Expression and Mechanism of TRPV1 Channel in Prefrontal Cortex after Acute Hypoxic Exercise

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

Abstract Objective This study aims to explore TRPV1's function in acute hypoxic exercise and the CNS's impact on initial exercise decline in high-altitude-trained athletes. Methods After acute hypoxia intervention, RTqPCR was employed to detect the content of transient receptor potential vanilloid subtype 1 (TRPV1) and 5-hydroxytryptamine1A(5-HT1A) in the rat prefrontal cortex; ELISA was used to measure the content of 5-hydroxytryptamine (5-HT) in the rat prefrontal cortex. Results Hypoxic conditions can shorten the time rats can perform increased load exercise, leading to an early onset of fatigue and a significant decline in exercise capacity. Acute hypoxic exercise has been observed to increase the expression of TRPV1, 5-HT and 5-HT1A in the prefrontal cortex, which may contribute to the decline in exercise capacity. Blocking TRPV1 and 5-HT1A further extending the time for increased load exercise under hypoxic conditions and enhancing exercise capacity. Conclusion Rats' initial decline in exercise during acute hypoxia may result from TRPV1 upregulation, which activates the 5-HT/5-HT1A pathway; TRPV1 blockade can alleviate the stress caused by hypoxic conditions, thereby reducing prefrontal cortex cell damage and apoptosis, and ultimately extending exercise time.
Full text 118,245 characters · extracted from preprint-html · click to expand
Expression and Mechanism of TRPV1 Channel in Prefrontal Cortex after Acute Hypoxic Exercise | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Expression and Mechanism of TRPV1 Channel in Prefrontal Cortex after Acute Hypoxic Exercise Jing Ma, Xing Huang, Lijing Gong, Yizhu Tang, Chi Xu This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6697572/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 19 Jan, 2026 Read the published version in BMC Sports Science, Medicine and Rehabilitation → Version 1 posted 10 You are reading this latest preprint version Abstract Objective This study aims to explore TRPV1's function in acute hypoxic exercise and the CNS's impact on initial exercise decline in high-altitude-trained athletes. Methods After acute hypoxia intervention, RTqPCR was employed to detect the content of transient receptor potential vanilloid subtype 1 (TRPV1) and 5-hydroxytryptamine1A(5-HT1A) in the rat prefrontal cortex; ELISA was used to measure the content of 5-hydroxytryptamine (5-HT) in the rat prefrontal cortex. Results Hypoxic conditions can shorten the time rats can perform increased load exercise, leading to an early onset of fatigue and a significant decline in exercise capacity. Acute hypoxic exercise has been observed to increase the expression of TRPV1, 5-HT and 5-HT1A in the prefrontal cortex, which may contribute to the decline in exercise capacity. Blocking TRPV1 and 5-HT1A further extending the time for increased load exercise under hypoxic conditions and enhancing exercise capacity. Conclusion Rats' initial decline in exercise during acute hypoxia may result from TRPV1 upregulation, which activates the 5-HT/5-HT1A pathway; TRPV1 blockade can alleviate the stress caused by hypoxic conditions, thereby reducing prefrontal cortex cell damage and apoptosis, and ultimately extending exercise time. TRPV1 5-HT 5-HT1A Acute hypoxic exercise Prefrontal corte Significance To provide a biological basis for studying the nutritional strategies to counteract physical decline in military personnel and adventurers during their initial ascent to high-altitude regions. 1. Introduction High altitude training, known for its efficacy in enhancing aerobic capacity, is extensively applied in elite athletic competition and general fitness programs. However, when compared to normoxic training, the duration of exercise to fatigue is shortened under hypoxic conditions[1], leading to an earlier onset of exercise fatigue. This results in athletes finding it difficult to maintain overall training intensity, and volume reduces the performance of military personnel stationed in high-altitude areas and weakens the exercise capacity of the general public engaging in fitness activities, which goes against the original purpose of high-altitude training. Regarding the issue of exercise capacity declining prematurely due to hypoxia, scholars have primarily focused on hypoxia's effects on cardiopulmonary capacity and muscle oxygen utilization. However, the decline in exercise capacity during hypoxic exercise is often the result of the combined action of the muscular system (peripheral fatigue), cardiovascular and respiratory systems, and the central nervous system (central fatigue)[2]. Existing studies have shown that the decline in exercise capacity upon first exposure to high altitude is closely related to central fatigue, primarily due to the harmful effects of acute hypoxia on the brain, which leads to a decrease in the ability to perform exercise tasks. Further hypoxia during exercise may affect the central nervous system by damaging brain oxygenation and motor cortex function[3][4], resulting in an earlier onset of exercise fatigue due to dual factors. Hemodynamic studies further prove the significant role of the prefrontal cortex in issuing motor stop commands[5][6], although its biological mechanism is not yet clear. Therefore, understanding the biological mechanism behind the early reduction in exercise capacity under hypoxic conditions is critically important. Ca 2+ is vital for the governance of central nervous system function, and the Ca 2+ overload hypothesis suggests that Ca 2+ contributes to the development of central fatigue. As a member of the calcium channel family, the transient receptor potential vanilloid 1 (TRPV1) has been shown to play a role in cerebral ischemic hypoxic injury[7]. Studies have demonstrated that TRPV1, when bound to a ligand, further activates TRPV1, leading to an increased influx of calcium ions and a higher intracellular calcium concentration, which in turn triggers various physiological or pathological reactions such as intracellular chemical sensing, neurogenic inflammation, presynaptic regulation of neurotransmitter release, and itchiness[8][9]. Furthermore, research indicates that a rise in brain serotonin (5-hydroxytryptamine, 5-HT) levels during extended exercise can impair central nervous system function, resulting in a decline in exercise performance[10]. 5-HT is regulated by various factors, including its synthesis rate-limiting enzyme, tryptophan hydroxylase (TPH), and the 5-hydroxytryptamine receptor 1A (5HT1A)[11]. The 5-HT1A receptor is one of the most important subtypes involved in serotonergic function and subjects engaging in strenuous exercise tend to experience faster fatigue when taking 5-HT1A receptor agonists[12][13]. TRPV1 is now believed to have broader functions in the central nervous system. Furthermore, studies have shown that TRPV1 and 5-HT play a role in exacerbating pain[14], and the upregulation or activation of TRPV1 expression can lead to the release of various local sensory neurotransmitters, including 5-HT, which further activate downstream nerves to transmit nerve impulses, resulting in increased visceral sensitivity and the development of hyperalgesia. Based on these findings, this study aims to investigate the roles of TRPV1, 5-HT1A, and 5-HT in the prefrontal cortex in issuing movement-stop instructions during acute hypoxia, and to explore whether the relationship between TRPV1 and 5-HT plays a crucial role in the biological mechanism of central fatigue. To achieve the above objectives, in this study, firstly, we investigated the expression of TRPV1, 5-HT and 5-HT1A after acute hypoxic exercise, and analyzed the role of prefrontal cortex in the signaling of exercise cessation. Second, TRPV1 inhibitor and 5-HT1A inhibitor were injected separately to explore the function of TRPV1 and its related mechanisms in acute hypoxic exercise. The effects of these different interventions on exercise duration in rats with acute hypoxic exercise were analyzed, further confirming the involvement of TRPV1 and 5-HT.The roles of 5-HT and 5-HT1A in acute hypoxic exercise will be further elucidated in terms of their biological mechanisms. 2. Related Works 2.1Test indicators and methods This study utilized a double-blind experimental design.Animals used in this study were treated strictly according to national and regional ethical guidelines. In the study, forty-eight male Wistar rats, weighing between 280 and 300 grams, were chosen as the subjects for research, purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. The study was approved by the Ethics Committee (approval number 2020176). Four rats per cage were placed in standard cages, with the room temperature maintained at 20–24°C, a relative humidity of 40–60%, and a 12-hour light/12-hour dark cycle implemented. Animals were fed standard feed according to national standards, and the water and food intake were not controlled. The rats were randomly divided into 6 groups with single blindness: normoxic rest group (O, n = 8), normoxic exhaustion group (OE, n = 8), hypoxic exercise rest group (H, n = 8), hypoxic exercise exhaustion group (HE, n = 8), hypoxic exercise exhaustion + AMG9810 group (HE1, n = 8), and hypoxic exercise exhaustion + WAY100635 group (HE5, n = 8). In the inhibitor groups, since the study involved exercise-induced exhaustion in rats, intracranial injection of inhibitors could affect the rats’ mobility. Considering the feasibility of practical application, intraperitoneal injection was employed in this study. The corresponding inhibitors were administered intraperitoneal injection 30 minutes before exercise (0.5 mg/kg body weight). Subsequently, the rats underwent incremental load exercise until exhaustion. Anesthesia was induced with an intraperitoneal injection of 3% pentobarbital sodium solution (12.5 ml/kg body weight). After the animals were sedated, blood samples were drawn from the abdominal aorta. Subsequently, the animals were euthanized using cervical dislocation following anesthesia, and then brain tissue was promptly harvested. After the experiment, histological analysis, including Elisa and RT-qPCR, was performed on the brain tissue. Euthanasia was planned for rats that exhibited weight loss, lethargy, or respiratory distress, but it was not carried out. 2.2 Rat's Adaptive Treadmill Training Program The rats underwent 5 days of adaptive treadmill training, running at a speed of 10 meters per minute for 15 minutes each day. 2.3 Rat incremental load exercise program The rat exercise protocol was adapted from Leandro's model for assessing maximal oxygen uptake in Wistar rats. In this study, we followed Leandro's protocol for maximal oxygen uptake testing in rats. The rats were subjected to an incremental exercise protocol on a treadmill with a 10° incline, starting at a speed of 5 m/min for 4 minutes and then increasing the speed by 5 m/min every 3 minutes until they could no longer maintain their pace under electrical stimulation. The maximum speed reached was 50 m/min[15]. Exhaustion was determined when the rats were unable to continue running on the treadmill under electrical stimulation conditions. 2.4 Material drawing Administer a 3% solution of sodium pentobarbital intraperitoneally (12.5 ml/kg body weight) to induce anesthesia. Once the animal is sedated, collect blood samples from the abdominal aorta and promptly extract the brain tissue. 2.5 Enzyme-Linked Immunosorbent Assay In this experiment, a rat 5-HT ELISA kit was employed, and the procedure was as follows: (1) Standardization of Protein Concentration To ensure consistency in ELISA results, tissue samples were first extracted for protein and standardized in concentration. A 50:1 ratio of pre-chilled PBS buffer was mixed with a protease inhibitor cocktail, and 250 µl of PBS buffer was added to each sample. The samples were then homogenized and centrifuged at 4°C at 12,000 rpm for 10 minutes to obtain the supernatant for BCA protein quantification. (2) Protein Concentration Determination According to the instructions provided with the BCA protein quantification kit, the protein standard solution was prepared, and the lysate was chilled on ice. A standard curve was plotted using the standard protein content and absorbance values. (3) Protein Concentration Standardization PBS buffer was replenished, and the protein concentration of the samples was standardized to 400 µg/ml (using the sample with the lowest concentration as the reference). The standardized samples were then subjected to ELISA according to the instructions provided with the ELISA kit. The specific procedure followed the detailed instructions in the ELISA kit manual. 