Hydromorphone ameliorates endotoxin-induced acute lung injury by suppressing ferroptosis via Nrf2/HO-1 signaling pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Hydromorphone ameliorates endotoxin-induced acute lung injury by suppressing ferroptosis via Nrf2/HO-1 signaling pathway Xiangkun Li, Yexiang Xu, Wenyi Liu, Shaona Li, Cuicui Liu, Cuili Wen, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7370812/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Endotoxin-induced acute lung injury (ALI) features uncontrolled pulmonary inflammation with high mortality. Ferroptosis, an iron-dependent immunogenic cell death, contributes to ALI pathogenesis. While the Nrf2/HO-1 pathway mitigates ALI by regulating oxidative stress, hydromorphone (HM)-a clinical opioid analgesic-alleviates ALI through incompletely defined mechanisms. This study investigated HM's protective effects in lipopolysaccharide (LPS)-induced ALI models. Methods LPS was administered to mice and MH-S alveolar macrophages with/without HM. Lung pathology was evaluated via H&E and Masson staining. Pro-inflammatory cytokines were measured by ELISA. Ferroptosis markers were assessed using Western blot, PCR, immunohistochemistry, and immunofluorescence. Apoptosis and mitochondrial membrane potential (JC-1 probe) were analyzed by flow cytometry. Mitochondrial ultrastructure was examined via transmission electron microscopy. Nrf2 knockout mice and siRNA-transfected cells determined pathway involvement. Results HM significantly attenuated LPS-induced ALI. The LPS + HM group exhibited reduced pulmonary edema, inflammatory cell infiltration, and fibrosis vs LPS group, along with decreased pro-inflammatory cytokines. HM suppressed oxidative stress and ferroptosis, evidenced by elevated GSH, SOD, and GPX4 levels/expression, but reduced GSSG, MDA, Fe²⁺, LPO, PTGS2, and 4-HNE in LPS + HM group versus LPS controls. HM treatment reversed mitochondrial membrane potential collapse and ameliorated mitochondrial damage. Crucially, HM's protection depended on Nrf2/HO-1 activation, as LPS + HM treatment significantly upregulated Nrf2 and HO-1. Experiments also confirmed that HM's anti-ferroptotic and lung-protective effects require intact Nrf2/HO-1 signaling. Conclusion HM protects against endotoxin-induced ALI by inhibiting ferroptosis via activating the Nrf2/HO-1 pathway. Hydromorphone Ferroptosis Acute lung injury LPS Nrf2/HO-1 pathway Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 1. Introduction Acute lung injury (ALI) represents severe lung inflammation caused by various pathogenic factors and is characterized by damage to the alveolar-capillary interface. If the condition is not treated effectively, ALI progresses to acute respiratory distress syndrome (ARDS), a more severe condition ( 1 ). Sepsis, a principal instigator of ALI and ARDS, induces systemic inflammation through the recognition of pathogen-associated molecular patterns such as lipopolysaccharide (LPS) by the innate immune system ( 2 ). Sepsis and septic ALI/ARDS are common clinical syndromes with a mortality rate of approximately 40% in the ICU over the past decade ( 3 ). Despite extensive research focusing on the development of effective treatments for septic ALI/ARDS, therapeutic options are very limited ( 4 – 6 ). Therefore, deciphering the underlying mechanisms of septic ALI/ARDS is crucial for developing effective and novel therapeutic drugs. Dixon et al first reported ferroptosis as an iron-dependent form of cell death mechanism distinct from apoptosis and autophagy ( 7 ). Ferroptosis is linked to several human diseases and its inhibition alleviates symptoms of several medical conditions such as heart injury, neurodegeneration, renal failure, and liver injury ( 8 – 11 ). Emerging evidence also implicates ferroptosis in the pathophysiological progression of ALI. Moreover, targeted inhibition of ferroptosis demonstrates significant therapeutic potential in preclinical models. For example, Liu et al demonstrated that ferrostatin-1 (Fer-1) attenuates LPS-induced ALI by inhibiting ferroptosis ( 12 ). Li et al demonstrated that wedelolactone alleviates lung injury induced by hyperoxia through GPX4-mediated inhibition of ferroptosis ( 13 ). Li et al reported that panaxydol inhibits ferroptosis in LPS-induced ALI through the Nrf2/HO-1 pathway ( 14 ). Mechanistic analysis has demonstrated that ferroptosis exacerbates ALI pathogenesis. Besides, pharmacological potentiation of the Nrf2/HO-1 axis has emerged as a viable therapeutic approach to mitigate ferroptosis. Consequently, our study aimed to identify pharmacological agents that can activate the Nrf2/HO-1 pathway to counteract ferroptosis associated with ALI. Hydromorphone (HM), a potent µ-opioid receptor agonist, is widely used as an analgesic ( 15 ). Recent reports have suggested that HM possesses anti-inflammatory and anti-oxidant properties in certain inflammatory settings ( 16 , 17 ). Shi et al demonstrated that HM protected against carbon-dioxide pneumoperitoneum-induced ALI by regulating mitochondrial dynamics through the HO-1-related pathway ( 18 ). Zhang et al demonstrated that HM attenuated cardiopulmonary bypass-induced ALI in the alveolar macrophages by inhibiting pyroptosis ( 19 ). Collectively, these findings suggest that HM protects against ALI. However, its therapeutic effects and underlying mechanisms are not well characterized. Therefore, to develop HM as a novel therapeutic option for managing the complex pathophysiology of ALI, there is an urgent need for an in-depth analyses of the molecular mechanisms of HM. The current study investigated the protective mechanisms of HM on LPS-induced ALI, especially emphasizing on the role of the Nrf2/HO-1 signaling pathway using both in vivo and in vitro models. We also investigated the effects of HM on oxidative stress, inflammation, and cellular apoptosis. Histological assessments and molecular analyses, including Western blotting and RT-PCR, were performed to determine the mechanisms by which HM exerted its anti-ALI effects. Moreover, to delineate the mechanistic involvement of the Nrf2/HO-1 axis in HM-related protective effects against ALI, experiments were performed with the global Nrf2 knockout mice and Nrf2 siRNA-transfected cells, with specific emphasis on the status of ferroptosis. Overall, this study aimed to lay a strong foundation to determine the clinical utility of HM as an effective therapeutic option for managing septic ALI and related conditions. 2. Methods 2.1 Experimental mice In our study, experiments were conducted using two kinds of healthy C57BL/6J male mice aged 6–8 weeks: wild type (WT) mice (obtained from the Laboratory Animal Center of The Affiliated Hospital of Qingdao University) and Nrf2-deficient mice (provided by Jiangsu Huachuang Sino Pharmaceutical Technology Co., Ltd). This study was strictly conducted according to the NIH Guide for the Care and Use of Laboratory Animals (85 − 23 rev.) and in full compliance with the international animal research standards. Ethical approval was obtained from the Institutional Animal Care and Use Committee (IACUC) of The affiliated hospital of Qingdao University (Protocol No. QYFY-WZLL-2023-28466). All experimental animals were housed in a SPF-grade IVC system under standardized environmental conditions (temperature, 22 ± 1°C; humidity, 55 ± 5%;, and 12 h photoperiod). The mice were allowed to habituate for 7 -days and provided ad libitum access to gamma-irradiated food and acidified water (pH 2.5-3.0). Prior to the experiments, the mice were fasted for 12 h and deprived of water for 4 h. One set of mice were randomly allocated into the control, LPS, LPS + HM, and HM groups ( n = 6/group). To assess ferroptosis, another set of mice were allocated into control, LPS, LPS + HM, and LPS + ferrostatin-1 (Fer-1) groups ( n = 6/group). To evaluate Nrf2-mediated attenuation of HM-induced lung pathology, a set of mice were allocated into the LPS + HM and Nrf2 KO + LPS + HM groups ( n = 6/group). Based on a previous study, endotoxin-induced ALI model mice were generated by injecting 15 mg/kg LPS (Solarbio, Beijing, China) through the tail vein ( 20 ). Based on human-to-animal dose conversion guidelines and pharmacokinetic characteristics ( 21 ), mice received an intraperitoneal injection of 3 mg/kg HM (Yichang Humanwell Pharmaceutical Co., Ltd., Yichang, China) 2 h before LPS stimulation. The LPS + Fer-1 group mice were administered 5 mg/kg Ferrostatin-1 (Sigma-Aldrich, St. Louis, MO, USA) via intraperitoneal injection 2 h before the LPS challenge ( 22 ). After 12 h of LPS treatment, mice were euthanized and their lung and blood serum samples were harvested for downstream analyses. The mice were anesthetized with isoflurane (2–3% in oxygen) until loss of righting reflex, followed by cervical dislocation for euthanasia. This method ensures unconsciousness prior to physical disruption of the spinal cord, in accordance with AVMA guidelines for humane euthanasia of rodents. 2.2 Hematoxylin and Eosin (H&E) and Masson's staining Lung tissue from the left superior lobe was harvested, fixed with 4% (w/v) paraformaldehyde, dehydrated with gradient ethanol (70%→100%), embedded in paraffin block, and sectioned with a microtome to obtain 4 µm thick slices. H&E and Masson’s staining were performed according to previously published protocols ( 23 ). For H&E staining, slices were incubated with the Harris hematoxylin stain for 8 min followed by acid ethanol differentiation. Then, the slices were incubated with 0.5% eosin Y counterstain for 1 min. For Masson’s staining, slices were incubated with Weigert’s hematoxylin for 5 min, followed by Biebrich scarlet-acid fuchsin for 10 min. Then, the slices were incubated with phosphomolybdic acid for 5 min followed by counterstaining with aniline blue for 5 min. All the reagents were purchased from Solarbio. The stained sections were scored for lung injury by blinded pathologists after observation under a Nikon Eclipse E100 microscope (400×). The sections were analyzed in six random fields using a semiquantitative scale ( 24 ): 0 (normal), 1 (mild, 50%). Final scores were obtained by averaging the data. Masson’s trichome staining of collagen fibers (blue) were quantified using threshold-based segmentation with the Image J software. Collagen deposition was quantified using the following formula: (collagen-positive area ÷ total histological area) × 100%. The measurements were performed using computerized morphometric analysis. 2.3 Estimation of Wet-to-Dry Weight (W/D) ratios Pulmonary edema was quantified using gravimetric analysis. Right lung specimens were excised and the surface moisture was absorbed using a filter paper to remove all external moisture. Then, wet mass (W) of the lung tissue measured using an analytical balance (± 0.1 mg precision). Subsequently, the lung tissues were oven-dried at 70°C until < 0.5% mass variation over a 48 h period. Then, dry mass (D) was measured using the analytical balance. The hydration index was calculated as (W - D)/D. 2.4 Cell culture and treatment MH-S murine alveolar macrophages (CL-0597; Procell, Wuhan, China) were cultured in RPMI-1640 medium (Gibco, Carlsbad, CA, USA) containing 10% heat-inactivated FBS and 1% penicillin-streptomycin (Invitrogen, Waltham, MA, USA) under standard conditions (37°C and 5% CO₂). The medium was replaced every 48–72 h. MH-S cells at passages 2 or 3 were used for experiments. MH-S cells were stimulated with 10 µg/mL LPS ( 20 ) to generate the in vitro sepsis model. To determine the optimal concentration of HM, MH-S cells were treated with varying doses of HM (0, 5, 15, 25, and 50 µM) for 12 h before incubation with LPS for an additional 24 h. CCK-8 assay was performed to determine the HM concentration yielding highest cell viability. This optimal HM concentration was then used for subsequent experiments. MH-S cells were randomly divided into the control, LPS, LPS + HM, and HM groups ( n = 6/group). To investigate the effects of HM on ferroptosis, MH-S cells were further categorized into control, LPS, LPS + HM, and LPS + Fer-1 groups ( n = 6/group). To elucidate the role of the Nrf2 signaling pathway in the HM-mediated protective effects on lung injury, the cells were divided into the control, LPS, LPS + HM, Nrf2 siRNA + LPS + HM, and NC siRNA + LPS + HM groups ( n = 6/group). To achieve Nrf2 gene silencing, MH-S cells were transfected with Nrf2-specific and scrambled siRNAs (50 nM, 24 h) using the RNAiMAX transfection agent (Invitrogen, Carlsbad, CA, USA) in OPTI-MEM medium (Gibco, Carlsbad, CA, USA) according to the manufacturer’s instructions. Nrf2 gene silencing efficacy was evaluated by RT-qPCR. MH-S cells in the LPS + Fer-1 group were pretreated with 1µM Fer-1 for 12 h followed by stimulation with LPS for another 24 h. Then, the supernatants and cells were separately harvested for subsequent analyses. 2.5 CCK-8 cell viability assay MH-S cell viability was assessed using the Cell Counting Kit-8 (CCK-8, BS350A, Biosharp, China). Briefly, cells were incubated with 10 µL of CCK-8 reagent at 37°C for 2.5 h. Then, the absorbance was recorded at 450 nm (primary wavelength) and 650 nm (reference wavelength) using a microplate reader (Bio-Rad, Hercules, CA, USA). 2.6 Enzyme-linked immunosorbent assay (ELISA) The concentrations of interleukin-1β (IL-1β), interleukin-6 (IL-6), and tumor necrosis factor α (TNF-α) in the serum samples and cell supernatants were analyzed using specific ELISA kits (IL-1β:SEKM-0034; IL-6:SEKM-0002; TNF-α:SEKM-0007; Solarbio, Beijing, China) according to the manufacturer’s instructions. Serum samples was prepared by centrifuging the blood samples at 1,000 g for 10 min. The cell supernatants were passed through a 0.22 µm sterile filter before experimentation. Optical density was determined at two wavelengths (450/630 nm) using a BioTek Synergy H1 microplate reader. A four-parameter logistic (4-PL) standard curve was generated using serially diluted standard solutions. Final concentrations were calculated by multiplying the standard curve-derived values by the respective sample dilution factors. 2.7 Measurement of Oxidative Stress and Ferroptosis To assess the oxidative stress and ferroptosis biomarkers, lung tissue specimens were homogenized in ice-cold PBS and lysed in RIPA buffer. The tissue lysates were centrifuged at 12,000×g for 15 min at 4°C and the cell-free supernatants were harvested. Glutathione redox status was determined using a commercial T-GSH/GSSG assay kit (A061-1; Jiancheng Bioengineering, Nanjing, China) and the GSH/GSSG ratio was calculated according to the manufacturer’s guidelines. Lipid peroxidation was assessed using the malondialdehyde assay kit (A003-2-2; Sway Biotech, Wuhan, China). Superoxide dismutase activity was measured using the SOD detection system (A001-3; Jiancheng Bioengineering, Nanjing, China) according to manufacturer’s instructions. Ferroptosis-specific markers including Fe²⁺ concentration (DIFE-250; BioAssay Systems, Wuhan, China) and lipid peroxide levels (LiperFluo; ab133085; Abcam, Cambridge, UK) were analyzed in both the tissue homogenates and cellular fractions according to previously established protocols and manufacturer’s instructions. 2.8 Cell apoptosis assay MH-S cells were detached from the 6-well plates using PBS. Subsequently, after rinsing with PBS twice, MH-S cells were stained with the Annexin V-FITC/PI staining kit (eBioscience™ Apoptosis Kit, Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions and analyzed in a BD LSRFortessa™ flow cytometer (BD Biosciences). 2.9 Mitochondrial membrane potential (MMP) assay Mitochondrial membrane potential (MMP) was quantified using a JC-1 Assay Kit (Thermo Fisher Scientific, #T3168, USA). After 20-min incubation with JC-1 at 37°C, cells were washed twice with assay buffer and analyzed by flow cytometry (BD FACSCanto II, USA). 2.10 Immunofluorescence (IF) and Immunohistochemistry (IHC) Formalin-fixed 5 µm thick lung sections were processed by sequential deparaffinization, graded ethanol hydration, and heat-mediated antigen retrieval with 10 mM citrate (pH 6.0) at 95°C for 20 min). Then, they were incubated with the primary antibody to detect 4-HNE (details in Table 1 ). This was followed by incubation with 1:500 diluted Alexa Fluor 488-conjugated secondary antibody (Invitrogen, Carlsbad) for 1 h at room temperature in the dark. The tissue was then counterstained with the nucleus-staining dye DAPI. For IHC, the tissue sections were blocked with 3% H 2 O 2 and incubated with anti-GPX4, anti-4-HNE, or anti-Nrf2 antibodies (Table 1 ). Subsequently, they were incubated with the HRP-conjugated secondary antibody (ZSGB-BIO PV-9000). Color development was performed with DAB (ZSGB-BIO ZLI-9018). Then, the tissues were counterstained with hematoxylin. For MH-S cytospins, cells were fixed in 4% PFA, permeabilized with 0.1% Triton X-100, and stained with anti-GPX4 (IF, single-label) or co-stained with anti-Nrf2 (rabbit) and anti-HO-1 (mouse) (IF dual-label, Alexa Fluor 488/568 secondary antibodies, respectively). Images of the stained tissue sections were acquired using a Nikon Eclipse Ni microscope under consistent exposure settings. Table 1 List of primary antibodies Primary antibody Dilution ratio Commercial details Molecular weight (kDa) GPX4 1:500 CST, 52455 22 PTGS2 1:1000 Abcam, ab179800 69 4-HNE 1:200 Abcam, ab46545 67 Nrf2 1:100 Santa Cruz, sc-365949 100 HO-1 1:200 Novus, NBP1-31344 33 β-actin 1:5000 Sigma, A5441 43 Abbreviations: GPX4, Glutathione Peroxidase 4; PTGS2, Prostaglandin-endoperoxide synthase 2; 4-HNE, 4-hydroxy-2-nonenal; Nrf2, nuclear factor erythroid 2-related factor 2; HO-1, heme oxygenase-1 2.11 Western blotting Total protein samples were obtained from the lung tissues and cell samples by incubating with the RIPA lysis buffer (P0013B; Beyotime, Shanghai, China). The concentration of protein was quantified using the Pierce BCA Protein Assay Kit (23225; Thermo Fisher Scientific, Waltham, MA, USA). Protein lysates (20 µg/lane) were separated via 10% SDS-PAGE and transferred onto activated PVDF membranes. The membranes were blocked with 5% non-fat milk/TBST for 1 h at 25 o C. This was followed by overnight incubation at 4 o C with primary antibodies (Table 1 ). Subsequently, after three washes with TBST, the membranes were incubated with HRP-conjugated secondary antibodies (1:5000; CST) for 1 h at 25 o C. The blots were developed using the ECL substrate (Thermo Fisher Scientific, Waltham, MA, USA) and the chemiluminescent signals were quantified using the ImageJ v1.53 software (National Institutes of Health, Bethesda, MD, USA). Band intensities were normalized to β-actin as the loading control and three independent biological replicates were analyzed per experimental group. 