Universal two-dimensional labelled probe-mediated melting curve analysis based on multiplex PCR for rapid typing of plasmodium in a single closed tube

33 Nowadays, malaria is still one of the major public health problems which commonly 34 caused by four plasmodium species, especially in the epidemic of COVID -19 35 harboring similar symptoms of fever or fatigue, which easily result in misdiagnosis. 36 The disadvantages of previous traditional detection methods, such as time-consuming, 37 costly, complicated operation, strong professionalism, indistinguishable typing and so 38 on, lead to the dilemma of difficulty to meet the clinical requirements of rapid, easy 39 and accurate typing o f common plasmodiums. Herein, we developed and maximally 40 optimized a universal two -dimensional label led probe -mediated melting curve 41 analysis (UP-MCA) assay based on multiplex PCR for rapid and accurate typing of 42 five plasmodiums, including novel human plasmodium, Plasmodium knowlesi (Pk), in 43 a single closed tube following genome extraction. The assay showed the limit of 44 detection (LOD) of 10 copies per reaction and can accurately distinguish plasmodium 45 species from intra -plasmodium and other pathogens. In addition, we also proposed 46 and verified different methods of fluorescence -quenching and two dimensional 47 labelled tag for probes that are suitable for UP -MCA assay. Furthermore, its clinical 48 performance was evaluated by 184 samples and showed sensitivity of 100% (164/164) 49 and specificity of 100% (20/20) at 99% confidence interval, respectively, with the 50 microscopy method as gold standard. Taken together, the UP -MCA system showed 51 excellent sensitivity, specificity and accuracy for genotyping of plasmodium, an d it 52 meets the requirements of rapidity and convenience for plasmodium detection in 53 clinical routine and has great potential for clinical translation. 54 55

56 All rights reserved. No reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. The copyright holder for this preprintthis version posted April 16, 2022. ; https://doi.org/10.1101/2022.04.12.22271963doi: medRxiv preprint 3 / 27 Malaria is a life -threatening disease caused by protozoan parasites, belong to the 57 Plasmodium genus, which are transmitted to people through the bites of infected 58 female anopheles mosquitoes. Approximately 229 million malaria cases were reported 59 worldwide according to World Malaria Report 2020, causing an estimated 409,000 60 deaths in 2019. Althou gh claim of local malaria elimination from some regions or 61 countries authenticated by World Health Organization (WHO), there is still a great 62 risk of imported malaria with the development of economy globalization and the 63 aggravation of population immigration and emigration across regions or countries. 64 Commonly, there are four parasite species of plasmodium genus known to cause 65 human malaria, including Plasmodium vivax (Pv), Plasmodium falciparum (Pf), 66 Plasmodium ovale (Po), and Plasmodium malariae (Pm). Additionally, Plasmodium 67 knowlesi (Pk) derived from macaques was considered as the fifth species of 68 Plasmodium causing malaria in humans (1) since large focus and description in 69 2004(2). Clinically, different treatments and monitoring patterns would be taken after 70 the judgment of different plasmodium species(3). Therefore, timely, easy and accurate 71 typing of plasmodium is very important for countries or coastal cities of happening 72 transactions or population mobility frequently over the world, especially imported 73 malaria from plasmodium high-burden regions. 74 Traditionally, microscopy, known as the gold standard for the diagnosis of clinical 75 malaria, is professional interpretative and time -consuming, requires expertise gained 76 by strict training and experience, and cannot effectively support large studies. Also, it 77 is difficult in distinguishing P . knowlesi from P . malariae because of their 78 morphological similarities (2, 4) , while P . knowlesi results in severe and deadly 79 malaria. Rapid diagnostic tests (RDTs) based on immune -chromatographic antigen 80 detection have been implemented in some diagnostic labor atories as a supplement to 81 microscopy(5). Although they are rapid, simple, and easy to interpret, RDTs target 82 proteins specific to P . falciparum or P . vivax or those common to all plasmodium 83 species and cannot specifically differ P . malariae, P . ovale, and P . knowlesi(5, 6). 84 Furthermore, di agnostic sensitivity (e.g., lacking sensitivity for some strains of P . 