2.6 Measurement of relative expression of TRPV1 and 5-HT1A mRNA 2.6.1. Primer design. As shown in Table 1 , primer sequences for the corresponding genes were designed through NCBI’s Prime-BLAST search and detected using Oligo7.0 software. All primers were synthesized at Shanghai Sangon Biotech Co., Ltd. The synthesized upstream and downstream primers were replicated and stored at -20°C for future use. Table 1 Detection of Gene Primers Gene Upstream primer Downstream Primers TRPV1 AGGACCCAGGCAACTGTG ATCCCTCAGAAGGGGAACC 5HT1A TGTTGCTCATGCTGGTTCTCTAC CTGACAGTCTTGCGGATTCG 2.6.2. Extraction and quantification of total RNA concentration. A segment of the prefrontal cortex was immersed in RNA Later solution and stored at -20°C for RNA extraction at a later stage. Total RNA was extracted from the rat's prefrontal cortex using the RNAprep Pure Tissue Kit (TIANGEN BIOTECH), following the kit's specified protocols. 2.6.3. RT-PCR reaction The cDNA synthesis was performed as per the protocol outlined in the Prime ScriptTM RT MasterMix Kit (Takara) brochure, resulting in the creation of cDNA. 2.7 Statistical Analyses Statistical analyses were performed using SPSS Statistics. The following data analysis methods were employed in this study: A two-way analysis of variance (ANOVA) was performed on each indicator data, with one factor being the testing environment and the other being exercise intensity. Based on the interaction test, there was no interaction between the two factors; therefore, post hoc comparisons were conducted using Tukey’s test. Independent samples t-tests were used for comparisons between two groups, and one-way analysis of variance (ANOVA) was used for comparisons among multiple groups. 3 Research result 3.1 Rat exhaustion time As shown in Table 2 , there was a statistically significant reduction in exercise time in the HE group compared to the OE group. This finding further indicates that the hypoxic conditions contributed to a decrease in exercise duration and a decline in the exercise capacity of the rats, confirming the successful establishment of the hypoxic exercise fatigue model in this study. Following the administration of AMG9810, the rats in the HE + AMG9810 group exhibited a notably extended time to exhaustion compared to the HE group. Similarly, after the administration of WAY100635, the rats in the HE + WAY100635 group demonstrated a significantly longer duration of exercise to exhaustion than those in the HE group. These results suggest that both AMG9810 and WAY100635 are effective in delaying exercise exhaustion in rats. Table 2 Rat Exhaustion Exercise Timetable Group Time(min) OE 114.17 ± 33.58 HE 49.29 ± 8.06 ** HE + AMG9810 76.17 ± 30.68 ## HE + WAY100635 76.17 ± 19.52 ## Note:*Indicates comparison with OE, p < 0.05,**Indicates comparison with OE, p < 0.01.#Indicates comparison with HE, p < 0.01,##Indicates comparison with HE, p < 0.01. 3.2 RTqPCR results of TRPV1 in the prefrontal cortex during acute hypoxic exercise Table 3 shows that under normoxic conditions, the expression of TRPV1 mRNA does not show a statistically significant difference in the OE group compared to the O group. In hypoxic conditions, the expression of TRPV1 was significantly upregulated in the HE group compared to the H group. Across different oxygen environments, the expression of TRPV1 mRNA is not significantly different in the OE group compared to the O group. and it was also not significantly different in the HE group compared to the OE group. Table 3 Relative expression of TRPV1mRNA in rat prefrontal cortex Group TRPV1mRNA O 1.09 ± 0.11 OE 1.26 ± 0.25 H 1.14 ± 0.27 HE 1.39 ± 0.22* Note: * Indicates comparison of HE with H, p<0.05. 3.3 ELISA results of 5-HT expression in the prefrontal cortex during acute hypoxic exercise Table 4 shows that under normoxic conditions, the expression of 5-HT was significantly upregulated in the OE group compared to the O group. In hypoxic conditions, the expression of 5-HT was significantly upregulated in the HE group compared to the H group. Across different oxygen environments, the expression of 5-HT was significantly upregulated in the H group compared to the O group, and it was also significantly upregulated in the HE group compared to the OE group. Table 4 Results of 5-HT expression in rat prefrontal cortex Group 5-HT(ng/mL) O 0.78 ± 0.02 OE 0.98 ± 0.09* H 1.03 ± 0.09 # HE 1.28 ± 0.11* ## Note: Comparison within the group:* Indicates comparisons with the resting group of equal oxygen concentration, p < 0.05,** Indicates comparisons with the resting group of equal oxygen concentration, p < 0.01.Comparison between groups:#Indicates comparisons with normoxic peers, p < 0.05,## Indicates comparisons with normoxic peers, p < 0.0.1. 3.4 RTqPCR results of 5-HT1A in the prefrontal cortex during acute hypoxic exercise Table 5 shows that under normoxic conditions, the expression of 5-HT1A mRNA was significantly upregulated in the OE group compared to the O group. In hypoxic conditions, the expression of 5-HT1A mRNA was significantly upregulated in the HE group compared to the H group. Across different oxygen environments, the expression of 5-HT1A mRNA was significantly upregulated in the H group compared to the O group, and it was also significantly upregulated in the HE group compared to the OE group. Table 5 Results of 5-HT1A expression mRNA in rat prefrontal cortex Group 5-HT1AmRNA O 0.99 ± 0.08 OE 1.88 ± 0.04** H 2.32 ± 0.07 ## HE 2.91 ± 0.04** ## Note: Comparison within the group:* Indicates comparisons with the resting group of equal oxygen concentration, p < 0.05.** Indicates comparisons with the resting group of equal oxygen concentration, p < 0.01.Comparison between group:#Indicates comparisons with normoxic peers, p < 0.05.## Indicates comparisons with normoxic peers, p < 0.0.1. 3.5 RTqPCR results of TRPV1 expression in the prefrontal cortex by Intraperitoneal administration of AMG9810 Table 6 shows that the expression of TRPV1 in the rat prefrontal cortex significantly increased following acute hypoxic exhaustive exercise. With the intervention of HE+AMG9810, the expression of TRPV1 in the prefrontal cortex of rats in the HE+AMG9810 group was notably decreased. These results suggest that HE+AMG9810 effectively downregulates the expression of TRPV1 in the prefrontal cortex. Table 6 Results of AMG9810 on the relative expression of TRPV1 in the prefrontal cortex. Group TRPV1mRNA H 0.77 ± 0.14 HE 0.91 ± 0.15* HE + AMG9810 0.70 ± 0.09 # Note: * Indicates comparison of HE with H, p < 0.05,# Indicates HE + AMG9810 compared to HE, p < 0.05. 3.6 RTqPCR results of 5-HT1A in prefrontal cortex by Intraperitoneal administration of WAY100635 Table 7 shows that the expression of 5-HT1A in the rat prefrontal cortex significantly increased following acute hypoxic exhaustive exercise. With the intervention of WAY100635, the expression of 5-HT1A in the prefrontal cortex of rats in the HE + WAY100635 group was notably decreased. These results suggest that WAY100635 effectively downregulates the expression of 5-HT1A in the prefrontal cortex. Table 7 Results of WAY100635 on the relative expression of 5-HT1A in the prefrontal cortex Group 5-HT1AmRNA H 1.00 ± 0.03 HE 1.25 ± 0.01* HE + WAY10063 1.03 ± 0.03 # Note:* Indicates comparison with H, p < 0.05, #Indicates comparison with HE, p < 0.05. 4 Discussion and analysis Research indicates that as elevation increases in plateau environments, the efficiency of the human body decreases. At an altitude of 4,500 meters, the body's work capacity is only 60% of that at lower altitudes. In areas above 5,500 meters, the maximum labor capacity is just 30% of that in the plains. The decline in athletic performance in high-altitude environments can be attributed to hypoxic conditions, which reduce athletes' ability to train effectively. The main reason is that low oxygen levels lead to a decrease in both the oxygen concentration and blood flow to the prefrontal cortex of the brain. The capacity to maintain high minute ventilation in the face of reduced arterial oxygen hemoglobin saturation affects endurance exercise performance in hypoxic conditions. Additionally, hypoxic environments induce greater neuronal excitation in localized brain regions compared to normoxic environments, leading to increased oxygen consumption. Consequently, these brain regions require more nutrients to replenish the consumed oxygen, resulting in an earlier decline in exercise capacity in hypoxic environments. 4.1 Analysis of TRPV1 results The TRPV1 channel is encoded by a gene on chromosome 17p13 and consists of 17 exons[17][18]. Recent evidence suggests that TRPV1 is also present intracellularly in certain cell types. It is primarily found in the endoplasmic reticulum, it may function as a calcium release conduit and potentially induce endoplasmic reticulum stress. TRPV1 has also been detected on the sarcoplasmic reticulum membranes of skeletal muscles, specifically in the longitudinal sarcoplasmic reticulum through isolated membrane preparations[19]. Additionally, TRPV1 located in mitochondria is involved in calcium uptake and subsequent organelle depolarization[20], and its presence in the Golgi apparatus suggests a role in secretory protein transport[21]. Our study's findings highlight a significant increase in TRPV1 mRNA levels in the prefrontal cortex under hypoxic conditions, particularly during exhaustive exercise compared to rest. These results suggest that TRPV1 channels play a critical role in the premature decline of exercise capacity during acute hypoxic stress. This may be superior to ligand-binding activation of TRPV1 channels, which leads to channel activation, calcium ion influx, and subsequent elevation of intracellular calcium concentrations. This triggers a series of physiological or pathological events, such as the regulation of neurogenic inflammation and neurotransmitter release [8][9]. Studies have indicated that TRPV1 has a broader range of functions in the central nervous system [22]. TRPV1 can mediate multiple pathways, including glial and neuronal responses, as well as the release of cytokines [23]. Furthermore, the activation of TRPV1 expression can lead to cell death in astrocytomas [24]. In an ischemic stroke model, the inhibition of TRPV1 with AMG9810 reduced post-stroke inflammation, suggesting that TRPV1 may be a potential therapeutic target for ischemic stroke[25]. The results of our experiment provide preliminary confirmation of the involvement of TRPV1 channels in the onset of decreased exercise capacity under hypoxia. 4.2 Analysis of 5-HT results Our study observed a significant increase in 5-HT levels in the prefrontal cortex immediately after exhaustive exercise under normoxic conditions. This increase is even more pronounced following hypoxic exercise. Comparing the normoxic resting state to the hypoxic resting state, there is a notable augmentation in 5-HT expression in the prefrontal cortex. This increase is particularly significant when comparing exhaustive exercises under normoxic and hypoxic conditions. This phenomenon may be related to the role of monoaminergic neurotransmitters in mediating ischemic neuronal injury during cerebral ischemia and hypoxia. Ischemic stroke triggers the release of monoaminergic neurotransmitters, leading to impairments in reuptake and degradation, resulting in an excessive accumulation of neurotransmitters in the extracellular space and even abnormal reuptake into surrounding neurons, causing acute neural damage. The excessive discharge of monoamines may act as potent agonists that open calcium channels, causing an influx of intracellular calcium, activation of phospholipases, and subsequent neuronal death. The findings of this study also suggest that changes in 5-HT levels in the prefrontal cortex during acute hypoxic exercise could contribute to the premature decline in exercise capacity under hypoxia. Central fatigue is thought to be associated with neurotransmitters such as 5-HT, NE, and DA. Of these, it is evident that 5-HT plays a crucial role in the development of central fatigue[26]. Numerous studies have shown that increasing 5-HT concentration leads to fatigue occurrence, while decreasing its concentration may enhance exercise duration and reduce fatigue. Prolonged exercise increases the levels of 5-HT in the brain, which may impair central nervous system function by reducing signaling between the central and peripheral systems and affecting motor skills[27]. Furthermore, exhaustive exercise leads to elevated 5-HT concentrations, resulting in a decline in endurance exercise performance. Inhibiting 5-HT production in the brain may improve endurance exercise performance[28]. Gomez et al[29]. allowed rats to run for 120 minutes without any adaptive training and found that the changes in extracellular 5-HIAA levels in the hippocampus and cortex were consistent with the changes in 5-HT levels. The levels of both 5-HIAA and 5-HT significantly rose following 90 minutes of exercise, peaking within the initial 30 minutes of the recovery period. Studies have indicated that prolonged exercise can increase the brain's 5-HT mainly due to the elevated concentration caused by exercise. Increased 5-HT release can inhibit rhythmic activity and firing of motor neurons, ultimately leading to central fatigue[10][11][12]. The present study found a positive correlation between prefrontal cortex 5-HT expression and the occurrence of fatigue in both normoxic and hypoxic exhaustion exercises. Moreover, the concentration of prefrontal cortex 5-HT immediately after exhaustion exercise was significantly higher compared to the control group. In conclusion, the results suggest that changes in prefrontal cortical 5-HT levels in a hypoxic environment may contribute to an early decline in hypoxic exercise capacity. 