Enhanced Nutrient Uptake in Side-Row Maize and Improved Microbial Community Diversity in Wide-Strip Intercropping of Maize and Peanut | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Enhanced Nutrient Uptake in Side-Row Maize and Improved Microbial Community Diversity in Wide-Strip Intercropping of Maize and Peanut Xinhua Zhao, Qiqi Dong, Yi Han, Kezhao Zhang, Xiaolong Shi, Xu Yang, and 9 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-643717/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 10 You are reading this latest preprint version Abstract Background: Intercropping, a diversified planting pattern is currently the subject of major global research, but uncertainty remains about the rhizosphere interaction of intercropped maize and peanut, which increases nitrogen uptake. We explored the changes in soil physicochemical properties, nutrient uptake and use, and microbial community structure in wide-strip intercropped maize and peanut. Results: The results from three treatments, sole maize (SM), sole peanut (SP) and intercropping of maize and peanut (IMP), showed that intercropping maize (IM) had a marginal advantage and that the nutrient content of roots, stems and grains in side-row maize was better than that of middle intercropping maize (MIM) and SM. And the yield of intercropped maize was higher than sole cropping. Compared with SM and SP, the soil nitrogen content (TN) in IM and intercropping peanut (IP) was lower and increased the soil enzyme activities of nitrate reeducates (NR) and peroxidase (POD), showing a significant negative correlation with soil TN. And decreased the soil enzymes activities of Pro and DHO, showing a positively correlation with soil TN. The diversity and richness of bacteria and fungi was decreased in IM rhizosphere soil, however, that richness of fungi was increased in IP rhizosphere soil. The RB41 , Candidatus-udaeobacter, Stropharia , Fusarium and Penicillium were correlated with soil enzyme activity. In addition, intercropping enriched the functional diversity of bacterial community and reduced the pathogenic fungi. Conclusion: IMP changed the rhizosphere soil bacterial and fungal community structure and composition, enriched nitrogen-fixing bacteria in the IP rhizosphere soil, promoted the nitrogen content of IM and provided a scientific basis for promoting IMP in northeastern China. General Microbiology Applied & Industrial Microbiology maize peanut wide-strip intercropping nitrogen content 16S/ ITS soil enzyme Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Background Maize and peanut are major grain and oil crops and are important in ensuring food security in China. Sole cropping has been widely used in recent decades to facilitate planting, field management and mechanization. Sole cropping and improving yield by increasing fertilizer application are, however, not only detrimental to grain production in China [ 1 ] but also disturb the ecological stability of the soil microbial community and limit environmental sustainability [ 2 ]. Previous studies have found that wide-strip intercropping has the advantages of using marginal effects to increase yield, to optimize population structure, and to promote light energy utilization [ 3 , 4 ]. This method is also suitable for mechanized seeding, fertilization and field management [ 5 ]. Maize and peanut strip intercropping can not only improve crop yield and water and fertilizer utilization efficiency, but also can reduce competition for major soil nutrients, increase beneficial soil microorganism numbers and diversity and reduce pathogenic and poisonous microorganisms, effectively improving the ecological environment of farmland [ 6 , 7 ]. While helping to reduce carbon emissions and to increase the economic value of the ecosystem [ 8 ]. Previous studies have showed that plant nutrient uptake is affected by soil nutrient distribution, and the presence of neighboring plants greatly affects crop nutrient uptake in an intercropping system [ 9 ]. In the Loess Plateau of China, the intercropping of proso millet and mung bean have been reported to increased the nitrogen absorption efficiency by 96% and 71.6%, respectively, due to complementarity of crops[ 10 ]. The maize grain nitrogen uptake was increased by 25.5% in the maize and soybean strip intercropping in southwest of China[ 11 ]. Intercropping with legumes, through the legumes' symbiotic relationship with nitrogen-fixing bacteria to obtain nitrogen from the air, allows neighboring plants to obtain more nitrogen from the soil [ 12 ]. Intercropping can improve the efficient utilization of soil nutrient resources through the complementary niche of crop root growth time and space. Soil microbial activities are critical to nutrient mobilization and mineralization, directly affects the nutrient utilization efficiency of plants [ 13 ],and an important source of soil enzymes [ 14 ]. Previous studies have reported that intercropping changes the composition and function of microbial communities. The abundance of the nitrogen-fixing microbes Rhizobium hainanense , R. leguminosarum and Frankia spp. were promoted in the rhizosphere of peanut when intercropped with maize [ 15 ]. Intercropping of cassava and peanut induced ethylene release resulted in the increase of Actinomycetes abundance in the rhizosphere of peanut and promoted the absorption of soil available nutrients, thus increasing the yield of peanut [ 16 ]. Some studies have also shown that root exudates affect the structure and function of rhizosphere microbial community, promote soil organic matter mineralization, and thus affect the rhizosphere nitrogen cycle [ 17 ]. In the study of intercropping of maize and faba bean, maize root exudates increased nodule formation and biological nitrogen fixation in faba bean root, except that flavonoids in leguminous root exudates stimulated NOD gene expression in rhizobia [ 18 ]. The nitrate absorption pathway of mycorrhizal symbiosis has also been shown to promote the nitrogen absorption efficiency of gramineous crops [ 19 ]. The presence of maize increased the secretion of carboxylate in alfalfa root system, improved the availability of soil phosphorus, and then promoted the growth of maize in the aboveground and absorption of phosphorus [ 20 ]. Therefore, the relationship between microorganisms, plants and soil under intercropping of maize and peanut can not only reveal the adaptation of plants to the microecological environment but also improve resource utilization efficiency, reduce fertilizer application, protect the ecological environment and help to develop sustainable agriculture. Northeastern China has a temperate monsoon climate, drought and less rain during the growing season, and there has been limited systematic research into the characteristics and mechanism of nitrogen uptake by crop and correlation between soil physicochemical properties and soil microorganisms at genus level. Through a field experiment in the study, the purpose of 1) the changes in structure and diversity of bacterial and fungal community at the genera level in intercropping, compared with sole cropping, which genera are beneficial, 2) Whether there is a correlation and the mechanism of soil enzyme activities and bacterial and fungal communities at the genus level, 3) We also clarified microecological changes in farmland ecosystems under maize and peanut strip intercropping in Northeast China maintain the balance of the soil ecosystem and increase productivity through sustainable agriculture. Results Effect of intercropping on the nitrogen content and yield of maize and peanut Changes in the nitrogen content of maize and peanuts were similar between 2018 and 2019. The IM had higher nitrogen contents than those of SM, and the IP was lower than SP. The nitrogen content in the roots of IM was clearly higher than that of SM, The stems and leaves of IP significantly lower than those of SP (Fig. 1 ), indicating that intercropping increased the nitrogen content in maize. Compared with MIM, the IM was significantly higher than MIM. The IP was lower than MIP, indicating that intercropped maize has the marginal advantage. In addition, ear length and number of grains per spike significantly affected maize yield. Compared with SM, the yield of intercropped maize was significantly increased, by 30.34% (2018) and 24.8% (2019) (Table S1). The yield of peanut was significantly affected by 100 kernel weight. Intercropped peanut yield decreased by 33.49% (2018) and 2.4% (2019), compared with SP. Changes in soil TN content and soil enzyme activity at IMP The soil TN content of SM and SP were significantly higher than that of IM and IP, showed that intercropping increased soil nutrient consumption. And the soil TN content of IM and IP were lower than SIM and SIP, respectively (Table 1 ). It was speculated that the interspecific root interaction between IM and IP could promote soil nutrients uptake and utilization. The soil TN of II between IM and IP were no significantly difference. (Table S2). Table 1 Soil total nitrogen (TN) content of different soil samples (mg/Kg) Stage Trumpeting Stage Heading Stage/ Anthesis and Silking stage/ Grain Filling Stage/ Mature stage Sample Seedling Sage Flowering stage Podding Stage SM 235.43 ± 1.59a 224.44 ± 2.66a 186.01 ± 2.56a 157 ± 0.85a 125 ± 1.18a MIM 4.34 ± 0.89c 6.34 ± 0.33b 5.19 ± 0.09b 6.59 ± 0.5b 2.91 ± 0.49b IM 7.39 ± 0.15b 6.63 ± 0.37b 5.62 ± 0.19b 4.93 ± 0.54c 2.31 ± 0.7b SP 258.16 ± 1.42a 217.66 ± 1.62a 179.37 ± 1.37a 133.91 ± 1.36a 85.93 ± 0.61a MIP 5.87 ± 0.68b 7.73 ± 0.16b 6.5 ± 0.17b 11.47 ± 0.53b 2.31 ± 0.65b IP 6.98 ± 0.5b 6.4 ± 0.31b 7.13 ± 0.22b 9.67 ± 0.29b 3.38 ± 0.05b Compared with SM, the activities of nitrate reductase (NR) and peroxidase (POD) (Duncan test, P < 0.05) in IM soil increased, and the activity of protease (Pro) (Duncan test, P < 0.05) and dehydrogenase (DHO) decreased (Fig. 2 ). The POD in IP soil was increased and the activity of NR, Pro (Duncan test, P < 0.05) and DHO (Duncan test, P < 0.05) were decreased than SP (Fig. 2 ). Compared with monoculture, IMP significantly altered the activities of Pro, POD and DHO. Compared with the middle row of intercropping, the change of soil enzyme activities in the side row was similar to the above (Fig. 2 ). Furthermore, four soil enzyme activities were no significant difference in IM, IP and II (Table S3), which indicated soil enzyme activities tended to be stable under intercropping. Correlation analysis showed that POD activity was significantly negatively correlated with TN, while other enzyme activities were significantly positively correlated with TN (Figure S1). The results showed that IMP changes the soil physicochemical properties compared with sole cropping, and it affected the change of soil nutrient content. OTUs and diversity of the rhizosphere soil microbial community Through OTUs analysis, combined with the species represented by OTUs, common microorganisms in different environments can be found. Compared with SM, the OTUs of bacteria and fungi in IM were decreased markedly by 9.7% and 10.4%, respectively. However, compared with SP, the variation of OTUs in IP was different. The number of OTUs was lower (by 3.9%) in the bacterial community, while the number of fungal OTUs was higher (by 7.9%) (Figure S2). IMP changed the number of OTUs bacteria and fungi in rhizosphere soil, and the change was different among crop types. Bacterial OTUs analysis indicated that 4 OTUs were common to all samples. The number of OTUs shared by IM and SM was 1, IP and SP was 4, IP and II was 1 (Fig. 3 -A). In the fungal community, of the number of OTUs shared by IM and SIM was 1, IM and II was 1,IP and SP was 7, IP and SIP was 2, IP and II was 3, respectively (Fig. 3 -B). The diversity and richness of bacteria and fungi in IM were lower than that of SM and SIM, and richness of fungi in IP were higher than that of SP and SIP. The bacterial diversity and richness of Ⅱ were higher than IP and IM, respectively. While the fungal diversity and richness of Ⅱ were lower than IM and IP (Fig. 4 ). Composition and function of the microbial community in rhizosphere soil Although reduced the diversity and richness of microorganisms in intercropping. However, compared with sole cropping and middle row of intercropping, the abundance of some species increased. Such as RB41 , Haliangium , Ramlibacter and Candidatus-udaeobacter were higher in IM and IP (Fig. 5 -A). The abundance of Ellin6067 , MND1 , RB41 and in II were higher than in those in IP and IM, whereas Ramlibacter and Candidatus-udaeobacter were lower (Fig. 5 -A). Specificaly, the abundance of Sphingomonas was increased in IP (Fig. 5 -A). To identify the representative microbial of the samples, soil microbial from the different treatment groups were compared using LEfSe analysis. In the genus level, Ramlibacter and MND1 were significantly enriched in IP and II, respectively (Fig. 6 -A). Analysis for KEGG pathway using LEfSe, the functions of the first level of the genus bacteria were mainly metabolism (Figure S3). The functions of the second level included amino acids metabolism, carbohydrates metabolism and other amino acids metabolism accounted for high relatively abundance (Fig. 7 -A). Compared with SM and SIM, the abundance of Fusarium , Neocosmospora , Chaetomium , Cladosporium , Staphylotrichum and Penicillium were higher in IM (Fig. 5 -B). The abundance of Mortierella , Fusarium , Chaetomium , Cladosporium and Penicillium in IP were higher than those in SP (Fig. 5 -B). In case of II, the abundance of Mortierella , Staphylotrichum , Saccharomyces and Tausonia were higher than those in IM and IP, whereas the abundance of Fusarium , Chaetomium , Cladosporium were lower (Fig. 5 -B). The abundance of Chaetomium and Stropharia were significantly enriched IM, and the abundance of Penicillium and Fusarium were significantly enriched IP (Fig. 6 -B). According to the function analysis of the fungal community, it was found that most fungal species in the rhizosphere soil were saprophyrotrophic fungi, while pathotroph fungi had the least species (Fig. 7 -B). Therefore, IMP reduced the varities of pathogenic bacteria in the rhizosphere soil. Correlation between bacterial and fungal communities and soil physicochemical properties RB41, Candidatus-udaeobacter were significantly positively correlated with POD activity, extremely significantly negatively correlated with TN, Pro and DHO, and significantly negatively correlated with Pro. Vicinamibacter, Gemmatimonas and Ellin6067 were significantly positively correlated with TN, Pro and DHO (Fig. 8 -A). In the fungal community, Mortierella was significantly positively correlated with TN. Chaetomium, Fusarium and Penicillium were extremely significantly and significantly positively correlated with POD activity, and extremely significantly or negatively correlated with DHO, Pro and TN. Stropharia , Staphylotrichum and Cladosporium were extremely significantly and significantly negatively correlated with TN and DHO, respectively (Fig. 8 -B). Discussion Nitrogen is an essential element for plant growth and development and is the element most closely related to yield. In a gramineous and leguminous intercropping system, nitrogen content was clearly promoted nitrogen content and yield in the gramineous crop, and improved land productivity [ 21 ]. In the current study, maize had marginal advantage under IMP. The nitrogen content in the IM roots, stems and leaves was significantly higher than SM and MIM, respectively (Fig. 1 ), which was consistent with the findings of another [ 4 ]. Due to the adjustment of root length density and root distribution, the nitrogen uptake per unit root length was increased, compared with that of monoculture [ 22 ]. Combined with other research reports, maize competes strongly for nitrogen and absorbs more nitrogen than peanut, so significantly increasing the nitrogen content in IM and promoting the yield of maize [ 23 ]. In the middle and late growth period, the shading of IM was intensified, and photosynthesis was weakened on the IP, which further affected the absorption of nutrients by the peanut (Fig. 1 ). In the intercropping of maize and soybean, light transmittance was increased after defoliation of the top two leaves of the maize, and the nitrogen absorption of soybean was increased by 5% (grain), 10%(stem) and 14% (root), respectively [ 24 ]. The shading of maize inhibited the growth of peanut and the yield of intercropped