85 falciparum and up to 50% of P . knowlesi)(7) and specificity (e.g., P . vivax in patients 86 All rights reserved. No reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. The copyright holder for this preprintthis version posted April 16, 2022. ; https://doi.org/10.1101/2022.04.12.22271963doi: medRxiv preprint 4 / 27 with co-infections and high P . falciparum parasitemia levels) are variable widely for 87 commercially available RDTs. 88 Conversely, molecular detection methods offer an attractive alternative approach. 89 Commonly, PCR is a heat -dependent cycle amplification react ion that harbors ability 90 of exponential amplification for original genome used as one of most important 91 nucleic acid test method (8-10). Conventional PCR assays require post -handling, 92 time-consuming and risk of cross -contamination. Although some real -time PCR 93 assays have been described (11, 12) , they cannot distinguish multiple plasmodium 94 species in one -pot reaction mainly as a result of l ow fluorescent channel and 95 throughput, with similarly limited evaluation of one or two plasmodium species 96 samples. Additionally, clinical performance of specificity cannot be ensured since 97 blood samples from patients with plasmodium are difficult to be obt ained and 98 infrequently tested. Recently, Plasmodium species detection assay based on 99 isothermal amplification, such as loop -mediated isothermal amplification 100 (LAMP)(13-16), recombinase polymerase amplification (RPA) (17-19) etc, showed a 101 great convenience for point -of-care diagnosis, especially for resource -limited setting, 102 but it lacks of detection throughput and sensitivity in field diagnosis, especially 103 appearance of false positive or negative results. CRISPR based diagnostic platform 104 (CRISPR-Dx) as a new emerging nucleic acid detection technology used for 105 point-of-care diagnosis, such as Cas12a mediated plasmodium detection assay (20), 106 showed great sensitivity and specificity, but it requires expensive Cas protein from 107 commercial corporation and it is difficult to achieve multiple objects detection in a 108 single closed tube. 109 Herein, we proposed a Universal two -dimensional labe lled Probe-mediated Melting 110 Curve Analysis (UP-MCA) assay based on multiplex PCR within four fluorescence 111 channels at real-time PCR instrument for malaria genotyping. It is a rapid, sensi tive, 112 specific, low cost and high throughput detection strategy for five plasmodium species, 113 including Plasmodium falciparum, Plasmodium vivax, Plasmodium malariae, 114 Plasmodium ovale, and Plasmodium knowlesi , with human ribonuclease P (RNase P) 115 gene as the internal control in state of one -pot and closed tube following introduction 116 All rights reserved. No reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. The copyright holder for this preprintthis version posted April 16, 2022. ; https://doi.org/10.1101/2022.04.12.22271963doi: medRxiv preprint 5 / 27 of genome extract. Moreover, the assay was validated by detection of clinical malaria 117 samples and showed as a good alternative tool for clinical malaria diagnosis. 118 119

and Method 120 Collection and genome extraction for clinical samples 121 Clinical blood samples were collected from Mengchao Hepatobiliary Hospital of 122 Fujian Medical University from July 2016 to March 2020 with one sample came from 123 one person, including patients with signs and symptoms of, such as fever, fatigue etc. 124 which is similar to malaria. And genome extraction of 200 microliters whole blood for 125 these samples were prepared by Ex -DNA whole blood extraction kit using automated 126 nucleic acid extraction equipment (NP968-C, Xi'an Tianlong Science and Technology 127 Co., Ltd, China) and 80 microliters nucleic acid extract were left over and measured 128 by Nanodrop 2000 (Thermo Fisher Scientific, USA). They were stored at -20 ° C until 129 used. 130 131 Principle of species-specific plasmodium detection assay 132 Although real-time PCR based on sequence specific probe shows higher sensitivity 133 and specificity than that using saturated or unsaturated dye, such as SYBR Green or 134 Eva Green, the amount of detected objects are limited becau se of limited fluorescent 135 channels of real-time PCR equipment. So, in order to achieve more objects detect ion 136 in one reaction, we proposed that universal two -dimensional labelled probe-mediated 137 melting curve analysis based on multiplex PCR (UP -MCA) assay f or reliable 138 detection of five common species -specific plasmodium in one -pot reaction. This 139

