCAGAGAGTGGGG-3' .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint pUL14-EGFP 5'-GCCTCGAGACCATGAGCCGAGACGCCAGCCA-3' 5'-GCGAATTCCTCGCCATCGGGACAGTCCC-3' pUL16-EGFP 5'-CGAGAATTCGCCACCCTGGCACAGCGGGCACTCTG-3' 5'-AGTGGATCCCTTTGTAATCGGACGATGAGG-3' pTk-EGFP 5'-GCCTCGAGACCATGGCTTCTCACGCCGGCCA-3' 5'-GCGAATTCAACTCCCCCCACCTCGCGGG-3' pVHS-EGFP 5'-CGAAAGCTTGCCACCATGGGTCTGTTTGGCATGATG-3' 5'-AGTGGTACCGCTCGTCCCAGAATTTAGCCAGG-3' pUL47-EGFP 5'-CGAGAATTCGCCACCATGTCCGTGCGCGGGCATGCCGTACGCC-3' 5'-AGTGGATCCCTGGGCGTGGCGGGCCGCCCAGCCCGGTC-3' pVP16-EGFP 5'-CGAGAATTCGCCACCATGGACCTGTTGGTCGACGA-3' 5'-AGTGGATCCCCCCCCCAAAGTCGTCAATGC-3' pVP22-EGFP 5'-CGAGAATTCGCCACCATGACCTCTCGCCGCTCCGT-3' 5'-AGTGGATCCCCTCGAGGGGGCGGCGGGGAC-3' pvdUTPase-EGFP 5'-CGAAAGCTTGCCACCATGAGTCAGTGGGGGCCCAG-3' 5'-AGTGGTACCGGATGCCAGTGGAGCCAAACC-3' pUL51-EGFP 5'-CGAAAGCTTGCCACCATGGCGTCCCTGCTCGGGGTG-3' 5'-AGTGGTACCGAGCGAGAAGGAGGGGGGCCTC-3' pICP27-EGFP 5'-CGAGAATTCGCCACCATGGCTACCGACATTGATAT-3' 5'-AGTGGTACCGAAATAGGGAGTTGCAGTAGAAG-3' pUL55-EGFP 5'-CGAGAATTCGCCACCATGACAACGACGCCCCTCTC-3' 5'-AGTGGTACCGTACCTTGATTTTGATTTTGA-3' .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint pUs2-EGFP 5'-CGAGAATTCGCCACCATGGGCGTTGTTGTTGTAAG-3' 5'-AGTGGTACCGGAGGTTGGTGATTGGATAGC-3' pUs3-EGFP 5'-CGAGAATTCGCCACCATGGCCTGTCGTAAGTTCTG-3' 5'-AGTGGTACCGCTTAGGGTGAAATAGCGGCAG-3' pUs10-EGFP 5'-CGAAAGCTTGCCACCATGATCCGGCGGCGGGGAAAC-3' 5'-AGTGGTACCGATTACACCAACCACCCTGTC-3' pUs11-EGFP 5'-CGAAAGCTTGCCACCATGGCATCCGGGGTTTCCCC-3' 5'-AGTGGTACCGGGCAAGCCCGCGGGTTGCGC-3' pcDNA-HA 5'-GGCCGCGCCACCATGTACCCATACGATGTTCCGGATTACGCTG -3' 5'-AATTCAGCGTAATCCGGAACATCGTATGGGTACATGGTGGCGC-3' pcDNA-HA-UL55 5'-ACTGAATTCATGACAACGACGCCCCTCTCGAAC-3' 5'-CCCAAGCTTTTATACCTTGATTTTGATTTTGATTTTG-3' pcDNA-HA-Us10 5'-CTCGGTACCGATGATCCGGCGGCGGGGAAACGTGG-3' 5'-CCCAAGCTTTTAATTACACCAACCACCCTGTC-3' pcDNA-HA-ORF3 5'-ACTGAATTCATGGATACAACGGGAGCTTCCGAAAG-3' 5'-ACTAAGCTTTCATAGTCCGCCGACAGCCGCTCGGG-3' pcDNA-HA-ORF64 5'-ACTGAATTCATGAATCTCTGCGGATCCCGCGGTGAG-3' 5'-ACTAAGCTTTCAGGATCTCTCGTAGGTTCTTGGGAC-3' pMAL-UL55-P1 5'-CCTGAATTCATGACAACGACGCCCCTCTCGAACC-3' 5'-CTGGTCGACTTACTCTAGTTCGCGCAAGACGGGC-3' pMAL-Us10-P1 5'-CCTGAATTCCCAGGGCACCACGTGTCCCCAG-3' 5'-CTGGTCGACTTAGGTGTCGGACGCGGGCGCGTTATG-3' .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint pMAL-Us9-P1 5'-CCTGAATTCATGACCTCCCGGCCCGCCGAC-3' 5'-CTGGTCGACCTACTGGCGGCCCATGCGCACGAG-3' pYEbac861/UL55+KanS 5'-GCGGCTGCGGTGCACGGGCCCATTCAGCTGCGGAACCATCAAGGACGTCTCCGGTGCATCCCCAGGATGAC GACGATAAGTAGGG-3' 5'-TTATCGTGTATTCCCCCGCGGGGGATGCACCGGAGACGTCCTTGATGGTTCCGCAGCTGAATGCAACCAATTA ACCAATTCTGATTAG-3' .