Autolyzed yeast and sodium butyrate supplemented alone to diets promoted improvements in performance, intestinal health and nutrient transporter in weaned piglets

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

Abstract This study investigated the effects of supplemental nucleotides, autolyzed yeast (Saccharomyces cerevisiae), and sodium butyrate in diets for nursery pigs on growth performance, diarrhea incidence, blood profile, intestinal morphology, mRNA expression of nutrient transporters, inflammatory markers, antioxidant profile, and tight junction proteins in the small intestine. One hundred eighty 21-d-old pigs (5.17 ± 0.57 kg) were assigned in a randomized block design to 1 of 4 dietary treatments: (1) CON: control, basal diet, (2) NUC: CON + nucleotides, (3) YSC: CON + lysed yeast S. cerevisiae, (4) ASB: CON + acidifier sodium butyrate. Pigs were fed for 24 d, phase 1 (21 to 32 d) and 2 (32 to 45 d). During phase 1, YSC and ASB improved average daily gain (ADG) and feed conversion (FC) compared with CON. At the overall period, ASB improved ADG and YSC improved FC compared with CON. The NUC diet did not affect growth performance. The ASB increased ileal villus height compared to CON. The YSC and ASB reduced the number of Peyer’s patches in the ileum compared with CON. The YSC increased mRNA expression of nutrient transporters (SMCT2, MCT1, and PepT1), tight junction proteins (OCL and ZO-1), antioxidants (GPX), and IL1-β in the jejunum compared with CON. The ASB increased mRNA expression of nutrient transporters (SGLT1 and MCT1), tight junction proteins (OCL and ZO-1), and antioxidants (GPX and SOD) compared with CON. In conclusion, autolyzed yeast and sodium butyrate promoted growth performance by improving the integrity of the intestinal barrier, the mRNA expression of nutrient transporters, and antioxidant enzymes in the jejunum of nursery pigs whereas supplementation of nucleotides did not show such effects.
Full text 207,828 characters · extracted from preprint-html · click to expand
Autolyzed yeast and sodium butyrate supplemented alone to diets promoted improvements in performance, intestinal health and nutrient transporter in weaned piglets | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Autolyzed yeast and sodium butyrate supplemented alone to diets promoted improvements in performance, intestinal health and nutrient transporter in weaned piglets Amanda Medeiros Correia¹, Jansller Luiz Genova¹, Sung Woo Kim, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4112899/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 23 May, 2024 Read the published version in Scientific Reports → Version 1 posted 10 You are reading this latest preprint version Abstract This study investigated the effects of supplemental nucleotides, autolyzed yeast ( Saccharomyces cerevisiae ), and sodium butyrate in diets for nursery pigs on growth performance, diarrhea incidence, blood profile, intestinal morphology, mRNA expression of nutrient transporters, inflammatory markers, antioxidant profile, and tight junction proteins in the small intestine. One hundred eighty 21-d-old pigs (5.17 ± 0.57 kg) were assigned in a randomized block design to 1 of 4 dietary treatments: (1) CON: control, basal diet, (2) NUC: CON + nucleotides, (3) YSC: CON + lysed yeast S. cerevisiae , (4) ASB: CON + acidifier sodium butyrate. Pigs were fed for 24 d, phase 1 (21 to 32 d) and 2 (32 to 45 d). During phase 1, YSC and ASB improved average daily gain (ADG) and feed conversion (FC) compared with CON. At the overall period, ASB improved ADG and YSC improved FC compared with CON. The NUC diet did not affect growth performance. The ASB increased ileal villus height compared to CON. The YSC and ASB reduced the number of Peyer’s patches in the ileum compared with CON. The YSC increased mRNA expression of nutrient transporters (SMCT2, MCT1, and PepT1), tight junction proteins (OCL and ZO-1), antioxidants (GPX), and IL1-β in the jejunum compared with CON. The ASB increased mRNA expression of nutrient transporters (SGLT1 and MCT1), tight junction proteins (OCL and ZO-1), and antioxidants (GPX and SOD) compared with CON. In conclusion, autolyzed yeast and sodium butyrate promoted growth performance by improving the integrity of the intestinal barrier, the mRNA expression of nutrient transporters, and antioxidant enzymes in the jejunum of nursery pigs whereas supplementation of nucleotides did not show such effects. Biological sciences/Zoology/Animal physiology Biological sciences/Immunology Biological sciences/Molecular biology Health sciences/Biomarkers Biological sciences/Biochemistry/Dna autolyzed yeast gut health performance piglets nucleotides sodium butyrate Figures Figure 1 Figure 2 Introduction Weaning is considered the “critical window” in the piglet’s life because it is associated with several stress factors, such as loss of contact with the mother and original litter, solid diet, environmental and structural changes, and the establishment of a new hierarchy 1,2 . Abrupt separation from the sow and dietary transition are critical events causing intestinal challenges and compromising immune functions affecting growth of pigs 3,4 . Dietary interventions with various functional additives have been introduced and implemented to cope with challenges to the intestine and immune functions upon weaning. Nucleotides 5,6 , yeast 7,8 and organic acids 9,10 have appeared on the market as feeding strategies to improve intestinal health and, consequently, promote better growth performance of weaned piglets. Globally, their use as in-feed additives in pig diets has become more frequent, especially during the weaning period 11,12 . However, factors such as the form of supplementation, the type of additive, and the site of action make each application unique and complex in animal responses and should be better understood in studies involving pigs fed different feed additives 13,14,15 . Nucleotides are monomers that serve as building blocks of nucleic acids (DNA and RNA) and are synthesized by animals through the de novo pathway or the salvage pathway. These monomers function as physiological mediators, coenzyme components, and contributors to cell growth and division and are crucial to the rapid proliferation of intestinal mucosa cells and immune cells 16,17 . Thus, the supplementation of nucleotides to the diet can bring benefits in periods of rapid growth and development (e.g. digestive organs, immune systems, cell renewal) helping in circumstances associated with intestinal injuries and stress, such as post-weaning period 5,6 . The lysed yeast ( S. cerevisiae ) contains in the cell wall a complex polymer and is composed of β-glucans, α-mannans, mannoproteins, and a minor component of chitin 18 , in addition, the cytoplasm contains B complex vitamins, highly digestible proteins and free amino acids 15 . However, monogastric animals do not have enzymes to digest polysaccharides such as those present in the yeast cell wall, therefore, the breakdown of yeast cell wall by lysing would improve the bioavailability of yeast components for animal nutrition 7 . The major polysaccharide constituents of the yeast cell wall, β-glucans and α-mannans, have been recognized to be capable of modulation of the mucosa immune system, promoting beneficial effects on pig health (e.g. inhibition of pathogen adhesion to gastrointestinal epithelial tissue and stimulation of immunocompetent cells in Peyer's patches) 19,20 . Thus, yeast products, mainly based on S. cerevisiae , are widely used as feed additives. Organic acids (e.g. sodium butyrate) act by reducing the pH of digesta in the gastrointestinal tract, stimulating the activity of digestive enzymes, inhibiting the proliferation of pathogenic bacteria, and improving the digestibility of nutrients 9,21 . Sodium butyrate is a short-chain fatty acid that acts by improving villus height, decreasing crypt, and improving the expression of tight junction protein in the gut 14 . As a result, it beneficially affects the reabsorption of fluids and electrolytes which is associated with reduced diarrhea 22 , moreover modulating intestinal permeability will reduce translocation of intraluminal toxins and antigens from the lumen into subepithelial tissues and systemic blood circulation 23 . Together with improving gut health, the ability of sodium butyrate to alleviate oxidative stress and improve immunological profile will result in improved pig weight gain 22,14,24 . However, free organic acids dissociate and lose most of their antibacterial capacity before reaching the distal part of the digestive system 25 . Therefore, sodium butyrate in encapsulated form allows progressive reach to the distal parts of the gastrointestinal tract without being fully dissociated, because the product is gradually released compared to an uncoated product 10 . In view of the above, the hypothesis of the study was that the dietary supplementation of purified nucleotide, lysed yeast ( S. cerevisiae ), or encapsulated sodium butyrate would improve the growth performance of weaned piglets by beneficially stimulating the immune response and supporting intestinal physiological and health functions. Therefore, the objective of this study was to evaluate the effects of purified nucleotide, lysed yeast, and sodium butyrate in diets for nursery pigs on growth performance, diarrhea incidence, blood profile, intestinal morphology, mRNA expression of nutrients transporter, inflammatory markers, antioxidant profile, and tight junction proteins. Results Growth performance During phase 1 (21 to 32 d), pigs fed YSC or ASB diets showed ( P < 0.05) improvements in ADG, FC, and BW compared with pigs fed CON diet; however, ADFI was not affected by dietary treatments (Table 1 ). In phase 2 (32 to 45 d), pigs fed ASB diet had higher ( P < 0.05) BW compared to pigs fed CON diet. In addition, there was a trend to increase the BW ( P = 0.095) in pigs fed YSC diet compared to those fed CON diet. Pigs fed NUC diet tended to present lower ADG ( P = 0.080). However, FC was not affected by dietary treatments. During the overall period, ADG was higher ( P < 0.05) in pigs fed ASB diet than those with CON diet. In addition, FC was better ( P < 0.05), and a trend was observed to improve ADG ( P = 0.095) in pigs fed YSC diet compared with pigs on CON diet. Moreover, ADFI was not affected by dietary treatments. Table 1 Growth performance of piglets fed diets supplemented or not with feed additives (n = 9 pens replicates per dietary treatment and 5 piglets per pen as an experimental unit). a Average daily feed intake (ADFI, g/d), average daily weight gain (ADG, g/d), feed conversion ratio (FC, g:g). b Dietary treatment: phase 1 (21 to 32 d) and phase 2(32 to 45 d), respectively: ( 1 ) CON: control, basal diet, ( 2 ) NUC: CON + 1 g/kg and 0.5 g/kg of nucleotides (Nucleobase 1.5, Aleris Animal Nutrition, Jundiaí, SP, Brazil), ( 3 ) YSC: CON + 20 g/kg and 10 g/kg of lysed yeast S. cerevisiae (Sinergis, Aleris Animal Nutrition, Brazil), ( 4 ) ASB: CON + 1.5 g/kg and 1 g/kg of acidifier sodium butyrate (Nuttritiva B90CNa, Additiva Nutrition, Monte Alegre do Sul, SP, Brazil). c Pooled standard error of the mean. Item a Dietary treatment b SEM c P -value CON NUC YSC ASB CON × NUC CON × YSC CON × ASB Body weight, kg Initial 5.22 5.22 5.22 5.22 - - - - 32 d of age 6.83 6.89 7.18 7.18 0.11 0.693 0.034 0.031 45 d of age 12.64 12.36 13.12 13.32 0.19 0.321 0.095 0.019 Phase 1, 21 to 32 d ADFI, g/d 296 286 281 302 7.02 0.319 0.133 0.546 ADG, g/d 146 152 178 178 10.08 0.687 0.035 0.030 FC, g/g 2.05 1.97 1.61 1.74 0.09 0.549 < 0.010 0.034 Phase 2, 32 to 45 d ADFI, g/d 627 600 638 668 17.35 0.263 0.678 0.105 ADG, g/d 486 454 494 510 12.57 0.080 0.674 0.187 FC, g/g 1.29 1.32 1.29 1.31 0.02 0.336 0.940 0.602 Overall period ADFI, g/d 449 431 448 473 10.88 0.237 0.902 0.141 ADG, g/d 309 297 329 337 8.20 0.326 0.095 0.019 FC, g/g 1.46 1.45 1.36 1.40 0.02 0.848 < 0.010 0.103 Diarrhea incidence There was a trend to reduce the diarrhea incidence ( P = 0.098) in pigs fed NUC diet and improved fecal score ( P = 0.090) in pigs fed YSC diet than pigs fed CON diet in the phase 1 (Table 2 ). In phase 2, there was a trend to reduce the diarrhea incidence ( P = 0.089) and improved fecal score ( P = 0.091) in pigs fed YSC diet than in those fed CON diet. Table 2 Diarrhea incidence and fecal score of piglets fed diets supplemented or not with feed additives (n = 9 pens replicate per dietary treatment and 5 piglets per pen as an experimental unit). a Dietary treatment: phase 1 (24 to 32 d) and phase 2 (32 to 45 d), respectively: ( 1 ) CON: control, basal diet, ( 2 ) NUC: CON + 1 g/kg and 0.5 g/kg of nucleotides (Nucleobase 1.5, Aleris Animal Nutrition, Jundiaí, SP, Brazil), ( 3 ) YSC: CON + 20 g/kg and 10 g/kg of lysed yeast S. cerevisiae (Sinergis, Aleris Animal Nutrition, Brazil), ( 4 ) ASB: CON + 1.5 g/kg and 1 g/kg of acidifier sodium butyrate (Nuttritiva B90CNa, Additiva Nutrition, Monte Alegre do Sul, SP, Brazil). b Pooled standard error of the mean. Item Dietary treatment a SEM b P -value CON NUC YSC ASB CON × NUC CON × YSC CON × ASB Phase 1 Diarrhea incidence, % 20.01 12.10 14.33 15.56 3.28 0.098 0.230 0.345 Fecal score 0.80 0.64 0.61 0.69 0.07 0.161 0.090 0.341 Phase 2 Diarrhea incidence, % 15.50 16.00 6.70 7.16 3.55 0.927 0.089 0.106 Fecal score 0.53 0.60 0.32 0.37 0.11 0.516 0.091 0.193 Blood profile There was no effect of dietary treatments on IgG, creatinine, and urea concentrations (Table 3 ). Table 3 Blood profile of piglets fed diets supplemented or not with feed additives on d 32 (n = 9 pigs replicates per dietary treatment). a Dietary treatment: CON, control, basal diet; NUC, CON + 1 g/kg of nucleotides (Nucleobase 1.5, Aleris Animal Nutrition, Jundiaí, SP, Brazil); YSC, CON + 20 g/kg of lysed yeast S. cerevisiae (Sinergis, Aleris Animal Nutrition, Brazil); ASB: CON + 1.5 g/kg of acidifier sodium butyrate (Nuttritiva B90CNa, Additiva Nutrition, Monte Alegre do Sul, SP, Brazil). b Pooled standard error of the mean. Item Dietary treatment a SEM b P -value CON NUC YSC ASB CON × NUC CON × YSC CON × ASB Urea, mg/dL 16.55 16.89 15.55 13.11 1.58 0.882 0.658 0.133 Creatinine, mg/dL 0.64 0.70 0.68 0.66 0.06 0.416 0.330 0.458 IgG, mg/dL 272.74 306.67 266.07 273.69 23.42 0.157 0.777 0.968 Intestinal morphology Dietary treatments had no effects on villus height, crypt depth, villus:crypt ratio, and proportion of goblet cells in the duodenum and jejunum (Table 4 ). In the ileum, the dietary treatments had no effects on crypt depth and proportion of goblet cells. However, villus height was increased ( P < 0.05) and villus:crypt ratio trended to increase ( P = 0.066) in pigs fed ASB diet than pigs fed CON diet. In addition, the number of Peyer’s patches in pigs fed YSC or ASB diets was lower ( P < 0.05) compared to pigs that received CON diet. There was a trend towards an increase ( P = 0.071) villus height and reduce ( P = 0.078) the number of Peyer’s patches in pigs fed NUC diet than those fed the CON diet. Table 4 Intestinal morphology of piglets fed diets supplemented or not with feed additives on d 32 (n = 9 pigs replicates per dietary treatment). a Dietary treatment: CON, control, basal diet; NUC, CON + 1 g/kg of nucleotides (Nucleobase 1.5, Aleris Animal Nutrition, Jundiaí, SP, Brazil); YSC, CON + 20 g/kg of lysed yeast S. cerevisiae (Sinergis, Aleris Animal Nutrition, Brazil); ASB: CON + 1.5 g/kg of acidifier sodium butyrate (Nuttritiva B90CNa, Additiva Nutrition, Monte Alegre do Sul, SP, Brazil). b Pooled standard error of the mean. Item Dietary treatment a SEM b P -value CON NUC YSC ASB CON × NUC CON × YSC CON × ASB Duodenum Villus height, µm 307 297 298 300 19.09 0.662 0.689 0.753 Crypt depth, µm 178 176 182 177 9.23 0.840 0.761 0.926 Villus:crypt ratio 1.72 1.70 1.63 1.71 0.08 0.812 0.387 0.857 Goblet cells, % 32.50 34.25 33.51 36.79 3.00 0.656 0.790 0.227 Jejunum Villus height, µm 264 255 261 268 24.09 0.771 0.922 0.880 Crypt depth, µm 150 139 143 157 11.12 0.474 0.640 0.590 Villus:crypt ratio 1.80 1.83 1.82 1.71 0.10 0.804 0.851 0.486 Goblet cells, % 23.15 24.62 25.16 22.79 2.76 0.683 0.562 0.912 Ileum Villus height, µm 210 241 234 255 12.99 0.071 0.150 < 0.010 Crypt depth, µm 132 139 138 138 9.17 0.534 0.573 0.576 Villus:crypt ratio 1.64 1.66 1.69 1.81 0.07 0.896 0.603 0.066 Goblet cells, % 50.43 53.07 46.65 45.94 4.59 0.661 0.514 0.405 Peyer’s patches, n 48 40 39 38 3.33 0.078 0.042 0.017 mRNA relative abundance of nutrient transporters In the jejunum, there was no effect of dietary treatments on the mRNA expression of GLUT2, EAAC1, and y + LAT1 (Fig. 1 ). However, mRNA expression of SMCT2 and PepT1 was higher ( P < 0.05) in pigs fed YSC diet compared to pigs fed CON diet. The mRNA expression of MCT1 in pigs fed ASB and YSC diets was higher ( P < 0.05) than in those fed CON diet. In addition, SGLT1 mRNA expression in pigs fed ASB diet was higher ( P < 0.05), and YSC diet ( P = 0.055) trended upwards compared to pigs fed CON diet. mRNA relative abundance of inflammatory and antioxidants markers, and tight junction proteins There was no effect of dietary treatments on the mRNA expression of CAT, IFN-γ, and IL-10 (Fig. 2 ). However, mRNA expression of GPX, OCL, and ZO-1 was higher ( P < 0.05) in pigs fed YSC or ASB diets compared to pigs fed CON diet. The mRNA expression of SOD in pigs fed ASB diet, and IL1-β in pigs fed YSC diet was higher ( P < 0.05) than in those fed CON diet. In addition, TNF-α mRNA expression in pigs fed YSC diet ( P = 0.082) and ASB diet ( P = 0.061) trended upwards compared to pigs fed CON diet. There was a downward trend ( P = 0.058) in IL1-β mRNA expression of pigs fed NUC diet than pigs that received CON diet. Discussion The hypothesis of the current experiment was that the dietary supplementation of purified nucleotide, S. cerevisiae yeast, or encapsulated acidifier sodium butyrate would improve the growth performance of weaned piglets and beneficially affect gut parameters. The present results showed that feeding nursery pigs with YSC or ASB diets increased growth performance and improved gut health, whereas no improvements were observed feeding the NUC diet. Although nucleotides can be synthesized from other precursors in pigs’ diets, in the post-weaning a stressful and limited nutrient intake period, nucleotides could be considered an essential nutrient 6 . However, in the present study, performance was not influenced by NUC diet, while others have reported positive effects of nucleotide supplementation on piglet growth performance 26,27 and feed intake 5 . The NUC diets correspond to 100 mg nucleotides/kg diet in phase 1 and 75 mg nucleotides/kg in phase 2 in a 24-d trial and were fed purified. On the other side, Superchi et al. 26 used a nucleotide yeast-derived source that also contains viable cells, cell wall components, inositol, and functional amino acids. Weaver and Kim 27 demonstrated improved growth performance with up to 1,000 mg nucleotides/kg during a 28-d trial. Working with different levels of nucleotides (0, 50, 150, 250, and 500 mg/kg) in a 20-d trial with one pig per pen, Jang and Kim 5 only found significant improvements in the feed intake, and when feeding the lower supplementation levels (50 and 150 mg/kg). Thus, the discrepancies in growth performance results between studies are justified due to the different sources, the different dosages used, and administration time. Regarding the YSC diet, the improved growth performance results are attributed to the improvements in intestinal health promoted by the supplementation of S. cerevisiae yeast. This additive contains high amounts of highly digestible protein, essential amino acids, nucleotides, mannanoligosaccharides, and β-glucans 15 . These components present in yeast may have anti-inflammatory properties to reduce