4.3 Analysis of 5-HT1A results The serotonin (5-HT) receptor family encompasses seven distinct subfamilies (ranging from 5-HT1 to 5-HT7), each with multiple subtypes. The 5-HT1A receptor, a critical subtype, plays a pivotal role in the serotonin system, controlling mood, motor function, thermoregulation, and behavior. Studies indicate that 5-HT1A receptors are widely distributed on the soma and dendrites of serotonin neurons, acting as autoregulatory receptors for these neurons. The neurotransmission mediated by 5-HT1A receptors operates through an autoregulatory feedback loop. When activated by 5-HT or its agonists, these autoreceptors modulate the activity of serotonin neurons through a negative feedback mechanism, reducing the firing frequency of neurons, the release of neurotransmitters, and the activation of protein kinases[29]. Our study observed a rapid increase in 5-HT1A expression in the prefrontal cortex following strenuous exercise under normoxic and hypoxic conditions. Compared to the normoxic rest group, the hypoxic resting group showed a significant increase in 5-HT1A protein expression in the prefrontal cortex; similarly, compared to the normoxic exercise group, the hypoxic exercise group showed a significant in 5-HT1A protein levels in the prefrontal cortex. Kim et al.'s study[30] found that strenuous exercise can enhance the expression levels of 5-HT1A receptors and serotonin transporters (5-HTT); conversely, treatment with colostrum serum can mitigate the expression of 5-HT1A receptors in the dorsal raphe region following intense exercise. Perrier et al.'s study[31] revealed that the influx of serotonin into the axon initial segment and subsequent activation of 5-HT1A receptors can inhibit the action potentials of motor neurons, thereby preventing muscle over-contraction during prolonged activity. Consistent with our findings, the increased expression of 5-HT1A may further suppress neural excitability, leading to an early decline in exercise performance. This suggests that the 5-HT1A receptor may serve as a target for 5-HT, playing a role in diminishing exercise capacity. 4.4 Analysis of results of Intraperitoneal administration of AMG9810 Previous studies have shown that activation of the TRPV1 channel stimulates sensory neurons and triggers an accumulation of calcium in microglia. This leads to an increased burden of mitochondrial calcium and subsequent impairment and fragmentation of mitochondria[32]. Our findings reveal that acute hypoxic exercise increases the expression of TRPV1 channels in the cerebral prefrontal cortex. Significantly, the administration of a TRPV1 antagonist prolonged the exercise duration in rats, indicating that the increased expression of TRPV1 negatively impacts motor performance during acute hypoxic exercise. Therefore, strategic attenuation of TRPV1 may contribute to prolonged exercise endurance in hypoxic conditions. Additionally, inhibiting TRPV1 has shown potential benefits in enhancing exercise-induced cognitive functions and improving behavioral performance. For example, Razavinasab et al. demonstrated that inhibition of TRPV1 receptors can alter cellular distribution in the substantia nigra and effectively mitigate declines in motor and cognitive function induced by 6-hydroxydopamine in a rat model of Parkinson's disease[33]. In the context of levodopa-related complications, studies have demonstrated that suppressing TRPV1 receptor activity can effectively prevent the development of motor disorders[34]. Furthermore, studies on mice with traumatic brain injury have shown that inhibiting TRPV1 receptors through intraperitoneal injection of an antagonist can reduce neuronal apoptosis in the brain tissue following the injury, significantly improving behavioral performance[35]. 4.5 Analysis of results of Intraperitoneal administration of WAY100635 Research suggests that the activation of 5-HT1A receptors plays a pivotal role in inducing exercise-induced fatigue[36]. Participants who engage in strenuous physical activity and are administered 5-HT1A receptor agonists experience a heightened sense of fatigue[12]. Studies have shown that the activation of 5-HT1A receptors can reduce defensive aggressive behaviors within the hypothalamus and periaqueductal gray regions. A study on rats exposed to chronic stress showed that 5-HT1A receptor agonists effectively reduced pathological aggressive behaviors in rats under chronic stress[37]. Our study observed that acute hypoxic exercise in rats reduces the expression of 5-HT/5-HT1A in the cerebral prefrontal cortex. This change in prefrontal 5-HT/5-HT1A under hypoxic conditions may contribute to the decline in exercise performance. Moreover, our study noted a decrease in endurance among rats subjected to simulated high-altitude exercise at 4000 meters. Interestingly, administering a 5-HT1A antagonist to rats led to a significant increase in their exercise duration. This suggests that the activation of 5-HT1A receptors may diminish motor performance. Overall, our findings indicate that strategically modulating 5-HT1A signaling may be beneficial in enhancing the endurance performance of rats during acute hypoxic exercise. 5 Conclusion Acute hypoxic exercise has been observed to increase the expression of TRPV1 channels in the prefrontal cortex. This increase in TRPV1 expression may play a role in the decline of hypoxic exercise ability. Additionally, the expression of 5-HT/5-HT1A in the prefrontal cortex is also increased during acute hypoxic exercise, and this increase may be one of the mechanisms contributing to the decline in exercise ability. To investigate these mechanisms further, a study was conducted using the TRPV1 blocker (AMG9810) and 5-HT1A blocker (WAY100635). The findings indicated that inhibiting TRPV1 led to a decrease in its expression within the prefrontal cortex, and similarly, blocking 5-HT1A receptor activity led to downregulation of its expression levels. Moreover, the blocking of these receptors prolonged the time of incremental loading exercise in a hypoxic environment. In summary, these findings suggest that the decreased exercise capacity in rats during acute hypoxic exercise may be attributed to the up-regulation of TRPV1 expression, which subsequently activates the expression of 5-HT/5-HT1A, conclusively resulting in diminished exercise performance. 6 Full-text summary and research outlook The present study provides preliminary evidence that the decrease in exercise capacity observed in rats during acute hypoxic exercise is correlated with elevated expression of TRPV1, 5-HT, and 5-HT1A in the prefrontal cortex. Additionally, injecting the inhibitor in the abdominal cavity revealed that the mechanism underlying the decrease in exercise capacity may involve the up-regulation of TRPV1 expression, which further activates the expression of 5-HT/5-HT1A, ultimately leading to decreased exercise capacity. The study highlights the critical regulatory roles of TRPV1 and 5-HT1A in the decline of acute hypoxic exercise capacity, suggesting that appropriate down-regulation of these molecules may prolong exercise duration in rats. This finding lays the foundation for future studies on nutrient interventions. By exploring the activation mechanism of TRPV1, this study provides a biological basis for identifying nutrients that can down-regulate TRPV1 activation. It is important to note that this study is only a preliminary demonstration of the potential role of blockers in improving hypoxic exercise capacity, and further experimental studies are needed to explore and verify these findings. Additionally, it is worth mentioning that the animal model used in this experiment may not fully reflect real-life hypoxic exhaustion scenarios, as it was designed to investigate the related mechanisms. Abbreviations TRPV1 Transient receptor potential vanilloid subtype 1 5-HT1A 5-hydroxytryptamine1A 5-HT 5-hydroxytryptamine Declarations Ethics approval and consent to participate This study is reported in accordance with the ARRIVE guidelines, was conducted in accordance with the Basel Declaration, and was approved by the Ethics Committee of Sports Science Experiment of Beijing Sport University (approval number: 2020176). Consent for publication Not applicable. Availability of data and materials All data generated in this study are included in its Supplementary Information document. Competing Interests The Authors declares that they have no Conflicts of Interest. Funding This work was supported by Beijing Higher Education Teaching Reform Project(202310029005), Hubei natural science foundation (JCZRLH202501226), Science Popularization Project of the General Administration of Sport of China (2025TK021), and the Emerging Interdisciplinary Platform for Medicine and Engineering in Sports (EIPMES). Authors' contributions All authors contributed to the study. Jing Ma conceived and designed research. Material preparation, data collection and analysis were performed by Jing Ma, Xing Huang, Lijing Gong, Yizhu Tang, Chi Xu. The first draft of the manuscript was written by Jing Ma, Xing Huang, Lijing Gong, Yizhu Tang, Chi Xu. All authors read and approved the final manuscript. Acknowledgements The authors were grateful to the participants for their time and investment in the investigation. References C. Siebenmann and P. Rasmussen, “Does cerebral hypoxia facilitate central fatigue?,” Experimental Physiology, vol. 101, no. 9, pp. 1173–1177, 2016. Y. Liang et al., “Effects of Moxibustion on Central Fatigue in Rats Subjected to Different Degrees of Exhaustive Exercise,” Physikalische Medizin, Rehabilitationsmedizin, Kurortmedizin, vol. 29, no. 01, pp. 39–44, 2019. T. RUPP, T. L. R. MALLOUF, S. PERREY, B. WUYAM, G. Y. MILLET, and S. VERGES, “CO2 Clamping, Peripheral and Central Fatigue during Hypoxic Knee Extensions in Men,” Medicine & Science in Sports & Exercise, vol. 47, no. 12, pp. 2513–2524, 2015. J.-L. Fan and B. Kayser, “Fatigue and Exhaustion in Hypoxia: The Role of Cerebral Oxygenation,” High Altitude Medicine & Biology, vol. 17, no. 2, pp. 72–84, 2016. A. W. Subudhi, B. R. Miramon, M. Granger, and R. C. Roach, “Frontal and motor cortex oxygenation during maximal exercise in normoxia and hypoxia,” Journal of Applied Physiology, vol. 106, no. 4, pp. 1153–1158, 2009. X. Huang, Y. Hu, L. Zhao, B. Gu, R. Zhu, and Y. Li, “TRPV4 plays an important role in rat prefrontal cortex changes induced by acute hypoxic exercise,” Saudi J Biol Sci, vol. 26, no. 6, pp. 1194–1206, 2019. X.-L. Yang, X. Wang, L. Shao, G.-T. Jiang, J.-W. Min, and X.-Y. Mei, “TRPV1 mediates astrocyte activation and interleukin-1β release induced by hypoxic ischemia (HI),” Journal of Neuroinflammation, vol. 16, no. 1, pp.114, 2019. D. S. K. Samways, B. S. Khakh, and T. M. Egan, “Tunable Calcium Current through TRPV1 Receptor Channels,” Journal of Biological Chemistry, vol. 283, no. 46, pp. 31274–31278, 2008. A. W. Subudhi, B. R. Miramon, M. Granger, and R. C. Roach, “Frontal and motor cortex oxygenation during maximal exercise in normoxia and hypoxia,” Journal of Applied Physiology, vol. 106, no. 4, pp. 1153–1158, 2009. D. D. Soares, C. C. Coimbra, and U. Marubayashi, “Tryptophan-induced central fatigue in exercising rats is related to serotonin content in preoptic area,” Neuroscience Letters, vol. 415, no. 3, pp. 274–278, 2007. L. M. S. Cordeiro, P. C. R. Rabelo, M. M. Moraes, F. Teixeira-Coelho, C. C. Coimbra, and S. P. Wanner, “Physical exercise-induced fatigue: the role of serotonergic and dopaminergic systems,” Brazilian journal of medical and biological research, vol. 50, no. 12, pp. e6432, 2017. G. Marvin, A. Sharma, W. Aston, C. Field, M. Kendall, and D. Jones, “The effects of buspirone on perceived exertion and time to fatigue in man,” Experimental Physiology, vol. 82, no. 6, pp. 1057–1060, 1997. S.-S. Park, T.-W. Kim, C.-J. Kim, S.-Y. Hong, B.-K. Kim, and Y.