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint Table 2. Oligonucleotide sequences for the construction of recombinant viruses. Recombinant virus Oligonucleotide sequence (5′-3′) Plasmid DNA template E. coli GS1873 containing HSV-2 BAC UL13-HA 5’-TGGTCTCCCGCCTCTGTCACGCCAACCCGGCCGCGCGCCACTCTCTGTCGT ACCCATACGATGTTCCGGATTACGCTTAGAGGATGACGACGATAAGTAGGG -3’ pEP-KanS (46) E. coli GS1783 /pYEbac861 (18) 5’-CGGCCGCCATTTTTACGAGCAGCCGAAGAGCTCGAGGGCGGAAGGGATCCC TAAGCGTAATCCGGAACATCGTATGGGTACGACAGAGAGTGGCGCGCGGCAA CCAATTAACCAATTCTGATTAG-3’ ΔUL55, ΔUL55/ΔUs10 5’-ACGGCAGACGCGTATTCACCGACCCCCCCCTCGCAACCCCACCCCCTTCCCT CCGAGTCCAGGATGACGACGATAAGTAGGG-3’ pEP-KanS (46) E. coli GS1783 /pYEbac861 (18) 5’-TTATTAATGAGGTTGCATACGGACTCGGAGGGAAGGGGGTGGGGTTGCGA GGGGGGGGTCCAACCAATTAACCAATTCTGATTAG-3’ ΔUL55-repair, ΔUL55/ΔUs10-repair 5’-GTGCGCGTGGGAGGAGGGCGATGAC-3’ pYEbac861/ UL55+KanS (This study) E. coli GS1783 containing the ΔUL55 genome (This study), E. coli GS1783 containing the ΔUL55/ΔUs10 genome (This study) 5’-TCGCGGTGGTCGTCGTTATCATCTTG-3’ ΔUs10, ΔUL55/ΔUs10 5’-ATCCGGCGGCGGGGAAACGTGGAGATTCGGGTCTACTAAGAGTCTGTGCGG CCCTCTCGAGGATGACGACGATAAGTAGGG-3’ pEP-KanS (46) E. coli GS1783 /pYEbac861 (18), .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint 5’-GCTTCAGATGGCTTCGGGATCGAGAGGGCCGCACAGACTCTTAGTAGACCC GAATCTCCACCAACCAATTAACCAATTCTGATTAG-3’ E. coli GS1783 containing the ΔUL55 genome (This study) ΔUs10-repair, ΔUL55/ΔUs10-repair 5’-ATCCGGCGGCGGGGAAACGTGGAGATTCGGGTCTACTACGAGTCTGTGCGG CCCTCTCGAGGATGACGACGATAAGTAGGG-3’ pEP-KanS (46) E. coli GS1783 containing the ΔUs10 genome (This study), E. coli GS1783 containing the ΔUL55/ΔUs10 genome (This study) 5’-GCTTCAGATGGCTTCGGGATCGAGAGGGCCGCACAGACTCGTAGTAGACCC GAATCTCCACCAACCAATTAACCAATTCTGATTAG-3’ .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint empty UL7 UL11 UL14 UL16 UL23 UL36 UL37 UL41 UL47 UL48 UL49 UL50 UL51 UL54 UL55 Us2 Us3 Us10 Us11 ICP0 ICP4 ICP34.5 0.00 0.05 0.10 0.15 0.20 N. Koyanagi et al. Fig. 1 E (kDa) 123456 + + + + + － +－ － + － － + + + + + － +－ － + + +－ + +－ － － HA-UL55 SE-UL13-K176M EGFP- EF-1δ(F) HA(empty) SE-UL13 +DMSO +MG132 EGFP-EF-1δ(F)-S133P / EGFP-EF-1δ(F) UL7 UL11 UL16 Tk UL36 UL14 UL37 VHS empty UL47 VP16 vdUTPase UL51 UL55 Us2 Us3 Us10 ICP27 Us11 ICP0 VP22 ICP4 ICP34.5 0.20 0.15 0.10 0.05 0.00 (kDa) A empty HSV-2 SE-UL13 VZV SE-ORF47 HCMV SE-UL97 HHV-6B SE-U69 EBV SE-BGLF4 KSHV SE-ORF36 66 66 66 45 97 45 1 2 3 4 5 6 7 SE-CHPKs (IB:α-Strep) 31 66 EGFP-EF-1δ(F)-S133P (IB:α-EF-1δ-S133P) EGFP-EF-1δ(F) (IB:α-Flag) SE-UL13 (IB:α-Strep) β-actin (IB:α-β-actin) HA-UL55 (IB:α-HA) 66 66 45 UL13+empty