2.12 Quantitative real-time PCR (qRT-PCR) Total RNA samples were isolated from the lung tissues and MH-S cells using TRIzol (Thermo Fisher Scientific, Waltham, MA, USA) followed by DNase I treatment (Takara Bio, Dalian, China) to remove genomic DNA. Reverse transcription was performed using the PrimeScript RT Master Mix (Takara Bio, Dalian, China) according to the manufacturer's protocol. Quantitative PCR was performed using the TB Green Premix (Takara Bio, Dalian, China) in a Bio-Rad CFX96 QPCR machine using the following cycling parameters: initial denaturation at 95°C for 30 s; 40 cycles of denaturation at 95°C for 5 s and annealing at 60°C for 30 s. Gene-specific primers (Table 2 ) were designed to span the exon-exon junctions and amplicon lengths were optimized between 80–200 bp to ensure amplification efficiency. QPCR efficiency was validated (90–110%) using the standard curve analysis (R² >0.99). Relative gene expression was calculated using the 2^-ΔΔCt method using GAPDH as the endogenous control. Three independent biological replicates were analyzed per experimental group. Table 2 Primer sequences for qRT-PCR analysis Gene Forward primer (5'-3') Reverse primer (5'-3') Product Size (bp) GPX4 CTGGAGAAGTGCGAGGTGA AGAGCGGGTGAGCCTTGT 152 Nrf2 TGGACGGGACTATTGAAGGCT GCCGCCTTTTCAGTAGATGG 178 GAPDH AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA 123 Abbreviations: GPX4, Glutathione Peroxidase 4; Nrf2, nuclear factor erythroid 2-related factor 2;GAPDH, Glyceraldehyde-3-phosphate dehydrogenase Figures and Figure legends (A-C) GSH and GSSG levels and the GSH/GSSG ratio in the control, LPS, LPS + HM, HM, and LPS-Fer-1 group mice ( n = 6). ( D-F) The levels of MDA, Fe2+, and LPO in the control, LPS, LPS + HM, HM, and LPS-Fer-1 group mice ( n = 6). ( G-K) Representative western blots and semi-quantitative analysis shows the expression levels of ferroptosis-related proteins such as GPX4, PTGS2, and 4-HNE in the lung tissues of the control, LPS, LPS + HM, HM, and LPS-Fer-1 group mice ( n = 3). Full-length blots are shown in the Supplementary file 1. Band intensity values were normalized to β-actin. The data values were expressed as mean ± SD. Multiple group comparisons were performed using one-way ANOVA with the Bonferroni correction. * denotes P < 0.05 compared to the control group; # denotes P < 0.05 compared to the LPS group; & denotes P < 0.05 compared to the LPS + HM group. ( L) Representative immunofluorescence images show 4-HNE protein expression in the control, LPS, LPS + HM, HM, and LPS-Fer-1 group mice ( magnification, × 400). Scale bar: 50 µm. Green staining indicates 4-HNE; blue staining indicates DAPI-stained nuclear structure. ( M ) Transmission electron microscopy images of representative mitochondrial structures (scale bar, 500 nm). Abbreviations: MDA, malondialdehyde; GSH, glutathione; GSSG, oxidized glutathione; LPO, LiperFluo; GPX4, Glutathione Peroxidase 4; PTGS2, Prostaglandin-endoperoxide synthase 2; 4-HNE, 4-hydroxy-2-nonenal; DAPI, 4',6-diamidino-2-phenylindole; HM, Hydromorphone. 2.13 Transmission Electron Microscopy (TEM) Glutaraldehyde-fixed lung tissues (2.5%) were PBS-rinsed, post-fixed in 1% OsO₄ (2h), and dehydrated through graded ethanols/acetone. Specimens were embedded in epoxy resin (37℃/24h). Ultrathin sections (70nm) were stained with uranyl acetate (20min) and lead citrate (5min). Mitochondrial ultrastructure was imaged using Hitachi H-7500 TEM (80kV). 2.14 Statistical analysis Quantitative data was expressed as mean ± standard deviation (mean ± SD) and the differences between two groups were analyzed using a t-test. Differences between multiple groups were analyzed using a one-way ANOVA with the GraphPad Prism 9.2.0 software, followed by the Bonferroni post-test. A p-value of < 0.05 was considered statistically significant. 3. Results 3.1 HM ameliorates in vivo LPS-induced ALI in mice Firstly, we investigated the effects of HM on LPS-induced ALI in mice. Compared to mice in the LPS group, pretreatment with HM significantly reduced LPS-induced ALI. H&E staining results showed significantly reduced pulmonary interstitial edema, inflammatory infiltration, alveolar wall thickening, and lung tissue damage in the LPS + HM group compared to the LPS group; Masson staining results demonstrated that HM mitigated lung interstitial fibrosis (Fig. 1 A, D). The lung injury scores and W/D ratios were significantly lower for the LPS + HM group compared to the LPS group (Fig. 1 B-C). Moreover, serum levels of pro-inflammatory cytokines, including IL-1β, IL-6, and TNF-α were significantly lower in LPS + HM group than in the LPS group, thereby indicating that pretreatment with HM effectively reduced the inflammatory response in the LPS-treated mice (Fig. 1 E-G). Therefore, these data demonstrate that HM significantly alleviates LPS-triggered ALI in the preclinical mouse model. 3.2 HM inhibits oxidative stress response and ferroptosis in the LPS-triggered ALI model mice We evaluated oxidative stress-related indicators such as GSH, GSSG, GSH/GSSG ratio, and MDA. In mice, oxidative stress-related injury was significantly increased by LPS, but significantly inhibited by pretreatment with HM or Fer-1 (Fig. 2 A-D). Furthermore, the levels of Fe 2+ and LPO (major regulators of ferroptosis) were significantly increased by LPS, but were reduced by HM and Fer-1(Fig. 2 E-F). We also evaluated the expression levels of ferroptosis-associated proteins such as glutathione peroxidase 4 (GPX4), prostaglandin-endoperoxide synthase 2 ( PTGS2), and 4-hydroxy-2-nonenal (4-HNE) in the lung tissues. Compared to the control group, LPS group showed higher expression levels of PTGS2 and 4-HNE proteins and lower protein and mRNA expression levels of GPX4. However, GPX4 expression levels were significantly higher and PTGS2 and 4-HNE expression levels were significantly lower in the lung tissues of mice pre-treated with HM or Fer-1 compared to those from the LPS-treatment group (Fig. 2 G-K). Furthermore, we performed immunofluorescence staining to assess the levels of 4-HNE, a major aldehydic product of LPO. Compared to the control group, 4-HNE levels were significantly higher in the LPS group. However, 4-HNE levels were significantly lower in the LPS + HM and LPS + Fer-1 groups compared to the LPS group (Fig. 2 L). Ultrastructural analysis via transmission electron microscopy (TEM) revealed ferroptosis-specific mitochondrial alterations in LPS-exposed murine lung tissues, including diminished organelle volume, loss of cristae integrity, and disrupted membrane continuity. These pathological manifestations were significantly attenuated by HM treatment (Fig. 2 M), with comparable efficacy observed in Fer-1-administered groups. These data demonstrated that HM significantly inhibits oxidative stress response and ferroptosis in the sepsis-induced ALI model mice. 3.3 HM alleviates LPS-induced inflammatory response and oxidative stress in MH-S cells CCK-8 assay was used to estimate MH-S cell viability and determine the optimal doses of HM and LPS. Firstly, MH-S cells grown with different doses of HM (0–50 µM) did not show significant changes in cell viability (Fig. 3 A). Then, MH-S cells were treated with different doses of HM for 12 h before being stimulated with 10 µg/mL LPS ( 20 ). As shown in Fig. 3 B, the viability of LPS-treated MH-S cells was significantly high at 50 µM HM compared to those treated with lower concentrations of HM. Therefore, pretreatment with 50 µM HM for 12 h before LPS stimulation was used in subsequent experiments.As shown in Fig. 3 C-D, IL-1β and IL-6 levels were significantly lower in the LPS + HM group than in the LPS group. This suggested that HM pretreatment alleviates inflammatory response in the LPS-stimulated MH-S cells. Furthermore, as shown in Fig. 3 E-I, LPS + HM group exhibited significantly lower levels of MDA and GSSG as well as significantly higher levels of SOD and GSH, and the GSH/GSSG ratio compared to the LPS group. These findings suggested that HM pretreatment mitigates LPS-induced oxidative stress in the MH-S cells. Subsequently, we analyzed the effects of HM pretreatment on the apoptosis of LPS-stimulated cells by flow cytometry. As shown in Fig. 3 J-K, the apoptosis rate was significantly reduced in the MH-S cells of the LPS + HM group compared to the LPS group. This suggested that HM pretreatment reduces LPS-induced apoptosis in the MH-S cells. 3.4 HM alleviates ferroptosis in the LPS-stimulated MH-S cells Next, we analyzed whether HM regulates ferroptosis in the LPS-stimulated MH-S cells by assessing GPX4, 4-HNE, and PTGS2 expression levels, and estimating the cellular levels of Fe²⁺ and LPO. Immunofluorescence results showed that GPX4 expression was significantly higher in the LPS + HM and LPS + Fer-1 groups compared to the LPS group (Fig. 4 A). Western blotting results showed that GPX4 expression levels were significantly increased and 4-HNE and PTGS2 expression levels were significantly decreased in the LPS + HM and LPS + Fer-1 groups compared to the LPS group (Fig. 4 B-E). Furthermore, Fe 2+ and LPO levels were lower in the LPS + HM and LPS + Fer-1 groups compared to the LPS group (Fig. 4 F-G). Mitochondrial membrane potential (MMP), a critical indicator of mitochondrial function, demonstrated significant impairment in LPS-exposed MH-S cells. HM treatment effectively restored MMP levels (Fig. 3 H-I). These all suggested that HM attenuated ferroptosis in the LPS-stimulated MH-S cells. 3.5 HM alleviates in vitro LPS-mediated ferroptosis in the MH-S cells through the Nrf2/HO-1 signaling pathway To determine the mechanism underlying the inhibitory effects of HM on MH-S cell injury and ferroptosis, we generated Nrf2-silenced MH-S cells using Nrf2-specific siRNAs. Generation of Nrf2-silenced MH-S cells were confirmed by RT-PCR analysis (Fig. 5 A). In the control MH-S cells, HM pretreatment effectively suppressed LPS-induced oxidative damage markers (MDA/Fe²⁺/LPO), but Nrf2 silencing suppressed the antioxidant effects of HM and increased the expression levels of ferroptosis biomarkers upon stimulation by LPS (Fig. 5 B-D). Western blotting analysis demonstrated upregulation of GPX4, Nrf2, and HO-1 protein expression and significant downregulation of 4-HNE and PTGS2 protein expression in the LPS + HM group compared to the LPS group. However, GPX4, Nrf2, and HO-1 expression levels were significantly reduced and 4-HNE and PTGS2 expression levels were significantly increased in the Nrf2 siRNA + LPS + HM group compared to the LPS + HM group (Fig. 5 E-J). The dual immunofluorescence staining results demonstrated that Nrf2 and HO-1 expression levels were higher in the LPS + HM group than in the LPS group. However, expression levels of Nrf2 and HO-1 were significantly lower in the Nrf2 siRNA + LPS + HM group compared to the LPS + HM group (Fig. 5 K). These data demonstrated that HM exerts anti-ferroptosis effects in the LPS-stimulated MH-S cells by activating the Nrf2/HO-1 signaling pathway. 3.6. HM protects against in vivo LPS-induced ALI by suppressing ferroptosis through Nrf2/HO-1 pathway activation To further determine whether the in vivo protective effects of HM were mediated through the Nrf2/HO-1 pathway, we used the Nrf2 knockout (Nrf2 KO) mice. Compared to the LPS + HM group, Nrf2 KO + LPS + HM group exhibited aggravated lung injury and significantly higher lung injury scores, W/D lung tissue ratios, collagen fibrils, and serum levels of IL-1β. IL-6 and TNF-α (Fig. 6 . A-G). Furthermore, the levels of MDA, Fe 2+ , and LPO in the lung tissues were significantly higher in the Nrf2 KO + LPS + HM group compared to the LPS + HM mice (Fig. 6 . I-K). These findings demonstrated that HM mitigates lung injury and inhibits ferroptosis via Nrf2. Furthermore, in the HM pretreated sepsis-induced modeling experiments, lung tissues from the Nrf2 KO mice showed reduced expression levels of GPX4, Nrf2, and HO-1, as well as up-regulation of 4-HNE and PTGS2 compared to the WT mice (Fig. 6 . H, L-S). TEM analysis revealed exacerbated mitochondrial damage in Nrf2KO + LPS + HM group compared to LPS + HM group, manifested by significant reductions in mitochondrial volume and cristae density(Fig. 6 . T). These findings suggested that HM exerts anti-ferroptosis effects by activating the Nrf2/HO-1 signaling axis and these effects are abrogated by the genetic ablation of Nrf2. 4. Discussion This study suggested that HM mitigates LPS-stimulated ALI in mice by inhibiting ferroptosis via activation of the Nrf2/HO-1 axis. Previous studies have established that HM reduces ALI by modulating mitochondrial dynamics and inhibiting pyroptosis ( 18 , 19 ). However, the specific mechanisms by which HM mitigates LPS-stimulated ALI are not clear. In this study, we found that HM decreased LPS-induced ALI by mitigating ferroptosis. Furthermore, the lung protective effects of HM were partially mediated through activation of the Nrf2/HO-1 axis (Fig. 7 ). Our results provide evidence for the use of HM as a novel therapeutic strategy for the management of septic ALI. 4.1 HM mitigates sepsis-related ALI by suppressing ferroptosis The progression of sepsis-related ALI is characterized by rapid deterioration of alveolar-capillary membrane integrity accompanied by amplified inflammatory cascades, which can lead to ARDS ( 24 ). Furthermore, oxidative stress is a critical pathophysiological mediator in the progression of sepsis and its related pulmonary complications ( 25 ). The mortality rate of sepsis-related ALI/ARDS is significantly high because effective clinical interventions are lacking ( 26 ). Experimental characterization of LPS-challenged ALI models have revealed the following three hallmark pathological features: ( 1 ) substantial histopathological impairment of the pulmonary architecture; ( 2 ) up-regulation of pro-inflammatory mediators such as IL-1β, IL-6, and TNF-α; and ( 3 ) dysregulated redox homeostasis, as evidenced by imbalanced glutathione system (lower GSH and SOD levels and higher GSSG levels) and elevated levels of lipid peroxidation marker, MDA. Therefore, there is an urgent need for developing targeted interventions against endotoxin-mediated pulmonary pathophysiology. Ferroptosis is a novel modality of regulated cell death and is mechanistically characterized by iron-catalyzed accumulation of lipid peroxidation products that culminates in catastrophic membrane integrity failure ( 27 ). Ferroptosis contributes to pathological progression of oxidative stress-related diseases, including neurodegenerative disorders, ischemia-reperfusion injury, and tumorigenesis, by disrupting cellular redox homeostasis ( 28 – 30 ). GPX4 plays a critical role in regulating ferroptosis by maintaining membrane integrity through glutathione-dependent reduction of lipid peroxidation ( 31 ). PTGS2, a well-established biomarker of ferroptosis, is significantly upregulated in correlation with activation of the inflammatory signaling pathway (e.g., NF-κB or MAPK), thereby suggesting a mechanistic link between ferroptosis and inflammation ( 32 ). Lipid peroxidation end-products such as 4-HNE and MDA directly reflect membrane oxidative damage ( 33 ). Ferrous iron (Fe²⁺) drives the lipid peroxidation cascade via Fenton reaction catalysis, whereas accumulation of LPO represents a core molecular event for executing ferroptosis ( 34 ). These biomarkers are integral components of the complex metabolic network associated with ferroptosis. Ferroptosis plays a significant role in the pathology of endotoxin-induced ALI. The concentrations of MDA, Fe²⁺, and LPO are significantly elevated in the LPS-challenged ALI models relative to the controls. Ferroptosis activation in LPS-induced pulmonary injury is associated with concomitant suppression of GPX4 expression and coordinated upregulation of PTGS2 and 4-HNE. Therefore, it is essential to investigate pharmacological agents that target ferroptosis as a potential therapeutic approach for endotoxin-induced ALI. HM exhibits multimodal therapeutic effects beyond analgesia, including anti-inflammatory and antioxidant properties under inflammatory conditions ( 18 , 19 ). Experimental studies have indicated that HM suppresses pro-inflammatory mediators through µ-opioid receptor-mediated pathways. These dual actions are evidenced by decreased levels of LPO markers and improved redox balance in preclinical inflammatory models, thereby suggesting potential clinical applications. Previous studies have shown that HM exerts protective effects against ALI through multimodal mechanisms involving suppression of inflammation, modulation of redox homeostasis, and inhibition of pyroptosis. However, precise molecular pathways underlying the effects of HM are not clear and require further elucidation. Our experimental data demonstrates that HM preconditioning attenuates LPS-mediated lung damage, as evidenced by improved histopathology, lower lung injury score, downregulation of inflammatory mediators, and altered profiles of oxidative stress biomarkers. Furthermore, HM pretreatment resulted in up-regulation of GPX4 and concurrently down-regulation of PTGS2 and 4-HNE. This suggests that HM alleviates LPS-triggered pulmonary injury by suppressing inflammatory signaling, redox imbalance, and ferroptosis. 