intestinal inflammation and, consequently, minimize diarrheal disorders (as observed in the current study) and nutrient malabsorption 1 . According to Kogan and Kocher 19 , β-glucans are capable of blocking fimbriae of pathogenic bacteria and preventing their adhesion to the epithelium of the intestinal mucosa, acting to prevent or eliminate infection. Yeast-based additives support the immune system of piglets by modulating the intestinal microbiota 28 , which may contribute to improve growth performance 29 . An increase in nutrient digestibility as reported by Barbosa et al. 30 and Boontiam et al. 8 is another mechanism by which yeast supplementation in nursery pigs’ diets can improve the growth performance. Nutrient transporters are proteins expressed in the apical membrane of intestinal cells that absorb nutrients and, therefore, it is possible to improve digestibility by increasing the expression of these transporters 31 . This is supported by the results of our study, which showed increased mRNA expression of nutrient transporters (SGLT1, SMCT2, MCT1, and PepT1) in the jejunum of pigs. The SGLT1 is responsible for glucose absorption, while PepT1 acts on peptide absorption. The increase in the expression of these transporters suggested that there was greater availability of glucose and amino acids at the cellular level, in agreement with the findings by Clarke et al. 31 . Similarly, the increased expression of SMCT2 and MCT1 indicated a greater availability of monocarboxylates (e.g. lactate, short-chain fatty acids, and ketone bodies) 32 , which represent substrates for maintaining the energetic state in cells like the enterocytes. Regarding the ASB diet, the improvement in growth performance is supported by the increase in SGLT1 and MCT1 mRNA expression in the jejunum of nursery pigs. The MCT1 is expressed in both the small and large intestines, and its function is to transport butyrate into the cell 33 . However, in the small intestine, microbial butyrate formation is low or absent 34 , but the addition of butyrate to diets exerts trophic effects 35 and stimulates the secretion of digestive enzymes 21 , and this can result in more efficient digestion and absorption of dietary nutrients, leading to improved performance. Furthermore, butyrate is a source of energy for enterocytes and additionally has an antiapoptotic effect 33 . Therefore, greater MCT1 and SGLT1 expression may enhance the absorption of nutrients and energy to cope with post-weaning stress 36 . In the present study, sodium butyrate was added in encapsulated form (composed of a vegetable fat-based coating material) to be enzymatically broken down by lipase secreted in the duodenum, as mentioned by Maito et al. 10 . According to Tugnoli et al. 25 , the encapsulation process provides protection that allows a gradual release of the acidifier along the length of the gastrointestinal tract, reducing the dissociation in the stomach and maintaining their efficacy in jejunum and ileum. The weaning transition promotes physiological changes in the structural and functional aspects of the intestine, causing villous atrophy and increased crypt depth, which in turn reduces the small intestine capacity to absorb nutrients 3 . In the present study, villus height and villus:crypt ratio in the ileum were higher in pigs fed the ASB diet, indicating improvement in intestinal morphology. Moreover, a greater abundance of jejunal mucosal barrier function-related genes (OCL and ZO-1) was observed in pigs fed the ASB diet. These results indicated that ASB diet was efficient in the structural maintenance of the small intestine, as suggested by others 35 . The gradual release of sodium butyrate throughout the intestinal tract seems to be critical in achieving the expected target 9 , allowing the additive to affect different portions of the intestine such as jejunum and ileum. According to Guilloteau et al. 33 , supplementation with sodium butyrate stimulates the proliferation of epithelial cells, resulting in a greater absorption surface and preservation of villi length, reflecting the improvements observed in growth performance of pigs. A greater abundance of jejunal OCL and ZO-1 mRNA expression was also observed in pigs fed the YSC. According to Rose et al. 37 , OCL and ZO-1 are classified as intestinal junction proteins with a role in regulating epithelial permeability. Decreased intestinal permeability can be correlated with reduced oxidative stress, because this results in attenuation of damage to the intestinal mucosal barrier 14 . Oxidative stress is a physiological stage in which antioxidant defense is inadequate to detoxify the reactive oxygen species, this oxidative process damages essential biomolecules, leading to reduced growth performance 29 . The GPX and SOD as the key enzymes of the antioxidant system play a crucial role in eliminating free radicals, reducing oxidative damage, and maintaining cell structure is well known 38 . In our study, in addition to the increase in the expression of tight junction proteins, pigs fed the ASB and YSC diet had greater expression of GPX and SOD mRNA. These results suggested that nursery pigs fed with additives had greater antioxidant capacity than those fed the CON diet, demonstrating that there was an improvement in the intestinal redox state. The impacts of weaning stress are not only limited to intestinal barrier function and oxidative stress, but an increase in the activation of the immune system in weaned piglets is also observed 3 . An unregulated enhanced immune response may trigger a negative effect on other metabolic processes and as a result impair growth performance 39 . Peyer's patches are the major organized lymphoid structures involved in the induction of mucosal immune responses in the intestine 40 . In the present study, a reduction in Peyer's patch counts was observed in the ileum of pigs fed YSC or ASB diet. This suggested that there was less induction of the mucosal immune system in pigs that received YSC and ASB diets and, consequently, less stimulus to the immune system because Peyer's patches can be considered as immunological sensors of the intestine 41 . These results suggested that both yeast and sodium butyrate could help enhance the small intestine epithelial barrier, antioxidant capacity, and immune system. Thus, the enhancement of overall gut health helps explain the improvement in the growth performance of pigs fed YSC and ASB diets. Regarding the production of pro-inflammatory cytokines, it was found that pigs fed the YSC diet showed an increase in IL1-β mRNA expression and a tendency to increase TNF-α, while piglets fed the ASB diet showed a tendency to increase TNF-α mRNA expression. On the other hand, pigs fed the NUC diet had a tendency to reduce IL1-β mRNA expression. Nucleotides, yeast, and acidifier-based additives can improve pig immune responses in the post-weaning period 16 . These additives can activate immune cells, including macrophages, which produce IL-1β as part of the immune response 42, 43 . The results of the present study indicated a sustained condition of immune response, because in some cases, a controlled and transient increase in IL-1β may be part of a healthy immune response to support the ability of pigs to fight infections or maintain intestinal health 18 . According to Grimble 39 , it is considered beneficial the presence of cytokines (e.g. IL-1β and TNF-α) in adequate concentrations during an inflammatory response to infection. It is important to avoid overstimulation of the immune system, as greater expression of pro-inflammatory cytokines can trigger pathological responses in inflammatory conditions 44 . However, in a previous study, it was observed that TNF-α increases the expression of specific anti-apoptotic proteins, as well as triggers the expression of the survival gene BCL2A1 (not evaluated in the current study) in the intestine of weaned piglets 45 . Also, the β-glucans present in yeast are recognized by specific receptors (pattern recognition receptors) on immune cells, such as macrophages and neutrophils. In particular, they are recognized by the dectin-1 receptor 46 . Once β-glucans bind to these receptors, they can trigger an immune response. Upon recognition of β-glucans, immune cells can produce pro-inflammatory cytokines, such as TNF-α, and IL-1β 47 . Collectively, although these cytokines play a central role in initiating and magnifying the inflammatory response, they did not negatively affect the biological response of nursery pigs fed YSC and ASB diets. Conclusions Based on the evaluated criteria, dietary supplementation of autolyzed yeast S. cerevisiae or sodium butyrate promotes better growth performance by improving the integrity of the intestinal barrier, the mRNA expression of nutrient transporters and antioxidant enzymes in the jejunum of nursery pigs, but without major differences in intestinal morphology in those fed with S. cerevisiae yeast. Furthermore, none of the dietary treatments promoted changes in blood metabolites, but a diet containing S. cerevisiae yeast or sodium butyrate provided a sustained immune response in the jejunum of nursery pigs. On the other hand, dietary nucleotide supplementation did not improve growth performance and gut health. Material and Methods The experimental protocol follows the ethical principles in animal research (CONCEA, 2016) and was approved by the Ethical Committee on Animal Use of Universidade Federal de Viçosa, under protocol nº 0110/2022. All methods were carried out in accordance with relevant guidelines and regulations. All methods were reported in accordance with ARRIVE guidelines ( https://arriveguidelines.org/arrive-guidelines ). Animals, experimental design, housing, and diets The experiment was conducted on a commercial farm in the municipality of Santo Antônio do Grama, MG, Brazil. A total of 180 piglets [PIC 337 (Large White × Landrace × Duroc × Pietrain) × DB 90 (Large White × Landrace)] castrated males and females, weaned at 21 d-old and with 5.17 ± 0.57 kg BW were used in a 24-d trial. Piglets were assigned to a randomized block design based on their initial BW (light and heavy) into 4 dietary treatments and 9 pens replicates (5 pigs/pen). The experiment was conducted only in one series, without an adaptation period. The pigs were housed in suspended pens (1.75 × 1.00 m, 0.35 m²/pig), with a plastic floor, semi-automatic feeders and nipple drinkers, with free access to diet and water. The minimum and maximum temperatures in the nursery room were 22.9 ± 1.50ºC and 31.8 ± 2.54ºC, respectively. Pigs were fed in a two-phase feeding regimen (phase 1: 21 to 32 d, and phase 2: 32 to 45 d). All diets were corn and soybean meal-based with industrial amino acids and formulated according to the nutritional recommendations of the Brazilian Tables for Poultry and Swine 48 (Table 5 ), and provided in mash form. During phases 1 and 2, the dietary treatments consisted, respectively, of: ( 1 ) CON: control, basal diet, ( 2 ) NUC: CON + 1 g/kg and 0.5 g/kg of nucleotides, ( 3 ) YSC: CON + 20 g/kg and 10 g/kg of lysed yeast S. cerevisiae , ( 4 ) ASB: CON + 1.5 g/kg and 1 g/kg of acidifier sodium butyrate. Feed additives were added in replacement with inert in the CON based on the manufacturer's recommendations. Table 5 Ingredients and chemical composition of control diets fed to nursery piglets (g/kg, as-fed basis). a Feed additives were included as a replacement for the inert in the diet. Phase 1 (21 to 32 d) and phase 2(32 to 45 d), respectively: ( 1 ) CON: control, basal diet, ( 2 ) NUC: CON + 1 g/kg and 0.5 g/kg of nucleotides (Nucleobase 1.5, Aleris Animal Nutrition, Jundiaí, SP, Brazil), ( 3 ) YSC: CON + 20 g/kg and 10 g/kg of lysed yeast S. cerevisiae (Sinergis, Aleris Animal Nutrition, Brazil), ( 4 ) ASB: CON + 1.5 g/kg and 1 g/kg of acidifier sodium butyrate (Nuttritiva B90CNa, Additiva Nutrition, Monte Alegre do Sul, SP, Brazil). b Composition per kg of diet: vitamin A, 12,000 IU; vitamin D 3 , 2,250 IU; vitamin E, 65 IU; vitamin K, 3 mg; thiamine, 2.25 mg; riboflavin, 6 mg; pyridoxine, 2.25 mg; vitamin B 12 , 27 mcg; folic acid, 400 mcg; biotin, 150 mcg; pantothenic acid, 22.5 mg; niacin, 45 mg; copper sulfate, 10 mg; iodine, 1.5 mg; iron sulfate, 100 mg; manganese sulfate, 40 mg; sodium selenite, 0,3 mg; zinc oxide, 100 mg. c Natuphos®, Basf enzyme. d Standardized ileal digestible. Item a Phase 1 Phase 2 21 to 32 d 32 to 45 d Ground corn, 7.8% CP 388.1 470.9 Soybean meal, 46.0% CP 219.7 242.2 Dried whey, 12.5% CP 150.0 100.0 Soybean micronized, 36.0% CP 100.0 70.0 Extrude corn, 7.6% CP 20.0 20.0 Plasma protein, 78.0% CP 20.0 10.0 Sugar 30.0 30.0 Inert (kaolin) 20.0 10.0 Dicalcium phosphate 9.35 10.6 Limestone calcitic 7.69 7.34 Soybean oil 15.93 11.1 Zinc oxide 2.50 2.20 Choline chloride 1.95 1.50 L-lys, 78.0% 4.69 4,45 DL-met, 99.0% 2.32 1.96 L-thr, 98.5% 2.30 2.14 L-trp, 99.0% 0.32 0.28 L-val, 96.5% 1.03 0.76 Salt 1.90 2.44 Copper sulfate 0.60 0.60 Vitamin-mineral premix b 1.40 1.40 Phytase c 0.05 0.05 BHT 0.10 0.10 Calculated composition ME, kcal/kg 3,400 3,375 Crude protein, g/kg 213.00 213.00 SID d lys, g/kg 14.50 13.46 SID met, g/kg 4.90 4.53 SID met + cys, g/kg 8.13 7.54 SID thr, g/kg 9.72 9.02 SID trp, g/kg 2.76 2.56 SID val, g/kg 10.01 9.29 SID ile, g/kg 8.01 7.70 Total Ca, g/kg 8.50 8.25 Available P, g/kg 5.19 5.00 Total Na, g/kg 2.80 2.30 Lactose, g/kg 112.50 75.00 Composition of feed additives The source of nucleotides (Nucleobase 1.5, Aleris Animal Nutrition, Jundiaí, SP, Brazil) obtained from yeast extract purified with autolyzed yeast, contained 15% free nucleotides and 85% vehicle, corresponding to 100 mg free nucleotides/kg diet (phase 1) and 75 mg free nucleotides/kg (phase 2). The yeast source (Sinergis, Aleris Animal Nutrition, Brazil) contained 100% autolyzed yeast S. cerevisiae. The acidifier source (Nuttritiva B90CNa, Additiva Nutrition, Monte Alegre do Sul, SP, Brazil) contained 90% sodium butyrate in the form of a protected and encapsulated salt with palm oil, microgranulated, corresponding to 1.35 g sodium butyrate/kg diet (phase 1) and 0.90 g sodium butyrate/kg diet (phase 2). Growth performance and diarrhea incidence Throughout the trial, the offered diet and leftovers were weighed to calculate average daily feed intake (ADFI). Pigs were individually weighed on d 21, 32, and 45 to determine BW, average daily weight gain (ADG), and feed conversion (FC). The fecal consistency of each pig was visually assessed during phase 1 (24 to 32 d) and phase 2 (32 to 45 d), using the method described by Liu et al. 49 . Fresh feces were ranked on a 4-point scale as follows: 0 = solid, 1 = semi-solid, 2 = semi-liquid, and 3 = liquid. The diarrhea incidence was defined as the consistency of feces at scale 2 or 3 for 2 continuous days. The diarrhea incidence for the pigs was calculated as follows: diarrhea incidence (%) = [(the number of pigs with diarrhea in each pen × number of days of diarrhea) ÷ (total number of pigs in each pen × number of days)] × 100%. Observations were made in the morning, every day throughout the experimental period by a trained evaluator. Sample collection At 32 d-old, blood was collected from 1 piglet with BW closest to the average weight of the pigs within its respective pen. The animals were not fasted. Blood was collected (09h00) by orbital sinus puncture with a hypodermic needle (40 × 1.6 mm) into 10 mL tubes without anticoagulants. Samples were immediately sent at room temperature to the Viçosa Clinical Laboratory (Viçosa, MG - Brazil) for determination of serum urea nitrogen (SUN; Ureal Cobas C311, Linklab, software PNCQ), creatinine (Creatinine, WS-Kovalent, kinetic method, ASB-380, Mindray), and immunoglobulin G concentrations (IgG Atellica CH IgG_2, CH Analyzer, Siemens Healthineers). The same blood donor piglet was electrically stunned (240 volts for 3 s) followed by exsanguination to collect samples on d 32. Fragments measuring 2 cm were sampled (8 pigs/treatment) from the duodenum (10 cm from the pylorus junction), jejunum (mid-section), and ileum (5 cm to ileocecal junction) for histological evaluation 50 . The histological sections were then washed in a physiological solution (0.9% sodium chloride) and fixed in 4% paraformaldehyde solution (100 mL 40% paraformaldehyde, 900 mL distilled water, 2.28 g monobasic sodium phosphate, and 21.74 g dibasic sodium phosphate) for 24 h at room temperature 6 . Another 2 cm of jejunum was collected and immediately frozen in liquid nitrogen, stored at − 80°C for RNA extraction and gene expression analysis. Intestinal morphology, Peyer’s patches, and goblet cells After 24 h of fixation, the fragments of the duodenum, jejunum, and ileum were transferred to an ethanol solution 70% (v/v). Then, the samples were cut into cross-sections and dried in increasing gradients of ethyl, diaphanized in HistoChoice®, and embedded in liquid Paraplast® at 65°C. Five cross-sections (5 µm thickness each) were placed per slide and stained with hematoxylin and eosin. The sections were semi-serial using 1 in 10 cuts 51 . For morphological readings of villus height and crypt depth in the duodenum, jejunum, and ileum, an EVOS™ M5000 Cell Imaging System optical microscope (Invitrogen, Thermo Fisher Scientific) with a 10-objective lens was used. The images were then analyzed using ImageJ 1.50i (Java1.6.0_20; National Institutes of Health, USA). Heights of 20 villus and their 20 crypts were selected and measured. Villus to crypt ratios using the length data were then calculated. All measurements were made by a single trained individual. In the ileum fragment, the total count of the Peyer’s patches was performed at 4× magnification 52 . To assess the goblet cells in the duodenum, jejunum, and ileum, 10 fields per slide were photographed at 20× magnification. Subsequently, the ImageJ program was used, and perpendicular lines were inserted with markings in uniformly sized quadrants under each image. Then, the total number of intersections in the image and the cells that touched the intersections were then counted. The calculation was made according to the methodology proposed by Mandarim de Lacerda 53 : Goblet cells (%) = \(\frac{total number of goblet cells x 100}{total number total number of intersections}\) Relative mRNA abundance Total RNA was extracted using a commercial kit (SV Total RNA isolation kit – Promega, Z3100), following the manufacturer's instructions. The RNA concentration was estimated using NanoDrop™ Lite (Thermo Fisher Scientific), and RNA integrity was assessed using 1% agarose gel electrophoresis. Complementary DNA was synthesized according to the GoScript™ Reverse Transcription System protocol (Promega Corporation). GenBank numbers used to access the gene primers are shown in Table 6 . Primers were used for reverse transcription quantitative PCR with GoTaq® qPCR Master Mix (Promega) in QuantStudio® 3 (Applied Biosystems, Thermo Fisher Scientific). Geometric mean of Ct value of β-actina was used to normalize the expression of the target genes for the jejunum samples. The relative expression of the gene of interest was calculated by ΔCt 54 for glutathione peroxidase (GPX), superoxide dismutase (SOD), catalase (CAT), occludin (OCL), zonula occludens-1 (ZO-1), interferon gamma (IFN-γ), tumor necrosis factor alpha (TNF-α), interleukin 1 beta (IL1-β), interleukin 10 (IL-10), glucose transporter type 2 (GLUT2), Na + /glucose co-transporter 1 (SGLT1), sodium-coupled monocarboxylate transporter (SMCT2), monocarboxylate transporter 1 (MCT1), peptide transporter 1 (PepT1), excitatory amino acid carrier 1 (EAAC1), Na + -independent cationic and Na + -dependent neutral amino acid transporter 1 (y + LAT1). Table 6 List of primers used in reverse transcription quantitative-PCR gene expression analysis in weaned piglets. a GPX, glutathione peroxidase; SOD, superoxide dismutase; CAT, catalase; OCL, occludin; ZO-1, zonula occludens-1; IFN-γ, interferon gamma; TNF-α, tumor necrosis factor alpha; IL1- β, interleukin 1 beta; IL-10, interleukin 10; GLUT2, glucose transporter type 2; SGLT1, Na+/glucose co-transporter 1; SMCT2, sodium-coupled monocarboxylate transporter; MCT1, monocarboxylate transporter 1; PepT1, peptide transporter 1; EAAC1, excitatory amino acid carrier 1; y + LAT1, Na+-independent cationic and Na+-dependent neutral amino acid transporter 1. 