-J. Sim, “Effect of sildenafil citrate on brain central fatigue after exhaustive swimming exercise in rats,” Journal of Exercise Rehabilitation, vol. 15, no. 5, pp. 651–656, Oct. 2019. M. Li, M. Zhu, Q. Xu, F. Ding, Y. Tian, and M. Zhang, “Sensation of TRPV1 via 5-hydroxytryptamine signaling modulates pain hypersensitivity in a 6-hydroxydopamine induced mice model of Parkinson’s disease,” Biochemical and Biophysical Research Communications, vol. 521, no. 4, pp. 868–873, 2020. T. Schilling and C. Eder, “Importance of the non-selective cation channel TRPV1 for microglial reactive oxygen species generation,” Journal of Neuroimmunology., vol. 216, no. 1-2, pp. 118-121, 30, 2009. S. R. Kim, S. U. Kim, U. Oh, and B. K. Jin, "Transient receptor potential vanilloid subtype 1 mediates microglial cell death in vivo and in vitro via Ca 2+ -mediated mitochondrial damage and cytochrome c release," The Journal. Immunology., vol. 177, no. 7, pp. 4322-4329, 1, 2006. L. Birnbaumer, E. Yildirim, and J. Abramowitz, “A comparison of the genes coding for canonical TRP channels and their M, V and P relatives,” Cell Calcium, vol. 33, no. 5-6, pp. 419-432, 2003. S. Bevan, T. Quallo, and D. A. Andersson, “TRPV1,” Handbook of experimental. pharmacology, vol. 222, pp. 207-245, 2014 R. Zhao, S. Y. Tsang, “Versatile Roles of Intracellularly Located TRPV1 Channel,” Journal Cell Physiology., vol. 232, no. 8, pp. 1957-1965, 2017. T. Miyake, H. Shirakawa, T. Nakagawa, and S. Kaneko, “Activation of mitochondrial transient receptor potential vanilloid 1 channel contributes to microglial migration,” Glia, vol. 63, no. 10, pp. 1870-1882, 2015. S. Lotteau, S. Ducreux, C. Romestaing, C. Legrand, and F. Van Coppenolle, “Characterization of functional TRPV1 channels in the sarcoplasmic reticulum of mouse skeletal muscle,” PLoS One, vol. 8, no. 3, e58673, 2013. Z. Luo, L. Ma, Z. Zhao, H. He, D. Yang, X. Feng, S. Ma, X. Chen, T. Zhu, T. Cao, D. Liu, B. Nilius, Y. Huang, Z. Yan, and Z. Zhu, “TRPV1 activation improves exercise endurance and energy metabolism through PGC-1α upregulation in mice,” Cell Research, vol. 22, no. 3, pp. 551-564, 2012 A. Navarria, A. Tamburella, F. A. Iannotti, V. Micale, G. Camillieri, L. Gozzo, R. Verde, R. Imperatore, G. M. Leggio, F. Drago, and V. Di Marzo, “The dual blocker of FAAH/TRPV1 N-arachidonoyl serotonin reverses the behavioral despair induced by stress in rats and modulates the HPA-axis,” Pharmacological research., vol. 87, pp. 151-159, 2014. K. Stock, J. Kumar, M. Synowitz, S. Petrosino, R. Imperatore, E. S. Smith, P. Wend, B. Purfürst, U. A. Nuber, U. Gurok, V. Matyash, J. H. Wälzlein, S. R. Chirasani, G. Dittmar, B. F. Cravatt, S. Momma, G. R. Lewin, A. Ligresti, L. De Petrocellis, L. Cristino, V. Di Marzo, H. Kettenmann, and R. Glass, “Neural precursor cells induce cell death of high-grade astrocytomas through stimulation of TRPV1,” Nature medicine., vol. 18, no. 8, pp. 1232-1238, 2012. E. Hakimizadeh, A. Shamsizadeh, A. Roohbakhsh, M. K. Arababadi, M. R. Hajizadeh, M. Shariati, M. R. Rahmani, and M. Allahtavakoli, “Inhibition of transient receptor potential vanilloid-1 confers neuroprotection, reduces tumor necrosis factor-alpha, and increases IL-10 in a rat stroke model,” Fundamental Clinical Pharmacology., vol. 31, no. 4, pp. 420-428, 2017. K. TW, K. CJ, J. Seo, “Effects of colostrum serum on the serotonergic system in the dorsal raphe nuclei of exercised rats,” J. Exerc. Nutrition Biochem., vol. 21, no. 1, pp. 33-39, 31,2017. Cotel F, Exley R, Cragg S J, et al. Serotonin spillover onto the axon initial segment of motoneurons induces central fatigue by inhibiting action potential initiation[J]. Proceedings of the National Academy of Sciences, 2013, 110(12):4774-4779. J. H. Seo, Y. H. Sung, K. J. Kim, M. S. Shin, E. K. Lee, and C. J. Kim, “Effects of Phellinus linteus administration on serotonin synthesis in the brain and expression of monocarboxylate transporters in the muscle during exhaustive exercise in rats,” Journal Nutritional Science and Vitaminology. (Tokyo), vol. 57, no. 1, pp. 95-103, 2011. Gomez-Merino D, F Béquet, Berthelot M , et al. Site-dependent effects of an acute intensive exercise on extracellular 5-HT and 5-HIAA levels in rat brain[J]. Neuroscience Letters, 2001, 301(2):143-146. A. Newman-Tancredi, R. Y. Depoortère, M. S. Kleven, M. Kołaczkowski, and L. Zimmer, “Translating biased agonists from molecules to medications: Serotonin 5-HT1A receptor functional selectivity for CNS disorders,” Pharmacology & Therapeutics., vol. 229, pp. 107937, 2022. J.-F. Perrier, “Modulation of motoneuron activity by serotonin,” Danish Medical Journal., vol. 63, no. 2, pp. B5204, 2016 W. Gao, Y. Sun, M. Cai, Y. Zhao, W. Cao, Z. Liu, G. Cui, and B. Tang, “Copper sulfide nanoparticles as a photothermal switch for TRPV1 signaling to attenuate atherosclerosis,” Nature Communications., vol. 9, no. 1, pp. 231, 15, 2018. M. Razavinasab, A. Shamsizadeh, M. Shabani, M. Nazeri, M. Allahtavakoli, M. Asadi-Shekaari, S. Esmaeli-Mahani, and V. Sheibani, “Pharmacological blockade of TRPV1 receptors modulates the effects of 6-OHDA on motor and cognitive functions in a rat model of Parkinson’s disease,” Fundamental Clinical Pharmacology., vol. 27, no. 6, pp. 632-640, 2013 R. González-Aparicio and R. Moratalla, “Oleoylethanolamide reduces L-DOPA-induced dyskinesia via TRPV1 receptor in a mouse model of Parkinson’s disease,” Neurobiology of disease., vol. 62, pp. 416-425, 2014. D. X. Yang, Y. Jing, Y. L. Liu, Z. M. Xu, F. Yuan, M. L. Wang, Z. Geng, and H. L. Tian, “Inhibition of Transient Receptor Potential Vanilloid 1 Attenuates Blood-Brain Barrier Disruption after Traumatic Brain Injury in Mice,” Journal of Neurotrauma, vol. 36, no. 8, pp. 1279-1290, 15, 2019. Z. Liu, Y. Wu, T. Liu, R. Li, and M. Xie, “Serotonin regulation in a rat model of exercise-induced chronic fatigue,” Neuroscience., vol. 349, pp. 27-34, 4, 2017. K. C. Fone and M. V. Porkess, “Behavioural and neurochemical effects of post-weaning social isolation in rodents - relevance to developmental neuropsychiatric disorders,” Neuroscience and Biobehavioral Reviews., vol. 32, no. 6, pp. 1087-1102, 2008. Additional Declarations No competing interests reported. Supplementary Files AuthorChecklistFull.pdf Data.zip Cite Share Download PDF Status: Published Journal Publication published 19 Jan, 2026 Read the published version in BMC Sports Science, Medicine and Rehabilitation → Version 1 posted Editorial decision: Revision requested 30 Jun, 2025 Reviews received at journal 21 Jun, 2025 Reviewers agreed at journal 10 Jun, 2025 Reviews received at journal 08 Jun, 2025 Reviewers agreed at journal 06 Jun, 2025 Reviewers agreed at journal 04 Jun, 2025 Reviewers invited by journal 03 Jun, 2025 Editor assigned by journal 29 May, 2025 Submission checks completed at journal 28 May, 2025 First submitted to journal 28 May, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6697572","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":466573926,"identity":"40a7e178-9db1-4944-8e4c-2e1d19fdf974","order_by":0,"name":"Jing Ma","email":"","orcid":"","institution":"Capital University of Physical Education and Sports","correspondingAuthor":false,"prefix":"","firstName":"Jing","middleName":"","lastName":"Ma","suffix":""},{"id":466573927,"identity":"131339e4-ca25-4836-9795-e501946ee985","order_by":1,"name":"Xing Huang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA9klEQVRIiWNgGAWjYBACAwglwcDA3gATSyBWC88B0rSAdMFVEtBiLpH87OHXNos8+cjHz6QLKuoY+NlzDBh+7sCtxXJGmrmxzBmJYsPbaWbSM84cZpDseWPA2HsGj8NuJJhJS1RIJG6cncMmzdt2ACiSY8DM2IZPS/o3aQkDoJaZZ4Ba/tUx2BPWkmMm+QFoy3wJHqCWBmYGAwlCWs68KZNmOCORuIEnzdh6xrHDPBJnnhUc7MWn5Xj6NsmfbXWJ89sPP7xdUFMnx9+evPHBTzxaQICZB6T3AJABpEFshgP4NTAwMP4AEvINEC2jYBSMglEwCjAAAKhNTRdT6x4FAAAAAElFTkSuQmCC","orcid":"","institution":"Capital University of Physical Education and Sports","correspondingAuthor":true,"prefix":"","firstName":"Xing","middleName":"","lastName":"Huang","suffix":""},{"id":466573928,"identity":"b0256a86-8de2-4476-b225-642f6bd23727","order_by":2,"name":"Lijing Gong","email":"","orcid":"","institution":"Key Laboratory of Exercise and Physical Fitness(Beijing Sport University),Ministry of Education","correspondingAuthor":false,"prefix":"","firstName":"Lijing","middleName":"","lastName":"Gong","suffix":""},{"id":466573930,"identity":"6cfa544b-7511-431b-a377-111fdd319f21","order_by":3,"name":"Yizhu Tang","email":"","orcid":"","institution":"Hubei Institute of Sport Science, Wuhan 430205, China","correspondingAuthor":false,"prefix":"","firstName":"Yizhu","middleName":"","lastName":"Tang","suffix":""},{"id":466573931,"identity":"6e826695-bea7-4837-8b02-8fbdf9513576","order_by":4,"name":"Chi Xu","email":"","orcid":"","institution":"Hubei Institute of Sport Science, Wuhan 430205, China","correspondingAuthor":false,"prefix":"","firstName":"Chi","middleName":"","lastName":"Xu","suffix":""}],"badges":[],"createdAt":"2025-05-19 09:53:12","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6697572/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6697572/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s13102-025-01523-6","type":"published","date":"2026-01-19T15:59:06+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":101152797,"identity":"68e6113b-4064-4795-a0dd-9df36d63fdfb","added_by":"auto","created_at":"2026-01-26 16:13:05","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1012968,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6697572/v1/3a5f2a2a-538e-44dc-9c84-0780f362aacb.pdf"},{"id":83979749,"identity":"e1d1e1ef-e0d9-4bf8-9593-7746e73b2e73","added_by":"auto","created_at":"2025-06-05 09:49:42","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":132746,"visible":true,"origin":"","legend":"","description":"","filename":"AuthorChecklistFull.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6697572/v1/580501a80d4f09d82a3637c1.pdf"},{"id":83979752,"identity":"4fa8ec9a-1cb8-47ae-aaf8-83d341d7bf64","added_by":"auto","created_at":"2025-06-05 09:49:43","extension":"zip","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":41433,"visible":true,"origin":"","legend":"","description":"","filename":"Data.zip","url":"https://assets-eu.researchsquare.com/files/rs-6697572/v1/93b42962193e8cd529880574.zip"}],"financialInterests":"No competing interests reported.","formattedTitle":"Expression and Mechanism of TRPV1 Channel in Prefrontal Cortex after Acute Hypoxic Exercise","fulltext":[{"header":"Significance","content":"\u003cp\u003eTo provide a biological basis for studying the nutritional strategies to counteract physical decline in military personnel and adventurers during their initial ascent to high-altitude regions.\u003c/p\u003e"},{"header":"1. Introduction","content":"\u003cp\u003eHigh altitude training, known for its efficacy in enhancing aerobic capacity, is extensively applied in elite athletic competition and general fitness programs. However, when compared to normoxic training, the duration of exercise to fatigue is shortened under hypoxic conditions[1], leading to an earlier onset of exercise fatigue. This results in athletes finding it difficult to maintain overall training intensity, and volume reduces the performance of military personnel stationed in high-altitude areas and weakens the exercise capacity of the general public engaging in fitness activities, which goes against the original purpose of high-altitude training. Regarding the issue of exercise capacity declining prematurely due to hypoxia, scholars have primarily focused on hypoxia's effects on cardiopulmonary capacity and muscle oxygen utilization. However, the decline in exercise capacity during hypoxic exercise is often the result of the combined action of the muscular system (peripheral fatigue), cardiovascular and respiratory systems, and the central nervous system (central fatigue)[2]. Existing studies have shown that the decline in exercise capacity upon first exposure to high altitude is closely related to central fatigue, primarily due to the harmful effects of acute hypoxia on the brain, which leads to a decrease in the ability to perform exercise tasks. Further hypoxia during exercise may affect the central nervous system by damaging brain oxygenation and motor cortex function[3][4], resulting in an earlier onset of exercise fatigue due to dual factors. Hemodynamic studies further prove the significant role of the prefrontal cortex in issuing motor stop commands[5][6], although its biological mechanism is not yet clear. Therefore, understanding the biological mechanism behind the early reduction in exercise capacity under hypoxic conditions is critically important.\u003c/p\u003e \u003cp\u003eCa\u003csup\u003e2+\u003c/sup\u003e is vital for the governance of central nervous system function, and the Ca\u003csup\u003e2+\u003c/sup\u003e overload hypothesis suggests that Ca\u003csup\u003e2+\u003c/sup\u003e contributes to the development of central fatigue. As a member of the calcium channel family, the transient receptor potential vanilloid 1 (TRPV1) has been shown to play a role in cerebral ischemic hypoxic injury[7]. Studies have demonstrated that TRPV1, when bound to a ligand, further activates TRPV1, leading to an increased influx of calcium ions and a higher intracellular calcium concentration, which in turn triggers various physiological or pathological reactions such as intracellular chemical sensing, neurogenic inflammation, presynaptic regulation of neurotransmitter release, and itchiness[8][9].\u003c/p\u003e \u003cp\u003eFurthermore, research indicates that a rise in brain serotonin (5-hydroxytryptamine, 5-HT) levels during extended exercise can impair central nervous system function, resulting in a decline in exercise performance[10]. 