Naringenin Protects Rats against Ang-II Induced Cardiac Hypertrophy and Fibrosis by Downregulating TGF-β1/Smads Signaling Pathways

Naringenin Protects Rats against Ang-II Induced Cardiac Hypertrophy and Fibrosis by Downregulating TGF-β1/Smads Signaling Pathways | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Naringenin Protects Rats against Ang-II Induced Cardiac Hypertrophy and Fibrosis by Downregulating TGF-β1/Smads Signaling Pathways Xiaowei Chen, Xi Zhao, Han Wang, Hengdao Liu This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-694850/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background :Naringenin (Nrg), a flavone found in several plant foods with various biological properties, has been shown prevention of cardiac remodeling. However, themechanisms underlying this suppression of cardiac remodeling has not been known clearly. Methods : Male Sprague Dawley (SD) rats were AngII infused via osmotic minipumps for 4 weeks and were given Nrg by gavage (100mg/kg/day) at the same time. In vitro experiments used cardiomyocyte and cardiac fibroblasts(CF) treated with AngII or AngII plus Nrg.Cardiac remodeling was assessed using the echocardiography and histological analysis. And, the effect of Nrg on TGF-β1/Smadssignaling pathway was investigated. Results : Treatmentwith Nrg(100mg/kg/day) decreased the ratio of heart weight to tibia length and hypertrophy markers in rats given AngII infusion. In vitro experiments demonstrated that AngII-induced cardiomyocyte hypertrophy and proliferation of CFs were significantly inhibited by Nrg administration. Nrg inhibited activation of the TGF-β1/Smad2/3 signaling pathway stimulated by AngII. Conclusions : Nrgsupplementation prevented cardiac remodeling via down-regulating the TGF-β1/Smad2/3 signaling pathway both in cardiomyocyte and CFs, and attenuating cardiac remodeling in AngII-induced rats model. Nutrition & Dietetics Naringenin Cardiac hypertrophy Cardiac fibrosis TGF signaling pathway Angiotensin II Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Cardiac remodeling is characterized by cardiac hypertrophy and fibrosis, which has been recognized as a key determinant of clinical outcome in heart disease [ 1 ]. Angiotensin II (AngII) is a crucial regulator of cardiac remodeling through inducing cardiomyocyte hypertrophy and proliferation and migration of cardiac fibroblasts (CFs). Transforming growth factor-β1 (TGF-β1) has been identified as a key regulator of extracellular matrix synthesis and degradation, which is believed to partially mediate AngII-induced cardiac remodeling [ 2 ]. Naringenin (Nrg) is a flavonoid compound found in several plant foods including citrus fruit, tomatoes and figs. Nrg has been identified as a potential therapeutic agent as it demonstrates anticancer [ 3 ], anti-inflammation [ 4 ], anti-atherogenic [ 5 ] and antimicrobial [ 6 ] effect. Previous studies have reported that Nrg ameliorates cardiac hypertrophy induced by high glucose [ 7 ] [ 8 ] and pressure overload [ 9 ]. Although Nrg inhibits TGF-β1 signaling and the subsequent Smad3 phosphorylation for the downstream signal transduction [ 10 ], whether Nrg modifies AngII-induced cardiac remodeling through TGF-β1/Smad signaling pathway remains elusive. This study therefore explored the possible prevention by Nrg of cardiac remodeling in vivo, using the AngII-induced rat model, and in vitro on cardiomyocytes and CFs stimulated by AngII plus Nrg. Methods Materials Naringenin, AngII, 3-[4,5-dimethyl-thiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT), Antibiotic-antimycotic solution (10,000 units/ml of penicillin, 10,000µg/ml of streptomycin), and Tris were purchased from Sigma-Aldrich (St. Louis, MO, USA). Trizol Reagent was purchase from Invitrogen (USA). All-In-One RT Mastermix and EvaGreen qPCR MaterMix were purchased from ABM (Canada). Antibodies against ANP, β-MHC, TGF-β1, Smad2/3, phospho-Smad2/3 (p-Smad3), and GAPDH were purchased from Abcam CO (Cambrige, UK). Animal Male 8-week-old male Sprague Dawley (SD) rats (150–180 g body weight) were purchased from Beijing Vital River Laboratory Animal Technology Company (Beijing, China). All experiments involving rats were approved by the Institutional Animal Care Research Advisory Committee of the National Institute of Biological Science (NIBS) and Animal Care Committee of Zhengzhou University. All rats were kept under a 12-hr light/dark cycle with free access to water and food. Experimental Design And Treatment Protocol A rat model of AngII infusion induced cardiac remodeling was established as described previously [ 11 ]. In brief, SD rats were quickly anesthetized with an intraperitoneal injection of sodium pentobarbital (50 mg/kg), then the prefilled osmotic minipumps (Alzet, Model 2002) were implanted into the subcutaneous tissue to deliver AngII (Sigma-Aldrich, A9525) at 400 ng/kg/min for 4 weeks. Rats were randomly assigned to one of the following groups: the sham group (n = 10) received subcutaneous injections of phosphate buffer (PBS) for 4 weeks; the AngII group (n = 10) received subcutaneous injections of AngII (400 ng/kg/min) via osmotic minipumps; the AngII + Nrg group (n = 10) received naringenin by gavage (100mg/kg/day) plus the daily injections of Ang as above. Echocardiographic Study Transthoracic echocardiography was used to measure left ventricular (LV) function variables one day before killing. Briefly, rats were placed in a supine position after the induction of general anesthesia. Rats were underwent transthoracic two dimensional guided M-mode echocardiography with a 12L MHz transducer (Sibiscape Co. Ltd.). From the cardiac short axis, the LV anterior wall end-diastolic thickness (LVAWd), the systolic LV anterior wall thickness (LVAWs),the LV internal dimension at end-diastole (LVIDd), the LV internal dimension at end-systole (LVIDs), the LV posterior wall end-diastolic thickness (LVPWd), the LV posterior wall end-systolic thickness (LVPWs) were measured. Echocardiographic measurements were averaged from at least three separate cardiac cycles. Heart Histological Analysis The left ventricle were fixed in 10% formalin and embedded in paraffin, and subsequently were sectioned at 4µm and stained with Masson to evaluate the cardiac collagen deposition. To evaluate the size of cardiomyocytes, tissue sections were stained with 1.0 mg/ml Alexa Fluor 488® conjugate of wheat germ agglutinin (WGA) solution (MolecularProbes, Eugene, OR, USA). Ten fields in each region of the heart were selected randomly from four nonconsecutive serial sections, and collagen content was quantified by measuring the total blue area per square millimeter using the ImageJ. Neonatal Rat Ventricular Cardiomyocytes Isolation, Culture And Treatment Neonatal rat ventricular cardiomyocytes and CFs were obtained from the hearts of 1–2 days old SD rats as described previously [ 12 ]. In brief, the ventricles of neonatal rats were harvested after killed by decapitation, and then were cut into ~ 1mm 3 pieces in a dish with cold PBS. 0.125% and 0.05% collagenase type I were used to dissociate cardiomyocytes and fibroblasts. Cells were cultured in DMEM with 15% FBS, 100 U/mL penicillin and 100 µg/mL streptomycin in a humidified atmosphere of 5% CO 2 and 95% air at about 37℃. Naringenin were dissolved in dimethyl sulfoxide (DMSO) and diluted with DMEM. Cells were incubated with Nrg (0.1, 1, 10µM) with or without AngII 10uM for 24 