combines multiplex PCR with melting curve analysis, which is mediated by 140 universal fluorescent probe corresponding to specific fluorescent channel and 141 annealing temperature (Tm) produced for hybridization with homology tag that 142 carried in plasmodium species -specific primer. Its process involves that polymerase 143 mediated asymmetric amplification using target specific primers for tag mark of 144 specific amplicon and fluorescent detection depending on hybridization between 145 All rights reserved. No reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. The copyright holder for this preprintthis version posted April 16, 2022. ; https://doi.org/10.1101/2022.04.12.22271963doi: medRxiv preprint 6 / 27 homology tag and non -target sequence dependent universal fluorescent probe. 146 Different Tm values brought out by variable degrees of hybridization analyzed by 147 melting curve analysis are used for detect ion of specific plasmodium candidates in 148 addition to difference of fluorescent channel ( Figure.1). According to the previous 149 research, this two dimensional label method can achieve detection of dozens of 150 objects in one reaction under different fluorescence and elaborate Tm value 151 representing detailed detection object(21). 152 153 Design and synthesis of plasmodium species-specific primers and universal probe 154 Initially, the amplification targets for P. falciparum, P. vivax, P. malariae, P. ovale and 155 P. knowlesi based on previous studies(10, 11, 20, 22-24) and available gene sequences 156 in GenBank were analyzed. Following that, nuclear small subunit (SSU) rRNA gene 157 was confirmed as plasmodium detection target and used for the design of plasmodium 158 species-specific primers as a result of the availability of its sufficient copies and 159 conservative and species -specific sequences for plasmodium detection. Hence, we 160 further blasted the sequences of SSU rRNA gene in P. falciparum (GenBank accession 161 no. M19172), P. vivax (GenBank accession no. X13926), P. ovale (GenBank 162 accession no. L48987), P. malariae (GenBank accession no. M54897), and P. knowlesi 163 (GenBank accession no. AY327550) using the software ClustalX and selected one 164 sequence region existing great difference, also existing high homology for 165 plasmodium genus for the availability of number of primers reduction. Following that, 166 homology and difference sequences we re selected for the design of plasmodium 167 UP-MCA assay of abundant forward primer (AF primer) and limiting reverse primer 168 (LR primer), respectively. All primers and fluorescent probes were synthesized from 169 Sunya Biotech (Fuzhou) Co., Ltd and Sangon Biotech (Shanghai) Co., Ltd. And DNA 170 plasmid standards of different plasmodium species -specific and conservative 171 fragments of SSU rRNA gene and fragments of human RNaseP gene were constructed 172 by General Biosystems (Anhui) Co. Ltd. 173 Universal fluorescent probes and tags for species-specific plasmodium detection were 174 chosen from previous research (21). Furthermore, variable degrees of hybridization 175 All rights reserved. No reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. The copyright holder for this preprintthis version posted April 16, 2022. ; https://doi.org/10.1101/2022.04.12.22271963doi: medRxiv preprint 7 / 27 between homology tag and universal fluorescent probe determine the detail Tm value 176 resulted from their effective hybridization length and ba se pairing degree. So we 177 inferred and verified that homologous tags of certain length used for real 178 hybridization with universal probe can also result in different Tm values 179 corresponding to different candidate. 180 181 Establishment of Universal two -dimensional labelled probe- mediated melt curve 182 analysis (UP-MCA) for species-specific plasmodium detection assay 183 DNA standards of SSU rRNA gene from species-specific plasmodium were prepared 184 before establishment of detection assay ( Table. S1 ). In order to achieve bet ter 185 performance of plasmodium detection, optimizations were implemented by the assay 186 of polymerase enzymes (Taq DNA Polymerase, TaKaRa Taq HS, Vent ® (exo-) DNA 187 Polymerase, Klenow Fragment (3’→5’exo -), all of initial concentration are 5 U/μl), 188 buffers (Taq buffer, Taq HS buffer, buffer A, buffer M, buffer 6 and PCR buffer, initial 189 concentrations of all are 10× ), temperature (54~66 ° C) and concentration of Mg 2+ 190 (3~6 mM) and primers. Furthermore, Extreme Thermostable Single -Stranded DNA 191 Binding Protein (ET SSB ) is a single -stranded DNA binding protein used for 192 stabilization of ssDNA structure and improvement of the processivity of DNA 193 polymerase following that increasing the yield and specificity of PCR. Therefore, we 194 also took ET SSB into consideration for assay optimization. 