5-HT is regulated by various factors, including its synthesis rate-limiting enzyme, tryptophan hydroxylase (TPH), and the 5-hydroxytryptamine receptor 1A (5HT1A)[11]. The 5-HT1A receptor is one of the most important subtypes involved in serotonergic function and subjects engaging in strenuous exercise tend to experience faster fatigue when taking 5-HT1A receptor agonists[12][13]. TRPV1 is now believed to have broader functions in the central nervous system. Furthermore, studies have shown that TRPV1 and 5-HT play a role in exacerbating pain[14], and the upregulation or activation of TRPV1 expression can lead to the release of various local sensory neurotransmitters, including 5-HT, which further activate downstream nerves to transmit nerve impulses, resulting in increased visceral sensitivity and the development of hyperalgesia. Based on these findings, this study aims to investigate the roles of TRPV1, 5-HT1A, and 5-HT in the prefrontal cortex in issuing movement-stop instructions during acute hypoxia, and to explore whether the relationship between TRPV1 and 5-HT plays a crucial role in the biological mechanism of central fatigue. To achieve the above objectives, in this study, firstly, we investigated the expression of TRPV1, 5-HT and 5-HT1A after acute hypoxic exercise, and analyzed the role of prefrontal cortex in the signaling of exercise cessation. Second, TRPV1 inhibitor and 5-HT1A inhibitor were injected separately to explore the function of TRPV1 and its related mechanisms in acute hypoxic exercise. The effects of these different interventions on exercise duration in rats with acute hypoxic exercise were analyzed, further confirming the involvement of TRPV1 and 5-HT.The roles of 5-HT and 5-HT1A in acute hypoxic exercise will be further elucidated in terms of their biological mechanisms.\u003c/p\u003e"},{"header":"2. Related Works","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1Test indicators and methods\u003c/h2\u003e \u003cp\u003eThis study utilized a double-blind experimental design.Animals used in this study were treated strictly according to national and regional ethical guidelines. In the study, forty-eight male Wistar rats, weighing between 280 and 300 grams, were chosen as the subjects for research, purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. The study was approved by the Ethics Committee (approval number 2020176). Four rats per cage were placed in standard cages, with the room temperature maintained at 20\u0026ndash;24\u0026deg;C, a relative humidity of 40\u0026ndash;60%, and a 12-hour light/12-hour dark cycle implemented. Animals were fed standard feed according to national standards, and the water and food intake were not controlled. The rats were randomly divided into 6 groups with single blindness: normoxic rest group (O, n\u0026thinsp;=\u0026thinsp;8), normoxic exhaustion group (OE, n\u0026thinsp;=\u0026thinsp;8), hypoxic exercise rest group (H, n\u0026thinsp;=\u0026thinsp;8), hypoxic exercise exhaustion group (HE, n\u0026thinsp;=\u0026thinsp;8), hypoxic exercise exhaustion\u0026thinsp;+\u0026thinsp;AMG9810 group (HE1, n\u0026thinsp;=\u0026thinsp;8), and hypoxic exercise exhaustion\u0026thinsp;+\u0026thinsp;WAY100635 group (HE5, n\u0026thinsp;=\u0026thinsp;8). In the inhibitor groups, since the study involved exercise-induced exhaustion in rats, intracranial injection of inhibitors could affect the rats\u0026rsquo; mobility. Considering the feasibility of practical application, intraperitoneal injection was employed in this study. The corresponding inhibitors were administered intraperitoneal injection 30 minutes before exercise (0.5 mg/kg body weight). Subsequently, the rats underwent incremental load exercise until exhaustion. Anesthesia was induced with an intraperitoneal injection of 3% pentobarbital sodium solution (12.5 ml/kg body weight). After the animals were sedated, blood samples were drawn from the abdominal aorta. Subsequently, the animals were euthanized using cervical dislocation following anesthesia, and then brain tissue was promptly harvested. After the experiment, histological analysis, including Elisa and RT-qPCR, was performed on the brain tissue. Euthanasia was planned for rats that exhibited weight loss, lethargy, or respiratory distress, but it was not carried out.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Rat's Adaptive Treadmill Training Program\u003c/h2\u003e \u003cp\u003eThe rats underwent 5 days of adaptive treadmill training, running at a speed of 10 meters per minute for 15 minutes each day.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Rat incremental load exercise program\u003c/h2\u003e \u003cp\u003eThe rat exercise protocol was adapted from Leandro's model for assessing maximal oxygen uptake in Wistar rats. In this study, we followed Leandro's protocol for maximal oxygen uptake testing in rats. The rats were subjected to an incremental exercise protocol on a treadmill with a 10\u0026deg; incline, starting at a speed of 5 m/min for 4 minutes and then increasing the speed by 5 m/min every 3 minutes until they could no longer maintain their pace under electrical stimulation. The maximum speed reached was 50 m/min[15]. Exhaustion was determined when the rats were unable to continue running on the treadmill under electrical stimulation conditions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Material drawing\u003c/h2\u003e \u003cp\u003eAdminister a 3% solution of sodium pentobarbital intraperitoneally (12.5 ml/kg body weight) to induce anesthesia. Once the animal is sedated, collect blood samples from the abdominal aorta and promptly extract the brain tissue.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Enzyme-Linked Immunosorbent Assay\u003c/h2\u003e \u003cp\u003eIn this experiment, a rat 5-HT ELISA kit was employed, and the procedure was as follows:\u003c/p\u003e \u003cp\u003e(1) Standardization of Protein Concentration To ensure consistency in ELISA results, tissue samples were first extracted for protein and standardized in concentration. A 50:1 ratio of pre-chilled PBS buffer was mixed with a protease inhibitor cocktail, and 250 \u0026micro;l of PBS buffer was added to each sample. The samples were then homogenized and centrifuged at 4\u0026deg;C at 12,000 rpm for 10 minutes to obtain the supernatant for BCA protein quantification.\u003c/p\u003e \u003cp\u003e(2) Protein Concentration Determination According to the instructions provided with the BCA protein quantification kit, the protein standard solution was prepared, and the lysate was chilled on ice. A standard curve was plotted using the standard protein content and absorbance values.\u003c/p\u003e \u003cp\u003e(3) Protein Concentration Standardization PBS buffer was replenished, and the protein concentration of the samples was standardized to 400 \u0026micro;g/ml (using the sample with the lowest concentration as the reference). The standardized samples were then subjected to ELISA according to the instructions provided with the ELISA kit. The specific procedure followed the detailed instructions in the ELISA kit manual.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Measurement of relative expression of TRPV1 and 5-HT1A mRNA\u003c/h2\u003e \u003cdiv id=\"Sec9\" class=\"Section3\"\u003e \u003ch2\u003e2.6.1. Primer design.\u003c/h2\u003e \u003cp\u003eAs shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, primer sequences for the corresponding genes were designed through NCBI\u0026rsquo;s Prime-BLAST search and detected using Oligo7.0 software. All primers were synthesized at Shanghai Sangon Biotech Co., Ltd. The synthesized upstream and downstream primers were replicated and stored at -20\u0026deg;C for future use.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eDetection of Gene Primers\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eUpstream primer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDownstream Primers\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTRPV1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGGACCCAGGCAACTGTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATCCCTCAGAAGGGGAACC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e5HT1A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGTTGCTCATGCTGGTTCTCTAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTGACAGTCTTGCGGATTCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section3\"\u003e \u003ch2\u003e2.6.2. Extraction and quantification of total RNA concentration.\u003c/h2\u003e \u003cp\u003eA segment of the prefrontal cortex was immersed in RNA Later solution and stored at -20\u0026deg;C for RNA extraction at a later stage. Total RNA was extracted from the rat's prefrontal cortex using the RNAprep Pure Tissue Kit (TIANGEN BIOTECH), following the kit's specified protocols.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section3\"\u003e \u003ch2\u003e2.6.3. RT-PCR reaction\u003c/h2\u003e \u003cp\u003eThe cDNA synthesis was performed as per the protocol outlined in the Prime ScriptTM RT MasterMix Kit (Takara) brochure, resulting in the creation of cDNA.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Statistical Analyses\u003c/h2\u003e \u003cp\u003eStatistical analyses were performed using SPSS Statistics. The following data analysis methods were employed in this study: A two-way analysis of variance (ANOVA) was performed on each indicator data, with one factor being the testing environment and the other being exercise intensity. Based on the interaction test, there was no interaction between the two factors; therefore, post hoc comparisons were conducted using Tukey\u0026rsquo;s test. Independent samples t-tests were used for comparisons between two groups, and one-way analysis of variance (ANOVA) was used for comparisons among multiple groups.\u003c/p\u003e \u003c/div\u003e"},{"header":"3 Research result","content":"\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e3.1 Rat exhaustion time\u003c/h2\u003e \u003cp\u003eAs shown in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, there was a statistically significant reduction in exercise time in the HE group compared to the OE group. This finding further indicates that the hypoxic conditions contributed to a decrease in exercise duration and a decline in the exercise capacity of the rats, confirming the successful establishment of the hypoxic exercise fatigue model in this study. Following the administration of AMG9810, the rats in the HE\u0026thinsp;+\u0026thinsp;AMG9810 group exhibited a notably extended time to exhaustion compared to the HE group. Similarly, after the administration of WAY100635, the rats in the HE\u0026thinsp;+\u0026thinsp;WAY100635 group demonstrated a significantly longer duration of exercise to exhaustion than those in the HE group. These results suggest that both AMG9810 and WAY100635 are effective in delaying exercise exhaustion in rats.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eRat Exhaustion Exercise Timetable\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGroup\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTime(min)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e114.17\u0026thinsp;\u0026plusmn;\u0026thinsp;33.58\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e49.29\u0026thinsp;\u0026plusmn;\u0026thinsp;8.06\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHE\u0026thinsp;+\u0026thinsp;AMG9810\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e76.17\u0026thinsp;\u0026plusmn;\u0026thinsp;30.68\u003csup\u003e##\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHE\u0026thinsp;+\u0026thinsp;WAY100635\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e76.17\u0026thinsp;\u0026plusmn;\u0026thinsp;19.52\u003csup\u003e##\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"2\"\u003eNote:*Indicates comparison with OE, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05,**Indicates comparison with OE, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01.#Indicates comparison with HE, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01,##Indicates comparison with HE, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e3.2 RTqPCR results of TRPV1 in the prefrontal cortex during acute hypoxic exercise\u003c/h2\u003e \u003cp\u003eTable\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e shows that under normoxic conditions, the expression of TRPV1 mRNA does not show a statistically significant difference in the OE group compared to the O group. In hypoxic conditions, the expression of TRPV1 was significantly upregulated in the HE group compared to the H group. Across different oxygen environments, the expression of TRPV1 mRNA is not significantly different in the OE group compared to the O group. and it was also not significantly different in the HE group compared to the OE group.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eRelative expression of TRPV1mRNA in rat prefrontal cortex\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGroup\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTRPV1mRNA\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e1.09\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e1.26\u0026thinsp;\u0026plusmn;\u0026thinsp;0.25\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e1.14\u0026thinsp;\u0026plusmn;\u0026thinsp;0.27\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e1.39\u0026thinsp;\u0026plusmn;\u0026thinsp;0.22*\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"2\"\u003eNote: * Indicates comparison of HE with H, p\u0026lt;0.05.