4.2 Nrf2/HO-1 signaling pathway plays a pivotal role in reducing ferroptosis linked to HM in endotoxin-induced ALI Mechanistically, Nrf2 orchestrates cellular antioxidant defenses and preserves redox equilibrium through transcriptional regulation of downstream targets ( 35 , 36 ). Nrf2 activation serves as a central regulatory mechanism for reducing reactive oxygen species (ROS) production and maintaining redox homeostasis ( 37 ). Nrf2 is also recognized as a crucial modulator of ALI ( 38 ). Activated Nrf2 translocates to the nucleus, binds to the antioxidant response elements (AREs), and initiates transcriptional activation of cytoprotective genes such as heme oxygenase-1 (HO-1) ( 39 ). The HO-1 enzyme system mediates dual protective effects against inflammatory cascades and redox imbalance through bioactive metabolites such as carbon monoxide and biliverdin ( 40 ). Furthermore, HO-1 protects lungs by regulating ferroptosis ( 41 , 42 ). Our study demonstrated that pretreatment with HM reduced LPS-induced lung injury by significantly elevating Nrf2 and HO-1 expression levels. Consequently, our data suggests that HM confers protection against LPS-triggered ALI by modulating the Nrf2/HO-1 signaling axis. We used the Nrf2 knockout (KO) model mice as well as Nrf2 siRNA-transfected MH-S cells to further investigate the role of the Nrf2/HO-1 signaling pathway. Nrf2 knockout in mice as well as Nrf2 silencing in MH-S cells significantly reduced the protective effects associated with HM pretreatment. Nrf2 KO/LPS/HM mice demonstrated exacerbated lung damage, higher lung injury scores, as well as enhanced inflammation and oxidative stress. Similar effects were observed in the Nrf2-silenced MH-S cells. Both Nrf2 KO/LPS/HM mice and Nrf2-silenced MH-S cells demonstrated reduced expression levels of GPX4, Nrf2, and HO-1 and increased expression levels of PTGS2 and 4-HNE compared to the corresponding controls. These data suggested that HM pretreatment significantly reduced ferroptosis and endotoxin-induced ALI through activation of the Nrf2/HO-1 axis. The significance of our findings include elucidation of the molecular mechanisms and signaling pathways through which HM exerts protective effects against LPS-stimulated ALI. HM mediates protective benefits effects by mitigating inflammation, oxidative stress, and ferroptosis, all of which are critical players in the pathogenesis of ALI. Furthermore, Nrf2/HO-1 pathway plays a pivotal role in mediating the beneficial effects of HM, thereby underscoring the importance of targeting this signaling axis for future therapeutic strategies. The limitations of this study merit careful consideration. While the findings underscore the beneficial effect of HM in alleviating LPS-stimulated ALI, lack of clinical validation restricts the applicability of these results to human populations. Furthermore, the small sample size of the animal models may compromise the generalizability of the outcomes. Moreover, the lack of long-term follow-up evidence hinders our understanding of the long-term efficacy and safety of HM in chronic inflammatory diseases. Therefore, future research studies with larger and more diverse cohorts are necessary to overcome these limitations and assess the long-term therapeutic potential and mechanistic details of HM in clinical settings. Collectively, our findings demonstrate that HM alleviates LPS-induced ALI through multifaceted mechanisms, including suppression of inflammatory cascades, restoration of redox homeostasis, and inhibition of ferroptosis through activation of the Nrf2/HO-1 axis. These findings not only enhance our understanding of the pharmacological potential of HM in treating septic ALI but also lay the groundwork for future investigations aimed at exploring its therapeutic applications in related inflammatory conditions. Further research is warranted to elucidate the clinical relevance and long-term benefits of HM as a treatment option for acute lung injury and its underlying mechanisms. 5. Conclusions This study demonstrates that HM protects against LPS-induced ALI through Nrf2/HO-1-mediated suppression of ferroptosis in both cellular and animal experimental systems. Furthermore, targeted inhibition of the Nrf2/HO-1 pathway decreases LPS-induced ferroptosis and inflammation in the lungs as well as MH-S cells. These findings suggest that HM is a potential therapeutic strategy for alleviating endotoxin-induced ALI. Abbreviations HM Hydromorphone LPS lipopolysaccharide ALI acute lung injury Nrf2 nuclear factor erythroid 2-related factor-2 HO-1 heme oxygenase-1 KO knockout WT wild-type GPX4 Glutathione Peroxidase 4 PTGS2 Prostaglandin-endoperoxide synthase 2 4-HNE 4-hydroxy-2-nonenal Declarations Ethics statement animal experimentation This study strictly adhered to the NIH Guide for the Care and Use of Laboratory Animals (85-23 rev.) and obtained ethical clearance from Qingdao University Affiliated Hospital's IACUC (Protocol No. QYFY-WZLL-2023-28466), ensuring full compliance with international animal research standards. Consent for publication Not applicable. Availability of data and materials The raw data supporting the conclusions of this article will be made available by the corresponding author without undue reservation. Competing interests The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as potential conflicts of interest. Consent to Participate declaration : Not applicable. Funding Declaration There was no Funding. Author Contributions X.K.L. : Conceptualization, Formal analysis, Investigation, Writing-original draft. Y.X.X. : Data curation, Methodology, Software, Visualization, Writing-original draft. W.Y.L: Investigation, Validation. S.N.L. : Funding acquisition, Project administration, Supervision, Writing-review & editing. C.C.L.: Data curation, Resources. C.L.W.: Formal analysis, Software. Q.Z.: Investigation, Visualization. H.Y.G.: Resources, Validation. Y.T.W. : Conceptualization, Project administration, Supervision, Writing-review & editing. Ackowledgements Not applicable. References Abbott M, Li Y, Brochard L, Zhang H. Precision Medicine Using Simultaneous Monitoring and Assessment with Imaging and Biomarkers to Manage Mechanical Ventilation in ARDS. Intensive Care Res. 2023;3(3):195–203. 10.1007/s44231-023-00045-4 . Li W, Li D, Chen Y et al. Classic Signaling Pathways in Alveolar Injury and Repair Involved in Sepsis-Induced ALI/ARDS: New Research Progress and Prospect. Dis Markers. 2022;2022:6362344. Published 2022 Jun 18. 10.1155/2022/6362344 Shen Y, He Y, Pan Y, Liu L, Liu Y, Jia J. Role and mechanisms of autophagy, ferroptosis, and pyroptosis in sepsis-induced acute lung injury. Front Pharmacol. 2024;15:1415145. Published 2024 Aug 5. 10.3389/fphar.2024.1415145 Holford P, Carr AC, Jovic TH, et al. Vitamin C-An Adjunctive Therapy for Respiratory Infection, Sepsis and COVID-19. Nutrients. 2020;12(12):3760. 10.3390/nu12123760 . Published 2020 Dec 7. Xu Y, Xin J, Sun Y, et al. Mechanisms of Sepsis-Induced Acute Lung Injury and Advancements of Natural Small Molecules in Its Treatment. Pharmaceuticals (Basel). 2024;17(4):472. 10.3390/ph17040472 . Published 2024 Apr 8. Krutsinger DC, Yadav KN, Harhay MO, Bartels K, Courtright KR. A systematic review and meta-analysis of enrollment into ARDS and sepsis trials published between 2009 and 2019 in major journals. Crit Care. 2021;25(1):392. Published 2021 Nov 15. 10.1186/s13054-021-03804-1 Dixon SJ, Olzmann JA. The cell biology of ferroptosis. Nat Rev Mol Cell Biol. 2024;25(6):424–42. 10.1038/s41580-024-00703-5 . Fang X, Ardehali H, Min J, Wang F. The molecular and metabolic landscape of iron and ferroptosis in cardiovascular disease. Nat Rev Cardiol. 2023;20(1):7–23. 10.1038/s41569-022-00735-4 . Ryan SK, Zelic M, Han Y, et al. Microglia ferroptosis is regulated by SEC24B and contributes to neurodegeneration. Nat Neurosci. 2023;26(1):12–26. 10.1038/s41593-022-01221-3 . Lin Q, Li S, Jin H, et al. Mitophagy alleviates cisplatin-induced renal tubular epithelial cell ferroptosis through ROS/HO-1/GPX4 axis. Int J Biol Sci. 2023;19(4):1192–210. 10.7150/ijbs.80775 . Published 2023 Feb 13. Yang W, Wang Y, Zhang C et al. Maresin1 Protect Against Ferroptosis-Induced Liver Injury Through ROS Inhibition and Nrf2/HO-1/GPX4 Activation. Front Pharmacol. 2022;13:865689. Published 2022 Apr 4. 10.3389/fphar.2022.865689 Liu P, Feng Y, Li H, et al. Ferrostatin-1 alleviates lipopolysaccharide-induced acute lung injury via inhibiting ferroptosis. Cell Mol Biol Lett. 2020;25:10. 10.1186/s11658-020-00205-0 . Published 2020 Feb 27. Li K, Wang XQ, Liao ZL, et al. Wedelolactone inhibits ferroptosis and alleviates hyperoxia-induced acute lung injury via the Nrf2/HO-1 signaling pathway. Toxicol Sci. 2024;202(1):25–35. 10.1093/toxsci/kfae099 . Li J, Lu K, Sun F et al. Panaxydol attenuates ferroptosis against LPS-induced acute lung injury in mice by Keap1-Nrf2/HO-1 pathway. J Transl Med. 2021;19(1):96. Published 2021 Mar 2. 10.1186/s12967-021-02745-1 Li Y, Yue X, Liang S, Ren F, Guo Q, Zou W. Effectiveness and Safety of Hydromorphone Compared to Morphine for Postoperative Analgesia: A Systematic Review and Meta-analysis. Pain Physician. 2024;27(8):469–78. Qiu L, Yan Y, Zhong G, et al. Hydromorphone hydrochloride preconditioning combined with postconditioning attenuates myocardial ischemia/reperfusion injury in rats by improving mitochondrial function and activating the PI3K/Akt signaling pathway. Chem Biol Drug Des. 2024;103(2):e14474. 10.1111/cbdd.14474 . Hale Mitchell LK, Koh RB, Nevarez JG. Successful Treatment of a Cervical Injury and Myopathy Using Integrative Medicine Techniques in an Eclectus Parrot (Eclectus roratus) Following Cervical Entrapment. J Avian Med Surg. 2023;37(2):175–9. 10.1647/22-00013 . Shi J, Du SH, Yu JB et al. Hydromorphone Protects against CO2 Pneumoperitoneum-Induced Lung Injury via Heme Oxygenase-1-Regulated Mitochondrial Dynamics. Oxid Med Cell Longev. 2021;2021:9034376. Published 2021 Apr 9. 10.1155/2021/9034376 Zhang J, Li J, An Z, Qi J, HYDROMORPHONE MITIGATES CARDIOPULMONARY BYPASS-INDUCED ACUTE, LUNG INJURY BY REPRESSING PYROPTOSIS OF ALVEOLAR MACROPHAGES. Shock. 2023;60(1):92–9. 10.1097/SHK.0000000000002138 . Ma Y, Wang Z, Wu X, et al. 5-Methoxytryptophan ameliorates endotoxin-induced acute lung injury in vivo and in vitro by inhibiting NLRP3 inflammasome-mediated pyroptosis through the Nrf2/HO-1 signaling pathway. Inflamm Res. 2023;72(8):1633–47. 10.1007/s00011-023-01769-1 . Nair AB, Jacob S. A simple practice guide for dose conversion between animals and human. J Basic Clin Pharm. 2016;7(2):27–31. 10.4103/0976-0105.177703 . Zhao Q, Kong C, Wu X, et al. Ciprofol prevents ferroptosis in LPS induced acute lung injury by activating the Nrf2 signaling pathway. BMC Pulm Med. 2024;24(1):591. 10.1186/s12890-024-03415-w . Published 2024 Nov 28. He R, Liu B, Xiong R, et al. Itaconate inhibits ferroptosis of macrophage via Nrf2 pathways against sepsis-induced acute lung injury. Cell Death Discov. 2022;8(1):43. 10.1038/s41420-021-00807-3 . Published 2022 Feb 2. Liu C, Xiao K, Xie L. Advances in the Regulation of Macrophage Polarization by Mesenchymal Stem Cells and Implications for ALI/ARDS Treatment. Front Immunol. 2022;13:928134. 10.3389/fimmu.2022.928134 . Published 2022 Jul 8. Lai K, Song C, Gao M, et al. Uridine Alleviates Sepsis-Induced Acute Lung Injury by Inhibiting Ferroptosis of Macrophage. Int J Mol Sci. 2023;24(6):5093. 10.3390/ijms24065093 . Published 2023 Mar 7. Li W, Li D, Chen Y et al. Classic Signaling Pathways in Alveolar Injury and Repair Involved in Sepsis-Induced ALI/ARDS: New Research Progress and Prospect. Dis Markers. 2022;2022:6362344. Published 2022 Jun 18. 10.1155/2022/6362344 Jiang X, Stockwell BR, Conrad M. Ferroptosis: mechanisms, biology and role in disease. Nat Rev Mol Cell Biol. 2021;22(4):266–82. 10.1038/s41580-020-00324-8 . Li Z, Zhang Y, Ji M, Wu C, Zhang Y, Ji S. Targeting ferroptosis in neuroimmune and neurodegenerative disorders for the development of novel therapeutics. Biomed Pharmacother. 2024;176:116777. 10.1016/j.biopha.2024.116777 . Cai W, Liu L, Shi X, et al. Alox15/15-HpETE Aggravates Myocardial Ischemia-Reperfusion Injury by Promoting Cardiomyocyte Ferroptosis. Circulation. 2023;147(19):1444–60. 10.1161/CIRCULATIONAHA.122.060257 . Li H, Yu K, Hu H, et al. METTL17 coordinates ferroptosis and tumorigenesis by regulating mitochondrial translation in colorectal cancer. Redox Biol. 2024;71:103087. 10.1016/j.redox.2024.103087 . Liang D, Feng Y, Zandkarimi F, et al. Ferroptosis surveillance independent of GPX4 and differentially regulated by sex hormones. Cell. 2023;186(13):2748–e276422. 10.1016/j.cell.2023.05.003 . Zhou Y, Zhou H, Hua L, et al. Verification of ferroptosis and pyroptosis and identification of PTGS2 as the hub gene in human coronary artery atherosclerosis. Free Radic Biol Med. 2021;171:55–68. 10.1016/j.freeradbiomed.2021.05.009 . Liu L, Pang J, Qin D, et al. Deubiquitinase OTUD5 as a Novel Protector against 4-HNE-Triggered Ferroptosis in Myocardial Ischemia/Reperfusion Injury. Adv Sci (Weinh). 2023;10(28):e2301852. 10.1002/advs.202301852 . Huang D, Xu D, Chen W, et al. Fe-MnO 2 nanosheets loading dihydroartemisinin for ferroptosis and immunotherapy. Biomed Pharmacother. 2023;161:114431. 10.1016/j.biopha . .2023.114431 Antitumor Effects of Hydromorphone on Human Gastric Cancer Cells in vitro. Ma C, Gu C, Lian P, et al. Sulforaphane alleviates psoriasis by enhancing antioxidant defense through KEAP1-NRF2 Pathway activation and attenuating inflammatory signaling. Cell Death Dis. 2023;14(11):768. 10.1038/s41419-023-06234-9 . Published 2023 Nov 25. Barnes PJ. Oxidative stress-based therapeutics in COPD. Redox Biol. 2020;33:101544. 10.1016/j.redox.2020.101544 . Jo Y, Shim JA, Jeong JW, et al. Targeting ROS-sensing Nrf2 potentiates anti-tumor immunity of intratumoral CD8 + T and CAR-T cells. Mol Ther. 2024;32(11):3879–94. 10.1016/j.ymthe.2024.08.019 . Dong H, Xia Y, Jin S et al. Nrf2 attenuates ferroptosis-mediated IIR-ALI by modulating TERT and SLC7A11. Cell Death Dis . 2021;12(11):1027. Published 2021 Oct 29. 10.1038/s41419-021-04307-1 O'Rourke SA, Shanley LC, Dunne A. The Nrf2-HO-1 system and inflammaging. Front Immunol. 2024;15:1457010. 10.3389/fimmu.2024.1457010 . Published 2024 Sep 24. Sadeghi M, Fathi M, Gholizadeh Navashenaq J et al. The prognostic and therapeutic potential of HO-1 in leukemia and MDS. Cell Commun Signal . 2023;21(1):57. Published 2023 Mar 13. 10.1186/s12964-023-01074-8 Luo P, Liu D, Zhang Q, et al. Celastrol induces ferroptosis in activated HSCs to ameliorate hepatic fibrosis via targeting peroxiredoxins and HO-1. Acta Pharm Sin B. 2022;12(5):2300–14. 10.1016/j.apsb.2021.12.007 . Yang R, Gao W, Wang Z, et al. Polyphyllin I induced ferroptosis to suppress the progression of hepatocellular carcinoma through activation of the mitochondrial dysfunction via Nrf2/HO-1/GPX4 axis. Phytomedicine. 2024;122:155135. 10.1016/j.phymed.2023.155135 . Additional Declarations No competing interests reported. Supplementary Files Supplementaryfile1.pdf Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7370812","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":529737407,"identity":"c5267f48-b268-4cfb-bb78-871471f3a141","order_by":0,"name":"Xiangkun Li","email":"","orcid":"","institution":"The Affiliated Hospital of Qingdao University","correspondingAuthor":false,"prefix":"","firstName":"Xiangkun","middleName":"","lastName":"Li","suffix":""},{"id":529737408,"identity":"635ccf4c-5b3b-4837-9bcf-38b157309b3b","order_by":1,"name":"Yexiang Xu","email":"","orcid":"","institution":"The Affiliated Hospital of Qingdao University","correspondingAuthor":false,"prefix":"","firstName":"Yexiang","middleName":"","lastName":"Xu","suffix":""},{"id":529737409,"identity":"f72446b4-b8f9-4c4e-8fec-db2456f90cb8","order_by":2,"name":"Wenyi Liu","email":"","orcid":"","institution":"The Affiliated Hospital of Qingdao University","correspondingAuthor":false,"prefix":"","firstName":"Wenyi","middleName":"","lastName":"Liu","suffix":""},{"id":529737411,"identity":"c27c00c5-a0bf-44b4-8e2f-7ff86fcca95b","order_by":3,"name":"Shaona Li","email":"","orcid":"","institution":"The Affiliated Hospital of Qingdao University","correspondingAuthor":false,"prefix":"","firstName":"Shaona","middleName":"","lastName":"Li","suffix":""},{"id":529737413,"identity":"c1285875-f5bb-4ba6-b36d-e04253cc6bbc","order_by":4,"name":"Cuicui Liu","email":"","orcid":"","institution":"The Affiliated Hospital of Qingdao University","correspondingAuthor":false,"prefix":"","firstName":"Cuicui","middleName":"","lastName":"Liu","suffix":""},{"id":529737414,"identity":"af0a8700-0619-4688-93a8-05443f025659","order_by":5,"name":"Cuili Wen","email":"","orcid":"","institution":"The Affiliated Hospital of Qingdao University","correspondingAuthor":false,"prefix":"","firstName":"Cuili","middleName":"","lastName":"Wen","suffix":""},{"id":529737416,"identity":"4fc27b04-832f-4616-923a-8ae627e19419","order_by":6,"name":"Qin Zhao","email":"","orcid":"","institution":"The Affiliated Hospital of Qingdao University","correspondingAuthor":false,"prefix":"","firstName":"Qin","middleName":"","lastName":"Zhao","suffix":""},{"id":529737418,"identity":"4ec1cb2e-305f-457e-b2a1-fccec3afed05","order_by":7,"name":"Haiyan Guo","email":"","orcid":"","institution":"The Affiliated Hospital of Qingdao University","correspondingAuthor":false,"prefix":"","firstName":"Haiyan","middleName":"","lastName":"Guo","suffix":""},{"id":529737419,"identity":"8c4d63a1-d7cf-439d-8c82-cf7de350b0e5","order_by":8,"name":"Yanting Wang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABHklEQVRIie3Mv0vDQBTA8TsC53I266tK+y+cBLK04L8SEZLlKpmKg0inuEhdU8T/Qf+DKw/MEqtjhg6FQpdmSBfJYvGMP3CIraPDfbnHcfA+R4jJ9J9jerA8gxYh3udzS6B3KJK06/yd6LGQRv7xYBsRySMu+fn0orF/+Ywhw2CYSEGKPhL7ZlBP0lO/wx8WwA7SEGOOvVGaCxpPkMBU1RJXSdfhDIGB9BQH7N1lUli7ERIBXj15yjVZfxGBgXgnr5tIJp25/lOTQCH3fK8idAM5ynKX3g6xGYEk41h1D0fpIhxfTQIOWT1pXkunyF/QbsfBvFitod1ITu5nZb/TsuN6omN7vLq5+Hir6hD+277OWpXVvTP7JiaTyWT62RthwGkvaEJn3QAAAABJRU5ErkJggg==","orcid":"","institution":"The Affiliated Hospital of Qingdao University","correspondingAuthor":true,"prefix":"","firstName":"Yanting","middleName":"","lastName":"Wang","suffix":""}],"badges":[],"createdAt":"2025-08-14 07:23:12","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7370812/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7370812/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":93669586,"identity":"05ecd360-2255-41db-b57b-cf643ea97944","added_by":"auto","created_at":"2025-10-16 09:41:17","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":11116321,"visible":true,"origin":"","legend":"","description":"","filename":"finalmanuscript.docx","url":"https://assets-eu.researchsquare.com/files/rs-7370812/v1/3fa3b0236885c0c4f9e41208.docx"},{"id":93669573,"identity":"352079cd-b843-4680-a02d-4508ad9ec735","added_by":"auto","created_at":"2025-10-16 09:41:16","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":10155,"visible":true,"origin":"","legend":"","description":"","filename":"9e397feba7144265bab1cd51c7aefcbe.json","url":"https://assets-eu.researchsquare.com/files/rs-7370812/v1/b0e51a33701027664f1ab2a4.json"},{"id":93669581,"identity":"f78028f3-fee7-41f8-8ceb-49cb151e1265","added_by":"auto","created_at":"2025-10-16 09:41:17","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":10081533,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementaryfile1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7370812/v1/249f2410eaaac63f3e85fdcb.pdf"},{"id":93669576,"identity":"e6aa3e04-fd99-4ac4-a8ae-9491288ba6f0","added_by":"auto","created_at":"2025-10-16 