h in a 6 well plate. Cell surface area analysis was performed using confocal microscopy as described previously [ 13 ]. Methylthiazolyl Tetrazolium Assay For Cell Viability Cells were cultured at a density of 4–5 x 10 4 cells per well in 96-well plates for 24 h. The cells were treated with different concentrations of Nrg for 24 h. And then cell viability was determined by the MTT reduction assay. Cells were incubated with MTT solution (5 mg/mL) for 4 h at 37°C. The dark blue formazan crystals that formed in intact cells were solubilized with 150 µL of DMSO, and the absorbance at 490 nm was measured with a microplate reader (Bio-Rad, Hercules, CA, USA). Western Blotting The heart tissues or cells were lysed by RIPA lysis buffer and the protein concentration was detected by using a BCA protein assay kit. Protein (30µg) were separated using 10% SDS-PAGE and then were transferred onto a polyvinylidene difluoride membrane (PVDF). Next, PVDF membranes were blocked with 5% fat-free milk and incubated with primary antibodies overnight at 4℃. Subsequently, the membranes were washed and incubated with secondary antibodies at room temperature. The optical density of the bands was visualized by an ECL system (Pierce). GAPDH was used as an endogenous control. Data was normalized to GAPDH levels. Rna Isolation And Quantitative Real-time Pcr Total RNA was extracted from the frozen tissues or cultured cells using Trizol reagent (Invitrogen, USA). First strand cDNA was synthesized using an RT kit (Invitrogen, USA). qPCR analysis were performed in a MiniOpticon Real-Time PCR Detection System (BioRad Laboratories, USA). Results were expressed as fold differences relative to GAPDH using the 2-ΔΔCT method. All the primers were synthesized by Sangon Biotech (Shanghai, China) and the sequence are listed in Table 1 . Table 1 Primers used for reverse transcription and real-time PCR Primer Names Sequences ANP Sense Anti-Sense CCTTCTCCATCACCAA TGTTATCTTCGGTACCG β-MHC Sense Anti-Sense GCCGAGTCCCAGGTCAACAA GTAATTCGAGGGCAGGAACCC α-SMA Sense Anti-Sense GCAAACAGGAATACGACGAAGC GCTTTGGGCAGGAATGATTTG Co1 I Sense Anti-Sense ACTCAGCCCTCTGTGCCT CCTTCGCTTCCATACTCG GAPDH Sense Anti-Sense GACATCAAGAAGGTGGTGAAGC TGTCATTGAGAGCAATGCCAGC Statistical analysis All data are presented as means ± SEM. SPSS 21.0 was used to perform statistical analysis of the data. Statistical differences were calculated with the 2-tailed Student t test when comparing 2 conditions, and ANOVA was used when comparing ༞2 conditions. A value of P < 0.05 was considered statistically significant. Results Nrg alleviated AngII-induced proliferation and collagen expression of CFs Firstly, we detected the cytotoxicity of Nrg on CFs. The results of methylthiazolyl tetrazolium assay showed that Nrg had no cytotoxic effects on CFs at concentrations less than 200µM (Fig. 1 A). Thus, in the following experiments, Nrg concentrations of 200µM were chosen. Then, we examined whether Nrg could inhibit AngII induced proliferation of CFs. CFs were pretreated with Nrg (200µM) following with AngII (0.1µM) for 72h. Our results demonstrated that Nrg could inhibit AngII-induced proliferation of CFs in a concentration-dependent manner (Fig. 1 B). Then we examined the effect of Nrg on collagen expression in cardiac fibroblasts (CFs). Following AngII administration, the fibrotic markers α-SMA and Col1a1 gene expression were increased in CFs, and Nrg treatment prevented AngII induced CF collagen expression (Fig. 1 C and D). Nrg Attenuated Angii-induced Cardiomyocyte Growth In Cultured Cardiomyocytes To assess the protective role of Nrg on the development of cardiac hypertrophy, cardiomyocytes were treated with AngII 0.1µM for 24 h, and cell surface area and hypertrophic markers were measured. AngII treatment induced significant increase of hypertrophic markers (ANP andβ-MHC) and cell surface area compared to the control group (Fig. 1 B, C and D). However, compared with AngII group, combined treatment with Nrg significantly reversed AngII-induced increases of hypertrophic markers (ANP and β-MHC) and cell surface area (Fig. 1 B, C and D). Nrg Ameliorated Angii-induced Cardiac Hypertrophy Here we analyzed cardiac effects of Nrg treatment in an animal model of AngII-induced cardiac hypertrophy in rats. AngII infusion rats showed a significant increase in the ratio of weight/tibia length (HW/TL), and the cell size of cardiomyocytes (Fig. 3 A and D). Examination by echocardiography revealed that the thickness of the left ventricular post wall at the end-diastole (LVPWd) and the end-systole (LVPWs) was higher in AngII infusion rats (Fig. 3 B and C). Compared with AngII group, Nrg treatment markedly ameliorated AngII-induced cardiac hypertrophy, as demonstrated by a significantly decrease in HW/TL, cardiomyocyte size, the thickness of the left ventricular post wall at the end-diastole (LVPWd) and the end-systole (LVPWs) (Fig. 3 A, B, C and D). Meanwhile, AngII infusion induced increased protein levels of ANP and β-MHC, while their expression was inhibited in Nrg-treated rat (Fig. 3 E). Nrg Attenuated Angii-induced Cardiac Fibrosis To determine the effect of Nrg on cardiac fibrosis, heart sections were stained with Masson’s staining. Quantitative data revealed increased collagen deposition in AngII-induced rats, while was significantly attenuated in Nrg-treated rats (Fig. 4 A). As showed in Fig. 4 B, AngII infusion induced a significant increase in protein levels of α-SMA and Col I, and Nrg treatment reversed cardiac fibrosis as evidenced by a decreased in collagen deposition and α-SMA and Col I protein level (Fig. 4 A and B). Collectively, Nrg treatment can attenuated AngII-induced cardiac hypertrophy and fibrosis. Suppression of TGF-β1/Smad2/3 signaling contributes to the anti-hypertrophy effect of Nrg Furthermore, we explored the mechanism underlying the anti-hypertrophy effect of Nrg. As shown in Fig. 5 A, the expression of TGF-β1 and phosphorylated Smad2/3 were increased in AngII-induced rat model, which could be attenuated by treatment with Nrg. In cultured cardiomyocytes and cardiac fibroblasts, AngII induced upregulation of TGF-β1 and phosphorylated Smad2/3 (Fig. 5 B and C), and Nrg treatment inhibited TGF-β1/Smad2/3 signaling as evidenced by attenuating protein expression of TGF-β1 and phosphorylated Smad2/3 (Fig. 5 B and C). Discussion Cardiac remodeling is a major driving force in the development and progression of cardiovascular diseases including cardiac hypertrophy, heart failure and myocardial infarction. However, no therapeutic intervention directly targets the fibrotic response. A better understanding of the mechanisms underlying cardiac remodeling is important for developing more effective diagnostic and therapeutic strategies. In the present study, one of the important findings is that Nrg treatment markedly improved AngII-induced cardiac hypertrophy and fibrosis through downregulating TGF-β1 signaling pathway. AngII, the main effector peptide of renin-angiotensin system (RAS), has been shown to induce TGF-β1 expression and its subsequent signaling and mediates cardiac remodeling [ 14 – 16 ]. Pharmacological inhibition of angiotensin converting enzyme and AngII receptor have shown their therapeutic effects for cardiac remodeling [ 17 ]. Our previous study also demonstrated that suppressing TGF-β1/Smads signaling pathway inhibits cardiac fibrosis and improves cardiac function [ 18 ]. Nrg, a