peanut decreased (Table S1). Ear length, number of grains per spike and fruit weight per hundred were the main yield components (Table S1), which were the same as the findings of previous studies [ 4 ]. In this study, it was found that interspecific root interactions of IMP promoted soil nutrient uptake and utilization, compared with monoculture (Table 1 ). The results were consistent with the decrease of soil TN in intercropping Chinease milk vetch and rape[ 25 ]. It is reported, the root density distribution was different under different soil depths, which affected the absorption and utilization of soil nutrients [ 26 ], and IMP maintained the basic stability of soil chemical properties and the diversity effect of soil nitrogen accumulation (Table S2-3) [ 14 , 27 ]. It is needed to explore the interactions of rhizosphere microbial community in intercropping, and the inner mechanism of IMP was elucidated through analyzing the physicochemical properties of and rhizosphere soil microbial community [ 26 ]. Soil microorganisms are one of the main sources of soil enzymes, and there is a correlation between soil enzyme activity and microorganisms [ 11 , 28 ], it’s consistent with this study show that RB41 , Candidatus-udaeobacter and Chaetomium were significantly positively correlated with soil POD, and negatively correlated with Pro and DHO (Fig. 8 ). Besides, Fusarium, Stropharia and Penicillium also were negatively correlated with Pro and DHO (Fig. 8 -B). Candidatus-udaeobacter within the Verrucomicrobia phylum is pervasive in soils around the world, sacrificing metabolic versatility for efficiency to become dominant in the soil environment. The Chaetomium , which is a beneficial fungi with biocontrol effect and antagonistic to soil pathogenic bacteria [ 29 ].In our study, the soil POD was negatively correlated with soil TN content across all soil (Figure S1), due to it is involved in the degradation of hydrocarbons and their intermediates [ 30 ]. Soil Pro and DHO activities were positively correlated with TN (Figure S1), which was consistent with previous studies [ 31 ]. Soil Pro are involved in the conversion of amino acids and other nitrogen-containing organic compounds present in soil, and their hydrolysates are one of the nitrogen sources for higher plants [ 32 ]. Soil DHO participates in soil carbon cycle and promotes dehydrogenation of carbohydrates and organic acids [ 31 ]. Soil microorganisms play a key role in soil nutrient cycling and crop nutrient uptake [ 13 ]. Through the analysis of the dominant bacteria in the soil components, it was found that the intercropping varieties had increased the relative abundance on the dominant bacteria species (Fig. 5 -A). The Ramlibacter and MND1 were significantly enriched in IP and II, respectively (Fig. 6 -A). The functions of MND1 need to be investigated more deeply. The Ramlibacter within the Proteobacteria, comprising an enormous range of metabolic diversity [ 26 ]. In addition, Sphingomonas also increased in IP than SP (Fig. 5 -B), which is the characteristics of promoting nitrogen fixation and dehydrogenation [ 33 ] and the uptake of nutrients in the rhizosphere, improving the soil environment in the rhizosphere of IP, and maintaining the soil nitrogen balance. This result could be related to the reduced abundance of denitrifying bacteria Haliangium , which reduces nitrates in the soil to nitrogen and releases them into the air [ 34 ]. So that, intercropping improved the bacterial community structure and increased the abundance of beneficial bacteria. IMP changed the abundance of bacteria in soil, affected soil enzyme activities and soil nutrients, and ultimately affected crop nutrient uptake (Fig. 9 ). Other bacterial genera had no significant correlation with soil enzyme activities (Fig. 8 ). The reason is that there are many kinds of bacteria in the soil, and the correlation between soil enzyme activity and bacteria is not specific and unique. A single bacterium can affect a variety of enzyme activities, so it is necessary to further explore or study the functional properties of each bacterium and the mechanism of soil enzyme activities themselves [ 35 ]. It was found that the transport and metabolism of amino acids, carbohydrate transport and metabolism, and metabolism of other amino acids in the secondary functional areas were relatively high in abundance, which was consistent with previous findings [ 32 , 36 ]. Furthermore, it was speculated that the relative abundance of RB41 and Candidatus-udaeobacter increased. Soil microorganisms to transport amino acid metabolism, carbohydrate metabolism to produce a series of material, when they were plants as signal perception, can cause related enzyme activity in plant or related gene expression changes, ensure the survival of the bacteria, and then adjust the plant physiological metabolism and nutrient accumulation levels, which promote plant growth and development [ 37 , 38 ]. We found that, compared with SP, the change in OTUs and richness of IP was higher than those of SP (Figure S2 and 4). These results were consistent with the promotion of fungal community growth in the IMP, intercropping promotes fungal community growth [ 39 ]. On the one hand, many biotic and abiotic factors can alter the fungal community, such as soil chemical properties, plant functional diversities and management practices. On the other hand, the variety and quantity of root exudates affect the abundance of the rhizosphere fungal community owing to the presence of different crop species [ 40 , 41 ]. Soil fungi decompose organic matter in crop residues and fertilizers, which is beneficial to soil nutrient supply and crop growth, but also affects soil enzyme activity [ 35 ]. Mortierella decomposes organic matter and promotes mineral uptake by plant roots. It also has the potential to secrete antimicrobials that inhibit pathogenic bacteria such as Fusarium [ 42 – 44 ]. However, many fungi are plant pathogens and cause fungal diseases [ 35 ]. The relative abundance of soil pathogens such as Fusarium increased (Fig. 5 -B). IMP can reduce the damage of pathogenic fungi in soil to plants. The unique of Saccharomyces promoted crop yield increases under IMP. One possible reason is the secretion of hormones such as gibberellin (GA), cytokinin (CTK) and auxin (IAA), which promote metabolic activity and stimulate crop growth and development. Another reason may be that the large concentrations of bacteria around the rhizosphere are advantageous to Saccharomyces , effectively reducing pathogenic bacterial infection and improving crop resistance. The reason for the increased abundance of Saccharomyces in II is, however, unclear. Overall, the fungal structure in IMP, SM and SP was relatively stable but still had some differences in distribution. This is because different crops release chemical substances to the surrounding environment through allelopathy produced by secondary substances in intercropping. Another reason is that the physicochemical properties of soil are related. Saprotrophic fungi are concentrated in rhizosphere soil as a dominant functional group and can obtain nutrients by degrading dead host cells (Fig. 7 -C). They are closely involved in the cycle of decomposition of organic matter and nutrients and can also produce a series of hydrolases and oxidases, which contribute to the decomposition of carbohydrates and increase the nutrients in soil organic matter [ 45 ]. Compared with that of sole cropping, the soil IMP micro ecological environment is complex and microorganisms and plants are interdependent. This characteristic provides a theoretical basis for further understanding the mechanism of plant nutrient absorption. Our results indicated that the staggered superposition of roots and secretion of secondary metabolites among root systems in IMP promoted the reproduction of rhizosphere fungi and improved microbial diversity [ 12 ]. In this regard, managing rhizosphere microbes and maintaining the balance of the soil microbial community assist plant growth and nutrient uptake. Conclusion Compared with sole maize and peanut, IMP improved the microecological environment of rhizosphere soil, and the bacterial and fungal diversity of maize rhizosphere soil decreased (Fig. 9 ). However, the relative abundance of beneficial bacteria in the genus RB41 and Candidatus-udaeobacter were increased in IM. On the contrary, the diversity and richness of fungi in IP was increased. IMP can alleviate the imbalance of rhizosphere soil fungal community structure caused by perennial continuous cropping and benefit the abundance of fungi Chaetomium . In addition, IMP changed soil enzyme activities, affected the distribution of soil bacteria and fungi, activated the transport and metabolism of bacterial amino acids and carbohydrates, and reduced the species of pathogenic fungi. Overall, the IMP system can stimulate soil microbial communities, that are beneficial to plant growth, and its use is appropriate in agricultural practice. Our study clearly illustrated that the microbial community composition in rhizosphere soil has an important relationship with nutrient uptake and thus provides a theoretical basis for the use of IMP and nutrients in northeastern China. Methods Methods Field sites and experimental design Field experiments were conducted in 2018 and 2019 in long-term plots at Shenyang Agricultural University, Shenyang city, China (41°82′ N, 123°56′ E). We used a single-factor randomized block design with three treatments comprising sole maize (SM), sole peanut (SP) and intercropping of maize and peanut (IMP) and included three replicate plots. The maize was hybrid Liang-yu 99 ( Zea mays L.), a semicompact plant with high nutrient efficiency (Dandong Denghai Seed Industry Co. Ltd., China). The peanut was Nong-hua 9 ( Arachis hypogaea L.), which is upright and sparsely branched, has strong shade resistance and good comprehensive resistance (Peanut Research Institute of Shenyang Agricultural University, China). The sowing and harvest dates of maize and peanuts are shown in Supplementary Table S4. The field site was previously used for sole peanut, and the soil was a brown loam (Table S5). We used a planting pattern of 8:8 wide belts to intercrop maize and peanut, and the crop rows were oriented north–south (Fig. 9 ). Intercropping maize was grown at a row distance of 60 cm, with plant distance in the row of 25 cm, resulting in a density of 66670 plants/hm 2 . Intercropping peanut was a small ridge and double rows with a row distance of 60 cm, with a plant distance in the row of 12.3 cm, resulting in a density of 135508 plants/hm 2 . Apply base fertilizer before sowing, intercropped maize with conventional compound fertilizer 750 kg/hm 2 (N-P 2 O 5 -K 2 O = 27-13-15) and peanut with potassium phosphate compound fertilizer 750 kg/hm 2 (N-P 2 O 5 -K 2 O = 14-16-15) (Table S6). Sole maize and peanut plots comprised 24 rows, and plant density and fertilizer were the same as in the intercropping pattern. Other cultivation management measures were consistent with conventional field production. Sample collection Plant samples Maize ( trumpeting stage, heading stage, anthesis and silking stage, grain filling stage and mature stage) and peanut (seedling stage, flowering stage, podding stage, and mature stage ) were sampled from the main growth stages. We selected three plants of uniform size in each intercropped plot from the side row (IM for maize, IP for peanut), middle row (MIM for maize, MIP for peanut) and sole cropping middle row (SM for maize, SP for peanut). Soil samples We sampled maize and peanut soil at the same time. Samples were taken from in the side row (IM, IP) and middle row of the intercropped ridge (MIM, MIP), the shared soil of intercropping maize and peanut (II), and the middle of sole maize (SM) and sole peanut (SP). Soil samples and three replicates were taken at 0–20 cm from each point. The nitrogen content (TN) of the soil was determined after air drying and sieving. In 2019, the activities of soil enzymes were measured in soil samples at maize of anthesis and silking stage /peanut of flowering stage. Rhizosphere soil was collected during the flowering stages of peanut in 2019. And selected from the side row of the intercropped ridge (IM, IP), the shared soil of intercropping maize and peanut (II) and the side (SM, SP) and middle of (SIM, SIP) in sole cropping. The roots were carefully uprooted from the soil and shaken gently to remove loosely attached soil. A sterile brush was used to collect soil from depths of 5–15 cm that had adhered firmly to the roots, and then the rhizosphere soil was sieved through 0.9-mm mesh [ 46 ]. Soil samples were separated into two parts: one part was stored at − 80°C for soil DNA extraction, and the other was stored at 4°C for analysis of soil physicochemical properties. Measurement of nutrients and soil enzyme The organs of maize (roots, stems, leaves and grains) and peanut (roots, stems, leaves and pods) were heated to 105°C for 30 min and dried at 80°C to constant weight. The total nitrogen (TN) content of the sample was determined by the Kjeldahl method (Kjeltec 8400, Foss, Denmark). Soil samples from different depths in each treatment were sieved and air-dried to determine soil TN content by the same method. The nitrate reductase (NR), peroxidase (POD), protease (Pro) and dehydrogenase (DHO) of soil enzymes activities were measured using an ELISA kit (MLBIO, Shanghai, China). The kit assay Soil NR, Pro, Pod and DHO level in the sample, use Purified Soil NR antibody to coat micro titer plate wells, make solid-phase antibody, then add NR to the wells, Combined antibody which With HRP labeled, become antibody-antigen-enzyme-antibody complex, after washing Completely, Add TMB substrate solution, TMB substrate becomes blue color At HRP enzyme-catalyzed, reaction is terminated by the addition of a sulphuric acid solution and the color change is measured spectrophotometric ally at a wavelength of 450 nm. The concentration of NR in the samples is then determined by comparing the OD of the samples to the standard curve. DNA extraction, PCR amplification and high-throughput sequencing Soil genomic DNA was isolated using the PowerSoil® DNA Isolation kit (MoBio Laboratories, Inc., Carlsbad, CA, USA) according to the manufacturer’s protocol. The 16S rRNA was amplified for each sample using primer sets of 27F (5’-AGRGTTTGATYNTGGCTCAG-3’) and 1492R (5’-TASGGHTACCTTGTTASGACTT-3’) with adapter sequences and barcode sequences. The ITS was amplified for each sample using primer sets of ITS9 munngs (F—CTTGGTCATTTAGAGGAAGTAA) and ITS4 ngsUni (R—TCCTCCGCTTATTGATATGC) with adapter sequences and barcode sequences. PCR was performed as follows: an initial denaturation at 95°C for 5 min, followed by 95°C for 30 s, 50°C for 30 s and 72°C for 1 min/1 kb and 72°C for 7 min, for 25–30 cycles. After the electrophoretic results were obtained, all PCR products were quantified by ImageJ software (version 1.4.3.67). After quantification, the samples were mixed according to the required output data amount and fragment size of each sample, and then recovered and purified with 0.8x magnetic beads to form a sequencing library (SMRT Bell), and the library was subjected to quality inspection [ 47 , 48 ]. The qualified libraries were sequenced with PacBio sequencing platform, and SMRT Cell method was used to sequence marker genes in Biomarker Technologies Co.,Ltd, Beijing, China. To obtain the raw tags, paired-end reads were merged by FLASH (version 1.2.11 http://ccb.jhu.edu/software/FLASH/ ) [ 49 ]. Tags with an average quality score < 20 in a 50 bp sliding window were truncated using Trimmomatic (version 0.33) [ 50 ], and tags shorter than 350 bp were removed. We identified possible chimeras by employing UCHIME (version 4.2) [ 51 ], high-quality Tags sequences were obtained. Statistical and bioinformatics analysis The plant nutrient content, yield and soil physiochemical properties and diversity indices were tested for differences among wetlands restoration with the one-way Analysis of Variance (ANOVA) using SPSS 23.0 for Windows (IBM SPSS Inc., USA). Significance differences were defined at p < 0.05. Using OriginPro version 9.0 (OriginLab Corporation, Northampton, MA, United States) and R software (version 4.0.3) for drawing. The high-quality sequences were clustered using USEARCH (version 10.0), and tags with similarity ≥ 97% were regarded as OTUs. The high-quality