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e3.3 ELISA results of 5-HT expression in the prefrontal cortex during acute hypoxic exercise\u003c/h2\u003e \u003cp\u003eTable\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e shows that under normoxic conditions, the expression of 5-HT was significantly upregulated in the OE group compared to the O group. In hypoxic conditions, the expression of 5-HT was significantly upregulated in the HE group compared to the H group. Across different oxygen environments, the expression of 5-HT was significantly upregulated in the H group compared to the O group, and it was also significantly upregulated in the HE group compared to the OE group.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eResults of 5-HT expression in rat prefrontal cortex\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGroup\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5-HT(ng/mL)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e0.78\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e0.98\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09*\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e1.03\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09\u003csup\u003e#\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e1.28\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11*\u003csup\u003e##\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"2\"\u003eNote: Comparison within the group:* Indicates comparisons with the resting group of equal oxygen concentration, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05,** Indicates comparisons with the resting group of equal oxygen concentration, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01.Comparison between groups:#Indicates comparisons with normoxic peers, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05,## Indicates comparisons with normoxic peers, p\u0026thinsp;\u0026lt;\u0026thinsp;0.0.1.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e3.4 RTqPCR results of 5-HT1A in the prefrontal cortex during acute hypoxic exercise\u003c/h2\u003e \u003cp\u003eTable\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e shows that under normoxic conditions, the expression of 5-HT1A mRNA was significantly upregulated in the OE group compared to the O group. In hypoxic conditions, the expression of 5-HT1A mRNA was significantly upregulated in the HE group compared to the H group. Across different oxygen environments, the expression of 5-HT1A mRNA was significantly upregulated in the H group compared to the O group, and it was also significantly upregulated in the HE group compared to the OE group.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eResults of 5-HT1A expression mRNA in rat prefrontal cortex\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGroup\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5-HT1AmRNA\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e0.99\u0026thinsp;\u0026plusmn;\u0026thinsp;0.08\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e1.88\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04**\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e2.32\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07\u003csup\u003e##\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e2.91\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04**\u003csup\u003e##\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"2\"\u003eNote: Comparison within the group:* Indicates comparisons with the resting group of equal oxygen concentration, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05.** Indicates comparisons with the resting group of equal oxygen concentration, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01.Comparison between group:#Indicates comparisons with normoxic peers, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05.## Indicates comparisons with normoxic peers, p\u0026thinsp;\u0026lt;\u0026thinsp;0.0.1.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \n\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\n \u003ch2\u003e3.5 RTqPCR results of TRPV1 expression in the prefrontal cortex by Intraperitoneal administration of AMG9810\u003c/h2\u003e\n \u003cp\u003eTable 6 shows that the expression of TRPV1 in the rat prefrontal cortex significantly increased following acute hypoxic exhaustive exercise. With the intervention of HE+AMG9810, the expression of TRPV1 in the prefrontal cortex of rats in the HE+AMG9810 group was notably decreased. These results suggest that HE+AMG9810 effectively downregulates the expression of TRPV1 in the prefrontal cortex.\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\u0026nbsp;\u003ctable id=\"Tab6\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 6\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eResults of AMG9810 on the relative expression of TRPV1 in the prefrontal cortex.\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eGroup\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eTRPV1mRNA\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.77\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHE\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.91\u0026thinsp;\u0026plusmn;\u0026thinsp;0.15*\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHE\u0026thinsp;+\u0026thinsp;AMG9810\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.70\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09\u003csup\u003e#\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n \u003cp\u003e\u003cstrong\u003eNote:\u0026nbsp;\u003c/strong\u003e* Indicates comparison of HE with H, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05,# Indicates HE\u0026thinsp;+\u0026thinsp;AMG9810 compared to HE, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\n \u003ch2\u003e3.6 RTqPCR results of 5-HT1A in prefrontal cortex by Intraperitoneal administration of WAY100635\u003c/h2\u003e\n \u003cp\u003eTable \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003e shows that the expression of 5-HT1A in the rat prefrontal cortex significantly increased following acute hypoxic exhaustive exercise. With the intervention of WAY100635, the expression of 5-HT1A in the prefrontal cortex of rats in the HE\u0026thinsp;+\u0026thinsp;WAY100635 group was notably decreased. These results suggest that WAY100635 effectively downregulates the expression of 5-HT1A in the prefrontal cortex.\u0026nbsp;\u003c/p\u003e\n \u003ctable id=\"Tab7\" border=\"1\" class=\"fr-table-selection-hover\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 7\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eResults of WAY100635 on the relative expression of 5-HT1A in the prefrontal cortex\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eGroup\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e5-HT1AmRNA\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHE\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.25\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01*\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHE\u0026thinsp;+\u0026thinsp;WAY10063\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.03\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003csup\u003e#\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003ctfoot\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\"\u003eNote:* Indicates comparison with H, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05, #Indicates comparison with HE, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tfoot\u003e\n \u003c/table\u003e\n\u003c/div\u003e"},{"header":"4 Discussion and analysis","content":"\u003cp\u003eResearch indicates that as elevation increases in plateau environments, the efficiency of the human body decreases. At an altitude of 4,500 meters, the body's work capacity is only 60% of that at lower altitudes. In areas above 5,500 meters, the maximum labor capacity is just 30% of that in the plains. The decline in athletic performance in high-altitude environments can be attributed to hypoxic conditions, which reduce athletes' ability to train effectively. The main reason is that low oxygen levels lead to a decrease in both the oxygen concentration and blood flow to the prefrontal cortex of the brain. The capacity to maintain high minute ventilation in the face of reduced arterial oxygen hemoglobin saturation affects endurance exercise performance in hypoxic conditions. Additionally, hypoxic environments induce greater neuronal excitation in localized brain regions compared to normoxic environments, leading to increased oxygen consumption. Consequently, these brain regions require more nutrients to replenish the consumed oxygen, resulting in an earlier decline in exercise capacity in hypoxic environments.\u003c/p\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003e4.1 Analysis of TRPV1 results\u003c/h2\u003e \u003cp\u003eThe TRPV1 channel is encoded by a gene on chromosome 17p13 and consists of 17 exons[17][18]. Recent evidence suggests that TRPV1 is also present intracellularly in certain cell types. It is primarily found in the endoplasmic reticulum, it may function as a calcium release conduit and potentially induce endoplasmic reticulum stress. TRPV1 has also been detected on the sarcoplasmic reticulum membranes of skeletal muscles, specifically in the longitudinal sarcoplasmic reticulum through isolated membrane preparations[19]. Additionally, TRPV1 located in mitochondria is involved in calcium uptake and subsequent organelle depolarization[20], and its presence in the Golgi apparatus suggests a role in secretory protein transport[21].\u003c/p\u003e \u003cp\u003eOur study's findings highlight a significant increase in TRPV1 mRNA levels in the prefrontal cortex under hypoxic conditions, particularly during exhaustive exercise compared to rest. These results suggest that TRPV1 channels play a critical role in the premature decline of exercise capacity during acute hypoxic stress. This may be superior to ligand-binding activation of TRPV1 channels, which leads to channel activation, calcium ion influx, and subsequent elevation of intracellular calcium concentrations. This triggers a series of physiological or pathological events, such as the regulation of neurogenic inflammation and neurotransmitter release [8][9]. Studies have indicated that TRPV1 has a broader range of functions in the central nervous system [22]. TRPV1 can mediate multiple pathways, including glial and neuronal responses, as well as the release of cytokines [23]. Furthermore, the activation of TRPV1 expression can lead to cell death in astrocytomas [24]. In an ischemic stroke model, the inhibition of TRPV1 with AMG9810 reduced post-stroke inflammation, suggesting that TRPV1 may be a potential therapeutic target for ischemic stroke[25]. The results of our experiment provide preliminary confirmation of the involvement of TRPV1 channels in the onset of decreased exercise capacity under hypoxia.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003e4.2 Analysis of 5-HT results\u003c/h2\u003e \u003cp\u003eOur study observed a significant increase in 5-HT levels in the prefrontal cortex immediately after exhaustive exercise under normoxic conditions. This increase is even more pronounced following hypoxic exercise. Comparing the normoxic resting state to the hypoxic resting state, there is a notable augmentation in 5-HT expression in the prefrontal cortex. This increase is particularly significant when comparing exhaustive exercises under normoxic and hypoxic conditions. This phenomenon may be related to the role of monoaminergic neurotransmitters in mediating ischemic neuronal injury during cerebral ischemia and hypoxia. Ischemic stroke triggers the release of monoaminergic neurotransmitters, leading to impairments in reuptake and degradation, resulting in an excessive accumulation of neurotransmitters in the extracellular space and even abnormal reuptake into surrounding neurons, causing acute neural damage. The excessive discharge of monoamines may act as potent agonists that open calcium channels, causing an influx of intracellular calcium, activation of phospholipases, and subsequent neuronal death. The findings of this study also suggest that changes in 5-HT levels in the prefrontal cortex during acute hypoxic exercise could contribute to the premature decline in exercise capacity under hypoxia.\u003c/p\u003e \u003cp\u003eCentral fatigue is thought to be associated with neurotransmitters such as 5-HT, NE, and DA. Of these, it is evident that 5-HT plays a crucial role in the development of central fatigue[26]. Numerous studies have shown that increasing 5-HT concentration leads to fatigue occurrence, while decreasing its concentration may enhance exercise duration and reduce fatigue. Prolonged exercise increases the levels of 5-HT in the brain, which may impair central nervous system function by reducing signaling between the central and peripheral systems and affecting motor skills[27]. Furthermore, exhaustive exercise leads to elevated 5-HT concentrations, resulting in a decline in endurance exercise performance. Inhibiting 5-HT production in the brain may improve endurance exercise performance[28]. Gomez et al[29]. allowed rats to run for 120 minutes without any adaptive training and found that the changes in extracellular 5-HIAA levels in the hippocampus and cortex were consistent with the changes in 5-HT levels. The levels of both 5-HIAA and 5-HT significantly rose following 90 minutes of exercise, peaking within the initial 30 minutes of the recovery period. Studies have indicated that prolonged exercise can increase the brain's 5-HT mainly due to the elevated concentration caused by exercise. Increased 5-HT release can inhibit rhythmic activity and firing of motor neurons, ultimately leading to central fatigue[10][11][12]. The present study found a positive correlation between prefrontal cortex 5-HT expression and the occurrence of fatigue in both normoxic and hypoxic exhaustion exercises. Moreover, the concentration of prefrontal cortex 5-HT immediately after exhaustion exercise was significantly higher compared to the control group. In conclusion, the results suggest that changes in prefrontal cortical 5-HT levels in a hypoxic environment may contribute to an early decline in hypoxic exercise capacity.