natural flavanone with many pharmacological effects, has been proved to reduce Smad3 phosphorylation and expression in the presence of TGF-β1 [ 19 ], and exerted anti-fibrosis effect [ 20 ]. In this work, we therefore attempted to characterize the potential role of TGF-β1 signaling pathway in Nrg inhibition of Ang II-induced cardiac remodeling in vitro and in vivo . Our results showed that Nrg markedly improved AngII-induced cardiac hypertrophy and fibrosis through inhibiting the TGF-β1 signaling pathway. Thus, our result suggest that Nrg might play a protective role in AngII-mediated cardiac remodeling by targeting the TGF-β1 signaling pathway. However, it remains obscure what’s the inhibition mechanism of Nrg on the AngII-TGF-β1 signaling pathway. One possible explanation is that Nrg can reduced the binding probability of TGF-β1 to its specific TGF-β1 type II receptor (TβRII). TGF-β1 binding to TβRII is the initial step of TGF-β signaling. Thus the effect of Nrg on TGF-β ligand-receptor interaction induced inhibition of the receptor dimerization and activation for the signaling complex formation and the subsequent Smad3 phosphorylation for the downstream signal transduction [ 10 ]. Conclusions In present study, we arrived at a conclusion that Nrg targeting TGF-β1/Smad signaling pathway, and promoted cardiac hypertrophy and fibrosis in AngII-induced rats. Our study supports the notion Nrg has the potential to be developed as a novel inhibitor target for TGF-β signaling, and might be considered as potential prevention strategy for cardiac hypertrophy and fibrosis. Our results might help to deepen the understanding of the role and function of TGF-β signaling in cardiac hypertrophy. These findings offer important insights into fundamental mechanisms underlying functions of Nrg, meanwhile, would provide a potential therapeutic targets for cardiac hypertrophy. Abbreviations Nrg: Narinngenin; SD: Sprague Dawley; Transforming growth factor-β1 (TGF-β1); LV: left ventricular;LVAWd: the LV anterior wall end-diastolic thickness; LVAWs: the systolic LV anterior wall thickness; LVIDs: the LV internal dimension at end-systole; LVPWd: the LV posterior wall end-diastolic thickness; LVPWs: the LV posterior wall end-systolic thickness; WGA: wheat germ agglutinin; PVDF: polyvinylidene difluoride membrane; CFs: cardiac fibroblasts. Declarations Acknowledgment Not applicable Funding This work was supported by Joint project of Medical Science and Technology Research of Henan (Grant No. LHGJ20190099). Availability of data and materials All data generated of analyzed during this study are included in this published article or are available from the corresponding author on reasonable request. Author’s contributions HDL designed the study; XWC and XZ conducted the experiments; HW did sample analysis and data analysis, HDL wrote the manuscript; HDL revised the paper. All authors read and approved the final manuscript. Ethics approval and consent to participate This study was approved by the ethics committee of Zhengzhou University. Consent for publication Not applicable Competing interest The authors have no conflicts of interest to disclose. References Luscher TF: Predictors as well as surrogate and hard endpoints in cardiovascular disease. Eur Heart J 2015, 36: 2197-2199. Rosenkranz S: TGF-beta1 and angiotensin networking in cardiac remodeling. Cardiovasc Res 2004, 63: 423-432. Shi X, Luo X, Chen T, Guo W, Liang C, Tang S, Mo J: Naringenin inhibits migration, invasion, induces apoptosis in human lung cancer cells and arrests tumour progression in vitro. J Cell Mol Med 2021, 25: 2563-2571. Wang Q, Ou Y, Hu G, Wen C, Yue S, Chen C, Xu L, Xie J, Dai H, Xiao H, et al: Naringenin attenuates non-alcoholic fatty liver disease by down-regulating the NLRP3/NF-kappaB pathway in mice. Br J Pharmacol 2020, 177: 1806-1821. Burke AC, Sutherland BG, Telford DE, Morrow MR, Sawyez CG, Edwards JY, Drangova M, Huff MW: Intervention with citrus flavonoids reverses obesity and improves metabolic syndrome and atherosclerosis in obese Ldlr(-/-) mice. J Lipid Res 2018, 59: 1714-1728. Nahmias Y, Goldwasser J, Casali M, van Poll D, Wakita T, Chung RT, Yarmush ML: Apolipoprotein B-dependent hepatitis C virus secretion is inhibited by the grapefruit flavonoid naringenin. Hepatology 2008, 47: 1437-1445. Zhang J, Qiu H, Huang J, Ding S, Huang B, Zhou P, Jiang Q: EETs/PPARs activation together mediates the preventive effect of naringenin in high glucose-induced cardiomyocyte hypertrophy. Biomed Pharmacother 2019, 109: 1498-1505. You Q, Wu Z, Wu B, Liu C, Huang R, Yang L, Guo R, Wu K, Chen J: Naringin protects cardiomyocytes against hyperglycemia-induced injuries in vitro and in vivo. J Endocrinol 2016, 230: 197-214. Zhang N, Yang Z, Yuan Y, Li F, Liu Y, Ma Z, Liao H, Bian Z, Zhang Y, Zhou H, et al: Naringenin attenuates pressure overload-induced cardiac hypertrophy. Exp Ther Med 2015, 10: 2206-2212. Yang Y, Xu Y, Xia T, Chen F, Zhang C, Liang W, Lai L, Fang X: A single-molecule study of the inhibition effect of Naringenin on transforming growth factor-beta ligand-receptor binding. Chem Commun (Camb) 2011, 47: 5440-5442. Li H, Xu JD, Fang XH, Zhu JN, Yang J, Pan R, Yuan SJ, Zeng N, Yang ZZ, Yang H, et al: Circular RNA circRNA_000203 aggravates cardiac hypertrophy via suppressing miR-26b-5p and miR-140-3p binding to Gata4. Cardiovasc Res 2020, 116: 1323-1334. Tang CM, Liu FZ, Zhu JN, Fu YH, Lin QX, Deng CY, Hu ZQ, Yang H, Zheng XL, Cheng JD, et al: Myocyte-specific enhancer factor 2C: a novel target gene of miR-214-3p in suppressing angiotensin II-induced cardiomyocyte hypertrophy. Sci Rep 2016, 6: 36146. Tse MM, Aboutabl ME, Althurwi HN, Elshenawy OH, Abdelhamid G, El-Kadi AO: Cytochrome P450 epoxygenase metabolite, 14,15-EET, protects against isoproterenol-induced cellular hypertrophy in H9c2 rat cell line. Vascul Pharmacol 2013, 58: 363-373. Everett AD, Tufro-McReddie A, Fisher A, Gomez RA: Angiotensin receptor regulates cardiac hypertrophy and transforming growth factor-beta 1 expression. Hypertension 1994, 23: 587-592. Kupfahl C, Pink D, Friedrich K, Zurbrugg HR, Neuss M, Warnecke C, Fielitz J, Graf K, Fleck E, Regitz-Zagrosek V: Angiotensin II directly increases transforming growth factor beta1 and osteopontin and indirectly affects collagen mRNA expression in the human heart. Cardiovasc Res 2000, 46: 463-475. Schultz Jel J, Witt SA, Glascock BJ, Nieman ML, Reiser PJ, Nix SL, Kimball TR, Doetschman T: TGF-beta1 mediates the hypertrophic cardiomyocyte growth induced by angiotensin II. J Clin Invest 2002, 109: 787-796. Diez J, Querejeta R, Lopez B, Gonzalez A, Larman M, Martinez Ubago JL: Losartan-dependent regression of myocardial fibrosis is associated with reduction of left ventricular chamber stiffness in hypertensive patients. Circulation 2002, 105: 2512-2517. Meng Z, Li HY, Si CY, Liu YZ, Teng S: Asiatic acid inhibits cardiac fibrosis throughNrf2/HO-1 and TGF-beta1/Smads signaling pathways in spontaneous hypertension rats. Int Immunopharmacol 2019, 74: 105712. Liu X, Wang W, Hu H, Tang N, Zhang C, Liang W, Wang M: Smad3 specific inhibitor, naringenin, decreases the expression of extracellular matrix induced by TGF-beta1 in cultured rat hepatic stellate cells. Pharm Res 2006, 23: 82-89. Du G, Jin L, Han X, Song Z, Zhang H, Liang W: Naringenin: a potential immunomodulator for inhibiting lung fibrosis and metastasis. Cancer Res 2009, 69: 3205-3212. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-694850","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research","associatedPublications":[],"authors":[{"id":38439530,"identity":"7a3fe690-5951-45f5-a7dc-a7e89c2916ce","order_by":0,"name":"Xiaowei Chen","email":"","orcid":"","institution":"The First Affiliated Hospital of Zhengzhou University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xiaowei","middleName":"","lastName":"Chen","suffix":""},{"id":38439531,"identity":"4fb0b809-0db1-4838-bdc4-2575f3b3042b","order_by":1,"name":"Xi Zhao","email":"","orcid":"","institution":"The First Affiliated Hospital of Zhengzhou University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xi","middleName":"","lastName":"Zhao","suffix":""},{"id":38439532,"identity":"8b9c8c85-ff67-4a43-9a19-6019822643da","order_by":2,"name":"Han Wang","email":"","orcid":"","institution":"The First Affiliated Hospital of Zhengzhou University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Han","middleName":"","lastName":"Wang","suffix":""},{"id":38439533,"identity":"535f67bd-f6a6-482c-b1bc-c40bdccce754","order_by":3,"name":"Hengdao Liu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAApElEQVRIiWNgGAWjYBACPgkGAwYGAxsefv4GIrWwQbSkyUjOOECSFobDNgYNCcRqkW7e/OFHwXkeA4YDjB8+5hCjReZYmWSPwW0ec+YGZsmZ24hyWI4ZMwNQi2XDATZmXiK1GH9mMDjHY3AggXgtBtIMBgdI0pIG8ksyj+SMg83E+YVfIhkYYn/s7Pn5mw9++EiMFiTA2ECa+lEwCkbBKBgFuAEAfHku1wrsl/4AAAAASUVORK5CYII=","orcid":"","institution":"The First Affiliated Hospital of Zhengzhou University","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Hengdao","middleName":"","lastName":"Liu","suffix":""}],"badges":[],"createdAt":"2021-07-07 23:45:27","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-694850/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-694850/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":11507869,"identity":"4acc6e77-301f-473f-91db-4aaf44f321a7","added_by":"auto","created_at":"2021-07-15 21:39:08","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":99581,"visible":true,"origin":"","legend":"Naringenin (Nrg) treatment inhibited AngII-induced cardiac fibroblasts proliferation and collagen expression in vitro.\nCardiac fibroblasts (CFs) were exposed to AngII(0.1uM) with or without Nrg 200uM for 24 h, and then the cell viability was measured by MTT assay (A).CFs were pretreated with Nrg (50, 100 and 200 μM), and then stimulated with AngII (0.1uM) for 72h. The proliferation of CFs was measured by MTT assay (B). mRNA level of α-SMA (C)and Col1a1 (D) were quantified using real-time PCR. Data are presented as mean ±SEM, ##P\u003c0.01 vs Vehicle; **P\u003c0.01 vs Ang II; *P\u003c0.05 vs Ang II.","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-694850/v1/6bb0433d702e413051d04be5.png"},{"id":11507870,"identity":"f09965a2-1110-49e7-b3ef-178639999d96","added_by":"auto","created_at":"2021-07-15 21:39:08","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":51789,"visible":true,"origin":"","legend":"Naringenin (Nrg) treatment inhibited AngII-induced hypertrophy in cultured cardiomyocytes in vitro. Cardiomyocytes were exposed to AngII0.1uM with or without Nrg 200uM for 24 h.\n(A) Surface area was determined. mRNA level of ANP (B) and β-MHC(C) were quantified using real-time PCR. Data are presented as mean ±SEM, ##P\u003c0.01 vs Vehicle; **P\u003c0.01 vs Ang II; *P\u003c0.05 vs Ang II.","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-694850/v1/c266b3b677701a9ebde2fc37.png"},{"id":11507955,"identity":"9e0930f0-ea12-49da-a51f-83aeb2fa499f","added_by":"auto","created_at":"2021-07-15 21:42:08","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1333755,"visible":true,"origin":"","legend":"Naringenin (Nrg) ameliorated AngII-induced cardiac hypertrophy in vivo. \n(A) Heart weight to tibia length ratio of different groups, n=10. (B) Left ventricular post wall thickness in diastole (LVPWd). (C) Left ventricular post wall thickness in systole (LVPWs). (D) Representative wheat germ agglutinin-stained of the left ventricles to cardiomyocyte size and quantification of the cardiomyocyte size in the indicated groups (n=8 per group). (E) Western blot images and densitometric quantitation for ANP andβ-MHC protein in different groups (n=6 per group). Data are presented as mean ±SEM,##P\u003c0.01 vs Sham; **P\u003c0.01 vs Ang II.","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-694850/v1/7983fd93439b421641b0eff9.png"},{"id":11507873,"identity":"e4994884-8b75-4379-9159-a5a64c2dce3f","added_by":"auto","created_at":"2021-07-15 21:39:08","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":2079596,"visible":true,"origin":"","legend":"Naringenin (Nrg) ameliorated AngII-induced cardiac fibrosis in vivo.\n (A) Representative Masson-staining of the left ventricles to assess cardiac fibrosis and quantification of the fibrosis area in different groups (n=9 per group). (B) Western blot images and densitometric quantitation for Co1 I and α-SMA protein in different groups (n=6 per group). Data are presented as mean ±SEM,## P＜0.01 vs. Sham, **P＜0.01vs. AngII.","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-694850/v1/a7453d3c7f69fc8f93e99c4c.png"},{"id":11507872,"identity":"78a69693-aea2-4a91-9a1f-14031732ce7c","added_by":"auto","created_at":"2021-07-15 21:39:08","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":424785,"visible":true,"origin":"","legend":"Naringenin (Nrg) downregulated TGF-β1 signaling in vivo and in vitro. \n(A) Western blot images and densitometric quantitation for TGF-β1, phosphorylated (P-) Smad2 and P-Smad3 protein levels in heart tissues (n=6 per group). (B) Western blot images and densitometric quantitation for TGF-β1, phosphorylated (P-) Smad2 and P-Smad3 protein levels in cultured cardiomyocytes (n=6 per group). (C) Western blot images and densitometric quantitation for TGF-β1, phosphorylated (P-) Smad2 and P-Smad3 protein levels in cultured fibroblasts (n=6 per group). Data are presented as the mean ±SEM, ## P＜0.01 vs. Sham, **P＜0.01vs. AngII.","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-694850/v1/1705775bf50c99f6bb0d8c1b.png"},{"id":13704521,"identity":"8a40e7c3-90ba-4347-857b-298a8b9b6aa6","added_by":"auto","created_at":"2021-09-17 13:46:42","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2454131,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-694850/v1/f2c1fcba-692d-4f16-96ab-a638420eb1b6.pdf"}],"financialInterests":"","formattedTitle":"\u003cp\u003eNaringenin Protects Rats against Ang-II Induced Cardiac Hypertrophy and Fibrosis by Downregulating TGF-β1/Smads Signaling Pathways\u003c/p\u003e","fulltext":[{"header":"Introduction","content":"\u003cp\u003eCardiac remodeling is characterized by cardiac hypertrophy and fibrosis, which has been recognized as a key determinant of clinical outcome in heart disease [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Angiotensin II (AngII) is a crucial regulator of cardiac remodeling through inducing cardiomyocyte hypertrophy and proliferation and migration of cardiac fibroblasts (CFs). Transforming growth factor-β1 (TGF-β1) has been identified as a key regulator of extracellular matrix synthesis and degradation, which is believed to partially mediate AngII-induced cardiac remodeling [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eNaringenin (Nrg) is a flavonoid compound found in several plant foods including citrus fruit, tomatoes and figs. Nrg has been identified as a potential therapeutic agent as it demonstrates anticancer [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e], anti-inflammation [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e], anti-atherogenic [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e] and antimicrobial [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e] effect. Previous studies have reported that Nrg ameliorates cardiac hypertrophy induced by high glucose [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e] [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e] and pressure overload [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Although Nrg inhibits TGF-β1 signaling and the subsequent Smad3 phosphorylation for the downstream signal transduction [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e], whether Nrg modifies AngII-induced cardiac remodeling through TGF-β1/Smad signaling pathway remains elusive.