sequences were clustered using USEARCH (version 10.0) [ 52 ] and tags with similarity ≥ 97% were regarded as a OTU. Taxonomy was assigned to all OTUs by searching against the Silva databases (Release128, http://www.arb-silva.de ) [ 53 ], and the UNITE database (Release 8.1, http://unite.ut.ee/index.php ) [ 54 ], and then were identified down to phylum, class, order, family and genus level using Ribosomal Database Project (RDP, version 2.2, http://sourceforge.net/projects/rdpclassifier/ ), the confidence threshold was 0.8. Alpha diversity indices referring to community richness (Chao1) and community diversity (Shannon) were calculated by Mothur (version v.1.30, http://www.mothur.org/ ). PICRUSt software ( http://kiwi.cs.dal.ca/Software/STAMP ) was used to predict the functional gene composition of the samples by comparing the species composition information obtained from 16S sequencing data, so as to analyze the functional differences between different samples or groups. Pair T-test was performed between different groups and the p-value was 0.05 [ 55 ]. Fungi Functional Guild (FUN Guild) was used to speculate the differential functional gene composition in bacterial and fungal samples to analyze the functional differences between different samples or groups. Abbreviations SM Sole maize SP Sole peanut SIM The middle row of sole maize SIP The middle row of sole peanut IM Intercropping maize IP Intercropping peanut II The shared of intercropping maize and peanut MIM The middle intercropping maize MIP The middle intercropping peanut NR Nitrate reductase Pro Protease POD DHO Peroxidase Dehydrogenase GA Gibberellin CTK Cytokinin IAA Auxin TN Total nitrogen OTUs Operational Taxonomic Units KEGG Kyoto Encyclopedia of Genes and Genomes Declarations Acknowledgments: The research was supported by the China Agricultural Research System (CARS-13). We thank Lijun Zhang for guidance in the paper. We thank Pei Guo for drawing the simulated diagram in the paper. Author Contributions XZ and HY designed this study. QD and XZ conducted the data analysis and wrote the manuscript. YH, ZZ, YZ, YY, XY and KW carried out the field experiments. LS, and HZ helped data analysis. GW, JJ, BL and MZ revised the manuscript. All authors have read and approved the final manuscript. Funding: This study was made possible by the China Agricultural Research System (CARS-13). Availability of data and materials All raw sequences have been deposited into a NCBI Sequence Read Archive with the accession number PRJNA728390 (Bacteria) and PRJNA728391 (Fungi). Declarations Ethics approval and consent to participate Not applicable. Consent for publication Not applicable. C ompeting i nterest s The authors declare no competing interests. Author details 1 Peanut Research Institute, Shenyang Agricultural University, Shenyang 110161, China. 2 Shandong Peanut Research Institute, Qingdao 266100, Shandong, China. References Zhang Q, Chu Y, Xue Y, Ying H, Chen X, Zhao Y, Ma W, Ma L, Zhang J, Yin Y et al : Outlook of China's agriculture transforming from smallholder operation to sustainable production . Global Food Security 2020, 26 . Misra P, Maji D, Awasthi A, Pandey SS, Yadav A, Pandey A, Saikia D, Babu CSV, Kalra A: Vulnerability of Soil Microbiome to Monocropping of Medicinal and Aromatic Plants and Its Restoration Through Intercropping and Organic Amendments . Front Microbiol 2019, 10 :2604. Yang F, Liao D, Wu X, Gao R, Fan Y, Raza MA, Wang X, Yong T, Liu W, Liu J et al : Effect of aboveground and belowground interactions on the intercrop yields in maize-soybean relay intercropping systems . Field Crops Res 2017, 203 :16–23. Wang R, Sun Z, Zhang L, Yang N, Feng L, Bai W, Zhang D, Wang Q, Evers JB, Liu Y et al : Border-row proportion determines strength of interspecific interactions and crop yields in maize/peanut strip intercropping . Field Crops Res 2020, 253 . Du J-b, Han T-f, Gai J-y, Yong T-w, Sun X, Wang X-c, Yang F, Liu J, Shu K, Liu W-g et al : Maize-soybean strip intercropping: Achieved a balance between high productivity and sustainability . Journal of Integrative Agriculture 2018, 17 (4):747–754. Du Q, Zhou L, Chen P, Liu X, Song C, Yang F, Wang X, Liu W, Sun X, Du J et al : Relay-intercropping soybean with maize maintains soil fertility and increases nitrogen recovery efficiency by reducing nitrogen input . The Crop Journal 2020, 8 (1):140–152. He Y, Ding N, Shi J, Wu M, Liao H, Xu J: Profiling of microbial PLFAs: Implications for interspecific interactions due to intercropping which increase phosphorus uptake in phosphorus limited acidic soils . Soil Biol Biochem 2013, 57 :625–634. Sun T, Zhao C, Feng X, Yin W, Gou Z, Lal R, Deng A, Chai Q, Song Z, Zhang W: Maize-based intercropping systems achieve higher productivity and profitability with lesser environmental footprint in a water‐scarce region of northwest China . Food and Energy Security 2020. Zhang D, Lyu Y, Li H, Tang X, Hu R, Rengel Z, Zhang F, Whalley WR, Davies WJ, Cahill JF, Jr. et al : Neighbouring plants modify maize root foraging for phosphorus: coupling nutrients and neighbours for improved nutrient-use efficiency . New Phytol 2019. Gong X, Dang K, Liu L, Zhao G, Lv S, Tian L, Jin F, Feng Y, Zhao Y, Feng B: Intercropping combined with nitrogen input promotes proso millet (Panicum miliaceum L.) growth and resource use efficiency to increase grain yield on the Loess plateau of China . Agric Water Manage 2021, 243 . Fu Zd, Zhou L, Chen P, Du Q, Pang T, Song C, Wang Xc, Liu Wg, Yang Wy, Yong Tw: Effects of maize-soybean relay intercropping on crop nutrient uptake and soil bacterial community . Journal of Integrative Agriculture 2019, 18 (9):2006–2018. Mommer L, Kirkegaard J, van Ruijven J: Root-Root Interactions: Towards A Rhizosphere Framework . Trends Plant Sci 2016, 21 (3):209–217. Guo Z, Wan S, Hua K, Yin Y, Chu H, Wang D, Guo X: Fertilization regime has a greater effect on soil microbial community structure than crop rotation and growth stage in an agroecosystem . Applied Soil Ecology 2020, 149 . Wang Z-g, Bao X-g, Li X-f, Jin X, Zhao J-h, Sun J-h, Christie P, Li L: Intercropping maintains soil fertility in terms of chemical properties and enzyme activities on a timescale of one decade . Plant Soil 2015, 391 (1–2):265–282. Chen J, Arafat Y, Wu L, Xiao Z, Li Q, Khan MA, Khan MU, Lin S, Lin W: Shifts in soil microbial community, soil enzymes and crop yield under peanut/maize intercropping with reduced nitrogen levels . Applied Soil Ecology 2018, 124 :327–334. Chen Y, Bonkowski M, Shen Y, Griffiths BS, Jiang Y, Wang X, Sun B: Root ethylene mediates rhizosphere microbial community reconstruction when chemically detecting cyanide produced by neighbouring plants . Microbiome 2020, 8 (1):4. Keiluweit M, Bougoure JJ, Nico PS, Pett-Ridge J, Weber PK, Kleber M: Mineral protection of soil carbon counteracted by root exudates . Nature Climate Change 2015, 5 (6):588–595. Coskun D, Britto DT, Shi W, Kronzucker HJ: How Plant Root Exudates Shape the Nitrogen Cycle . Trends Plant Sci 2017, 22 (8):661–673. Wang S, Chen A, Xie K, Yang X, Luo Z, Chen J, Zeng D, Ren Y, Yang C, Wang L et al : Functional analysis of the OsNPF4.5 nitrate transporter reveals a conserved mycorrhizal pathway of nitrogen acquisition in plants . Proc Natl Acad Sci U S A 2020. Wang L, Hou B, Zhang D, Lyu Y, Zhang K, Li H, Rengel Z, Shen J: The niche complementarity driven by rhizosphere interactions enhances phosphorus-use efficiency in maize/alfalfa mixture . Food and Energy Security 2020, 9 (4). Jensen ES, Carlsson G, Hauggaard-Nielsen H: Intercropping of grain legumes and cereals improves the use of soil N resources and reduces the requirement for synthetic fertilizer N: A global-scale analysis . Agronomy for Sustainable Development 2020, 40 (1). Liu Y-X, Sun J-H, Zhang F-F, Li L: The plasticity of root distribution and nitrogen uptake contributes to recovery of maize growth at late growth stages in wheat/maize intercropping . Plant Soil 2019, 447 (1–2):39–53. Fan Y, Wang Z, Liao D, Raza MA, Wang B, Zhang J, Chen J, Feng L, Wu X, Liu C et al : Uptake and utilization of nitrogen, phosphorus and potassium as related to yield advantage in maize-soybean intercropping under different row configurations . Sci Rep 2020, 10 (1):9504. Raza MA, Bin Khalid MH, Zhang X, Feng LY, Khan I, Hassan MJ, Ahmed M, Ansar M, Chen YK, Fan YF et al : Effect of planting patterns on yield, nutrient accumulation and distribution in maize and soybean under relay intercropping systems . Sci Rep 2019, 9 (1):4947. Zhou Q, Chen J, Xing Y, Xie X, Wang L: Influence of intercropping Chinese milk vetch on the soil microbial community in rhizosphere of rape . Plant Soil 2019, 440 (1–2):85–96. Tang X, Zhong R, Jiang J, He L, Huang Z, Shi G, Wu H, Liu J, Xiong F, Han Z et al : Cassava/peanut intercropping improves soil quality via rhizospheric microbes increased available nitrogen contents . BMC Biotechnol 2020, 20 (1):13. Xue Y, Xia H, Christie P, Zhang Z, Li L, Tang C: Crop acquisition of phosphorus, iron and zinc from soil in cereal/legume intercropping systems: a critical review . Ann Bot 2016, 117 (3):363–377. Diamantidis G, Effosse A, Potier P, Bally R: Purification and characterization of the first bacterial laccase in the rhizospheric bacterium Azospirillum lipoferum . Soil Biology & Biochemistry 2000, 32 :919–927. Gao Z, Han M, Hu Y, Li Z, Liu C, Wang X, Tian Q, Jiao W, Hu J, Liu L et al : Effects of Continuous Cropping of Sweet Potato on the Fungal Community Structure in Rhizospheric Soil . Front Microbiol 2019, 10 :2269. Liu Y, Yang F, Yang W, Wu F, Xu Z, Liu Y, Zhang L, Yue K, Ni X, Lan L et al : Effects of naphthalene on soil fauna abundance and enzyme activity in the subalpine forest of western Sichuan, China . Sci Rep 2019, 9 (1):2849. Chae Y, Cui R, Woong Kim S, An G, Jeong SW, An YJ: Exoenzyme activity in contaminated soils before and after soil washing: ss-glucosidase activity as a biological indicator of soil health . Ecotoxicol Environ Saf 2017, 135 :368–374. Tang X, Zhang Y, Jiang J, Meng X, Huang Z, Wu H, He L, Xiong F, Liu J, Zhong R et al : Sugarcane/peanut intercropping system improves physicochemical properties by changing N and P cycling and organic matter turnover in root zone soil . PeerJ 2021, 9 :e10880. Leys NM, Ryngaert A, Bastiaens L, Verstraete W, Top EM, Springael D: Occurrence and phylogenetic diversity of Sphingomonas strains in soils contaminated with polycyclic aromatic hydrocarbons . Appl Environ Microbiol 2004, 70 (4):1944–1955. Zhou X, Wang Z, Jia H, Li L, Wu F: Continuously Monocropped Jerusalem Artichoke Changed Soil Bacterial Community Composition and Ammonia-Oxidizing and Denitrifying Bacteria Abundances . Front Microbiol 2018, 9 :705. Wang X, Song D, Liang G, Zhang Q, Ai C, Zhou W: Maize biochar addition rate influences soil enzyme activity and microbial community composition in a fluvo-aquic soil . Applied Soil Ecology 2015, 96 :265–272. Zeng J, Liu J, Lu C, Ou X, Luo K, Li C, He M, Zhang H, Yan H: Intercropping With Turmeric or Ginger Reduce the Continuous Cropping Obstacles That Affect Pogostemon cablin (Patchouli) . Frontiers in Microbiology 2020, 11 . Sekar J, Raju K, Duraisamy P, Ramalingam Vaiyapuri P: Potential of Finger Millet Indigenous Rhizobacterium Pseudomonas sp. MSSRFD41 in Blast Disease Management-Growth Promotion and Compatibility With the Resident Rhizomicrobiome . Front Microbiol 2018, 9 :1029. Choudoir M, Rossabi S, Gebert M, Helmig D, Fierer N: A Phylogenetic and Functional Perspective on Volatile Organic Compound Production by Actinobacteria . mSystems 2019, 4 (2):e00295-00218. Liu H, Pan F-j, Han X-z, Song F-b, Zhang Z-m, Yan J, Xu Y-l: A comprehensive analysis of the response of the fungal community structure to long-term continuous cropping in three typical upland crops . Journal of Integrative Agriculture 2020, 19 (3):866–880. Li W-h, Liu Q-z: Changes in fungal community and diversity in strawberry rhizosphere soil after 12 years in the greenhouse . Journal of Integrative Agriculture 2019, 18 (3):677–687. Sun Z-c, Li G-t, Zhang C-l, Wang Z-m, Lin Q-m, Zhao X-r: Contrasting resilience of soil microbial biomass, microbial diversity and ammonification enzymes under three applied soil fumigants . Journal of Integrative Agriculture 2020, 19 (10):2561–2570. Miao CP, Mi QL, Qiao XG, Zheng YK, Chen YW, Xu LH, Guan HL, Zhao LX: Rhizospheric fungi of Panax notoginseng: diversity and antagonism to host phytopathogens . J Ginseng Res 2016, 40 (2):127–134. Li R, Shen Z, Sun L, Zhang R, Fu L, Deng X, Shen Q: Novel soil fumigation method for suppressing cucumber Fusarium wilt disease associated with soil microflora alterations . Applied Soil Ecology 2016, 101 :28–36. Lin W-p, Jiang N-h, Peng L, Fan X-y, Gao Y, Wang G-p, Cai K-z: Silicon impacts on soil microflora under Ralstonia Solanacearum inoculation . Journal of Integrative Agriculture 2020, 19 (1):251–264. Phillips LA, Ward V, Jones MD: Ectomycorrhizal fungi contribute to soil organic matter cycling in sub-boreal forests . ISME J 2014, 8 (3):699–713. Li Q, Chen J, Wu L, Luo X, Li N, Arafat Y, Lin S, Lin W: Belowground Interactions Impact the Soil Bacterial Community, Soil Fertility, and Crop Yield in Maize/Peanut Intercropping Systems . Int J Mol Sci 2018, 19 (2). Zhu F, Ju Y, Wang W, Wang Q, Guo R, Ma Q, Sun Q, Fan Y, Xie Y, Yang Z et al : Metagenome-wide association of gut microbiome features for schizophrenia . Nat Commun 2020, 11 (1):1612. Yang F, Sun J, Luo H, Ren H, Zhou H, Lin Y, Han M, Chen B, Liao H, Brix S et al : Assessment of fecal DNA extraction protocols for metagenomic studies . Gigascience 2020, 9 (7). Magoc T, Salzberg SL: FLASH: fast length adjustment of short reads to improve genome assemblies . Bioinformatics 2011, 27 (21):2957–2963. Bolger AM, Lohse M, Usadel B: Trimmomatic: a flexible trimmer for Illumina sequence data . Bioinformatics 2014, 30 (15):2114–2120. Edgar RC, Haas BJ, Clemente JC, Quince C, Knight R: UCHIME improves sensitivity and speed of chimera detection . Bioinformatics 2011, 27 (16):2194–2200. Edgar RC: UPARSE: highly accurate OTU sequences from microbial amplicon reads . Nat Methods 2013, 10 (10):996–998. Wang Q, Garrity GM, Tiedje JM, Cole JR: Naive Bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy . Appl Environ Microbiol 2007, 73 (16):5261–5267. Caporaso JG, Bittinger K, Bushman FD, DeSantis TZ, Andersen GL, Knight R: PyNAST: a flexible tool for aligning sequences to a template alignment . Bioinformatics 2010, 26 (2):266–267. Parks DH, Tyson GW, Hugenholtz P, Beiko RG: STAMP: statistical analysis of taxonomic and functional profiles . Bioinformatics 2014, 30 (21):3123–3124. Additional Declarations No competing interests reported. Supplementary Files BMCMICROBIOLGYSupplementary.docx Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Major revision 06 Sep, 2021 Reviews received at journal 03 Sep, 2021 Reviewers agreed at journal 16 Jul, 2021 Reviews received at journal 11 Jul, 2021 Reviewers agreed at journal 29 Jun, 2021 Reviewers invited by journal 28 Jun, 2021 Editor assigned by journal 22 Jun, 2021 Editor invited by journal 22 Jun, 2021 Submission checks completed at journal 22 Jun, 2021 First submitted to journal 20 Jun, 2021 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-643717","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":34903357,"identity":"ed5981cd-37f1-4ef2-9aaa-b34247b57a48","order_by":0,"name":"Xinhua Zhao","email":"","orcid":"","institution":"Shenyang Agricultural University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xinhua","middleName":"","lastName":"Zhao","suffix":""},{"id":34903358,"identity":"8473facb-cbbd-4d5a-af51-e7a7a3cbe7b2","order_by":1,"name":"Qiqi Dong","email":"","orcid":"","institution":"Shenyang Agricultural University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Qiqi","middleName":"","lastName":"Dong","suffix":""},{"id":34903359,"identity":"87d8c53a-c84b-41ae-88de-52f371d4e07f","order_by":2,"name":"Yi Han","email":"","orcid":"","institution":"Shenyang Agricultural University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yi","middleName":"","lastName":"Han","suffix":""},{"id":34903360,"identity":"4f9d2b4c-4e56-435a-bae0-508d82762ab7","order_by":3,"name":"Kezhao Zhang","email":"","orcid":"","institution":"Shenyang Agricultural University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Kezhao","middleName":"","lastName":"Zhang","suffix":""},{"id":34903361,"identity":"2651e1a8-60d9-47a1-b363-ba48f1fb1bb3","order_by":4,"name":"Xiaolong Shi","email":"","orcid":"","institution":"Shenyang