Impact of gastrointestinal inoculation and benznidazole treatment on Trypanosoma cruzi II infection in mice | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Impact of gastrointestinal inoculation and benznidazole treatment on Trypanosoma cruzi II infection in mice Hevillyn Fernanda Lucas da Silva, Marcella Paula Mansano Sarto, and 7 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-2239490/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract The protozoan Trypanosoma cruzi causes Chagas disease and the most frequent form of transmission of the parasite is the oral route, associated with greater severity and worse response to benznidazole (BZ), the drug used in its treatment. This study aimed to evaluate the impact of gastrointestinal infection (GI) and BZ treatment on the histopathological alterations in mice inoculated with T. cruzi II. Swiss mice were inoculated by GI and intraperitoneal (IP) routes with 2x10 6 culture-derived metacyclic trypomastigotes of the Y strain (TcII) of T. cruzi and were treated with BZ in the acute phase of the infection. Fresh blood examination, qPCR, histopathological and biochemical evaluations (enzymatic dosages and oxidative stress-OS) were performed. BZ treatment of uninfected animals caused changes in the liver, increased the activity of AST and ALT enzymes and OS, showing that the drug alone affects this organ. Inflammation and necrosis in the cardiac tissue were less intense and deaths occurred later in animals inoculated via the GI route than the animals inoculated via the IP route. BZ reduced the intensity of tissue lesions and avoided lethality in animals inoculated via the GI route, and decreased parasitemia and OS in those inoculated via both routes. Although BZ alone caused liver damage, it was less intense than that caused by both routes of inoculation. Infection with the Y strain of T. cruzi II via the GI route proved to be less virulent and pathogenic and responded better to treatment than the infection acquired via the IP route. Trypanosoma cruzi oral Chagas disease benznidazole qPCR aminotransferases oxidative stress Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Trypanosoma cruzi is a hemoflagellate protozoan, belonging to the order Kinetoplastida and family Trypanosomatidae, which is the etiologic agent of Chagas disease (CD), also known as American trypanosomiasis [ 1 ]. Approximately 6 to 7 million people worldwide are currently infected with T. cruzi , particularly in Latin American countries [ 2 ]. The prevalence of CD is higher in countries where the vector transmission of T. cruzi occurs, whether in the classic form, after the blood meal of a triatomine bug, or by ingesting food contaminated with the crushed vector and/or its feces [ 3 ]. Oral transmission, although accidental, has emerged as the main form of transmission of CD in Brazil, accounting for 75% of new cases [ 4 ]. The majority of patients (95 to 98%) in the acute phase of CD are asymptomatic [ 5 ]. However, myocarditis and meningoencephalitis can occur, leading to death, especially in children. Other symptoms can include fever, lymphadenopathy, and hepatosplenomegaly. During the chronic phase, 50–70% of infected patients are asymptomatic (indeterminate form), 25–30% have the cardiac form, and 12 to 15% have digestive manifestations [ 6 ]. T. cruzi has widely heterogeneous populations, consisting of a variety of strains that circulate in the domestic and wild transmission cycles between insect vectors, humans, and animal reservoirs [ 7 , 8 ]. The genetic lineages of the parasite are classified into six discrete typing units (DTUs), from TcI to TcVI [ 9 ]. Although a seventh DTU, TcBat, was recently described, after it was isolated from bats, which was subsequently found to be capable of infecting humans. These DTUs may have different geographic distributions and are associated with different clinical and epidemiological features. TcII, for example, is often isolated from the blood of chronic patients and is associated with the domestic cycle of transmission in the countries of the Southern Cone of South America, where cardiac manifestations of the disease predominate, but digestive manifestations are also found [ 10 ]. Oral transmission is probably the oldest strategy for the spread of T. cruzi among mammals. However, the intraperitoneal (IP) inoculation route is the most used in experimental in vivo infection, mainly in mice. Among the factors related to the parasite that can influence the evolution of the experimental infection are the origin of trypomastigotes (infective forms), in that they can either be isolated from blood or culture, the inoculation route, inoculum volume and concentration, and the parasite DTU [ 11 ]. T. cruzi strains may present differentiated tissue tropism, being classified as myotropic, preferentially parasitizing muscle tissue; or macrophagotropic, when they parasitize lymphoid organs. The latter is the case of the Y and Berenice 62 strains of T. cruzi , which, in addition to the myocardium, have been reported to cause intense tissue parasitism in the liver and spleen of Swiss mice inoculated via the IP route with 100,000 blood trypomastigotes (BT) [ 12 ]. On the other hand, it was observed that during the acute phase of the experimental infection of BALB/c mice with 1,000 BT of the Y strain (inoculation route not described), although amastigote forms were rarely found in the liver, the inflammation was commonly observed, indicating that this organ is also affected, even with a lower parasite inoculum [ 13 ]. The parasite is exposed to reactive oxygen species generated by its own aerobic metabolism, the host's immune response, and those released by drugs used in the treatment of CD [ 14 ]. Thus, T. cruzi infection can lead to tissue oxidative stress (OS), which, associated with toxic parasite secretions and a cytotoxic immune response, can contribute to tissue destruction [ 15 ]. In the blood of BALB/c mice orally inoculated with the Tulahuén (TcVI) strain, but not treated with BZ, an increase in AST and ALT enzymes was observed [ 3 ]. These authors also found that in infections via the oral or gastrointestinal (GI) routes, the stimulated immune response can lead to a more severe infection compared to the IP route, affecting the heart and, more intensely, the liver of the animal. The drug used for the etiological treatment of CD is benznidazole (BZ), a nitroheterocyclic derivative that has low efficacy during the chronic phase and important adverse reactions, in addition to alterations in liver enzymes that can be indicative of tissue damage [ 16 ]. It has already been demonstrated, experimentally in vivo , that the response to treatment with BZ can vary according to the genotype of T. cruzi [ 17 , 18 ], as well as its DTU [ 19 , 20 , 21 ]. In addition to altering aspartate aminotransferase (AST) and alanine aminotransferase (ALT) levels, BZ treatment of mice that had been infected IP with an inoculum as low as 500 BT caused a further increase in OS [ 22 ]. We hypothesize that GI infection with the Y strain (TcII) of T. cruzi is more severe, in terms of virulence and pathogenicity for mice, and responds worse to treatment with BZ, than the infection via the IP route. Given the above, we aimed to investigate the impact of the parasite inoculation route (GI and IP), and treatment with BZ, in the experimental infection of Swiss mice with the Y strain (TcII, macrophagotropic) of T. cruzi during the acute phase of the infection, using parasitological (parasitemia and parasite load detected by qPCR), biochemical (dosage of liver enzymes and OS), and histopathological parameters in the evaluation of the animals. Results • Infectiousness and survival Mice inoculated with 2x10 6 culture-derived metacyclic trypomastigotes (CMT) of the Y strain of T. cruzi (TcII) presented 100% of infectivity rate (%INF), when infected by either the GI or IP routes (data not shown). During the acute phase of the infection, the survival rate of infected animals, both GI and IP, and not treated with BZ, was 50%. However, as can be seen in the Kaplan-Meier graph, the deaths of animals inoculated by the GI route occurred later, indicating lower virulence by this inoculation route ( p = 0.007) (Fig. 1 ). Treatment with BZ avoided lethality in animals inoculated by both routes, during the period of the experiments. • Parasitological And Molecular Parameters The mean parasitemia curves of animals inoculated by both routes (GI and IP) are shown in Fig. 2 a. The untreated (NT) animals, inoculated via the GI route, had parasitemia levels three times lower than those inoculated via the IP route, in addition to a later day of maximum parasitemia peak (Dpmax, 13th day of infection), when compared to the IP-inoculated animals, whose maximum peak (Pmax) occurred on the 8th day of infection (d.i.) (Fig. 2 a). Regarding the other parasitological parameters derived from the parasitemia curve and obtained from the fresh blood examination (FBE) [pre-patent period (PPP), patent period (PP), Pmax, and the percentage of animals with a positive FBE (%+FBE)], and molecular parameters [percentage of mice with positive real-time polymerase chain reaction (%+qPCR) and the mean parasite load], in the comparison between NT animals inoculated via the GI and via the IP routes, significant differences were observed in three parameters (Table 1 and Fig. 2 a). In animals inoculated via the GI route, only the PPP was higher than in the IP-inoculated animals, indicating lower virulence of the infection via the GI route, since the higher the PPP, the lower the virulence. Table 1 Statistical comparisons (mean and standard deviation) of the parasitological and molecular parameters of mice inoculated via the gastrointestinal (GI) and intraperitoneal (IP) routes with 2x10 6 culture-derived metacyclic trypomastigotes of the Y strain (TcII) of Trypanosoma cruzi , treated with benznidazole (BZ 100 mg/kg/day, 20X) from the 5th day of infection, and in untreated controls (NT). GI IP Parameter NT BZ p NT BZ p PPP A (days) 9.5 ± 1.4 * AP G < 0.001 4.1 ± 0.6 * 3.6 ± 0.5 NS PP B (days) 11.6 ± 2.0 ** AP < 0.001 14.3 ± 3.3 ** 2.6 ± 0.5 < 0.001 Pmax C (x10 ³) 75.7 ± 26.4 * AP < 0.001 250.9 ± 154.7 * 5.7 ± 1.3 < 0.001 Dpmax D 13.2 ± 2.3 AP < 0.001 10.3 ± 3.1 4.6 ± 0.5 < 0.001 %+FBE E 100.0 (10/10) AP ≤ 0.05 100.0 (10/10) 20.0 (2/10) ≤ 0.05 %+qPCR F 100.0 (5/5) 100.0 (6/6) NS H 100.0 (3/3) 100.0 (5/5) NS Number of significant reductions 5/6 4/6 A Pre-patent period; B Patent period; C Number of trypomastigotes / 0.1 mL of blood at parasitemia peak; D day of the maximum peak; E Percentage of animals with positive fresh blood examination; F Percentage of animals with positive qPCR; G Absent parasitemia; H Not significant. When comparing the inoculation routes of NT animals, values with * ( p < 0.001 ) and ** ( p ≤ 0.05 ) on the same line are significantly different. The nonparametric Mann-Whitney test was used. The %+FBE and %+qPCR were 100% for animals infected by both routes and not treated (Table 1 ). In untreated animals, the parasite load was 0.6 equivalent parasites (par. eq.) per mL of blood for those inoculated via the GI route and 2.3 par. eq./mL for those inoculated via IP route, with no statistically significant difference between the groups (Fig. 2 b). • Impact Of Etiological Treatment On Parasitological And Molecular Parameters The parasitemia of animals inoculated both by the GI and IP routes was suppressed by the treatment with BZ from the first day of treatment (Fig. 2 a). In animals inoculated via the GI route, BZ treatment promoted a significant reduction in 5/6 parasitological parameters (PPP, PP, Pmax, Dpmax, and %+FBE), while in those inoculated via the IP route, the reduction occurred in 4/6 (PP, Pmax, Dpmax, and %+FBE) (Table 1 ). The qPCR was positive in all animals inoculated via both the GI and IP routes, and in both the treated and untreated groups (Table 1 ), with the BZ treatment not significantly altering the parasite load of animals (Fig. 2 b). • Histopathological Parameters In Cardiac Tissue Amastigote nests were not observed in the histological sections of cardiac tissue of infected animals in any of the groups, which were submitted to euthanasia on the 47th d.i. Except for the animals in the uninfected and untreated (NI) (Fig. 3 a) group, inflammatory processes were observed in all other experimental groups, including the animals of the uninfected group that were treated with BZ (NI + BZ) (Fig. 3 b, 3 c, 3 d, 3 e and 3 f). No animal in the NI group had cardiac tissue damage (Fig. 3 a and 3 g). A moderate inflammatory process was observed in 83.33% (5/6) of the animals in the infected via GI route and untreated (GINT) group (Fig. 3 g), with focal epicarditis and myocarditis (Fig. 3 b), while an intense inflammatory process was observed in 100% (2/2) of the surviving animals in the infected via IP route and untreated (IPNT) group (Fig. 3 g), with diffuse myocarditis, necrotic cardiac fibers, areas of myocardial fibrosis, and connective tissue deposition as the initial form of the healing process (Fig. 3 c). The animals in the GINT group presented mild (50%; 3/6) to moderate necrosis (33.3%; 2/6), while the two survivors (100%) in the IPNT group presented intense necrotic tissue. Five (83.3%) animals in the GINT group had mild fibrotic tissue, while the other (16.6%) had moderate fibrotic tissue, whereas the two surviving animals in the IPNT group had intense fibrotic tissue ( p < 0.05) (Fig. 3 g). Although these changes were observed in animals infected by both routes and not treated, they were more intense (+++) in animals from the surviving IPNT group (Fig. 3 g). • Histopathological Parameters Of Liver Tissue Histological analysis of the liver of NI animals showed normal morphology with hepatocytes organized in well-defined cell strands, as expected (Fig. 4 a). In the liver of animals infected both by the GI and IP routes and not treated, amastigote forms were also not detected. However, focal inflammatory processes were observed in the liver parenchyma and the periphery of the portal triad region (Fig. 4 b) and, in some cases, of the central vein (Fig. 4 c). Animals of the GINT group displayed a focus of hepatitis with intensity ranging from mild (4/6; 66.6%) to moderate (2/6; 33.3%), while in those of the IPNT group, focal hepatitis was classified as intense in the two surviving animals (100%) (Fig. 4 g). Although no statistical differences were observed between untreated animals inoculated via the GI and IP routes, in the animals of the GINT group, necrotic tissue was not observed, and 100% (6/6) of them had mild fibrotic tissue. On the other hand, the two surviving animals in the IPNT group had moderate necrotic tissue (100%) and fibrotic tissue ranging from moderate (1/2; 50%) to intense (1/2; 50%). • Impact Of Etiological Treatment On Histopathological Lesions The animals in the uninfected but BZ-treated group had a mild inflammatory process in the heart (Fig. 3 d), with a significant difference ( p < 0.05) compared to the animals in the NI group (Fig. 3 g). When comparing the hearts of animals in the infected and BZ-treated groups with their respective untreated controls, for each inoculation route, significant differences were observed only between the GI-inoculated animals, regarding inflammatory process and necrotic tissue (Fig. 3 g). Treatment with BZ promoted a significant reduction ( p < 0.05) in the intensity of the inflammatory process with 6/6 (100%) of the infected via GI route and treated (GI + BZ) animals presenting a mild inflammatory process (Fig. 3 e), against 5/6 (83.3%) and 1/6 (16.6%) of the GINT group that presented a moderate or an intense inflammatory process, respectively (Fig. 3 g). The treatment of GI-inoculated animals also promoted a significant reduction ( p < 0.05) in the number of animals with necrotic tissue and the intensity of these lesions, with no animal in the GI + BZ group presenting necrotic tissue against 3/6 (50.0%) with moderate and 2/6 (33.3%) with mild necrotic tissue in the untreated group (GINT) (Fig. 3 g). Therefore, treatment with BZ promoted benefits in animals that had been infected via the GI route. On the other hand, due to the high mortality caused by IP infection route, the number of animals remaining for evaluation in both IP groups was reduced, infected via IP route and treated (IP + BZ) (n = 4) and IPNT (n = 2). Thus, no significant differences were observed regarding heart lesions, between treated and untreated animals, inoculated by the IP route (Fig. 3 g). The liver tissue of uninfected animals that had been submitted to treatment with BZ presented a mild inflammatory process (Fig. 4 d- red arrow) in 3/5 (60%) animals and moderate inflammatory process in 1/5 (20%) of the animals evaluated, with a significant difference ( p < 0.05) in relation to the NI group, indicating that there was tissue damage in the liver caused by BZ (Fig. 4 g), with greater intensity than that observed in the cardiac tissue. Regarding the histopathological lesions of the liver, there were no significant differences between the animals infected by both routes and treated with BZ (Fig. 4 e and 4 f) and their respective untreated controls (Fig. 4 b and 4 c). Although without a statistical difference, the BZ treatment of the animals inoculated via the GI route apparently promoted an increase in the intensity of the lesions compared to the untreated animals (Fig. 4 e). The opposite occurred with the treatment of animals inoculated by the IP route (Fig. 4 f). Since only two animals in the IPNT group survived, suggesting greater lethality of the CMT forms of the Y strain (TcII) when inoculated by the IP route, the small number (n) of animals in this group interfered in the result of the statistical analyses. In animals infected with the macrophagotropic Y strain, these data suggest that BZ may increase the intensity of lesions in the liver (Fig. 4 g), the organ where it is metabolized, promoting fewer benefits for the GI infection compared to IP infection, and differently from what was observed in the heart (Fig. 3 g). • Biochemical Parameters The results of the measurements of plasma liver enzymes and hepatic OS from the different experimental groups are shown in Table 2 . In NT animals infected via the GI route, the enzymes AST and ALT, but not alkaline phosphatase (ALP), presented higher values ( p ≤ 0.05) than the NI animals. In NT animals infected via the IP route, only the ALT enzyme showed a significant change ( p ≤ 0.05) compared to NI animals (Table 2 ). These results show that infection, mainly via the GI route, promotes an increase in liver enzymes. Table 2 Plasma markers and oxidative stress parameters of liver injury in mice inoculated via the gastrointestinal (GI) and intraperitoneal (IP) routes with 2x10 6 culture-derived metacyclic trypomastigotes/animal of the Y strain (TcII) of Trypanosoma cruzi , treated with benznidazole (BZ) (100 mg/kg/day, 20X), and untreated controls. Data are the mean ± standard error of 3–6 animals. Experimental groups Parameters NI NI + BZ GINT GI + BZ IPNT IP + BZ Plasma parameters of liver damage (U·L − 1 ) AST 70.9 ± 5.0 97.5 ± 7.6 * 140.0 ± 9.8 * 91.7 ± 8.3 ** 93.7 ± 12.8 82.9 ± 4.7 ALT 51.1 ± 4.4 94.7 ± 6.3 * 81.6 ± 5.3 * 61.1 ± 4.3 ** 76.0 ± 9.1 * 43.2 ± 3.9 ** ALP 143.7 ± 12.0 132.7 ± 12.5 124.4 ± 13.3 157.5 ± 13.4 212.8 ± 31.6 210.6 ± 27.8 Hepatic oxidative stress parameters GSH (nmol·mg − 1 ) 8.24 ± 0.11 * 6.02 ± 0.65 * 3.47 ± 0.35 ** 6.19 ± 0.72 * 6.12 ± 0.21 * 7.80 ± 0.63 * Catalase (mmol·min − 1 ·mg − 1 ) 0.26 ± 0.03 0.43 ± 0.04 0.39 ± 0.04 0.34 ± 0.05 0.33 ± 0.03 0.29 ± 0.05 Carbonyl groups (nmol·mg − 1 ) 2.60 ± 0.14 * 3.87 ± 0.20 ** 3.46 ± 0.28 ** 3.95 ± 0.1 ** 3.98 ± 0.12 ** 3.21 ± 0.09 *,** NI, uninfected; NI + BZ, uninfected and treated; GINT, inoculated via the gastrointestinal (GI) route and untreated; GI + BZ, inoculated via the GI route and treated; IPNT, inoculated via the intraperitoneal (IP) route and untreated; IP + BZ, inoculated via the IP route and treated. GSH, Reduced glutathione. For plasma parameters of liver damage: values with * are different from NI; and ** are different from NT, within the same route ( p ≤ 0.05 ). For hepatic OS parameters, values with different symbols (* and **), on the same row, are different ( p ≤ 0.05 ). In the liver OS parameters of NT animals, only infection via the GI route resulted in decreased levels of reduced glutathione (GSH), which means an increase in tissue OS in this condition. Infection both by the GI and IP routes caused an increase in protein carbonyl groups, suggesting an increase in tissue injury (Table 2 ). • Impact Of Etiological Treatment On Biochemical Parameters In the plasma parameters of liver damage, treatment with BZ in uninfected animals (NI + BZ group) caused a significant increase ( p ≤ 0.05) in the levels of AST and ALT enzymes, showing that the drug, by itself, affects the liver (Table 2 ). Treatment with BZ, however, reduced the AST enzyme level in animals infected via the GI route, and ALT in animals infected by both routes, showing that the treatment reversed the effects of infection and promoted some benefits (Table 2 ). For the ALP enzyme, there was no significant alteration caused either by the infection or the drug. In the analysis of the OS parameters, it was observed that BZ caused a significant increase only in the carbonyl groups of proteins for the animals in the NI + BZ group (Table 2 ). For animals infected via the GI route, a significant increase in GSH was observed in treated animals compared to GINT (Table 2 ). In the animals infected via the IP route, although BZ promoted a significant reduction in the carbonyl groups, the values of this parameter did not return to the level of NI animals. Discussion Despite the wide diversity in T. cruzi strains and DTUs, the Y strain of T. cruzi , belonging to the DTU TcII, is one of the most used in experimental studies around the world. Initially, in the treatment with BZ and nifurtimox of Swiss mice inoculated via the IP route with BT forms, the Y strain was considered partially resistant to drugs in vivo , since around 50% of treated animals were not considered cured [ 23 , 24 ]. However, in these studies, the authors did not use cyclophosphamide (Cy) immunosuppression or the qPCR technique to monitor the cure of animals undergoing etiological treatment. In the current study, in which stricter cure criteria was used, we obtained a cure rate of 0% in Swiss animals inoculated with the Y strain by both the GI and IP routes with the same inoculum and treated with the same BZ regime. This T. cruzi strain should therefore be considered resistant to BZ, since no animal treated was cured, which is corroborated by the literature when similar cure criteria was used [ 25 ]. In the present study, the infection of mice with CMT of the Y strain (TcII) by both inoculation routes (GI and IP) caused 50% mortality in these animals within the experimental period. However, deaths occurred later in the animals inoculated via the GI route, suggesting a lower severity of this inoculation route for this T. cruzi strain. Nonetheless, this needs to be verified with other strains of the same DTU. Dias et al. [ 11 ], using trypomastigotes of the same origin and strain, and in the same inoculum, in the infection of animals, also found no differences in the mortality rate between the two inoculation routes; however, they observed mortality rates higher than those in the present study: 90% and 100%, respectively, for the GI and IP routes. Differences in the maintenance time of the strain in the culture medium, before inoculation of the animals, can lead to differences in its infectivity and lethality for mice. However, in the current study, BZ prevented lethality in the infection by both routes, even though the mice were not parasitologically cured by the etiological treatment, which is similar to that which was observed in the study of Zanusso Jr et al. [ 25 ]. When comparing the parasitological parameters between the routes (GI x IP), the levels of parasitemia were about three times lower following inoculation by the GI route compared to the IP route, suggesting lower virulence of the Y strain via the GI route. These data corroborate the histopathological findings observed in the cardiac tissue of these animals, in which an inflammatory process (epicarditis and myocarditis), necrotic cardiac fibers, and a healing process (tissue fibrosis) of lower intensity were observed in animals inoculated via the GI route when comparing with the animals inoculated via the IP route. Animals infected via the GI route also had higher PPP and lower parasite compared to those inoculated by the IP route, although the difference in parasite load was not significant, due to the low number of animals (3/6) surviving in the group infected via the IP route (Fig. 2 b). Blood samples used to determine parasite load by qPCR were collected on the 27th d.i., which corresponds to the beginning of the chronic phase in the experimental infection. Dias et al. [ 11 ] also observed lower virulence for mice infected with CMT of the Y strain via the GI route compared to the IP route, when considering the parameters PPP, PP, and maximum peak of parasitemia. When evaluating the impact of BZ treatment on parasitological parameters derived from the parasitemia curve (PPP, PP, Pmax, and Dpmax) and %+FBE, as well as %+qPCR, a significant reduction was observed in 4/6 parameters, in animals infected by both the GI and IP routes. In addition, BZ suppressed the parasitemia in animals infected by both inoculation routes evaluated (GI and IP) during the entire course of treatment, which is in agreement with the literature, where a cure rate of 50% has been reported for IP-inoculated animals [ 23 , 24 ], and 0 to 12.5% for GI-inoculated animals [ 25 ] for the Y strain infection. In other words, parasitemia is suppressed by treatment with BZ, even in mice infected via the GI route despite lower rates of cure. However, in the present study no significant differences were observed in the parasite load between the inoculation routes or between treated animals and untreated controls. Important adverse reactions caused by the antiparasitic drugs BZ and nifurtimox (NX), used in the treatment of CD, have already been reported in the literature, including areas of necrosis, periportal inflammatory infiltrates, and vascular congestion in the liver [ 26 , 27 ]. On the other hand, in the Brazilian Amazon region, familial microepidemics of acute CD, acquired by oral transmission, through the ingestion of food contaminated by the parasite, mainly palm fruits such as açaí, have also been observed. These cases present more severe conditions than those acquired by the classical vector route (contamination by triatomine excreta) and may present greater lethality [ 19 , 28 ]. Medicines administered orally, as well as pathogens acquired by this route, after being absorbed by the intestinal gastric mucosa, are transported to the hepatic portal system [ 3 ]. In addition, the liver is affected in the acute T. cruzi infection and has the function of clearing blood trypomastigotes [ 13 , 29 ]. In the cardiac tissue of the groups infected and treated with BZ, a decrease in tissue damage was observed only in the animals inoculated via the GI route. The intensities of the lesions went from moderate to mild, which did not happen with the animals inoculated by the IP route, in which the lesions remained intense, even after the etiological treatment. That is, in infection with the Y strain (TcII), in addition to the GI route causing less intense histopathological changes in the heart, the animals infected via this route responded better to treatment with BZ than those infected via the IP route in terms of reducing cardiac lesions. In a study with Swiss mice inoculated by the IP route with two strains of TcII (PR1219 and PR2259), an increase in the number of tissue lesions in different organs (including the heart) of animals treated in the acute phase with BZ, was observed during the chronic phase of infection. However, this number was still lower than in infected animals that were left untreated [ 21 ]. As the parasite load becomes controlled, inflammatory and oxidative processes decrease in skeletal muscle, colon, and stomach tissues; however, mitochondrial function deterioration, which is responsible for the production of free radicals, persists in the heart muscle, contributing to the lesions found in CD [ 27 , 28 ]. In the present study, the analysis of plasma enzymes showed an increase in AST and ALT levels only in the infection via the GI route, and there was no significant change in ALP by either parasite inoculation route. These data suggest damage at the hepatocellular level in GI-inoculated animals, leading to the release of these enzymes into the bloodstream and an increase in their serum levels [ 30 ]. Increased AST levels indicate hepatic necrosis and may occur in parasitic infections. The ALT enzyme is found in high concentrations in the liver and its origin is predominantly cytoplasmic, being a sensitive marker of liver damage. These data suggest that the Y strain (TcII, macrophagotropic), when inoculated via the GI route, unlike what was observed in the heart, causes more changes in the liver than when inoculated via the IP route. These data corroborate Barreto-de-Albuquerque et al. [ 3 ], who found that BALB/c mice orally inoculated with the Tulahuén (TcVI) strain had liver damage, given the increased serum levels of AST and ALT, which was further confirmed by histology. However, our histopathological findings showed more intense lesions in the liver tissue of animals inoculated via the IP route, even though they were not significant due to the low number of surviving animals; there was an increase in hepatic sinusoids due to obstruction of blood vessels, caused by fibrosis, and also by a greater blood supply due to heart failure caused by the intense myocardial lesions found in this group. The group of IPNT animals showed increased serum levels only for the ALT enzyme. For AST, even with a tendency to increase, it was not significant, due to the greater virulence of the IP route, with a consequent higher mortality, making these analyses difficult. Despite these limitations, these findings confirm the study by Novaes et al. [ 31 ], carried out with male C57BL/6 mice infected via the IP route with the Y strain (5,000 BT forms), which presented high serum levels of AST and ALT enzymes. However, this same study also recorded an increase in these enzymes in animals that received BZ only. In the present study, BZ administered to uninfected mice caused a significant increase in AST and ALT enzymes, confirming that this drug causes liver damage in uninfected animals [ 31 , 32 , 33 ]. This was also confirmed by the increase in liver OS in NI + BZ animals, demonstrated by the increase in the carbonyl groups of proteins and by histopathological analyses that showed a mild inflammatory process in the organ. On the other hand, the etiological treatment promoted a reduction in the dosage of the two enzymes in animals infected via the GI route, and only in the ALT of those infected via the IP route, showing a reversal of the condition caused by the drug. This result suggests a greater benefit of etiological treatment in the infection via the GI route. Individually, infection with T. cruzi and the treatment with BZ caused an increase in OS and tissue alterations in the liver, corroborating the literature [ 31 , 34 ]. Although the etiological treatment reduced the serum levels of the plasma enzymes (AST and ALT) in infected and treated animals, the analysis of OS markers in the liver indicated an increase in the production of carbonyl groups in the treated animals inoculated by both routes. The production of carbonyl groups is used as a marker of free radical-mediated protein oxidation, which is indicative of tissue damage [ 35 ], corroborating our histopathological findings in the animals infected and treated with BZ. Although exposure to BZ was harmful to liver tissue [ 31 ], treatment attenuated the inflammatory processes caused by both infection routes, mainly in the heart. Gruendling et al. [ 21 ] also observed a significant reduction in the number of organs undergoing an inflammatory process in Swiss mice infected with strains belonging to three DTUs (TcI, TcII, and TcIV) and submitted to treatment with BZ. Our results also showed positive changes in OS parameters in the liver after treatment. After the reduction of GSH values in animals infected via the GI route, the BZ treatment promoted a return to its normal levels, suggesting a reduction in OS and another benefit of the treatment for infection caused by the GI route. In the IP infection, BZ also promoted benefits, demonstrated by the reduction of carbonyl groups; however, a study by Novaes et al. [ 31 ], who also used the Y strain, but with an inoculum of 5,000 BT, contradict our findings, associating the BZ treatment of infected animals with a more severe OS. The lower severity of infection with Y strain (TcII) in mice when inoculated via the GI route, compared to IP route infection, observed in the present study, contrasts with the greater severity and worse response to treatment observed in mice infected via the GI route with TcIV strains [ 36 , 37 ]. It is possible that different strains/DTUs of T. cruzi , whose composition of surface glycoproteins of their developmental forms may differ [ 37 ], can stimulate different reactions in combination with treatment and infection routes, given that the genetic diversity of the species may have an important impact on the biological and medical properties of the parasite such as virulence, pathogenicity, and drug resistance [ 17 , 19 , 21 , 38 ]. The Y strain used in this study was maintained through alternating passages in mice and liver infusion tryptose (LIT) acellular culture medium in vitro . It is known that the Y strain, isolated from a patient in 1950, becomes more virulent after successive passages in mice [ 39 ]. The conditions used in the maintenance of T. cruzi strains may result in a artificial selection for some subpopulations, and a strain may be the result of the interaction of these subpopulations that are selected after a few years of maintenance in the laboratory [ 40 ]. In addition to biological and genetic diversity, which can influence the behavior of the T. cruzi strain, differences in the time of maintenance of the strain in the culture medium before inoculation, and inoculum volume and concentration, may also contribute to differences in its infectivity, pathogenicity, and lethality in mice. The results obtained in this study, in general, allow us to reject our working hypothesis, since the infection with CMT of the Y strain (TcII) by the GI route was less severe and responded better to BZ treatment than the infection via the IP route, contradicting the findings obtained in BALB/c mice with the Tulauhen (TcVI) strain [ 3 ], which found greater severity of infection via the oral and GI routes compared to the IP route. However, the strain influences the resistance of the host, some can be extremely virulent, such as the Y strain [ 39 ], while others not, such as Tulahuen [ 41 ]. They also contradict the findings obtained in Swiss mice inoculated with TcIV strains from Amazonas state (Brazilian Amazon region), which observed, in addition to greater virulence by the GI route [ 42 ], a worse response to treatment with BZ [ 36 ]. Therefore, the results of the present study suggest that both the severity and the response to treatment of oral/GI infection by T. cruzi depend on the strain or DTU of the parasite. We must also consider the conditions of origin, maintenance of these strains, and experimental models used, all of which may influence the course of T. cruzi infection. Conclusion Swiss mice infected with the Y strain (TcII) via the GI route displayed lower levels of parasitemia, with a later peak, and less intense lesions in the heart and liver than mice infected via the IP route, suggesting a lower severity of infection for this strain of T. cruzi when inoculated by the GI route. Although animals infected by both the GI and IP routes had a mortality rate of 50%, deaths occurred later in those inoculated via the GI route, also suggesting a lower lethality rate of this route. Furthermore, these data suggest that the severity of the infection route depends on the strain or DTU of T. cruzi . BZ administered to uninfected mice caused a focal inflammatory process in the heart and liver of animals, although mild, and increased plasmatic parameters of liver damage and OS, confirming that the drug alone causes liver damage in these animals. Although liver damage and OS parameters suggested greater severity of the GI route, with increased levels of AST and ALT enzymes and reduced levels of GSH, compared to an increase only in ALT in IP-inoculated animals, both BZ and T. cruzi infection alone caused tissue alterations and increased OS in the liver of mice. However, the BZ treatment of the infected animals reverted this situation with the return to normal enzymatic levels, suggesting reversion of liver damage and OS, another benefit of the treatment in addition to parasite clearance. Methods • Ethical aspects The use, maintenance, and care of the mice followed the guidelines of the National Council for the Control of Animal Experimentation (CONCEA), and we complied with the ARRIVE guidelines. The research was approved by the Ethics Committee on the Use of Animals of the State University of Maringá (UEM) (registration number 9659251017/2017). The animals were kept in polyethylene cages (dimensions 20x32x21 cm) on microenvironmental shelves (AL20 - Alesco®) with water and food ad libitum and light/dark cycle (12/12 h). For organ collection (heart and liver), animals were euthanized by deepening anesthetic with administration of the association of ketamine (50 mg/kg) and