2F and R indicate Forward and Reverse primers, respectively. Genes a GenBank number Sequence 2 GPX NM_214201.1 F: 5′GCCCAACTTCATGCTCTTC3′ R: 5′CAGGATCTCCCCATTCTTGGC3′ SOD NM_001190422.1 F: 5′ATCAAGAGAGGCACGTTGGA3′ R: 5′TCTGCCCAAGTCATCTGGTT3′ CAT NM_214301.2 F: 5′GCTTTAGTGCTCCCGAACAG3′ R: 5′AGATGACCCGCAATGTTCTC3′ OCL NM_001163647.1 F: 5′TCCTGGGTGTGATGGTGTTC3′ R: 5′CGTAGAGTCCAGTCACCGCA3′ ZO-1 XM_003353439.2 F: 5´AAGCCCTAAGTTCAATCACAATCT3′ R: 5´ATCAAACTCAGGAGGCGGC3′ IFN- γ NM_213948 F: 5′TGGTAGCTCTGGGAAACTGAATG3′ R: 5′GGCTTTGCGCTGGATCTG3′ TNF-α NM_214022.1 F: 5′CATCGCCGTCTCCTACCA3′ R: 5′CCCAGATTCAGCAAAGTCCA3′ IL1- β NM_214055.1 F: 5′TCTGCCCTGTACCCCAACTG3′ R: 5′CCCAGGAAGACGGGCTTT3′ IL-10 NM_214041.1 F: 5′GAAGGACCAGATGGGCGACTT3′ R: 5′CACCTCCTCCACGGCCCTTG3′ GLUT2 FJ209732.1 F: 5′TTGCCTTGGATGAGTTATGTGA3’ R: 5′GCGTGGTCCTTGACTGAAAA3’ SGLT1 MW_280290.1 F: 5′GGTTGGAGCTTCTCTGTTTG3’ R: 5′CCAGAACAACCACCCAAATC3’ SMCT2 XM_003122908.1 F: 5′AGGTCTACCGCTTTGGAGCAT3’ R:5′GAGCTCTGATGTGAAGATGATGACA3’ MCT1 AM_286425.1 F: 5′GGTGGAGGTCCTATCAGCAG3’ R: 5′AAGCAGCCGCCAATAATCAT3’ PepT1 AY_180903.1 F: 5′CATGGATGCTGTGGTGTATC3’ R: 5′CATGGAAGCCAGGAACATC3’ EAAC1 NM_001164649.1 F: 5′CAGTGGATGCCATGTTAGAC3’ R: 5′CGTCTCTGGCTCACTAGAA 3’ y + LAT1 EU_047705.1 F: 5′ TGCGTGGAGGACATCTT3’ R: 5′CTCCTTCCAGCGCAAATAG3’ β-actin U07786.1 F: 5′CTCTTCCATCGTGTCCTTCTAC3′ R: 5′CCTCAGACTTGTCGATCTTCTG3′ Statistical procedures The pen was considered the experimental unit for growth performance and diarrhea incidence analysis. One pig from each pen was considered the experimental unit for intestinal morphology, gene expression, and blood profile. The statistical model included the fixed effect of dietary treatment, and block and residual error as random factors. The normality of experimental errors was evaluated using Shapiro-Wilk. The data were analyzed using the mixed procedure of SAS 9.4 (SAS Inst., Inc., Cary, NC, USA) via one-way analysis of variance (ANOVA). When an effect was detected in the ANOVA ( P < 0.05), differences between means were determined by the preplanned contrasts, in which each of the treatments (NUC, YSC, and ASB) were compared versus the control treatment (CON). The statistical significance and tendency were declared at P < 0.05 and 0.05 ≤ P < 0.10, respectively. Declarations Acknowledgements The authors thank CNPq—Conselho Nacional de Desenvolvimento Científico e Tecnológico, CAPES – Coordenação de Aperfeiçoamento de Pessoal de Nível Superior, INCT-CA—Instituto Nacional de Ciência e Tecnologia de Ciência Animal, and FAPEMIG - Fundação de Amparo à Pesquisa do Estado de Minas Gerais. Special thanks to Ajinomoto do Brazil for providing the crystalline amino acids used in the experiment. Author contributions GCR and AMC: conceptualization, data curation, and project management. GCR, AMC, and FFA: methodology. GCR: software. GCR, AMC, JLG and SWK: statistical analysis, formal analysis, and writing—original draft preparation. GCR and SWK: validation. AMC and FFA: investigation. AMC, JLG, SWK and GCR: writing—review and editing. GCR: supervision. All authors contributed to the article and approved the submitted version. Data availability statement The datasets used and/or analysed during the current study available from the corresponding author on reasonable request. Additional Information Competing interests The authors declare no competing interests. Funding Not applicable. References Genova, J. et al. A summary of feed additives, intestinal health and intestinal alkaline phosphatase in piglet nutrition. Czech J. Anim. Sci . 65 , 281-294. https://doi.org/10.17221/70/2020-CJAS (2020). Moore, K. L., Mullan, B. P., Pluske, J. R., Kim, J. C. & D'Souza, D. N. The use of nucleotides, vitamins and functional amino acids to enhance the structure of the small intestine and circulating measures of immune function in the post-weaned piglet. Anim. Feed Sci. Technol 165 , 184-190. https://doi.org/10.1016/j.anifeedsci.2010.09.013 (2011) Kim, S. W. & Duarte, M. E. Understanding intestinal health in nursery pigs and the relevant nutritional strategies. Anim. Biosci . 34 , 338-344. https://doi.org/10.5713/ab.21.0010 (2021). Moeser, A. J., Pohl, C. S. & Rajput, M. Weaning stress and gastrointestinal barrier development: Implications for lifelong gut health in pigs. Anim. Nutr. 3 , 313-321. https://doi.org/10.1016/j.aninu.2017.06.003 (2017). Jang, K. B. & Kim, S. W. Supplemental effects of dietary nucleotides on intestinal health and growth performance of newly weaned pigs. J. Anim. Sci. 97 , 4875-4882. https://doi.org/10.1093/jas/skz334 (2019). Valini, G. A. C. et al. Dietary nucleotide supplementation as an alternative to in-feed antibiotics in weaned piglets. Anim . 15 , 100021. https://doi.org/10.1016/j.animal.2020.100021 (2021). Berto, P. N. et al. Dietary supplementation with hydrolyzed yeast and its effect on the performance, intestinal microbiota, and immune response of weaned piglets. Anais Acad. Bras. de Ciên . 92 . https://doi.org/10.1590/0001-3765202020180969 (2020). Boontiam, W., Bunchasak, C., Kim, Y. Y., Kitipongpysan, S. & Hong, J. Hydrolyzed yeast supplementation to newly weaned piglets: Growth performance, gut health, and microbial fermentation. Anim . 12 , 350. https://doi.org/10.3390/ani12030350 (2022). Liu, J. D., Bayir, H. O., Cosby, D. E., Cox, N. A., Williams, S. M. & Fowler, J. Evaluation of encapsulated sodium butyrate on growth performance, energy digestibility, gut development, and Salmonella colonization in broilers. Poult. Sci . 96 , 3638-3644. https://doi.org/10.3382/ps/pex174 (2017b). Maito, C. D. et al. Simultaneous feeding of calcium butyrate and tannin extract decreased the incidence of diarrhea and proinflammatory markers in weaned piglets. Anim. Biosci . 35 , 87. https://doi.org/10.5713/ab.21.0011 (2022). Pluske, J.R. Feed- and feed additives-related aspects of gut health and development in weanling pigs . J. Anim. Sci. Biotechnol. 4 , 1-7. https://doi.org/10.1186/2049-1891-4-1 (2013). Zheng, L., Duarte, M. E., Loftus, A. S. & Kim, S. W. Intestinal health of pigs upon weaning: challenges and nutritional intervention. Front Vet. Sci., 8 , 628258. https://doi.org/10.3389/fvets.2021.628258 (2021). Gomes, M. D. S. et al. Effect of antibiotics and low-crude protein diets on growth performance, health, immune response, and fecal microbiota of growing pigs. J. Anim. Sci . 101 . https://doi.org/10.1093/jas/skad357 (2023). Huang, C. et al. Dietary Sodium Butyrate Decreases Postweaning Diarrhea by Modulating Intestinal Permeability and Changing the Bacterial Communities in Weaned Piglets. J. Nutr . 145 , 2774-2780. https://doi.org/10.3945/jn.115.217406 (2015). Xiong, X. et al. Dietary supplementation with yeast product improves intestinal function, and serum and ileal amino acid contents in weaned piglets. Livest. Sci. 171 , 20-27. https://doi.org/10.1016/j.livsci.2014.10.012 (2015). Liu, Y. et al. Non-antibiotic feed additives in diets for pigs: A review. Anim. Nutr . 4 , 113-125. https://doi.org/10.1016/j.aninu.2018.01.007 (2018). Sauer, N., Mosenthin, R. & Bauer, E. The role of dietary nucleotides in single stomached animals. Nutr. Res. Rev. 24 , 46–59. https://doi.org/10.1017/S0954422410000326 (2011). Jiang, Z. et al. Effects of different forms of yeast Saccharomyces cerevisiae on growth performance, intestinal development, and systemic immunity in early-weaned piglets. J. Anim. Sci. Biotechnol . 6 , 1-8. http://dx.doi.org/10.1186/s40104-015-0046-8 (2015a). Kogan, G. & Kocher, A. Role of yeast cell wall polysaccharides in pig nutrition and health protection. Livest. Sci. 109 , 161-165. https://doi.org/10.1016/j.livsci.2007.01.134 (2007). Liu, G. et al. Dietary Saccharomyces cerevisiae Cell Wall Extract Supplementation Alleviates Oxidative Stress and Modulates Serum Amino Acids Profiles in Weaned Piglets . Oxidative Med. Cell. Longev. 2017 . https://doi.org/10.1155/2017/3967439 (2017a). Papatsiros, V. G., Christodoulopoulos, G. & Filippopoulos, L. C. The use of organic acids in monogastric animals (swine and rabbits). J. Cell Anim. Biol . 6 , 154-159. http://doi.org/10.5897/JCAB11.081 (2012). Fang, C.L., Sun, H., Wu, J., Niu, H. H. & Feng, J. Effects of sodium butyrate on growth performance, haematological and immunological characteristics of weanling piglets. J. Anim. Physiol. Anim. Nutr . 98 , 680–685. https://doi.org/10.1111/jpn.12122 (2014). Lewis, K. et al. Enhanced translocation of bacteria across metabolically stressed epithelia is reduced by butyrate. Inflamm. Bowel Dis . 16 , 1138–1148. https://doi.org/10.1002/ibd.21177 (2010). Li, X. et al. Sodium butyrate ameliorates oxidative stress-induced intestinal epithelium barrier injury and mitochondrial damage through AMPK-mitophagy pathway. Ox idative Med. Cell. Longev . 2022 . https://doi.org/10.1155/2022/3745135 (2022). Tugnoli, B., Giovagnoni, G., Piva, A. & Grilli, E. From acidifiers to intestinal health enhancers: How organic acids can improve growth efficiency of pigs. Anim . 10 , 134. https://doi.org/10.3390/ani10010134 (2020). Superchi, P. et al. Effects of dietary nucleotide supplementation on growth performance and hormonal and immune responses of piglets. Anim. 6, 902-908. DOI: https://doi.org/10.1017/S1751731111002473 (2012). Weaver, A. C., & Kim, S. W. Supplemental nucleotides high in inosine 5′-monophosphate to improve the growth and health of nursery pigs. J. Anim. Sci. 92, 645-651. https://doi.org/10.2527/jas.2013-6564 (2014). Vries, H. et al. Impact of yeast-derived β-glucans on the porcine gut microbiota and immune system in early life. Microorganisms. 8, 1573. https://doi.org/10.3390/microorganisms8101573 (2020). Gomes, M. D. S. et al. Effect of amino acid blend as alternative to antibiotics for growing pigs. J. Anim. Sci. 100. https://doi.org/10.1093/jas/skac008 (2022). Barbosa, K. A. et al . Effects of combined feed additives in diets to support growth performance and intestinal health profile in nursery piglets. Livest. Sci . 266, 105121. https://doi.org/10.1016/j.livsci.2022.105121 (2022). Clarke, L. C. et al. Effect of β-glucanase and β-xylanase enzyme supplemented barley diets on nutrient digestibility, growth performance and expression of intestinal nutrient transporter genes in finisher pigs. Anim. Feed Sci. Technol. 238, 98-110. https://doi.org/10.1016/j.anifeedsci.2018.02.006 (2018). Metzler-Zebeli, B. U., Ertl, R., Grüll, D., Molnar, T. & Zebeli, Q. Enzymatically modified starch up-regulates expression. of incretins and sodium-coupled monocarboxylate transporter in jejunum of growing pigs. Anim. 11, 1180-1188. https://doi.org/10.1017/S1751731116002615 (2017). Guilloteau, P. et al. From the gut to the peripheral tissues: the multiple effects of butyrate. Nutr. Res. Rev. 23, 366-384. https://doi.org/10.1017/S0954422410000247 (2010). Bartholome, A. L., Albin, D. M., Baker, D. H., Holst, J. J. & Tappenden, K. A. Supplementation of total parenteral nutrition with butyrate acutely increases structural aspects of intestinal adaptation after an 80% jejunoileal resection in neonatal piglets. J. Parenter Enteral Nutr . 28, 210-222. https://doi.org/10.1177/0148607104028004210 (2004). Liu, H., Zhao, J., Zhang, W. & Nie, C. Impacts of sodium butyrate on intestinal mucosal barrier and intestinal microbial community in a weaned piglet model. Front. Microbiol . 13, 1041885. https://doi.org/10.3389/fmicb.2022.1041885 (2023). Deng, Q. et al . Changes in cecal morphology, cell proliferation, antioxidant enzyme, volatile fatty acids, lipopolysaccharide, and cytokines in piglets during the postweaning period. J. Anim Sci . 98, https://doi.org/10.1093/jas/skaa046 (2020). Rose, E. C., Odle, J., Blikslager, A. T. & Ziegler, A.L. Probiotics, Prebiotics and Epithelial Tight Junctions: A Promising Approach to Modulate Intestinal Barrier Function. Int. J. Mol. Sci. 22, 6729. https://doi.org/10.3390/ijms22136729 (2021). He, J. et al. Effects of l-glutamine on growth performance, antioxidant ability, immunity and expression of genes related to intestinal health in weanling pigs. Livest. Sci. 189, 102–109. https://doi.org/10.1016/j.livsci.2016.05.009 (2016). Grimble, R. F. Dietary lipids and the inflammatory response. Proc. Nutr. Soc. 57, 535-542. https://doi.org/10.1079/PNS19980078 (1998). Makala, L. H. et al. Ontogeny of pig discrete Peyer’s patches: distribution and morphometric analysis. Pathobiol. 68, 275-282. https://doi.org/10.1159/000055938 (2001). Kobayashi, N., Takahashi, D., Takano, S., Kimura, S. & Hase, K. The roles of Peyer's patches and microfold cells in the gut immune system: relevance to autoimmune diseases. Front. Immunol. 10, 2345. https://doi.org/10.3389/fimmu.2019.02345 (2019). Jiang, Y., Zhang, W., Gao, F. & Zhou, G. Effect of sodium butyrate on intestinal inflammatory response to lipopolysaccharide in broiler chickens. Can. J. Anim. Sci . 95, 389-395. https://doi.org/10.4141/cjas-2014-183 (2015b). Sanchez, N. C. B., Broadway, P. R. & Carroll, J. A. Influence of yeast products on modulating metabolism and immunity in cattle and swine. Anim. 11, 371. https://doi.org/10.3390/ani11020371 (2021). Bennett, J. M., Reeves, G., Billman, G. E. & Sturmberg, J. P. Inflammation–nature’s way to efficiently respond to all types of challenges: implications for understanding and managing “the epidemic” of chronic diseases. Front. med. 5, 316. https://doi.org/10.3389/fmed.2018.00316 (2018). Novais, A. K. et al. Weaning differentially affects mitochondrial function, oxidative stress, inflammation and apoptosis in normal and low birth weight piglets. PLoS One , 6, 1. http://dx.doi.org/10.1371/journal.pone.0247188 (2021). Goodridge, H. S., Wolf, A. J. & Underhill, D. M. β‐glucan recognition by the innate immune system. Immunol. Rev. 230, 38-50. https://doi.org/10.1111/j.1600-065X.2009.00793.x (2009). Fu, R. et al. Yeast hydrolysate attenuates lipopolysaccharide-induced inflammatory responses and intestinal barrier damage in weaned piglets. J. Anim. Sci. Biotechnol. 14, 1-15. https://doi.org/10.1186/s40104-023-00835-2 (2023). Rostagno, H. S. et al. Brazilian Tables for Poultry and Swine: composition of feedstuffs and nutritional requirements. Animal Science Department UFV (2017), Viçosa, MG, Brazil, 488. Liu, P. P. X. S. et al. Chito-oligosaccharide reduces diarrhea incidence and attenuates the immune response of weaned pigs challenged with Escherichia coli K88. J. Anim. Sci. 88, 3871-3879. https://doi.org/10.2527/jas.2009-2771 (2010). Yang, K.M., Jiang, Z.Y., Zheng, C.T., Wang, L. & Yang, X.F. Effect of Lactobacillus plantarum on diarreia and intestinal barrier function of young piglets challenged with enterotoxigenic Escherichia coli K88. J. Anim. Sci. 92, 1496-1503. https://doi.org/10.2527/jas.2013-6619 (2014). Júnior, D. T. V. et al. Supplementation of Bacillus subtilis DSM 32540 improves performance and intestinal health of weaned pigs fed diets containing different fiber sources. Livest. Sci. 270, 105202. https://doi.org/10.1016/j.livsci.2023.105202 (2023). Correia, A. M., Genova, J. L., Saraiva, A., Rocha, G. C. Effects of crude protein and non-essential amino acids on growth performance, blood profile, and intestinal health of weaned piglets. Front Vet. Sci. 10, https://doi.org/10.3389/fvets.2023.1243357 (2023). Mandarim De Lacerda, C. A. Métodos quantitativos em morfologia. Rio de Janeiro(1995). Eduerj , 131 . Livak, K.J., Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2 − ΔΔCT method. Methods . 25, 402-408. https://doi.org/10.1006/meth.2001.1262 (2001). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 23 May, 2024 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 06 May, 2024 Reviews received at journal 04 May, 2024 Reviewers agreed at journal 28 Apr, 2024 Reviews received at journal 02 Apr, 2024 Reviewers agreed at journal 02 Apr, 2024 Reviewers invited by journal 02 Apr, 2024 Editor assigned by journal 02 Apr, 2024 Editor invited by journal 27 Mar, 2024 Submission checks completed at journal 27 Mar, 2024 First submitted to journal 16 Mar, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4112899","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":285577740,"identity":"d0d76953-67bb-4b3a-8af2-6fa0ab129824","order_by":0,"name":"Amanda Medeiros Correia¹","email":"","orcid":"","institution":"Universidade Federal de Viçosa","correspondingAuthor":false,"prefix":"","firstName":"Amanda","middleName":"Medeiros","lastName":"Correia¹","suffix":""},{"id":285577741,"identity":"a81e5c7f-4b97-4bba-87b5-a99218df3e55","order_by":1,"name":"Jansller Luiz Genova¹","email":"","orcid":"","institution":"Universidade Federal de Viçosa","correspondingAuthor":false,"prefix":"","firstName":"Jansller","middleName":"Luiz","lastName":"Genova¹","suffix":""},{"id":285577742,"identity":"6a9dbec1-4051-4e0f-8a63-23e7a9608007","order_by":2,"name":"Sung Woo Kim","email":"","orcid":"","institution":"North Carolina State University","correspondingAuthor":false,"prefix":"","firstName":"Sung","middleName":"Woo","lastName":"Kim","suffix":""},{"id":285577743,"identity":"9a7a71e6-4edf-4945-a8b5-5bb92c0380bf","order_by":3,"name":"Fernanda Fialho Abranches","email":"","orcid":"","institution":"Universidade Federal de Viçosa","correspondingAuthor":false,"prefix":"","firstName":"Fernanda","middleName":"Fialho","lastName":"Abranches","suffix":""},{"id":285577744,"identity":"7d887aa1-79bc-46f6-8f45-9edfdf085e7b","order_by":4,"name":"Gabriel Cipriano Rocha","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAApElEQVRIiWNgGAWjYLACxgYGOQbmAwzMJGkxZmBLIFFLYgPRWuTdzz588HOHXfqGYzwGzIV7iNBieCbd2LD3THIuWMuMZ8RomcHGJs3Yxpy74X5bAjPPAeK11KcbHGMjUou8BFjL4QSDY8wHiNNiwJPGbNjbdtxwJlDL4RlE2dJ+jPHBz7Zqeb5jjI2PC4iyBVkRMRqAtjQQpWwUjIJRMApGNAAAVWwzHf2yw7oAAAAASUVORK5CYII=","orcid":"","institution":"Universidade Federal de Viçosa","correspondingAuthor":true,"prefix":"","firstName":"Gabriel","middleName":"Cipriano","lastName":"Rocha","suffix":""}],"badges":[],"createdAt":"2024-03-16 11:29:13","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4112899/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4112899/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-024-62551-9","type":"published","date":"2024-05-24T00:33:47+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":53836414,"identity":"af74d147-9225-45a3-906c-76afef0e1d35","added_by":"auto","created_at":"2024-04-01 06:17:57","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":107838,"visible":true,"origin":"","legend":"\u003cp\u003emRNA relative abundance of nutrient transporters in the jejunum of piglets fed diets supplemented or not with feed additives on d 32. Dietary treatment: CON, control, basal diet; NUC, CON + 1 g/kg of nucleotides (Nucleobase 1.5, Aleris Animal Nutrition, Jundiaí, SP, Brazil); YSC, CON + 20 g/kg of lysed yeast \u003cem\u003eS. cerevisiae \u003c/em\u003e(Sinergis, Aleris Animal Nutrition, Brazil); ASB: CON + 1.5 g/kg of acidifier sodium butyrate (Nuttritiva B90CNa, Additiva Nutrition, Monte Alegre do Sul, SP, Brazil). Data are means of 9 pigs replicates per dietary treatment. \u003cem\u003eP\u003c/em\u003e-value, preplanned contrasts of each of the treatments (NUC, YSC, and ASB) versus the control treatment (CON). \u003cstrong\u003e(A)\u003c/strong\u003e GLUT2, glucose transporter type 2; \u003cstrong\u003e(B)\u003c/strong\u003e SGLT1, Na\u003csup\u003e+\u003c/sup\u003e/glucose co-transporter 1; \u003cstrong\u003e(C)\u003c/strong\u003e SMCT2, sodium-coupled monocarboxylate transporter; \u003cstrong\u003e(D)\u003c/strong\u003e MCT1, monocarboxylate transporter 1; \u003cstrong\u003e(E)\u003c/strong\u003e PepT1, peptide transporter 1; \u003cstrong\u003e(F)\u003c/strong\u003e EAAC1, excitatory amino acid carrier 1; \u003cstrong\u003e(G)\u003c/strong\u003e y\u003csup\u003e+\u003c/sup\u003eLAT1, Na\u003csup\u003e+\u003c/sup\u003e-independent cationic and Na\u003csup\u003e+\u003c/sup\u003e-dependent neutral amino acid transporter 1.