UL13WT+UL55 UL13KM+UL55 0.0 0.2 0.4 0.6 0.8 0.2 0.4 0.6 0.8 0 SE-UL13 +HA(empty) n.s. EGFP-EF-1δ(F)-S133P / EGFP-EF-1δ(F) SE-UL13 +HA-UL55 SE-UL13-K176M +HA-UL55 +DMSO UL13+empty UL13WT+UL55 UL13KM+UL55 0.0 0.2 0.4 0.6 0.8 0.2 0.4 0.6 0.8 0 SE-UL13 +HA(empty) n.s.SE-UL13 +HA-UL55 SE-UL13-K176M +HA-UL55 +MG132 D (kDa) 123 + + + + + － +－ － + + +－ － － HA-Us10 SE-UL13-K176M EGFP- EF-1δ(F) HA(empty) SE-UL13 EGFP-EF-1δ(F)-S133P (IB:α-EF-1δ-S133P) EGFP-EF-1δ(F) (IB:α-Flag) SE-UL13 (IB:α-Strep) HA-Us10 (IB:α-HA) β-actin (IB:α-β-actin) 66 66 45 66 45 0.2 0.4 0.6 0.8 0 SE-UL13 +HA(empty) n.s. EGFP-EF-1δ(F)-S133P / EGFP-EF-1δ(F) SE-UL13 +HA-Us10 SE-UL13-K176M +HA-Us10 EGFP-EF-1δ(F)-S133P / EGFP-EF-1δ(F) B * *** *********** ****** EGFP-EF-1δ(F)-S133P (IB:α-EF-1δ-S133P) EGFP-EF-1δ(F) (IB:α-Flag) β-actin (IB:α-β-actin) FC G 123456 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint － + N. Koyanagi et al. Fig. 2 (kDa) 1234 Us10-EGFP SE-UL13-K176M MBP- EF-1δ(107-146) EGFP(empty) SE-UL13 MBP- EF-1δ(107-146)-S133A MBP-EF-1δ(107-146)-S133P (IB:α-EF-1δ-S133P) MBP-EF-1δ(107-146) (Ponceau-S) SE-UL13 (IB:α-Strep) (kDa) 1234 + + + － + － － + + +－ － － UL55-EGFP SE-UL13-K176M MBP- EF-1δ(107-146) EGFP(empty) SE-UL13 MBP- EF-1δ(107-146)-S133A + + + － － － + － － BA 45 45 45 66 45 UL55-EGFP (IB:α-GFP) MBP-EF-1δ(107-146) (Ponceau-S) 45 MBP-EF-1δ(107-146)-S133P (IB:α-EF-1δ-S133P) 66 SE-UL13 (IB:α-Strep) 66 Us10-EGFP (IB:α-GFP) － ++ + + － + － － + + +－ － － + + + － － － + － － .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint N. Koyanagi et al. Fig. 3 UL Usa b b'a'c' c a UL55 UL56ICP27 9 10UL55 186(aa) 11 YK878 (ΔUL55/ΔUs10) 12YK875 (ΔUL55-repair) HSV-2 186 (wild-type) 1(aa) Us10 Us9Us11 13 Us10 302(aa)1(aa) 14 15 Us11： …CTA CGA … YK876 (ΔUs10) Us10 Arg Tyr 14 Us11： … CTA AGA …Arg Stop 14Us10： … TAC TAC GAG … Us10： … TAC TAA GAG … YK877 (ΔUs10-repair) 14 Us10 Us11 Us11 YK874 (ΔUL55) YK879 (ΔUL55/ΔUs10-repair) Us10 Us11 14 Us10 Us11 UL13 UL12 UL14 UL13 UL15 518(aa) YK864 (UL13-K176M) 2 176 K M YK865 (UL13-K176M-repair) 176 M K 1(aa) YK873 (UL13-HA) HA 1 16 6 3 7 8 418(aa)158(aa) YK862 (ΔUL13) YK863 (ΔUL13-repair) 4 5 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint ΔUL55 ΔUL55-repair Mock HSV-2 186(wild-type) 1234 (kDa) N. Koyanagi et al. Fig. 4 116 21.5 45 ΔUL55 ΔUL55-repair Mock HSV-2 186(wild-type) 1234 (kDa) 66 45 45 116 ΔUL55/ΔUs10 ΔUL55 /ΔUs10-repair Mock HSV-2 186(wild-type) Us10 (IB:α-Us10) 1234 (kDa) 21.5 45 116 45 ΔUs10 ΔUs10-repair Mock HSV-2 186(wild-type) UL37 (IB:α-UL37) Us10 (IB:α-Us10) 1234 (kDa) 116 45 β-actin (IB:α-β-actin) 