195 For single-plex assay, the reaction volume of twenty -five microliter including 1× Taq 196 HS buffer, 1.5 U TaKaRa Taq HS（5 U/μl）, 4 mM MgCl2, 200 μM dNTP（A/G/C/T）, 197 0.2 μM universal fluorescence probe, 0.8 μM abundant forward primer, 0.04 μM 198 limiting reverse primer with homologous tag, 2 μL template. The assay was 199 performed at the standard two -step PCR protocol with initial denaturation at 95° C for 200 3 min followed by 50 cycles of denaturation at 95° C for 15 s, annealing / extension at 201 60 ° C for 45 s, then addition of melting curve analysis from 35 ℃ to 85 ℃ before 202 sufficient denaturation at 95° C for 1 min and hybridization at 30° C for 2 min. 203 Parameter replacement of annealing / extension at 64 ℃ and addition of 4 ng/uL ET 204 SSB were used for mult iplex species -specific plasmodium detection assay. The 205 All rights reserved. No reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. The copyright holder for this preprintthis version posted April 16, 2022. ; https://doi.org/10.1101/2022.04.12.22271963doi: medRxiv preprint 8 / 27 different channel fluorescence (FAM or HEX or FAM and HEX) can be only 206 collected during the process of melting curve analysis, not for amplification process. 207 The reaction was occurred by the fluorescen ce PCR equipment (Applied Biosystems 208 7500 Real-Time PCR System in this study; Thermo Fisher Scientific). 209 As defined herein, the determination of detected result was taken by the fluorescence 210 channel and preset Tm value. And positive result of sample for o ne subject was 211 refined as the –d(RFU)/dT value of melt peak height was 1.5 times more than that of 212 negative control which RNase -free water or non -plasmodium DNA or RNA serve as 213 reaction template. 214 215 Performance evaluation of UP -MCA assay (including sensitivi ty, specificity, 216 selectivity and clinical performance) for plasmodium detection 217 For evaluation of the sensitivity of UP -MCA for species -specific plasmodium assay, 218 the preparation of reaction template was used by a series of gradient dilution 219 concentration of various plasmodium plasmids from 105 copies / μL to 101 copies / μL. 220 Various concentrations of different plasmodium plasmids served as template were run 221 at least in triplex wells. The selection of some pathogens of similar clinical symptoms 222 or blood-borne diseases, including Babesia, Borrelia burgdorferi, Chikungunya virus, 223 human immunodeficiency virus, Hepatitis B virus, Hepatitis C virus and Novel 224 coronavirus (2019) was applied for the assessment of the specificity of this UP -MCA 225 assay. For examination of the selection and distinction ability of species -specific 226 plasmodium detection assay, two neighboring object s at the same fluorescence 227 channel, Plasmodium falciparum and Plasmodium vivax, were taken into observation 228 of accurate detection of plasmodium species. Furthermore, negative control of 229 RNase-free water or non -plasmodium genome served as template for plasmodium 230 assay was taken for above three tests. 231 Practically, the performance evaluation of species -specific plasmodium detection 232 assay was carried out by multiplex UP -MCA fluorescence system using a total of 184 233 clinical blood samples mentioned above, including 164 microscopy -positive of 234 malaria and 20 microscopy-negative of blood -borne diseases with similar signs and 235 All rights reserved. No reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. The copyright holder for this preprintthis version posted April 16, 2022. ; https://doi.org/10.1101/2022.04.12.22271963doi: medRxiv preprint 9 / 27 symptoms consistent with malaria. Before they tested, all microscopy results of 236 clinical blood samples were blind for the tester of the assay. And various plasmid 237 standards of objects conta ining internal control human RNaseP gene under the 238 concentration of 100 copies / μL were served as positive control for the assay and the 239 RNase-free water was used as negative control. 240 241 Data analysis 242 As the analysis of the performance of our UP -MCA assay, we considered microscopy 243 as the gold standard analysis. The discordance of result was considered for samples of 244 which UP -MCA assay detection results did not agree with microscopy results. 245 Discordant samples were retested with alternative multiplex qPCR met hod based on 246 Taqman probe recommended by World Health Organization(11). Then we considered 247 samples with identical results as true-positive PCR results, since assigning a species is 248 not alw ays possible with microscopy. Moreover, all data were analyzed with 249 GraphPad Prism software. Each experiment was repeated at least three duplicates for 250 each sample. 251 252