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-4112899/v1/38da51740a46969fbf420181.png"},{"id":53836415,"identity":"ce7e97f6-9a84-477a-bfd4-e363d7981cf3","added_by":"auto","created_at":"2024-04-01 06:17:58","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":136188,"visible":true,"origin":"","legend":"\u003cp\u003emRNA relative abundance of inflammatory and antioxidants markers, and tight junction proteins in the jejunum of pigls fed diets supplemented or not with feed additives on d 32. Dietary treatment: CON, control, basal diet; NUC, CON + 1 g/kg of nucleotides (Nucleobase 1.5, Aleris Animal Nutrition, Jundiaí, SP, Brazil); YSC, CON + 20 g/kg of lysed yeast \u003cem\u003eS. cerevisiae \u003c/em\u003e(Sinergis, Aleris Animal Nutrition, Brazil); ASB: CON + 1.5 g/kg of acidifier sodium butyrate (Nuttritiva B90CNa, Additiva Nutrition, Monte Alegre do Sul, SP, Brazil). Data are means of 9 pigs replicates per dietary treatment. \u003cem\u003eP\u003c/em\u003e-value, preplanned contrasts of each of the treatments (NUC, YSC, and ASB) versus the control treatment (CON). \u003cstrong\u003e(A)\u003c/strong\u003e GPX, glutathione peroxidase; \u003cstrong\u003e(B)\u003c/strong\u003e SOD, superoxide dismutase; \u003cstrong\u003e(C)\u003c/strong\u003e CAT, catalase; \u003cstrong\u003e(D)\u003c/strong\u003e OCL, occludin; \u003cstrong\u003e(E)\u003c/strong\u003e ZO-1, zonula occludens-1; \u003cstrong\u003e(F)\u003c/strong\u003e IFN-γ, interferon gamma; \u003cstrong\u003e(G)\u003c/strong\u003e TNF-α, tumor necrosis factor alpha; \u003cstrong\u003e(H)\u003c/strong\u003e IL1- β, interleukin 1 beta; \u003cstrong\u003e(I)\u003c/strong\u003eIL-10, interleukin 10.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-4112899/v1/723278a25d632a34d1acfbad.png"},{"id":57115332,"identity":"de769e47-03e8-4fd7-a76b-3c8a24123b94","added_by":"auto","created_at":"2024-05-25 00:33:53","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1384079,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4112899/v1/cf0e942d-d22e-4863-a9c5-bca82dd5c46e.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Autolyzed yeast and sodium butyrate supplemented alone to diets promoted improvements in performance, intestinal health and nutrient transporter in weaned piglets","fulltext":[{"header":"Introduction","content":"\u003cp\u003eWeaning is considered the \u0026ldquo;critical window\u0026rdquo; in the piglet\u0026rsquo;s life because it is associated with several stress factors, such as loss of contact with the mother and original litter, solid diet, environmental and structural changes, and the establishment of a new hierarchy\u003csup\u003e1,2\u003c/sup\u003e. Abrupt separation from the sow and dietary transition are critical events causing intestinal challenges and compromising immune functions affecting growth of pigs\u003csup\u003e3,4\u003c/sup\u003e. Dietary interventions with various functional additives have been introduced and implemented to cope with challenges to the intestine and immune functions upon weaning. Nucleotides\u003csup\u003e5,6\u003c/sup\u003e, yeast\u003csup\u003e7,8\u003c/sup\u003e and organic acids\u003csup\u003e9,10\u003c/sup\u003e have appeared on the market as feeding strategies to improve intestinal health and, consequently, promote better growth performance of weaned piglets. Globally, their use as in-feed additives in pig diets has become more frequent, especially during the weaning period\u003csup\u003e11,12\u003c/sup\u003e. However, factors such as the form of supplementation, the type of additive, and the site of action make each application unique and complex in animal responses and should be better understood in studies involving pigs fed different feed additives\u003csup\u003e13,14,15\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eNucleotides are monomers that serve as building blocks of nucleic acids (DNA and RNA) and are synthesized by animals through the \u003cem\u003ede novo\u003c/em\u003e pathway or the salvage pathway. These monomers function as physiological mediators, coenzyme components, and contributors to cell growth and division and are crucial to the rapid proliferation of intestinal mucosa cells and immune cells\u003csup\u003e16,17\u003c/sup\u003e. Thus, the supplementation of nucleotides to the diet can bring benefits in periods of rapid growth and development (e.g. digestive organs, immune systems, cell renewal) helping in circumstances associated with intestinal injuries and stress, such as post-weaning period\u003csup\u003e5,6\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThe lysed yeast (\u003cem\u003eS. cerevisiae\u003c/em\u003e) contains in the cell wall a complex polymer and is composed of β-glucans, α-mannans, mannoproteins, and a minor component of chitin\u003csup\u003e18\u003c/sup\u003e, in addition, the cytoplasm contains B complex vitamins, highly digestible proteins and free amino acids\u003csup\u003e15\u003c/sup\u003e. However, monogastric animals do not have enzymes to digest polysaccharides such as those present in the yeast cell wall, therefore, the breakdown of yeast cell wall by lysing would improve the bioavailability of yeast components for animal nutrition\u003csup\u003e7\u003c/sup\u003e. The major polysaccharide constituents of the yeast cell wall, β-glucans and α-mannans, have been recognized to be capable of modulation of the mucosa immune system, promoting beneficial effects on pig health (e.g. inhibition of pathogen adhesion to gastrointestinal epithelial tissue and stimulation of immunocompetent cells in Peyer's patches)\u003csup\u003e19,20\u003c/sup\u003e. Thus, yeast products, mainly based on \u003cem\u003eS. cerevisiae\u003c/em\u003e, are widely used as feed additives.\u003c/p\u003e \u003cp\u003eOrganic acids (e.g. sodium butyrate) act by reducing the pH of digesta in the gastrointestinal tract, stimulating the activity of digestive enzymes, inhibiting the proliferation of pathogenic bacteria, and improving the digestibility of nutrients\u003csup\u003e9,21\u003c/sup\u003e. Sodium butyrate is a short-chain fatty acid that acts by improving villus height, decreasing crypt, and improving the expression of tight junction protein in the gut\u003csup\u003e14\u003c/sup\u003e. As a result, it beneficially affects the reabsorption of fluids and electrolytes which is associated with reduced diarrhea\u003csup\u003e22\u003c/sup\u003e, moreover modulating intestinal permeability will reduce translocation of intraluminal toxins and antigens from the lumen into subepithelial tissues and systemic blood circulation\u003csup\u003e23\u003c/sup\u003e. Together with improving gut health, the ability of sodium butyrate to alleviate oxidative stress and improve immunological profile will result in improved pig weight gain\u003csup\u003e22,14,24\u003c/sup\u003e. However, free organic acids dissociate and lose most of their antibacterial capacity before reaching the distal part of the digestive system\u003csup\u003e25\u003c/sup\u003e. Therefore, sodium butyrate in encapsulated form allows progressive reach to the distal parts of the gastrointestinal tract without being fully dissociated, because the product is gradually released compared to an uncoated product\u003csup\u003e10\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eIn view of the above, the hypothesis of the study was that the dietary supplementation of purified nucleotide, lysed yeast (\u003cem\u003eS. cerevisiae\u003c/em\u003e ), or encapsulated sodium butyrate would improve the growth performance of weaned piglets by beneficially stimulating the immune response and supporting intestinal physiological and health functions. Therefore, the objective of this study was to evaluate the effects of purified nucleotide, lysed yeast, and sodium butyrate in diets for nursery pigs on growth performance, diarrhea incidence, blood profile, intestinal morphology, mRNA expression of nutrients transporter, inflammatory markers, antioxidant profile, and tight junction proteins.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eGrowth performance\u003c/h2\u003e \u003cp\u003eDuring phase 1 (21 to 32 d), pigs fed YSC or ASB diets showed (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) improvements in ADG, FC, and BW compared with pigs fed CON diet; however, ADFI was not affected by dietary treatments (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). In phase 2 (32 to 45 d), pigs fed ASB diet had higher (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) BW compared to pigs fed CON diet. In addition, there was a trend to increase the BW (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.095) in pigs fed YSC diet compared to those fed CON diet. Pigs fed NUC diet tended to present lower ADG (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.080). However, FC was not affected by dietary treatments. During the overall period, ADG was higher (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in pigs fed ASB diet than those with CON diet. In addition, FC was better (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and a trend was observed to improve ADG (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.095) in pigs fed YSC diet compared with pigs on CON diet. Moreover, ADFI was not affected by dietary treatments.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eGrowth performance of piglets fed diets supplemented or not with feed additives (n\u0026thinsp;=\u0026thinsp;9 pens replicates per dietary treatment and 5 piglets per pen as an experimental unit). \u003csup\u003ea\u003c/sup\u003eAverage daily feed intake (ADFI, g/d), average daily weight gain (ADG, g/d), feed conversion ratio (FC, g:g). \u003csup\u003eb\u003c/sup\u003eDietary treatment: phase 1 (21 to 32 d) and phase 2(32 to 45 d), respectively: (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e) CON: control, basal diet, (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e) NUC: CON\u0026thinsp;+\u0026thinsp;1 g/kg and 0.5 g/kg of nucleotides (Nucleobase 1.5, Aleris Animal Nutrition, Jundia\u0026iacute;, SP, Brazil), (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e) YSC: CON\u0026thinsp;+\u0026thinsp;20 g/kg and 10 g/kg of lysed yeast \u003cem\u003eS. cerevisiae\u003c/em\u003e (Sinergis, Aleris Animal Nutrition, Brazil), (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e) ASB: CON\u0026thinsp;+\u0026thinsp;1.5 g/kg and 1 g/kg of acidifier sodium butyrate (Nuttritiva B90CNa, Additiva Nutrition, Monte Alegre do Sul, SP, Brazil). \u003csup\u003ec\u003c/sup\u003ePooled standard error of the mean.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"9\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eItem\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"4\" nameend=\"c5\" namest=\"c2\"\u003e \u003cp\u003eDietary treatment\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eSEM\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c9\" namest=\"c7\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e-value\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCON\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNUC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eYSC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eASB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCON \u0026times;\u003c/p\u003e \u003cp\u003eNUC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eCON \u0026times;\u003c/p\u003e \u003cp\u003eYSC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eCON \u0026times;\u003c/p\u003e \u003cp\u003eASB\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBody weight, kg\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eInitial\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5.22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5.22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5.22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5.22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e32 d of age\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e6.83\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e6.89\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e7.18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e7.18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.693\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.034\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.031\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e45 d of age\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e12.64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e12.36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e13.12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e13.32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.321\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.095\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.019\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePhase 1, 21 to 32 d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eADFI, g/d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e296\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e286\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e281\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e302\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e7.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.319\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.133\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.546\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eADG, g/d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e146\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e152\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e178\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e178\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e10.08\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.687\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.035\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.030\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFC, g/g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.61\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.74\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.549\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.010\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.034\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePhase 2, 32 to 45 d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eADFI, g/d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e627\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e600\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e638\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e668\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e17.35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.263\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.678\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.105\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eADG, g/d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e486\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e454\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e494\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e510\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e12.57\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.080\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.674\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.187\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFC, g/g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.336\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.940\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.602\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOverall period\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eADFI, g/d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e449\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e431\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e448\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e473\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e10.88\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.237\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.902\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.141\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eADG, g/d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e309\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e297\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e329\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e337\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e8.20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.326\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.095\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.019\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFC, g/g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.848\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.010\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.103\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eDiarrhea incidence\u003c/h2\u003e \u003cp\u003eThere was a trend to reduce the diarrhea incidence (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.098) in pigs fed NUC diet and improved fecal score (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.090) in pigs fed YSC diet than pigs fed CON diet in the phase 1 (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). In phase 2, there was a trend to reduce the diarrhea incidence (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.089) and improved fecal score (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.091) in pigs fed YSC diet than in those fed CON diet.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eDiarrhea incidence and fecal score of piglets fed diets supplemented or not with feed additives (n\u0026thinsp;=\u0026thinsp;9 pens replicate per dietary treatment and 5 piglets per pen as an experimental unit). \u003csup\u003ea\u003c/sup\u003eDietary treatment: phase 1 (24 to 32 d) and phase 2 (32 to 45 d), respectively: (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e) CON: control, basal diet, (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e) NUC: CON\u0026thinsp;+\u0026thinsp;1 g/kg and 0.5 g/kg of nucleotides (Nucleobase 1.5, Aleris Animal Nutrition, Jundia\u0026iacute;, SP, Brazil), (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e) YSC: CON\u0026thinsp;+\u0026thinsp;20 g/kg and 10 g/kg of lysed yeast \u003cem\u003eS. cerevisiae\u003c/em\u003e (Sinergis, Aleris Animal Nutrition, Brazil), (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e) ASB: CON\u0026thinsp;+\u0026thinsp;1.5 g/kg and 1 g/kg of acidifier sodium butyrate (Nuttritiva B90CNa, Additiva Nutrition, Monte Alegre do Sul, SP, Brazil). \u003csup\u003eb\u003c/sup\u003ePooled standard error of the mean.