Agricultural University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xiaolong","middleName":"","lastName":"Shi","suffix":""},{"id":34903362,"identity":"6b6d6a07-afb1-48d4-aa78-bd778d8124a2","order_by":5,"name":"Xu Yang","email":"","orcid":"","institution":"Shenyang Agricultural University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xu","middleName":"","lastName":"Yang","suffix":""},{"id":34903363,"identity":"ad13fedf-c080-4dfd-8e3f-ea38202320c9","order_by":6,"name":"Yang Yuan","email":"","orcid":"","institution":"Shenyang Agricultural University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yang","middleName":"","lastName":"Yuan","suffix":""},{"id":34903364,"identity":"2d5a6f83-5b6d-4145-8f76-fcca00b1b320","order_by":7,"name":"Dongying Zhou","email":"","orcid":"","institution":"Shenyang Agricultural University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Dongying","middleName":"","lastName":"Zhou","suffix":""},{"id":34903365,"identity":"f9446178-8088-4999-b1c3-cceed706e032","order_by":8,"name":"Kai Wang","email":"","orcid":"","institution":"Shenyang Agricultural University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Kai","middleName":"","lastName":"Wang","suffix":""},{"id":34903366,"identity":"85738ada-174e-4585-9444-a4bc1c06ea02","order_by":9,"name":"Xiaoguang Wang","email":"","orcid":"","institution":"Shenyang Agricultural University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xiaoguang","middleName":"","lastName":"Wang","suffix":""},{"id":34903367,"identity":"584eca00-d9d0-4a96-91dd-c124129b63b5","order_by":10,"name":"Chunji Jiang","email":"","orcid":"","institution":"Shenyang Agricultural University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Chunji","middleName":"","lastName":"Jiang","suffix":""},{"id":34903368,"identity":"d37f136a-8401-45c2-9c00-947ed77dbfec","order_by":11,"name":"Xibo Liu","email":"","orcid":"","institution":"Shenyang Agricultural University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xibo","middleName":"","lastName":"Liu","suffix":""},{"id":34903369,"identity":"9fe03c7f-07ea-4504-ac53-d454d2e83e9d","order_by":12,"name":"He Zhang","email":"","orcid":"","institution":"Shenyang Agricultural University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"He","middleName":"","lastName":"Zhang","suffix":""},{"id":34903370,"identity":"df09218a-168a-43cb-bb75-2e173c519644","order_by":13,"name":"Zhimeng Zhang","email":"","orcid":"","institution":"Shandong Peanut Research Institute","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Zhimeng","middleName":"","lastName":"Zhang","suffix":""},{"id":34903371,"identity":"20320e2b-cebe-4e6e-ab4e-e0df430c115a","order_by":14,"name":"Haiqiu Yu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3klEQVRIiWNgGAWjYFACHgaGBAYJBn4ol7GBaC2SDSRpAQGDA8RqMbiRe/DDgzKLxM3nzxh+5mGwkd1wgPnZA/xa8pIlEs5JJG67kWMszcOQZrzhAJu5AX4tOQYSiW0gLTwGQC2HEzcc4GGTIKDF+AdIy+b+M8a/eRj+E6XFDGzLBoYcM6AtBwhrkTzzxswC6BfjGTfSyiznGCQbzzzMZoZXC9/xHOObP8rqZPv7D2++8abCTrbvePMzvFoUDoBINhDBAQwnUFAx41MPBPINcC3sDwioHQWjYBSMgpEKAGnVSpylmCfnAAAAAElFTkSuQmCC","orcid":"","institution":"Shenyang Agricultural University","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Haiqiu","middleName":"","lastName":"Yu","suffix":""}],"badges":[],"createdAt":"2021-06-21 01:44:03","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-643717/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-643717/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":10747798,"identity":"ae69287f-63bc-40ad-b258-f2921324b2d8","added_by":"auto","created_at":"2021-06-24 19:11:19","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2103352,"visible":true,"origin":"","legend":"The nitrogen content of maize and peanut under IMP. (A) The nitrogen content in various organs of maize in 2018; (B) The nitrogen content in various organs of maize in 2019; (C) The nitrogen content in various organs of peanut in 2018; (D) The nitrogen content in various organs of peanut in 2019. 50d, trumpeting stage; 65d, heading stage/ seedling stage; 80d, anthesis and silking stage/ flowering stage; 95d, grain filling stage/ podding stage; 120d, mature stage.","description":"","filename":"OnlineFigure1.png","url":"https://assets-eu.researchsquare.com/files/rs-643717/v1/e1e4320fbe4a2428742486f9.png"},{"id":10748314,"identity":"a53396a4-0de4-42a9-b58e-b93ebde5f15c","added_by":"auto","created_at":"2021-06-24 19:14:20","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":36321,"visible":true,"origin":"","legend":"Changes in soil enzyme activities under IMP. ","description":"","filename":"OnlineFigure2.png","url":"https://assets-eu.researchsquare.com/files/rs-643717/v1/c1d08e9ecfe9f4b56b4a51f3.png"},{"id":10747801,"identity":"474905a8-33b3-4a89-bb3d-7cd1d0efc099","added_by":"auto","created_at":"2021-06-24 19:11:20","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":107053,"visible":true,"origin":"","legend":"The Upset of the number distribution of OTUs in bacterial community (A), and fungal community (B). ","description":"","filename":"OnlineFigure3.png","url":"https://assets-eu.researchsquare.com/files/rs-643717/v1/3860243dd161b9ea1cebeafd.png"},{"id":10747814,"identity":"9a35e9fb-1f46-4d0d-995c-9eca30c7d19f","added_by":"auto","created_at":"2021-06-24 19:11:20","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":83710,"visible":true,"origin":"","legend":"The diversity and richness of the bacterial community (A), and fungal community (B). ","description":"","filename":"OnlineFigure4.png","url":"https://assets-eu.researchsquare.com/files/rs-643717/v1/53d697b28888aa975e9b12ce.png"},{"id":10747815,"identity":"8245d78a-d93b-451c-9b4f-453412e111e1","added_by":"auto","created_at":"2021-06-24 19:11:20","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":144910,"visible":true,"origin":"","legend":"Composition of the bacterial community (A), and fungal community (B) at the genus level in the rhizosphere soil. The histogram of distribution figures shows the relative abundance of the top 10 rhizosphere soil bacteria and fungi at the genus level. A color represents a species, and the length of the color block represents the relative abundance ratio of species at the genus level. The heatmap of the relative abundance of the figure shows the genus-level RA of the 20% bacterial and fungal community of rhizosphere soil. ","description":"","filename":"OnlineFigure5.png","url":"https://assets-eu.researchsquare.com/files/rs-643717/v1/0287ccf5a73d785f20864995.png"},{"id":10748313,"identity":"6c001d7b-5d10-4430-b64c-7d5aedb67da9","added_by":"auto","created_at":"2021-06-24 19:14:20","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":79209,"visible":true,"origin":"","legend":"LEfse of difference analysis of bacterial community (A), and fungal community (B).","description":"","filename":"OnlineFigure6.png","url":"https://assets-eu.researchsquare.com/files/rs-643717/v1/c0351b829bdcb47bc9115fdc.png"},{"id":10747816,"identity":"62b3de5b-fb2a-49b5-b108-bc9095c5e6fd","added_by":"auto","created_at":"2021-06-24 19:11:21","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":227385,"visible":true,"origin":"","legend":"Cluster heatmap of correlation between the soil physiochemical properties and bacterial community (A) fungal community (B).","description":"","filename":"OnlineFigure7.png","url":"https://assets-eu.researchsquare.com/files/rs-643717/v1/824e7d62e2703a6efff6f3c2.png"},{"id":10748315,"identity":"d730ecc4-9bd6-41d2-851c-2529aa2a29c0","added_by":"auto","created_at":"2021-06-24 19:14:21","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":91682,"visible":true,"origin":"","legend":"Predictions of functional genes in bacterial community (A), and fungal community (B).","description":"","filename":"OnlineFigure8.png","url":"https://assets-eu.researchsquare.com/files/rs-643717/v1/2457051c015125da5e3a7c8e.png"},{"id":10747812,"identity":"6072e099-a57e-44ee-bb30-3c4663ba9b73","added_by":"auto","created_at":"2021-06-24 19:11:20","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":44418,"visible":true,"origin":"","legend":"Overview of promoting nutrient uptake by root interaction IMP.","description":"","filename":"OnlineFigure9.png","url":"https://assets-eu.researchsquare.com/files/rs-643717/v1/8dd60f7a1b1b194498237e4f.png"},{"id":10748312,"identity":"83c3c9f8-48b2-44a2-ac64-b5181c5717ef","added_by":"auto","created_at":"2021-06-24 19:14:20","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":337098,"visible":true,"origin":"","legend":"Please see the Manuscript file for the complete figure caption.\n\n","description":"","filename":"OnlineFigure10.png","url":"https://assets-eu.researchsquare.com/files/rs-643717/v1/cf4b58ecae5774229dc533b2.png"},{"id":13700315,"identity":"aa0904e0-7771-404f-b639-77c9811ec2ed","added_by":"auto","created_at":"2021-09-17 13:24:18","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3587720,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-643717/v1/fa00e185-643f-4845-a156-9888f8787269.pdf"},{"id":10747818,"identity":"9d395834-f705-4805-a543-837407bb8d8a","added_by":"auto","created_at":"2021-06-24 19:11:21","extension":"docx","order_by":12,"title":"","display":"","copyAsset":false,"role":"supplement","size":267256,"visible":true,"origin":"","legend":"","description":"","filename":"BMCMICROBIOLGYSupplementary.docx","url":"https://assets-eu.researchsquare.com/files/rs-643717/v1/94fea84829a296057c4bd1f3.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"\u003cp\u003eEnhanced Nutrient Uptake in Side-Row Maize and Improved Microbial Community Diversity in Wide-Strip Intercropping of Maize and Peanut\u003c/p\u003e","fulltext":[{"header":"Background","content":" \u003cp\u003eMaize and peanut are major grain and oil crops and are important in ensuring food security in China. Sole cropping has been widely used in recent decades to facilitate planting, field management and mechanization. Sole cropping and improving yield by increasing fertilizer application are, however, not only detrimental to grain production in China [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e] but also disturb the ecological stability of the soil microbial community and limit environmental sustainability [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Previous studies have found that wide-strip intercropping has the advantages of using marginal effects to increase yield, to optimize population structure, and to promote light energy utilization [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. This method is also suitable for mechanized seeding, fertilization and field management [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Maize and peanut strip intercropping can not only improve crop yield and water and fertilizer utilization efficiency, but also can reduce competition for major soil nutrients, increase beneficial soil microorganism numbers and diversity and reduce pathogenic and poisonous microorganisms, effectively improving the ecological environment of farmland [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. While helping to reduce carbon emissions and to increase the economic value of the ecosystem [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e \u003cp\u003ePrevious studies have showed that plant nutrient uptake is affected by soil nutrient distribution, and the presence of neighboring plants greatly affects crop nutrient uptake in an intercropping system [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. In the Loess Plateau of China, the intercropping of proso millet and mung bean have been reported to increased the nitrogen absorption efficiency by 96% and 71.6%, respectively, due to complementarity of crops[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. The maize grain nitrogen uptake was increased by 25.5% in the maize and soybean strip intercropping in southwest of China[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Intercropping with legumes, through the legumes' symbiotic relationship with nitrogen-fixing bacteria to obtain nitrogen from the air, allows neighboring plants to obtain more nitrogen from the soil [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Intercropping can improve the efficient utilization of soil nutrient resources through the complementary niche of crop root growth time and space.\u003c/p\u003e \u003cp\u003eSoil microbial activities are critical to nutrient mobilization and mineralization, directly affects the nutrient utilization efficiency of plants [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e],and an important source of soil enzymes [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Previous studies have reported that intercropping changes the composition and function of microbial communities. The abundance of the nitrogen-fixing microbes \u003cem\u003eRhizobium hainanense\u003c/em\u003e, \u003cem\u003eR. leguminosarum\u003c/em\u003e and \u003cem\u003eFrankia\u003c/em\u003e spp. were promoted in the rhizosphere of peanut when intercropped with maize [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Intercropping of cassava and peanut induced ethylene release resulted in the increase of \u003cem\u003eActinomycetes\u003c/em\u003e abundance in the rhizosphere of peanut and promoted the absorption of soil available nutrients, thus increasing the yield of peanut [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Some studies have also shown that root exudates affect the structure and function of rhizosphere microbial community, promote soil organic matter mineralization, and thus affect the rhizosphere nitrogen cycle [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. In the study of intercropping of maize and faba bean, maize root exudates increased nodule formation and biological nitrogen fixation in faba bean root, except that flavonoids in leguminous root exudates stimulated NOD gene expression in rhizobia [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. The nitrate absorption pathway of mycorrhizal symbiosis has also been shown to promote the nitrogen absorption efficiency of gramineous crops [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. The presence of maize increased the secretion of carboxylate in alfalfa root system, improved the availability of soil phosphorus, and then promoted the growth of maize in the aboveground and absorption of phosphorus [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Therefore, the relationship between microorganisms, plants and soil under intercropping of maize and peanut can not only reveal the adaptation of plants to the microecological environment but also improve resource utilization efficiency, reduce fertilizer application, protect the ecological environment and help to develop sustainable agriculture.\u003c/p\u003e \u003cp\u003eNortheastern China has a temperate monsoon climate, drought and less rain during the growing season, and there has been limited systematic research into the characteristics and mechanism of nitrogen uptake by crop and correlation between soil physicochemical properties and soil microorganisms at genus level. Through a field experiment in the study, the purpose of 1) the changes in structure and diversity of bacterial and fungal community at the genera level in intercropping, compared with sole cropping, which genera are beneficial, 2) Whether there is a correlation and the mechanism of soil enzyme activities and bacterial and fungal communities at the genus level, 3) We also clarified microecological changes in farmland ecosystems under maize and peanut strip intercropping in Northeast China maintain the balance of the soil ecosystem and increase productivity through sustainable agriculture.\u003c/p\u003e "},{"header":"Results","content":" \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eEffect of intercropping on the nitrogen content and yield of maize and peanut\u003c/h2\u003e \u003cp\u003eChanges in the nitrogen content of maize and peanuts were similar between 2018 and 2019. The IM had higher nitrogen contents than those of SM, and the IP was lower than SP. The nitrogen content in the roots of IM was clearly higher than that of SM, The stems and leaves of IP significantly lower than those of SP (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), indicating that intercropping increased the nitrogen content in maize. Compared with MIM, the IM was significantly higher than MIM. The IP was lower than MIP, indicating that intercropped maize has the marginal advantage. In addition, ear length and number of grains per spike significantly affected maize yield. Compared with SM, the yield of intercropped maize was significantly increased, by 30.34% (2018) and 24.8% (2019) (Table S1). The yield of peanut was significantly affected by 100 kernel weight. Intercropped peanut yield decreased by 33.49% (2018) and 2.4% (2019), compared with SP.