09:41:16","extension":"xml","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":140741,"visible":true,"origin":"","legend":"","description":"","filename":"9e397feba7144265bab1cd51c7aefcbe1enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7370812/v1/ee142c1ad12f7b363761c132.xml"},{"id":93669593,"identity":"4aa22bb5-2c31-4674-bc5d-ccf916c0296c","added_by":"auto","created_at":"2025-10-16 09:41:17","extension":"jpeg","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1506484,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7370812/v1/d86f54b9d80461eceb49c146.jpeg"},{"id":93669583,"identity":"7c398ea5-c3e1-489b-a508-33ff4d24bb7c","added_by":"auto","created_at":"2025-10-16 09:41:17","extension":"jpeg","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6780316,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7370812/v1/cd28214e0768d32738873b4a.jpeg"},{"id":93669585,"identity":"2f794ca4-d66d-47bf-8266-765b4a8d4490","added_by":"auto","created_at":"2025-10-16 09:41:17","extension":"jpeg","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2774896,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7370812/v1/d175508ec4dc32ab4e9903e7.jpeg"},{"id":93669903,"identity":"736ecfc0-65b7-4a99-b715-745bf88bcaf1","added_by":"auto","created_at":"2025-10-16 09:49:17","extension":"jpeg","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5135320,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7370812/v1/eff16a59fbd1ff74ed7aa6a7.jpeg"},{"id":93669904,"identity":"5ae41bed-a22c-42bd-8e9d-8b1b62092098","added_by":"auto","created_at":"2025-10-16 09:49:17","extension":"jpeg","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5805760,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7370812/v1/af130be383e10f66dd75db93.jpeg"},{"id":93669594,"identity":"1c581078-f7c6-4999-aa3c-4e9f44cc2b47","added_by":"auto","created_at":"2025-10-16 09:41:17","extension":"jpeg","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":9102274,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7370812/v1/cb22e62eb1384e829ccc4e92.jpeg"},{"id":93669591,"identity":"25015ab0-aed4-48d1-b5f8-6c8d70bdd4ae","added_by":"auto","created_at":"2025-10-16 09:41:17","extension":"jpeg","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":856841,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7370812/v1/da51832d1dce6123f84da3fd.jpeg"},{"id":93669596,"identity":"74160216-003f-4423-9f35-d07681819813","added_by":"auto","created_at":"2025-10-16 09:41:17","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":408689,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7370812/v1/47be0c860133ed2d47332cdd.png"},{"id":93669599,"identity":"35ed2c4f-7665-4793-8fd1-076b953f9cb1","added_by":"auto","created_at":"2025-10-16 09:41:18","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":204785,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7370812/v1/333961cb373cccdf506cae5a.png"},{"id":93669905,"identity":"d4c5868d-4afe-4eed-9331-40ee937d0318","added_by":"auto","created_at":"2025-10-16 09:49:17","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":186840,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7370812/v1/2cc093e7e616375e6fcef047.png"},{"id":93669592,"identity":"8c97f4e4-309e-4089-9f53-71c5e4a33d99","added_by":"auto","created_at":"2025-10-16 09:41:17","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":316296,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7370812/v1/1aa51f48d822d086a92d135f.png"},{"id":93669582,"identity":"e6c9da4e-e3b7-45cd-99c7-1f672c097b9e","added_by":"auto","created_at":"2025-10-16 09:41:17","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":137874,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7370812/v1/798e205f900f11de93c17078.png"},{"id":93669595,"identity":"69671334-8f56-4330-a176-ee74120c3cc2","added_by":"auto","created_at":"2025-10-16 09:41:17","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":377140,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7370812/v1/4a08ee66b31f1c5965c72959.png"},{"id":93669600,"identity":"255472c9-0569-449d-ba5e-14c151fa0a34","added_by":"auto","created_at":"2025-10-16 09:41:18","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":251863,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-7370812/v1/cb8605e914e70f864edd17c1.png"},{"id":93669598,"identity":"1ed23b58-bf7f-4052-9740-d1af763cec41","added_by":"auto","created_at":"2025-10-16 09:41:18","extension":"xml","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":138401,"visible":true,"origin":"","legend":"","description":"","filename":"9e397feba7144265bab1cd51c7aefcbe1structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7370812/v1/0250cd6b25f4a7ed72a5b894.xml"},{"id":93669588,"identity":"e2910a85-6958-40e4-a9fe-c39dde130085","added_by":"auto","created_at":"2025-10-16 09:41:17","extension":"html","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":151126,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7370812/v1/8ceb7020e6c0c18431944a2c.html"},{"id":93669578,"identity":"87b772d0-3f2e-4bbc-bb4b-bb60baf9cf5e","added_by":"auto","created_at":"2025-10-16 09:41:17","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":4793508,"visible":true,"origin":"","legend":"\u003cp\u003ePretreatment with HM mitigates LPS-induced ALI in mice.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e H\u0026amp;E and Masson staining results show the histopathological changes in the lung sections of the LPS, LPS+HM, and HM mice compared to the control mice (original magnification,× 200). Scale bar: 100 μm. (\u003cstrong\u003eB)\u003c/strong\u003e Lung injury scores in the control, LPS, LPS+HM, and HM mice. (\u003cstrong\u003eC)\u003c/strong\u003e The lung wet/dry (W/D) weight ratio in the control, LPS, LPS+HM, and HM mice. (\u003cstrong\u003eD)\u003c/strong\u003e The percentage of collagen fibrosis based on Masson’s staining results in the control, LPS, LPS+HM, and HM mice. (\u003cstrong\u003eE-G)\u003c/strong\u003e ELISA results show the levels of pro-inflammatory cytokines IL-1β, IL-6, and TNF-α in the control, LPS, LPS+HM, and HM mice. The data represented in the bar graphs are expressed as mean ± SD. Multiple group comparisons were performed using one-way ANOVA with Bonferroni correction (\u003cem\u003en \u003c/em\u003e= 6). * denotes \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05 compared with the control group; \u003csup\u003e#\u003c/sup\u003e denotes \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05 compared with the LPS group. Abbreviations: LPS, lipopolysaccharide; ALI, acute lung injury; H\u0026amp;E, hematoxylin and eosin; ELISA, enzyme-linked immunosorbent assay; ANOVA, analysis of variance; \u0026nbsp;HM, Hydromorphone.\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-7370812/v1/53b993e6ef1fc946055fe2f9.png"},{"id":93669902,"identity":"9547f8be-37da-4a94-ae61-5e5efb1e7fea","added_by":"auto","created_at":"2025-10-16 09:49:16","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":5843881,"visible":true,"origin":"","legend":"\u003cp\u003eHM pretreatment alleviates oxidative stress and ferroptosis in LPS-induced sepsis model mice.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A-C)\u003c/strong\u003e GSH and GSSG levels and the GSH/GSSG ratio in the control, LPS, LPS+HM, HM, and LPS-Fer-1 group mice (\u003cem\u003en \u003c/em\u003e= 6). (\u003cstrong\u003eD-F)\u003c/strong\u003eThe levels of MDA, Fe2+, and LPO in the control, LPS, LPS+HM, HM, and LPS-Fer-1 group mice (\u003cem\u003en \u003c/em\u003e= 6). (\u003cstrong\u003eG-K)\u003c/strong\u003e Representative western blots and semi-quantitative analysis shows the expression levels of ferroptosis-related proteins such as GPX4, PTGS2, and 4-HNE in the lung tissues of the control, LPS, LPS+HM, HM, and LPS-Fer-1 group mice (\u003cem\u003en \u003c/em\u003e= 3). Full-length blots are shown in the [A1] Supplementary file 1. Band intensity values were normalized to β-actin. The data values were expressed as mean ± SD. Multiple group comparisons were performed using one-way ANOVA with the Bonferroni correction. * denotes\u003cem\u003e P \u003c/em\u003e\u0026lt; 0.05 compared to the control group; # denotes \u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05 compared to the LPS group; \u0026amp; denotes \u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05 compared to the LPS+HM group. (\u003cstrong\u003eL)\u003c/strong\u003eRepresentative immunofluorescence images show 4-HNE protein expression in the control, LPS, LPS+HM, HM, and LPS-Fer-1 group mice ( magnification, × 400). Scale bar: 50 μm. Green staining indicates 4-HNE; blue staining indicates DAPI-stained nuclear structure. (\u003cstrong\u003eM\u003c/strong\u003e) Transmission electron microscopy images of representative mitochondrial structures (scale bar, 500 nm). Abbreviations: MDA, malondialdehyde; GSH, glutathione; GSSG, oxidized glutathione; LPO, LiperFluo; GPX4, Glutathione Peroxidase 4; PTGS2, \u003cstrong\u003eProstaglandin-endoperoxide synthase 2;\u003c/strong\u003e 4-HNE, 4-hydroxy-2-nonenal; DAPI, 4',6-diamidino-2-phenylindole; HM, Hydromorphone.\u003c/p\u003e","description":"","filename":"image2.png","url":"https://assets-eu.researchsquare.com/files/rs-7370812/v1/915045039ad9de8adb9f3570.png"},{"id":93669574,"identity":"3ab2ad6e-f29e-4f8e-adfa-36bc5c485e87","added_by":"auto","created_at":"2025-10-16 09:41:16","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":3452289,"visible":true,"origin":"","legend":"\u003cp\u003eHM alleviates inflammation and oxidative stress in LPS-stimulated MH-S cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e CCK-8 assay results show the viability of MH-S cells incubated with different concentrations of HM (0-50 µM) for 12 h. (\u003cstrong\u003eB)\u003c/strong\u003e CCK-8 assay results show the viability of MH-S cells pre-treated with different concentrations of HM (0-50 µM) for 12 h before stimulation with LPS (10 μg/mL) for another 24 h. The data between groups were analyzed by one-way ANOVA and Bonferroni correction. * denotes \u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05 compared to the control group without HM and LPS stimulation (HM 0, LPS 0). # denotes \u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05 compared to the LPS group treated with 10 µg/mL LPS but without HM pre-treatment (HM 0, LPS 10). (\u003cstrong\u003eC-D)\u003c/strong\u003eThe levels of pro-inflammatory factors IL-1β and IL-6 in the MH-S cell supernatants from the control, LPS, LPS+HM, and HM groups. (\u003cstrong\u003eE-I)\u003c/strong\u003e MDA levels, SOD activity, GSH levels, GSSG levels, and GSH/GSSG ratio in the control, LPS, LPS+HM, and HM groups, indicating the status of oxidative stress. (\u003cstrong\u003eJ-K) \u003c/strong\u003eFlow cytometry data shows the percentage of MH-S cell apoptosis in the control, LPS, LPS+HM, and HM groups. The data in (C)-(K) is expressed as mean ± SD. Multiple group comparisons were performed using one-way ANOVA with the Bonferroni correction (\u003cem\u003en \u003c/em\u003e= 6). * denotes \u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05 compared to the control group; # denotes \u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05 compared to the LPS group. Abbreviations: CCK-8, Cell Counting Kit-8; SOD, superoxide dismutase.\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-7370812/v1/b7a9ae01bfa1c7ba30bcb70e.png"},{"id":93669590,"identity":"56e2569e-654a-4d3f-a5c8-96262de3f96e","added_by":"auto","created_at":"2025-10-16 09:41:17","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":7594329,"visible":true,"origin":"","legend":"\u003cp\u003eHM ameliorates ferroptosis in the LPS-stimulated MH-S cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e Representative immunofluorescence images show GPX4 protein expression in the control, LPS, LPS+HM, and LPS+Fer-1 groups of MH-S cells (\u003cem\u003en \u003c/em\u003e= 3). (\u003cstrong\u003eB-E) \u003c/strong\u003eRepresentative western blot and\u0026nbsp; bar plots of the protein band intensities show the expression levels of ferroptosis-related proteins, GPX4, PTGS2, and 4-HNE in control, LPS, LPS+HM, and LPS+Fer-1 groups of MH-S cells (\u003cem\u003en \u003c/em\u003e= 3). (\u003cstrong\u003eF-G) \u003c/strong\u003eThe levels of Fe\u003csup\u003e2+\u003c/sup\u003e and LPO in the MH-S cells from the control, LPS, LPS+HM, and LPS+Fer-1 groups (\u003cem\u003en \u003c/em\u003e= 6). (\u003cstrong\u003eH-I) \u003c/strong\u003eMitochondrial membrane potential (MMP) was determined by flow cytometry, after cells were stained with JC-1 indicated by the red/green fluorescence ratio (n = 3 per group).The data in (\u003cstrong\u003eC\u003c/strong\u003e)-(\u003cstrong\u003eH\u003c/strong\u003e) is expressed as mean ± SD. Multiple group comparisons were performed using one-way ANOVA with the Bonferroni correction. * denotes \u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05 compared to the control group; # denotes \u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05 compared to the LPS group. Abbreviations: GPX4, Glutathione Peroxidase 4; PTGS2, \u003cstrong\u003eProstaglandin-endoperoxide synthase 2;\u003c/strong\u003e 4-HNE, 4-hydroxy-2-nonenal.\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-7370812/v1/40dee249829ca92bce5ceaec.png"},{"id":93669575,"identity":"af59858b-f915-432f-a7f4-e8671abe9935","added_by":"auto","created_at":"2025-10-16 09:41:16","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":3505561,"visible":true,"origin":"","legend":"\u003cp\u003eHM alleviates ferroptosis in the \u003cem\u003ein vitro\u003c/em\u003e LPS-stimulated MH-S cells through the Nrf2/HO-1 signaling pathway.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A) \u003c/strong\u003eRT-qPCR analysis demonstrates relative Nrf2 mRNA expression levels in the NC-siRNA and Nrf2-siRNA-transfected MH-S cells. Statistical analysis was performed using the paired t test (\u003cem\u003en\u0026nbsp; \u003c/em\u003e=6). (\u003cstrong\u003eB)\u003c/strong\u003e The levels of MDA, Fe\u003csup\u003e2+\u003c/sup\u003e, and LPO in the MH-S cells from the control, LPS, LPS+HM, Nrf2siRNA+LPS+HM, and NCsiRNA+LPS+HM groups (\u003cem\u003en \u003c/em\u003e= 6/group). (\u003cstrong\u003eE-J)\u003c/strong\u003e Western blotting analysis shows the expression levels of GPX4, PTGS2, 4-HNE, Nrf2, and HO-1 in the MH-S cells from the control, LPS, LPS+HM, Nrf2siRNA+LPS+HM, and NCsiRNA+LPS+HM groups (\u003cem\u003en \u003c/em\u003e= 3/group). Full-length blots are shown in the Additional file 1. The relative expression levels of different proteins were estimated by analyzing the specific band intensity from the western blots relative to β-actin (loading control). (\u003cstrong\u003eK)\u003c/strong\u003e Dual immunofluorescence analysis shows Nrf2 and HO-1 protein expression levels in the MH-S cells from the control, LPS, LPS+HM, Nrf2siRNA+LPS+HM, and NCsiRNA+LPS+HM groups (magnification,× 400). Scale bar: 50 μm. Green staining indicates Nrf2; red staining indicates HO-1; blue staining indicates DAPI-stained nuclear structure. The data in (B)-(J) is expressed as mean ± SD. Multiple group comparisons were performed using one-way ANOVA with the Bonferroni correction. * denotes \u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05 compared to the control group; # denotes \u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05 compared to the LPS group; \u0026amp; denotes \u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05 compared to the LPS+HM group. Abbreviations: Nrf2, nuclear factor erythroid 2-related factor 2; HO-1, heme oxygenase-1.\u003c/p\u003e","description":"","filename":"image5.png","url":"https://assets-eu.researchsquare.com/files/rs-7370812/v1/c50f70de75053dbc6edc7a3b.png"},{"id":93669580,"identity":"13d197f3-9e4a-4f5a-b880-3e34611749a1","added_by":"auto","created_at":"2025-10-16 09:41:17","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":9708773,"visible":true,"origin":"","legend":"\u003cp\u003eHM alleviates \u003cem\u003ein vivo\u003c/em\u003e LPS-induced ALI and ferroptosis through the Nrf2/HO-1 signaling pathway.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A) \u003c/strong\u003eH\u0026amp;E and Masson’s staining results show the histopathological changes in the lung tissue sections from the LPS+HM and Nrf2KO+LPS+HM groups (magnification, × 200). Scale bar: 100 μm. (\u003cstrong\u003eB)\u003c/strong\u003e The lung injury scores in the LPS+HM and Nrf2KO+LPS+HM groups. (\u003cstrong\u003eC)\u003c/strong\u003e The lung wet/dry (W/D) weight ratio in the LPS+HM and Nrf2KO+LPS+HM groups (\u003cem\u003en \u003c/em\u003e= 6). (\u003cstrong\u003eD)\u003c/strong\u003e The percentage of collagen fibrosis in the LPS+HM and Nrf2KO+LPS+HM groups (\u003cem\u003en \u003c/em\u003e= 6). (\u003cstrong\u003eE-G) \u003c/strong\u003eELISA results show the levels of pro-inflammatory cytokines IL-1β, IL-6, and TNF-α in the LPS+HM and Nrf2KO+LPS+HM groups (\u003cem\u003en \u003c/em\u003e= 6).\u003cstrong\u003e (I-K) \u003c/strong\u003eThe levels\u003cstrong\u003e \u003c/strong\u003eof MDA, Fe\u003csup\u003e2+\u003c/sup\u003e, and LPO in the lung tissues from the LPS+HM and Nrf2KO+LPS+HM groups (\u003cem\u003en \u003c/em\u003e= 6). (\u003cstrong\u003eH) \u003c/strong\u003eImmunohistochemical\u003cstrong\u003e \u003c/strong\u003estaining shows\u003cstrong\u003e \u003c/strong\u003eGPX4, 4-HNE, and Nrf2 expression in the lung tissue sections from the LPS+HM and Nrf2KO+LPS+HM groups\u0026nbsp; (\u003cem\u003en \u003c/em\u003e= 3). \u003cstrong\u003e(L, M)\u003c/strong\u003e Quantitative analysis of GPX4 and 4-HNE expression based on immunohistochemical staining (H) of lung tissues from the LPS+HM and Nrf2KO+LPS+HM groups. \u003cstrong\u003e(N, O-S) \u003c/strong\u003eWestern blotting analysis shows the protein expression levels of GPX4, PTGS2, 4-HNE, Nrf2, and HO-1 in the lung tissues from the LPS+HM and Nrf2KO+LPS+HM groups (\u003cem\u003en \u003c/em\u003e= 3). (\u003cstrong\u003eT\u003c/strong\u003e) Transmission electron microscopy images of representative mitochondrial structures (scale bar, 500\u0026nbsp;nm).The data are presented as mean ± SD. Statistical analysis was performed using the t-test. * denotes\u003cem\u003e P \u003c/em\u003e\u0026lt; 0.05 compared to the LPS+HM group. Abbreviations: Nrf2 KO, Nrf2 knockout.