45 ΔUs10 ΔUs10-repair Mock HSV-2 186(wild-type) Us11 (IB:α-Us11) 1234 (kDa) 45 21.5 21.5 Us9 (IB:α-Us9) 116 (IB:α-UL37) UL37 β-actin (IB:α-β-actin) 123 HSV-2 186(wild-type) UL13-HA (kDa) UL13-HA Mock UL37 (IB:α-UL37) UL13 (IB:α-UL13) UL13-HA (IB:α-HA) 45 116 66 66 G ΔUL55/ΔUs10 ΔUL55 /ΔUs10-repair Mock HSV-2 186(wild-type) 1234 (kDa) 21.5 Us9 (IB:α-Us9) 66 45 21.5 Us11 (IB:α-Us11) UL56 (IB:α-UL56) ICP27 (IB:α-ICP27) 116 UL37 (IB:α-UL37) 45 β-actin (IB:α-β-actin) β-actin (IB:α-β-actin) β-actin (IB:α-β-actin) UL37 (IB:α-UL37) UL55 (IB:α-UL55) β-actin (IB:α-β-actin) ICP27 (IB:α-ICP27) UL56 (IB:α-UL56) UL37 (IB:α-UL37) β-actin (IB:α-β-actin) UL55 (IB:α-UL55) UL37 (IB:α-UL37) FE B DCA .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint 1 2 3 4 (kDa) HSV-2 186(wild-type) UL13-HA HSV-2 186(wild-type) UL13-HA N. Koyanagi et al. Fig. 5 WCL IP: α-HA UL13-HA (IB:α-HA) UL55 (IB:α-UL55) Us10 (IB:α-Us10) VP23 (IB:α-VP23) 66 21.5 45 45 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint B UL13-K176M UL13-K176M-repair Mock HSV-2 186(wild-type) 1234 (kDa) 21.5 45 Us10 (IB:α-Us10) 116 UL37 (IB:α-UL37) β-actin (IB:α-β-actin) 45 N. Koyanagi et al. Fig. 6 A ΔUL13 ΔUL13-repair Mock HSV-2 186(wild-type) 1234 (kDa) Us10 (IB:α-Us10) UL37 (IB:α-UL37) β-actin (IB:α-β-actin) 21.5 116 45 45 UL55 (IB:α-UL55) UL55 (IB:α-UL55) .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint UL13KM ΔUL55 ΔUL55/ΔUs10 0.0 0.2 0.4 0.6 UL13KM ΔUL55 ΔUL55/ΔUs10 0.0 0.2 0.4 0.6 mock 186 ΔUs10 ΔUs10R 0.0 0.1 0.2 0.3 0.4 mock 186 ΔUs10 ΔUs10R 0.0 0.1 0.2 0.3 0.4 mock 186 ΔUL55/ΔUs10 ΔUL55R/ΔUs10R 0.0 0.1 0.2 0.3 0.4 0.5 mock 186 ΔUL55 ΔUL55R 0.0 0.1 0.2 0.3 0.4 mock 186 ΔUL55/ΔUs10 ΔUL55R/ΔUs10R 0.0 0.2 0.4 0.6 mock 186 ΔUL55 ΔUL55R 0.0 0.1 0.2 0.3 0.4 0.5 B ΔUs10 ΔUs10-repair Mock HSV-2 186(wild-type) C (kDa) ΔUL55/ΔUs10 ΔUL55 /ΔUs10-repair Mock HSV-2 186(wild-type) (kDa) N. Koyanagi et al. Fig. 7 45 45 UL37 (IB:α-UL37) β-actin (IB:α-β-actin) EF-1δ (IB:α-EF-1δ) ] 116 45 1234 EF-1δ (IB:α-EF-1δ) ] UL37 (IB:α-UL37) β-actin (IB:α-β-actin) 1234 EF-1δ-S133P (IB:α-EF-1δ-S133P) EF-1δ-S133P (IB:α-EF-1δ-S133P) ΔUL55 ΔUL55-repair Mock HSV-2 186(wild-type) UL37 (IB:α-UL37) β-actin (IB:α-β-actin) 1234 (kDa) EF-1δ-S133P (IB:α-EF-1δ-S133P) EF-1δ (IB:α-EF-1δ) ] 45 45 116 45 45 45 116 45 DA UL13-K176M ΔUL55(kDa) ΔUL55/ΔUs10 EF-1δ (IB:α-EF-1δ) ] UL37 (IB:α-UL37) β-actin (IB:α-β-actin) 123 EF-1δ-S133P (IB:α-EF-1δ-S133P) 116 45 45 45 0.1 0.2 0.3 0.5 F G H 0 ΔUL55 ΔUL55-repair Mock HSV-2 186 (wild-type) EF-1δ-S133P / β-actin EF-1δ-S133P / β-actin EF-1δ-S133P / β-actin EF-1δ-S133P / β-actin ΔUs10 ΔUs10-repair Mock 0.1 0.2 0.3 0.4 0 ΔUL55/ΔUs10 ΔUL55/ΔUs10 -repair Mock HSV-2 186 (wild-type) HSV-2 186 (wild-type) ΔUL55 ΔUL55/ΔUs10 UL13-K176M n.s. ****** n.s. n.s. n.s.n.s. 0.4 0.6 0 0.2 ** ** n.s. 0.4 0.6 0 0.2 0.1 0.2 0.3 0.4 I L 0 ΔUL55 ΔUL55-repair Mock HSV-2 186 (wild-type) hyperphosphorylated form of EF-1δ / total EF-1δ hyperphosphorylated form of EF-1δ / total EF-1δ hyperphosphorylated form of EF-1δ / total EF-1δ hyperphosphorylated form of EF-1δ / total EF-1δ ΔUs10 ΔUs10-repair Mock 0.1 0.2 0.3 0.4 0 ΔUL55/ΔUs10 ΔUL55/ΔUs10 -repair Mock HSV-2 186 (wild-type) HSV-2 186 (wild-type) ΔUL55 ΔUL55/ΔUs10 UL13-K176M n.s. *** **** *** n.s. n.s. n.s.n.s. 0.1 0.4 0.5 0 0.3 0.2 ** ** n.s. 0.4 0.6 0 0.2 0.4 E J K *** *** .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint mock 186 ΔUL55/ΔUs10 ΔUL55R/ΔUs10R 0.0 0.1 0.2 0.3 0.4 0.5 mock 186 ΔUs10 ΔUs10R 0.0 0.1 0.2 0.3 0.4 mock 186 ΔUL55 ΔUL55R 0.0 0.1 0.2 0.3 0.4 UL13KM ΔUL55 ΔUL55/ΔUs10 0.0 0.2 0.4 0.6 mock 186 ΔUL55/ΔUs10 ΔUL55R/ΔUs10R 0.0 0.1 0.2 0.3 0.4 0.5 mock 186 ΔUs10 ΔUs10R 0.0 0.1 0.2 0.3 0.4 mock 186 ΔUL55 ΔUL55R 0.0 0.1 0.2 0.3 0.4 B ΔUs10 ΔUs10-repair Mock HSV-2 186(wild-type) C (kDa) ΔUL55/ΔUs10 ΔUL55 /ΔUs10-repair Mock HSV-2 186(wild-type) (kDa) 0.1 0.2 0.3 0.4 N. Koyanagi et al. Fig. 8 1234 1234 ΔUL55 ΔUL55-repair Mock HSV-2 186(wild-type) UL37 (IB:α-UL37) β-actin (IB:α-β-actin) 1234 (kDa) EF-1δ-S133P (IB:α-EF-1δ-S133P) EF-1δ (IB:α-EF-1δ) ] DA UL13-K176M ΔUL55(kDa) ΔUL55/ΔUs10 123 E F G H 0 ΔUL55 ΔUL55-repair Mock HSV-2 186 (wild-type) EF-1δ-S133P / β-actin EF-1δ-S133P / β-actin EF-1δ-S133P / β-actin EF-1δ-S133P / β-actin ΔUs10 ΔUs10-repair Mock 0.1 0.2 0.3 0.4 0 ΔUL55/ΔUs10 ΔUL55/ΔUs10 -repair Mock HSV-2 186 (wild-type) HSV-2 186 (wild-type) ΔUL55 ΔUL55/ΔUs10 UL13-K176M n.s. *** **** ** n.s. n.s. n.s.n.s. 0.1 0.4 0.5 0 0.3 0.2 *** *** n.s. 45 45 116 45 0.4 0.6 0 0.2 45 116 45 45 116 45 45 45 45 45 116 45 0.1 0.2 0.3 0.4 L 0 ΔUL55 ΔUL55-repair Mock HSV-2 186 (wild-type) hyperphosphorylated form of EF-1δ / total EF-1δ hyperphosphorylated form of EF-1δ / total EF-1δ hyperphosphorylated form of EF-1δ / total EF-1δ hyperphosphorylated form of EF-1δ / total EF-1δ ΔUs10 ΔUs10-repair Mock 0.1 0.2 0.3 0.4 0 ΔUL55/ΔUs10 ΔUL55/ΔUs10 -repair Mock HSV-2 186 (wild-type) HSV-2 186 (wild-type) ΔUL55 ΔUL55/ΔUs10 UL13-K176M *** ***** *** n.s. n.s. n.s.n.s. 0.1 0.4 0.5 0 0.3 0.2 *** *** n.s. 0.1 0.4 0.5 0 0.3 0.2 UL37 (IB:α-UL37) β-actin (IB:α-β-actin) EF-1δ-S133P (IB:α-EF-1δ-S133P) EF-1δ (IB:α-EF-1δ) ] UL37 (IB:α-UL37) β-actin (IB:α-β-actin) EF-1δ-S133P (IB:α-EF-1δ-S133P) EF-1δ (IB:α-EF-1δ) ] UL37 (IB:α-UL37) β-actin (IB:α-β-actin) EF-1δ-S133P (IB:α-EF-1δ-S133P) EF-1δ (IB:α-EF-1δ) ] I J K * .