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"9\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eItem\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"4\" nameend=\"c5\" namest=\"c2\"\u003e \u003cp\u003eDietary treatment\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eSEM\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c9\" namest=\"c7\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e-value\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCON\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNUC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eYSC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eASB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCON \u0026times;\u003c/p\u003e \u003cp\u003eNUC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eCON \u0026times;\u003c/p\u003e \u003cp\u003eYSC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eCON \u0026times;\u003c/p\u003e \u003cp\u003eASB\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePhase 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDiarrhea incidence, %\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e20.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e12.10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e14.33\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e15.56\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e3.28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.098\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.230\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.345\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFecal score\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.80\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.61\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.69\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.161\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.090\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.341\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePhase 2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDiarrhea incidence, %\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e15.50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e16.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e6.70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e7.16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e3.55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.927\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.089\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.106\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFecal score\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.37\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.516\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.091\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.193\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eBlood profile\u003c/h2\u003e \u003cp\u003eThere was no effect of dietary treatments on IgG, creatinine, and urea concentrations (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eBlood profile of piglets fed diets supplemented or not with feed additives on d 32 (n\u0026thinsp;=\u0026thinsp;9 pigs replicates per dietary treatment). \u003csup\u003ea\u003c/sup\u003eDietary treatment: CON, control, basal diet; NUC, CON\u0026thinsp;+\u0026thinsp;1 g/kg of nucleotides (Nucleobase 1.5, Aleris Animal Nutrition, Jundia\u0026iacute;, SP, Brazil); YSC, CON\u0026thinsp;+\u0026thinsp;20 g/kg of lysed yeast \u003cem\u003eS. cerevisiae\u003c/em\u003e (Sinergis, Aleris Animal Nutrition, Brazil); ASB: CON\u0026thinsp;+\u0026thinsp;1.5 g/kg of acidifier sodium butyrate (Nuttritiva B90CNa, Additiva Nutrition, Monte Alegre do Sul, SP, Brazil). \u003csup\u003eb\u003c/sup\u003ePooled standard error of the mean.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"9\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eItem\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"4\" nameend=\"c5\" namest=\"c2\"\u003e \u003cp\u003eDietary treatment\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eSEM\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c9\" namest=\"c7\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e-value\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCON\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNUC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eYSC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eASB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCON \u0026times;\u003c/p\u003e \u003cp\u003eNUC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eCON \u0026times;\u003c/p\u003e \u003cp\u003eYSC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eCON \u0026times;\u003c/p\u003e \u003cp\u003eASB\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eUrea, mg/dL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e16.55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e16.89\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e15.55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e13.11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e1.58\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.882\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.658\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.133\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCreatinine, mg/dL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.68\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.66\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.416\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.330\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.458\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIgG, mg/dL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e272.74\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e306.67\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e266.07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e273.69\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e23.42\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.157\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.777\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.968\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eIntestinal morphology\u003c/h2\u003e \u003cp\u003eDietary treatments had no effects on villus height, crypt depth, villus:crypt ratio, and proportion of goblet cells in the duodenum and jejunum (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). In the ileum, the dietary treatments had no effects on crypt depth and proportion of goblet cells. However, villus height was increased (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) and villus:crypt ratio trended to increase (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.066) in pigs fed ASB diet than pigs fed CON diet. In addition, the number of Peyer\u0026rsquo;s patches in pigs fed YSC or ASB diets was lower (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) compared to pigs that received CON diet. There was a trend towards an increase (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.071) villus height and reduce (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.078) the number of Peyer\u0026rsquo;s patches in pigs fed NUC diet than those fed the CON diet.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eIntestinal morphology of piglets fed diets supplemented or not with feed additives on d 32 (n\u0026thinsp;=\u0026thinsp;9 pigs replicates per dietary treatment). \u003csup\u003ea\u003c/sup\u003eDietary treatment: CON, control, basal diet; NUC, CON\u0026thinsp;+\u0026thinsp;1 g/kg of nucleotides (Nucleobase 1.5, Aleris Animal Nutrition, Jundia\u0026iacute;, SP, Brazil); YSC, CON\u0026thinsp;+\u0026thinsp;20 g/kg of lysed yeast \u003cem\u003eS. cerevisiae\u003c/em\u003e (Sinergis, Aleris Animal Nutrition, Brazil); ASB: CON\u0026thinsp;+\u0026thinsp;1.5 g/kg of acidifier sodium butyrate (Nuttritiva B90CNa, Additiva Nutrition, Monte Alegre do Sul, SP, Brazil). \u003csup\u003eb\u003c/sup\u003ePooled standard error of the mean.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"9\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eItem\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"4\" nameend=\"c5\" namest=\"c2\"\u003e \u003cp\u003eDietary treatment\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eSEM\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c9\" namest=\"c7\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e-value\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCON\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNUC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eYSC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eASB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCON \u0026times;\u003c/p\u003e \u003cp\u003eNUC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eCON \u0026times;\u003c/p\u003e \u003cp\u003eYSC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eCON \u0026times;\u003c/p\u003e \u003cp\u003eASB\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDuodenum\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVillus height, \u0026micro;m\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e307\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e297\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e298\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e300\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e19.09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.662\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.689\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.753\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCrypt depth, \u0026micro;m\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e178\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e176\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e182\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e177\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e9.23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.840\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.761\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.926\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVillus:crypt ratio\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.63\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.08\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.812\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.387\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.857\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGoblet cells, %\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e32.50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e34.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e33.51\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e36.79\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e3.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.656\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.790\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.227\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eJejunum\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVillus height, \u0026micro;m\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e264\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e255\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e261\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e268\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e24.09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.771\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.922\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.880\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCrypt depth, \u0026micro;m\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e150\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e139\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e143\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e157\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e11.12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.474\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.640\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.590\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVillus:crypt ratio\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.80\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.83\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.82\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.804\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.851\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.486\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGoblet cells, %\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e23.15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e24.62\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e25.16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e22.79\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e2.76\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.683\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.562\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.912\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIleum\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVillus height, \u0026micro;m\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e210\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e241\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e234\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e255\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e12.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.071\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.150\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.010\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCrypt depth, \u0026micro;m\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e132\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e139\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e138\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e138\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e9.17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.534\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.573\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.576\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVillus:crypt ratio\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.66\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.69\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.81\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.896\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.603\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.066\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGoblet cells, %\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e50.43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e53.07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e46.65\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e45.94\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4.59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.661\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.514\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.405\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePeyer\u0026rsquo;s patches, n\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e3.33\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.078\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.042\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.017\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003emRNA relative abundance of nutrient transporters\u003c/h2\u003e \u003cp\u003eIn the jejunum, there was no effect of dietary treatments on the mRNA expression of GLUT2, EAAC1, and y\u003csup\u003e+\u003c/sup\u003eLAT1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). However, mRNA expression of SMCT2 and PepT1 was higher (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in pigs fed YSC diet compared to pigs fed CON diet. The mRNA expression of MCT1 in pigs fed ASB and YSC diets was higher (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) than in those fed CON diet. In addition, SGLT1 mRNA expression in pigs fed ASB diet was higher (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and YSC diet (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.055) trended upwards compared to pigs fed CON diet.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003emRNA relative abundance of inflammatory and antioxidants markers, and tight junction proteins\u003c/h2\u003e \u003cp\u003eThere was no effect of dietary treatments on the mRNA expression of CAT, IFN-γ, and IL-10 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). However, mRNA expression of GPX, OCL, and ZO-1 was higher (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in pigs fed YSC or ASB diets compared to pigs fed CON diet. The mRNA expression of SOD in pigs fed ASB diet, and IL1-β in pigs fed YSC diet was higher (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) than in those fed CON diet. In addition, TNF-α mRNA expression in pigs fed YSC diet (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.082) and ASB diet (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.061) trended upwards compared to pigs fed CON diet. There was a downward trend (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.058) in IL1-β mRNA expression of pigs fed NUC diet than pigs that received CON diet.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe hypothesis of the current experiment was that the dietary supplementation of purified nucleotide, \u003cem\u003eS. cerevisiae\u003c/em\u003e yeast, or encapsulated acidifier sodium butyrate would improve the growth performance of weaned piglets and beneficially affect gut parameters. The present results showed that feeding nursery pigs with YSC or ASB diets increased growth performance and improved gut health, whereas no improvements were observed feeding the NUC diet.\u003c/p\u003e \u003cp\u003eAlthough nucleotides can be synthesized from other precursors in pigs\u0026rsquo; diets, in the post-weaning a stressful and limited nutrient intake period, nucleotides could be considered an essential nutrient\u003csup\u003e6\u003c/sup\u003e. However, in the present study, performance was not influenced by NUC diet, while others have reported positive effects of nucleotide supplementation on piglet growth performance\u003csup\u003e26,27\u003c/sup\u003e and feed intake\u003csup\u003e5\u003c/sup\u003e. The NUC diets correspond to 100 mg nucleotides/kg diet in phase 1 and 75 mg nucleotides/kg in phase 2 in a 24-d trial and were fed purified. On the other side, Superchi et al.\u003csup\u003e26\u003c/sup\u003e used a nucleotide yeast-derived source that also contains viable cells, cell wall components, inositol, and functional amino acids. Weaver and Kim\u003csup\u003e27\u003c/sup\u003e demonstrated improved growth performance with up to 1,000 mg nucleotides/kg during a 28-d trial. Working with different levels of nucleotides (0, 50, 150, 250, and 500 mg/kg) in a 20-d trial with one pig per pen, Jang and Kim\u003csup\u003e5\u003c/sup\u003e only found significant improvements in the feed intake, and when feeding the lower supplementation levels (50 and 150 mg/kg). Thus, the discrepancies in growth performance results between studies are justified due to the different sources, the different dosages used, and administration time.\u003c/p\u003e \u003cp\u003eRegarding the YSC diet, the improved growth performance results are attributed to the improvements in intestinal health promoted by the supplementation of \u003cem\u003eS. cerevisiae\u003c/em\u003e yeast. This additive contains high amounts of highly digestible protein, essential amino acids, nucleotides, mannanoligosaccharides, and β-glucans\u003csup\u003e15\u003c/sup\u003e. These components present in yeast may have anti-inflammatory properties to reduce intestinal inflammation and, consequently, minimize diarrheal disorders (as observed in the current study) and nutrient malabsorption\u003csup\u003e1\u003c/sup\u003e. According to Kogan and Kocher\u003csup\u003e19\u003c/sup\u003e, β-glucans are capable of blocking fimbriae of pathogenic bacteria and preventing their adhesion to the epithelium of the intestinal mucosa, acting to prevent or eliminate infection. Yeast-based additives support the immune system of piglets by modulating the intestinal microbiota\u003csup\u003e28\u003c/sup\u003e, which may contribute to improve growth performance\u003csup\u003e29\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eAn increase in nutrient digestibility as reported by Barbosa et al.