\u003c/p\u003e","description":"","filename":"image6.png","url":"https://assets-eu.researchsquare.com/files/rs-7370812/v1/1e5955499262ccf422a9baca.png"},{"id":93669579,"identity":"720eda46-5720-402d-82d1-1030952fae7c","added_by":"auto","created_at":"2025-10-16 09:41:17","extension":"jpeg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":97995,"visible":true,"origin":"","legend":"\u003cp\u003eGraphical illustration of HM pretreatment-mediated inhibition of ferroptosis via regulating the Nrf2/HO-1 signaling pathway. When LPS was administered to C57BL/6J mice or MH-S murine alveolar macrophages, HM activated Nrf2/HO-1 pathway, leading to Nrf2 transferred from the cytoplasm to the nucleus, and increased the ARE response to induce HO-1 target gene expression. Meanwhile, pretreatment of HM down-regulated the expression of ferroptosis markers GPX4, yet up-regulated the expression of ferroptosis marker proteins PTGS2 and 4-HNE. In conclusion, HM pretreatment alleviates ferroptosis in endotoxin-related acute lung injury, thereby reducing inflammation, oxidative stress, and cell apoptosis in lung tissue.\u003c/p\u003e","description":"","filename":"image7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7370812/v1/2b8e4277a62ebe460cdbb1f7.jpeg"},{"id":109205549,"identity":"7f83142a-7adf-4449-974c-5b87e5f16005","added_by":"auto","created_at":"2026-05-13 15:05:42","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":31979375,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7370812/v1/ad041b4b-7faa-45d5-8aed-dd8ca304dcc3.pdf"},{"id":93669584,"identity":"742dba52-7786-462a-89d0-1a16719a0acc","added_by":"auto","created_at":"2025-10-16 09:41:17","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":10081533,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementaryfile1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7370812/v1/4d0d7cbe8d9a697cb61a4f49.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Hydromorphone ameliorates endotoxin-induced acute lung injury by suppressing ferroptosis via Nrf2/HO-1 signaling pathway","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eAcute lung injury (ALI) represents severe lung inflammation caused by various pathogenic factors and is characterized by damage to the alveolar-capillary interface. If the condition is not treated effectively, ALI progresses to acute respiratory distress syndrome (ARDS), a more severe condition (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). Sepsis, a principal instigator of ALI and ARDS, induces systemic inflammation through the recognition of pathogen-associated molecular patterns such as lipopolysaccharide (LPS) by the innate immune system (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). Sepsis and septic ALI/ARDS are common clinical syndromes with a mortality rate of approximately 40% in the ICU over the past decade (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e). Despite extensive research focusing on the development of effective treatments for septic ALI/ARDS, therapeutic options are very limited (\u003cspan additionalcitationids=\"CR5\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e). Therefore, deciphering the underlying mechanisms of septic ALI/ARDS is crucial for developing effective and novel therapeutic drugs.\u003c/p\u003e\u003cp\u003eDixon et al first reported ferroptosis as an iron-dependent form of cell death mechanism distinct from apoptosis and autophagy (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e). Ferroptosis is linked to several human diseases and its inhibition alleviates symptoms of several medical conditions such as heart injury, neurodegeneration, renal failure, and liver injury (\u003cspan additionalcitationids=\"CR9 CR10\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e). Emerging evidence also implicates ferroptosis in the pathophysiological progression of ALI. Moreover, targeted inhibition of ferroptosis demonstrates significant therapeutic potential in preclinical models. For example, Liu et al demonstrated that ferrostatin-1 (Fer-1) attenuates LPS-induced ALI by inhibiting ferroptosis (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e). Li et al demonstrated that wedelolactone alleviates lung injury induced by hyperoxia through GPX4-mediated inhibition of ferroptosis (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e). Li et al reported that panaxydol inhibits ferroptosis in LPS-induced ALI through the Nrf2/HO-1 pathway (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). Mechanistic analysis has demonstrated that ferroptosis exacerbates ALI pathogenesis. Besides, pharmacological potentiation of the Nrf2/HO-1 axis has emerged as a viable therapeutic approach to mitigate ferroptosis. Consequently, our study aimed to identify pharmacological agents that can activate the Nrf2/HO-1 pathway to counteract ferroptosis associated with ALI.\u003c/p\u003e\u003cp\u003eHydromorphone (HM), a potent \u0026micro;-opioid receptor agonist, is widely used as an analgesic (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e). Recent reports have suggested that HM possesses anti-inflammatory and anti-oxidant properties in certain inflammatory settings (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e). Shi et al demonstrated that HM protected against carbon-dioxide pneumoperitoneum-induced ALI by regulating mitochondrial dynamics through the HO-1-related pathway (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e). Zhang et al demonstrated that HM attenuated cardiopulmonary bypass-induced ALI in the alveolar macrophages by inhibiting pyroptosis (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e). Collectively, these findings suggest that HM protects against ALI. However, its therapeutic effects and underlying mechanisms are not well characterized. Therefore, to develop HM as a novel therapeutic option for managing the complex pathophysiology of ALI, there is an urgent need for an in-depth analyses of the molecular mechanisms of HM.\u003c/p\u003e\u003cp\u003eThe current study investigated the protective mechanisms of HM on LPS-induced ALI, especially emphasizing on the role of the Nrf2/HO-1 signaling pathway using both \u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003ein vitro\u003c/em\u003e models. We also investigated the effects of HM on oxidative stress, inflammation, and cellular apoptosis. Histological assessments and molecular analyses, including Western blotting and RT-PCR, were performed to determine the mechanisms by which HM exerted its anti-ALI effects. Moreover, to delineate the mechanistic involvement of the Nrf2/HO-1 axis in HM-related protective effects against ALI, experiments were performed with the global Nrf2 knockout mice and Nrf2 siRNA-transfected cells, with specific emphasis on the status of ferroptosis. Overall, this study aimed to lay a strong foundation to determine the clinical utility of HM as an effective therapeutic option for managing septic ALI and related conditions.\u003c/p\u003e"},{"header":"2. Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003e2.1 Experimental mice\u003c/h2\u003e\u003cp\u003eIn our study, experiments were conducted using two kinds of healthy C57BL/6J male mice aged 6\u0026ndash;8 weeks: wild type (WT) mice (obtained from the Laboratory Animal Center of The Affiliated Hospital of Qingdao University) and Nrf2-deficient mice (provided by Jiangsu Huachuang Sino Pharmaceutical Technology Co., Ltd). This study was strictly conducted according to the NIH Guide for the Care and Use of Laboratory Animals (85\u0026thinsp;\u0026minus;\u0026thinsp;23 rev.) and in full compliance with the international animal research standards. Ethical approval was obtained from the Institutional Animal Care and Use Committee (IACUC) of The affiliated hospital of Qingdao University (Protocol No. QYFY-WZLL-2023-28466). All experimental animals were housed in a SPF-grade IVC system under standardized environmental conditions (temperature, 22\u0026thinsp;\u0026plusmn;\u0026thinsp;1\u0026deg;C; humidity, 55\u0026thinsp;\u0026plusmn;\u0026thinsp;5%;, and 12 h photoperiod). The mice were allowed to habituate for 7 -days and provided ad libitum access to gamma-irradiated food and acidified water (pH 2.5-3.0). Prior to the experiments, the mice were fasted for 12 h and deprived of water for 4 h. One set of mice were randomly allocated into the control, LPS, LPS\u0026thinsp;+\u0026thinsp;HM, and HM groups (\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;6/group). To assess ferroptosis, another set of mice were allocated into control, LPS, LPS\u0026thinsp;+\u0026thinsp;HM, and LPS\u0026thinsp;+\u0026thinsp;ferrostatin-1 (Fer-1) groups (\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;6/group). To evaluate Nrf2-mediated attenuation of HM-induced lung pathology, a set of mice were allocated into the LPS\u0026thinsp;+\u0026thinsp;HM and Nrf2 KO\u0026thinsp;+\u0026thinsp;LPS\u0026thinsp;+\u0026thinsp;HM groups (\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;6/group). Based on a previous study, endotoxin-induced ALI model mice were generated by injecting 15 mg/kg LPS (Solarbio, Beijing, China) through the tail vein (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e). Based on human-to-animal dose conversion guidelines and pharmacokinetic characteristics (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e), mice received an intraperitoneal injection of 3 mg/kg HM (Yichang Humanwell Pharmaceutical Co., Ltd., Yichang, China) 2 h before LPS stimulation. The LPS\u0026thinsp;+\u0026thinsp;Fer-1 group mice were administered 5 mg/kg Ferrostatin-1 (Sigma-Aldrich, St. Louis, MO, USA) via intraperitoneal injection 2 h before the LPS challenge (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e). After 12 h of LPS treatment, mice were euthanized and their lung and blood serum samples were harvested for downstream analyses. The mice were anesthetized with isoflurane (2\u0026ndash;3% in oxygen) until loss of righting reflex, followed by cervical dislocation for euthanasia. This method ensures unconsciousness prior to physical disruption of the spinal cord, in accordance with AVMA guidelines for humane euthanasia of rodents.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\u003ch2\u003e2.2 Hematoxylin and Eosin (H\u0026amp;E) and Masson's staining\u003c/h2\u003e\u003cp\u003eLung tissue from the left superior lobe was harvested, fixed with 4% (w/v) paraformaldehyde, dehydrated with gradient ethanol (70%\u0026rarr;100%), embedded in paraffin block, and sectioned with a microtome to obtain 4 \u0026micro;m thick slices. H\u0026amp;E and Masson\u0026rsquo;s staining were performed according to previously published protocols (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e). For H\u0026amp;E staining, slices were incubated with the Harris hematoxylin stain for 8 min followed by acid ethanol differentiation. Then, the slices were incubated with 0.5% eosin Y counterstain for 1 min. For Masson\u0026rsquo;s staining, slices were incubated with Weigert\u0026rsquo;s hematoxylin for 5 min, followed by Biebrich scarlet-acid fuchsin for 10 min. Then, the slices were incubated with phosphomolybdic acid for 5 min followed by counterstaining with aniline blue for 5 min. All the reagents were purchased from Solarbio. The stained sections were scored for lung injury by blinded pathologists after observation under a Nikon Eclipse E100 microscope (400\u0026times;). The sections were analyzed in six random fields using a semiquantitative scale (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e): 0 (normal), 1 (mild, \u0026lt;\u0026thinsp;25%), 2 (moderate, 25\u0026ndash;50%), 3 (severe, \u0026gt;\u0026thinsp;50%). Final scores were obtained by averaging the data. Masson\u0026rsquo;s trichome staining of collagen fibers (blue) were quantified using threshold-based segmentation with the Image J software. Collagen deposition was quantified using the following formula: (collagen-positive area\u0026thinsp;\u0026divide;\u0026thinsp;total histological area) \u0026times; 100%. The measurements were performed using computerized morphometric analysis.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\u003ch2\u003e2.3 Estimation of Wet-to-Dry Weight (W/D) ratios\u003c/h2\u003e\u003cp\u003ePulmonary edema was quantified using gravimetric analysis. Right lung specimens were excised and the surface moisture was absorbed using a filter paper to remove all external moisture. Then, wet mass (W) of the lung tissue measured using an analytical balance (\u0026plusmn;\u0026thinsp;0.1 mg precision). Subsequently, the lung tissues were oven-dried at 70\u0026deg;C until \u0026lt;\u0026thinsp;0.5% mass variation over a 48 h period. Then, dry mass (D) was measured using the analytical balance. The hydration index was calculated as (W - D)/D.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\u003ch2\u003e2.4 Cell culture and treatment\u003c/h2\u003e\u003cp\u003eMH-S murine alveolar macrophages (CL-0597; Procell, Wuhan, China) were cultured in RPMI-1640 medium (Gibco, Carlsbad, CA, USA) containing 10% heat-inactivated FBS and 1% penicillin-streptomycin (Invitrogen, Waltham, MA, USA) under standard conditions (37\u0026deg;C and 5% CO₂). The medium was replaced every 48\u0026ndash;72 h. MH-S cells at passages 2 or 3 were used for experiments. MH-S cells were stimulated with 10 \u0026micro;g/mL LPS (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e) to generate the \u003cem\u003ein vitro\u003c/em\u003e sepsis model. To determine the optimal concentration of HM, MH-S cells were treated with varying doses of HM (0, 5, 15, 25, and 50 \u0026micro;M) for 12 h before incubation with LPS for an additional 24 h. CCK-8 assay was performed to determine the HM concentration yielding highest cell viability. This optimal HM concentration was then used for subsequent experiments. MH-S cells were randomly divided into the control, LPS, LPS\u0026thinsp;+\u0026thinsp;HM, and HM groups (\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;6/group). To investigate the effects of HM on ferroptosis, MH-S cells were further categorized into control, LPS, LPS\u0026thinsp;+\u0026thinsp;HM, and LPS\u0026thinsp;+\u0026thinsp;Fer-1 groups (\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;6/group). To elucidate the role of the Nrf2 signaling pathway in the HM-mediated protective effects on lung injury, the cells were divided into the control, LPS, LPS\u0026thinsp;+\u0026thinsp;HM, Nrf2 siRNA\u0026thinsp;+\u0026thinsp;LPS\u0026thinsp;+\u0026thinsp;HM, and NC siRNA\u0026thinsp;+\u0026thinsp;LPS\u0026thinsp;+\u0026thinsp;HM groups (\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;6/group). To achieve Nrf2 gene silencing, MH-S cells were transfected with Nrf2-specific and scrambled siRNAs (50 nM, 24 h) using the RNAiMAX transfection agent (Invitrogen, Carlsbad, CA, USA) in OPTI-MEM medium (Gibco, Carlsbad, CA, USA) according to the manufacturer\u0026rsquo;s instructions. Nrf2 gene silencing efficacy was evaluated by RT-qPCR. MH-S cells in the LPS\u0026thinsp;+\u0026thinsp;Fer-1 group were pretreated with 1\u0026micro;M Fer-1 for 12 h followed by stimulation with LPS for another 24 h. Then, the supernatants and cells were separately harvested for subsequent analyses.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\u003ch2\u003e2.5 CCK-8 cell viability assay\u003c/h2\u003e\u003cp\u003eMH-S cell viability was assessed using the Cell Counting Kit-8 (CCK-8, BS350A, Biosharp, China). Briefly, cells were incubated with 10 \u0026micro;L of CCK-8 reagent at 37\u0026deg;C for 2.5 h. Then, the absorbance was recorded at 450 nm (primary wavelength) and 650 nm (reference wavelength) using a microplate reader (Bio-Rad, Hercules, CA, USA).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003e2.6 Enzyme-linked immunosorbent assay (ELISA)\u003c/h2\u003e\u003cp\u003e The concentrations of interleukin-1β (IL-1β), interleukin-6 (IL-6), and tumor necrosis factor α (TNF-α) in the serum samples and cell supernatants were analyzed using specific ELISA kits (IL-1β:SEKM-0034; IL-6:SEKM-0002; TNF-α:SEKM-0007; Solarbio, Beijing, China) according to the manufacturer\u0026rsquo;s instructions. Serum samples was prepared by centrifuging the blood samples at 1,000 g for 10 min. The cell supernatants were passed through a 0.22 \u0026micro;m sterile filter before experimentation. Optical density was determined at two wavelengths (450/630 nm) using a BioTek Synergy H1 microplate reader. A four-parameter logistic (4-PL) standard curve was generated using serially diluted standard solutions. Final concentrations were calculated by multiplying the standard curve-derived values by the respective sample dilution factors.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\u003ch2\u003e2.7 Measurement of Oxidative Stress and Ferroptosis\u003c/h2\u003e\u003cp\u003eTo assess the oxidative stress and ferroptosis biomarkers, lung tissue specimens were homogenized in ice-cold PBS and lysed in RIPA buffer. The tissue lysates were centrifuged at 12,000\u0026times;g for 15 min at 4\u0026deg;C and the cell-free supernatants were harvested. Glutathione redox status was determined using a commercial T-GSH/GSSG assay kit (A061-1; Jiancheng Bioengineering, Nanjing, China) and the GSH/GSSG ratio was calculated according to the manufacturer\u0026rsquo;s guidelines. Lipid peroxidation was assessed using the malondialdehyde assay kit (A003-2-2; Sway Biotech, Wuhan, China). Superoxide dismutase activity was measured using the SOD detection system (A001-3; Jiancheng Bioengineering, Nanjing, China) according to manufacturer\u0026rsquo;s instructions. Ferroptosis-specific markers including Fe\u0026sup2;⁺ concentration (DIFE-250; BioAssay Systems, Wuhan, China) and lipid peroxide levels (LiperFluo; ab133085; Abcam, Cambridge, UK) were analyzed in both the tissue homogenates and cellular fractions according to previously established protocols and manufacturer\u0026rsquo;s instructions.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\u003ch2\u003e2.8 Cell apoptosis assay\u003c/h2\u003e\u003cp\u003eMH-S cells were detached from the 6-well plates using PBS. Subsequently, after rinsing with PBS twice, MH-S cells were stained with the Annexin V-FITC/PI staining kit (eBioscience\u0026trade; Apoptosis Kit, Invitrogen, Carlsbad, CA, USA) according to the manufacturer\u0026rsquo;s instructions and analyzed in a BD LSRFortessa\u0026trade; flow cytometer (BD Biosciences).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003e2.9 Mitochondrial membrane potential (MMP) assay\u003c/h2\u003e\u003cp\u003eMitochondrial membrane potential (MMP) was quantified using a JC-1 Assay Kit (Thermo Fisher Scientific, #T3168, USA). After 20-min incubation with JC-1 at 37\u0026deg;C, cells were washed twice with assay buffer and analyzed by flow cytometry (BD FACSCanto II, USA).