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint ΔUs10 ΔUs10-repair UL13-K176M-repair ΔUL55 ΔUL55-repair Mock HSV-2 186(wild-type) UL13-K176M (kDa) 1 2 3 4 5 6 7 8 9 ΔUL55/ΔUs10 ΔUL55/ΔUs10-repair A 10 N. Koyanagi et al. Fig. 9 ] Vero cells ΔUs10 ΔUs10-repair UL13-K176M-repair ΔUL55 ΔUL55-repair Mock HSV-2 186(wild-type) UL13-K176M (kDa) 1 2 3 4 5 6 7 8 9 ΔUL55/ΔUs10 ΔUL55/ΔUs10-repair 10 ] U2OS cells 66 116 45 66 116 45 0.00 hyperphosphorylated form of UL13 / total UL13 0.20 ΔUL55 ΔUL55-repair HSV-2 186(wild-type) ΔUs10 ΔUs10-repair ΔUL55/ΔUs10 ΔUL55/ΔUs10-repair UL13-K176M UL13-K176M-repair D 0.15 0.10 0.05 0.00 hyperphosphorylated form of UL13 / total UL13 0.20 ΔUL55 ΔUL55-repair HSV-2 186(wild-type) ΔUs10 ΔUs10-repair ΔUL55/ΔUs10 ΔUL55/ΔUs10-repair UL13-K176M UL13-K176M-repair n.s. n.s.*** *** B 0.15 0.10 0.05 *** *** *** *** n.s. n.s. n.s. n.s. n.s.*** *** *** *** *** *** n.s. n.s. n.s. UL37 (IB:α-UL37) β-actin (IB:α-β-actin) UL13 (IB:α-UL13) UL37 (IB:α-UL37) β-actin (IB:α-β-actin) UL13 (IB:α-UL13) C .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint 186 UL13KM UL13KM-rep ΔUL55 ΔUL55-rep ΔUs10 ΔUs10-rep ΔUL55/ΔUs10 ΔUL55-rep/ΔUs10-rep 1000 10000 100000 1000000 186 UL13KM UL13KM-rep ΔUL55 ΔUL55-rep ΔUs10 ΔUs10-rep ΔUL55/ΔUs10 ΔUL55-rep/ΔUs10-rep 1000 10000 100000 1000000 N. Koyanagi et al. Fig. 10 U2OS cells, MOI=0.01, 24h 103 PFU/ml 105 106 104 ΔUL55 ΔUL55-repair HSV-2 186(wild-type) ΔUs10 ΔUs10-repair ΔUL55/ΔUs10 ΔUL55/ΔUs10-repair UL13-K176M UL13-K176M-repair n.s. n.s.** *** * * * U2OS cells, MOI=3, 12h n.s. 103 PFU/ml 105 106 104 ΔUL55 ΔUL55-repair HSV-2 186(wild-type) ΔUs10 ΔUs10-repair ΔUL55/ΔUs10 ΔUL55/ΔUs10-repair UL13-K176M UL13-K176M-repair B n.s. n.s. n.s. n.s. n.s. n.s. n.s. A 186 UL13KM UL13KMR ΔUL55 ΔUL55R ΔUs10 ΔUs10R ΔUL55/ΔUs10 ΔUL55R/ΔUs10R 0 500 1000 1500 Plaque size (μm) 0 Plaque size (μm) 1000 1500 500 ΔUL55 ΔUL55-repair HSV-2 186(wild-type) ΔUs10 ΔUs10-repair ΔUL55/ΔUs10 ΔUL55/ΔUs10-repair UL13-K176M UL13-K176M-repair *** *** *** *** *** n.s. *** E U2OS cells n.s. * 186 UL13KM UL13KMR ΔUL55 ΔUL55R ΔUs10 ΔUs10R ΔUL55/ΔUs10 ΔUL55R/ΔUs10R 0 200 400 600 Plaque size (μm) n.s. 0 Plaque size (μm) 400 600 200 ΔUL55 ΔUL55-repair HSV-2 186(wild-type) ΔUs10 ΔUs10-repair ΔUL55/ΔUs10 ΔUL55/ΔUs10-repair UL13-K176M UL13-K176M-repair n.s. n.s. n.s. n.s. n.s. n.s. n.s. 186 UL13KM UL13KM-rep ΔUL55 ΔUL55-rep ΔUs10 ΔUs10-rep ΔUL55/ΔUs10 ΔUL55-rep/ΔUs10-rep 1000 