xylazine (10 mg/kg) intraperitoneally. • Parasites The Y strain of T. cruzi genotyped as TcII was used [ 9 ]. This strain presents tropism for lymphoid organs, parasitizing preferentially the liver and spleen, in addition to the heart [ 12 ]. Furthermore, it is highly virulent to albino mice and was found to be partially resistant to BZ and NX in animals inoculated via the IP route with BT forms [ 23 , 24 ], and resistant to BZ in mice inoculated via the GI route with 2x10 6 CMT/animal [ 25 ]. The parasites were maintained through alternating passages between Swiss mice and LIT acellular culture medium supplemented with 10% heat-inactivated PBS, pH 7.4. To obtain the metacyclic forms, the blood with the trypomastigote forms of the Y strain was incubated in LIT culture medium in a Biochemical Oxygen Demand (B.O.D.) to obtain the epimastigote forms. Cultures were maintained axenic at 28°C in a stationary growth phase for at least 15 days before inoculation of experimental animals. The parasites present in the culture were counted in a Neubauer chamber and the inoculum was adjusted to 2x10 6 CMT/ 1.0 mL. • Inoculation Of Animals We used 60 Swiss male mice, 21 to 28 days old, from the Central Animal Facility of UEM. Twenty animals were inoculated via the GI route and 20 via the IP route, with 2x10 6 CMT in 1.0 mL of LIT medium [ 11 ]. GI inoculation was performed by gavage with a special cannula (Biomedical Needles, Popper & Sons, Inc., New York, USA) and a volume of 1.0 mL of the inoculum was injected into the stomach, as used for IP inoculation. The animals inoculated via the GI route have previously fasted for approximately 12 h. The remaining 20 animals were not inoculated and served as uninfected controls. • Experimental Groups The animals were divided into six experimental groups with 10 animals each, as follows: 1) Uninfected and untreated (NI); 2) Uninfected and treated (NI + BZ); 3) Infected via GI route and untreated (GINT); 4) Infected via GI route and treated (GI + BZ); 5) Infected via IP route and untreated (IPNT); 6) Infected via IP route and treated (IP + BZ). • Etiological Treatment The etiological treatment consisted of administering a dose of 100 mg/kg/day of BZ (LAFEPE®, Pernambuco, Brazil) by gavage, for 20 consecutive days, starting on the 5th d.i. All infected groups, ~ 48 h after the end of treatment with BZ, underwent immunosuppression with cyclophosphamide (Cy, Genuxal, Baxter, Brazil), at a dose of 50 mg/kg/day, for four consecutive days in the first week and three alternate days in the following two weeks [ 43 ]. • Parasitological Assessments Fresh blood examination (FBE) This test was performed on all inoculated animals before, during, and after treatment with BZ to confirm the infection and plot the parasitemia curve. The parasitemia was evaluated daily from the 3rd d.i. until negative results for three consecutive days [ 44 ]. Parasitemia was also evaluated, on alternate days, during and after the administration of the immunosuppressive agent (Cy), to verify the reactivation of the infection, characterized by the return of patent parasitemia and increased mortality. From the mean parasitemia curve, the following parameters were obtained: PPP, first day on which positive FBE was detected; PP, mean of the periods in which each animal had the parasitemia detected by the FBE; Pmax, mean obtained from the detected parasitemia peak for each animal; and Dpmax, mean of the days on which each animal had the peak of parasitemia detected. With the results of this test, the %+FBE was obtained. Real-time polymerase chain reaction (qPCR) The qPCR test was performed to detect T. cruzi DNA and quantify the blood parasite load. Blood samples for qPCR analysis were collected on the 47th d.i., after the Cy immunosuppression period. DNA was extracted by the phenol/chloroform method, as described by Caldas et al [ 45 ], and modified by Gruendling et al. [ 21 ]. The DNA obtained was analyzed using the QuantiNova SYBR Green PCR kit (Qiagen) with 100 ng of total genomic DNA, using the primers TCZ-F (5' –GCTCTTGCCCACAMGGGTGC– 3') and TCZ-R (5' –CCAAGCAGCGGATAGTTCAGG– 3') [ 28 ]. Samples were amplified in LightCycler® 480 by denaturation at 95°C for 2 minutes, 35 cycles of amplification at 95°C for 15 seconds, and 60°C for 10 seconds. To monitor primer-dimers or the formation of non-specific products, an analysis of the melting curve from 65°C to 97°C was performed at the end of each assay. A standard curve was established using purified T. cruzi DNA; serial dilutions ranging from 100 to 0.001 ng of DNA were added to the reaction plate wells in triplicate. The standard curve was generated by the LightCycler® 96 software and was used to calculate the equivalent parasite ratio in each sample. The equivalent parasites (par. eq.) per mL of blood were based on the amount of DNA per epimastigote cell, in which 200 fg/parasite were considered [ 46 ]. With these results, the percentage of mice with positive qPCR (%+qPCR) and the mean parasite load for each experimental group were obtained. Infectiousness and survival rate Animals with positive FBE and/or qPCR were considered infected. The %INF was obtained by the ratio between the number of infected animals and the number of inoculated animals X 100. Deaths were recorded throughout the experiments and the survival rates of the different groups were compared using the Kaplan-Meyer plot. • Histopathological Evaluations We evaluated 2–6 animals per experimental group. The animals were euthanized and had their heart and liver collected 48 h after the end of immunosuppression, on the 47th d.i. Fragments of these organs were first fixed in 10% formalin and were preserved in 70% alcohol after 24 h. After dehydration and diaphanization, the tissues were embedded in paraffin. Subsequently, they were cut into 5 µm thick sections, separated by 25 µm intervals, placed on microscope slides (four sections per slide), and then were stained with hematoxylin-eosin. The sections were examined under an optical microscope in a 40X objective, and the photomicrographs were obtained using the Optical Microscopy OPTHD software Copyright© 2003–2017. Four sections per animal were counted and individual data were determined as the average of the results of the four sections. The histopathological parameters analyzed included of tissue parasitism, inflammatory process, tissue necrosis, and tissue fibrosis. For the analysis of the inflammatory infiltrate, the presence of 10 or more inflammatory cells per field was considered as an inflammatory process and was classified as follows: absent (–) (without the presence of minimal inflammatory cells), mild (+) (10–25 cells), moderate (++) (26–50 cells) and intense (+++) (> 50 cells) [ 21 ]. Tissues with nuclear pyknosis (nucleus with basophil staining and reduced size), karyolysis (absence of nucleus) and dispersion of the nucleus in the cytoplasm were considered as necrosis. Tissue fibrosis was characterized by the presence of fibroblasts, accumulation of connective tissue and excessive deposition of collagen fibers occupying the space of lost cardiac cells [ 30 ]. Tissue necrosis and fibrosis alterations were classified according to lesion severity and distribution, (-) normal histological appearance; (+) mild and focal lesion; (++) moderate multifocal or diffuse lesion; (+++) intense multifocal or diffuse lesion. • Biochemical Assessments The following plasma parameters of liver damage were evaluated: dosages of the enzymes AST, ALT, and ALP; and OS parameters: dosages of GSH, catalase and protein carbonyl groups. Dosage of plasma liver enzymes The enzymes AST, ALT, and ALP were measured in blood plasma by spectrophotometry (Hitachi U-3000 spectrophotometer) with commercial kits from Gold Analyze Diagnostica Ltda. (Belo Horizonte, MG, Brazil). The blood of the animals was collected by cardiac puncture, 48 h after the end of treatment with BZ and 48 h after the end of immunosuppression, using sodium heparin as an anticoagulant, and was centrifuged at 252 g for 20 minutes to separate the plasma. Subsequently, the plasma samples were transferred to Eppendorf microtubes and were frozen at -4 ºC, until use. Oxidative stress (OS) in the liver After euthanasia, the liver was clamped and kept in liquid nitrogen. For the preparation of the organ homogenate, the Van Potter-Elvehjem homogenizer was used with 10 volumes of 0.1 M potassium phosphate buffer (pH 7.4), in an ice bath, and an aliquot was separated for use as the total homogenate. The remaining homogenate was centrifuged at 11,000 g for 15 minutes and the supernatant was separated as a soluble fraction of the homogenate. GSH was measured spectrofluorimetrically (excitation at 350 nm and emission at 420 nm) using the o-phthaloaldehyde assay as described previously [ 48 ]. Catalase activity was estimated by measuring the change in absorbance at 240 nm using H 2 O 2 as substrate and the results were calculated using the molar extinction coefficient (ε) of 9.6x10-3 M-1 • cm-1. Protein carbonyl groups were measured spectrophotometrically using 2,4-dinitrophenylhydrazine [ 49 ] and their levels were calculated using the molar extinction coefficient (ε) of 2.20x10-4 M-1 • cm -1. • Statistical analysis Statistical analysis of parasitological parameters was performed as follows: PPP, PP, Pmax, Dpmax, and parasite load were compared with the non-parametric tests of Mann-Whitney or Krust-Wallis, using the Biostat software, version 5.3 (Belém, PA, Brazil). The parameters %+FBE, %+qPCR, and %INF were compared by the chi-square test (χ 2 ). In the analysis of biochemical parameters, the mean and standard error were used. The Kaplan-Meier graph of the GraphPad Prism 5.0 software was used to compare the survival rate. Fisher’s exact test was used to compare the intensity of histopathological lesions and the proportion of organs with alterations, using the Biostat software, version 5.3. Statistical comparisons were made between uninfected and infected animals, between inoculation routes (GI x IP) and between BZ-treated and untreated animals (GI + BZ x GINT, IP + BZ x IPNT). Differences with a p-value ≤ 0.05 were considered significant. Declarations Additional information Competing interests The authors declare no competing interests. Acknowledgments To the Coordination for the Improvement of Higher Education Personnel (CAPES), Brazil, Financing Code 001. Funding This work was supported by grants from the Araucaria Foundation for Scientific and Technological Development through the Basic and Applied Research Support program (251/2014, number 10943812) and from the National Council for Scientific and Technological Development (CNPq) through the Research Productivity program (PQ – 2014, number 305853/2014–7) to MJOT. The funders did not have any role in study design, data collection, management, analysis, data interpretation, manuscript writing, and the decision to submit the manuscript for publication. Ethics approval All methods were performed in accordance with the relevant guidelines and regulations of the National Council for the Control of Animal Experimentation (CONCEA), and ARRIVE guidelines. The research was approved by the Ethics Committee for the Use of Animals of Maringá State University (UEM) (registration number 9659251017/2017). Data Availability The datasets used and/or analyzed during the current study are available from the corresponding author on request. References Chagas, C. Nova tripanozomiase humana. Estudos sobre a morfolojia e o ciclo evolutivo do Schizotrypanum cruzi n. gen., n. sp., ajente etiolójico de nova entidade mórbida do homem. Mem. Inst. Oswaldo Cruz. 1 , 159-218 (1909). WHO. Chagas disease (also known as American trypanosomiasis) – Fact Sheet. World Health Organization . Available: https://www.who.int/news-room/fact-sheets/detail/chagas-disease-(american-trypanosomiasis) (2021). Barreto-de-Albuquerque, J. et al . Trypanosoma cruzi Infection through the Oral Route Promotes a Severe Infection in Mice: new disease form from an old infection? PLoS Negl. Trop. Dis. 9 , 1-21 (2015). BRASIL. Doença de Chagas: 14 de abril | Dia mundial. Boletim Epidemiológico especial: abril 2021. Ministério da Saúde. Secretaria de Vigilância em Saúde. Available in: https://www.gov.br/saude/pt-br/assuntos/saude-de-a-a-z/d/doenca-de-chagas (2021). Simões, M.V., Romano, M.M.D., Schmidt, A., Martins, K.S.M. & Marin-Neto, J.Á. Chagas Disease Cardiomyopathy . Int. J. Cardiovasc. Sci . 31 , 173-189 (2018). Dias, J.C.P. et al . II Consenso Brasileiro em Doença de Chagas, 2015. Epidemiol. Serv. Saúde. 25 , 1-21 (2016). Coura, J.R. Tripanosomose, Doença de Chagas. Ciênc. Cult. 55 , 30-33 (2003). Dias, J.C.P. Notas sobre o Trypanosoma cruzi e suas características bio-ecológicas, como agente de enfermidades transmitidas por alimentos. Rev. Soc. Bras. Med. Trop. 39 , 370-375 (2006). Zingales, B. et al . A new consensus for Trypanosoma cruzi intraspecific nomenclature: second revision meeting recommends TcI to TcVI. Mem. Inst. Oswaldo Cruz . 104 , 1051-1054 (2009). Zingales, B. et al. The revised Trypanosoma cruzi subspecific nomenclature: Rationale, epidemiological relevance and research applications. Infect. Genet. Evol. 12 , 240–253 (2012). Dias, G.B.M., Gruendling, A. P., Araújo, S. M., Gomes, M. L. & Toledo, M. J. O. Evolution of infection in mice inoculated by the oral route with different developmental forms of Trypanosoma cruzi I and II. Exp. Parasitol. 135 , 511-517 (2013). Melo, R.C. & Brener, Z. Tissue tropism of different Trypanosoma cruzi strains . J. Parasitol. 63 , 475-482 (1978). Sardinha, L.R., Elias, R.M. & Marinho, M.R.L. Contribution of NK, NK T, T, and γδ T, and αβ T Cells to the Gamma Interferon Response Required for Liver Protection against Trypanosoma cruzi . Infect. Immunol. 74 , 2031-2042 (2006). Docampo, R. Sensitivity of parasites to free radical damage by antiparasitic drugs . Chem-Biol. Interact . 73 , 1-27 (1990). Martins, G., Cardoso, M.A.G., Aliberti, J.C.S. & Silva, J.S. Nitric oxide-induced apoptotic cell death in the acute phase of Trypanosoma cruzi infection in mice. Immunol. Lett. 63 , 113-120 (1998). Silva-Filho, J.D. et al. Perfil hematológico e bioquímico de pacientes com doença de Chagas atendidos por um serviço de atenção farmacêutica no estado do Ceará. J. Health. Biol. Sci. 5 , 130-136 (2017). Toledo, M.J.O. et al . Chemotherapy with benznidazole and itraconazole for mice infected with different Trypanosoma cruzi clonal genotypes . Antimicrob. Agents. Chemother. 47 , 223-230 (2003). Caldas, S. et al. Trypanosoma cruzi : Acute and long-term infection in the vertebrate host can modify the response to benznidazole. Exp. Parasitol. 118 , 315-323 (2008). Teston, A.P.M. et al. In vivo susceptibility to benznidazole of Trypanosoma cruzi strains from the western Brazilian Amazon. Trop. Med. Int. Health . 18 , 85-95 (2013). Monteiro, W.M. et al. Trypanosoma cruzi I and IV Stocks from Brazilian Amazon Are Divergent in Terms of Biological and Medical Properties in Mice. PLoS Negl. Trop. Dis. 7 , e2069 (2013). Gruendling, A.P. et al. Impact of Benznidazole on Infection Course in Mice Experimentally Infected with Trypanosoma cruzi I, II, and IV. Am. J. Trop. Med. Hyg. 92 , 1178-1189 (2015). Francisco, A.F. Estresse Oxidativo, defesas antioxidantes e processo inflamatório na fase aguda da doença de Chagas experimental. Thesis , Universidade Federal de Ouro Preto (2011). Andrade, S.G. Caracterização morfológica e comportamental de cepas de Trypanosoma cruzi . Rev. Soc. Bras. Med. Trop. 18 , 39-46 (1985). Filardi, L.S. & Brener, Z. Susceptibility and natural resistance of Trypanosoma cruzi strains to drugs used clinically in Chagas disease. Trans. R. Soc. Trop. Med. Hyg. 81 , 755-759 (1987). Zanusso Junior, G., Massago, M., Teston A.P.M., Morey, AT & Toledo, M.J.O. Efficacy of some essential oils in mice infected with Trypanosoma cruzi . Trop. J. Pharm. Res. 16 , 1307-1316 (2017). Strauss, M., et al. Clomipramine and benznidazole association for the treatment of acute experimental Trypanosoma cruzi infection. Parasitol. Int. 62 , 293-299 (2013). Pinto, A.Y.N., Valente, S.A., da Costa V., Ferreira, J., Gomes A. & Coura J.R. Acute phase of Chagas disease in the Brazilian Amazon region. Study of 233 cases from Pará, Amapá and Maranhão observed between 1988 and 2005. Rev. Soc. Bras. Med. Trop. 41 , 602-614 (2008). Wen, J., Dhiman, M., Whorton, E. & Garg, N. Tissue-specific oxidative imbalance and mitochondrial dysfunction during Trypanosoma cruzi infection in mice. Microb. Infect. 10 , 1201-1209 (2008). Sardinha, L.R. et al. The Liver Plays a Major Role in Clearance and Destruction of Blood Trypomastigotes in Trypanosoma cruzi Chronically Infected Mice. PLOS Negl. Trop. Dis. 4 , e578 (2010). Bergmeyer, H.U., Scheibe, P. & Wahlefeld, A.W. Optimization of methods for aspartate aminotransferase and alanine aminotransferase. Clin. Chem. 58 , 58-73 (1978). Novaes, R.D. et al. Trypanosoma cruzi infection and benznidazole therapy independently stimulate oxidative status and structural pathological remodeling of the liver tissue in mice. Parasitol. Res. 114, 2873-2881 (2015). Moreno, C.J.G. Estabelecimento do modelo murino para a modulação de toxicidade do benzonidazol durante a terapêutica da doença de Chagas ( Trypanosoma cruzi ). Dissertation , Instituto de Higiene e Medicina Tropical (2015). Novaes, R.D. et al. Curcumin Enhances the Anti- Trypanosoma cruzi Activity of Benznidazole-Based Chemotherapy in Acute Experimental Chagas Disease. Antimicrob. Agents. Chemother. 60 , 3355-3364 (2016). Paiva, C.N. et al. Oxidative stress fuels Trypanosoma cruzi infection in mice. J. Clin. Investig . 122 , 2531-2542 (2012). Ferreira, A.L.A. et al. Síndrome metabólica: atualização de critérios diagnósticos e impacto do estresse oxidative na patogênese. Ver. Bras. Clin. Med. São Paulo. 9 , 54-61 (2011). Teston, A.P.M. et al. Therapeutic effects of benznidazole in Swiss mice that are orally inoculated with Trypanosoma cruzi IV strains from the Western Brazilian Amazon. Exp. Parasitol. 228 , 108-136 (2021). Yoshida, N. Molecular mechanisms of Trypanosoma cruzi infection by oral route. Mem. Inst. Oswaldo Cruz. 104 , 101-107 (2009). Meza, S.K.L. et al . Comparative pathogenicity in Swiss mice of Trypanosoma cruzi IV from northern Brazil and Trypanosoma cruzi II from southern Brazil. Exp. Parasitol. 146 , 34-42 (2014). Silva, L.H.P. & Nussenzweig, V. Sobre uma cepa de Trypanosoma cruzi altamente virulenta para o camundongo branco. Folia Clin. Biol. 20 , 191–203 (1953). Cortez, C. et al. Differential Infectivity by the Oral Route of Trypanosoma cruzi Lineages Derived from Y Strain. Plos negl. Trop. Dis. 6 , 1804-1805 (2012). Cardoni, R.L., Rimoldi, M.T., Esteva, M. & Bracco, M.M.E. Humoral antibody response in mice infected with Trypanosoma cruzi. Medicina (B. Aires) . 