253 Principle of UP-MCA detection assay for species-specific plasmodium 254 UP-MCA detecti on assay is a method that uses asymmetric PCR to achieve the 255 enrichment of two -dimensional labe lled products, and combines probe mediated 256 melting curve analysis technology to achieve specific detection of targets with 257 non-target sequence dependent universa l fluorescent probes. With regards to 258 asymmetric PCR and melting curve analysis, the difference in the proportion of 259 forward and reverse primers will be introduced into amplification and 260 two-dimensional label should be integrated into amplicon, respectivel y. Moreover, to 261 further simplify primer design and minify optimization of assay for specificity 262 improvement, we adopted asymmetric PCR of plasmodium genus forward primer 263 which serves as abundant primer, and plasmodium specie-specific reverse primer with 264 homologous tag at the 5’ end representing specific Tm value produced by 265 All rights reserved. No reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. The copyright holder for this preprintthis version posted April 16, 2022. ; https://doi.org/10.1101/2022.04.12.22271963doi: medRxiv preprint 10 / 27 hybridization with universal probe, which serves as limiting primer for multiplex 266 UP-MCA plasmodium detection ( Table 1). These primers were based on target SSU 267 rRNA gene of plasmodium, which its copy number range from 4 to 8 and known to be 268 highly conserved regions suitable for molecular detection of human malaria parasites. 269 This method was also helpful to improve the stability of Tm value of melting curve 270 analysis and avoid the false neg ative caused by low hybridization between amplicons 271 and specific probes, such as Taqman probe, that are susceptible to mutations of target. 272 For universal fluorescent probe, we proved different kinds of probe quenching method, 273 such as base -quenching and sel f-quenching, can be used for UP -MCA analysis 274 (Figure.2A). Furthermore, we speculated and also confirmed that different effective 275 lengths of tag could be used for hybridization with probe which was inspired by 276 different Tm value produced by variable degrees of hybridization (via mutations) 277 between homologous tag and fluorescent probe ( Figure.2B and Table 1 ). It seems to 278 be easy to design probes and tags which can simplify a large number of optimization 279 of predicted Tm value via hybrid simulation and synthesis of primer with tag for be 280 tried out. This will help to homogenize temperature range of melting curve analysis 281 and improve detection throughput within a limited temperature range. 282 283 Optimization of UP-MCA assay for species-specific plasmodium detection 284 To improve reaction efficiency, the possible influencing factors were optimized via 285 different enzymes, buffers, reaction temperature and concentration of Mg 2+. We found 286 that hot -start enzyme of TaqHS and the corresponding buffer or buffer M were the 287 main influencing factors for species -specific plasmodium UP -MCA assay (Figure.3), 288 and the assay obtained higher signal to noise (also difference of melt peak height 289 between positive and negative control) at the parameter of 4 mM Mg2+ and 63 °C 290 annealing temperature (Figure.S1 A and B) using the same concentration of target for 291 multiplex plasmodium detection. Interestingly, it seems that ET SSB served as an 292 enhancer of specificity of amplification was not functioned in the multiplex 293 species-specific plasmodium UP-MCA assay (Figure.S1 C). 294 295 All rights reserved. No reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. The copyright holder for this preprintthis version posted April 16, 2022. ; https://doi.org/10.1101/2022.04.12.22271963doi: medRxiv preprint 11 / 27 Performance of plasmodium UP -MCA detection assay (including sensitivity, 296 specificity, selectivity) 297 To evaluate the sensitivity of the UP -MCA plasmodium detection assay, a series of 298 gradient concentration of diluted plasmids of plasmodium species and human gene 299 (RNase P, internal control) as reaction template were tested. The results showed that 300 the melt peak height representing negative derivative of fluorescence value with 301 temperature ( -d(RFU)/dT) of each object decreases gr adually with the decrease of 302 concentration of plasmids, and the LOD for each object was 10 copies / μL (in 303 addition to Pm, 100 copies / μL ) (Figure.4A) that nearly access to within the LOD 304 required by WHO. 305 To assess the specificity of the UP -MCA plasmodiu m detection assay, genome of 306 samples from a panel of homologous pathogens and that of blood -borne diseases 307 having similar clinical symptoms or signs to malaria were tested. Three duplicates 308 were performed, and 100 copies of species -specific plasmodium stan dards were used 309 as templates of positive control for each reaction. Consequently, there were no 310 positive results from the tested pathogens except for the DNA standards of 311 species-specific plasmodium ( Figure.4B), indicating that the high specificity of 312 species-specific plasmodium UP -MCA assay for detecting plasmodium of detailed 313 genotype. 