\u003c/p\u003e \u003cp\u003eThis study therefore explored the possible prevention by Nrg of cardiac remodeling in vivo, using the AngII-induced rat model, and in vitro on cardiomyocytes and CFs stimulated by AngII plus Nrg.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n\u003ch2\u003eMaterials\u003c/h2\u003e\n\u003cp\u003eNaringenin, AngII, 3-[4,5-dimethyl-thiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT), Antibiotic-antimycotic solution (10,000 units/ml of penicillin, 10,000\u0026micro;g/ml of streptomycin), and Tris were purchased from Sigma-Aldrich (St. Louis, MO, USA). Trizol Reagent was purchase from Invitrogen (USA). All-In-One RT Mastermix and EvaGreen qPCR MaterMix were purchased from ABM (Canada). Antibodies against ANP, \u0026beta;-MHC, TGF-\u0026beta;1, Smad2/3, phospho-Smad2/3 (p-Smad3), and GAPDH were purchased from Abcam CO (Cambrige, UK).\u003c/p\u003e\n\u003c/div\u003e\n\u003ch2\u003eAnimal\u003c/h2\u003e\n\u003cp\u003eMale 8-week-old male Sprague Dawley (SD) rats (150\u0026ndash;180 g body weight) were purchased from Beijing Vital River Laboratory Animal Technology Company (Beijing, China). All experiments involving rats were approved by the Institutional Animal Care Research Advisory Committee of the National Institute of Biological Science (NIBS) and Animal Care Committee of Zhengzhou University. All rats were kept under a 12-hr light/dark cycle with free access to water and food.\u003c/p\u003e\n\u003ch2\u003eExperimental Design And Treatment Protocol\u003c/h2\u003e\n\u003cp\u003eA rat model of AngII infusion induced cardiac remodeling was established as described previously [\u003cspan class=\"CitationRef\"\u003e11\u003c/span\u003e]. In brief, SD rats were quickly anesthetized with an intraperitoneal injection of sodium pentobarbital (50 mg/kg), then the prefilled osmotic minipumps (Alzet, Model 2002) were implanted into the subcutaneous tissue to deliver AngII (Sigma-Aldrich, A9525) at 400 ng/kg/min for 4 weeks. Rats were randomly assigned to one of the following groups: the sham group (n\u0026thinsp;=\u0026thinsp;10) received subcutaneous injections of phosphate buffer (PBS) for 4 weeks; the AngII group (n\u0026thinsp;=\u0026thinsp;10) received subcutaneous injections of AngII (400 ng/kg/min) via osmotic minipumps; the AngII\u0026thinsp;+\u0026thinsp;Nrg group (n\u0026thinsp;=\u0026thinsp;10) received naringenin by gavage (100mg/kg/day) plus the daily injections of Ang as above.\u003c/p\u003e\n\u003ch2\u003eEchocardiographic Study\u003c/h2\u003e\n\u003cp\u003eTransthoracic echocardiography was used to measure left ventricular (LV) function variables one day before killing. Briefly, rats were placed in a supine position after the induction of general anesthesia. Rats were underwent transthoracic two dimensional guided M-mode echocardiography with a 12L MHz transducer (Sibiscape Co. Ltd.). From the cardiac short axis, the LV anterior wall end-diastolic thickness (LVAWd), the systolic LV anterior wall thickness (LVAWs),the LV internal dimension at end-diastole (LVIDd), the LV internal dimension at end-systole (LVIDs), the LV posterior wall end-diastolic thickness (LVPWd), the LV posterior wall end-systolic thickness (LVPWs) were measured. Echocardiographic measurements were averaged from at least three separate cardiac cycles.\u003c/p\u003e\n\u003ch2\u003eHeart Histological Analysis\u003c/h2\u003e\n\u003cp\u003eThe left ventricle were fixed in 10% formalin and embedded in paraffin, and subsequently were sectioned at 4\u0026micro;m and stained with Masson to evaluate the cardiac collagen deposition. To evaluate the size of cardiomyocytes, tissue sections were stained with 1.0 mg/ml Alexa Fluor 488\u0026reg; conjugate of wheat germ agglutinin (WGA) solution (MolecularProbes, Eugene, OR, USA). Ten fields in each region of the heart were selected randomly from four nonconsecutive serial sections, and collagen content was quantified by measuring the total blue area per square millimeter using the ImageJ.\u003c/p\u003e\n\u003ch2\u003eNeonatal Rat Ventricular Cardiomyocytes Isolation, Culture And Treatment\u003c/h2\u003e\n\u003cp\u003eNeonatal rat ventricular cardiomyocytes and CFs were obtained from the hearts of 1\u0026ndash;2 days old SD rats as described previously [\u003cspan class=\"CitationRef\"\u003e12\u003c/span\u003e]. In brief, the ventricles of neonatal rats were harvested after killed by decapitation, and then were cut into ~\u0026thinsp;1mm\u003csup\u003e3\u003c/sup\u003e pieces in a dish with cold PBS. 0.125% and 0.05% collagenase type I were used to dissociate cardiomyocytes and fibroblasts. Cells were cultured in DMEM with 15% FBS, 100 U/mL penicillin and 100 \u0026micro;g/mL streptomycin in a humidified atmosphere of 5% CO\u003csub\u003e2\u003c/sub\u003e and 95% air at about 37℃. Naringenin were dissolved in dimethyl sulfoxide (DMSO) and diluted with DMEM. Cells were incubated with Nrg (0.1, 1, 10\u0026micro;M) with or without AngII 10uM for 24 h in a 6 well plate. Cell surface area analysis was performed using confocal microscopy as described previously [\u003cspan class=\"CitationRef\"\u003e13\u003c/span\u003e].\u003c/p\u003e\n\u003ch2\u003eMethylthiazolyl Tetrazolium Assay For Cell Viability\u003c/h2\u003e\n\u003cp\u003eCells were cultured at a density of 4\u0026ndash;5 x 10\u003csup\u003e4\u003c/sup\u003e cells per well in 96-well plates for 24 h. The cells were treated with different concentrations of Nrg for 24 h. And then cell viability was determined by the MTT reduction assay. Cells were incubated with MTT solution (5 mg/mL) for 4 h at 37\u0026deg;C. The dark blue formazan crystals that formed in intact cells were solubilized with 150 \u0026micro;L of DMSO, and the absorbance at 490 nm was measured with a microplate reader (Bio-Rad, Hercules, CA, USA).\u003c/p\u003e\n\u003ch2\u003eWestern Blotting\u003c/h2\u003e\n\u003cdiv class=\"Heading\"\u003eThe heart tissues or cells were lysed by RIPA lysis buffer and the protein concentration was detected by using a BCA protein assay kit. Protein (30\u0026micro;g) were separated using 10% SDS-PAGE and then were transferred onto a polyvinylidene difluoride membrane (PVDF). Next, PVDF membranes were blocked with 5% fat-free milk and incubated with primary antibodies overnight at 4℃. Subsequently, the membranes were washed and incubated with secondary antibodies at room temperature. The optical density of the bands was visualized by an ECL system (Pierce). GAPDH was used as an endogenous control. Data was normalized to GAPDH levels.