46 , 435-439 (1986). Teston, A.P.M., Abreu, A.P., Abegg, C.P., Gomes, M.L. & Toledo, M.J.O. Outcome of oral infection in mice inoculated with Trypanosoma cruzi IV of the Western Brazilian Amazon. Acta Trop. 166 , 212–217 (2017). Bértoli, M., Andó, M.H., Toledo, M.J.O., Araújo, S.M. & Gomes, M.L. Infectivity for mice of Trypanosoma cruzi I and II strains isolated from different hosts. Parasitol. Res. 99 , 7-13 (2006). Brener, Z. Therapeutic activity and criterion of cure on mice experimentally infected with Trypanosoma cruzi . Rev. Inst. Med. Trop. São Paulo. 4 , 389-396 (1962). Caldas, S. Real-time PCR strategy for parasite quantification in blood and tissue samples of experimental Trypanosoma cruzi infection. Acta Trop. 123 , 170-177 (2012). Duffy, T., et al. Accurate real-time PCR strategy for monitoring bloodstream parasitic loads in Chagas disease patients. PLoS Negl. Trop. Dis. 3 , e419 (2009). Miller, M.A. & Zachary, J.F. Mechanisms and Morphology of Cellular Injury, Adaptation, and Death. Pathol. Bas. Vet. Dis . 2–43, e19 (2017). Hissin, P.J. & Hilf, R. Fluorimetric method for determination of oxidized and reduced glutathione in tissues. Anal. Biochem. 74 , 214–226 (1976). Levine, R.L. et al. Determination of carbonyl content in oxidatively modified proteins. Meth. Enzymol. 186 , 464–478 (1990). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-2239490","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":150207980,"identity":"51328b7d-2271-4e93-bd15-2c1a943b5587","order_by":0,"name":"Hevillyn Fernanda Lucas da Silva","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAyklEQVRIiWNgGAWjYBACAyA+8KCAgYEfxEsoIFZLApCUbABpMSBSC1ilwQE4lwAwZ+8xBNpyOM/4/OrEDw8MGOT5xQ7g12LZc8YApKXY7MbbzRJA6wxnzk4g4LAbaQkgLYnbbpzdANKSYHCbkJb7zyBaNs84u/kHcVpuMB8Aa9nA37uNSFvOJIO0pCfOuMG7zSLBQIIIvxw/2PzhQ4V1Yn//2c03f1TYyPNLE9ACBc0MDBJglRJEKQeBOmCKOUC06lEwCkbBKBhhAAAql01egvigsAAAAABJRU5ErkJggg==","orcid":"","institution":"State University of Maringá","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Hevillyn","middleName":"Fernanda Lucas da","lastName":"Silva","suffix":""},{"id":150207982,"identity":"b3e49cdd-e4db-462f-9610-5cafb581e868","order_by":1,"name":"Marcella Paula Mansano Sarto","email":"","orcid":"","institution":"State University of Maringá","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Marcella","middleName":"Paula Mansano","lastName":"Sarto","suffix":""},{"id":150207984,"identity":"d7267e58-56d1-43f3-b239-483eb78a60b0","order_by":2,"name":"Ana Paula de Abreu","email":"","orcid":"","institution":"State University of Maringá","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Ana","middleName":"Paula","lastName":"de Abreu","suffix":""},{"id":150207985,"identity":"91b6f95f-6899-44d4-af09-7ec26a9bdeb3","order_by":3,"name":"Nilma de Souza Fernandes","email":"","orcid":"","institution":"State University of Maringá","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Nilma","middleName":"de Souza","lastName":"Fernandes","suffix":""},{"id":150207986,"identity":"55a0592a-a1ac-4326-b524-68f51a75b41d","order_by":4,"name":"João Vitor de Souza Trovo","email":"","orcid":"","institution":"State University of Maringá","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"João","middleName":"Vitor de Souza","lastName":"Trovo","suffix":""},{"id":150207987,"identity":"a2f2bfdb-e1e7-4775-ad58-9b6a1decfb6b","order_by":5,"name":"Aline Francieli da Silva","email":"","orcid":"","institution":"State University of Maringá","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Aline","middleName":"Francieli da","lastName":"Silva","suffix":""},{"id":150207988,"identity":"aa8c70eb-5658-4926-8d63-be2640f6b9d1","order_by":6,"name":"Alice Maria de Souza-Kaneshima","email":"","orcid":"","institution":"State University of Maringá","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Alice","middleName":"Maria","lastName":"de Souza-Kaneshima","suffix":""},{"id":150207989,"identity":"8c8e3dda-e4c8-487d-9f9e-567d95b338ad","order_by":7,"name":"Jurandir Fernando Comar","email":"","orcid":"","institution":"State University of Maringá","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jurandir","middleName":"Fernando","lastName":"Comar","suffix":""},{"id":150207990,"identity":"394de4f6-580b-4b59-87a7-d8258dc177df","order_by":8,"name":"Max Jean de Ornelas Toledo","email":"","orcid":"","institution":"State University of Maringá","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Max","middleName":"Jean de Ornelas","lastName":"Toledo","suffix":""}],"badges":[],"createdAt":"2022-11-04 21:14:10","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-2239490/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-2239490/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":28968628,"identity":"2bd12f41-4560-4d31-aa05-071ef2b6c9ae","added_by":"auto","created_at":"2022-11-11 20:57:09","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":21425,"visible":true,"origin":"","legend":"\u003cp\u003eSurvival curves of Swiss mice infected via the gastrointestinal (GI) and intraperitoneal (IP) routes with 2x10\u003csup\u003e6\u003c/sup\u003e culture-derived metacyclic trypomastigotes/animal of the Y strain (TcII) of \u003cem\u003eTrypanosoma cruzi\u003c/em\u003e, treated with benznidazole (BZ) (100 mg/kg /day, 20X) and in untreated controls (NT). The GI+BZ and IP+BZ groups are superimposed on the graph.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-2239490/v1/6811034d288200496fc331fe.png"},{"id":28968627,"identity":"8f1daedc-5744-4957-b675-3737e588c56d","added_by":"auto","created_at":"2022-11-11 20:57:09","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":23878,"visible":true,"origin":"","legend":"\u003cp\u003eMean parasitemia curves in Swiss mice inoculated via the gastrointestinal (GI) and intraperitoneal (IP) routes with 2x10\u003csup\u003e6\u003c/sup\u003e culture-derived metacyclic trypomastigotes of Y strain (TcII) of \u003cem\u003eTrypanosoma cruzi\u003c/em\u003e, treated with benznidazole (BZ) (100 mg/ kg/day, 20X), from the 5th day of infection, and in untreated controls (NT) (a). Mean parasite load detected by real-time polymerase chain reaction on the 47th day after infection, in blood from the same animals (b).\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-2239490/v1/fd0362b8e96d385928e49a07.png"},{"id":28968630,"identity":"0fa82c0b-6f15-428e-a2c1-e97bcf872616","added_by":"auto","created_at":"2022-11-11 20:57:10","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":6707943,"visible":true,"origin":"","legend":"\u003cp\u003eMicrophotographs of cardiac tissue from Swiss mice inoculated via gastrointestinal (GI) and intraperitoneal (IP) routes, with the Y strain (TcII) of \u003cem\u003eTrypanosoma cruzi\u003c/em\u003e, treated with benznidazole (BZ 100 mg/kg/day, 20X) and untreated controls, euthanized on the 47th day of infection. Inoculum: 2x10\u003csup\u003e6\u003c/sup\u003e culture-derived metacyclic trypomastigotes/animal.\u003c/p\u003e\n\u003cp\u003ea - Uninfected and untreated control (NI), b - Infected via GI route and untreated (GINT) animal showing mild and focal epicarditis (red arrows), c - Infected via IP route and untreated (IPNT) animal with diffuse myocarditis and areas of myocardial fibrosis, d - uninfected animal treated with BZ (NI+BZ) with mild inflammatory focus (red arrow), e - animal infected via GI route and treated with BZ (GI+BZ), showing focal epicarditis (red arrows), and f - Infected via IP route and treated (IP+BZ) animal with diffuse myocarditis. 400X magnification in HE.\u003c/p\u003e\n\u003cp\u003eg - Number and percentage of animals showing histopathological changes of different intensities. (-) absent; (+) mild; (++) moderate; and (+++) intense. \u003cem\u003en:\u003c/em\u003e number of animals evaluated per group. Comparisons showing significant differences: untreated vs. treated with BZ (*), in intensity (**), and GINT vs. IPNT: (***); Fisher’s exact test with a significance value of \u003cem\u003ep \u0026lt; 0.05\u003c/em\u003e.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-2239490/v1/231adc905830bbccc5b32a7d.png"},{"id":28968629,"identity":"f6843ed7-442d-499f-87f7-8b235054d861","added_by":"auto","created_at":"2022-11-11 20:57:09","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":6870430,"visible":true,"origin":"","legend":"\u003cp\u003eMicrophotographs of liver tissue from Swiss mice inoculated via gastrointestinal (GI) and intraperitoneal (IP) routes, with the Y strain (TcII) of \u003cem\u003eTrypanosoma cruzi\u003c/em\u003e, treated with benznidazole (BZ 100 mg/kg/day, 20X) and untreated controls, euthanized on the 47th day of infection. Inoculum: 2x10\u003csup\u003e6\u003c/sup\u003e culture-derived metacyclic trypomastigotes/animal.\u003c/p\u003e\n\u003cp\u003ea - Uninfected and untreated control (NI) (400X in HE), b – Infected via GI route and untreated (GINT) animal showing an inflammatory process (red arrow) in the portal triad and active hyperemia of the hepatic arteriole with the marginalization of mononuclear cells (black arrow) (600X in HE), c - Infected via IP route and untreated (IPNT) animal showing an inflammatory process (red arrow) in a portal triad with portal vein congestion and sinusoid dilatation (blue arrow) (200X in HE), d - uninfected animal treated with BZ (NI+BZ) showing a focal inflammatory process (red arrow) (400X in HE), e - animal infected via GI and treated with BZ (GI+BZ) showing area of fibrosis (white arrow) in the liver parenchyma (400X in HE), and f - Infected via IP route and treated (IP+BZ) animal showing inflammatory cells and fibrosis area (400X in HE).\u003c/p\u003e\n\u003cp\u003eg - Number and percentage of animals showing histopathological changes of different intensities. (-) absent; (+) mild; (++) moderate; and (+++) intense. \u003cem\u003en\u003c/em\u003e: number of animals evaluated per group. * Significant differences between groups on the same row. Fisher’s exact test with a significance value of \u003cem\u003ep \u0026lt; 0.05\u003c/em\u003e.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-2239490/v1/7b75e3037dcc1c04bd4f1762.png"},{"id":30551934,"identity":"24f6ce50-1b02-4d25-9e64-c51710fb256c","added_by":"auto","created_at":"2022-12-20 07:14:42","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3062435,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-2239490/v1/2a19ca3d-5e0d-4524-b889-8c7ab17e1178.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Impact of gastrointestinal inoculation and benznidazole treatment on Trypanosoma cruzi II infection in mice","fulltext":[{"header":"Introduction","content":"\u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003e \u003cem\u003eTrypanosoma cruzi\u003c/em\u003e is a hemoflagellate protozoan, belonging to the order Kinetoplastida and family Trypanosomatidae, which is the etiologic agent of Chagas disease (CD), also known as American trypanosomiasis [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Approximately 6 to 7\u0026nbsp;million people worldwide are currently infected with \u003cem\u003eT. cruzi\u003c/em\u003e, particularly in Latin American countries [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. The prevalence of CD is higher in countries where the vector transmission of \u003cem\u003eT. cruzi\u003c/em\u003e occurs, whether in the classic form, after the blood meal of a triatomine bug, or by ingesting food contaminated with the crushed vector and/or its feces [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Oral transmission, although accidental, has emerged as the main form of transmission of CD in Brazil, accounting for 75% of new cases [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. The majority of patients (95 to 98%) in the acute phase of CD are asymptomatic [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. However, myocarditis and meningoencephalitis can occur, leading to death, especially in children. Other symptoms can include fever, lymphadenopathy, and hepatosplenomegaly. During the chronic phase, 50\u0026ndash;70% of infected patients are asymptomatic (indeterminate form), 25\u0026ndash;30% have the cardiac form, and 12 to 15% have digestive manifestations [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003cem\u003eT. cruzi\u003c/em\u003e has widely heterogeneous populations, consisting of a variety of strains that circulate in the domestic and wild transmission cycles between insect vectors, humans, and animal reservoirs [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. The genetic lineages of the parasite are classified into six discrete typing units (DTUs), from TcI to TcVI [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Although a seventh DTU, TcBat, was recently described, after it was isolated from bats, which was subsequently found to be capable of infecting humans. These DTUs may have different geographic distributions and are associated with different clinical and epidemiological features. TcII, for example, is often isolated from the blood of chronic patients and is associated with the domestic cycle of transmission in the countries of the Southern Cone of South America, where cardiac manifestations of the disease predominate, but digestive manifestations are also found [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eOral transmission is probably the oldest strategy for the spread of \u003cem\u003eT. cruzi\u003c/em\u003e among mammals. However, the intraperitoneal (IP) inoculation route is the most used in experimental \u003cem\u003ein vivo\u003c/em\u003e infection, mainly in mice. Among the factors related to the parasite that can influence the evolution of the experimental infection are the origin of trypomastigotes (infective forms), in that they can either be isolated from blood or culture, the inoculation route, inoculum volume and concentration, and the parasite DTU [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003cem\u003eT. cruzi\u003c/em\u003e strains may present differentiated tissue tropism, being classified as myotropic, preferentially parasitizing muscle tissue; or macrophagotropic, when they parasitize lymphoid organs. The latter is the case of the Y and Berenice 62 strains of \u003cem\u003eT. cruzi\u003c/em\u003e, which, in addition to the myocardium, have been reported to cause intense tissue parasitism in the liver and spleen of Swiss mice inoculated via the IP route with 100,000 blood trypomastigotes (BT) [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. On the other hand, it was observed that during the acute phase of the experimental infection of BALB/c mice with 1,000 BT of the Y strain (inoculation route not described), although amastigote forms were rarely found in the liver, the inflammation was commonly observed, indicating that this organ is also affected, even with a lower parasite inoculum [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe parasite is exposed to reactive oxygen species generated by its own aerobic metabolism, the host's immune response, and those released by drugs used in the treatment of CD [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Thus, \u003cem\u003eT. cruzi\u003c/em\u003e infection can lead to tissue oxidative stress (OS), which, associated with toxic parasite secretions and a cytotoxic immune response, can contribute to tissue destruction [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. In the blood of BALB/c mice orally inoculated with the Tulahu\u0026eacute;n (TcVI) strain, but not treated with BZ, an increase in AST and ALT enzymes was observed [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. These authors also found that in infections via the oral or gastrointestinal (GI) routes, the stimulated immune response can lead to a more severe infection compared to the IP route, affecting the heart and, more intensely, the liver of the animal.\u003c/p\u003e \u003cp\u003eThe drug used for the etiological treatment of CD is benznidazole (BZ), a nitroheterocyclic derivative that has low efficacy during the chronic phase and important adverse reactions, in addition to alterations in liver enzymes that can be indicative of tissue damage [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. It has already been demonstrated, experimentally \u003cem\u003ein vivo\u003c/em\u003e, that the response to treatment with BZ can vary according to the genotype of \u003cem\u003eT. cruzi\u003c/em\u003e [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e], as well as its DTU [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. In addition to altering aspartate aminotransferase (AST) and alanine aminotransferase (ALT) levels, BZ treatment of mice that had been infected IP with an inoculum as low as 500 BT caused a further increase in OS [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eWe hypothesize that GI infection with the Y strain (TcII) of \u003cem\u003eT. cruzi\u003c/em\u003e is more severe, in terms of virulence and pathogenicity for mice, and responds worse to treatment with BZ, than the infection via the IP route. Given the above, we aimed to investigate the impact of the parasite inoculation route (GI and IP), and treatment with BZ, in the experimental infection of Swiss mice with the Y strain (TcII, macrophagotropic) of \u003cem\u003eT. cruzi\u003c/em\u003e during the acute phase of the infection, using parasitological (parasitemia and parasite load detected by qPCR), biochemical (dosage of liver enzymes and OS), and histopathological parameters in the evaluation of the animals.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e\u0026bull; Infectiousness and survival\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eMice inoculated with 2x10\u003csup\u003e6\u003c/sup\u003e culture-derived metacyclic trypomastigotes (CMT) of the Y strain of \u003cem\u003eT. cruzi\u003c/em\u003e (TcII) presented 100% of infectivity rate (%INF), when infected by either the GI or IP routes (data not shown). During the acute phase of the infection, the survival rate of infected animals, both GI and IP, and not treated with BZ, was 50%. However, as can be seen in the Kaplan-Meier graph, the deaths of animals inoculated by the GI route occurred later, indicating lower virulence by this inoculation route (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.007) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Treatment with BZ avoided lethality in animals inoculated by both routes, during the period of the experiments.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003e• Parasitological And Molecular Parameters\u003c/h3\u003e\n\u003cp\u003eThe mean parasitemia curves of animals inoculated by both routes (GI and IP) are shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea. The untreated (NT) animals, inoculated via the GI route, had parasitemia levels three times lower than those inoculated via the IP route, in addition to a later day of maximum parasitemia peak (Dpmax, 13th day of infection), when compared to the IP-inoculated animals, whose maximum peak (Pmax) occurred on the 8th day of infection (d.i.) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eRegarding the other parasitological parameters derived from the parasitemia curve and obtained from the fresh blood examination (FBE) [pre-patent period (PPP), patent period (PP), Pmax, and the percentage of animals with a positive FBE (%+FBE)], and molecular parameters [percentage of mice with positive real-time polymerase chain reaction (%+qPCR) and the mean parasite load], in the comparison between NT animals inoculated via the GI and via the IP routes, significant differences were observed in three parameters (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e and Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea). In animals inoculated via the GI route, only the PPP was higher than in the IP-inoculated animals, indicating lower virulence of the infection via the GI route, since the higher the PPP, the lower the virulence.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eStatistical comparisons (mean and standard deviation) of the parasitological and molecular parameters of mice inoculated via the gastrointestinal (GI) and intraperitoneal (IP) routes with 2x10\u003csup\u003e6\u003c/sup\u003e culture-derived metacyclic trypomastigotes of the Y strain (TcII) of \u003cem\u003eTrypanosoma cruzi\u003c/em\u003e, treated with benznidazole (BZ 100 mg/kg/day, 20X) from the 5th day of infection, and in untreated controls (NT).\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"8\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eGI\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e \u003cp\u003eIP\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eParameter\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eBZ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003ep\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eNT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eBZ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cem\u003ep\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePPP\u003csup\u003eA\u003c/sup\u003e (days)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e9.5\u0026thinsp;\u0026plusmn;\u0026thinsp;1.4\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAP\u003csup\u003eG\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e4.1\u0026thinsp;\u0026plusmn;\u0026thinsp;0.6\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e3.6\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eNS\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePP\u003csup\u003eB\u003c/sup\u003e (days)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e11.6\u0026thinsp;\u0026plusmn;\u0026thinsp;2.0\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e14.3\u0026thinsp;\u0026plusmn;\u0026thinsp;3.3\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e2.6\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePmax\u003csup\u003eC\u003c/sup\u003e (x10\u003cem\u003e\u0026sup3;)\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e75.7\u0026thinsp;\u0026plusmn;\u0026thinsp;26.4\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e250.9\u0026thinsp;\u0026plusmn;\u0026thinsp;154.7\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e5.7\u0026thinsp;\u0026plusmn;\u0026thinsp;1.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDpmax\u003csup\u003eD\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e13.2\u0026thinsp;\u0026plusmn;\u0026thinsp;2.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e10.3\u0026thinsp;\u0026plusmn;\u0026thinsp;3.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e4.6\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e%+FBE\u003csup\u003eE\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e100.0 (10/10)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026le;\u0026thinsp;0.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e100.0 (10/10)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e20.0 (2/10)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u0026le;\u0026thinsp;0.05\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e%+qPCR\u003csup\u003eF\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e100.0 (5/5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e100.0 (6/6)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNS\u003csup\u003eH\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e100.0 (3/3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e100.0 (5/5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eNS\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNumber of significant reductions\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5/6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e4/6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"8\"\u003e\u003csup\u003eA\u003c/sup\u003e Pre-patent period; \u003csup\u003eB\u003c/sup\u003e Patent period; \u003csup\u003eC\u003c/sup\u003e Number of trypomastigotes / 0.1 mL of blood at parasitemia peak; \u003csup\u003eD\u003c/sup\u003e day of the maximum peak; \u003csup\u003eE\u003c/sup\u003e Percentage of animals with positive fresh blood examination; \u003csup\u003eF\u003c/sup\u003e Percentage of animals with positive qPCR; \u003csup\u003eG\u003c/sup\u003e Absent parasitemia; \u003csup\u003eH\u003c/sup\u003e Not significant. When comparing the inoculation routes of NT animals, values with * (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;\u003cem\u003e0.001\u003c/em\u003e) and ** (\u003cem\u003ep\u0026thinsp;\u0026le;\u0026thinsp;0.05\u003c/em\u003e) on the same line are significantly different. The nonparametric Mann-Whitney test was used.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eThe %+FBE and %+qPCR were 100% for animals infected by both routes and not treated (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). In untreated animals, the parasite load was 0.6 equivalent parasites (par. eq.) per mL of blood for those inoculated via the GI route and 2.3 par. eq./mL for those inoculated via IP route, with no statistically significant difference between the groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb).\u003c/p\u003e\n\u003ch3\u003e• Impact Of Etiological Treatment On Parasitological And Molecular Parameters\u003c/h3\u003e\n\u003cp\u003eThe parasitemia of animals inoculated both by the GI and IP routes was suppressed by the treatment with BZ from the first day of treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea). In animals inoculated via the GI route, BZ treatment promoted a significant reduction in 5/6 parasitological parameters (PPP, PP, Pmax, Dpmax, and %+FBE), while in those inoculated via the IP route, the reduction occurred in 4/6 (PP, Pmax, Dpmax, and %+FBE) (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe qPCR was positive in all animals inoculated via both the GI and IP routes, and in both the treated and untreated groups (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), with the BZ treatment not significantly altering the parasite load of animals (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb).\u003c/p\u003e\n\u003ch3\u003e• Histopathological Parameters In Cardiac Tissue\u003c/h3\u003e\n\u003cp\u003eAmastigote nests were not observed in the histological sections of cardiac tissue of infected animals in any of the groups, which were submitted to euthanasia on the 47th d.i. Except for the animals in the uninfected and untreated (NI) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea) group, inflammatory processes were observed in all other experimental groups, including the animals of the uninfected group that were treated with BZ (NI\u0026thinsp;+\u0026thinsp;BZ) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb, \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec, \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ed, \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ee and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ef).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eNo animal in the NI group had cardiac tissue damage (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eg). A moderate inflammatory process was observed in 83.33% (5/6) of the animals in the infected via GI route and untreated (GINT) group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eg), with focal epicarditis and myocarditis (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb), while an intense inflammatory process was observed in 100% (2/2) of the surviving animals in the infected via IP route and untreated (IPNT) group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eg), with diffuse myocarditis, necrotic cardiac fibers, areas of myocardial fibrosis, and connective tissue deposition as the initial form of the healing process (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec). The animals in the GINT group presented mild (50%; 3/6) to moderate necrosis (33.3%; 2/6), while the two survivors (100%) in the IPNT group presented intense necrotic tissue. Five (83.3%) animals in the GINT group had mild fibrotic tissue, while the other (16.6%) had moderate fibrotic tissue, whereas the two surviving animals in the IPNT group had intense fibrotic tissue (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eg). Although these changes were observed in animals infected by both routes and not treated, they were more intense (+++) in animals from the surviving IPNT group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eg).\u003c/p\u003e\n\u003ch3\u003e• Histopathological Parameters Of Liver Tissue\u003c/h3\u003e\n\u003cp\u003eHistological analysis of the liver of NI animals showed normal morphology with hepatocytes organized in well-defined cell strands, as expected (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn the liver of animals infected both by the GI and IP routes and not treated, amastigote forms were also not detected. However, focal inflammatory processes were observed in the liver parenchyma and the periphery of the portal triad region (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb) and, in some cases, of the central vein (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec). Animals of the GINT group displayed a focus of hepatitis with intensity ranging from mild (4/6; 66.6%) to moderate (2/6; 33.3%), while in those of the IPNT group, focal hepatitis was classified as intense in the two surviving animals (100%) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eg). Although no statistical differences were observed between untreated animals inoculated via the GI and IP routes, in the animals of the GINT group, necrotic tissue was not observed, and 100% (6/6) of them had mild fibrotic tissue. On the other hand, the two surviving animals in the IPNT group had moderate necrotic tissue (100%) and fibrotic tissue ranging from moderate (1/2; 50%) to intense (1/2; 50%).\u003c/p\u003e\n\u003ch3\u003e• Impact Of Etiological Treatment On Histopathological Lesions\u003c/h3\u003e\n\u003cp\u003eThe animals in the uninfected but BZ-treated group had a mild inflammatory process in the heart (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ed), with a significant difference (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) compared to the animals in the NI group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eg).\u003c/p\u003e \u003cp\u003eWhen comparing the hearts of animals in the infected and BZ-treated groups with their respective untreated controls, for each inoculation route, significant differences were observed only between the GI-inoculated animals, regarding inflammatory process and necrotic tissue (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eg). Treatment with BZ promoted a significant reduction (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in the intensity of the inflammatory process with 6/6 (100%) of the infected via GI route and treated (GI\u0026thinsp;+\u0026thinsp;BZ) animals presenting a mild inflammatory process (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ee), against 5/6 (83.3%) and 1/6 (16.6%) of the GINT group that presented a moderate or an intense inflammatory process, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eg). The treatment of GI-inoculated animals also promoted a significant reduction (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in the number of animals with necrotic tissue and the intensity of these lesions, with no animal in the GI\u0026thinsp;+\u0026thinsp;BZ group presenting necrotic tissue against 3/6 (50.0%) with moderate and 2/6 (33.3%) with mild necrotic tissue in the untreated group (GINT) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eg). Therefore, treatment with BZ promoted benefits in animals that had been infected via the GI route. On the other hand, due to the high mortality caused by IP infection route, the number of animals remaining for evaluation in both IP groups was reduced, infected via IP route and treated (IP\u0026thinsp;+\u0026thinsp;BZ) (n\u0026thinsp;=\u0026thinsp;4) and IPNT (n\u0026thinsp;=\u0026thinsp;2). Thus, no significant differences were observed regarding heart lesions, between treated and untreated animals, inoculated by the IP route (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eg).\u003c/p\u003e \u003cp\u003eThe liver tissue of uninfected animals that had been submitted to treatment with BZ presented a mild inflammatory process (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ed- red arrow) in 3/5 (60%) animals and moderate inflammatory process in 1/5 (20%) of the animals evaluated, with a significant difference (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in relation to the NI group, indicating that there was tissue damage in the liver caused by BZ (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eg), with greater intensity than that observed in the cardiac tissue.\u003c/p\u003e \u003cp\u003eRegarding the histopathological lesions of the liver, there were no significant differences between the animals infected by both routes and treated with BZ (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ee and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ef) and their respective untreated controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec). Although without a statistical difference, the BZ treatment of the animals inoculated via the GI route apparently promoted an increase in the intensity of the lesions compared to the untreated animals (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ee). The opposite occurred with the treatment of animals inoculated by the IP route (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ef). Since only two animals in the IPNT group survived, suggesting greater lethality of the CMT forms of the Y strain (TcII) when inoculated by the IP route, the small number (n) of animals in this group interfered in the result of the statistical analyses. In animals infected with the macrophagotropic Y strain, these data suggest that BZ may increase the intensity of lesions in the liver (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eg), the organ where it is metabolized, promoting fewer benefits for the GI infection compared to IP infection, and differently from what was observed in the heart (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eg).\u003c/p\u003e\n\u003ch3\u003e• Biochemical Parameters\u003c/h3\u003e\n\u003cp\u003eThe results of the measurements of plasma liver enzymes and hepatic OS from the different experimental groups are shown in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. In NT animals infected via the GI route, the enzymes AST and ALT, but not alkaline phosphatase (ALP), presented higher values (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;0.05) than the NI animals. In NT animals infected via the IP route, only the ALT enzyme showed a significant change (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;0.05) compared to NI animals (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). These results show that infection, mainly via the GI route, promotes an increase in liver enzymes.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePlasma markers and oxidative stress parameters of liver injury in mice inoculated via the gastrointestinal (GI) and intraperitoneal (IP) routes with 2x10\u003csup\u003e6\u003c/sup\u003e culture-derived metacyclic trypomastigotes/animal of the Y strain (TcII) of \u003cem\u003eTrypanosoma cruzi\u003c/em\u003e, treated with benznidazole (BZ) (100 mg/kg/day, 20X), and untreated controls. Data are the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error of 3\u0026ndash;6 animals.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"7\" nameend=\"c7\" namest=\"c1\"\u003e \u003cp\u003eExperimental groups\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eParameters\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNI\u0026thinsp;+\u0026thinsp;BZ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGINT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eGI\u0026thinsp;+\u0026thinsp;BZ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eIPNT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eIP\u0026thinsp;+\u0026thinsp;BZ\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"7\" nameend=\"c7\" namest=\"c1\"\u003e \u003cp\u003ePlasma parameters of liver damage (U\u0026middot;L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAST\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e70.9\u0026thinsp;\u0026plusmn;\u0026thinsp;5.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e97.5\u0026thinsp;\u0026plusmn;\u0026thinsp;7.6\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e140.0\u0026thinsp;\u0026plusmn;\u0026thinsp;9.8\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e91.7\u0026thinsp;\u0026plusmn;\u0026thinsp;8.3\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e93.7\u0026thinsp;\u0026plusmn;\u0026thinsp;12.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e82.9\u0026thinsp;\u0026plusmn;\u0026thinsp;4.7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eALT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e51.1\u0026thinsp;\u0026plusmn;\u0026thinsp;4.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e94.7\u0026thinsp;\u0026plusmn;\u0026thinsp;6.3\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e81.6\u0026thinsp;\u0026plusmn;\u0026thinsp;5.3\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e61.1\u0026thinsp;\u0026plusmn;\u0026thinsp;4.3\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e76.0\u0026thinsp;\u0026plusmn;\u0026thinsp;9.1\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e43.2\u0026thinsp;\u0026plusmn;\u0026thinsp;3.9\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eALP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e143.7\u0026thinsp;\u0026plusmn;\u0026thinsp;12.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e132.7\u0026thinsp;\u0026plusmn;\u0026thinsp;12.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e124.4\u0026thinsp;\u0026plusmn;\u0026thinsp;13.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e157.5\u0026thinsp;\u0026plusmn;\u0026thinsp;13.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e212.8\u0026thinsp;\u0026plusmn;\u0026thinsp;31.