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eChanges in soil TN content and soil enzyme activity at IMP\u003c/h2\u003e \u003cp\u003eThe soil TN content of SM and SP were significantly higher than that of IM and IP, showed that intercropping increased soil nutrient consumption. And the soil TN content of IM and IP were lower than SIM and SIP, respectively (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). It was speculated that the interspecific root interaction between IM and IP could promote soil nutrients uptake and utilization. The soil TN of II between IM and IP were no significantly difference. (Table S2).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003e\u003cb\u003eSoil total nitrogen (TN) content of different soil samples\u003c/b\u003e(mg/Kg)\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eStage\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTrumpeting Stage\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHeading Stage/\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAnthesis and Silking stage/\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eGrain Filling Stage/\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eMature stage\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSample\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSeedling Sage\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eFlowering stage\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003ePodding Stage\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e235.43\u0026thinsp;\u0026plusmn;\u0026thinsp;1.59a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e224.44\u0026thinsp;\u0026plusmn;\u0026thinsp;2.66a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e186.01\u0026thinsp;\u0026plusmn;\u0026thinsp;2.56a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e157\u0026thinsp;\u0026plusmn;\u0026thinsp;0.85a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e125\u0026thinsp;\u0026plusmn;\u0026thinsp;1.18a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMIM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4.34\u0026thinsp;\u0026plusmn;\u0026thinsp;0.89c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e6.34\u0026thinsp;\u0026plusmn;\u0026thinsp;0.33b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5.19\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e6.59\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2.91\u0026thinsp;\u0026plusmn;\u0026thinsp;0.49b\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7.39\u0026thinsp;\u0026plusmn;\u0026thinsp;0.15b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e6.63\u0026thinsp;\u0026plusmn;\u0026thinsp;0.37b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5.62\u0026thinsp;\u0026plusmn;\u0026thinsp;0.19b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4.93\u0026thinsp;\u0026plusmn;\u0026thinsp;0.54c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2.31\u0026thinsp;\u0026plusmn;\u0026thinsp;0.7b\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e258.16\u0026thinsp;\u0026plusmn;\u0026thinsp;1.42a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e217.66\u0026thinsp;\u0026plusmn;\u0026thinsp;1.62a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e179.37\u0026thinsp;\u0026plusmn;\u0026thinsp;1.37a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e133.91\u0026thinsp;\u0026plusmn;\u0026thinsp;1.36a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e85.93\u0026thinsp;\u0026plusmn;\u0026thinsp;0.61a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMIP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5.87\u0026thinsp;\u0026plusmn;\u0026thinsp;0.68b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e7.73\u0026thinsp;\u0026plusmn;\u0026thinsp;0.16b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e6.5\u0026thinsp;\u0026plusmn;\u0026thinsp;0.17b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e11.47\u0026thinsp;\u0026plusmn;\u0026thinsp;0.53b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2.31\u0026thinsp;\u0026plusmn;\u0026thinsp;0.65b\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e6.98\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e6.4\u0026thinsp;\u0026plusmn;\u0026thinsp;0.31b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e7.13\u0026thinsp;\u0026plusmn;\u0026thinsp;0.22b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e9.67\u0026thinsp;\u0026plusmn;\u0026thinsp;0.29b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e3.38\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05b\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eCompared with SM, the activities of nitrate reductase (NR) and peroxidase (POD) (Duncan test, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in IM soil increased, and the activity of protease (Pro) (Duncan test, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) and dehydrogenase (DHO) decreased (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The POD in IP soil was increased and the activity of NR, Pro (Duncan test, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) and DHO (Duncan test, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) were decreased than SP (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Compared with monoculture, IMP significantly altered the activities of Pro, POD and DHO. Compared with the middle row of intercropping, the change of soil enzyme activities in the side row was similar to the above (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Furthermore, four soil enzyme activities were no significant difference in IM, IP and II (Table S3), which indicated soil enzyme activities tended to be stable under intercropping. Correlation analysis showed that POD activity was significantly negatively correlated with TN, while other enzyme activities were significantly positively correlated with TN (Figure S1). The results showed that IMP changes the soil physicochemical properties compared with sole cropping, and it affected the change of soil nutrient content.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec5\" class=\"Section3\"\u003e \u003ch2\u003eOTUs and diversity of the rhizosphere soil microbial community\u003c/h2\u003e \u003cp\u003eThrough OTUs analysis, combined with the species represented by OTUs, common microorganisms in different environments can be found. Compared with SM, the OTUs of bacteria and fungi in IM were decreased markedly by 9.7% and 10.4%, respectively. However, compared with SP, the variation of OTUs in IP was different. The number of OTUs was lower (by 3.9%) in the bacterial community, while the number of fungal OTUs was higher (by 7.9%) (Figure S2). IMP changed the number of OTUs bacteria and fungi in rhizosphere soil, and the change was different among crop types. Bacterial OTUs analysis indicated that 4 OTUs were common to all samples. The number of OTUs shared by IM and SM was 1, IP and SP was 4, IP and II was 1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e-A). In the fungal community, of the number of OTUs shared by IM and SIM was 1, IM and II was 1,IP and SP was 7, IP and SIP was 2, IP and II was 3, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e-B).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe diversity and richness of bacteria and fungi in IM were lower than that of SM and SIM, and richness of fungi in IP were higher than that of SP and SIP. The bacterial diversity and richness of Ⅱ were higher than IP and IM, respectively. While the fungal diversity and richness of Ⅱ were lower than IM and IP (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eComposition and function of the microbial community in rhizosphere soil\u003c/h2\u003e \u003cp\u003eAlthough reduced the diversity and richness of microorganisms in intercropping. However, compared with sole cropping and middle row of intercropping, the abundance of some species increased. Such as \u003cem\u003eRB41\u003c/em\u003e, \u003cem\u003eHaliangium\u003c/em\u003e, \u003cem\u003eRamlibacter\u003c/em\u003e and \u003cem\u003eCandidatus-udaeobacter\u003c/em\u003e were higher in IM and IP (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e-A). The abundance of \u003cem\u003eEllin6067\u003c/em\u003e, \u003cem\u003eMND1\u003c/em\u003e, \u003cem\u003eRB41\u003c/em\u003e and in II were higher than in those in IP and IM, whereas \u003cem\u003eRamlibacter\u003c/em\u003e and \u003cem\u003eCandidatus-udaeobacter\u003c/em\u003e were lower (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e-A). Specificaly, the abundance of \u003cem\u003eSphingomonas\u003c/em\u003e was increased in IP (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e-A). To identify the representative microbial of the samples, soil microbial from the different treatment groups were compared using LEfSe analysis. In the genus level, \u003cem\u003eRamlibacter\u003c/em\u003e and MND1 were significantly enriched in IP and II, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e-A). Analysis for KEGG pathway using LEfSe, the functions of the first level of the genus bacteria were mainly metabolism (Figure S3). The functions of the second level included amino acids metabolism, carbohydrates metabolism and other amino acids metabolism accounted for high relatively abundance (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e-A).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eCompared with SM and SIM, the abundance of \u003cem\u003eFusarium\u003c/em\u003e, \u003cem\u003eNeocosmospora\u003c/em\u003e, \u003cem\u003eChaetomium\u003c/em\u003e, \u003cem\u003eCladosporium\u003c/em\u003e, \u003cem\u003eStaphylotrichum\u003c/em\u003e and \u003cem\u003ePenicillium\u003c/em\u003e were higher in IM (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e-B). The abundance of \u003cem\u003eMortierella\u003c/em\u003e, \u003cem\u003eFusarium\u003c/em\u003e, \u003cem\u003eChaetomium\u003c/em\u003e, \u003cem\u003eCladosporium\u003c/em\u003e and \u003cem\u003ePenicillium\u003c/em\u003e in IP were higher than those in SP (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e-B). In case of II, the abundance of \u003cem\u003eMortierella\u003c/em\u003e, \u003cem\u003eStaphylotrichum\u003c/em\u003e, \u003cem\u003eSaccharomyces\u003c/em\u003e and \u003cem\u003eTausonia\u003c/em\u003e were higher than those in IM and IP, whereas the abundance of \u003cem\u003eFusarium\u003c/em\u003e, \u003cem\u003eChaetomium\u003c/em\u003e, \u003cem\u003eCladosporium\u003c/em\u003e were lower (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e-B). The abundance of \u003cem\u003eChaetomium\u003c/em\u003e and Stropharia were significantly enriched IM, and the abundance of \u003cem\u003ePenicillium\u003c/em\u003e and \u003cem\u003eFusarium\u003c/em\u003e were significantly enriched IP (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e-B). According to the function analysis of the fungal community, it was found that most fungal species in the rhizosphere soil were saprophyrotrophic fungi, while pathotroph fungi had the least species (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e-B). Therefore, IMP reduced the varities of pathogenic bacteria in the rhizosphere soil.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eCorrelation between bacterial and fungal communities and soil physicochemical properties\u003c/h2\u003e \u003cp\u003e \u003cem\u003eRB41, Candidatus-udaeobacter\u003c/em\u003e were significantly positively correlated with POD activity, extremely significantly negatively correlated with TN, Pro and DHO, and significantly negatively correlated with Pro. \u003cem\u003eVicinamibacter, Gemmatimonas\u003c/em\u003e and \u003cem\u003eEllin6067\u003c/em\u003e were significantly positively correlated with TN, Pro and DHO (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e-A). In the fungal community, \u003cem\u003eMortierella\u003c/em\u003e was significantly positively correlated with TN. \u003cem\u003eChaetomium, Fusarium\u003c/em\u003e and \u003cem\u003ePenicillium\u003c/em\u003e were extremely significantly and significantly positively correlated with POD activity, and extremely significantly or negatively correlated with DHO, Pro and TN. \u003cem\u003eStropharia\u003c/em\u003e, \u003cem\u003eStaphylotrichum\u003c/em\u003e and \u003cem\u003eCladosporium\u003c/em\u003e were extremely significantly and significantly negatively correlated with TN and DHO, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e-B).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e "},{"header":"Discussion","content":" \u003cp\u003eNitrogen is an essential element for plant growth and development and is the element most closely related to yield. In a gramineous and leguminous intercropping system, nitrogen content was clearly promoted nitrogen content and yield in the gramineous crop, and improved land productivity [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. In the current study, maize had marginal advantage under IMP. The nitrogen content in the IM roots, stems and leaves was significantly higher than SM and MIM, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), which was consistent with the findings of another [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Due to the adjustment of root length density and root distribution, the nitrogen uptake per unit root length was increased, compared with that of monoculture [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Combined with other research reports, maize competes strongly for nitrogen and absorbs more nitrogen than peanut, so significantly increasing the nitrogen content in IM and promoting the yield of maize [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. In the middle and late growth period, the shading of IM was intensified, and photosynthesis was weakened on the IP, which further affected the absorption of nutrients by the peanut (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). In the intercropping of maize and soybean, light transmittance was increased after defoliation of the top two leaves of the maize, and the nitrogen absorption of soybean was increased by 5% (grain), 10%(stem) and 14% (root), respectively [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. The shading of maize inhibited the growth of peanut and the yield of intercropped peanut decreased (Table S1). Ear length, number of grains per spike and fruit weight per hundred were the main yield components (Table S1), which were the same as the findings of previous studies [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn this study, it was found that interspecific root interactions of IMP promoted soil nutrient uptake and utilization, compared with monoculture (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The results were consistent with the decrease of soil TN in intercropping Chinease milk vetch and rape[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. It is reported, the root density distribution was different under different soil depths, which affected the absorption and utilization of soil nutrients [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e], and IMP maintained the basic stability of soil chemical properties and the diversity effect of soil nitrogen accumulation (Table S2-3) [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIt is needed to explore the interactions of rhizosphere microbial community in intercropping, and the inner mechanism of IMP was elucidated through analyzing the physicochemical properties of and rhizosphere soil microbial community [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Soil microorganisms are one of the main sources of soil enzymes, and there is a correlation between soil enzyme activity and microorganisms [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], it\u0026rsquo;s consistent with this study show that \u003cem\u003eRB41\u003c/em\u003e, \u003cem\u003eCandidatus-udaeobacter\u003c/em\u003e and \u003cem\u003eChaetomium\u003c/em\u003e were significantly positively correlated with soil POD, and negatively correlated with Pro and DHO (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e). Besides, \u003cem\u003eFusarium, Stropharia\u003c/em\u003e and \u003cem\u003ePenicillium\u003c/em\u003e also were negatively correlated with Pro and DHO (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e-B). \u003cem\u003eCandidatus-udaeobacter\u003c/em\u003e within the Verrucomicrobia phylum is pervasive in soils around the world, sacrificing metabolic versatility for efficiency to become dominant in the soil environment. The \u003cem\u003eChaetomium\u003c/em\u003e, which is a beneficial fungi with biocontrol effect and antagonistic to soil pathogenic bacteria [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e].In our study, the soil POD was negatively correlated with soil TN content across all soil (Figure S1), due to it is involved in the degradation of hydrocarbons and their intermediates [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Soil Pro and DHO activities were positively correlated with TN (Figure S1), which was consistent with previous studies [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Soil Pro are involved in the conversion of amino acids and other nitrogen-containing organic compounds present in soil, and their hydrolysates are one of the nitrogen sources for higher plants [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Soil DHO participates in soil carbon cycle and promotes dehydrogenation of carbohydrates and organic acids [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eSoil microorganisms play a key role in soil nutrient cycling and crop nutrient uptake [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Through the analysis of the dominant bacteria in the soil components, it was found that the intercropping varieties had increased the relative abundance on the dominant bacteria species (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e-A). The \u003cem\u003eRamlibacter\u003c/em\u003e and \u003cem\u003eMND1\u003c/em\u003e were significantly enriched in IP and II, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e-A). The functions of \u003cem\u003eMND1\u003c/em\u003e need to be investigated more deeply. The \u003cem\u003eRamlibacter\u003c/em\u003e within the Proteobacteria, comprising an enormous range of metabolic diversity [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. In addition, \u003cem\u003eSphingomonas\u003c/em\u003e also increased in IP than SP (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e-B), which is the characteristics of promoting nitrogen fixation and dehydrogenation [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e] and the uptake of nutrients in the rhizosphere, improving the soil environment in the rhizosphere of IP, and maintaining the soil nitrogen balance. This result could be related to the reduced abundance of denitrifying bacteria \u003cem\u003eHaliangium\u003c/em\u003e, which reduces nitrates in the soil to nitrogen and releases them into the air [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. So that, intercropping improved the bacterial community structure and increased the abundance of beneficial bacteria. IMP changed the abundance of bacteria in soil, affected soil enzyme activities and soil nutrients, and ultimately affected crop nutrient uptake (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e). Other bacterial genera had no significant correlation with soil enzyme activities (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e). The reason is that there are many kinds of bacteria in the soil, and the correlation between soil enzyme activity and bacteria is not specific and unique. A single bacterium can affect a variety of enzyme activities, so it is necessary to further explore or study the functional properties of each bacterium and the mechanism of soil enzyme activities themselves [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. It was found that the transport and metabolism of amino acids, carbohydrate transport and metabolism, and metabolism of other amino acids in the secondary functional areas were relatively high in abundance, which was consistent with previous findings [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Furthermore, it was speculated that the relative abundance of \u003cem\u003eRB41\u003c/em\u003e and \u003cem\u003eCandidatus-udaeobacter\u003c/em\u003e increased. Soil microorganisms to transport amino acid metabolism, carbohydrate metabolism to produce a series of material, when they were plants as signal perception, can cause related enzyme activity in plant or related gene expression changes, ensure the survival of the bacteria, and then adjust the plant physiological metabolism and nutrient accumulation levels, which promote plant growth and development [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWe found that, compared with SP, the change in OTUs and richness of IP was higher than those of SP (Figure S2 and 4). These results were consistent with the promotion of fungal community growth in the IMP, intercropping promotes fungal community growth [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. On the one hand, many biotic and abiotic factors can alter the fungal community, such as soil chemical properties, plant functional diversities and management practices. On the other hand, the variety and quantity of root exudates affect the abundance of the rhizosphere fungal community owing to the presence of different crop species [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eSoil fungi decompose organic matter in crop residues and fertilizers, which is beneficial to soil nutrient supply and crop growth, but also affects soil enzyme activity [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. \u003cem\u003eMortierella\u003c/em\u003e decomposes organic matter and promotes mineral uptake by plant roots. It also has the potential to secrete antimicrobials that inhibit pathogenic bacteria such as \u003cem\u003eFusarium\u003c/em\u003e [\u003cspan additionalcitationids=\"CR43\" citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. However, many fungi are plant pathogens and cause fungal diseases [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. The relative abundance of soil pathogens such as \u003cem\u003eFusarium\u003c/em\u003e increased (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e-B). IMP can reduce the damage of pathogenic fungi in soil to plants. The unique of \u003cem\u003eSaccharomyces\u003c/em\u003e promoted crop yield increases under IMP. One possible reason is the secretion of hormones such as gibberellin (GA), cytokinin (CTK) and auxin (IAA), which promote metabolic activity and stimulate crop growth and development. Another reason may be that the large concentrations of bacteria around the rhizosphere are advantageous to \u003cem\u003eSaccharomyces\u003c/em\u003e, effectively reducing pathogenic bacterial infection and improving crop resistance. The reason for the increased abundance of \u003cem\u003eSaccharomyces\u003c/em\u003e in II is, however, unclear. Overall, the fungal structure in IMP, SM and SP was relatively stable but still had some differences in distribution. This is because different crops release chemical substances to the surrounding environment through allelopathy produced by secondary substances in intercropping. Another reason is that the physicochemical properties of soil are related. Saprotrophic fungi are concentrated in rhizosphere soil as a dominant functional group and can obtain nutrients by degrading dead host cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e-C). They are closely involved in the cycle of decomposition of organic matter and nutrients and can also produce a series of hydrolases and oxidases, which contribute to the decomposition of carbohydrates and increase the nutrients in soil organic matter [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. Compared with that of sole cropping, the soil IMP micro ecological environment is complex and microorganisms and plants are interdependent. This characteristic provides a theoretical basis for further understanding the mechanism of plant nutrient absorption. Our results indicated that the staggered superposition of roots and secretion of secondary metabolites among root systems in IMP promoted the reproduction of rhizosphere fungi and improved microbial diversity [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. In this regard, managing rhizosphere microbes and maintaining the balance of the soil microbial community assist plant growth and nutrient uptake.\u003c/p\u003e "},{"header":"Conclusion","content":" \u003cp\u003eCompared with sole maize and peanut, IMP improved the microecological environment of rhizosphere soil, and the bacterial and fungal diversity of maize rhizosphere soil decreased (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e). However, the relative abundance of beneficial bacteria in the genus \u003cem\u003eRB41\u003c/em\u003e and \u003cem\u003eCandidatus-udaeobacter\u003c/em\u003e were increased in IM. On the contrary, the diversity and richness of fungi in IP was increased. IMP can alleviate the imbalance of rhizosphere soil fungal community structure caused by perennial continuous cropping and benefit the abundance of fungi \u003cem\u003eChaetomium\u003c/em\u003e. In addition, IMP changed soil enzyme activities, affected the distribution of soil bacteria and fungi, activated the transport and metabolism of bacterial amino acids and carbohydrates, and reduced the species of pathogenic fungi. Overall, the IMP system can stimulate soil microbial communities, that are beneficial to plant growth, and its use is appropriate in agricultural practice. Our study clearly illustrated that the microbial community composition in rhizosphere soil has an important relationship with nutrient uptake and thus provides a theoretical basis for the use of IMP and nutrients in northeastern China.\u003c/p\u003e "},{"header":"Methods","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eMethods\u003c/h2\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eField sites and experimental design\u003c/h2\u003e \u003cp\u003eField experiments were conducted in 2018 and 2019 in long-term plots at Shenyang Agricultural University, Shenyang city, China (41\u0026deg;82\u0026prime; N, 123\u0026deg;56\u0026prime; E). We used a single-factor randomized block design with three treatments comprising sole maize (SM), sole peanut (SP) and intercropping of maize and peanut (IMP) and included three replicate plots. The maize was hybrid Liang-yu 99 (\u003cem\u003eZea mays\u003c/em\u003e L.), a semicompact plant with high nutrient efficiency (Dandong Denghai Seed Industry Co. Ltd., China). The peanut was Nong-hua 9 (\u003cem\u003eArachis hypogaea\u003c/em\u003e L.), which is upright and sparsely branched, has strong shade resistance and good comprehensive resistance (Peanut Research Institute of Shenyang Agricultural University, China). The sowing and harvest dates of maize and peanuts are shown in Supplementary Table S4. The field site was previously used for sole peanut, and the soil was a brown loam (Table S5). We used a planting pattern of 8:8 wide belts to intercrop maize and peanut, and the crop rows were oriented north\u0026ndash;south (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e). Intercropping maize was grown at a row distance of 60 cm, with plant distance in the row of 25 cm, resulting in a density of 66670 plants/hm\u003csup\u003e2\u003c/sup\u003e. Intercropping peanut was a small ridge and double rows with a row distance of 60 cm, with a plant distance in the row of 12.3 cm, resulting in a density of 135508 plants/hm\u003csup\u003e2\u003c/sup\u003e. Apply base fertilizer before sowing, intercropped maize with conventional compound fertilizer 750 kg/hm\u003csup\u003e2\u003c/sup\u003e (N-P\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e5\u003c/sub\u003e-K\u003csub\u003e2\u003c/sub\u003eO\u0026thinsp;=\u0026thinsp;27-13-15) and peanut with potassium phosphate compound fertilizer 750 kg/hm\u003csup\u003e2\u003c/sup\u003e (N-P\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e5\u003c/sub\u003e-K\u003csub\u003e2\u003c/sub\u003eO\u0026thinsp;=\u0026thinsp;14-16-15) (Table S6). Sole maize and peanut plots comprised 24 rows, and plant density and fertilizer were the same as in the intercropping pattern. Other cultivation management measures were consistent with conventional field production.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eSample collection\u003c/h2\u003e \u003cdiv id=\"Sec13\" class=\"Section3\"\u003e \u003ch2\u003ePlant samples\u003c/h2\u003e \u003cp\u003eMaize ( trumpeting stage, heading stage, anthesis and silking stage, grain filling stage and mature stage) and peanut (seedling stage, flowering stage, podding stage, and mature stage ) were sampled from the main growth stages. We selected three plants of uniform size in each intercropped plot from the side row (IM for maize, IP for peanut), middle row (MIM for maize, MIP for peanut) and sole cropping middle row (SM for maize, SP for peanut).\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eSoil samples\u003c/h2\u003e \u003cp\u003eWe sampled maize and peanut soil at the same time. Samples were taken from in the side row (IM, IP) and middle row of the intercropped ridge (MIM, MIP), the shared soil of intercropping maize and peanut (II), and the middle of sole maize (SM) and sole peanut (SP). Soil samples and three replicates were taken at 0\u0026ndash;20 cm from each point. The nitrogen content (TN) of the soil was determined after air drying and sieving. In 2019, the activities of soil enzymes were measured in soil samples at maize of anthesis and silking stage /peanut of flowering stage.\u003c/p\u003e \u003cp\u003eRhizosphere soil was collected during the flowering stages of peanut in 2019. And selected from the side row of the intercropped ridge (IM, IP), the shared soil of intercropping maize and peanut (II) and the side (SM, SP) and middle of (SIM, SIP) in sole cropping. The roots were carefully uprooted from the soil and shaken gently to remove loosely attached soil. A sterile brush was used to collect soil from depths of 5\u0026ndash;15 cm that had adhered firmly to the roots, and then the rhizosphere soil was sieved through 0.9-mm mesh [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. Soil samples were separated into two parts: one part was stored at \u0026minus;\u0026thinsp;80\u0026deg;C for soil DNA extraction, and the other was stored at 4\u0026deg;C for analysis of soil physicochemical properties.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eMeasurement of nutrients and soil enzyme\u003c/h2\u003e \u003cp\u003eThe organs of maize (roots, stems, leaves and grains) and peanut (roots, stems, leaves and pods) were heated to 105\u0026deg;C for 30 min and dried at 80\u0026deg;C to constant weight. The total nitrogen (TN) content of the sample was determined by the Kjeldahl method (Kjeltec 8400, Foss, Denmark). Soil samples from different depths in each treatment were sieved and air-dried to determine soil TN content by the same method.\u003c/p\u003e \u003cp\u003eThe nitrate reductase (NR), peroxidase (POD), protease (Pro) and dehydrogenase (DHO) of soil enzymes activities were measured using an ELISA kit (MLBIO, Shanghai, China). The kit assay Soil NR, Pro, Pod and DHO level in the sample, use Purified Soil NR antibody to coat micro titer plate wells, make solid-phase antibody, then add NR to the wells, Combined antibody which With HRP labeled, become antibody-antigen-enzyme-antibody complex, after washing Completely, Add TMB substrate solution, TMB substrate becomes blue color At HRP enzyme-catalyzed, reaction is terminated by the addition of a sulphuric acid solution and the color change is measured spectrophotometric ally at a wavelength of 450 nm. The concentration of NR in the samples is then determined by comparing the OD of the samples to the standard curve.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eDNA extraction, PCR amplification and high-throughput sequencing\u003c/h2\u003e \u003cp\u003eSoil genomic DNA was isolated using the PowerSoil\u0026reg; DNA Isolation kit (MoBio Laboratories, Inc., Carlsbad, CA, USA) according to the manufacturer\u0026rsquo;s protocol.