\u003c/div\u003e\n\u003ch2\u003eRna Isolation And Quantitative Real-time Pcr\u003c/h2\u003e\n\u003cp\u003eTotal RNA was extracted from the frozen tissues or cultured cells using Trizol reagent (Invitrogen, USA). First strand cDNA was synthesized using an RT kit (Invitrogen, USA). qPCR analysis were performed in a MiniOpticon Real-Time PCR Detection System (BioRad Laboratories, USA). Results were expressed as fold differences relative to GAPDH using the 2-\u0026Delta;\u0026Delta;CT method. All the primers were synthesized by Sangon Biotech (Shanghai, China) and the sequence are listed in Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003ctable id=\"Tab1\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003ePrimers used for reverse transcription and real-time PCR\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003ePrimer Names\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\u0026nbsp;\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eSequences\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eANP\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eSense\u003c/p\u003e\n\u003cp\u003eAnti-Sense\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCCTTCTCCATCACCAA\u003c/p\u003e\n\u003cp\u003eTGTTATCTTCGGTACCG\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u0026beta;-MHC\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eSense\u003c/p\u003e\n\u003cp\u003eAnti-Sense\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eGCCGAGTCCCAGGTCAACAA\u003c/p\u003e\n\u003cp\u003eGTAATTCGAGGGCAGGAACCC\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u0026alpha;-SMA\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eSense\u003c/p\u003e\n\u003cp\u003eAnti-Sense\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eGCAAACAGGAATACGACGAAGC\u003c/p\u003e\n\u003cp\u003eGCTTTGGGCAGGAATGATTTG\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCo1 I\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eSense\u003c/p\u003e\n\u003cp\u003eAnti-Sense\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eACTCAGCCCTCTGTGCCT\u003c/p\u003e\n\u003cp\u003eCCTTCGCTTCCATACTCG\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eGAPDH\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eSense\u003c/p\u003e\n\u003cp\u003eAnti-Sense\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eGACATCAAGAAGGTGGTGAAGC\u003c/p\u003e\n\u003cp\u003eTGTCATTGAGAGCAATGCCAGC\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n\u003ch2\u003eStatistical analysis\u003c/h2\u003e\n\u003cp\u003eAll data are presented as means\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM. SPSS 21.0 was used to perform statistical analysis of the data. Statistical differences were calculated with the 2-tailed Student t test when comparing 2 conditions, and ANOVA was used when comparing ༞2 conditions. A value of P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\n\u003ch2\u003eNrg alleviated AngII-induced proliferation and collagen expression of CFs\u003c/h2\u003e\n\u003cp\u003eFirstly, we detected the cytotoxicity of Nrg on CFs. The results of methylthiazolyl tetrazolium assay showed that Nrg had no cytotoxic effects on CFs at concentrations less than 200\u0026micro;M (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eA). Thus, in the following experiments, Nrg concentrations of 200\u0026micro;M were chosen. Then, we examined whether Nrg could inhibit AngII induced proliferation of CFs. CFs were pretreated with Nrg (200\u0026micro;M) following with AngII (0.1\u0026micro;M) for 72h. Our results demonstrated that Nrg could inhibit AngII-induced proliferation of CFs in a concentration-dependent manner (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eB). Then we examined the effect of Nrg on collagen expression in cardiac fibroblasts (CFs). Following AngII administration, the fibrotic markers \u0026alpha;-SMA and Col1a1 gene expression were increased in CFs, and Nrg treatment prevented AngII induced CF collagen expression (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eC and D).\u003c/p\u003e\n\u003c/div\u003e\n\u003ch2\u003eNrg Attenuated Angii-induced Cardiomyocyte Growth In Cultured Cardiomyocytes\u003c/h2\u003e\n\u003cp\u003eTo assess the protective role of Nrg on the development of cardiac hypertrophy, cardiomyocytes were treated with AngII 0.1\u0026micro;M for 24 h, and cell surface area and hypertrophic markers were measured. AngII treatment induced significant increase of hypertrophic markers (ANP and\u0026beta;-MHC) and cell surface area compared to the control group (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eB, C and D). However, compared with AngII group, combined treatment with Nrg significantly reversed AngII-induced increases of hypertrophic markers (ANP and \u0026beta;-MHC) and cell surface area (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eB, C and D).\u003c/p\u003e\n\u003ch2\u003eNrg Ameliorated Angii-induced Cardiac Hypertrophy\u003c/h2\u003e\n\u003cp\u003eHere we analyzed cardiac effects of Nrg treatment in an animal model of AngII-induced cardiac hypertrophy in rats. AngII infusion rats showed a significant increase in the ratio of weight/tibia length (HW/TL), and the cell size of cardiomyocytes (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eA and D). Examination by echocardiography revealed that the thickness of the left ventricular post wall at the end-diastole (LVPWd) and the end-systole (LVPWs) was higher in AngII infusion rats (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eB and C). Compared with AngII group, Nrg treatment markedly ameliorated AngII-induced cardiac hypertrophy, as demonstrated by a significantly decrease in HW/TL, cardiomyocyte size, the thickness of the left ventricular post wall at the end-diastole (LVPWd) and the end-systole (LVPWs) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eA, B, C and D). Meanwhile, AngII infusion induced increased protein levels of ANP and \u0026beta;-MHC, while their expression was inhibited in Nrg-treated rat (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eE).\u003c/p\u003e\n\u003ch2\u003eNrg Attenuated Angii-induced Cardiac Fibrosis\u003c/h2\u003e\n\u003cp\u003eTo determine the effect of Nrg on cardiac fibrosis, heart sections were stained with Masson\u0026rsquo;s staining. Quantitative data revealed increased collagen deposition in AngII-induced rats, while was significantly attenuated in Nrg-treated rats (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eA). As showed in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eB, AngII infusion induced a significant increase in protein levels of \u0026alpha;-SMA and Col I, and Nrg treatment reversed cardiac fibrosis as evidenced by a decreased in collagen deposition and \u0026alpha;-SMA and Col I protein level (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eA and B). Collectively, Nrg treatment can attenuated AngII-induced cardiac hypertrophy and fibrosis.\u003c/p\u003e\n\u003ch2\u003e\u003cstrong\u003eSuppression of TGF-\u0026beta;1/Smad2/3 signaling contributes to the anti-hypertrophy effect of Nrg\u003c/strong\u003e\u003c/h2\u003e\n\u003cp\u003eFurthermore, we explored the mechanism underlying the anti-hypertrophy effect of Nrg. As shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eA, the expression of TGF-\u0026beta;1 and phosphorylated Smad2/3 were increased in AngII-induced rat model, which could be attenuated by treatment with Nrg. In cultured cardiomyocytes and cardiac fibroblasts, AngII induced upregulation of TGF-\u0026beta;1 and phosphorylated Smad2/3 (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eB and C), and Nrg treatment inhibited TGF-\u0026beta;1/Smad2/3 signaling as evidenced by attenuating protein expression of TGF-\u0026beta;1 and phosphorylated Smad2/3 (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eB and C).