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e210.6\u0026thinsp;\u0026plusmn;\u0026thinsp;27.8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"7\" nameend=\"c7\" namest=\"c1\"\u003e \u003cp\u003eHepatic oxidative stress parameters\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGSH (nmol\u0026middot;mg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e8.24\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e6.02\u0026thinsp;\u0026plusmn;\u0026thinsp;0.65\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3.47\u0026thinsp;\u0026plusmn;\u0026thinsp;0.35\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e6.19\u0026thinsp;\u0026plusmn;\u0026thinsp;0.72\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e6.12\u0026thinsp;\u0026plusmn;\u0026thinsp;0.21\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e7.80\u0026thinsp;\u0026plusmn;\u0026thinsp;0.63\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCatalase (mmol\u0026middot;min\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e\u0026middot;mg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.26\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.43\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.39\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.34\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.33\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.29\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCarbonyl groups (nmol\u0026middot;mg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2.60\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3.87\u0026thinsp;\u0026plusmn;\u0026thinsp;0.20\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3.46\u0026thinsp;\u0026plusmn;\u0026thinsp;0.28\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3.95\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e3.98\u0026thinsp;\u0026plusmn;\u0026thinsp;0.12\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e3.21\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09\u003csup\u003e*,**\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"7\"\u003eNI, uninfected; NI\u0026thinsp;+\u0026thinsp;BZ, uninfected and treated; GINT, inoculated via the gastrointestinal (GI) route and untreated; GI\u0026thinsp;+\u0026thinsp;BZ, inoculated via the GI route and treated; IPNT, inoculated via the intraperitoneal (IP) route and untreated; IP\u0026thinsp;+\u0026thinsp;BZ, inoculated via the IP route and treated. GSH, Reduced glutathione.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"7\"\u003eFor plasma parameters of liver damage: values with * are different from NI; and ** are different from NT, within the same route (\u003cem\u003ep\u0026thinsp;\u0026le;\u0026thinsp;0.05\u003c/em\u003e).\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"7\"\u003eFor hepatic OS parameters, values with different symbols (* and **), on the same row, are different (\u003cem\u003ep\u0026thinsp;\u0026le;\u0026thinsp;0.05\u003c/em\u003e).\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eIn the liver OS parameters of NT animals, only infection via the GI route resulted in decreased levels of reduced glutathione (GSH), which means an increase in tissue OS in this condition. Infection both by the GI and IP routes caused an increase in protein carbonyl groups, suggesting an increase in tissue injury (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\n\u003ch3\u003e• Impact Of Etiological Treatment On Biochemical Parameters\u003c/h3\u003e\n\u003cp\u003eIn the plasma parameters of liver damage, treatment with BZ in uninfected animals (NI\u0026thinsp;+\u0026thinsp;BZ group) caused a significant increase (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;0.05) in the levels of AST and ALT enzymes, showing that the drug, by itself, affects the liver (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Treatment with BZ, however, reduced the AST enzyme level in animals infected via the GI route, and ALT in animals infected by both routes, showing that the treatment reversed the effects of infection and promoted some benefits (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). For the ALP enzyme, there was no significant alteration caused either by the infection or the drug.\u003c/p\u003e \u003cp\u003eIn the analysis of the OS parameters, it was observed that BZ caused a significant increase only in the carbonyl groups of proteins for the animals in the NI\u0026thinsp;+\u0026thinsp;BZ group (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). For animals infected via the GI route, a significant increase in GSH was observed in treated animals compared to GINT (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). In the animals infected via the IP route, although BZ promoted a significant reduction in the carbonyl groups, the values of this parameter did not return to the level of NI animals.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eDespite the wide diversity in \u003cem\u003eT. cruzi\u003c/em\u003e strains and DTUs, the Y strain of \u003cem\u003eT. cruzi\u003c/em\u003e, belonging to the DTU TcII, is one of the most used in experimental studies around the world. Initially, in the treatment with BZ and nifurtimox of Swiss mice inoculated via the IP route with BT forms, the Y strain was considered partially resistant to drugs \u003cem\u003ein vivo\u003c/em\u003e, since around 50% of treated animals were not considered cured [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. However, in these studies, the authors did not use cyclophosphamide (Cy) immunosuppression or the qPCR technique to monitor the cure of animals undergoing etiological treatment. In the current study, in which stricter cure criteria was used, we obtained a cure rate of 0% in Swiss animals inoculated with the Y strain by both the GI and IP routes with the same inoculum and treated with the same BZ regime. This \u003cem\u003eT. cruzi\u003c/em\u003e strain should therefore be considered resistant to BZ, since no animal treated was cured, which is corroborated by the literature when similar cure criteria was used [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn the present study, the infection of mice with CMT of the Y strain (TcII) by both inoculation routes (GI and IP) caused 50% mortality in these animals within the experimental period. However, deaths occurred later in the animals inoculated via the GI route, suggesting a lower severity of this inoculation route for this \u003cem\u003eT. cruzi\u003c/em\u003e strain. Nonetheless, this needs to be verified with other strains of the same DTU. Dias et al. [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e], using trypomastigotes of the same origin and strain, and in the same inoculum, in the infection of animals, also found no differences in the mortality rate between the two inoculation routes; however, they observed mortality rates higher than those in the present study: 90% and 100%, respectively, for the GI and IP routes. Differences in the maintenance time of the strain in the culture medium, before inoculation of the animals, can lead to differences in its infectivity and lethality for mice. However, in the current study, BZ prevented lethality in the infection by both routes, even though the mice were not parasitologically cured by the etiological treatment, which is similar to that which was observed in the study of Zanusso Jr et al. [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eWhen comparing the parasitological parameters between the routes (GI x IP), the levels of parasitemia were about three times lower following inoculation by the GI route compared to the IP route, suggesting lower virulence of the Y strain via the GI route. These data corroborate the histopathological findings observed in the cardiac tissue of these animals, in which an inflammatory process (epicarditis and myocarditis), necrotic cardiac fibers, and a healing process (tissue fibrosis) of lower intensity were observed in animals inoculated via the GI route when comparing with the animals inoculated via the IP route.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003eAnimals infected via the GI route also had higher PPP and lower parasite compared to those inoculated by the IP route, although the difference in parasite load was not significant, due to the low number of animals (3/6) surviving in the group infected via the IP route (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb). Blood samples used to determine parasite load by qPCR were collected on the 27th d.i., which corresponds to the beginning of the chronic phase in the experimental infection. Dias et al. [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e] also observed lower virulence for mice infected with CMT of the Y strain via the GI route compared to the IP route, when considering the parameters PPP, PP, and maximum peak of parasitemia.\u003c/p\u003e \u003cp\u003eWhen evaluating the impact of BZ treatment on parasitological parameters derived from the parasitemia curve (PPP, PP, Pmax, and Dpmax) and %+FBE, as well as %+qPCR, a significant reduction was observed in 4/6 parameters, in animals infected by both the GI and IP routes. In addition, BZ suppressed the parasitemia in animals infected by both inoculation routes evaluated (GI and IP) during the entire course of treatment, which is in agreement with the literature, where a cure rate of 50% has been reported for IP-inoculated animals [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e], and 0 to 12.5% for GI-inoculated animals [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e] for the Y strain infection. In other words, parasitemia is suppressed by treatment with BZ, even in mice infected via the GI route despite lower rates of cure. However, in the present study no significant differences were observed in the parasite load between the inoculation routes or between treated animals and untreated controls.\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eImportant adverse reactions caused by the antiparasitic drugs BZ and nifurtimox (NX), used in the treatment of CD, have already been reported in the literature, including areas of necrosis, periportal inflammatory infiltrates, and vascular congestion in the liver [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. On the other hand, in the Brazilian Amazon region, familial microepidemics of acute CD, acquired by oral transmission, through the ingestion of food contaminated by the parasite, mainly palm fruits such as a\u0026ccedil;a\u0026iacute;, have also been observed. These cases present more severe conditions than those acquired by the classical vector route (contamination by triatomine excreta) and may present greater lethality [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Medicines administered orally, as well as pathogens acquired by this route, after being absorbed by the intestinal gastric mucosa, are transported to the hepatic portal system [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. In addition, the liver is affected in the acute \u003cem\u003eT. cruzi\u003c/em\u003e infection and has the function of clearing blood trypomastigotes [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eIn the cardiac tissue of the groups infected and treated with BZ, a decrease in tissue damage was observed only in the animals inoculated via the GI route. The intensities of the lesions went from moderate to mild, which did not happen with the animals inoculated by the IP route, in which the lesions remained intense, even after the etiological treatment. That is, in infection with the Y strain (TcII), in addition to the GI route causing less intense histopathological changes in the heart, the animals infected via this route responded better to treatment with BZ than those infected via the IP route in terms of reducing cardiac lesions. In a study with Swiss mice inoculated by the IP route with two strains of TcII (PR1219 and PR2259), an increase in the number of tissue lesions in different organs (including the heart) of animals treated in the acute phase with BZ, was observed during the chronic phase of infection. However, this number was still lower than in infected animals that were left untreated [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. As the parasite load becomes controlled, inflammatory and oxidative processes decrease in skeletal muscle, colon, and stomach tissues; however, mitochondrial function deterioration, which is responsible for the production of free radicals, persists in the heart muscle, contributing to the lesions found in CD [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eIn the present study, the analysis of plasma enzymes showed an increase in AST and ALT levels only in the infection via the GI route, and there was no significant change in ALP by either parasite inoculation route. These data suggest damage at the hepatocellular level in GI-inoculated animals, leading to the release of these enzymes into the bloodstream and an increase in their serum levels [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Increased AST levels indicate hepatic necrosis and may occur in parasitic infections. The ALT enzyme is found in high concentrations in the liver and its origin is predominantly cytoplasmic, being a sensitive marker of liver damage. These data suggest that the Y strain (TcII, macrophagotropic), when inoculated via the GI route, unlike what was observed in the heart, causes more changes in the liver than when inoculated via the IP route. These data corroborate Barreto-de-Albuquerque et al. [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e], who found that BALB/c mice orally inoculated with the Tulahu\u0026eacute;n (TcVI) strain had liver damage, given the increased serum levels of AST and ALT, which was further confirmed by histology.\u003c/p\u003e\u003cp\u003eHowever, our histopathological findings showed more intense lesions in the liver tissue of animals inoculated via the IP route, even though they were not significant due to the low number of surviving animals; there was an increase in hepatic sinusoids due to obstruction of blood vessels, caused by fibrosis, and also by a greater blood supply due to heart failure caused by the intense myocardial lesions found in this group. The group of IPNT animals showed increased serum levels only for the ALT enzyme. For AST, even with a tendency to increase, it was not significant, due to the greater virulence of the IP route, with a consequent higher mortality, making these analyses difficult. Despite these limitations, these findings confirm the study by Novaes et al. [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e], carried out with male C57BL/6 mice infected via the IP route with the Y strain (5,000 BT forms), which presented high serum levels of AST and ALT enzymes. However, this same study also recorded an increase in these enzymes in animals that received BZ only.\u003c/p\u003e\u003cp\u003eIn the present study, BZ administered to uninfected mice caused a significant increase in AST and ALT enzymes, confirming that this drug causes liver damage in uninfected animals [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. This was also confirmed by the increase in liver OS in NI\u0026thinsp;+\u0026thinsp;BZ animals, demonstrated by the increase in the carbonyl groups of proteins and by histopathological analyses that showed a mild inflammatory process in the organ. On the other hand, the etiological treatment promoted a reduction in the dosage of the two enzymes in animals infected via the GI route, and only in the ALT of those infected via the IP route, showing a reversal of the condition caused by the drug. This result suggests a greater benefit of etiological treatment in the infection via the GI route.\u003c/p\u003e\u003cp\u003eIndividually, infection with \u003cem\u003eT. cruzi\u003c/em\u003e and the treatment with BZ caused an increase in OS and tissue alterations in the liver, corroborating the literature [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Although the etiological treatment reduced the serum levels of the plasma enzymes (AST and ALT) in infected and treated animals, the analysis of OS markers in the liver indicated an increase in the production of carbonyl groups in the treated animals inoculated by both routes. The production of carbonyl groups is used as a marker of free radical-mediated protein oxidation, which is indicative of tissue damage [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e], corroborating our histopathological findings in the animals infected and treated with BZ.\u003c/p\u003e\u003cp\u003eAlthough exposure to BZ was harmful to liver tissue [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e], treatment attenuated the inflammatory processes caused by both infection routes, mainly in the heart. Gruendling et al. [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e] also observed a significant reduction in the number of organs undergoing an inflammatory process in Swiss mice infected with strains belonging to three DTUs (TcI, TcII, and TcIV) and submitted to treatment with BZ. Our results also showed positive changes in OS parameters in the liver after treatment. After the reduction of GSH values in animals infected via the GI route, the BZ treatment promoted a return to its normal levels, suggesting a reduction in OS and another benefit of the treatment for infection caused by the GI route. In the IP infection, BZ also promoted benefits, demonstrated by the reduction of carbonyl groups; however, a study by Novaes et al. [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e], who also used the Y strain, but with an inoculum of 5,000 BT, contradict our findings, associating the BZ treatment of infected animals with a more severe OS.