10000 100000 1000000 Vero cells, MOI=3, 12h n.s. 103 PFU/ml 105 106 104 ΔUL55 ΔUL55-repair HSV-2 186(wild-type) ΔUs10 ΔUs10-repair ΔUL55/ΔUs10 ΔUL55/ΔUs10-repair UL13-K176M UL13-K176M-repair D n.s. n.s. n.s. n.s. n.s. n.s. n.s. 186 UL13KM UL13KM-rep ΔUL55 ΔUL55-rep ΔUs10 ΔUs10-rep ΔUL55/ΔUs10 ΔUL55-rep/ΔUs10-rep 1000 10000 100000 1000000 n.s. 103 PFU/ml 105 106 104 ΔUL55 ΔUL55-repair HSV-2 186(wild-type) ΔUs10 ΔUs10-repair ΔUL55/ΔUs10 ΔUL55/ΔUs10-repair UL13-K176M UL13-K176M-repair C n.s. n.s. n.s. n.s. n.s. n.s. n.s. Vero cells, MOI=0.01, 24h Vero cells n.s. n.s. n.s. F n.s. n.s. n.s. .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint Us10 homolog UL55 homolog - - Varicellovirus - -- - - - - -- -- -- - - - + + + + + + + + + + + + + + + + - + + + Mardivirus + + + + + + + + + + + + + + + + + + + + + + + + + - + - + - + + + + + - + - - + + + + Simplexvirus - + + Scutavirus Iltovirus Alphaherpesvirinae Genus C MD G A Y G H V H N G S P MAV D G E E S G A G T G T G A G A DG L Y P T S T D T A A H A V S L P R S V G D F A A V V R A V S A E AA D A L R S G A G MD G A Y G H G H N G S P MAV D G E E S G A GMG T - - G T NV L Y P T S T D T A A H A V S L P R S V G D F A A A V R A V S A E AA D A L R S G T G MD G A Y V H G H N G S P MAV D G E E S G A G T G A - - G A DG L Y P T S T D T A A H A V S L P R S V G D F A A A V R S V S A E AA D A L R S G A G equid alphaherpesvirus 1 equid alphaherpesvirus 8 equid alphaherpesvirus 9 1 1 1 75 73 73 P P A E AWP R V Y RM F C DM F G R Y A A S P MP V F H S A D P L R R A V G R Y L V D L G AA P V E T H A E L S G RML F C A YWC C L G H A F A C P P A E AWP R V Y RM F C DM F G R Y A A S P MP V F H S A D P L R R A V G R Y L V D L G AA P V E T H A E L S G RML F C A YWC C L G H A F A C P P A E AWP R V Y RM F C DM F G R Y A A S P MP V F H S A D P L R R A V G R Y L V D L G AA P V E T H A E L S G RML F C A YWC C L G H A F A C equid alphaherpesvirus 1 equid alphaherpesvirus 8 equid alphaherpesvirus 9 76 74 74 150 148 148 S R P QMY E R A C A R F F E T R L G I G E T P P AD A E R YWVA L L NMAG A E P E L F P R HA AAA AY L R A R G R K L P L Q L P S AH R T AK S R QQMY E R A C A R F F E T R L G I G E T P P AD A E R YWVA L L DMAG A E P E L F P R HA AAA AY L R A R G R K L P L Q L P A A C R T AK S R P QMY E R A C A R F F E T R L G I G E T P P AD A E R YWAA L L DMAG A E P E L F P R HA AAA AY L R T R G R K P P L Q L P A A R R T AK equid alphaherpesvirus 1 equid alphaherpesvirus 8 equid alphaherpesvirus 9 151 149 149 225 223 223 T V A V T G Q S I N F G E T P P A D A E R YWV A L L DMA G A E P E L F P R H A A A A A Y LR A R