\u003c/p\u003e \u003cp\u003eThe 16S rRNA was amplified for each sample using primer sets of 27F (5\u0026rsquo;-AGRGTTTGATYNTGGCTCAG-3\u0026rsquo;) and 1492R (5\u0026rsquo;-TASGGHTACCTTGTTASGACTT-3\u0026rsquo;) with adapter sequences and barcode sequences. The ITS was amplified for each sample using primer sets of ITS9 munngs (F\u0026mdash;CTTGGTCATTTAGAGGAAGTAA) and ITS4 ngsUni (R\u0026mdash;TCCTCCGCTTATTGATATGC) with adapter sequences and barcode sequences. PCR was performed as follows: an initial denaturation at 95\u0026deg;C for 5 min, followed by 95\u0026deg;C for 30 s, 50\u0026deg;C for 30 s and 72\u0026deg;C for 1 min/1 kb and 72\u0026deg;C for 7 min, for 25\u0026ndash;30 cycles. After the electrophoretic results were obtained, all PCR products were quantified by ImageJ software (version 1.4.3.67). After quantification, the samples were mixed according to the required output data amount and fragment size of each sample, and then recovered and purified with 0.8x magnetic beads to form a sequencing library (SMRT Bell), and the library was subjected to quality inspection [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e, \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe qualified libraries were sequenced with PacBio sequencing platform, and SMRT Cell method was used to sequence marker genes in Biomarker Technologies Co.,Ltd, Beijing, China. To obtain the raw tags, paired-end reads were merged by FLASH (version 1.2.11 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://ccb.jhu.edu/software/FLASH/\u003c/span\u003e\u003c/span\u003e) [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. Tags with an average quality score\u0026thinsp;\u0026lt;\u0026thinsp;20 in a 50 bp sliding window were truncated using Trimmomatic (version 0.33) [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e], and tags shorter than 350 bp were removed. We identified possible chimeras by employing UCHIME (version 4.2) [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e], high-quality Tags sequences were obtained.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eStatistical and bioinformatics analysis\u003c/h2\u003e \u003cp\u003eThe plant nutrient content, yield and soil physiochemical properties and diversity indices were tested for differences among wetlands restoration with the one-way Analysis of Variance (ANOVA) using SPSS 23.0 for Windows (IBM SPSS Inc., USA). Significance differences were defined at p\u0026thinsp;\u0026lt;\u0026thinsp;0.05. Using OriginPro version 9.0 (OriginLab Corporation, Northampton, MA, United States) and R software (version 4.0.3) for drawing.\u003c/p\u003e \u003cp\u003eThe high-quality sequences were clustered using USEARCH (version 10.0), and tags with similarity\u0026thinsp;\u0026ge;\u0026thinsp;97% were regarded as OTUs.\u003c/p\u003e \u003cp\u003eThe high-quality sequences were clustered using USEARCH (version 10.0) [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e] and tags with similarity\u0026thinsp;\u0026ge;\u0026thinsp;97% were regarded as a OTU. Taxonomy was assigned to all OTUs by searching against the Silva databases (Release128, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.arb-silva.de\u003c/span\u003e\u003c/span\u003e) [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e], and the UNITE database (Release 8.1, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://unite.ut.ee/index.php\u003c/span\u003e\u003c/span\u003e) [\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e], and then were identified down to phylum, class, order, family and genus level using Ribosomal Database Project (RDP, version 2.2, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://sourceforge.net/projects/rdpclassifier/\u003c/span\u003e\u003c/span\u003e), the confidence threshold was 0.8.\u003c/p\u003e \u003cp\u003eAlpha diversity indices referring to community richness (Chao1) and community diversity (Shannon) were calculated by Mothur (version v.1.30, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.mothur.org/\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e \u003cp\u003ePICRUSt software (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://kiwi.cs.dal.ca/Software/STAMP\u003c/span\u003e\u003c/span\u003e) was used to predict the functional gene composition of the samples by comparing the species composition information obtained from 16S sequencing data, so as to analyze the functional differences between different samples or groups. Pair T-test was performed between different groups and the p-value was 0.05 [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]. Fungi Functional Guild (FUN Guild) was used to speculate the differential functional gene composition in bacterial and fungal samples to analyze the functional differences between different samples or groups.\u003c/p\u003e "},{"header":"Abbreviations","content":" \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Taba\" border=\"1\"\u003e \u003ccolgroup cols=\"2\"\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSM\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSole maize\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSole peanut\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSIM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eThe middle row of sole maize\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSIP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eThe middle row of sole peanut\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eIntercropping maize\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eIntercropping peanut\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eII\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eThe shared of intercropping maize and peanut\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMIM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eThe middle intercropping maize\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMIP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eThe middle intercropping peanut\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNitrate reductase\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePro\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eProtease\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePOD\u003c/p\u003e \u003cp\u003eDHO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePeroxidase\u003c/p\u003e \u003cp\u003eDehydrogenase\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGibberellin\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCTK\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCytokinin\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAuxin\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTN\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTotal nitrogen\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOTUs\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eOperational Taxonomic Units\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eKEGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKyoto Encyclopedia of Genes and Genomes\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e "},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments:\u003c/strong\u003e The research was supported by the China Agricultural Research System (CARS-13).\u0026nbsp;We thank\u0026nbsp;Lijun Zhang\u0026nbsp;for guidance in the paper.\u0026nbsp;We thank Pei Guo for drawing the simulated diagram in the paper.\u003c/p\u003e\n\u003ch3\u003eAuthor Contributions\u003c/h3\u003e\n\u003cp\u003eXZ and HY designed this study. QD and XZ conducted the data analysis and wrote the manuscript. YH, ZZ, YZ, YY, XY and KW carried out the field experiments. LS, and HZ helped data analysis. GW, JJ, BL and MZ revised the manuscript. All authors have read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u0026nbsp;\u003c/strong\u003eThis\u0026nbsp;study\u0026nbsp;was made possible by the China Agricultural Research System (CARS-13).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll raw sequences have been deposited into a NCBI Sequence Read Archive with the accession number PRJNA728390 (Bacteria) and PRJNA728391 (Fungi).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclarations\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eC\u003c/strong\u003e\u003cstrong\u003eompeting\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003ei\u003c/strong\u003e\u003cstrong\u003enterest\u003c/strong\u003e\u003cstrong\u003es\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare\u0026nbsp;no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor details\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e1\u003c/sup\u003e Peanut Research Institute, Shenyang Agricultural University, Shenyang 110161, China.\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e2\u003c/sup\u003e Shandong Peanut Research Institute, Qingdao 266100, Shandong, China.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eZhang Q, Chu Y, Xue Y, Ying H, Chen X, Zhao Y, Ma W, Ma L, Zhang J, Yin Y \u003cem\u003eet al\u003c/em\u003e: \u003cb\u003eOutlook of China's agriculture transforming from smallholder operation to sustainable production\u003c/b\u003e. \u003cem\u003eGlobal Food Security\u003c/em\u003e 2020, \u003cb\u003e26\u003c/b\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMisra P, Maji D, Awasthi A, Pandey SS, Yadav A, Pandey A, Saikia D, Babu CSV, Kalra A: \u003cb\u003eVulnerability of Soil Microbiome to Monocropping of Medicinal and Aromatic Plants and Its Restoration Through Intercropping and Organic Amendments\u003c/b\u003e. \u003cem\u003eFront Microbiol\u003c/em\u003e 2019, \u003cb\u003e10\u003c/b\u003e:2604.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang F, Liao D, Wu X, Gao R, Fan Y, Raza MA, Wang X, Yong T, Liu W, Liu J \u003cem\u003eet al\u003c/em\u003e: \u003cb\u003eEffect of aboveground and belowground interactions on the intercrop yields in maize-soybean relay intercropping systems\u003c/b\u003e. \u003cem\u003eField Crops Res\u003c/em\u003e 2017, \u003cb\u003e203\u003c/b\u003e:16\u0026ndash;23.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang R, Sun Z, Zhang L, Yang N, Feng L, Bai W, Zhang D, Wang Q, Evers JB, Liu Y \u003cem\u003eet al\u003c/em\u003e: \u003cb\u003eBorder-row proportion determines strength of interspecific interactions and crop yields in maize/peanut strip intercropping\u003c/b\u003e. \u003cem\u003eField Crops Res\u003c/em\u003e 2020, \u003cb\u003e253\u003c/b\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDu J-b, Han T-f, Gai J-y, Yong T-w, Sun X, Wang X-c, Yang F, Liu J, Shu K, Liu W-g \u003cem\u003eet al\u003c/em\u003e: \u003cb\u003eMaize-soybean strip intercropping: Achieved a balance between high productivity and sustainability\u003c/b\u003e. \u003cem\u003eJournal of Integrative Agriculture\u003c/em\u003e 2018, \u003cb\u003e17\u003c/b\u003e(4):747\u0026ndash;754.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDu Q, Zhou L, Chen P, Liu X, Song C, Yang F, Wang X, Liu W, Sun X, Du J \u003cem\u003eet al\u003c/em\u003e: \u003cb\u003eRelay-intercropping soybean with maize maintains soil fertility and increases nitrogen recovery efficiency by reducing nitrogen input\u003c/b\u003e. \u003cem\u003eThe Crop Journal\u003c/em\u003e 2020, \u003cb\u003e8\u003c/b\u003e(1):140\u0026ndash;152.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHe Y, Ding N, Shi J, Wu M, Liao H, Xu J: \u003cb\u003eProfiling of microbial PLFAs: Implications for interspecific interactions due to intercropping which increase phosphorus uptake in phosphorus limited acidic soils\u003c/b\u003e. \u003cem\u003eSoil Biol Biochem\u003c/em\u003e 2013, \u003cb\u003e57\u003c/b\u003e:625\u0026ndash;634.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun T, Zhao C, Feng X, Yin W, Gou Z, Lal R, Deng A, Chai Q, Song Z, Zhang W: \u003cb\u003eMaize-based intercropping systems achieve higher productivity and profitability with lesser environmental footprint in a water‐scarce region of northwest China\u003c/b\u003e. \u003cem\u003eFood and Energy Security\u003c/em\u003e 2020.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang D, Lyu Y, Li H, Tang X, Hu R, Rengel Z, Zhang F, Whalley WR, Davies WJ, Cahill JF, Jr. \u003cem\u003eet al\u003c/em\u003e: \u003cb\u003eNeighbouring plants modify maize root foraging for phosphorus: coupling nutrients and neighbours for improved nutrient-use efficiency\u003c/b\u003e. \u003cem\u003eNew Phytol\u003c/em\u003e 2019.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGong X, Dang K, Liu L, Zhao G, Lv S, Tian L, Jin F, Feng Y, Zhao Y, Feng B: \u003cb\u003eIntercropping combined with nitrogen input promotes proso millet (Panicum miliaceum L.) growth and resource use efficiency to increase grain yield on the Loess plateau of China\u003c/b\u003e. \u003cem\u003eAgric Water Manage\u003c/em\u003e 2021, \u003cb\u003e243\u003c/b\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFu Zd, Zhou L, Chen P, Du Q, Pang T, Song C, Wang Xc, Liu Wg, Yang Wy, Yong Tw: \u003cb\u003eEffects of maize-soybean relay intercropping on crop nutrient uptake and soil bacterial community\u003c/b\u003e. \u003cem\u003eJournal of Integrative Agriculture\u003c/em\u003e 2019, \u003cb\u003e18\u003c/b\u003e(9):2006\u0026ndash;2018.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMommer L, Kirkegaard J, van Ruijven J: \u003cb\u003eRoot-Root Interactions: Towards A Rhizosphere Framework\u003c/b\u003e. \u003cem\u003eTrends Plant Sci\u003c/em\u003e 2016, \u003cb\u003e21\u003c/b\u003e(3):209\u0026ndash;217.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo Z, Wan S, Hua K, Yin Y, Chu H, Wang D, Guo X: \u003cb\u003eFertilization regime has a greater effect on soil microbial community structure than crop rotation and growth stage in an agroecosystem\u003c/b\u003e. \u003cem\u003eApplied Soil Ecology\u003c/em\u003e 2020, \u003cb\u003e149\u003c/b\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Z-g, Bao X-g, Li X-f, Jin X, Zhao J-h, Sun J-h, Christie P, Li L: \u003cb\u003eIntercropping maintains soil fertility in terms of chemical properties and enzyme activities on a timescale of one decade\u003c/b\u003e. \u003cem\u003ePlant Soil\u003c/em\u003e 2015, \u003cb\u003e391\u003c/b\u003e(1\u0026ndash;2):265\u0026ndash;282.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen J, Arafat Y, Wu L, Xiao Z, Li Q, Khan MA, Khan MU, Lin S, Lin W: \u003cb\u003eShifts in soil microbial community, soil enzymes and crop yield under peanut/maize intercropping with reduced nitrogen levels\u003c/b\u003e. \u003cem\u003eApplied Soil Ecology\u003c/em\u003e 2018, \u003cb\u003e124\u003c/b\u003e:327\u0026ndash;334.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen Y, Bonkowski M, Shen Y, Griffiths BS, Jiang Y, Wang X, Sun B: \u003cb\u003eRoot ethylene mediates rhizosphere microbial community reconstruction when chemically detecting cyanide produced by neighbouring plants\u003c/b\u003e. \u003cem\u003eMicrobiome\u003c/em\u003e 2020, \u003cb\u003e8\u003c/b\u003e(1):4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKeiluweit M, Bougoure JJ, Nico PS, Pett-Ridge J, Weber PK, Kleber M: \u003cb\u003eMineral protection of soil carbon counteracted by root exudates\u003c/b\u003e. \u003cem\u003eNature Climate Change\u003c/em\u003e 2015, \u003cb\u003e5\u003c/b\u003e(6):588\u0026ndash;595.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCoskun D, Britto DT, Shi W, Kronzucker HJ: \u003cb\u003eHow Plant Root Exudates Shape the Nitrogen Cycle\u003c/b\u003e. \u003cem\u003eTrends Plant Sci\u003c/em\u003e 2017, \u003cb\u003e22\u003c/b\u003e(8):661\u0026ndash;673.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang S, Chen A, Xie K, Yang X, Luo Z, Chen J, Zeng D, Ren Y, Yang C, Wang L \u003cem\u003eet al\u003c/em\u003e: \u003cb\u003eFunctional analysis of the OsNPF4.5 nitrate transporter reveals a conserved mycorrhizal pathway of nitrogen acquisition in plants\u003c/b\u003e. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e 2020.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang L, Hou B, Zhang D, Lyu Y, Zhang K, Li H, Rengel Z, Shen J: \u003cb\u003eThe niche complementarity driven by rhizosphere interactions enhances phosphorus-use efficiency in maize/alfalfa mixture\u003c/b\u003e. \u003cem\u003eFood and Energy Security\u003c/em\u003e 2020, \u003cb\u003e9\u003c/b\u003e(4).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJensen ES, Carlsson G, Hauggaard-Nielsen H: \u003cb\u003eIntercropping of grain legumes and cereals improves the use of soil N resources and reduces the requirement for synthetic fertilizer N: A global-scale analysis\u003c/b\u003e. \u003cem\u003eAgronomy for Sustainable Development\u003c/em\u003e 2020, \u003cb\u003e40\u003c/b\u003e(1).