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003e2.10 Immunofluorescence (IF) and Immunohistochemistry (IHC)\u003c/h2\u003e\u003cp\u003eFormalin-fixed 5 \u0026micro;m thick lung sections were processed by sequential deparaffinization, graded ethanol hydration, and heat-mediated antigen retrieval with 10 mM citrate (pH 6.0) at 95\u0026deg;C for 20 min). Then, they were incubated with the primary antibody to detect 4-HNE (details in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). This was followed by incubation with 1:500 diluted Alexa Fluor 488-conjugated secondary antibody (Invitrogen, Carlsbad) for 1 h at room temperature in the dark. The tissue was then counterstained with the nucleus-staining dye DAPI. For IHC, the tissue sections were blocked with 3% H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e and incubated with anti-GPX4, anti-4-HNE, or anti-Nrf2 antibodies (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Subsequently, they were incubated with the HRP-conjugated secondary antibody (ZSGB-BIO PV-9000). Color development was performed with DAB (ZSGB-BIO ZLI-9018). Then, the tissues were counterstained with hematoxylin. For MH-S cytospins, cells were fixed in 4% PFA, permeabilized with 0.1% Triton X-100, and stained with anti-GPX4 (IF, single-label) or co-stained with anti-Nrf2 (rabbit) and anti-HO-1 (mouse) (IF dual-label, Alexa Fluor 488/568 secondary antibodies, respectively). Images of the stained tissue sections were acquired using a Nikon Eclipse Ni microscope under consistent exposure settings.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eList of primary antibodies\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePrimary antibody\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eDilution ratio\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCommercial details\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eMolecular weight (kDa)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGPX4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e1:500\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCST, 52455\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e22\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePTGS2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e1:1000\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAbcam, ab179800\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e69\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e4-HNE\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e1:200\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAbcam, ab46545\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e67\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eNrf2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e1:100\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSanta Cruz, sc-365949\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e100\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHO-1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e1:200\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNovus, NBP1-31344\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e33\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eβ-actin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e1:5000\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSigma, A5441\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e43\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003ctfoot\u003e\u003ctr\u003e\u003ctd colspan=\"4\"\u003eAbbreviations: GPX4, Glutathione Peroxidase 4; PTGS2, Prostaglandin-endoperoxide synthase 2; 4-HNE, 4-hydroxy-2-nonenal; Nrf2, nuclear factor erythroid 2-related factor 2; HO-1, heme oxygenase-1\u003c/td\u003e\u003c/tr\u003e\u003c/tfoot\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003e2.11 Western blotting\u003c/h2\u003e\u003cp\u003eTotal protein samples were obtained from the lung tissues and cell samples by incubating with the RIPA lysis buffer (P0013B; Beyotime, Shanghai, China). The concentration of protein was quantified using the Pierce BCA Protein Assay Kit (23225; Thermo Fisher Scientific, Waltham, MA, USA). Protein lysates (20 \u0026micro;g/lane) were separated via 10% SDS-PAGE and transferred onto activated PVDF membranes. The membranes were blocked with 5% non-fat milk/TBST for 1 h at 25\u003csup\u003eo\u003c/sup\u003eC. This was followed by overnight incubation at 4\u003csup\u003eo\u003c/sup\u003eC with primary antibodies (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Subsequently, after three washes with TBST, the membranes were incubated with HRP-conjugated secondary antibodies (1:5000; CST) for 1 h at 25\u003csup\u003eo\u003c/sup\u003eC. The blots were developed using the ECL substrate (Thermo Fisher Scientific, Waltham, MA, USA) and the chemiluminescent signals were quantified using the ImageJ v1.53 software (National Institutes of Health, Bethesda, MD, USA). Band intensities were normalized to β-actin as the loading control and three independent biological replicates were analyzed per experimental group.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003e2.12 Quantitative real-time PCR (qRT-PCR)\u003c/h2\u003e\u003cp\u003eTotal RNA samples were isolated from the lung tissues and MH-S cells using TRIzol (Thermo Fisher Scientific, Waltham, MA, USA) followed by DNase I treatment (Takara Bio, Dalian, China) to remove genomic DNA. Reverse transcription was performed using the PrimeScript RT Master Mix (Takara Bio, Dalian, China) according to the manufacturer's protocol. Quantitative PCR was performed using the TB Green Premix (Takara Bio, Dalian, China) in a Bio-Rad CFX96 QPCR machine using the following cycling parameters: initial denaturation at 95\u0026deg;C for 30 s; 40 cycles of denaturation at 95\u0026deg;C for 5 s and annealing at 60\u0026deg;C for 30 s. Gene-specific primers (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e) were designed to span the exon-exon junctions and amplicon lengths were optimized between 80\u0026ndash;200 bp to ensure amplification efficiency. QPCR efficiency was validated (90\u0026ndash;110%) using the standard curve analysis (R\u0026sup2; \u0026gt;0.99). Relative gene expression was calculated using the 2^-ΔΔCt method using GAPDH as the endogenous control. Three independent biological replicates were analyzed per experimental group.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimer sequences for qRT-PCR analysis\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eGene\u003c/em\u003e\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward primer (5'-3')\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eReverse primer (5'-3')\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eProduct Size (bp)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eGPX4\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCTGGAGAAGTGCGAGGTGA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAGAGCGGGTGAGCCTTGT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e152\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eNrf2\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTGGACGGGACTATTGAAGGCT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGCCGCCTTTTCAGTAGATGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e178\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eGAPDH\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAGGTCGGTGTGAACGGATTTG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTGTAGACCATGTAGTTGAGGTCA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e123\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003ctfoot\u003e\u003ctr\u003e\u003ctd colspan=\"4\"\u003eAbbreviations: GPX4, Glutathione Peroxidase 4; Nrf2, nuclear factor erythroid 2-related factor 2;GAPDH, Glyceraldehyde-3-phosphate dehydrogenase\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd colspan=\"4\"\u003e\u003cb\u003eFigures and Figure legends\u003c/b\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd colspan=\"4\"\u003e\u003cb\u003e(A-C)\u003c/b\u003e GSH and GSSG levels and the GSH/GSSG ratio in the control, LPS, LPS\u0026thinsp;+\u0026thinsp;HM, HM, and LPS-Fer-1 group mice (\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;6). (\u003cb\u003eD-F)\u003c/b\u003e The levels of MDA, Fe2+, and LPO in the control, LPS, LPS\u0026thinsp;+\u0026thinsp;HM, HM, and LPS-Fer-1 group mice (\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;6). (\u003cb\u003eG-K)\u003c/b\u003e Representative western blots and semi-quantitative analysis shows the expression levels of ferroptosis-related proteins such as GPX4, PTGS2, and 4-HNE in the lung tissues of the control, LPS, LPS\u0026thinsp;+\u0026thinsp;HM, HM, and LPS-Fer-1 group mice (\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;3). Full-length blots are shown in the Supplementary file 1. Band intensity values were normalized to β-actin. The data values were expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD. Multiple group comparisons were performed using one-way ANOVA with the Bonferroni correction. * denotes \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 compared to the control group; # denotes \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 compared to the LPS group; \u0026amp; denotes \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 compared to the LPS\u0026thinsp;+\u0026thinsp;HM group. (\u003cb\u003eL)\u003c/b\u003e Representative immunofluorescence images show 4-HNE protein expression in the control, LPS, LPS\u0026thinsp;+\u0026thinsp;HM, HM, and LPS-Fer-1 group mice ( magnification, \u0026times; 400). Scale bar: 50 \u0026micro;m. Green staining indicates 4-HNE; blue staining indicates DAPI-stained nuclear structure. (\u003cb\u003eM\u003c/b\u003e) Transmission electron microscopy images of representative mitochondrial structures (scale bar, 500 nm). Abbreviations: MDA, malondialdehyde; GSH, glutathione; GSSG, oxidized glutathione; LPO, LiperFluo; GPX4, Glutathione Peroxidase 4; PTGS2, Prostaglandin-endoperoxide synthase 2; 4-HNE, 4-hydroxy-2-nonenal; DAPI, 4',6-diamidino-2-phenylindole; HM, Hydromorphone.\u003c/td\u003e\u003c/tr\u003e\u003c/tfoot\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003e2.13 Transmission Electron Microscopy (TEM)\u003c/h2\u003e\u003cp\u003eGlutaraldehyde-fixed lung tissues (2.5%) were PBS-rinsed, post-fixed in 1% OsO₄ (2h), and dehydrated through graded ethanols/acetone. Specimens were embedded in epoxy resin (37℃/24h). Ultrathin sections (70nm) were stained with uranyl acetate (20min) and lead citrate (5min). Mitochondrial ultrastructure was imaged using Hitachi H-7500 TEM (80kV).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003e2.14 Statistical analysis\u003c/h2\u003e\u003cp\u003eQuantitative data was expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD) and the differences between two groups were analyzed using a t-test. Differences between multiple groups were analyzed using a one-way ANOVA with the GraphPad Prism 9.2.0 software, followed by the Bonferroni post-test. A p-value of \u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e\u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003e3.1 HM ameliorates \u003cem\u003ein vivo\u003c/em\u003e LPS-induced ALI in mice\u003c/h2\u003e\u003cp\u003eFirstly, we investigated the effects of HM on LPS-induced ALI in mice. Compared to mice in the LPS group, pretreatment with HM significantly reduced LPS-induced ALI. H\u0026amp;E staining results showed significantly reduced pulmonary interstitial edema, inflammatory infiltration, alveolar wall thickening, and lung tissue damage in the LPS\u0026thinsp;+\u0026thinsp;HM group compared to the LPS group; Masson staining results demonstrated that HM mitigated lung interstitial fibrosis (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, D). The lung injury scores and W/D ratios were significantly lower for the LPS\u0026thinsp;+\u0026thinsp;HM group compared to the LPS group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB-C). Moreover, serum levels of pro-inflammatory cytokines, including IL-1β, IL-6, and TNF-α were significantly lower in LPS\u0026thinsp;+\u0026thinsp;HM group than in the LPS group, thereby indicating that pretreatment with HM effectively reduced the inflammatory response in the LPS-treated mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE-G). Therefore, these data demonstrate that HM significantly alleviates LPS-triggered ALI in the preclinical mouse model.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003e3.2 HM inhibits oxidative stress response and ferroptosis in the LPS-triggered ALI model mice\u003c/h2\u003e\u003cp\u003eWe evaluated oxidative stress-related indicators such as GSH, GSSG, GSH/GSSG ratio, and MDA. In mice, oxidative stress-related injury was significantly increased by LPS, but significantly inhibited by pretreatment with HM or Fer-1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA-D). Furthermore, the levels of Fe\u003csup\u003e2+\u003c/sup\u003e and LPO (major regulators of ferroptosis) were significantly increased by LPS, but were reduced by HM and Fer-1(Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE-F). We also evaluated the expression levels of ferroptosis-associated proteins such as glutathione peroxidase 4 (GPX4), prostaglandin-endoperoxide synthase 2 \u003cb\u003e(\u003c/b\u003ePTGS2), and 4-hydroxy-2-nonenal (4-HNE) in the lung tissues. Compared to the control group, LPS group showed higher expression levels of PTGS2 and 4-HNE proteins and lower protein and mRNA expression levels of GPX4. However, GPX4 expression levels were significantly higher and PTGS2 and 4-HNE expression levels were significantly lower in the lung tissues of mice pre-treated with HM or Fer-1 compared to those from the LPS-treatment group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG-K). Furthermore, we performed immunofluorescence staining to assess the levels of 4-HNE, a major aldehydic product of LPO. Compared to the control group, 4-HNE levels were significantly higher in the LPS group. However, 4-HNE levels were significantly lower in the LPS\u0026thinsp;+\u0026thinsp;HM and LPS\u0026thinsp;+\u0026thinsp;Fer-1 groups compared to the LPS group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eL). Ultrastructural analysis via transmission electron microscopy (TEM) revealed ferroptosis-specific mitochondrial alterations in LPS-exposed murine lung tissues, including diminished organelle volume, loss of cristae integrity, and disrupted membrane continuity. These pathological manifestations were significantly attenuated by HM treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eM), with comparable efficacy observed in Fer-1-administered groups. These data demonstrated that HM significantly inhibits oxidative stress response and ferroptosis in the sepsis-induced ALI model mice.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003ch2\u003e3.3 HM alleviates LPS-induced inflammatory response and oxidative stress in MH-S cells\u003c/h2\u003e\u003cp\u003eCCK-8 assay was used to estimate MH-S cell viability and determine the optimal doses of HM and LPS. Firstly, MH-S cells grown with different doses of HM (0\u0026ndash;50 \u0026micro;M) did not show significant changes in cell viability (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Then, MH-S cells were treated with different doses of HM for 12 h before being stimulated with 10 \u0026micro;g/mL LPS (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e). As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB, the viability of LPS-treated MH-S cells was significantly high at 50 \u0026micro;M HM compared to those treated with lower concentrations of HM. Therefore, pretreatment with 50 \u0026micro;M HM for 12 h before LPS stimulation was used in subsequent experiments.As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC-D, IL-1β and IL-6 levels were significantly lower in the LPS\u0026thinsp;+\u0026thinsp;HM group than in the LPS group. This suggested that HM pretreatment alleviates inflammatory response in the LPS-stimulated MH-S cells. Furthermore, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE-I, LPS\u0026thinsp;+\u0026thinsp;HM group exhibited significantly lower levels of MDA and GSSG as well as significantly higher levels of SOD and GSH, and the GSH/GSSG ratio compared to the LPS group. These findings suggested that HM pretreatment mitigates LPS-induced oxidative stress in the MH-S cells. Subsequently, we analyzed the effects of HM pretreatment on the apoptosis of LPS-stimulated cells by flow cytometry. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eJ-K, the apoptosis rate was significantly reduced in the MH-S cells of the LPS\u0026thinsp;+\u0026thinsp;HM group compared to the LPS group. This suggested that HM pretreatment reduces LPS-induced apoptosis in the MH-S cells.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\u003ch2\u003e3.4 HM alleviates ferroptosis in the LPS-stimulated MH-S cells\u003c/h2\u003e\u003cp\u003eNext, we analyzed whether HM regulates ferroptosis in the LPS-stimulated MH-S cells by assessing GPX4, 4-HNE, and PTGS2 expression levels, and estimating the cellular levels of Fe\u0026sup2;⁺ and LPO. Immunofluorescence results showed that GPX4 expression was significantly higher in the LPS\u0026thinsp;+\u0026thinsp;HM and LPS\u0026thinsp;+\u0026thinsp;Fer-1 groups compared to the LPS group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Western blotting results showed that GPX4 expression levels were significantly increased and 4-HNE and PTGS2 expression levels were significantly decreased in the LPS\u0026thinsp;+\u0026thinsp;HM and LPS\u0026thinsp;+\u0026thinsp;Fer-1 groups compared to the LPS group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB-E). Furthermore, Fe\u003csup\u003e2+\u003c/sup\u003e and LPO levels were lower in the LPS\u0026thinsp;+\u0026thinsp;HM and LPS\u0026thinsp;+\u0026thinsp;Fer-1 groups compared to the LPS group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF-G). Mitochondrial membrane potential (MMP), a critical indicator of mitochondrial function, demonstrated significant impairment in LPS-exposed MH-S cells. HM treatment effectively restored MMP levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eH-I). These all suggested that HM attenuated ferroptosis in the LPS-stimulated MH-S cells.