G R K L P L Q L P A A C R T A K T V A V AG Q S I T V A V AG Q S I N F G E T P P A D A E R YWV A L L DMA G A E P E L F P R H A A A A A Y LR T R G R K P P L Q L P A A R R T A K T V A V T G Q S I T V A V T G Q S I N F G E T P P A D A E R YWA A L L NMA G A E P E L F P R H A A A A A Y LR A R G R K L P L Q L P S A H R T A K T V A V T G Q S I equid alphaherpesvirus 1 equid alphaherpesvirus 8 equid alphaherpesvirus 9 226 224 224 A B - - MD L S R G E P V N P G S C Y H T DMD L Y R A E P V N P G S C Y P T RHD T S A H Q A LML P F E R E F A I E L C Q I S A D A F S A Y T C E P L MN L C G S R G E - - H P G G E Y - - - - - - - - - - - - - - A G L Y C T RHD T P A H Q A LMN D A E R Y F AA A L C A I S T E A Y E A F I H S P S cercopithecine alphaherpesvirus 9 human alphaherpesvirus 3 1 1 73 59 E R P C P A LWS R A K T A F G R L C A A F A A T R G I N Q I S F P AV R R A T L A V L R E K C A S D P P T H A E L S D R L V LMS YWC C L G H A G E R P C A S LWG R A K D A F G RMC G E L A A D R Q - R P P S V P P I R R A V L S L L R E Q CMP D P Q S H L E L S E R L I LMA YWC C L G H A G cercopithecine alphaherpesvirus 9 human alphaherpesvirus 3 74 60 147 133 T R L Y D Q P P D K L C I R A F VY N R R G G I C H R L F D A Y L G C G V Y P E S G R D R N I K HD EWP R L E C L P T I G L S P D N K C I R A E L Y D R P G G I C H R L F D A Y L G C G S L - - - G V P R T Y E R S - - - - - - - cercopithecine alphaherpesvirus 9 human alphaherpesvirus 3 148 134 204 180 236 234 234 N. Koyanagi et al. Fig. 11 Tree scale: 0.1 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint N. Koyanagi et al. Fig. 12 ORF47+empty ORF47+ORF3 ORF47KM+ORF3 0.0 0.2 0.4 0.6 0.8 0.2 0.4 0.6 0.8 0 SE-ORF47 +HA(empty) ** * n.s. EGFP-EF-1δ(F)-S133P / EGFP-EF-1δ(F) SE-ORF47 +HA-ORF3 SE-ORF47-K157M +HA-ORF3 (kDa) 123 + + + + + － +－ － + + +－ － － 66 66 66 21.5 45 HA-ORF64 SE-ORF47-K157M EGFP- EF-1δ(F) HA(empty) SE-ORF47 EGFP-EF-1δ(F)-S133P (IB:α-EF-1δ-S133P) EGFP-EF-1δ(F) (IB:α-Flag) SE-ORF47 (IB:α-Strep) HA-ORF64 (IB:α-HA) β-actin (IB:α-β-actin) ORF47+empty ORF47+ORF64 ORF47KM+ORF64 0.0 0.2 0.4 0.6 0.8 0.2 0.4 0.6 0.8 0 n.s. EGFP-EF-1δ(F)-S133P / EGFP-EF-1δ(F) n.s.n.s.SE-ORF47 +HA(empty) SE-ORF47 +HA-ORF64 SE-ORF47-K157M +HA-ORF64 EGFP-EF-1δ(F)-S133P (IB:α-EF-1δ-S133P) EGFP-EF-1δ(F) (IB:α-Flag) SE-ORF47 (IB:α-Strep) β-actin (IB:α-β-actin) (kDa) 123 HA-ORF3 (IB:α-HA) + + + + + － +－ － + + +－ － － HA-ORF3 SE-ORF47-K157M EGFP- EF-1δ(F) HA(empty) SE-ORF47 66 21.5 45 66 66 A B C D .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 7, 2025. ; https://doi.org/10.1101/2025.07.06.663391doi: bioRxiv preprint