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu Y-X, Sun J-H, Zhang F-F, Li L: \u003cb\u003eThe plasticity of root distribution and nitrogen uptake contributes to recovery of maize growth at late growth stages in wheat/maize intercropping\u003c/b\u003e. \u003cem\u003ePlant Soil\u003c/em\u003e 2019, \u003cb\u003e447\u003c/b\u003e(1\u0026ndash;2):39\u0026ndash;53.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFan Y, Wang Z, Liao D, Raza MA, Wang B, Zhang J, Chen J, Feng L, Wu X, Liu C \u003cem\u003eet al\u003c/em\u003e: \u003cb\u003eUptake and utilization of nitrogen, phosphorus and potassium as related to yield advantage in maize-soybean intercropping under different row configurations\u003c/b\u003e. \u003cem\u003eSci Rep\u003c/em\u003e 2020, \u003cb\u003e10\u003c/b\u003e(1):9504.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRaza MA, Bin Khalid MH, Zhang X, Feng LY, Khan I, Hassan MJ, Ahmed M, Ansar M, Chen YK, Fan YF \u003cem\u003eet al\u003c/em\u003e: \u003cb\u003eEffect of planting patterns on yield, nutrient accumulation and distribution in maize and soybean under relay intercropping systems\u003c/b\u003e. \u003cem\u003eSci Rep\u003c/em\u003e 2019, \u003cb\u003e9\u003c/b\u003e(1):4947.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou Q, Chen J, Xing Y, Xie X, Wang L: \u003cb\u003eInfluence of intercropping Chinese milk vetch on the soil microbial community in rhizosphere of rape\u003c/b\u003e. \u003cem\u003ePlant Soil\u003c/em\u003e 2019, \u003cb\u003e440\u003c/b\u003e(1\u0026ndash;2):85\u0026ndash;96.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTang X, Zhong R, Jiang J, He L, Huang Z, Shi G, Wu H, Liu J, Xiong F, Han Z \u003cem\u003eet al\u003c/em\u003e: \u003cb\u003eCassava/peanut intercropping improves soil quality via rhizospheric microbes increased available nitrogen contents\u003c/b\u003e. \u003cem\u003eBMC Biotechnol\u003c/em\u003e 2020, \u003cb\u003e20\u003c/b\u003e(1):13.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXue Y, Xia H, Christie P, Zhang Z, Li L, Tang C: \u003cb\u003eCrop acquisition of phosphorus, iron and zinc from soil in cereal/legume intercropping systems: a critical review\u003c/b\u003e. \u003cem\u003eAnn Bot\u003c/em\u003e 2016, \u003cb\u003e117\u003c/b\u003e(3):363\u0026ndash;377.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDiamantidis G, Effosse A, Potier P, Bally R: \u003cb\u003ePurification and characterization of the first bacterial laccase in the rhizospheric bacterium\u003c/b\u003e \u003cem\u003eAzospirillum lipoferum\u003c/em\u003e. \u003cem\u003eSoil Biology \u0026amp; Biochemistry\u003c/em\u003e 2000, \u003cb\u003e32\u003c/b\u003e:919\u0026ndash;927.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGao Z, Han M, Hu Y, Li Z, Liu C, Wang X, Tian Q, Jiao W, Hu J, Liu L \u003cem\u003eet al\u003c/em\u003e: \u003cb\u003eEffects of Continuous Cropping of Sweet Potato on the Fungal Community Structure in Rhizospheric Soil\u003c/b\u003e. \u003cem\u003eFront Microbiol\u003c/em\u003e 2019, \u003cb\u003e10\u003c/b\u003e:2269.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu Y, Yang F, Yang W, Wu F, Xu Z, Liu Y, Zhang L, Yue K, Ni X, Lan L \u003cem\u003eet al\u003c/em\u003e: \u003cb\u003eEffects of naphthalene on soil fauna abundance and enzyme activity in the subalpine forest of western Sichuan, China\u003c/b\u003e. \u003cem\u003eSci Rep\u003c/em\u003e 2019, \u003cb\u003e9\u003c/b\u003e(1):2849.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChae Y, Cui R, Woong Kim S, An G, Jeong SW, An YJ: \u003cb\u003eExoenzyme activity in contaminated soils before and after soil washing: ss-glucosidase activity as a biological indicator of soil health\u003c/b\u003e. \u003cem\u003eEcotoxicol Environ Saf\u003c/em\u003e 2017, \u003cb\u003e135\u003c/b\u003e:368\u0026ndash;374.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTang X, Zhang Y, Jiang J, Meng X, Huang Z, Wu H, He L, Xiong F, Liu J, Zhong R \u003cem\u003eet al\u003c/em\u003e: \u003cb\u003eSugarcane/peanut intercropping system improves physicochemical properties by changing N and P cycling and organic matter turnover in root zone soil\u003c/b\u003e. \u003cem\u003ePeerJ\u003c/em\u003e 2021, \u003cb\u003e9\u003c/b\u003e:e10880.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLeys NM, Ryngaert A, Bastiaens L, Verstraete W, Top EM, Springael D: \u003cb\u003eOccurrence and phylogenetic diversity of Sphingomonas strains in soils contaminated with polycyclic aromatic hydrocarbons\u003c/b\u003e. \u003cem\u003eAppl Environ Microbiol\u003c/em\u003e 2004, \u003cb\u003e70\u003c/b\u003e(4):1944\u0026ndash;1955.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou X, Wang Z, Jia H, Li L, Wu F: \u003cb\u003eContinuously Monocropped Jerusalem Artichoke Changed Soil Bacterial Community Composition and Ammonia-Oxidizing and Denitrifying Bacteria Abundances\u003c/b\u003e. \u003cem\u003eFront Microbiol\u003c/em\u003e 2018, \u003cb\u003e9\u003c/b\u003e:705.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang X, Song D, Liang G, Zhang Q, Ai C, Zhou W: \u003cb\u003eMaize biochar addition rate influences soil enzyme activity and microbial community composition in a fluvo-aquic soil\u003c/b\u003e. \u003cem\u003eApplied Soil Ecology\u003c/em\u003e 2015, \u003cb\u003e96\u003c/b\u003e:265\u0026ndash;272.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZeng J, Liu J, Lu C, Ou X, Luo K, Li C, He M, Zhang H, Yan H: \u003cb\u003eIntercropping With Turmeric or Ginger Reduce the Continuous Cropping Obstacles That Affect Pogostemon cablin (Patchouli)\u003c/b\u003e. \u003cem\u003eFrontiers in Microbiology\u003c/em\u003e 2020, \u003cb\u003e11\u003c/b\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSekar J, Raju K, Duraisamy P, Ramalingam Vaiyapuri P: \u003cb\u003ePotential of Finger Millet Indigenous Rhizobacterium Pseudomonas sp. MSSRFD41 in Blast Disease Management-Growth Promotion and Compatibility With the Resident Rhizomicrobiome\u003c/b\u003e. \u003cem\u003eFront Microbiol\u003c/em\u003e 2018, \u003cb\u003e9\u003c/b\u003e:1029.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChoudoir M, Rossabi S, Gebert M, Helmig D, Fierer N: \u003cb\u003eA Phylogenetic and Functional Perspective on Volatile Organic Compound Production by Actinobacteria\u003c/b\u003e. \u003cem\u003emSystems\u003c/em\u003e 2019, \u003cb\u003e4\u003c/b\u003e(2):e00295-00218.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu H, Pan F-j, Han X-z, Song F-b, Zhang Z-m, Yan J, Xu Y-l: \u003cb\u003eA comprehensive analysis of the response of the fungal community structure to long-term continuous cropping in three typical upland crops\u003c/b\u003e. \u003cem\u003eJournal of Integrative Agriculture\u003c/em\u003e 2020, \u003cb\u003e19\u003c/b\u003e(3):866\u0026ndash;880.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi W-h, Liu Q-z: \u003cb\u003eChanges in fungal community and diversity in strawberry rhizosphere soil after 12 years in the greenhouse\u003c/b\u003e. \u003cem\u003eJournal of Integrative Agriculture\u003c/em\u003e 2019, \u003cb\u003e18\u003c/b\u003e(3):677\u0026ndash;687.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun Z-c, Li G-t, Zhang C-l, Wang Z-m, Lin Q-m, Zhao X-r: \u003cb\u003eContrasting resilience of soil microbial biomass, microbial diversity and ammonification enzymes under three applied soil fumigants\u003c/b\u003e. \u003cem\u003eJournal of Integrative Agriculture\u003c/em\u003e 2020, \u003cb\u003e19\u003c/b\u003e(10):2561\u0026ndash;2570.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMiao CP, Mi QL, Qiao XG, Zheng YK, Chen YW, Xu LH, Guan HL, Zhao LX: \u003cb\u003eRhizospheric fungi of Panax notoginseng: diversity and antagonism to host phytopathogens\u003c/b\u003e. \u003cem\u003eJ Ginseng Res\u003c/em\u003e 2016, \u003cb\u003e40\u003c/b\u003e(2):127\u0026ndash;134.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi R, Shen Z, Sun L, Zhang R, Fu L, Deng X, Shen Q: \u003cb\u003eNovel soil fumigation method for suppressing cucumber Fusarium wilt disease associated with soil microflora alterations\u003c/b\u003e. \u003cem\u003eApplied Soil Ecology\u003c/em\u003e 2016, \u003cb\u003e101\u003c/b\u003e:28\u0026ndash;36.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin W-p, Jiang N-h, Peng L, Fan X-y, Gao Y, Wang G-p, Cai K-z: \u003cb\u003eSilicon impacts on soil microflora under Ralstonia Solanacearum inoculation\u003c/b\u003e. \u003cem\u003eJournal of Integrative Agriculture\u003c/em\u003e 2020, \u003cb\u003e19\u003c/b\u003e(1):251\u0026ndash;264.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePhillips LA, Ward V, Jones MD: \u003cb\u003eEctomycorrhizal fungi contribute to soil organic matter cycling in sub-boreal forests\u003c/b\u003e. \u003cem\u003eISME J\u003c/em\u003e 2014, \u003cb\u003e8\u003c/b\u003e(3):699\u0026ndash;713.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Q, Chen J, Wu L, Luo X, Li N, Arafat Y, Lin S, Lin W: \u003cb\u003eBelowground Interactions Impact the Soil Bacterial Community, Soil Fertility, and Crop Yield in Maize/Peanut Intercropping Systems\u003c/b\u003e. \u003cem\u003eInt J Mol Sci\u003c/em\u003e 2018, \u003cb\u003e19\u003c/b\u003e(2).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu F, Ju Y, Wang W, Wang Q, Guo R, Ma Q, Sun Q, Fan Y, Xie Y, Yang Z \u003cem\u003eet al\u003c/em\u003e: \u003cb\u003eMetagenome-wide association of gut microbiome features for schizophrenia\u003c/b\u003e. \u003cem\u003eNat Commun\u003c/em\u003e 2020, \u003cb\u003e11\u003c/b\u003e(1):1612.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang F, Sun J, Luo H, Ren H, Zhou H, Lin Y, Han M, Chen B, Liao H, Brix S \u003cem\u003eet al\u003c/em\u003e: \u003cb\u003eAssessment of fecal DNA extraction protocols for metagenomic studies\u003c/b\u003e. \u003cem\u003eGigascience\u003c/em\u003e 2020, \u003cb\u003e9\u003c/b\u003e(7).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMagoc T, Salzberg SL: \u003cb\u003eFLASH: fast length adjustment of short reads to improve genome assemblies\u003c/b\u003e. \u003cem\u003eBioinformatics\u003c/em\u003e 2011, \u003cb\u003e27\u003c/b\u003e(21):2957\u0026ndash;2963.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBolger AM, Lohse M, Usadel B: \u003cb\u003eTrimmomatic: a flexible trimmer for Illumina sequence data\u003c/b\u003e. \u003cem\u003eBioinformatics\u003c/em\u003e 2014, \u003cb\u003e30\u003c/b\u003e(15):2114\u0026ndash;2120.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEdgar RC, Haas BJ, Clemente JC, Quince C, Knight R: \u003cb\u003eUCHIME improves sensitivity and speed of chimera detection\u003c/b\u003e. \u003cem\u003eBioinformatics\u003c/em\u003e 2011, \u003cb\u003e27\u003c/b\u003e(16):2194\u0026ndash;2200.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEdgar RC: \u003cb\u003eUPARSE: highly accurate OTU sequences from microbial amplicon reads\u003c/b\u003e. \u003cem\u003eNat Methods\u003c/em\u003e 2013, \u003cb\u003e10\u003c/b\u003e(10):996\u0026ndash;998.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Q, Garrity GM, Tiedje JM, Cole JR: \u003cb\u003eNaive Bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy\u003c/b\u003e. \u003cem\u003eAppl Environ Microbiol\u003c/em\u003e 2007, \u003cb\u003e73\u003c/b\u003e(16):5261\u0026ndash;5267.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCaporaso JG, Bittinger K, Bushman FD, DeSantis TZ, Andersen GL, Knight R: \u003cb\u003ePyNAST: a flexible tool for aligning sequences to a template alignment\u003c/b\u003e. \u003cem\u003eBioinformatics\u003c/em\u003e 2010, \u003cb\u003e26\u003c/b\u003e(2):266\u0026ndash;267.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eParks DH, Tyson GW, Hugenholtz P, Beiko RG: \u003cb\u003eSTAMP: statistical analysis of taxonomic and functional profiles\u003c/b\u003e. \u003cem\u003eBioinformatics\u003c/em\u003e 2014, \u003cb\u003e30\u003c/b\u003e(21):3123\u0026ndash;3124.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"bmc-microbiology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mcro","sideBox":"Learn more about [BMC Microbiology](http://bmcmicrobiol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/mcro","title":"BMC Microbiology","twitterHandle":"#bmcmicrobiology","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"maize, peanut, wide-strip intercropping, nitrogen content, 16S/ ITS, soil enzyme ","lastPublishedDoi":"10.21203/rs.3.rs-643717/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-643717/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground:\u003c/strong\u003e Intercropping, a diversified planting pattern is currently the subject of major global research, but uncertainty remains about the rhizosphere interaction of intercropped maize and peanut, which increases nitrogen uptake. We explored the changes in soil physicochemical properties, nutrient uptake and use, and microbial community structure in wide-strip intercropped maize and peanut. \u003c/p\u003e\u003cp\u003e\u003cstrong\u003eResults:\u003c/strong\u003e The results from three treatments, sole maize (SM), sole peanut (SP) and intercropping of maize and peanut (IMP), showed that intercropping maize (IM) had a marginal advantage and that the nutrient content of roots, stems and grains in side-row maize was better than that of middle intercropping maize (MIM) and SM. And the yield of intercropped maize was higher than sole cropping. Compared with SM and SP, the soil nitrogen content (TN) in IM and intercropping peanut (IP) was lower and increased the soil enzyme activities of nitrate reeducates (NR) and peroxidase (POD), showing a significant negative correlation with soil TN. And decreased the soil enzymes activities of Pro and DHO, showing a positively correlation with soil TN. The diversity and richness of bacteria and fungi was decreased in IM rhizosphere soil, however, that richness of fungi was increased in IP rhizosphere soil. The \u003cem\u003eRB41\u003c/em\u003e, \u003cem\u003eCandidatus-udaeobacter, Stropharia\u003c/em\u003e, \u003cem\u003eFusarium\u003c/em\u003e and \u003cem\u003ePenicillium\u003c/em\u003e were correlated with soil enzyme activity. In addition, intercropping enriched the functional diversity of bacterial community and reduced the pathogenic fungi. \u003c/p\u003e\u003cp\u003e\u003cstrong\u003eConclusion:\u003c/strong\u003e IMP changed the rhizosphere soil bacterial and fungal community structure and composition, enriched nitrogen-fixing bacteria in the IP rhizosphere soil, promoted the nitrogen content of IM and provided a scientific basis for promoting IMP in northeastern China.\u0026nbsp;\u003c/p\u003e","manuscriptTitle":"Enhanced Nutrient Uptake in Side-Row Maize and Improved Microbial Community Diversity in Wide-Strip Intercropping of Maize and Peanut","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2021-06-24 19:11:16","doi":"10.21203/rs.3.rs-643717/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major revision","date":"2021-09-06T09:52:49+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2021-09-03T06:41:28+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"e46129bb-6722-4f95-9ddb-6eb6ab67ac8f","date":"2021-07-16T10:38:45+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2021-07-11T11:57:48+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"8172bfb3-17b7-4d6e-b9fd-4becab7f767d","date":"2021-06-29T15:52:27+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2021-06-28T08:47:27+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2021-06-23T02:42:21+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2021-06-23T02:37:11+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2021-06-23T02:33:21+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Microbiology","date":"2021-06-21T01:34:48+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"bmc-microbiology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mcro","sideBox":"Learn more about [BMC Microbiology](http://bmcmicrobiol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/mcro","title":"BMC Microbiology","twitterHandle":"#bmcmicrobiology","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"8e5652f9-1de9-4cc0-82f7-0b1cef8339a7","owner":[],"postedDate":"June 24th, 2021","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":5242297,"name":"General Microbiology"},{"id":5242298,"name":"Applied \u0026 Industrial Microbiology"}],"tags":[],"updatedAt":"2021-12-13T05:29:09+00:00","versionOfRecord":[],"versionCreatedAt":"2021-06-24 19:11:16","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-643717","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-643717","identity":"rs-643717","version":["v1"]},"buildId":"WrCJVZZCHTDjtuVLN7oU0","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.