314 To investigate the selectivity of the UP -MCA plasmodium detection assay, 315 Plasmodium falciparum and its adjacent Plasmodium vivax at the same fluorescent 316 channel were select ed to test the accuracy of the UP -MCA detection assay. 317 Specifically, different ratios of Pf and Pv plasmid standards under the 100 copies 318 concentration range from 0:100, 1:99, 3:97, 5:95, 10:90, 20:80, 50:50, 80:20, 90:10, 319 95:5, 97:3, 99:1, 100:0 were prep ared and performed by the multiplex plasmodium 320 detection assay. The result showed that the assay exactly detect different kinds of 321 dosage ratios of adjacent detected objects from the same fluorescence channel 322 (Figure.4C). The assay method has excellent discrimination ability of detection. 323 324

of clinical sample via UP-MCA detection assay for plasmodium 325 All rights reserved. No reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. The copyright holder for this preprintthis version posted April 16, 2022. ; https://doi.org/10.1101/2022.04.12.22271963doi: medRxiv preprint 12 / 27 To evaluate the clinical diagnosis performance of the plasmodium UP -MCA detection 326 assay, 184 patients samples (164 positive -result and 20 negative -result for 327 plasmodium microscopy), which had been confirmed by microscopy served as the 328 gold standard method for malaria, were tested by detector covered microscopical 329

above. There were 164 plasmodium -positive samples and 20 330 plasmodium-negative samples detecting by the plasmodium UP -MCA assay which 331 were all consistent to the results of plasmodium microscopy. Compared with the gold 332 standard detection method, the plasmodium UP -MCA assay showed the sensitivity 333 and specificity of both 100% (Table 2). 334 335

336 PCR, as one of the most widely used molecular biology detection methods, has the 337 great advantages of high sensitivity and specificity, simplicity and rapidity, and low 338 cost, especially for real -time quantitative PCR. It has been used in many fie lds 339 including pathogen detection, tumor marker detection, and genetic identification and 340 so on. We demonstrated universal two -dimensional labelled probe-mediated melting 341 curve analysis (UP-MCA) assay based on multiplex PCR for malaria that are sensitive 342 and specific for detection of the 5 major plasmodium species as well as the human 343 RNase P gene as an internal reference control with the employment of two 344 fluorescence channel. The multiplex plasmodium PCR assay can be performed 345 rapidly (nearly 3 hours, incl uding 1 hour for genome extraction and 2 hours for 346 amplification and detection) in a single closed tube, and the 384 -well or 96 -well 347 format both achieve high detection throughput, which is required for large clinical 348 sample detection and epidemiologic studies of imported malaria. 349 We rigorously investigated the plasmodium target gene based on its inherent 350 characteristics (including conservation, specificity and copy number etc.) and 351 previous published studies. The nuclear small subunit (SSU) rRNA gene of 352 plasmodium harboring four to eight copy numbers was carefully defined as target 353 gene for the reason that not only that is known to be highly conserved regions suitable 354 for plasmodium-genus primers selection, but also its existence of plasmodium -species 355 All rights reserved. No reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. The copyright holder for this preprintthis version posted April 16, 2022. ; https://doi.org/10.1101/2022.04.12.22271963doi: medRxiv preprint 13 / 27 region for specific primers design. Less optimization can be conducted by one 356 abundant primer selected from conservative region and numbers of limiting primers 357 designed from species -specific region for multiplex and asymmetric PCR detection 358 for plasmodium. Furth ermore, many optimizations for detection efficiency 359 improvement were rigorously carried out, including main factors of specific primers, 360 enzymes and best matching buffer etc. 361 For the UP -MCA assay, engineered fluorescent probes were not directly specific fo r 362 target sequence, but it was dependent on species -specific