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec23\" class=\"Section2\"\u003e \u003ch2\u003e4.3 Analysis of 5-HT1A results\u003c/h2\u003e \u003cp\u003eThe serotonin (5-HT) receptor family encompasses seven distinct subfamilies (ranging from 5-HT1 to 5-HT7), each with multiple subtypes. The 5-HT1A receptor, a critical subtype, plays a pivotal role in the serotonin system, controlling mood, motor function, thermoregulation, and behavior. Studies indicate that 5-HT1A receptors are widely distributed on the soma and dendrites of serotonin neurons, acting as autoregulatory receptors for these neurons. The neurotransmission mediated by 5-HT1A receptors operates through an autoregulatory feedback loop. When activated by 5-HT or its agonists, these autoreceptors modulate the activity of serotonin neurons through a negative feedback mechanism, reducing the firing frequency of neurons, the release of neurotransmitters, and the activation of protein kinases[29]. Our study observed a rapid increase in 5-HT1A expression in the prefrontal cortex following strenuous exercise under normoxic and hypoxic conditions. Compared to the normoxic rest group, the hypoxic resting group showed a significant increase in 5-HT1A protein expression in the prefrontal cortex; similarly, compared to the normoxic exercise group, the hypoxic exercise group showed a significant in 5-HT1A protein levels in the prefrontal cortex. Kim et al.'s study[30] found that strenuous exercise can enhance the expression levels of 5-HT1A receptors and serotonin transporters (5-HTT); conversely, treatment with colostrum serum can mitigate the expression of 5-HT1A receptors in the dorsal raphe region following intense exercise. Perrier et al.'s study[31] revealed that the influx of serotonin into the axon initial segment and subsequent activation of 5-HT1A receptors can inhibit the action potentials of motor neurons, thereby preventing muscle over-contraction during prolonged activity. Consistent with our findings, the increased expression of 5-HT1A may further suppress neural excitability, leading to an early decline in exercise performance. This suggests that the 5-HT1A receptor may serve as a target for 5-HT, playing a role in diminishing exercise capacity.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003e4.4 Analysis of results of Intraperitoneal administration of AMG9810\u003c/h2\u003e \u003cp\u003ePrevious studies have shown that activation of the TRPV1 channel stimulates sensory neurons and triggers an accumulation of calcium in microglia. This leads to an increased burden of mitochondrial calcium and subsequent impairment and fragmentation of mitochondria[32]. Our findings reveal that acute hypoxic exercise increases the expression of TRPV1 channels in the cerebral prefrontal cortex. Significantly, the administration of a TRPV1 antagonist prolonged the exercise duration in rats, indicating that the increased expression of TRPV1 negatively impacts motor performance during acute hypoxic exercise. Therefore, strategic attenuation of TRPV1 may contribute to prolonged exercise endurance in hypoxic conditions. Additionally, inhibiting TRPV1 has shown potential benefits in enhancing exercise-induced cognitive functions and improving behavioral performance. For example, Razavinasab et al. demonstrated that inhibition of TRPV1 receptors can alter cellular distribution in the substantia nigra and effectively mitigate declines in motor and cognitive function induced by 6-hydroxydopamine in a rat model of Parkinson's disease[33]. In the context of levodopa-related complications, studies have demonstrated that suppressing TRPV1 receptor activity can effectively prevent the development of motor disorders[34]. Furthermore, studies on mice with traumatic brain injury have shown that inhibiting TRPV1 receptors through intraperitoneal injection of an antagonist can reduce neuronal apoptosis in the brain tissue following the injury, significantly improving behavioral performance[35].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec25\" class=\"Section2\"\u003e \u003ch2\u003e4.5 Analysis of results of Intraperitoneal administration of WAY100635\u003c/h2\u003e \u003cp\u003eResearch suggests that the activation of 5-HT1A receptors plays a pivotal role in inducing exercise-induced fatigue[36]. Participants who engage in strenuous physical activity and are administered 5-HT1A receptor agonists experience a heightened sense of fatigue[12]. Studies have shown that the activation of 5-HT1A receptors can reduce defensive aggressive behaviors within the hypothalamus and periaqueductal gray regions. A study on rats exposed to chronic stress showed that 5-HT1A receptor agonists effectively reduced pathological aggressive behaviors in rats under chronic stress[37]. Our study observed that acute hypoxic exercise in rats reduces the expression of 5-HT/5-HT1A in the cerebral prefrontal cortex. This change in prefrontal 5-HT/5-HT1A under hypoxic conditions may contribute to the decline in exercise performance. Moreover, our study noted a decrease in endurance among rats subjected to simulated high-altitude exercise at 4000 meters. Interestingly, administering a 5-HT1A antagonist to rats led to a significant increase in their exercise duration. This suggests that the activation of 5-HT1A receptors may diminish motor performance. Overall, our findings indicate that strategically modulating 5-HT1A signaling may be beneficial in enhancing the endurance performance of rats during acute hypoxic exercise.\u003c/p\u003e \u003c/div\u003e"},{"header":"5 Conclusion","content":"\u003cp\u003eAcute hypoxic exercise has been observed to increase the expression of TRPV1 channels in the prefrontal cortex. This increase in TRPV1 expression may play a role in the decline of hypoxic exercise ability. Additionally, the expression of 5-HT/5-HT1A in the prefrontal cortex is also increased during acute hypoxic exercise, and this increase may be one of the mechanisms contributing to the decline in exercise ability. To investigate these mechanisms further, a study was conducted using the TRPV1 blocker (AMG9810) and 5-HT1A blocker (WAY100635). The findings indicated that inhibiting TRPV1 led to a decrease in its expression within the prefrontal cortex, and similarly, blocking 5-HT1A receptor activity led to downregulation of its expression levels. Moreover, the blocking of these receptors prolonged the time of incremental loading exercise in a hypoxic environment. In summary, these findings suggest that the decreased exercise capacity in rats during acute hypoxic exercise may be attributed to the up-regulation of TRPV1 expression, which subsequently activates the expression of 5-HT/5-HT1A, conclusively resulting in diminished exercise performance.\u003c/p\u003e"},{"header":"6 Full-text summary and research outlook","content":"\u003cp\u003eThe present study provides preliminary evidence that the decrease in exercise capacity observed in rats during acute hypoxic exercise is correlated with elevated expression of TRPV1, 5-HT, and 5-HT1A in the prefrontal cortex. Additionally, injecting the inhibitor in the abdominal cavity revealed that the mechanism underlying the decrease in exercise capacity may involve the up-regulation of TRPV1 expression, which further activates the expression of 5-HT/5-HT1A, ultimately leading to decreased exercise capacity. The study highlights the critical regulatory roles of TRPV1 and 5-HT1A in the decline of acute hypoxic exercise capacity, suggesting that appropriate down-regulation of these molecules may prolong exercise duration in rats. This finding lays the foundation for future studies on nutrient interventions. By exploring the activation mechanism of TRPV1, this study provides a biological basis for identifying nutrients that can down-regulate TRPV1 activation. It is important to note that this study is only a preliminary demonstration of the potential role of blockers in improving hypoxic exercise capacity, and further experimental studies are needed to explore and verify these findings. Additionally, it is worth mentioning that the animal model used in this experiment may not fully reflect real-life hypoxic exhaustion scenarios, as it was designed to investigate the related mechanisms.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eTRPV1 \u0026nbsp;Transient receptor potential vanilloid subtype 1\u003c/p\u003e\n\u003cp\u003e5-HT1A \u0026nbsp;5-hydroxytryptamine1A\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e5-HT 5-hydroxytryptamine\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study is reported in accordance with the ARRIVE guidelines, was conducted in accordance with the Basel Declaration, and was approved by the Ethics Committee of\u0026nbsp;Sports Science Experiment of Beijing Sport University (approval number: 2020176).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated in this study are included in its Supplementary Information document.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe Authors declares that they have no Conflicts of Interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by Beijing Higher Education Teaching Reform Project(202310029005), Hubei natural science foundation (JCZRLH202501226), Science Popularization Project of the General Administration of Sport of China (2025TK021), and the Emerging Interdisciplinary Platform for Medicine and Engineering in Sports (EIPMES).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors contributed to the study.\u0026nbsp;Jing Ma\u0026nbsp;conceived and designed research.\u0026nbsp;Material preparation, data collection and analysis were performed by\u0026nbsp;Jing Ma, Xing Huang,\u0026nbsp;Lijing Gong, Yizhu Tang, Chi Xu.\u0026nbsp;The first draft of the manuscript was written by Jing Ma, Xing Huang,\u0026nbsp;Lijing Gong, Yizhu Tang, Chi Xu.\u0026nbsp;All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors were grateful to the participants for their time and investment in the investigation.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eC. Siebenmann and P. Rasmussen, \u0026ldquo;Does cerebral hypoxia facilitate central fatigue?,\u0026rdquo; Experimental Physiology, vol. 101, no. 9, pp. 1173\u0026ndash;1177, 2016.\u003c/li\u003e\n\u003cli\u003eY. Liang et al., \u0026ldquo;Effects of Moxibustion on Central Fatigue in Rats Subjected to Different Degrees of Exhaustive Exercise,\u0026rdquo; Physikalische Medizin, Rehabilitationsmedizin, Kurortmedizin, vol. 29, no. 01, pp. 39\u0026ndash;44, 2019.\u003c/li\u003e\n\u003cli\u003eT. RUPP, T. L. R. MALLOUF, S. PERREY, B. WUYAM, G. Y. MILLET, and S. VERGES, \u0026ldquo;CO2 Clamping, Peripheral and Central Fatigue during Hypoxic Knee Extensions in Men,\u0026rdquo; Medicine \u0026amp; Science in Sports \u0026amp; Exercise, vol. 47, no. 12, pp. 2513\u0026ndash;2524, 2015.\u003c/li\u003e\n\u003cli\u003eJ.-L. Fan and B. Kayser, \u0026ldquo;Fatigue and Exhaustion in Hypoxia: The Role of Cerebral Oxygenation,\u0026rdquo; High Altitude Medicine \u0026amp; Biology, vol. 17, no. 2, pp. 72\u0026ndash;84, 2016.\u003c/li\u003e\n\u003cli\u003eA. W. Subudhi, B. R. Miramon, M. Granger, and R. C. Roach, \u0026ldquo;Frontal and motor cortex oxygenation during maximal exercise in normoxia and hypoxia,\u0026rdquo; Journal of Applied Physiology, vol. 106, no. 4, pp. 1153\u0026ndash;1158, 2009.\u003c/li\u003e\n\u003cli\u003eX. Huang, Y. Hu, L. Zhao, B. Gu, R. Zhu, and Y. Li, \u0026ldquo;TRPV4 plays an important role in rat prefrontal cortex changes induced by acute hypoxic exercise,\u0026rdquo; Saudi J Biol Sci, vol. 26, no. 6, pp. 1194\u0026ndash;1206, 2019.\u003c/li\u003e\n\u003cli\u003eX.-L. Yang, X. Wang, L. Shao, G.-T. Jiang, J.-W. Min, and X.-Y. Mei, \u0026ldquo;TRPV1 mediates astrocyte activation and interleukin-1\u0026beta; release induced by hypoxic ischemia (HI),\u0026rdquo; Journal of Neuroinflammation, vol. 16, no. 1, pp.114, 2019.\u003c/li\u003e\n\u003cli\u003eD. S. K. Samways, B. S. Khakh, and T. M. Egan, \u0026ldquo;Tunable Calcium Current through TRPV1 Receptor Channels,\u0026rdquo; Journal of Biological Chemistry, vol. 283, no. 46, pp. 31274\u0026ndash;31278, 2008.\u003c/li\u003e\n\u003cli\u003eA. W. Subudhi, B. R. Miramon, M. Granger, and R. C. Roach, \u0026ldquo;Frontal and motor cortex oxygenation during maximal exercise in normoxia and hypoxia,\u0026rdquo; Journal of Applied Physiology, vol. 106, no. 4, pp. 1153\u0026ndash;1158, 2009.