\u003csup\u003e30\u003c/sup\u003e and Boontiam et al.\u003csup\u003e8\u003c/sup\u003e is another mechanism by which yeast supplementation in nursery pigs\u0026rsquo; diets can improve the growth performance. Nutrient transporters are proteins expressed in the apical membrane of intestinal cells that absorb nutrients and, therefore, it is possible to improve digestibility by increasing the expression of these transporters\u003csup\u003e31\u003c/sup\u003e. This is supported by the results of our study, which showed increased mRNA expression of nutrient transporters (SGLT1, SMCT2, MCT1, and PepT1) in the jejunum of pigs. The SGLT1 is responsible for glucose absorption, while PepT1 acts on peptide absorption. The increase in the expression of these transporters suggested that there was greater availability of glucose and amino acids at the cellular level, in agreement with the findings by Clarke et al.\u003csup\u003e31\u003c/sup\u003e. Similarly, the increased expression of SMCT2 and MCT1 indicated a greater availability of monocarboxylates (e.g. lactate, short-chain fatty acids, and ketone bodies)\u003csup\u003e32\u003c/sup\u003e, which represent substrates for maintaining the energetic state in cells like the enterocytes.\u003c/p\u003e \u003cp\u003eRegarding the ASB diet, the improvement in growth performance is supported by the increase in SGLT1 and MCT1 mRNA expression in the jejunum of nursery pigs. The MCT1 is expressed in both the small and large intestines, and its function is to transport butyrate into the cell\u003csup\u003e33\u003c/sup\u003e. However, in the small intestine, microbial butyrate formation is low or absent\u003csup\u003e34\u003c/sup\u003e, but the addition of butyrate to diets exerts trophic effects\u003csup\u003e35\u003c/sup\u003e and stimulates the secretion of digestive enzymes\u003csup\u003e21\u003c/sup\u003e, and this can result in more efficient digestion and absorption of dietary nutrients, leading to improved performance. Furthermore, butyrate is a source of energy for enterocytes and additionally has an antiapoptotic effect\u003csup\u003e33\u003c/sup\u003e. Therefore, greater MCT1 and SGLT1 expression may enhance the absorption of nutrients and energy to cope with post-weaning stress\u003csup\u003e36\u003c/sup\u003e. In the present study, sodium butyrate was added in encapsulated form (composed of a vegetable fat-based coating material) to be enzymatically broken down by lipase secreted in the duodenum, as mentioned by Maito et al.\u003csup\u003e10\u003c/sup\u003e. According to Tugnoli et al.\u003csup\u003e25\u003c/sup\u003e, the encapsulation process provides protection that allows a gradual release of the acidifier along the length of the gastrointestinal tract, reducing the dissociation in the stomach and maintaining their efficacy in jejunum and ileum.\u003c/p\u003e \u003cp\u003eThe weaning transition promotes physiological changes in the structural and functional aspects of the intestine, causing villous atrophy and increased crypt depth, which in turn reduces the small intestine capacity to absorb nutrients\u003csup\u003e3\u003c/sup\u003e. In the present study, villus height and villus:crypt ratio in the ileum were higher in pigs fed the ASB diet, indicating improvement in intestinal morphology. Moreover, a greater abundance of jejunal mucosal barrier function-related genes (OCL and ZO-1) was observed in pigs fed the ASB diet. These results indicated that ASB diet was efficient in the structural maintenance of the small intestine, as suggested by others\u003csup\u003e35\u003c/sup\u003e. The gradual release of sodium butyrate throughout the intestinal tract seems to be critical in achieving the expected target\u003csup\u003e9\u003c/sup\u003e, allowing the additive to affect different portions of the intestine such as jejunum and ileum. According to Guilloteau et al.\u003csup\u003e33\u003c/sup\u003e, supplementation with sodium butyrate stimulates the proliferation of epithelial cells, resulting in a greater absorption surface and preservation of villi length, reflecting the improvements observed in growth performance of pigs.\u003c/p\u003e \u003cp\u003eA greater abundance of jejunal OCL and ZO-1 mRNA expression was also observed in pigs fed the YSC. According to Rose et al.\u003csup\u003e37\u003c/sup\u003e, OCL and ZO-1 are classified as intestinal junction proteins with a role in regulating epithelial permeability. Decreased intestinal permeability can be correlated with reduced oxidative stress, because this results in attenuation of damage to the intestinal mucosal barrier\u003csup\u003e14\u003c/sup\u003e. Oxidative stress is a physiological stage in which antioxidant defense is inadequate to detoxify the reactive oxygen species, this oxidative process damages essential biomolecules, leading to reduced growth performance\u003csup\u003e29\u003c/sup\u003e. The GPX and SOD as the key enzymes of the antioxidant system play a crucial role in eliminating free radicals, reducing oxidative damage, and maintaining cell structure is well known\u003csup\u003e38\u003c/sup\u003e. In our study, in addition to the increase in the expression of tight junction proteins, pigs fed the ASB and YSC diet had greater expression of GPX and SOD mRNA. These results suggested that nursery pigs fed with additives had greater antioxidant capacity than those fed the CON diet, demonstrating that there was an improvement in the intestinal redox state.\u003c/p\u003e \u003cp\u003eThe impacts of weaning stress are not only limited to intestinal barrier function and oxidative stress, but an increase in the activation of the immune system in weaned piglets is also observed\u003csup\u003e3\u003c/sup\u003e. An unregulated enhanced immune response may trigger a negative effect on other metabolic processes and as a result impair growth performance\u003csup\u003e39\u003c/sup\u003e. Peyer's patches are the major organized lymphoid structures involved in the induction of mucosal immune responses in the intestine\u003csup\u003e40\u003c/sup\u003e. In the present study, a reduction in Peyer's patch counts was observed in the ileum of pigs fed YSC or ASB diet. This suggested that there was less induction of the mucosal immune system in pigs that received YSC and ASB diets and, consequently, less stimulus to the immune system because Peyer's patches can be considered as immunological sensors of the intestine\u003csup\u003e41\u003c/sup\u003e. These results suggested that both yeast and sodium butyrate could help enhance the small intestine epithelial barrier, antioxidant capacity, and immune system. Thus, the enhancement of overall gut health helps explain the improvement in the growth performance of pigs fed YSC and ASB diets.\u003c/p\u003e \u003cp\u003eRegarding the production of pro-inflammatory cytokines, it was found that pigs fed the YSC diet showed an increase in IL1-β mRNA expression and a tendency to increase TNF-α, while piglets fed the ASB diet showed a tendency to increase TNF-α mRNA expression. On the other hand, pigs fed the NUC diet had a tendency to reduce IL1-β mRNA expression. Nucleotides, yeast, and acidifier-based additives can improve pig immune responses in the post-weaning period\u003csup\u003e16\u003c/sup\u003e. These additives can activate immune cells, including macrophages, which produce IL-1β as part of the immune response\u003csup\u003e42, 43\u003c/sup\u003e. The results of the present study indicated a sustained condition of immune response, because in some cases, a controlled and transient increase in IL-1β may be part of a healthy immune response to support the ability of pigs to fight infections or maintain intestinal health\u003csup\u003e18\u003c/sup\u003e. According to Grimble\u003csup\u003e39\u003c/sup\u003e, it is considered beneficial the presence of cytokines (e.g. IL-1β and TNF-α) in adequate concentrations during an inflammatory response to infection. It is important to avoid overstimulation of the immune system, as greater expression of pro-inflammatory cytokines can trigger pathological responses in inflammatory conditions\u003csup\u003e44\u003c/sup\u003e. However, in a previous study, it was observed that TNF-α increases the expression of specific anti-apoptotic proteins, as well as triggers the expression of the survival gene BCL2A1 (not evaluated in the current study) in the intestine of weaned piglets\u003csup\u003e45\u003c/sup\u003e. Also, the β-glucans present in yeast are recognized by specific receptors (pattern recognition receptors) on immune cells, such as macrophages and neutrophils. In particular, they are recognized by the dectin-1 receptor\u003csup\u003e46\u003c/sup\u003e. Once β-glucans bind to these receptors, they can trigger an immune response. Upon recognition of β-glucans, immune cells can produce pro-inflammatory cytokines, such as TNF-α, and IL-1β\u003csup\u003e47\u003c/sup\u003e. Collectively, although these cytokines play a central role in initiating and magnifying the inflammatory response, they did not negatively affect the biological response of nursery pigs fed YSC and ASB diets.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eBased on the evaluated criteria, dietary supplementation of autolyzed yeast \u003cem\u003eS. cerevisiae\u003c/em\u003e or sodium butyrate promotes better growth performance by improving the integrity of the intestinal barrier, the mRNA expression of nutrient transporters and antioxidant enzymes in the jejunum of nursery pigs, but without major differences in intestinal morphology in those fed with \u003cem\u003eS. cerevisiae\u003c/em\u003e yeast. Furthermore, none of the dietary treatments promoted changes in blood metabolites, but a diet containing \u003cem\u003eS. cerevisiae\u003c/em\u003e yeast or sodium butyrate provided a sustained immune response in the jejunum of nursery pigs. On the other hand, dietary nucleotide supplementation did not improve growth performance and gut health.\u003c/p\u003e"},{"header":"Material and Methods","content":"\u003cp\u003e The experimental protocol follows the ethical principles in animal research (CONCEA, 2016) and was approved by the Ethical Committee on Animal Use of Universidade Federal de Vi\u0026ccedil;osa, under protocol n\u0026ordm; 0110/2022. All methods were carried out in accordance with relevant guidelines and regulations. All methods were reported in accordance with ARRIVE guidelines (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://arriveguidelines.org/arrive-guidelines\u003c/span\u003e\u003cspan address=\"https://arriveguidelines.org/arrive-guidelines\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eAnimals, experimental design, housing, and diets\u003c/h2\u003e \u003cp\u003eThe experiment was conducted on a commercial farm in the municipality of Santo Ant\u0026ocirc;nio do Grama, MG, Brazil. A total of 180 piglets [PIC 337 (Large White \u0026times; Landrace \u0026times; Duroc \u0026times; Pietrain) \u0026times; DB 90 (Large White \u0026times; Landrace)] castrated males and females, weaned at 21 d-old and with 5.17\u0026thinsp;\u0026plusmn;\u0026thinsp;0.57 kg BW were used in a 24-d trial. Piglets were assigned to a randomized block design based on their initial BW (light and heavy) into 4 dietary treatments and 9 pens replicates (5 pigs/pen).\u003c/p\u003e \u003cp\u003eThe experiment was conducted only in one series, without an adaptation period. The pigs were housed in suspended pens (1.75 \u0026times; 1.00 m, 0.35 m\u0026sup2;/pig), with a plastic floor, semi-automatic feeders and nipple drinkers, with free access to diet and water. The minimum and maximum temperatures in the nursery room were 22.9\u0026thinsp;\u0026plusmn;\u0026thinsp;1.50\u0026ordm;C and 31.8\u0026thinsp;\u0026plusmn;\u0026thinsp;2.54\u0026ordm;C, respectively.\u003c/p\u003e \u003cp\u003ePigs were fed in a two-phase feeding regimen (phase 1: 21 to 32 d, and phase 2: 32 to 45 d). All diets were corn and soybean meal-based with industrial amino acids and formulated according to the nutritional recommendations of the Brazilian Tables for Poultry and Swine\u003csup\u003e48\u003c/sup\u003e (Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e), and provided in mash form. During phases 1 and 2, the dietary treatments consisted, respectively, of: (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e) CON: control, basal diet, (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e) NUC: CON\u0026thinsp;+\u0026thinsp;1 g/kg and 0.5 g/kg of nucleotides, (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e) YSC: CON\u0026thinsp;+\u0026thinsp;20 g/kg and 10 g/kg of lysed yeast \u003cem\u003eS. cerevisiae\u003c/em\u003e, (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e) ASB: CON\u0026thinsp;+\u0026thinsp;1.5 g/kg and 1 g/kg of acidifier sodium butyrate. Feed additives were added in replacement with inert in the CON based on the manufacturer's recommendations.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eIngredients and chemical composition of control diets fed to nursery piglets (g/kg, as-fed basis). \u003csup\u003ea\u003c/sup\u003eFeed additives were included as a replacement for the inert in the diet. Phase 1 (21 to 32 d) and phase 2(32 to 45 d), respectively: (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e) CON: control, basal diet, (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e) NUC: CON\u0026thinsp;+\u0026thinsp;1 g/kg and 0.5 g/kg of nucleotides (Nucleobase 1.5, Aleris Animal Nutrition, Jundia\u0026iacute;, SP, Brazil), (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e) YSC: CON\u0026thinsp;+\u0026thinsp;20 g/kg and 10 g/kg of lysed yeast \u003cem\u003eS. cerevisiae\u003c/em\u003e (Sinergis, Aleris Animal Nutrition, Brazil), (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e) ASB: CON\u0026thinsp;+\u0026thinsp;1.5 g/kg and 1 g/kg of acidifier sodium butyrate (Nuttritiva B90CNa, Additiva Nutrition, Monte Alegre do Sul, SP, Brazil). \u003csup\u003eb\u003c/sup\u003eComposition per kg of diet: vitamin A, 12,000 IU; vitamin D\u003csub\u003e3\u003c/sub\u003e, 2,250 IU; vitamin E, 65 IU; vitamin K, 3 mg; thiamine, 2.25 mg; riboflavin, 6 mg; pyridoxine, 2.25 mg; vitamin B\u003csub\u003e12\u003c/sub\u003e, 27 mcg; folic acid, 400 mcg; biotin, 150 mcg; pantothenic acid, 22.5 mg; niacin, 45 mg; copper sulfate, 10 mg; iodine, 1.5 mg; iron sulfate, 100 mg; manganese sulfate, 40 mg; sodium selenite, 0,3 mg; zinc oxide, 100 mg. \u003csup\u003ec\u003c/sup\u003eNatuphos\u0026reg;, Basf enzyme. \u003csup\u003ed\u003c/sup\u003eStandardized ileal digestible.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eItem\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePhase 1\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003ePhase 2\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e21 to 32 d\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e32 to 45 d\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGround corn, 7.8% CP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e388.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e470.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSoybean meal, 46.0% CP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e219.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e242.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDried whey, 12.5% CP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e150.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSoybean micronized, 36.0% CP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e100.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e70.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eExtrude corn, 7.6% CP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e20.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e20.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePlasma protein, 78.0% CP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e20.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e10.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSugar\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e30.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e30.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eInert (kaolin)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e20.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e10.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDicalcium phosphate\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e9.35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e10.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLimestone calcitic\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e7.69\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e7.34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSoybean oil\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e15.93\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e11.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eZinc oxide\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e2.50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCholine chloride\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e1.95\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eL-lys, 78.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e4.69\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4,45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDL-met, 99.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e2.32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.96\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eL-thr, 98.5%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e2.30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eL-trp, 99.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e0.32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eL-val, 96.5%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e1.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.76\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSalt\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e1.90\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCopper sulfate\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e0.60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVitamin-mineral premix\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e1.40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePhytase\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e0.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBHT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e0.10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"4\" nameend=\"c4\" namest=\"c1\"\u003e \u003cp\u003eCalculated composition\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eME, kcal/kg\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e3,400\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3,375\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCrude protein, g/kg\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e213.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e213.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSID\u003csup\u003ed\u003c/sup\u003e lys, g/kg\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e14.50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e13.46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSID met, g/kg\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e4.90\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSID met\u0026thinsp;+\u0026thinsp;cys, g/kg\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e8.