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eCardiac remodeling is a major driving force in the development and progression of cardiovascular diseases including cardiac hypertrophy, heart failure and myocardial infarction. However, no therapeutic intervention directly targets the fibrotic response. A better understanding of the mechanisms underlying cardiac remodeling is important for developing more effective diagnostic and therapeutic strategies. In the present study, one of the important findings is that Nrg treatment markedly improved AngII-induced cardiac hypertrophy and fibrosis through downregulating TGF-β1 signaling pathway.\u003c/p\u003e \u003cp\u003eAngII, the main effector peptide of renin-angiotensin system (RAS), has been shown to induce TGF-β1 expression and its subsequent signaling and mediates cardiac remodeling [\u003cspan additionalcitationids=\"CR15\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Pharmacological inhibition of angiotensin converting enzyme and AngII receptor have shown their therapeutic effects for cardiac remodeling [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Our previous study also demonstrated that suppressing TGF-β1/Smads signaling pathway inhibits cardiac fibrosis and improves cardiac function [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Nrg, a natural flavanone with many pharmacological effects, has been proved to reduce Smad3 phosphorylation and expression in the presence of TGF-β1 [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e], and exerted anti-fibrosis effect [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. In this work, we therefore attempted to characterize the potential role of TGF-β1 signaling pathway in Nrg inhibition of Ang II-induced cardiac remodeling \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e. Our results showed that Nrg markedly improved AngII-induced cardiac hypertrophy and fibrosis through inhibiting the TGF-β1 signaling pathway. Thus, our result suggest that Nrg might play a protective role in AngII-mediated cardiac remodeling by targeting the TGF-β1 signaling pathway.\u003c/p\u003e \u003cp\u003eHowever, it remains obscure what\u0026rsquo;s the inhibition mechanism of Nrg on the AngII-TGF-β1 signaling pathway. One possible explanation is that Nrg can reduced the binding probability of TGF-β1 to its specific TGF-β1 type II receptor (TβRII). TGF-β1 binding to TβRII is the initial step of TGF-β signaling. Thus the effect of Nrg on TGF-β ligand-receptor interaction induced inhibition of the receptor dimerization and activation for the signaling complex formation and the subsequent Smad3 phosphorylation for the downstream signal transduction [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e].\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eIn present study, we arrived at a conclusion that Nrg targeting TGF-β1/Smad signaling pathway, and promoted cardiac hypertrophy and fibrosis in AngII-induced rats. Our study supports the notion Nrg has the potential to be developed as a novel inhibitor target for TGF-β signaling, and might be considered as potential prevention strategy for cardiac hypertrophy and fibrosis.\u003c/p\u003e \u003cp\u003eOur results might help to deepen the understanding of the role and function of TGF-β signaling in cardiac hypertrophy. These findings offer important insights into fundamental mechanisms underlying functions of Nrg, meanwhile, would provide a potential therapeutic targets for cardiac hypertrophy.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eNrg: Narinngenin; SD: Sprague Dawley; Transforming growth factor-\u0026beta;1 (TGF-\u0026beta;1); LV: left ventricular;LVAWd: the LV anterior wall end-diastolic thickness; LVAWs: the systolic LV anterior wall thickness; LVIDs: the LV internal dimension at end-systole; LVPWd: the LV posterior wall end-diastolic thickness; LVPWs: the LV posterior wall end-systolic thickness; WGA: wheat germ agglutinin; PVDF: polyvinylidene difluoride membrane; CFs: cardiac fibroblasts.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgment\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by Joint project of Medical Science and Technology Research of Henan (Grant No. LHGJ20190099).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated of analyzed during this study are included in this published article or are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor\u0026rsquo;s contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHDL designed the study; XWC and XZ conducted the experiments; HW did sample analysis and data analysis, HDL wrote the manuscript; HDL revised the paper. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was approved by the ethics committee of Zhengzhou University.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no conflicts of interest to disclose.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eLuscher TF: \u003cstrong\u003ePredictors as well as surrogate and hard endpoints in cardiovascular disease.\u003c/strong\u003e\u003cem\u003eEur Heart J \u003c/em\u003e2015, \u003cstrong\u003e36:\u003c/strong\u003e2197-2199.\u003c/li\u003e\n\u003cli\u003eRosenkranz S: \u003cstrong\u003eTGF-beta1 and angiotensin networking in cardiac remodeling.\u003c/strong\u003e\u003cem\u003eCardiovasc Res \u003c/em\u003e2004, \u003cstrong\u003e63:\u003c/strong\u003e423-432.\u003c/li\u003e\n\u003cli\u003eShi X, Luo X, Chen T, Guo W, Liang C, Tang S, Mo J: \u003cstrong\u003eNaringenin inhibits migration, invasion, induces apoptosis in human lung cancer cells and arrests tumour progression in vitro.\u003c/strong\u003e\u003cem\u003eJ Cell Mol Med \u003c/em\u003e2021, \u003cstrong\u003e25:\u003c/strong\u003e2563-2571.\u003c/li\u003e\n\u003cli\u003eWang Q, Ou Y, Hu G, Wen C, Yue S, Chen C, Xu L, Xie J, Dai H, Xiao H, et al: \u003cstrong\u003eNaringenin attenuates non-alcoholic fatty liver disease by down-regulating the NLRP3/NF-kappaB pathway in mice.\u003c/strong\u003e\u003cem\u003eBr J Pharmacol \u003c/em\u003e2020, \u003cstrong\u003e177:\u003c/strong\u003e1806-1821.\u003c/li\u003e\n\u003cli\u003eBurke AC, Sutherland BG, Telford DE, Morrow MR, Sawyez CG, Edwards JY, Drangova M, Huff MW: \u003cstrong\u003eIntervention with citrus flavonoids reverses obesity and improves metabolic syndrome and atherosclerosis in obese Ldlr(-/-) mice.\u003c/strong\u003e\u003cem\u003eJ Lipid Res \u003c/em\u003e2018, \u003cstrong\u003e59:\u003c/strong\u003e1714-1728.\u003c/li\u003e\n\u003cli\u003eNahmias Y, Goldwasser J, Casali M, van Poll D, Wakita T, Chung RT, Yarmush ML: \u003cstrong\u003eApolipoprotein B-dependent hepatitis C virus secretion is inhibited by the grapefruit flavonoid naringenin.\u003c/strong\u003e\u003cem\u003eHepatology \u003c/em\u003e2008, \u003cstrong\u003e47:\u003c/strong\u003e1437-1445.\u003c/li\u003e\n\u003cli\u003eZhang J, Qiu H, Huang J, Ding S, Huang B, Zhou P, Jiang Q: \u003cstrong\u003eEETs/PPARs activation together mediates the preventive effect of naringenin in high glucose-induced cardiomyocyte hypertrophy.