\u003c/li\u003e\n\u003cli\u003eD. D. Soares, C. C. Coimbra, and U. Marubayashi, \u0026ldquo;Tryptophan-induced central fatigue in exercising rats is related to serotonin content in preoptic area,\u0026rdquo; Neuroscience Letters, vol. 415, no. 3, pp. 274\u0026ndash;278, 2007.\u003c/li\u003e\n\u003cli\u003eL. M. S. Cordeiro, P. C. R. Rabelo, M. M. Moraes, F. Teixeira-Coelho, C. C. Coimbra, and S. P. Wanner, \u0026ldquo;Physical exercise-induced fatigue: the role of serotonergic and dopaminergic systems,\u0026rdquo; Brazilian journal of medical and biological research, vol. 50, no. 12, pp. e6432, 2017.\u003c/li\u003e\n\u003cli\u003eG. Marvin, A. Sharma, W. Aston, C. Field, M. Kendall, and D. Jones, \u0026ldquo;The effects of buspirone on perceived exertion and time to fatigue in man,\u0026rdquo; Experimental Physiology, vol. 82, no. 6, pp. 1057\u0026ndash;1060, 1997.\u003c/li\u003e\n\u003cli\u003eS.-S. Park, T.-W. Kim, C.-J. Kim, S.-Y. Hong, B.-K. Kim, and Y.-J. Sim, \u0026ldquo;Effect of sildenafil citrate on brain central fatigue after exhaustive swimming exercise in rats,\u0026rdquo; Journal of Exercise Rehabilitation, vol. 15, no. 5, pp. 651\u0026ndash;656, Oct. 2019.\u003c/li\u003e\n\u003cli\u003eM. Li, M. Zhu, Q. Xu, F. Ding, Y. Tian, and M. Zhang, \u0026ldquo;Sensation of TRPV1 via 5-hydroxytryptamine signaling modulates pain hypersensitivity in a 6-hydroxydopamine induced mice model of Parkinson\u0026rsquo;s disease,\u0026rdquo; Biochemical and Biophysical Research Communications, vol. 521, no. 4, pp. 868\u0026ndash;873, 2020.\u003c/li\u003e\n\u003cli\u003eT. Schilling and C. Eder, \u0026ldquo;Importance of the non-selective cation channel TRPV1 for microglial reactive oxygen species generation,\u0026rdquo; Journal of Neuroimmunology., vol. 216, no. 1-2, pp. 118-121, 30, 2009.\u003c/li\u003e\n\u003cli\u003eS. R. Kim, S. U. Kim, U. Oh, and B. K. Jin, \u0026quot;Transient receptor potential vanilloid subtype 1 mediates microglial cell death in vivo and in vitro via Ca\u003csup\u003e2+\u003c/sup\u003e-mediated mitochondrial damage and cytochrome c release,\u0026quot; The Journal. Immunology., vol. 177, no. 7, pp. 4322-4329, 1, 2006.\u003c/li\u003e\n\u003cli\u003eL. Birnbaumer, E. Yildirim, and J. Abramowitz, \u0026ldquo;A comparison of the genes coding for canonical TRP channels and their M, V and P relatives,\u0026rdquo; Cell Calcium, vol. 33, no. 5-6, pp. 419-432, 2003.\u003c/li\u003e\n\u003cli\u003eS. Bevan, T. Quallo, and D. A. Andersson, \u0026ldquo;TRPV1,\u0026rdquo; Handbook of experimental. pharmacology, vol. 222, pp. 207-245, 2014\u003c/li\u003e\n\u003cli\u003eR. Zhao, S. Y. Tsang, \u0026ldquo;Versatile Roles of Intracellularly Located TRPV1 Channel,\u0026rdquo; Journal Cell Physiology., vol. 232, no. 8, pp. 1957-1965, 2017.\u003c/li\u003e\n\u003cli\u003eT. Miyake, H. Shirakawa, T. Nakagawa, and S. Kaneko, \u0026ldquo;Activation of mitochondrial transient receptor potential vanilloid 1 channel contributes to microglial migration,\u0026rdquo; Glia, vol. 63, no. 10, pp. 1870-1882, 2015.\u003c/li\u003e\n\u003cli\u003eS. Lotteau, S. Ducreux, C. Romestaing, C. Legrand, and F. Van Coppenolle, \u0026ldquo;Characterization of functional TRPV1 channels in the sarcoplasmic reticulum of mouse skeletal muscle,\u0026rdquo; PLoS One, vol. 8, no. 3, e58673, 2013.\u003c/li\u003e\n\u003cli\u003eZ. Luo, L. Ma, Z. Zhao, H. He, D. Yang, X. Feng, S. Ma, X. Chen, T. Zhu, T. Cao, D. Liu, B. Nilius, Y. Huang, Z. Yan, and Z. Zhu, \u0026ldquo;TRPV1 activation improves exercise endurance and energy metabolism through PGC-1\u0026alpha; upregulation in mice,\u0026rdquo; Cell Research, vol. 22, no. 3, pp. 551-564, 2012\u003c/li\u003e\n\u003cli\u003eA. Navarria, A. Tamburella, F. A. Iannotti, V. Micale, G. Camillieri, L. Gozzo, R. Verde, R. Imperatore, G. M. Leggio, F. Drago, and V. Di Marzo, \u0026ldquo;The dual blocker of FAAH/TRPV1 N-arachidonoyl serotonin reverses the behavioral despair induced by stress in rats and modulates the HPA-axis,\u0026rdquo; Pharmacological research., vol. 87, pp. 151-159, 2014.\u003c/li\u003e\n\u003cli\u003eK. Stock, J. Kumar, M. Synowitz, S. Petrosino, R. Imperatore, E. S. Smith, P. Wend, B. Purf\u0026uuml;rst, U. A. Nuber, U. Gurok, V. Matyash, J. H. W\u0026auml;lzlein, S. R. Chirasani, G. Dittmar, B. F. Cravatt, S. Momma, G. R. Lewin, A. Ligresti, L. De Petrocellis, L. Cristino, V. Di Marzo, H. Kettenmann, and R. Glass, \u0026ldquo;Neural precursor cells induce cell death of high-grade astrocytomas through stimulation of TRPV1,\u0026rdquo; Nature medicine., vol. 18, no. 8, pp. 1232-1238, 2012.\u003c/li\u003e\n\u003cli\u003eE. Hakimizadeh, A. Shamsizadeh, A. Roohbakhsh, M. K. Arababadi, M. R. Hajizadeh, M. Shariati, M. R. Rahmani, and M. Allahtavakoli, \u0026ldquo;Inhibition of transient receptor potential vanilloid-1 confers neuroprotection, reduces tumor necrosis factor-alpha, and increases IL-10 in a rat stroke model,\u0026rdquo; Fundamental Clinical Pharmacology., vol. 31, no. 4, pp. 420-428, 2017. \u003c/li\u003e\n\u003cli\u003eK. TW, K. CJ, J. Seo, \u0026ldquo;Effects of colostrum serum on the serotonergic system in the dorsal raphe nuclei of exercised rats,\u0026rdquo; J. Exerc. Nutrition Biochem., vol. 21, no. 1, pp. 33-39, 31,2017.\u003c/li\u003e\n\u003cli\u003eCotel F, Exley R, Cragg S J, et al. Serotonin spillover onto the axon initial segment of motoneurons induces central fatigue by inhibiting action potential initiation[J]. Proceedings of the National Academy of Sciences, 2013, 110(12):4774-4779.\u003c/li\u003e\n\u003cli\u003eJ. H. Seo, Y. H. Sung, K. J. Kim, M. S. Shin, E. K. Lee, and C. J. Kim, \u0026ldquo;Effects of Phellinus linteus administration on serotonin synthesis in the brain and expression of monocarboxylate transporters in the muscle during exhaustive exercise in rats,\u0026rdquo; Journal Nutritional Science and Vitaminology. (Tokyo), vol. 57, no. 1, pp. 95-103, 2011.\u003c/li\u003e\n\u003cli\u003eGomez-Merino D, F B\u0026eacute;quet, Berthelot M , et al. Site-dependent effects of an acute intensive exercise on extracellular 5-HT and 5-HIAA levels in rat brain[J]. Neuroscience Letters, 2001, 301(2):143-146. \u003c/li\u003e\n\u003cli\u003eA. Newman-Tancredi, R. Y. Depoort\u0026egrave;re, M. S. Kleven, M. Kołaczkowski, and L. Zimmer, \u0026ldquo;Translating biased agonists from molecules to medications: Serotonin 5-HT1A receptor functional selectivity for CNS disorders,\u0026rdquo; Pharmacology \u0026amp; Therapeutics., vol. 229, pp. 107937, 2022.\u003c/li\u003e\n\u003cli\u003eJ.-F. Perrier, \u0026ldquo;Modulation of motoneuron activity by serotonin,\u0026rdquo; Danish Medical Journal., vol. 63, no. 2, pp. B5204, 2016\u003c/li\u003e\n\u003cli\u003eW. Gao, Y. Sun, M. Cai, Y. Zhao, W. Cao, Z. Liu, G. Cui, and B. Tang, \u0026ldquo;Copper sulfide nanoparticles as a photothermal switch for TRPV1 signaling to attenuate atherosclerosis,\u0026rdquo; Nature Communications., vol. 9, no. 1, pp. 231, 15, 2018.\u003c/li\u003e\n\u003cli\u003eM. Razavinasab, A. Shamsizadeh, M. Shabani, M. Nazeri, M. Allahtavakoli, M. Asadi-Shekaari, S. Esmaeli-Mahani, and V. Sheibani, \u0026ldquo;Pharmacological blockade of TRPV1 receptors modulates the effects of 6-OHDA on motor and cognitive functions in a rat model of Parkinson\u0026rsquo;s disease,\u0026rdquo; Fundamental Clinical Pharmacology., vol. 27, no. 6, pp. 632-640, 2013\u003c/li\u003e\n\u003cli\u003eR. Gonz\u0026aacute;lez-Aparicio and R. Moratalla, \u0026ldquo;Oleoylethanolamide reduces L-DOPA-induced dyskinesia via TRPV1 receptor in a mouse model of Parkinson\u0026rsquo;s disease,\u0026rdquo; Neurobiology of disease., vol. 62, pp. 416-425, 2014.\u003c/li\u003e\n\u003cli\u003eD. X. Yang, Y. Jing, Y. L. Liu, Z. M. Xu, F. Yuan, M. L. Wang, Z. Geng, and H. L. Tian, \u0026ldquo;Inhibition of Transient Receptor Potential Vanilloid 1 Attenuates Blood-Brain Barrier Disruption after Traumatic Brain Injury in Mice,\u0026rdquo; Journal of Neurotrauma, vol. 36, no. 8, pp. 1279-1290, 15, 2019.\u003c/li\u003e\n\u003cli\u003eZ. Liu, Y. Wu, T. Liu, R. Li, and M. Xie, \u0026ldquo;Serotonin regulation in a rat model of exercise-induced chronic fatigue,\u0026rdquo; Neuroscience., vol. 349, pp. 27-34, 4, 2017.\u003c/li\u003e\n\u003cli\u003eK. C. Fone and M. V. Porkess, \u0026ldquo;Behavioural and neurochemical effects of post-weaning social isolation in rodents - relevance to developmental neuropsychiatric disorders,\u0026rdquo; Neuroscience and Biobehavioral Reviews., vol. 32, no. 6, pp. 1087-1102, 2008.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-sports-science-medicine-and-rehabilitation","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ssmr","sideBox":"Learn more about [BMC Sports Science, Medicine and Rehabilitation](http://bmcsportsscimedrehabil.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/ssmr/default.aspx","title":"BMC Sports Science, Medicine and Rehabilitation","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"TRPV1, 5-HT, 5-HT1A, Acute hypoxic exercise, Prefrontal corte","lastPublishedDoi":"10.21203/rs.3.rs-6697572/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6697572/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eObjective\u003c/h2\u003e \u003cp\u003eThis study aims to explore TRPV1's function in acute hypoxic exercise and the CNS's impact on initial exercise decline in high-altitude-trained athletes.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eAfter acute hypoxia intervention, RTqPCR was employed to detect the content of transient receptor potential vanilloid subtype 1 (TRPV1) and 5-hydroxytryptamine1A(5-HT1A) in the rat prefrontal cortex; ELISA was used to measure the content of 5-hydroxytryptamine (5-HT) in the rat prefrontal cortex.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eHypoxic conditions can shorten the time rats can perform increased load exercise, leading to an early onset of fatigue and a significant decline in exercise capacity. Acute hypoxic exercise has been observed to increase the expression of TRPV1, 5-HT and 5-HT1A in the prefrontal cortex, which may contribute to the decline in exercise capacity. Blocking TRPV1 and 5-HT1A further extending the time for increased load exercise under hypoxic conditions and enhancing exercise capacity.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eRats' initial decline in exercise during acute hypoxia may result from TRPV1 upregulation, which activates the 5-HT/5-HT1A pathway; TRPV1 blockade can alleviate the stress caused by hypoxic conditions, thereby reducing prefrontal cortex cell damage and apoptosis, and ultimately extending exercise time.\u003c/p\u003e","manuscriptTitle":"Expression and Mechanism of TRPV1 Channel in Prefrontal Cortex after Acute Hypoxic Exercise","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-06-05 09:49:38","doi":"10.21203/rs.3.rs-6697572/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-06-30T10:09:44+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-06-21T05:17:53+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"95662709176203258840599543321000777377","date":"2025-06-10T15:55:57+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-06-08T11:18:20+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"29814978255372387357250290055089150675","date":"2025-06-06T09:22:50+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"214920486191424725594491014324584008423","date":"2025-06-05T01:48:42+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-06-03T10:33:14+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-05-29T10:21:41+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-05-28T09:37:08+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Sports Science, Medicine and Rehabilitation","date":"2025-05-28T09:35:59+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-sports-science-medicine-and-rehabilitation","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ssmr","sideBox":"Learn more about [BMC Sports Science, Medicine and Rehabilitation](http://bmcsportsscimedrehabil.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/ssmr/default.aspx","title":"BMC Sports Science, Medicine and Rehabilitation","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"f6ba3ffa-2ff1-4ab5-941e-e15347805f65","owner":[],"postedDate":"June 5th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-01-26T16:09:57+00:00","versionOfRecord":{"articleIdentity":"rs-6697572","link":"https://doi.org/10.1186/s13102-025-01523-6","journal":{"identity":"bmc-sports-science-medicine-and-rehabilitation","isVorOnly":false,"title":"BMC Sports Science, Medicine and Rehabilitation"},"publishedOn":"2026-01-19 15:59:06","publishedOnDateReadable":"January 19th, 2026"},"versionCreatedAt":"2025-06-05 09:49:38","video":"","vorDoi":"10.1186/s13102-025-01523-6","vorDoiUrl":"https://doi.org/10.1186/s13102-025-01523-6","workflowStages":[]},"version":"v1","identity":"rs-6697572","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6697572","identity":"rs-6697572","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-22T02:00:06.705733+00:00
License: CC-BY-4.0