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e7.54\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSID thr, g/kg\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e9.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e9.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSID trp, g/kg\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e2.76\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.56\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSID val, g/kg\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e10.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e9.29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSID ile, g/kg\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e8.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e7.70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal Ca, g/kg\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e8.50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAvailable P, g/kg\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e5.19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal Na, g/kg\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e2.80\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLactose, g/kg\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e112.50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e75.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eComposition of feed additives\u003c/h2\u003e \u003cp\u003eThe source of nucleotides (Nucleobase 1.5, Aleris Animal Nutrition, Jundia\u0026iacute;, SP, Brazil) obtained from yeast extract purified with autolyzed yeast, contained 15% free nucleotides and 85% vehicle, corresponding to 100 mg free nucleotides/kg diet (phase 1) and 75 mg free nucleotides/kg (phase 2). The yeast source (Sinergis, Aleris Animal Nutrition, Brazil) contained 100% autolyzed yeast \u003cem\u003eS. cerevisiae.\u003c/em\u003e The acidifier source (Nuttritiva B90CNa, Additiva Nutrition, Monte Alegre do Sul, SP, Brazil) contained 90% sodium butyrate in the form of a protected and encapsulated salt with palm oil, microgranulated, corresponding to 1.35 g sodium butyrate/kg diet (phase 1) and 0.90 g sodium butyrate/kg diet (phase 2).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eGrowth performance and diarrhea incidence\u003c/h2\u003e \u003cp\u003eThroughout the trial, the offered diet and leftovers were weighed to calculate average daily feed intake (ADFI). Pigs were individually weighed on d 21, 32, and 45 to determine BW, average daily weight gain (ADG), and feed conversion (FC). The fecal consistency of each pig was visually assessed during phase 1 (24 to 32 d) and phase 2 (32 to 45 d), using the method described by Liu et al.\u003csup\u003e49\u003c/sup\u003e. Fresh feces were ranked on a 4-point scale as follows: 0\u0026thinsp;=\u0026thinsp;solid, 1\u0026thinsp;=\u0026thinsp;semi-solid, 2\u0026thinsp;=\u0026thinsp;semi-liquid, and 3\u0026thinsp;=\u0026thinsp;liquid. The diarrhea incidence was defined as the consistency of feces at scale 2 or 3 for 2 continuous days. The diarrhea incidence for the pigs was calculated as follows: diarrhea incidence (%) = [(the number of pigs with diarrhea in each pen \u0026times; number of days of diarrhea) \u0026divide; (total number of pigs in each pen \u0026times; number of days)] \u0026times; 100%. Observations were made in the morning, every day throughout the experimental period by a trained evaluator.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eSample collection\u003c/h2\u003e \u003cp\u003eAt 32 d-old, blood was collected from 1 piglet with BW closest to the average weight of the pigs within its respective pen. The animals were not fasted. Blood was collected (09h00) by orbital sinus puncture with a hypodermic needle (40 \u0026times; 1.6 mm) into 10 mL tubes without anticoagulants. Samples were immediately sent at room temperature to the Vi\u0026ccedil;osa Clinical Laboratory (Vi\u0026ccedil;osa, MG - Brazil) for determination of serum urea nitrogen (SUN; Ureal Cobas C311, Linklab, software PNCQ), creatinine (Creatinine, WS-Kovalent, kinetic method, ASB-380, Mindray), and immunoglobulin G concentrations (IgG Atellica CH IgG_2, CH Analyzer, Siemens Healthineers).\u003c/p\u003e \u003cp\u003eThe same blood donor piglet was electrically stunned (240 volts for 3 s) followed by exsanguination to collect samples on d 32. Fragments measuring 2 cm were sampled (8 pigs/treatment) from the duodenum (10 cm from the pylorus junction), jejunum (mid-section), and ileum (5 cm to ileocecal junction) for histological evaluation\u003csup\u003e50\u003c/sup\u003e. The histological sections were then washed in a physiological solution (0.9% sodium chloride) and fixed in 4% paraformaldehyde solution (100 mL 40% paraformaldehyde, 900 mL distilled water, 2.28 g monobasic sodium phosphate, and 21.74 g dibasic sodium phosphate) for 24 h at room temperature\u003csup\u003e6\u003c/sup\u003e. Another 2 cm of jejunum was collected and immediately frozen in liquid nitrogen, stored at \u0026minus;\u0026thinsp;80\u0026deg;C for RNA extraction and gene expression analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eIntestinal morphology, Peyer\u0026rsquo;s patches, and goblet cells\u003c/h2\u003e \u003cp\u003eAfter 24 h of fixation, the fragments of the duodenum, jejunum, and ileum were transferred to an ethanol solution 70% (v/v). Then, the samples were cut into cross-sections and dried in increasing gradients of ethyl, diaphanized in HistoChoice\u0026reg;, and embedded in liquid Paraplast\u0026reg; at 65\u0026deg;C. Five cross-sections (5 \u0026micro;m thickness each) were placed per slide and stained with hematoxylin and eosin. The sections were semi-serial using 1 in 10 cuts\u003csup\u003e51\u003c/sup\u003e. For morphological readings of villus height and crypt depth in the duodenum, jejunum, and ileum, an EVOS\u0026trade; M5000 Cell Imaging System optical microscope (Invitrogen, Thermo Fisher Scientific) with a 10-objective lens was used. The images were then analyzed using ImageJ 1.50i (Java1.6.0_20; National Institutes of Health, USA). Heights of 20 villus and their 20 crypts were selected and measured. Villus to crypt ratios using the length data were then calculated. All measurements were made by a single trained individual. In the ileum fragment, the total count of the Peyer\u0026rsquo;s patches was performed at 4\u0026times; magnification\u003csup\u003e52\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eTo assess the goblet cells in the duodenum, jejunum, and ileum, 10 fields per slide were photographed at 20\u0026times; magnification. Subsequently, the ImageJ program was used, and perpendicular lines were inserted with markings in uniformly sized quadrants under each image. Then, the total number of intersections in the image and the cells that touched the intersections were then counted. The calculation was made according to the methodology proposed by Mandarim de Lacerda\u003csup\u003e53\u003c/sup\u003e:\u003c/p\u003e \u003cp\u003e \u003cem\u003eGoblet cells (%) =\u003c/em\u003e \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\frac{total number of goblet cells x 100}{total number total number of intersections}\\)\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eRelative mRNA abundance\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted using a commercial kit (SV Total RNA isolation kit \u0026ndash; Promega, Z3100), following the manufacturer's instructions. The RNA concentration was estimated using NanoDrop\u0026trade; Lite (Thermo Fisher Scientific), and RNA integrity was assessed using 1% agarose gel electrophoresis. Complementary DNA was synthesized according to the GoScript\u0026trade; Reverse Transcription System protocol (Promega Corporation). GenBank numbers used to access the gene primers are shown in Table\u0026nbsp;\u003cspan refid=\"Tab6\" class=\"InternalRef\"\u003e6\u003c/span\u003e. Primers were used for reverse transcription quantitative PCR with GoTaq\u0026reg; qPCR Master Mix (Promega) in QuantStudio\u0026reg; 3 (Applied Biosystems, Thermo Fisher Scientific). Geometric mean of Ct value of β-actina was used to normalize the expression of the target genes for the jejunum samples. The relative expression of the gene of interest was calculated by ΔCt\u003csup\u003e54\u003c/sup\u003efor glutathione peroxidase (GPX), superoxide dismutase (SOD), catalase (CAT), occludin (OCL), zonula occludens-1 (ZO-1), interferon gamma (IFN-γ), tumor necrosis factor alpha (TNF-α), interleukin 1 beta (IL1-β), interleukin 10 (IL-10), glucose transporter type 2 (GLUT2), Na\u003csup\u003e+\u003c/sup\u003e/glucose co-transporter 1 (SGLT1), sodium-coupled monocarboxylate transporter (SMCT2), monocarboxylate transporter 1 (MCT1), peptide transporter 1 (PepT1), excitatory amino acid carrier 1 (EAAC1), Na\u003csup\u003e+\u003c/sup\u003e-independent cationic and Na\u003csup\u003e+\u003c/sup\u003e-dependent neutral amino acid transporter 1 (y\u003csup\u003e+\u003c/sup\u003eLAT1).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab6\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 6\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eList of primers used in reverse transcription quantitative-PCR gene expression analysis in weaned piglets. \u003csup\u003ea\u003c/sup\u003eGPX, glutathione peroxidase; SOD, superoxide dismutase; CAT, catalase; OCL, occludin; ZO-1, zonula occludens-1; IFN-γ, interferon gamma; TNF-α, tumor necrosis factor alpha; IL1- β, interleukin 1 beta; IL-10, interleukin 10; GLUT2, glucose transporter type 2; SGLT1, Na+/glucose co-transporter 1; SMCT2, sodium-coupled monocarboxylate transporter; MCT1, monocarboxylate transporter 1; PepT1, peptide transporter 1; EAAC1, excitatory amino acid carrier 1; y\u0026thinsp;+\u0026thinsp;LAT1, Na+-independent cationic and Na+-dependent neutral amino acid transporter 1. 2F and R indicate Forward and Reverse primers, respectively.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenes\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGenBank number\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSequence\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGPX\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_214201.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: 5\u0026prime;GCCCAACTTCATGCTCTTC3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: 5\u0026prime;CAGGATCTCCCCATTCTTGGC3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eSOD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_001190422.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: 5\u0026prime;ATCAAGAGAGGCACGTTGGA3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: 5\u0026prime;TCTGCCCAAGTCATCTGGTT3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eCAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_214301.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: 5\u0026prime;GCTTTAGTGCTCCCGAACAG3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: 5\u0026prime;AGATGACCCGCAATGTTCTC3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eOCL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_001163647.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: 5\u0026prime;TCCTGGGTGTGATGGTGTTC3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: 5\u0026prime;CGTAGAGTCCAGTCACCGCA3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eZO-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eXM_003353439.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: 5\u0026acute;AAGCCCTAAGTTCAATCACAATCT3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: 5\u0026acute;ATCAAACTCAGGAGGCGGC3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eIFN- γ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_213948\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: 5\u0026prime;TGGTAGCTCTGGGAAACTGAATG3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: 5\u0026prime;GGCTTTGCGCTGGATCTG3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTNF-α\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_214022.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: 5\u0026prime;CATCGCCGTCTCCTACCA3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: 5\u0026prime;CCCAGATTCAGCAAAGTCCA3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eIL1- β\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_214055.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: 5\u0026prime;TCTGCCCTGTACCCCAACTG3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: 5\u0026prime;CCCAGGAAGACGGGCTTT3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eIL-10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_214041.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: 5\u0026prime;GAAGGACCAGATGGGCGACTT3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: 5\u0026prime;CACCTCCTCCACGGCCCTTG3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGLUT2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eFJ209732.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: 5\u0026prime;TTGCCTTGGATGAGTTATGTGA3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: 5\u0026prime;GCGTGGTCCTTGACTGAAAA3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eSGLT1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eMW_280290.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: 5\u0026prime;GGTTGGAGCTTCTCTGTTTG3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: 5\u0026prime;CCAGAACAACCACCCAAATC3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eSMCT2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eXM_003122908.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: 5\u0026prime;AGGTCTACCGCTTTGGAGCAT3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR:5\u0026prime;GAGCTCTGATGTGAAGATGATGACA3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eMCT1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eAM_286425.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: 5\u0026prime;GGTGGAGGTCCTATCAGCAG3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: 5\u0026prime;AAGCAGCCGCCAATAATCAT3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003ePepT1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eAY_180903.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: 5\u0026prime;CATGGATGCTGTGGTGTATC3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: 5\u0026prime;CATGGAAGCCAGGAACATC3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eEAAC1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_001164649.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: 5\u0026prime;CAGTGGATGCCATGTTAGAC3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: 5\u0026prime;CGTCTCTGGCTCACTAGAA\u0026nbsp;3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003ey\u003csup\u003e+\u003c/sup\u003eLAT1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eEU_047705.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: 5\u0026prime;\u0026nbsp;TGCGTGGAGGACATCTT3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: 5\u0026prime;CTCCTTCCAGCGCAAATAG3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eβ-actin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eU07786.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: 5\u0026prime;CTCTTCCATCGTGTCCTTCTAC3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: 5\u0026prime;CCTCAGACTTGTCGATCTTCTG3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eStatistical procedures\u003c/h2\u003e \u003cp\u003eThe pen was considered the experimental unit for growth performance and diarrhea incidence analysis. One pig from each pen was considered the experimental unit for intestinal morphology, gene expression, and blood profile. The statistical model included the fixed effect of dietary treatment, and block and residual error as random factors. The normality of experimental errors was evaluated using Shapiro-Wilk. The data were analyzed using the mixed procedure of SAS 9.4 (SAS Inst., Inc., Cary, NC, USA) via one-way analysis of variance (ANOVA). When an effect was detected in the ANOVA (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), differences between means were determined by the preplanned contrasts, in which each of the treatments (NUC, YSC, and ASB) were compared versus the control treatment (CON). The statistical significance and tendency were declared at \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 and 0.05\u0026thinsp;\u0026le;\u0026thinsp;\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.10, respectively.\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors thank CNPq—Conselho Nacional de Desenvolvimento Científico e Tecnológico, CAPES – Coordenação de Aperfeiçoamento de Pessoal de Nível Superior, INCT-CA—Instituto Nacional de Ciência e Tecnologia de Ciência Animal, and FAPEMIG - Fundação de Amparo à Pesquisa do Estado de Minas Gerais.\u0026nbsp;Special thanks to Ajinomoto do Brazil for providing the crystalline amino acids used in the experiment.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGCR and AMC: conceptualization, data curation, and project management. GCR, AMC, and FFA: methodology. GCR: software. GCR, AMC, JLG and SWK: statistical analysis, formal analysis, and writing—original draft preparation. GCR and SWK: validation. AMC and FFA: investigation. AMC, JLG, SWK and GCR: writing—review and editing. GCR: supervision. All authors contributed to the article and approved the submitted version.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or analysed during the current study available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAdditional Information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eGenova, J. et al. A summary of feed additives, intestinal health and intestinal alkaline phosphatase in piglet nutrition. \u003cem\u003eCzech J. Anim. Sci\u003c/em\u003e. \u003cstrong\u003e65\u003c/strong\u003e, 281-294. https://doi.org/10.17221/70/2020-CJAS (2020).\u003c/li\u003e\n\u003cli\u003eMoore, K. L., Mullan, B. P., Pluske, J. R., Kim, J. C. \u0026amp; D'Souza, D. N. The use of nucleotides, vitamins and functional amino acids to enhance the structure of the small intestine and circulating measures of immune function in the post-weaned piglet. \u003cem\u003eAnim. Feed Sci. Technol\u003c/em\u003e \u003cstrong\u003e165\u003c/strong\u003e, 184-190. https://doi.org/10.1016/j.anifeedsci.2010.09.013 (2011)\u003c/li\u003e\n\u003cli\u003eKim, S. W. \u0026amp; Duarte, M. E. Understanding intestinal health in nursery pigs and the relevant nutritional strategies. \u003cem\u003eAnim. Biosci\u003c/em\u003e. \u003cstrong\u003e34\u003c/strong\u003e, 338-344. https://doi.org/10.5713/ab.21.0010 (2021).\u003c/li\u003e\n\u003cli\u003eMoeser, A. J., Pohl, C. S. \u0026amp; Rajput, M. Weaning stress and gastrointestinal barrier development: Implications for lifelong gut health in pigs. \u003cem\u003eAnim. Nutr.\u003c/em\u003e \u003cstrong\u003e3\u003c/strong\u003e, 313-321. https://doi.org/10.1016/j.aninu.2017.06.003 (2017).\u003c/li\u003e\n\u003cli\u003eJang, K. B. \u0026amp; Kim, S. W. Supplemental effects of dietary nucleotides on intestinal health and growth performance of newly weaned pigs. \u003cem\u003eJ. Anim. Sci.\u003c/em\u003e \u003cstrong\u003e97\u003c/strong\u003e, 4875-4882. https://doi.org/10.1093/jas/skz334 (2019).\u003c/li\u003e\n\u003cli\u003eValini, G. A. C. et al. Dietary nucleotide supplementation as an alternative to in-feed antibiotics in weaned piglets. \u003cem\u003eAnim\u003c/em\u003e. \u003cstrong\u003e15\u003c/strong\u003e, 100021. https://doi.org/10.1016/j.animal.2020.100021 (2021).\u003c/li\u003e\n\u003cli\u003eBerto, P. N. et al. Dietary supplementation with hydrolyzed yeast and its effect on the performance, intestinal microbiota, and immune response of weaned piglets. \u003cem\u003eAnais Acad. Bras. de Ciên\u003c/em\u003e.