\u003c/p\u003e\u003cp\u003eThe lower severity of infection with Y strain (TcII) in mice when inoculated via the GI route, compared to IP route infection, observed in the present study, contrasts with the greater severity and worse response to treatment observed in mice infected via the GI route with TcIV strains [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. It is possible that different strains/DTUs of \u003cem\u003eT. cruzi\u003c/em\u003e, whose composition of surface glycoproteins of their developmental forms may differ [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e], can stimulate different reactions in combination with treatment and infection routes, given that the genetic diversity of the species may have an important impact on the biological and medical properties of the parasite such as virulence, pathogenicity, and drug resistance [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eThe Y strain used in this study was maintained through alternating passages in mice and liver infusion tryptose (LIT) acellular culture medium \u003cem\u003ein vitro\u003c/em\u003e. It is known that the Y strain, isolated from a patient in 1950, becomes more virulent after successive passages in mice [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. The conditions used in the maintenance of \u003cem\u003eT. cruzi\u003c/em\u003e strains may result in a artificial selection for some subpopulations, and a strain may be the result of the interaction of these subpopulations that are selected after a few years of maintenance in the laboratory [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. In addition to biological and genetic diversity, which can influence the behavior of the \u003cem\u003eT. cruzi\u003c/em\u003e strain, differences in the time of maintenance of the strain in the culture medium before inoculation, and inoculum volume and concentration, may also contribute to differences in its infectivity, pathogenicity, and lethality in mice. The results obtained in this study, in general, allow us to reject our working hypothesis, since the infection with CMT of the Y strain (TcII) by the GI route was less severe and responded better to BZ treatment than the infection via the IP route, contradicting the findings obtained in BALB/c mice with the Tulauhen (TcVI) strain [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e], which found greater severity of infection via the oral and GI routes compared to the IP route. However, the strain influences the resistance of the host, some can be extremely virulent, such as the Y strain [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e], while others not, such as Tulahuen [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. They also contradict the findings obtained in Swiss mice inoculated with TcIV strains from Amazonas state (Brazilian Amazon region), which observed, in addition to greater virulence by the GI route [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e], a worse response to treatment with BZ [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Therefore, the results of the present study suggest that both the severity and the response to treatment of oral/GI infection by \u003cem\u003eT. cruzi\u003c/em\u003e depend on the strain or DTU of the parasite. We must also consider the conditions of origin, maintenance of these strains, and experimental models used, all of which may influence the course of \u003cem\u003eT. cruzi\u003c/em\u003e infection.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eSwiss mice infected with the Y strain (TcII) via the GI route displayed lower levels of parasitemia, with a later peak, and less intense lesions in the heart and liver than mice infected via the IP route, suggesting a lower severity of infection for this strain of \u003cem\u003eT. cruzi\u003c/em\u003e when inoculated by the GI route. Although animals infected by both the GI and IP routes had a mortality rate of 50%, deaths occurred later in those inoculated via the GI route, also suggesting a lower lethality rate of this route. Furthermore, these data suggest that the severity of the infection route depends on the strain or DTU of \u003cem\u003eT. cruzi\u003c/em\u003e.\u003c/p\u003e\u003cp\u003eBZ administered to uninfected mice caused a focal inflammatory process in the heart and liver of animals, although mild, and increased plasmatic parameters of liver damage and OS, confirming that the drug alone causes liver damage in these animals.\u003c/p\u003e\u003cp\u003eAlthough liver damage and OS parameters suggested greater severity of the GI route, with increased levels of AST and ALT enzymes and reduced levels of GSH, compared to an increase only in ALT in IP-inoculated animals, both BZ and \u003cem\u003eT. cruzi\u003c/em\u003e infection alone caused tissue alterations and increased OS in the liver of mice. However, the BZ treatment of the infected animals reverted this situation with the return to normal enzymatic levels, suggesting reversion of liver damage and OS, another benefit of the treatment in addition to parasite clearance.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e\u0026bull; Ethical aspects\u003c/h2\u003e \u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003e The use, maintenance, and care of the mice followed the guidelines of the National Council for the Control of Animal Experimentation (CONCEA), and we complied with the ARRIVE guidelines. The research was approved by the Ethics Committee on the Use of Animals of the State University of Maring\u0026aacute; (UEM) (registration number 9659251017/2017). The animals were kept in polyethylene cages (dimensions 20x32x21 cm) on microenvironmental shelves (AL20 - Alesco\u0026reg;) with water and food \u003cem\u003ead libitum\u003c/em\u003e and light/dark cycle (12/12 h). For organ collection (heart and liver), animals were euthanized by deepening anesthetic with administration of the association of ketamine (50 mg/kg) and xylazine (10 mg/kg) intraperitoneally.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003e• Parasites\u003c/h3\u003e\n\u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eThe Y strain of \u003cem\u003eT. cruzi\u003c/em\u003e genotyped as TcII was used [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. This strain presents tropism for lymphoid organs, parasitizing preferentially the liver and spleen, in addition to the heart [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Furthermore, it is highly virulent to albino mice and was found to be partially resistant to BZ and NX in animals inoculated via the IP route with BT forms [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e], and resistant to BZ in mice inoculated via the GI route with 2x10\u003csup\u003e6\u003c/sup\u003e CMT/animal [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe parasites were maintained through alternating passages between Swiss mice and LIT acellular culture medium supplemented with 10% heat-inactivated PBS, pH 7.4. To obtain the metacyclic forms, the blood with the trypomastigote forms of the Y strain was incubated in LIT culture medium in a Biochemical Oxygen Demand (B.O.D.) to obtain the epimastigote forms. Cultures were maintained axenic at 28\u0026deg;C in a stationary growth phase for at least 15 days before inoculation of experimental animals. The parasites present in the culture were counted in a Neubauer chamber and the inoculum was adjusted to 2x10\u003csup\u003e6\u003c/sup\u003e CMT/ 1.0 mL.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e\n\u003ch3\u003e• Inoculation Of Animals\u003c/h3\u003e\n\u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eWe used 60 Swiss male mice, 21 to 28 days old, from the Central Animal Facility of UEM. Twenty animals were inoculated via the GI route and 20 via the IP route, with 2x10\u003csup\u003e6\u003c/sup\u003e CMT in 1.0 mL of LIT medium [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. GI inoculation was performed by gavage with a special cannula (Biomedical Needles, Popper \u0026amp; Sons, Inc., New York, USA) and a volume of 1.0 mL of the inoculum was injected into the stomach, as used for IP inoculation. The animals inoculated via the GI route have previously fasted for approximately 12 h. The remaining 20 animals were not inoculated and served as uninfected controls.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e\n\u003ch3\u003e• Experimental Groups\u003c/h3\u003e\n\u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eThe animals were divided into six experimental groups with 10 animals each, as follows: 1) Uninfected and untreated (NI); 2) Uninfected and treated (NI\u0026thinsp;+\u0026thinsp;BZ); 3) Infected via GI route and untreated (GINT); 4) Infected via GI route and treated (GI\u0026thinsp;+\u0026thinsp;BZ); 5) Infected via IP route and untreated (IPNT); 6) Infected via IP route and treated (IP\u0026thinsp;+\u0026thinsp;BZ).\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e\n\u003ch3\u003e• Etiological Treatment\u003c/h3\u003e\n\u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eThe etiological treatment consisted of administering a dose of 100 mg/kg/day of BZ (LAFEPE\u0026reg;, Pernambuco, Brazil) by gavage, for 20 consecutive days, starting on the 5th d.i. All infected groups, ~\u0026thinsp;48 h after the end of treatment with BZ, underwent immunosuppression with cyclophosphamide (Cy, Genuxal, Baxter, Brazil), at a dose of 50 mg/kg/day, for four consecutive days in the first week and three alternate days in the following two weeks [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e\n\u003ch3\u003e• Parasitological Assessments\u003c/h3\u003e\n\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eFresh blood examination (FBE)\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eThis test was performed on all inoculated animals before, during, and after treatment with BZ to confirm the infection and plot the parasitemia curve. The parasitemia was evaluated daily from the 3rd d.i. until negative results for three consecutive days [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. Parasitemia was also evaluated, on alternate days, during and after the administration of the immunosuppressive agent (Cy), to verify the reactivation of the infection, characterized by the return of patent parasitemia and increased mortality. From the mean parasitemia curve, the following parameters were obtained: PPP, first day on which positive FBE was detected; PP, mean of the periods in which each animal had the parasitemia detected by the FBE; Pmax, mean obtained from the detected parasitemia peak for each animal; and Dpmax, mean of the days on which each animal had the peak of parasitemia detected. With the results of this test, the %+FBE was obtained.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eReal-time polymerase chain reaction (qPCR)\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eThe qPCR test was performed to detect \u003cem\u003eT. cruzi\u003c/em\u003e DNA and quantify the blood parasite load. Blood samples for qPCR analysis were collected on the 47th d.i., after the Cy immunosuppression period. DNA was extracted by the phenol/chloroform method, as described by Caldas et al [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e], and modified by Gruendling et al. [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. The DNA obtained was analyzed using the QuantiNova SYBR Green PCR kit (Qiagen) with 100 ng of total genomic DNA, using the primers TCZ-F (5' \u0026ndash;GCTCTTGCCCACAMGGGTGC\u0026ndash; 3') and TCZ-R (5' \u0026ndash;CCAAGCAGCGGATAGTTCAGG\u0026ndash; 3') [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Samples were amplified in LightCycler\u0026reg; 480 by denaturation at 95\u0026deg;C for 2 minutes, 35 cycles of amplification at 95\u0026deg;C for 15 seconds, and 60\u0026deg;C for 10 seconds. To monitor primer-dimers or the formation of non-specific products, an analysis of the melting curve from 65\u0026deg;C to 97\u0026deg;C was performed at the end of each assay.\u003c/p\u003e \u003cp\u003eA standard curve was established using purified \u003cem\u003eT. cruzi\u003c/em\u003e DNA; serial dilutions ranging from 100 to 0.001 ng of DNA were added to the reaction plate wells in triplicate. The standard curve was generated by the LightCycler\u0026reg; 96 software and was used to calculate the equivalent parasite ratio in each sample. The equivalent parasites (par. eq.) per mL of blood were based on the amount of DNA per epimastigote cell, in which 200 fg/parasite were considered [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. With these results, the percentage of mice with positive qPCR (%+qPCR) and the mean parasite load for each experimental group were obtained.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eInfectiousness and survival rate\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eAnimals with positive FBE and/or qPCR were considered infected. The %INF was obtained by the ratio between the number of infected animals and the number of inoculated animals X 100. Deaths were recorded throughout the experiments and the survival rates of the different groups were compared using the Kaplan-Meyer plot.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003e• Histopathological Evaluations\u003c/h3\u003e\n\u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eWe evaluated 2\u0026ndash;6 animals per experimental group. The animals were euthanized and had their heart and liver collected 48 h after the end of immunosuppression, on the 47th d.i.\u003c/p\u003e \u003cp\u003eFragments of these organs were first fixed in 10% formalin and were preserved in 70% alcohol after 24 h. After dehydration and diaphanization, the tissues were embedded in paraffin. Subsequently, they were cut into 5 \u0026micro;m thick sections, separated by 25 \u0026micro;m intervals, placed on microscope slides (four sections per slide), and then were stained with hematoxylin-eosin. The sections were examined under an optical microscope in a 40X objective, and the photomicrographs were obtained using the Optical Microscopy OPTHD software Copyright\u0026copy; 2003\u0026ndash;2017.\u003c/p\u003e \u003cp\u003eFour sections per animal were counted and individual data were determined as the average of the results of the four sections. The histopathological parameters analyzed included of tissue parasitism, inflammatory process, tissue necrosis, and tissue fibrosis.\u003c/p\u003e \u003cp\u003eFor the analysis of the inflammatory infiltrate, the presence of 10 or more inflammatory cells per field was considered as an inflammatory process and was classified as follows: absent (\u0026ndash;) (without the presence of minimal inflammatory cells), mild (+) (10\u0026ndash;25 cells), moderate (++) (26\u0026ndash;50 cells) and intense (+++) (\u0026gt;\u0026thinsp;50 cells) [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eTissues with nuclear pyknosis (nucleus with basophil staining and reduced size), karyolysis (absence of nucleus) and dispersion of the nucleus in the cytoplasm were considered as necrosis. Tissue fibrosis was characterized by the presence of fibroblasts, accumulation of connective tissue and excessive deposition of collagen fibers occupying the space of lost cardiac cells [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Tissue necrosis and fibrosis alterations were classified according to lesion severity and distribution, (-) normal histological appearance; (+) mild and focal lesion; (++) moderate multifocal or diffuse lesion; (+++) intense multifocal or diffuse lesion.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e\n\u003ch3\u003e• Biochemical Assessments\u003c/h3\u003e\n\u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eThe following plasma parameters of liver damage were evaluated: dosages of the enzymes AST, ALT, and ALP; and OS parameters: dosages of GSH, catalase and protein carbonyl groups.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cdiv id=\"Sec25\" class=\"Section2\"\u003e \u003ch2\u003eDosage of plasma liver enzymes\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eThe enzymes AST, ALT, and ALP were measured in blood plasma by spectrophotometry (Hitachi U-3000 spectrophotometer) with commercial kits from Gold Analyze Diagnostica Ltda. (Belo Horizonte, MG, Brazil). The blood of the animals was collected by cardiac puncture, 48 h after the end of treatment with BZ and 48 h after the end of immunosuppression, using sodium heparin as an anticoagulant, and was centrifuged at 252 g for 20 minutes to separate the plasma. Subsequently, the plasma samples were transferred to Eppendorf microtubes and were frozen at -4 \u0026ordm;C, until use.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec26\" class=\"Section2\"\u003e \u003ch2\u003eOxidative stress (OS) in the liver\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eAfter euthanasia, the liver was clamped and kept in liquid nitrogen. For the preparation of the organ homogenate, the Van Potter-Elvehjem homogenizer was used with 10 volumes of 0.1 M potassium phosphate buffer (pH 7.4), in an ice bath, and an aliquot was separated for use as the total homogenate. The remaining homogenate was centrifuged at 11,000 g for 15 minutes and the supernatant was separated as a soluble fraction of the homogenate. GSH was measured spectrofluorimetrically (excitation at 350 nm and emission at 420 nm) using the o-phthaloaldehyde assay as described previously [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. Catalase activity was estimated by measuring the change in absorbance at 240 nm using H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e as substrate and the results were calculated using the molar extinction coefficient (ε) of 9.6x10-3 M-1 \u0026bull; cm-1. Protein carbonyl groups were measured spectrophotometrically using 2,4-dinitrophenylhydrazine [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e] and their levels were calculated using the molar extinction coefficient (ε) of 2.20x10-4 M-1 \u0026bull; cm -1.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec27\" class=\"Section2\"\u003e \u003ch2\u003e\u0026bull; Statistical analysis\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eStatistical analysis of parasitological parameters was performed as follows: PPP, PP, Pmax, Dpmax, and parasite load were compared with the non-parametric tests of Mann-Whitney or Krust-Wallis, using the Biostat software, version 5.3 (Bel\u0026eacute;m, PA, Brazil). The parameters %+FBE, %+qPCR, and %INF were compared by the chi-square test (χ\u003csup\u003e2\u003c/sup\u003e). In the analysis of biochemical parameters, the mean and standard error were used. The Kaplan-Meier graph of the GraphPad Prism 5.0 software was used to compare the survival rate. Fisher\u0026rsquo;s exact test was used to compare the intensity of histopathological lesions and the proportion of organs with alterations, using the Biostat software, version 5.3.\u003c/p\u003e \u003cp\u003eStatistical comparisons were made between uninfected and infected animals, between inoculation routes (GI x IP) and between BZ-treated and untreated animals (GI\u0026thinsp;+\u0026thinsp;BZ x GINT, IP\u0026thinsp;+\u0026thinsp;BZ x IPNT). Differences with a p-value\u0026thinsp;\u0026le;\u0026thinsp;0.05 were considered significant.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e\n\n"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAdditional information\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo the Coordination for the Improvement of Higher Education Personnel (CAPES), Brazil, Financing Code 001.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by grants from the Araucaria Foundation for Scientific and Technological Development through the Basic and Applied Research Support program (251/2014, number 10943812) and from the National Council for Scientific and Technological Development (CNPq) through the Research Productivity program (PQ \u0026ndash; 2014, number 305853/2014\u0026ndash;7) to MJOT. The funders did not have any role in study design, data collection, management, analysis, data interpretation, manuscript writing, and the decision to submit the manuscript for publication.