\u003c/strong\u003e\u003cem\u003eBiomed Pharmacother \u003c/em\u003e2019, \u003cstrong\u003e109:\u003c/strong\u003e1498-1505.\u003c/li\u003e\n\u003cli\u003eYou Q, Wu Z, Wu B, Liu C, Huang R, Yang L, Guo R, Wu K, Chen J: \u003cstrong\u003eNaringin protects cardiomyocytes against hyperglycemia-induced injuries in vitro and in vivo.\u003c/strong\u003e\u003cem\u003eJ Endocrinol \u003c/em\u003e2016, \u003cstrong\u003e230:\u003c/strong\u003e197-214.\u003c/li\u003e\n\u003cli\u003eZhang N, Yang Z, Yuan Y, Li F, Liu Y, Ma Z, Liao H, Bian Z, Zhang Y, Zhou H, et al: \u003cstrong\u003eNaringenin attenuates pressure overload-induced cardiac hypertrophy.\u003c/strong\u003e\u003cem\u003eExp Ther Med \u003c/em\u003e2015, \u003cstrong\u003e10:\u003c/strong\u003e2206-2212.\u003c/li\u003e\n\u003cli\u003eYang Y, Xu Y, Xia T, Chen F, Zhang C, Liang W, Lai L, Fang X: \u003cstrong\u003eA single-molecule study of the inhibition effect of Naringenin on transforming growth factor-beta ligand-receptor binding.\u003c/strong\u003e\u003cem\u003eChem Commun (Camb) \u003c/em\u003e2011, \u003cstrong\u003e47:\u003c/strong\u003e5440-5442.\u003c/li\u003e\n\u003cli\u003eLi H, Xu JD, Fang XH, Zhu JN, Yang J, Pan R, Yuan SJ, Zeng N, Yang ZZ, Yang H, et al: \u003cstrong\u003eCircular RNA circRNA_000203 aggravates cardiac hypertrophy via suppressing miR-26b-5p and miR-140-3p binding to Gata4.\u003c/strong\u003e\u003cem\u003eCardiovasc Res \u003c/em\u003e2020, \u003cstrong\u003e116:\u003c/strong\u003e1323-1334.\u003c/li\u003e\n\u003cli\u003eTang CM, Liu FZ, Zhu JN, Fu YH, Lin QX, Deng CY, Hu ZQ, Yang H, Zheng XL, Cheng JD, et al: \u003cstrong\u003eMyocyte-specific enhancer factor 2C: a novel target gene of miR-214-3p in suppressing angiotensin II-induced cardiomyocyte hypertrophy.\u003c/strong\u003e\u003cem\u003eSci Rep \u003c/em\u003e2016, \u003cstrong\u003e6:\u003c/strong\u003e36146.\u003c/li\u003e\n\u003cli\u003eTse MM, Aboutabl ME, Althurwi HN, Elshenawy OH, Abdelhamid G, El-Kadi AO: \u003cstrong\u003eCytochrome P450 epoxygenase metabolite, 14,15-EET, protects against isoproterenol-induced cellular hypertrophy in H9c2 rat cell line.\u003c/strong\u003e\u003cem\u003eVascul Pharmacol \u003c/em\u003e2013, \u003cstrong\u003e58:\u003c/strong\u003e363-373.\u003c/li\u003e\n\u003cli\u003eEverett AD, Tufro-McReddie A, Fisher A, Gomez RA: \u003cstrong\u003eAngiotensin receptor regulates cardiac hypertrophy and transforming growth factor-beta 1 expression.\u003c/strong\u003e\u003cem\u003eHypertension \u003c/em\u003e1994, \u003cstrong\u003e23:\u003c/strong\u003e587-592.\u003c/li\u003e\n\u003cli\u003eKupfahl C, Pink D, Friedrich K, Zurbrugg HR, Neuss M, Warnecke C, Fielitz J, Graf K, Fleck E, Regitz-Zagrosek V: \u003cstrong\u003eAngiotensin II directly increases transforming growth factor beta1 and osteopontin and indirectly affects collagen mRNA expression in the human heart.\u003c/strong\u003e\u003cem\u003eCardiovasc Res \u003c/em\u003e2000, \u003cstrong\u003e46:\u003c/strong\u003e463-475.\u003c/li\u003e\n\u003cli\u003eSchultz Jel J, Witt SA, Glascock BJ, Nieman ML, Reiser PJ, Nix SL, Kimball TR, Doetschman T: \u003cstrong\u003eTGF-beta1 mediates the hypertrophic cardiomyocyte growth induced by angiotensin II.\u003c/strong\u003e\u003cem\u003eJ Clin Invest \u003c/em\u003e2002, \u003cstrong\u003e109:\u003c/strong\u003e787-796.\u003c/li\u003e\n\u003cli\u003eDiez J, Querejeta R, Lopez B, Gonzalez A, Larman M, Martinez Ubago JL: \u003cstrong\u003eLosartan-dependent regression of myocardial fibrosis is associated with reduction of left ventricular chamber stiffness in hypertensive patients.\u003c/strong\u003e\u003cem\u003eCirculation \u003c/em\u003e2002, \u003cstrong\u003e105:\u003c/strong\u003e2512-2517.\u003c/li\u003e\n\u003cli\u003eMeng Z, Li HY, Si CY, Liu YZ, Teng S: \u003cstrong\u003eAsiatic acid inhibits cardiac fibrosis throughNrf2/HO-1 and TGF-beta1/Smads signaling pathways in spontaneous hypertension rats.\u003c/strong\u003e\u003cem\u003eInt Immunopharmacol \u003c/em\u003e2019, \u003cstrong\u003e74:\u003c/strong\u003e105712.\u003c/li\u003e\n\u003cli\u003eLiu X, Wang W, Hu H, Tang N, Zhang C, Liang W, Wang M: \u003cstrong\u003eSmad3 specific inhibitor, naringenin, decreases the expression of extracellular matrix induced by TGF-beta1 in cultured rat hepatic stellate cells.\u003c/strong\u003e\u003cem\u003ePharm Res \u003c/em\u003e2006, \u003cstrong\u003e23:\u003c/strong\u003e82-89.\u003c/li\u003e\n\u003cli\u003eDu G, Jin L, Han X, Song Z, Zhang H, Liang W: \u003cstrong\u003eNaringenin: a potential immunomodulator for inhibiting lung fibrosis and metastasis.\u003c/strong\u003e\u003cem\u003eCancer Res \u003c/em\u003e2009, \u003cstrong\u003e69:\u003c/strong\u003e3205-3212.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Naringenin, Cardiac hypertrophy, Cardiac fibrosis, TGF signaling pathway, Angiotensin II","lastPublishedDoi":"10.21203/rs.3.rs-694850/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-694850/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground\u003c/strong\u003e:Naringenin (Nrg), a flavone found in several plant foods with various biological properties, has been shown prevention of cardiac remodeling. However, themechanisms underlying this suppression of cardiac remodeling has not been known clearly.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eMethods\u003c/strong\u003e: Male Sprague Dawley (SD) rats were AngII infused via osmotic minipumps for 4 weeks and were given Nrg by gavage (100mg/kg/day) at the same time. In vitro experiments used cardiomyocyte and cardiac fibroblasts(CF) treated with AngII or AngII plus Nrg.Cardiac remodeling was assessed using the echocardiography and histological analysis. And, the effect of Nrg on TGF-β1/Smadssignaling pathway was investigated.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eResults\u003c/strong\u003e: Treatmentwith Nrg(100mg/kg/day) decreased the ratio of heart weight to tibia length and hypertrophy markers in rats given AngII infusion. In vitro experiments demonstrated that AngII-induced cardiomyocyte hypertrophy and proliferation of CFs were significantly inhibited by Nrg administration. Nrg inhibited activation of the TGF-β1/Smad2/3 signaling pathway stimulated by AngII. \u003c/p\u003e\u003cp\u003e\u003cstrong\u003eConclusions\u003c/strong\u003e: Nrgsupplementation prevented cardiac remodeling via down-regulating the TGF-β1/Smad2/3 signaling pathway both in cardiomyocyte and CFs, and attenuating cardiac remodeling in AngII-induced rats model.\u003c/p\u003e","manuscriptTitle":"Naringenin Protects Rats against Ang-II Induced Cardiac Hypertrophy and Fibrosis by Downregulating TGF-β1/Smads Signaling Pathways","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2021-07-15 21:39:06","doi":"10.21203/rs.3.rs-694850/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"5e44b145-fdcb-4f20-a6bb-46306fe150fb","owner":[],"postedDate":"July 15th, 2021","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":5696858,"name":"Nutrition \u0026 Dietetics"}],"tags":[],"updatedAt":"2021-07-25T12:40:55+00:00","versionOfRecord":[],"versionCreatedAt":"2021-07-15 21:39:06","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-694850","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-694850","identity":"rs-694850","version":["v1"]},"buildId":"cBFmMYwuxLRRLfASyISRj","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}