\u003cstrong\u003e 92\u003c/strong\u003e. https://doi.org/10.1590/0001-3765202020180969 (2020). \u003c/li\u003e\n\u003cli\u003eBoontiam, W., Bunchasak, C., Kim, Y. Y., Kitipongpysan, S. \u0026amp; Hong, J. Hydrolyzed yeast supplementation to newly weaned piglets: Growth performance, gut health, and microbial fermentation. \u003cem\u003eAnim\u003c/em\u003e. \u003cstrong\u003e12\u003c/strong\u003e, 350. https://doi.org/10.3390/ani12030350 (2022).\u003c/li\u003e\n\u003cli\u003eLiu, J. D., Bayir, H. O., Cosby, D. E., Cox, N. A., Williams, S. M. \u0026amp; Fowler, J. Evaluation of encapsulated sodium butyrate on growth performance, energy digestibility, gut development, and Salmonella colonization in broilers. \u003cem\u003ePoult. Sci\u003c/em\u003e. \u003cstrong\u003e96\u003c/strong\u003e, 3638-3644. https://doi.org/10.3382/ps/pex174 (2017b).\u003c/li\u003e\n\u003cli\u003eMaito, C. D. et al. Simultaneous feeding of calcium butyrate and tannin extract decreased the incidence of diarrhea and proinflammatory markers in weaned piglets. \u003cem\u003eAnim. Biosci\u003c/em\u003e. \u003cstrong\u003e35\u003c/strong\u003e, 87. https://doi.org/10.5713/ab.21.0011 (2022).\u003c/li\u003e\n\u003cli\u003ePluske, J.R. Feed- and feed additives-related aspects of gut health and development in weanling pigs\u003cem\u003e. J. Anim. Sci. Biotechnol.\u003c/em\u003e \u003cstrong\u003e4\u003c/strong\u003e, 1-7. https://doi.org/10.1186/2049-1891-4-1 (2013).\u003c/li\u003e\n\u003cli\u003eZheng, L., Duarte, M. E., Loftus, A. S. \u0026amp; Kim, S. W. Intestinal health of pigs upon weaning: challenges and nutritional intervention. \u003cem\u003eFront Vet. Sci.,\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, 628258. https://doi.org/10.3389/fvets.2021.628258 (2021).\u003c/li\u003e\n\u003cli\u003eGomes, M. D. S. et al. Effect of antibiotics and low-crude protein diets on growth performance, health, immune response, and fecal microbiota of growing pigs. \u003cem\u003eJ.\u003c/em\u003e \u003cem\u003eAnim. Sci\u003c/em\u003e. \u003cstrong\u003e101\u003c/strong\u003e. https://doi.org/10.1093/jas/skad357 (2023).\u003c/li\u003e\n\u003cli\u003eHuang, C. et al. Dietary Sodium Butyrate Decreases Postweaning Diarrhea by Modulating Intestinal Permeability and Changing the Bacterial Communities in Weaned Piglets. \u003cstrong\u003eJ. Nutr\u003c/strong\u003e. \u003cstrong\u003e145\u003c/strong\u003e, 2774-2780. https://doi.org/10.3945/jn.115.217406 (2015).\u003c/li\u003e\n\u003cli\u003eXiong, X. et al. Dietary supplementation with yeast product improves intestinal function, and serum and ileal amino acid contents in weaned piglets. \u003cem\u003eLivest. Sci.\u003c/em\u003e \u003cstrong\u003e171\u003c/strong\u003e, 20-27. https://doi.org/10.1016/j.livsci.2014.10.012 (2015).\u003c/li\u003e\n\u003cli\u003eLiu, Y. et al. Non-antibiotic feed additives in diets for pigs: A review. \u003cem\u003eAnim. Nutr\u003c/em\u003e. \u003cstrong\u003e4\u003c/strong\u003e, 113-125. https://doi.org/10.1016/j.aninu.2018.01.007 (2018).\u003c/li\u003e\n\u003cli\u003eSauer, N., Mosenthin, R. \u0026amp; Bauer, E. The role of dietary nucleotides in single stomached animals. \u003cem\u003eNutr. Res. Rev.\u003c/em\u003e \u003cstrong\u003e24\u003c/strong\u003e, 46–59. https://doi.org/10.1017/S0954422410000326 (2011).\u003c/li\u003e\n\u003cli\u003eJiang, Z. et al. Effects of different forms of yeast Saccharomyces cerevisiae on growth performance, intestinal development, and systemic immunity in early-weaned piglets. \u003cem\u003eJ. Anim. Sci. Biotechnol\u003c/em\u003e. \u003cstrong\u003e6\u003c/strong\u003e, 1-8. http://dx.doi.org/10.1186/s40104-015-0046-8 (2015a).\u003c/li\u003e\n\u003cli\u003eKogan, G. \u0026amp; Kocher, A. Role of yeast cell wall polysaccharides in pig nutrition and health protection.\u003cem\u003e Livest. Sci. \u003c/em\u003e\u003cstrong\u003e109\u003c/strong\u003e, 161-165. https://doi.org/10.1016/j.livsci.2007.01.134 (2007).\u003c/li\u003e\n\u003cli\u003eLiu, G. et al. Dietary Saccharomyces cerevisiae Cell Wall Extract Supplementation Alleviates Oxidative Stress and Modulates Serum Amino Acids Profiles in Weaned Piglets\u003cem\u003e. Oxidative Med. Cell. Longev.\u003c/em\u003e \u003cstrong\u003e2017\u003c/strong\u003e. https://doi.org/10.1155/2017/3967439 (2017a). \u003c/li\u003e\n\u003cli\u003ePapatsiros, V. G., Christodoulopoulos, G. \u0026amp; Filippopoulos, L. C. The use of organic acids in monogastric animals (swine and rabbits). \u003cem\u003eJ. Cell Anim. Biol\u003c/em\u003e. \u003cstrong\u003e6\u003c/strong\u003e, 154-159. http://doi.org/10.5897/JCAB11.081 (2012).\u003c/li\u003e\n\u003cli\u003eFang, C.L., Sun, H., Wu, J., Niu, H. H. \u0026amp; Feng, J. Effects of sodium butyrate on growth performance, haematological and immunological characteristics of weanling piglets. \u003cem\u003eJ. Anim. Physiol. Anim. Nutr\u003c/em\u003e. \u003cstrong\u003e98\u003c/strong\u003e, 680–685. https://doi.org/10.1111/jpn.12122 (2014).\u003c/li\u003e\n\u003cli\u003eLewis, K. et al. Enhanced translocation of bacteria across metabolically stressed epithelia is reduced by butyrate. \u003cem\u003eInflamm. Bowel Dis\u003c/em\u003e. \u003cstrong\u003e16\u003c/strong\u003e, 1138–1148. https://doi.org/10.1002/ibd.21177 (2010).\u003c/li\u003e\n\u003cli\u003eLi, X. et al. Sodium butyrate ameliorates oxidative stress-induced intestinal epithelium barrier injury and mitochondrial damage through AMPK-mitophagy pathway. Ox\u003cem\u003eidative Med. Cell. Longev\u003c/em\u003e. \u003cstrong\u003e2022\u003c/strong\u003e. https://doi.org/10.1155/2022/3745135 (2022).\u003c/li\u003e\n\u003cli\u003eTugnoli, B., Giovagnoni, G., Piva, A. \u0026amp; Grilli, E. From acidifiers to intestinal health enhancers: How organic acids can improve growth efficiency of pigs. \u003cem\u003eAnim\u003c/em\u003e. \u003cstrong\u003e10\u003c/strong\u003e, 134. https://doi.org/10.3390/ani10010134 (2020).\u003c/li\u003e\n\u003cli\u003eSuperchi, P. \u003cem\u003eet al.\u003c/em\u003e Effects of dietary nucleotide supplementation on growth performance and hormonal and immune responses of piglets. \u003cem\u003eAnim.\u003c/em\u003e \u003cstrong\u003e6, \u003c/strong\u003e902-908. DOI: https://doi.org/10.1017/S1751731111002473 (2012).\u003c/li\u003e\n\u003cli\u003eWeaver, A. C., \u0026amp; Kim, S. W. Supplemental nucleotides high in inosine 5′-monophosphate to improve the growth and health of nursery pigs. \u003cem\u003eJ. Anim. Sci.\u003c/em\u003e \u003cstrong\u003e92, \u003c/strong\u003e645-651. https://doi.org/10.2527/jas.2013-6564 (2014).\u003c/li\u003e\n\u003cli\u003eVries, H. \u003cem\u003e et al.\u003c/em\u003e Impact of yeast-derived β-glucans on the porcine gut microbiota and immune system in early life. \u003cem\u003eMicroorganisms.\u003c/em\u003e \u003cstrong\u003e8, \u003c/strong\u003e1573. https://doi.org/10.3390/microorganisms8101573 (2020).\u003c/li\u003e\n\u003cli\u003eGomes, M. D. S. \u003cem\u003eet al.\u003c/em\u003e Effect of amino acid blend as alternative to antibiotics for growing pigs. \u003cem\u003eJ. Anim. Sci. \u003c/em\u003e\u003cstrong\u003e100.\u003c/strong\u003e https://doi.org/10.1093/jas/skac008 (2022).\u003c/li\u003e\n\u003cli\u003eBarbosa, K. A. \u003cem\u003eet al\u003c/em\u003e. Effects of combined feed additives in diets to support growth performance and intestinal health profile in nursery piglets. \u003cem\u003eLivest. Sci\u003c/em\u003e. \u003cstrong\u003e266, \u003c/strong\u003e105121. https://doi.org/10.1016/j.livsci.2022.105121 (2022).\u003c/li\u003e\n\u003cli\u003eClarke, L. C. \u003cem\u003eet al.\u003c/em\u003e Effect of β-glucanase and β-xylanase enzyme supplemented barley diets on nutrient digestibility, growth performance and expression of intestinal nutrient transporter genes in finisher pigs. \u003cem\u003eAnim. \u003c/em\u003e\u003cem\u003eFeed Sci. Technol.\u003c/em\u003e \u003cstrong\u003e238, \u003c/strong\u003e98-110. https://doi.org/10.1016/j.anifeedsci.2018.02.006 (2018).\u003c/li\u003e\n\u003cli\u003eMetzler-Zebeli, B. U., Ertl, R., Grüll, D., Molnar, T. \u0026amp; Zebeli, Q. Enzymatically modified starch up-regulates expression. of incretins and sodium-coupled monocarboxylate transporter in jejunum of growing pigs. \u003cem\u003eAnim.\u003c/em\u003e \u003cstrong\u003e11,\u003c/strong\u003e1180-1188. https://doi.org/10.1017/S1751731116002615 (2017).\u003c/li\u003e\n\u003cli\u003eGuilloteau, P. \u003cem\u003eet al.\u003c/em\u003e From the gut to the peripheral tissues: the multiple effects of butyrate. \u003cem\u003eNutr. Res. Rev.\u003c/em\u003e \u003cstrong\u003e23, \u003c/strong\u003e366-384. https://doi.org/10.1017/S0954422410000247 (2010).\u003c/li\u003e\n\u003cli\u003eBartholome, A. L., Albin, D. M., Baker, D. H., Holst, J. J. \u0026amp; Tappenden, K. A. Supplementation of total parenteral nutrition with butyrate acutely increases structural aspects of intestinal adaptation after an 80% jejunoileal resection in neonatal piglets. \u003cem\u003eJ. Parenter Enteral Nutr\u003c/em\u003e. \u003cstrong\u003e28, \u003c/strong\u003e210-222. https://doi.org/10.1177/0148607104028004210 (2004).\u003c/li\u003e\n\u003cli\u003eLiu, H., Zhao, J., Zhang, W. \u0026amp; Nie, C. Impacts of sodium butyrate on intestinal mucosal barrier and intestinal microbial community in a weaned piglet model. \u003cem\u003eFront. Microbiol\u003c/em\u003e. \u003cstrong\u003e13, \u003c/strong\u003e1041885. https://doi.org/10.3389/fmicb.2022.1041885 (2023).\u003c/li\u003e\n\u003cli\u003eDeng, Q. \u003cem\u003eet al\u003c/em\u003e. Changes in cecal morphology, cell proliferation, antioxidant enzyme, volatile fatty acids, lipopolysaccharide, and cytokines in piglets during the postweaning period. \u003cem\u003eJ. Anim Sci\u003c/em\u003e. \u003cstrong\u003e98,\u003c/strong\u003e https://doi.org/10.1093/jas/skaa046 (2020).\u003c/li\u003e\n\u003cli\u003eRose, E. C., Odle, J., Blikslager, A. T. \u0026amp; Ziegler, A.L. Probiotics, Prebiotics and Epithelial Tight Junctions: A Promising Approach to Modulate Intestinal Barrier Function. \u003cem\u003eInt. J. Mol. Sci.\u003c/em\u003e \u003cstrong\u003e22, \u003c/strong\u003e6729. https://doi.org/10.3390/ijms22136729 (2021).\u003c/li\u003e\n\u003cli\u003eHe, J. \u003cem\u003eet al. \u003c/em\u003eEffects of l-glutamine on growth performance, antioxidant ability, immunity and expression of genes related to intestinal health in weanling pigs. \u003cem\u003eLivest. Sci.\u003c/em\u003e \u003cstrong\u003e189, \u003c/strong\u003e102–109. https://doi.org/10.1016/j.livsci.2016.05.009 (2016).\u003c/li\u003e\n\u003cli\u003eGrimble, R. F. Dietary lipids and the inflammatory response. \u003cem\u003eProc. Nutr. Soc.\u003c/em\u003e \u003cstrong\u003e57, \u003c/strong\u003e535-542. https://doi.org/10.1079/PNS19980078 (1998).\u003c/li\u003e\n\u003cli\u003eMakala, L. H. \u003cem\u003eet al.\u003c/em\u003e Ontogeny of pig discrete Peyer’s patches: distribution and morphometric analysis. \u003cem\u003ePathobiol.\u003c/em\u003e \u003cstrong\u003e68,\u003c/strong\u003e 275-282. https://doi.org/10.1159/000055938 (2001).\u003c/li\u003e\n\u003cli\u003eKobayashi, N., Takahashi, D., Takano, S., Kimura, S. \u0026amp; Hase, K. The roles of Peyer's patches and microfold cells in the gut immune system: relevance to autoimmune diseases. \u003cem\u003eFront. Immunol.\u003c/em\u003e \u003cstrong\u003e10, \u003c/strong\u003e2345. https://doi.org/10.3389/fimmu.2019.02345 (2019).\u003c/li\u003e\n\u003cli\u003eJiang, Y., Zhang, W., Gao, F. \u0026amp; Zhou, G. Effect of sodium butyrate on intestinal inflammatory response to lipopolysaccharide in broiler chickens. \u003cem\u003eCan. J. Anim. Sci\u003c/em\u003e. \u003cstrong\u003e95, \u003c/strong\u003e389-395. https://doi.org/10.4141/cjas-2014-183 (2015b).\u003c/li\u003e\n\u003cli\u003eSanchez, N. C. B., Broadway, P. R. \u0026amp; Carroll, J. A. Influence of yeast products on modulating metabolism and immunity in cattle and swine. \u003cem\u003eAnim.\u003c/em\u003e \u003cstrong\u003e11, \u003c/strong\u003e371. https://doi.org/10.3390/ani11020371 (2021).\u003c/li\u003e\n\u003cli\u003eBennett, J. M., Reeves, G., Billman, G. E. \u0026amp; Sturmberg, J. P. Inflammation–nature’s way to efficiently respond to all types of challenges: implications for understanding and managing “the epidemic” of chronic diseases. \u003cem\u003eFront. med.\u003c/em\u003e \u003cstrong\u003e5, \u003c/strong\u003e316. https://doi.org/10.3389/fmed.2018.00316 (2018).\u003c/li\u003e\n\u003cli\u003eNovais, A. K. \u003cem\u003eet al. \u003c/em\u003e Weaning differentially affects mitochondrial function, oxidative stress, inflammation and apoptosis in normal and low birth weight piglets. \u003cem\u003ePLoS One\u003c/em\u003e, \u003cstrong\u003e6, \u003c/strong\u003e1. http://dx.doi.org/10.1371/journal.pone.0247188 (2021).\u003c/li\u003e\n\u003cli\u003eGoodridge, H. S., Wolf, A. J. \u0026amp; Underhill, D. M. β‐glucan recognition by the innate immune system. \u003cem\u003eImmunol. Rev.\u003c/em\u003e \u003cstrong\u003e230, \u003c/strong\u003e38-50. https://doi.org/10.1111/j.1600-065X.2009.00793.x (2009).\u003c/li\u003e\n\u003cli\u003eFu, R. \u003cem\u003eet al.\u003c/em\u003e Yeast hydrolysate attenuates lipopolysaccharide-induced inflammatory responses and intestinal barrier damage in weaned piglets. \u003cem\u003eJ. Anim. Sci. Biotechnol.\u003c/em\u003e \u003cstrong\u003e14, \u003c/strong\u003e1-15. https://doi.org/10.1186/s40104-023-00835-2 (2023).\u003c/li\u003e\n\u003cli\u003eRostagno, H. S. \u003cem\u003eet al.\u003c/em\u003e Brazilian Tables for Poultry and Swine: composition of feedstuffs and nutritional requirements. Animal Science Department UFV (2017), Viçosa, MG, Brazil, 488.\u003c/li\u003e\n\u003cli\u003eLiu, P. P. X. S.\u003cem\u003e et al.\u003c/em\u003e Chito-oligosaccharide reduces diarrhea incidence and attenuates the immune response of weaned pigs challenged with Escherichia coli K88. \u003cem\u003eJ. Anim. Sci.\u003c/em\u003e \u003cstrong\u003e88, \u003c/strong\u003e3871-3879. https://doi.org/10.2527/jas.2009-2771 (2010).\u003c/li\u003e\n\u003cli\u003eYang, K.M., Jiang, Z.Y., Zheng, C.T., Wang, L. \u0026amp; Yang, X.F. Effect of Lactobacillus plantarum on diarreia and intestinal barrier function of young piglets challenged with enterotoxigenic Escherichia coli K88. \u003cem\u003eJ. Anim. Sci.\u003c/em\u003e \u003cstrong\u003e92, \u003c/strong\u003e1496-1503. https://doi.org/10.2527/jas.2013-6619 (2014).\u003c/li\u003e\n\u003cli\u003eJúnior, D. T. V. \u003cem\u003eet al.\u003c/em\u003e Supplementation of Bacillus subtilis DSM 32540 improves performance and intestinal health of weaned pigs fed diets containing different fiber sources. \u003cem\u003eLivest. Sci.\u003c/em\u003e \u003cstrong\u003e270, \u003c/strong\u003e105202. https://doi.org/10.1016/j.livsci.2023.105202 (2023).\u003c/li\u003e\n\u003cli\u003eCorreia, A. M., Genova, J. L., Saraiva, A., Rocha, G. C. Effects of crude protein and non-essential amino acids on growth performance, blood profile, and intestinal health of weaned piglets. \u003cem\u003eFront Vet. Sci.\u003c/em\u003e \u003cstrong\u003e10,\u003c/strong\u003e https://doi.org/10.3389/fvets.2023.1243357 (2023).\u003c/li\u003e\n\u003cli\u003eMandarim De Lacerda, C. A. Métodos quantitativos em morfologia. Rio de Janeiro(1995). \u003cem\u003eEduerj\u003c/em\u003e, \u003cstrong\u003e131\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eLivak, K.J., Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2 − ΔΔCT method. \u003cem\u003eMethods\u003c/em\u003e. \u003cstrong\u003e25, \u003c/strong\u003e402-408. https://doi.org/10.1006/meth.2001.1262 (2001).\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"autolyzed yeast, gut health, performance, piglets, nucleotides, sodium butyrate","lastPublishedDoi":"10.21203/rs.3.rs-4112899/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4112899/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThis study investigated the effects of supplemental nucleotides, autolyzed yeast (\u003cem\u003eSaccharomyces cerevisiae\u003c/em\u003e), and sodium butyrate in diets for nursery pigs on growth performance, diarrhea incidence, blood profile, intestinal morphology, mRNA expression of nutrient transporters, inflammatory markers, antioxidant profile, and tight junction proteins in the small intestine. One hundred eighty 21-d-old pigs (5.17 ± 0.57 kg) were assigned in a randomized block design to 1 of 4 dietary treatments: (1) CON: control, basal diet, (2) NUC: CON + nucleotides, (3) YSC: CON + lysed yeast \u003cem\u003eS. cerevisiae\u003c/em\u003e, (4) ASB: CON + acidifier sodium butyrate. Pigs were fed for 24 d, phase 1 (21 to 32 d) and 2 (32 to 45 d). During phase 1, YSC and ASB improved average daily gain (ADG) and feed conversion (FC) compared with CON. At the overall period, ASB improved ADG and YSC improved FC compared with CON. The NUC diet did not affect growth performance. The ASB increased ileal villus height compared to CON. The YSC and ASB reduced the number of Peyer’s patches in the ileum compared with CON. The YSC increased mRNA expression of nutrient transporters (SMCT2, MCT1, and PepT1), tight junction proteins (OCL and ZO-1), antioxidants (GPX), and IL1-β in the jejunum compared with CON. The ASB increased mRNA expression of nutrient transporters (SGLT1 and MCT1), tight junction proteins (OCL and ZO-1), and antioxidants (GPX and SOD) compared with CON. In conclusion, autolyzed yeast and sodium butyrate promoted growth performance by improving the integrity of the intestinal barrier, the mRNA expression of nutrient transporters, and antioxidant enzymes in the jejunum of nursery pigs whereas supplementation of nucleotides did not show such effects.\u003c/p\u003e","manuscriptTitle":"Autolyzed yeast and sodium butyrate supplemented alone to diets promoted improvements in performance, intestinal health and nutrient transporter in weaned piglets","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-04-01 06:17:52","doi":"10.21203/rs.3.rs-4112899/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-05-06T10:13:20+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-05-05T03:13:34+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"8ecd86e6-ee18-4a40-9d1f-09de319daee0","date":"2024-04-29T02:15:17+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-04-02T18:18:29+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"8f14b150-8e6a-4124-84c6-6a0f8285df9b","date":"2024-04-02T16:52:44+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-04-02T08:59:42+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-04-02T08:49:02+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2024-03-27T07:04:04+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-03-27T06:42:44+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2024-03-16T11:27:06+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"23aa4a83-e1ac-4dc7-8c05-ae5c5ea2c05e","owner":[],"postedDate":"April 1st, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":30064527,"name":"Biological sciences/Zoology/Animal physiology"},{"id":30064528,"name":"Biological sciences/Immunology"},{"id":30064529,"name":"Biological sciences/Molecular biology"},{"id":30064530,"name":"Health sciences/Biomarkers"},{"id":30064531,"name":"Biological sciences/Biochemistry/Dna"}],"tags":[],"updatedAt":"2024-05-25T00:33:47+00:00","versionOfRecord":{"articleIdentity":"rs-4112899","link":"https://doi.org/10.1038/s41598-024-62551-9","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2024-05-24 00:33:47","publishedOnDateReadable":"May 24th, 2024"},"versionCreatedAt":"2024-04-01 06:17:52","video":"","vorDoi":"10.1038/s41598-024-62551-9","vorDoiUrl":"https://doi.org/10.1038/s41598-024-62551-9","workflowStages":[]},"version":"v1","identity":"rs-4112899","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4112899","identity":"rs-4112899","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-22T02:00:06.705733+00:00
License: CC-BY-4.0