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec22\" class=\"Section2\"\u003e\u003ch2\u003e3.5 HM alleviates \u003cem\u003ein vitro\u003c/em\u003e LPS-mediated ferroptosis in the MH-S cells through the Nrf2/HO-1 signaling pathway\u003c/h2\u003e\u003cp\u003eTo determine the mechanism underlying the inhibitory effects of HM on MH-S cell injury and ferroptosis, we generated Nrf2-silenced MH-S cells using Nrf2-specific siRNAs. Generation of Nrf2-silenced MH-S cells were confirmed by RT-PCR analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). In the control MH-S cells, HM pretreatment effectively suppressed LPS-induced oxidative damage markers (MDA/Fe\u0026sup2;⁺/LPO), but Nrf2 silencing suppressed the antioxidant effects of HM and increased the expression levels of ferroptosis biomarkers upon stimulation by LPS (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB-D). Western blotting analysis demonstrated upregulation of GPX4, Nrf2, and HO-1 protein expression and significant downregulation of 4-HNE and PTGS2 protein expression in the LPS\u0026thinsp;+\u0026thinsp;HM group compared to the LPS group. However, GPX4, Nrf2, and HO-1 expression levels were significantly reduced and 4-HNE and PTGS2 expression levels were significantly increased in the Nrf2 siRNA\u0026thinsp;+\u0026thinsp;LPS\u0026thinsp;+\u0026thinsp;HM group compared to the LPS\u0026thinsp;+\u0026thinsp;HM group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE-J). The dual immunofluorescence staining results demonstrated that Nrf2 and HO-1 expression levels were higher in the LPS\u0026thinsp;+\u0026thinsp;HM group than in the LPS group. However, expression levels of Nrf2 and HO-1 were significantly lower in the Nrf2 siRNA\u0026thinsp;+\u0026thinsp;LPS\u0026thinsp;+\u0026thinsp;HM group compared to the LPS\u0026thinsp;+\u0026thinsp;HM group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eK). These data demonstrated that HM exerts anti-ferroptosis effects in the LPS-stimulated MH-S cells by activating the Nrf2/HO-1 signaling pathway.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec23\" class=\"Section2\"\u003e\u003ch2\u003e3.6. HM protects against \u003cem\u003ein vivo\u003c/em\u003e LPS-induced ALI by suppressing ferroptosis through Nrf2/HO-1 pathway activation\u003c/h2\u003e\u003cp\u003eTo further determine whether the \u003cem\u003ein vivo\u003c/em\u003e protective effects of HM were mediated through the Nrf2/HO-1 pathway, we used the Nrf2 knockout (Nrf2 KO) mice. Compared to the LPS\u0026thinsp;+\u0026thinsp;HM group, Nrf2 KO\u0026thinsp;+\u0026thinsp;LPS\u0026thinsp;+\u0026thinsp;HM group exhibited aggravated lung injury and significantly higher lung injury scores, W/D lung tissue ratios, collagen fibrils, and serum levels of IL-1β. IL-6 and TNF-α (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e. A-G). Furthermore, the levels of MDA, Fe\u003csup\u003e2+\u003c/sup\u003e, and LPO in the lung tissues were significantly higher in the Nrf2 KO\u0026thinsp;+\u0026thinsp;LPS\u0026thinsp;+\u0026thinsp;HM group compared to the LPS\u0026thinsp;+\u0026thinsp;HM mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e. I-K). These findings demonstrated that HM mitigates lung injury and inhibits ferroptosis via Nrf2. Furthermore, in the HM pretreated sepsis-induced modeling experiments, lung tissues from the Nrf2 KO mice showed reduced expression levels of GPX4, Nrf2, and HO-1, as well as up-regulation of 4-HNE and PTGS2 compared to the WT mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e. H, L-S). TEM analysis revealed exacerbated mitochondrial damage in Nrf2KO\u0026thinsp;+\u0026thinsp;LPS\u0026thinsp;+\u0026thinsp;HM group compared to LPS\u0026thinsp;+\u0026thinsp;HM group, manifested by significant reductions in mitochondrial volume and cristae density(Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e. T). These findings suggested that HM exerts anti-ferroptosis effects by activating the Nrf2/HO-1 signaling axis and these effects are abrogated by the genetic ablation of Nrf2.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eThis study suggested that HM mitigates LPS-stimulated ALI in mice by inhibiting ferroptosis via activation of the Nrf2/HO-1 axis. Previous studies have established that HM reduces ALI by modulating mitochondrial dynamics and inhibiting pyroptosis (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e). However, the specific mechanisms by which HM mitigates LPS-stimulated ALI are not clear. In this study, we found that HM decreased LPS-induced ALI by mitigating ferroptosis. Furthermore, the lung protective effects of HM were partially mediated through activation of the Nrf2/HO-1 axis (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). Our results provide evidence for the use of HM as a novel therapeutic strategy for the management of septic ALI.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cdiv id=\"Sec25\" class=\"Section2\"\u003e\u003ch2\u003e4.1 HM mitigates sepsis-related ALI by suppressing ferroptosis\u003c/h2\u003e\u003cp\u003eThe progression of sepsis-related ALI is characterized by rapid deterioration of alveolar-capillary membrane integrity accompanied by amplified inflammatory cascades, which can lead to ARDS (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e). Furthermore, oxidative stress is a critical pathophysiological mediator in the progression of sepsis and its related pulmonary complications (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e). The mortality rate of sepsis-related ALI/ARDS is significantly high because effective clinical interventions are lacking (\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e). Experimental characterization of LPS-challenged ALI models have revealed the following three hallmark pathological features: (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e) substantial histopathological impairment of the pulmonary architecture; (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e) up-regulation of pro-inflammatory mediators such as IL-1β, IL-6, and TNF-α; and (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e) dysregulated redox homeostasis, as evidenced by imbalanced glutathione system (lower GSH and SOD levels and higher GSSG levels) and elevated levels of lipid peroxidation marker, MDA. Therefore, there is an urgent need for developing targeted interventions against endotoxin-mediated pulmonary pathophysiology.\u003c/p\u003e\u003cp\u003eFerroptosis is a novel modality of regulated cell death and is mechanistically characterized by iron-catalyzed accumulation of lipid peroxidation products that culminates in catastrophic membrane integrity failure (\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e). Ferroptosis contributes to pathological progression of oxidative stress-related diseases, including neurodegenerative disorders, ischemia-reperfusion injury, and tumorigenesis, by disrupting cellular redox homeostasis (\u003cspan additionalcitationids=\"CR29\" citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e). GPX4 plays a critical role in regulating ferroptosis by maintaining membrane integrity through glutathione-dependent reduction of lipid peroxidation (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e). PTGS2, a well-established biomarker of ferroptosis, is significantly upregulated in correlation with activation of the inflammatory signaling pathway (e.g., NF-κB or MAPK), thereby suggesting a mechanistic link between ferroptosis and inflammation (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e). Lipid peroxidation end-products such as 4-HNE and MDA directly reflect membrane oxidative damage (\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e). Ferrous iron (Fe\u0026sup2;⁺) drives the lipid peroxidation cascade via Fenton reaction catalysis, whereas accumulation of LPO represents a core molecular event for executing ferroptosis (\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e). These biomarkers are integral components of the complex metabolic network associated with ferroptosis. Ferroptosis plays a significant role in the pathology of endotoxin-induced ALI. The concentrations of MDA, Fe\u0026sup2;⁺, and LPO are significantly elevated in the LPS-challenged ALI models relative to the controls. Ferroptosis activation in LPS-induced pulmonary injury is associated with concomitant suppression of GPX4 expression and coordinated upregulation of PTGS2 and 4-HNE. Therefore, it is essential to investigate pharmacological agents that target ferroptosis as a potential therapeutic approach for endotoxin-induced ALI.\u003c/p\u003e\u003cp\u003eHM exhibits multimodal therapeutic effects beyond analgesia, including anti-inflammatory and antioxidant properties under inflammatory conditions (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e). Experimental studies have indicated that HM suppresses pro-inflammatory mediators through \u0026micro;-opioid receptor-mediated pathways. These dual actions are evidenced by decreased levels of LPO markers and improved redox balance in preclinical inflammatory models, thereby suggesting potential clinical applications. Previous studies have shown that HM exerts protective effects against ALI through multimodal mechanisms involving suppression of inflammation, modulation of redox homeostasis, and inhibition of pyroptosis. However, precise molecular pathways underlying the effects of HM are not clear and require further elucidation. Our experimental data demonstrates that HM preconditioning attenuates LPS-mediated lung damage, as evidenced by improved histopathology, lower lung injury score, downregulation of inflammatory mediators, and altered profiles of oxidative stress biomarkers. Furthermore, HM pretreatment resulted in up-regulation of GPX4 and concurrently down-regulation of PTGS2 and 4-HNE. This suggests that HM alleviates LPS-triggered pulmonary injury by suppressing inflammatory signaling, redox imbalance, and ferroptosis.\u003c/p\u003e\u003cp\u003e\u003cb\u003e4.2 Nrf2/HO-1 signaling pathway plays a pivotal role in reducing ferroptosis linked to HM in endotoxin-induced ALI\u003c/b\u003e\u003c/p\u003e\u003cp\u003eMechanistically, Nrf2 orchestrates cellular antioxidant defenses and preserves redox equilibrium through transcriptional regulation of downstream targets (\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e). Nrf2 activation serves as a central regulatory mechanism for reducing reactive oxygen species (ROS) production and maintaining redox homeostasis (\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e). Nrf2 is also recognized as a crucial modulator of ALI (\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e). Activated Nrf2 translocates to the nucleus, binds to the antioxidant response elements (AREs), and initiates transcriptional activation of cytoprotective genes such as heme oxygenase-1 (HO-1) (\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e). The HO-1 enzyme system mediates dual protective effects against inflammatory cascades and redox imbalance through bioactive metabolites such as carbon monoxide and biliverdin (\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e). Furthermore, HO-1 protects lungs by regulating ferroptosis (\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e). Our study demonstrated that pretreatment with HM reduced LPS-induced lung injury by significantly elevating Nrf2 and HO-1 expression levels. Consequently, our data suggests that HM confers protection against LPS-triggered ALI by modulating the Nrf2/HO-1 signaling axis.\u003c/p\u003e\u003cp\u003eWe used the Nrf2 knockout (KO) model mice as well as Nrf2 siRNA-transfected MH-S cells to further investigate the role of the Nrf2/HO-1 signaling pathway. Nrf2 knockout in mice as well as Nrf2 silencing in MH-S cells significantly reduced the protective effects associated with HM pretreatment. Nrf2 KO/LPS/HM mice demonstrated exacerbated lung damage, higher lung injury scores, as well as enhanced inflammation and oxidative stress. Similar effects were observed in the Nrf2-silenced MH-S cells. Both Nrf2 KO/LPS/HM mice and Nrf2-silenced MH-S cells demonstrated reduced expression levels of GPX4, Nrf2, and HO-1 and increased expression levels of PTGS2 and 4-HNE compared to the corresponding controls. These data suggested that HM pretreatment significantly reduced ferroptosis and endotoxin-induced ALI through activation of the Nrf2/HO-1 axis.\u003c/p\u003e\u003cp\u003eThe significance of our findings include elucidation of the molecular mechanisms and signaling pathways through which HM exerts protective effects against LPS-stimulated ALI. HM mediates protective benefits effects by mitigating inflammation, oxidative stress, and ferroptosis, all of which are critical players in the pathogenesis of ALI. Furthermore, Nrf2/HO-1 pathway plays a pivotal role in mediating the beneficial effects of HM, thereby underscoring the importance of targeting this signaling axis for future therapeutic strategies.\u003c/p\u003e\u003cp\u003eThe limitations of this study merit careful consideration. While the findings underscore the beneficial effect of HM in alleviating LPS-stimulated ALI, lack of clinical validation restricts the applicability of these results to human populations. Furthermore, the small sample size of the animal models may compromise the generalizability of the outcomes. Moreover, the lack of long-term follow-up evidence hinders our understanding of the long-term efficacy and safety of HM in chronic inflammatory diseases. Therefore, future research studies with larger and more diverse cohorts are necessary to overcome these limitations and assess the long-term therapeutic potential and mechanistic details of HM in clinical settings.\u003c/p\u003e\u003cp\u003eCollectively, our findings demonstrate that HM alleviates LPS-induced ALI through multifaceted mechanisms, including suppression of inflammatory cascades, restoration of redox homeostasis, and inhibition of ferroptosis through activation of the Nrf2/HO-1 axis. These findings not only enhance our understanding of the pharmacological potential of HM in treating septic ALI but also lay the groundwork for future investigations aimed at exploring its therapeutic applications in related inflammatory conditions. Further research is warranted to elucidate the clinical relevance and long-term benefits of HM as a treatment option for acute lung injury and its underlying mechanisms.\u003c/p\u003e\u003c/div\u003e"},{"header":"5. Conclusions","content":"\u003cp\u003eThis study demonstrates that HM protects against LPS-induced ALI through Nrf2/HO-1-mediated suppression of ferroptosis in both cellular and animal experimental systems. Furthermore, targeted inhibition of the Nrf2/HO-1 pathway decreases LPS-induced ferroptosis and inflammation in the lungs as well as MH-S cells. These findings suggest that HM is a potential therapeutic strategy for alleviating endotoxin-induced ALI.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cem\u003eHM\u003c/em\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eHydromorphone\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cem\u003eLPS\u003c/em\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003elipopolysaccharide\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cem\u003eALI\u003c/em\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eacute lung injury\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cem\u003eNrf2\u003c/em\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003enuclear factor erythroid 2-related factor-2\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cem\u003eHO-1\u003c/em\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eheme oxygenase-1\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cem\u003eKO\u003c/em\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eknockout\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cem\u003eWT\u003c/em\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003ewild-type\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cem\u003eGPX4\u003c/em\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eGlutathione Peroxidase 4\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cem\u003ePTGS2\u003c/em\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eProstaglandin-endoperoxide synthase 2\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cem\u003e4-HNE\u003c/em\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003e4-hydroxy-2-nonenal\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics statement animal experimentation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study strictly adhered to the NIH Guide for the Care and Use of Laboratory Animals (85-23 rev.) and obtained ethical clearance from Qingdao University Affiliated Hospital's IACUC (Protocol No. QYFY-WZLL-2023-28466), ensuring full compliance with international animal research standards.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe raw data supporting the conclusions of this article will be made available by the corresponding author without undue reservation.\u003c/p\u003e\n\u003ch1\u003eCompeting interests\u003c/h1\u003e\n\u003cp\u003eThe authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as potential conflicts of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to Participate declaration\u003c/strong\u003e:\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding Declaration\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThere was no Funding.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eX.K.L. : Conceptualization, Formal analysis, Investigation, Writing-original draft.\u003c/p\u003e\n\u003cp\u003eY.X.X. : Data curation, Methodology, Software, Visualization, Writing-original draft.\u003c/p\u003e\n\u003cp\u003eW.Y.L: Investigation, Validation.\u003c/p\u003e\n\u003cp\u003eS.N.L. : Funding acquisition, Project administration, Supervision, Writing-review \u0026amp; editing.\u003c/p\u003e\n\u003cp\u003eC.C.L.: Data curation, Resources.\u003c/p\u003e\n\u003cp\u003eC.L.W.: Formal analysis, Software.\u003c/p\u003e\n\u003cp\u003eQ.Z.: Investigation, Visualization.\u003c/p\u003e\n\u003cp\u003eH.Y.G.: Resources, Validation.\u003c/p\u003e\n\u003cp\u003eY.T.W. : Conceptualization, Project administration, Supervision, Writing-review \u0026amp; editing.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAckowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAbbott M, Li Y, Brochard L, Zhang H. Precision Medicine Using Simultaneous Monitoring and Assessment with Imaging and Biomarkers to Manage Mechanical Ventilation in ARDS. Intensive Care Res. 2023;3(3):195\u0026ndash;203. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s44231-023-00045-4\u003c/span\u003e\u003cspan address=\"10.1007/s44231-023-00045-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi W, Li D, Chen Y et al. Classic Signaling Pathways in Alveolar Injury and Repair Involved in Sepsis-Induced ALI/ARDS: New Research Progress and Prospect. Dis Markers. 2022;2022:6362344. Published 2022 Jun 18. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1155/2022/6362344\u003c/span\u003e\u003cspan address=\"10.1155/2022/6362344\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShen Y, He Y, Pan Y, Liu L, Liu Y, Jia J. Role and mechanisms of autophagy, ferroptosis, and pyroptosis in sepsis-induced acute lung injury. Front Pharmacol. 2024;15:1415145. Published 2024 Aug 5. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fphar.2024.1415145\u003c/span\u003e\u003cspan address=\"10.3389/fphar.2024.1415145\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHolford P, Carr AC, Jovic TH, et al. Vitamin C-An Adjunctive Therapy for Respiratory Infection, Sepsis and COVID-19. Nutrients. 2020;12(12):3760. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/nu12123760\u003c/span\u003e\u003cspan address=\"10.3390/nu12123760\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Published 2020 Dec 7.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXu Y, Xin J, Sun Y, et al. Mechanisms of Sepsis-Induced Acute Lung Injury and Advancements of Natural Small Molecules in Its Treatment. Pharmaceuticals (Basel). 2024;17(4):472. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ph17040472\u003c/span\u003e\u003cspan address=\"10.3390/ph17040472\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Published 2024 Apr 8.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKrutsinger DC, Yadav KN, Harhay MO, Bartels K, Courtright KR. A systematic review and meta-analysis of enrollment into ARDS and sepsis trials published between 2009 and 2019 in major journals. Crit Care. 2021;25(1):392. Published 2021 Nov 15. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s13054-021-03804-1\u003c/span\u003e\u003cspan address=\"10.1186/s13054-021-03804-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDixon SJ, Olzmann JA. The cell biology of ferroptosis. Nat Rev Mol Cell Biol. 2024;25(6):424\u0026ndash;42. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41580-024-00703-5\u003c/span\u003e\u003cspan address=\"10.1038/s41580-024-00703-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFang X, Ardehali H, Min J, Wang F. The molecular and metabolic landscape of iron and ferroptosis in cardiovascular disease. Nat Rev Cardiol. 2023;20(1):7\u0026ndash;23. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41569-022-00735-4\u003c/span\u003e\u003cspan address=\"10.1038/s41569-022-00735-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRyan SK, Zelic M, Han Y, et al. Microglia ferroptosis is regulated by SEC24B and contributes to neurodegeneration. Nat Neurosci. 2023;26(1):12\u0026ndash;26. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41593-022-01221-3\u003c/span\u003e\u003cspan address=\"10.1038/s41593-022-01221-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLin Q, Li S, Jin H, et al. Mitophagy alleviates cisplatin-induced renal tubular epithelial cell ferroptosis through ROS/HO-1/GPX4 axis. Int J Biol Sci. 2023;19(4):1192\u0026ndash;210. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.7150/ijbs.80775\u003c/span\u003e\u003cspan address=\"10.7150/ijbs.80775\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Published 2023 Feb 13.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYang W, Wang Y, Zhang C et al. Maresin1 Protect Against Ferroptosis-Induced Liver Injury Through ROS Inhibition and Nrf2/HO-1/GPX4 Activation. Front Pharmacol. 2022;13:865689. Published 2022 Apr 4. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fphar.2022.865689\u003c/span\u003e\u003cspan address=\"10.3389/fphar.2022.865689\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu P, Feng Y, Li H, et al. Ferrostatin-1 alleviates lipopolysaccharide-induced acute lung injury via inhibiting ferroptosis. Cell Mol Biol Lett. 2020;25:10. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s11658-020-00205-0\u003c/span\u003e\u003cspan address=\"10.1186/s11658-020-00205-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Published 2020 Feb 27.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi K, Wang XQ, Liao ZL, et al. Wedelolactone inhibits ferroptosis and alleviates hyperoxia-induced acute lung injury via the Nrf2/HO-1 signaling pathway. Toxicol Sci. 2024;202(1):25\u0026ndash;35. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/toxsci/kfae099\u003c/span\u003e\u003cspan address=\"10.1093/toxsci/kfae099\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi J, Lu K, Sun F et al. Panaxydol attenuates ferroptosis against LPS-induced acute lung injury in mice by Keap1-Nrf2/HO-1 pathway. J Transl Med. 2021;19(1):96. Published 2021 Mar 2. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12967-021-02745-1\u003c/span\u003e\u003cspan address=\"10.1186/s12967-021-02745-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi Y, Yue X, Liang S, Ren F, Guo Q, Zou W. Effectiveness and Safety of Hydromorphone Compared to Morphine for Postoperative Analgesia: A Systematic Review and Meta-analysis. Pain Physician. 2024;27(8):469\u0026ndash;78.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eQiu L, Yan Y, Zhong G, et al. Hydromorphone hydrochloride preconditioning combined with postconditioning attenuates myocardial ischemia/reperfusion injury in rats by improving mitochondrial function and activating the PI3K/Akt signaling pathway. Chem Biol Drug Des. 2024;103(2):e14474. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/cbdd.14474\u003c/span\u003e\u003cspan address=\"10.1111/cbdd.14474\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHale Mitchell LK, Koh RB, Nevarez JG. Successful Treatment of a Cervical Injury and Myopathy Using Integrative Medicine Techniques in an Eclectus Parrot (Eclectus roratus) Following Cervical Entrapment. J Avian Med Surg. 2023;37(2):175\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1647/22-00013\u003c/span\u003e\u003cspan address=\"10.1647/22-00013\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShi J, Du SH, Yu JB et al. Hydromorphone Protects against CO2 Pneumoperitoneum-Induced Lung Injury via Heme Oxygenase-1-Regulated Mitochondrial Dynamics. Oxid Med Cell Longev. 2021;2021:9034376. Published 2021 Apr 9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1155/2021/9034376\u003c/span\u003e\u003cspan address=\"10.1155/2021/9034376\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang J, Li J, An Z, Qi J, HYDROMORPHONE MITIGATES CARDIOPULMONARY BYPASS-INDUCED ACUTE, LUNG INJURY BY REPRESSING PYROPTOSIS OF ALVEOLAR MACROPHAGES. Shock. 2023;60(1):92\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1097/SHK.0000000000002138\u003c/span\u003e\u003cspan address=\"10.1097/SHK.0000000000002138\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMa Y, Wang Z, Wu X, et al. 5-Methoxytryptophan ameliorates endotoxin-induced acute lung injury in vivo and in vitro by inhibiting NLRP3 inflammasome-mediated pyroptosis through the Nrf2/HO-1 signaling pathway. Inflamm Res. 2023;72(8):1633\u0026ndash;47. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00011-023-01769-1\u003c/span\u003e\u003cspan address=\"10.1007/s00011-023-01769-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNair AB, Jacob S. A simple practice guide for dose conversion between animals and human. J Basic Clin Pharm. 2016;7(2):27\u0026ndash;31. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.4103/0976-0105.177703\u003c/span\u003e\u003cspan address=\"10.4103/0976-0105.177703\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhao Q, Kong C, Wu X, et al. Ciprofol prevents ferroptosis in LPS induced acute lung injury by activating the Nrf2 signaling pathway. BMC Pulm Med. 2024;24(1):591. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12890-024-03415-w\u003c/span\u003e\u003cspan address=\"10.1186/s12890-024-03415-w\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Published 2024 Nov 28.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHe R, Liu B, Xiong R, et al. Itaconate inhibits ferroptosis of macrophage via Nrf2 pathways against sepsis-induced acute lung injury. Cell Death Discov. 2022;8(1):43. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41420-021-00807-3\u003c/span\u003e\u003cspan address=\"10.1038/s41420-021-00807-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Published 2022 Feb 2.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu C, Xiao K, Xie L. Advances in the Regulation of Macrophage Polarization by Mesenchymal Stem Cells and Implications for ALI/ARDS Treatment. Front Immunol. 2022;13:928134. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fimmu.2022.928134\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2022.928134\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Published 2022 Jul 8.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLai K, Song C, Gao M, et al. Uridine Alleviates Sepsis-Induced Acute Lung Injury by Inhibiting Ferroptosis of Macrophage. Int J Mol Sci. 2023;24(6):5093. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms24065093\u003c/span\u003e\u003cspan address=\"10.3390/ijms24065093\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Published 2023 Mar 7.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi W, Li D, Chen Y et al. Classic Signaling Pathways in Alveolar Injury and Repair Involved in Sepsis-Induced ALI/ARDS: New Research Progress and Prospect. Dis Markers. 2022;2022:6362344. Published 2022 Jun 18. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1155/2022/6362344\u003c/span\u003e\u003cspan address=\"10.1155/2022/6362344\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJiang X, Stockwell BR, Conrad M. Ferroptosis: mechanisms, biology and role in disease. Nat Rev Mol Cell Biol. 2021;22(4):266\u0026ndash;82. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41580-020-00324-8\u003c/span\u003e\u003cspan address=\"10.1038/s41580-020-00324-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi Z, Zhang Y, Ji M, Wu C, Zhang Y, Ji S. Targeting ferroptosis in neuroimmune and neurodegenerative disorders for the development of novel therapeutics. Biomed Pharmacother. 2024;176:116777. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.biopha.2024.116777\u003c/span\u003e\u003cspan address=\"10.1016/j.biopha.2024.116777\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCai W, Liu L, Shi X, et al. Alox15/15-HpETE Aggravates Myocardial Ischemia-Reperfusion Injury by Promoting Cardiomyocyte Ferroptosis. Circulation. 2023;147(19):1444\u0026ndash;60. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1161/CIRCULATIONAHA.122.060257\u003c/span\u003e\u003cspan address=\"10.1161/CIRCULATIONAHA.122.060257\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi H, Yu K, Hu H, et al. METTL17 coordinates ferroptosis and tumorigenesis by regulating mitochondrial translation in colorectal cancer. Redox Biol. 2024;71:103087. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.redox.2024.103087\u003c/span\u003e\u003cspan address=\"10.1016/j.redox.2024.103087\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiang D, Feng Y, Zandkarimi F, et al. Ferroptosis surveillance independent of GPX4 and differentially regulated by sex hormones. Cell. 2023;186(13):2748\u0026ndash;e276422. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cell.2023.05.003\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2023.05.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhou Y, Zhou H, Hua L, et al. Verification of ferroptosis and pyroptosis and identification of PTGS2 as the hub gene in human coronary artery atherosclerosis. Free Radic Biol Med. 2021;171:55\u0026ndash;68. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.freeradbiomed.2021.05.009\u003c/span\u003e\u003cspan address=\"10.1016/j.freeradbiomed.2021.05.009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu L, Pang J, Qin D, et al. Deubiquitinase OTUD5 as a Novel Protector against 4-HNE-Triggered Ferroptosis in Myocardial Ischemia/Reperfusion Injury. Adv Sci (Weinh). 2023;10(28):e2301852. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/advs.202301852\u003c/span\u003e\u003cspan address=\"10.1002/advs.202301852\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHuang D, Xu D, Chen W, et al. Fe-MnO\u003csub\u003e2\u003c/sub\u003e nanosheets loading dihydroartemisinin for ferroptosis and immunotherapy. Biomed Pharmacother. 2023;161:114431. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.biopha\u003c/span\u003e\u003cspan address=\"10.1016/j.biopha\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. .2023.114431 Antitumor Effects of Hydromorphone on Human Gastric Cancer Cells in vitro.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMa C, Gu C, Lian P, et al. Sulforaphane alleviates psoriasis by enhancing antioxidant defense through KEAP1-NRF2 Pathway activation and attenuating inflammatory signaling. Cell Death Dis. 2023;14(11):768. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41419-023-06234-9\u003c/span\u003e\u003cspan address=\"10.1038/s41419-023-06234-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Published 2023 Nov 25.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBarnes PJ. Oxidative stress-based therapeutics in COPD. Redox Biol. 2020;33:101544. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.redox.2020.101544\u003c/span\u003e\u003cspan address=\"10.1016/j.redox.2020.101544\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJo Y, Shim JA, Jeong JW, et al. Targeting ROS-sensing Nrf2 potentiates anti-tumor immunity of intratumoral CD8\u003csup\u003e+\u003c/sup\u003e T and CAR-T cells. Mol Ther. 2024;32(11):3879\u0026ndash;94. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ymthe.2024.08.019\u003c/span\u003e\u003cspan address=\"10.1016/j.ymthe.2024.08.019\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDong H, Xia Y, Jin S et al. Nrf2 attenuates ferroptosis-mediated IIR-ALI by modulating TERT and SLC7A11. \u003cem\u003eCell Death Dis\u003c/em\u003e. 2021;12(11):1027. Published 2021 Oct 29. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41419-021-04307-1\u003c/span\u003e\u003cspan address=\"10.1038/s41419-021-04307-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eO'Rourke SA, Shanley LC, Dunne A. The Nrf2-HO-1 system and inflammaging. Front Immunol. 2024;15:1457010. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fimmu.2024.1457010\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2024.1457010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Published 2024 Sep 24.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSadeghi M, Fathi M, Gholizadeh Navashenaq J et al. The prognostic and therapeutic potential of HO-1 in leukemia and MDS. \u003cem\u003eCell Commun Signal\u003c/em\u003e. 2023;21(1):57. Published 2023 Mar 13. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12964-023-01074-8\u003c/span\u003e\u003cspan address=\"10.1186/s12964-023-01074-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLuo P, Liu D, Zhang Q, et al. Celastrol induces ferroptosis in activated HSCs to ameliorate hepatic fibrosis \u003cem\u003evia\u003c/em\u003e targeting peroxiredoxins and HO-1. Acta Pharm Sin B. 2022;12(5):2300\u0026ndash;14. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.apsb.2021.12.007\u003c/span\u003e\u003cspan address=\"10.1016/j.apsb.2021.12.007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYang R, Gao W, Wang Z, et al. Polyphyllin I induced ferroptosis to suppress the progression of hepatocellular carcinoma through activation of the mitochondrial dysfunction via Nrf2/HO-1/GPX4 axis. Phytomedicine. 2024;122:155135. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.phymed.2023.155135\u003c/span\u003e\u003cspan address=\"10.1016/j.phymed.2023.155135\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Hydromorphone, Ferroptosis, Acute lung injury, LPS, Nrf2/HO-1 pathway","lastPublishedDoi":"10.21203/rs.3.rs-7370812/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7370812/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEndotoxin-induced acute lung injury (ALI) features uncontrolled pulmonary inflammation with high mortality. Ferroptosis, an iron-dependent immunogenic cell death, contributes to ALI pathogenesis. While the Nrf2/HO-1 pathway mitigates ALI by regulating oxidative stress, hydromorphone (HM)-a clinical opioid analgesic-alleviates ALI through incompletely defined mechanisms. This study investigated HM's protective effects in lipopolysaccharide (LPS)-induced ALI models.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLPS was administered to mice and MH-S alveolar macrophages with/without HM. Lung pathology was evaluated via H\u0026amp;E and Masson staining. Pro-inflammatory cytokines were measured by ELISA. Ferroptosis markers were assessed using Western blot, PCR, immunohistochemistry, and immunofluorescence. Apoptosis and mitochondrial membrane potential (JC-1 probe) were analyzed by flow cytometry. Mitochondrial ultrastructure was examined via transmission electron microscopy. Nrf2 knockout mice and siRNA-transfected cells determined pathway involvement.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHM significantly attenuated LPS-induced ALI. The LPS + HM group exhibited reduced pulmonary edema, inflammatory cell infiltration, and fibrosis vs LPS group, along with decreased pro-inflammatory cytokines. HM suppressed oxidative stress and ferroptosis, evidenced by elevated GSH, SOD, and GPX4 levels/expression, but reduced GSSG, MDA, Fe²⁺, LPO, PTGS2, and 4-HNE in LPS + HM group versus LPS controls. HM treatment reversed mitochondrial membrane potential collapse and ameliorated mitochondrial damage. Crucially, HM's protection depended on Nrf2/HO-1 activation, as LPS + HM treatment significantly upregulated Nrf2 and HO-1. Experiments also confirmed that HM's anti-ferroptotic and lung-protective effects require intact Nrf2/HO-1 signaling.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHM protects against endotoxin-induced ALI by inhibiting ferroptosis via activating the Nrf2/HO-1 pathway.\u003c/p\u003e","manuscriptTitle":"Hydromorphone ameliorates endotoxin-induced acute lung injury by suppressing ferroptosis via Nrf2/HO-1 signaling pathway","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-10-16 09:41:10","doi":"10.21203/rs.3.rs-7370812/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"08910798-e1b7-4bec-a865-3ad21e50bd1c","owner":[],"postedDate":"October 16th, 2025","published":true,"recentEditorialEvents":[{"type":"decision","content":"Withdrawn","date":"2026-05-13T08:54:33+00:00","index":"","fulltext":""}],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-05-13T09:16:59+00:00","versionOfRecord":[],"versionCreatedAt":"2025-10-16 09:41:10","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7370812","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7370812","identity":"rs-7370812","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.