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eEthics approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll methods were performed in accordance with the relevant guidelines and regulations of the National Council for the Control of Animal Experimentation (CONCEA), and ARRIVE guidelines. The research was approved by the Ethics Committee for the Use of Animals of Maring\u0026aacute; State University (UEM) (registration number 9659251017/2017).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eData Availability\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or analyzed during the current study are available from the corresponding author on request.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eChagas, C. Nova tripanozomiase humana. Estudos sobre a morfolojia e o ciclo evolutivo do \u003cem\u003eSchizotrypanum cruzi\u003c/em\u003e n. gen., n. sp., ajente etiol\u0026oacute;jico de nova entidade m\u0026oacute;rbida do homem. \u003cem\u003eMem. Inst. Oswaldo Cruz. \u003c/em\u003e\u003cstrong\u003e1\u003c/strong\u003e, 159-218 (1909).\u003c/li\u003e\n\u003cli\u003eWHO. Chagas disease (also known as American trypanosomiasis) \u0026ndash; Fact Sheet. \u003cem\u003eWorld Health Organization\u003c/em\u003e. Available: https://www.who.int/news-room/fact-sheets/detail/chagas-disease-(american-trypanosomiasis) (2021). \u003c/li\u003e\n\u003cli\u003eBarreto-de-Albuquerque, J. \u003cem\u003eet al\u003c/em\u003e. \u003cem\u003eTrypanosoma cruzi\u003c/em\u003e Infection through the Oral Route Promotes a Severe Infection in Mice: new disease form from an old infection? \u003cem\u003ePLoS Negl. Trop. Dis.\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, 1-21 (2015).\u003c/li\u003e\n\u003cli\u003eBRASIL. Doen\u0026ccedil;a de Chagas: 14 de abril | Dia mundial. Boletim Epidemiol\u0026oacute;gico especial: abril 2021. \u003cem\u003eMinist\u0026eacute;rio da Sa\u0026uacute;de. Secretaria de Vigil\u0026acirc;ncia em Sa\u0026uacute;de.\u003c/em\u003e Available in: https://www.gov.br/saude/pt-br/assuntos/saude-de-a-a-z/d/doenca-de-chagas (2021). \u003c/li\u003e\n\u003cli\u003eSim\u0026otilde;es, M.V., Romano, M.M.D., Schmidt, A., Martins, K.S.M. \u0026amp; Marin-Neto, J.\u0026Aacute;. Chagas Disease Cardiomyopathy\u003cem\u003e. Int. J. Cardiovasc. Sci\u003c/em\u003e. \u003cstrong\u003e31\u003c/strong\u003e,\u003cstrong\u003e \u003c/strong\u003e173-189 (2018).\u003c/li\u003e\n\u003cli\u003eDias, J.C.P. \u003cem\u003eet al\u003c/em\u003e. II Consenso Brasileiro em Doen\u0026ccedil;a de Chagas, 2015. \u003cem\u003eEpidemiol. Serv. Sa\u0026uacute;de.\u003c/em\u003e \u003cstrong\u003e25\u003c/strong\u003e, 1-21 (2016).\u003c/li\u003e\n\u003cli\u003eCoura, J.R. Tripanosomose, Doen\u0026ccedil;a de Chagas. \u003cem\u003eCi\u0026ecirc;nc. Cult.\u003c/em\u003e \u003cstrong\u003e55\u003c/strong\u003e,\u003cstrong\u003e \u003c/strong\u003e30-33 (2003). \u003c/li\u003e\n\u003cli\u003eDias, J.C.P. Notas sobre o \u003cem\u003eTrypanosoma cruzi\u003c/em\u003e e suas caracter\u0026iacute;sticas bio-ecol\u0026oacute;gicas, como agente de enfermidades transmitidas por alimentos. \u003cem\u003eRev. Soc. Bras. Med. Trop.\u003c/em\u003e \u003cstrong\u003e39\u003c/strong\u003e, 370-375 (2006).\u003c/li\u003e\n\u003cli\u003eZingales, B. \u003cem\u003eet al\u003c/em\u003e. A new consensus for \u003cem\u003eTrypanosoma cruzi\u003c/em\u003e intraspecific nomenclature: second revision meeting recommends TcI to TcVI. \u003cem\u003eMem. Inst. Oswaldo Cruz\u003c/em\u003e. \u003cstrong\u003e104\u003c/strong\u003e, 1051-1054 (2009).\u003c/li\u003e\n\u003cli\u003eZingales, B. \u003cem\u003eet al. \u003c/em\u003eThe revised \u003cem\u003eTrypanosoma cruzi\u003c/em\u003e subspecific nomenclature: Rationale, epidemiological relevance and research applications. \u003cem\u003eInfect. Genet. Evol.\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 240\u0026ndash;253 (2012).\u003c/li\u003e\n\u003cli\u003eDias, G.B.M., Gruendling, A. P., Ara\u0026uacute;jo, S. M., Gomes, M. L. \u0026amp; Toledo, M. J. O. Evolution of infection in mice inoculated by the oral route with different developmental forms of \u003cem\u003eTrypanosoma cruzi\u003c/em\u003e I and II. \u003cem\u003eExp. Parasitol.\u003c/em\u003e \u003cstrong\u003e135\u003c/strong\u003e, 511-517 (2013).\u003c/li\u003e\n\u003cli\u003eMelo, R.C. \u0026amp; Brener, Z. Tissue tropism of different \u003cem\u003eTrypanosoma cruzi \u003c/em\u003estrains\u003cem\u003e. J. Parasitol.\u003c/em\u003e \u003cstrong\u003e63\u003c/strong\u003e, 475-482 (1978). \u003c/li\u003e\n\u003cli\u003eSardinha, L.R., Elias, R.M. \u0026amp; Marinho, M.R.L. Contribution of NK, NK T, T, and \u0026gamma;\u0026delta; T, and \u0026alpha;\u0026beta; T Cells to the Gamma Interferon Response Required for Liver Protection against \u003cem\u003eTrypanosoma cruzi\u003c/em\u003e. \u003cem\u003eInfect. Immunol.\u003c/em\u003e \u003cstrong\u003e74\u003c/strong\u003e, 2031-2042 (2006).\u003c/li\u003e\n\u003cli\u003eDocampo, R. Sensitivity of parasites to free radical damage by antiparasitic drugs\u003cem\u003e. Chem-Biol. Interact\u003c/em\u003e. \u003cstrong\u003e73\u003c/strong\u003e, 1-27 (1990).\u003c/li\u003e\n\u003cli\u003eMartins, G., Cardoso, M.A.G., Aliberti, J.C.S. \u0026amp; Silva, J.S. Nitric oxide-induced apoptotic cell death in the acute phase of \u003cem\u003eTrypanosoma cruzi\u003c/em\u003e infection in mice. \u003cem\u003eImmunol. Lett.\u003c/em\u003e \u003cstrong\u003e63\u003c/strong\u003e, 113-120 (1998).\u003c/li\u003e\n\u003cli\u003eSilva-Filho, J.D. \u003cem\u003eet al.\u003c/em\u003e Perfil hematol\u0026oacute;gico e bioqu\u0026iacute;mico de pacientes com doen\u0026ccedil;a de Chagas atendidos por um servi\u0026ccedil;o de aten\u0026ccedil;\u0026atilde;o farmac\u0026ecirc;utica no estado do Cear\u0026aacute;. \u003cem\u003eJ. Health. Biol. Sci.\u003c/em\u003e \u003cstrong\u003e5\u003c/strong\u003e, 130-136 (2017).\u003c/li\u003e\n\u003cli\u003eToledo, M.J.O. \u003cem\u003eet al\u003c/em\u003e. Chemotherapy with benznidazole and itraconazole for mice infected with different \u003cem\u003eTrypanosoma cruzi\u003c/em\u003e clonal genotypes\u003cem\u003e. Antimicrob. Agents. Chemother.\u003c/em\u003e \u003cstrong\u003e47\u003c/strong\u003e, 223-230 (2003).\u003c/li\u003e\n\u003cli\u003eCaldas, S. \u003cem\u003eet al.\u003c/em\u003e \u003cem\u003eTrypanosoma cruzi\u003c/em\u003e: Acute and long-term infection in the vertebrate host can modify the response to benznidazole. \u003cem\u003eExp. Parasitol.\u003c/em\u003e \u003cstrong\u003e118\u003c/strong\u003e, 315-323 (2008).\u003c/li\u003e\n\u003cli\u003eTeston, A.P.M. \u003cem\u003eet al.\u003c/em\u003e In vivo susceptibility to benznidazole of \u003cem\u003eTrypanosoma cruzi\u003c/em\u003e strains from the western Brazilian Amazon. \u003cem\u003eTrop. Med. Int. Health\u003c/em\u003e. \u003cstrong\u003e18\u003c/strong\u003e, 85-95 (2013).\u003c/li\u003e\n\u003cli\u003eMonteiro, W.M. \u003cem\u003eet al.\u003c/em\u003e \u003cem\u003eTrypanosoma cruzi\u003c/em\u003e I and IV Stocks from Brazilian Amazon Are Divergent in Terms of Biological and Medical Properties in Mice. \u003cem\u003ePLoS Negl. Trop. Dis.\u003c/em\u003e\u003cstrong\u003e 7\u003c/strong\u003e, e2069 (2013).\u003c/li\u003e\n\u003cli\u003eGruendling, A.P. \u003cem\u003eet al.\u003c/em\u003e Impact of Benznidazole on Infection Course in Mice Experimentally Infected with \u003cem\u003eTrypanosoma cruzi\u003c/em\u003e I, II, and IV. \u003cem\u003eAm. J. Trop. Med. Hyg.\u003c/em\u003e \u003cstrong\u003e92\u003c/strong\u003e, 1178-1189 (2015).\u003c/li\u003e\n\u003cli\u003eFrancisco, A.F. Estresse Oxidativo, defesas antioxidantes e processo inflamat\u0026oacute;rio na fase aguda da doen\u0026ccedil;a de Chagas experimental. \u003cem\u003eThesis\u003c/em\u003e, Universidade Federal de Ouro Preto (2011).\u003c/li\u003e\n\u003cli\u003eAndrade, S.G. Caracteriza\u0026ccedil;\u0026atilde;o morfol\u0026oacute;gica e comportamental de cepas de \u003cem\u003eTrypanosoma cruzi\u003c/em\u003e. \u003cem\u003eRev. Soc. Bras. Med. Trop.\u003c/em\u003e \u003cstrong\u003e18\u003c/strong\u003e, 39-46 (1985).\u003c/li\u003e\n\u003cli\u003eFilardi, L.S. \u0026amp; Brener, Z. Susceptibility and natural resistance of \u003cem\u003eTrypanosoma cruzi\u003c/em\u003e strains to drugs used clinically in Chagas disease. \u003cem\u003eTrans. R. Soc. Trop. Med. Hyg.\u003c/em\u003e \u003cstrong\u003e81\u003c/strong\u003e, 755-759 (1987).\u003c/li\u003e\n\u003cli\u003eZanusso Junior, G., Massago, M., Teston A.P.M., Morey, AT \u0026amp; Toledo, M.J.O. Efficacy of some essential oils in mice infected with \u003cem\u003eTrypanosoma cruzi\u003c/em\u003e. \u003cem\u003eTrop. J. Pharm. Res.\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, 1307-1316 (2017).\u003c/li\u003e\n\u003cli\u003eStrauss, M., \u003cem\u003eet al.\u003c/em\u003e Clomipramine and benznidazole association for the treatment of acute experimental \u003cem\u003eTrypanosoma cruzi\u003c/em\u003e infection. \u003cem\u003eParasitol. Int.\u003c/em\u003e \u003cstrong\u003e62\u003c/strong\u003e, 293-299 (2013).\u003c/li\u003e\n\u003cli\u003ePinto, A.Y.N., Valente, S.A., da Costa V., Ferreira, J., Gomes A. \u0026amp; Coura J.R. Acute phase of Chagas disease in the Brazilian Amazon region. Study of 233 cases from Par\u0026aacute;, Amap\u0026aacute; and Maranh\u0026atilde;o observed between 1988 and 2005. \u003cem\u003eRev. Soc. Bras. Med. Trop.\u003c/em\u003e \u003cstrong\u003e41\u003c/strong\u003e, 602-614 (2008). \u003c/li\u003e\n\u003cli\u003eWen, J., Dhiman, M., Whorton, E. \u0026amp; Garg, N. Tissue-specific oxidative imbalance and mitochondrial dysfunction during \u003cem\u003eTrypanosoma cruzi\u003c/em\u003e infection in mice. \u003cem\u003eMicrob. Infect.\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, 1201-1209 (2008).\u003c/li\u003e\n\u003cli\u003eSardinha, L.R. \u003cem\u003eet al.\u003c/em\u003e The Liver Plays a Major Role in Clearance and Destruction of Blood Trypomastigotes in \u003cem\u003eTrypanosoma cruzi\u003c/em\u003e Chronically Infected Mice. \u003cem\u003ePLOS Negl. Trop. Dis.\u003c/em\u003e \u003cstrong\u003e4\u003c/strong\u003e, e578 (2010).\u003c/li\u003e\n\u003cli\u003eBergmeyer, H.U., Scheibe, P. \u0026amp; Wahlefeld, A.W. Optimization of methods for aspartate aminotransferase and alanine aminotransferase. \u003cem\u003eClin. Chem.\u003c/em\u003e \u003cstrong\u003e58\u003c/strong\u003e, 58-73 (1978).\u003c/li\u003e\n\u003cli\u003eNovaes, R.D. \u003cem\u003eet al.\u003c/em\u003e \u003cem\u003eTrypanosoma cruzi\u003c/em\u003e infection and benznidazole therapy independently stimulate oxidative status and structural pathological remodeling of the liver tissue in mice. \u003cstrong\u003e\u003cem\u003eParasitol. Res.\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e \u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e114,\u003c/strong\u003e 2873-2881 (2015).\u003c/li\u003e\n\u003cli\u003eMoreno, C.J.G. Estabelecimento do modelo murino para a modula\u0026ccedil;\u0026atilde;o de toxicidade do benzonidazol durante a terap\u0026ecirc;utica da doen\u0026ccedil;a de Chagas (\u003cem\u003eTrypanosoma cruzi\u003c/em\u003e). \u003cem\u003eDissertation\u003c/em\u003e, Instituto de Higiene e Medicina Tropical (2015).\u003c/li\u003e\n\u003cli\u003eNovaes, R.D. \u003cem\u003eet al.\u003c/em\u003e Curcumin Enhances the Anti-\u003cem\u003eTrypanosoma cruzi\u003c/em\u003e Activity of Benznidazole-Based Chemotherapy in Acute Experimental Chagas Disease. \u003cem\u003eAntimicrob. Agents. Chemother.\u003c/em\u003e \u003cstrong\u003e60\u003c/strong\u003e, 3355-3364 (2016).\u003c/li\u003e\n\u003cli\u003ePaiva, C.N. \u003cem\u003eet al.\u003c/em\u003e Oxidative stress fuels \u003cem\u003eTrypanosoma cruzi\u003c/em\u003e infection in mice. \u003cem\u003eJ. Clin. Investig\u003c/em\u003e. \u003cstrong\u003e122\u003c/strong\u003e, 2531-2542 (2012). \u003c/li\u003e\n\u003cli\u003eFerreira, A.L.A. \u003cem\u003eet al.\u003c/em\u003e S\u0026iacute;ndrome metab\u0026oacute;lica: atualiza\u0026ccedil;\u0026atilde;o de crit\u0026eacute;rios diagn\u0026oacute;sticos e impacto do estresse oxidative na patog\u0026ecirc;nese. \u003cem\u003eVer. Bras. Clin. Med. S\u0026atilde;o Paulo.\u003c/em\u003e\u003cstrong\u003e 9\u003c/strong\u003e, 54-61 (2011).\u003c/li\u003e\n\u003cli\u003eTeston, A.P.M. \u003cem\u003eet al.\u003c/em\u003e Therapeutic effects of benznidazole in Swiss mice that are orally inoculated with \u003cem\u003eTrypanosoma cruzi\u003c/em\u003e IV strains from the Western Brazilian Amazon. \u003cem\u003eExp. Parasitol.\u003c/em\u003e \u003cstrong\u003e228\u003c/strong\u003e, 108-136 (2021). \u003c/li\u003e\n\u003cli\u003eYoshida, N. Molecular mechanisms of \u003cem\u003eTrypanosoma cruzi\u003c/em\u003e infection by oral route. \u003cem\u003eMem. Inst. Oswaldo Cruz.\u003c/em\u003e \u003cstrong\u003e104\u003c/strong\u003e, 101-107 (2009). \u003c/li\u003e\n\u003cli\u003eMeza, S.K.L. \u003cem\u003eet al\u003c/em\u003e. Comparative pathogenicity in Swiss mice of \u003cem\u003eTrypanosoma cruzi\u003c/em\u003e IV from northern Brazil and Trypanosoma cruzi II from southern Brazil. \u003cem\u003eExp. Parasitol.\u003c/em\u003e \u003cstrong\u003e146\u003c/strong\u003e, 34-42 (2014). \u003c/li\u003e\n\u003cli\u003eSilva, L.H.P. \u0026amp; Nussenzweig, V. Sobre uma cepa de \u003cem\u003eTrypanosoma cruzi\u003c/em\u003e altamente virulenta para o camundongo branco. \u003cem\u003eFolia Clin. Biol. \u003c/em\u003e \u003cstrong\u003e20\u003c/strong\u003e, 191\u0026ndash;203 (1953).\u003c/li\u003e\n\u003cli\u003eCortez, C. \u003cem\u003eet al.\u003c/em\u003e Differential Infectivity by the Oral Route of \u003cem\u003eTrypanosoma cruzi\u003c/em\u003e Lineages Derived from Y Strain. \u003cem\u003ePlos negl. Trop. Dis.\u003c/em\u003e\u003cstrong\u003e 6\u003c/strong\u003e, 1804-1805 (2012). \u003c/li\u003e\n\u003cli\u003eCardoni, R.L., Rimoldi, M.T., Esteva, M. \u0026amp; Bracco, M.M.E. Humoral antibody response in mice infected with \u003cem\u003eTrypanosoma cruzi.\u003c/em\u003e \u003cem\u003eMedicina (B. Aires)\u003c/em\u003e. \u003cstrong\u003e46\u003c/strong\u003e, 435-439 (1986).\u003c/li\u003e\n\u003cli\u003eTeston, A.P.M., Abreu, A.P., Abegg, C.P., Gomes, M.L. \u0026amp; Toledo, M.J.O. Outcome of oral infection in mice inoculated with \u003cem\u003eTrypanosoma cruzi\u003c/em\u003e IV of the Western Brazilian Amazon. \u003cem\u003eActa Trop.\u003c/em\u003e \u003cstrong\u003e166\u003c/strong\u003e, 212\u0026ndash;217 (2017).\u003c/li\u003e\n\u003cli\u003eB\u0026eacute;rtoli, M., And\u0026oacute;, M.H., Toledo, M.J.O., Ara\u0026uacute;jo, S.M. \u0026amp; Gomes, M.L. Infectivity for mice of \u003cem\u003eTrypanosoma cruzi\u003c/em\u003e I and II strains isolated from different hosts. \u003cem\u003eParasitol. Res.\u003c/em\u003e \u003cstrong\u003e99\u003c/strong\u003e, 7-13 (2006).\u003c/li\u003e\n\u003cli\u003eBrener, Z. Therapeutic activity and criterion of cure on mice experimentally infected with \u003cem\u003eTrypanosoma cruzi\u003c/em\u003e. \u003cem\u003eRev. Inst. Med. Trop. S\u0026atilde;o Paulo.\u003c/em\u003e \u003cstrong\u003e4\u003c/strong\u003e,\u003cstrong\u003e \u003c/strong\u003e389-396 (1962).\u003c/li\u003e\n\u003cli\u003eCaldas, S. Real-time PCR strategy for parasite quantification in blood and tissue samples of experimental \u003cem\u003eTrypanosoma cruzi\u003c/em\u003e infection. \u003cem\u003eActa Trop.\u003c/em\u003e \u003cstrong\u003e123\u003c/strong\u003e, 170-177 (2012). \u003c/li\u003e\n\u003cli\u003eDuffy, T., \u003cem\u003eet al.\u003c/em\u003e Accurate real-time PCR strategy for monitoring bloodstream parasitic loads in Chagas disease patients. \u003cem\u003ePLoS Negl. Trop. Dis.\u003c/em\u003e \u003cstrong\u003e3\u003c/strong\u003e, e419 (2009).\u003c/li\u003e\n\u003cli\u003eMiller, M.A. \u0026amp; Zachary, J.F. Mechanisms and Morphology of Cellular Injury, Adaptation, and Death. \u003cem\u003ePathol. Bas. Vet. Dis\u003c/em\u003e. 2\u0026ndash;43, e19 (2017).\u003c/li\u003e\n\u003cli\u003eHissin, P.J. \u0026amp; Hilf, R. Fluorimetric method for determination of oxidized and reduced glutathione in tissues. \u003cem\u003eAnal. Biochem.\u003c/em\u003e\u003cstrong\u003e 74\u003c/strong\u003e, 214\u0026ndash;226 (1976). \u003c/li\u003e\n\u003cli\u003eLevine, R.L. \u003cem\u003eet al.\u003c/em\u003e Determination of carbonyl content in oxidatively modified proteins. \u003cem\u003eMeth. Enzymol.\u003c/em\u003e \u003cstrong\u003e186\u003c/strong\u003e, 464\u0026ndash;478 (1990). \u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Trypanosoma cruzi, oral Chagas disease, benznidazole, qPCR, aminotransferases, oxidative stress","lastPublishedDoi":"10.21203/rs.3.rs-2239490/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-2239490/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe protozoan \u003cem\u003eTrypanosoma cruzi\u003c/em\u003e causes Chagas disease and the most frequent form of transmission of the parasite is the oral route, associated with greater severity and worse response to benznidazole (BZ), the drug used in its treatment. This study aimed to evaluate the impact of gastrointestinal infection (GI) and BZ treatment on the histopathological alterations in mice inoculated with \u003cem\u003eT. cruzi\u003c/em\u003e II. Swiss mice were inoculated by GI and intraperitoneal (IP) routes with 2x10\u003csup\u003e6\u003c/sup\u003e culture-derived metacyclic trypomastigotes of the Y strain (TcII) of \u003cem\u003eT. cruzi\u003c/em\u003e and were treated with BZ in the acute phase of the infection. Fresh blood examination, qPCR, histopathological and biochemical evaluations (enzymatic dosages and oxidative stress-OS) were performed. BZ treatment of uninfected animals caused changes in the liver, increased the activity of AST and ALT enzymes and OS, showing that the drug alone affects this organ. Inflammation and necrosis in the cardiac tissue were less intense and deaths occurred later in animals inoculated via the GI route than the animals inoculated via the IP route. BZ reduced the intensity of tissue lesions and avoided lethality in animals inoculated via the GI route, and decreased parasitemia and OS in those inoculated via both routes. Although BZ alone caused liver damage, it was less intense than that caused by both routes of inoculation. Infection with the Y strain of \u003cem\u003eT. cruzi\u003c/em\u003e II via the GI route proved to be less virulent and pathogenic and responded better to treatment than the infection acquired via the IP route.\u003c/p\u003e","manuscriptTitle":"Impact of gastrointestinal inoculation and benznidazole treatment on Trypanosoma cruzi II infection in mice","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-11-11 20:57:04","doi":"10.21203/rs.3.rs-2239490/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"af88de9e-7974-42ab-8a36-8c74d06be2df","owner":[],"postedDate":"November 11th, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2022-12-20T07:14:34+00:00","versionOfRecord":[],"versionCreatedAt":"2022-11-11 20:57:04","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-2239490","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-2239490","identity":"rs-2239490","version":["v1"]},"buildId":"7rjqhiLT3MXkJMwkYKINL","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.