limiting primer used in 363 asymmetric PCR resulting in abundant single -strand DNA products with specific tag 364 for special hybridization. It is helpful to improve the resistance of mutations or SNP 365 existed in probe hybridization region and theoretically increase sensitivity of the 366 plasmodium detection assay. Moreover, in addition to mutation existing in 367 homologous tag, our experiment showed different effect hybridization length between 368 tag and fluoresce nt probe also can be applied in two -dimensional label design 369 strategies for universal probe. It was great advantage for difficulty reduction of 370 two-dimensional label design and throughput improvement of detection target 371 following homogenization of melting temperature, unfortunately lacking of further 372 more detection objects in one-pot to be validated. 373

were also demonstrated in the plasmodium UP -MCA detection assay. 374 Firstly, there should be more targets to be validated for detection throughput 375 improvement used in plasmodium UP -MCA assay, and less detection objects and 376 numbers of primers may be the reason of ET SSB seldom seems to be functioned. But, 377 in other words, primers designed and used in the assay were adequately specific for 378 species-specific plasmodium. Secondly, the UP -MCA assay was one of 379 half-quantitative multiplex method that could not accurately achieve to quantitative 380 plasmodium species. Furthermore, more clinical samples collected from multicenter 381 should be incorporated into the assay for clinical performance validation. 382 In summary, we developed one plasmodium species -specific detection assay for 383 greatly enhancing sensitivity and specificity that was important for import malaria 384 derived from regions or cities of frequent communications for economy or population 385 All rights reserved. No reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. The copyright holder for this preprintthis version posted April 16, 2022. ; https://doi.org/10.1101/2022.04.12.22271963doi: medRxiv preprint 14 / 27 emigration and immigration. It can be rapidly and accurately genotype 5 plasmodium 386 species and great helpful to increase the ability of eliminating imported malaria. 387 In summary, the developed plasmodium UP -MCA assay exhibited exce llent 388 sensitivity, specificity and selectivity for plasmodium species -specific detection. It is 389 helpful to rapid and sensitive genotyping of 5 species -specific plasmodiums in a 390 single closed tube under malaria control plan accordingly proposed by World Hea lth 391 Organization. 392 393

394 1. White NJ. 2008. Plasmodium knowlesi: the fifth human malaria parasite. Clin Infect Dis 395 46:172-3. 396 2. Singh B, Kim Sung L, Matusop A, Radhakrishnan A, Shamsul SS, Cox -Singh J, Thomas A, 397 Conway DJ. 2004. A large focus of naturally acquired Plasmodium knowlesi infections in 398 human beings. Lancet 363:1017-24. 399 3. Organization WHJW. 2015. Guidelines for the Treatment of Malaria. Third Edition (PDF). 400 4. Singh B, Daneshvar C. 2013. Human infections and detection of Plasmodium knowlesi. Clin 401 Microbiol Rev 26:165-84. 402 5. Wilson ML. 2012. Malaria rapid diagnostic tests. Clin Infect Dis 54:1637-41. 403 6. Erdman LK, Kain KC. 2008. Molecular diagnostic and surveillance tools for global malaria 404 control. Travel Med Infect Dis 6:82-99. 405 7. Barber BE, William T , Grigg MJ, Piera K, Yeo TW, Anstey NM. 2013. Evaluation of the 406 sensitivity of a pLDH -based and an aldolase -based rapid diagnostic test for diagnosis of 407 uncomplicated and severe malaria caused by PCR -confirmed Plasmodium knowlesi, 408 Plasmodium falciparum, and Plasmodium vivax. J Clin Microbiol 51:1118-23. 409 8. Putaporntip C, Buppan P , Jongwutiwes S. 2011. Improved performance with saliva and urine 410 as alternative DNA sources for malaria diagnosis by mitochondrial DNA -based PCR assays. 411 Clin Microbiol Infect 17:1484-91. 412 9. Canier L, Khim N, Kim S, Sluydts V, Heng S, Dourng D, Eam R, Chy S, Khean C, Loch K, Ken M, 413 Lim H, Siv S, Tho S, Masse -Navette P , Gryseels C, Uk S, Van Roey K, Grietens KP , Sokny M, 414 Thavrin B, Chuor CM, Deubel V, Durnez L, Coosemans M, Ménard D. 2013. An innovative tool 415 for moving malaria PCR detection of parasite reservoir into the field. Malar J 12:405. 416 10. Komaki-Yasuda K, Vincent JP , Nakatsu M, Kato Y , Ohmagari N, Kano S. 2018. A novel 417 PCR-based system for th e detection of four species of human malaria parasites and 418 Plasmodium knowlesi. PLoS One 13:e0191886. 419 11. Rougemont M, Van Saanen M, Sahli R, Hinrikson HP , Bille J, Jaton K. 2004. Detection of four 420 Plasmodium species in blood from humans by 18S rRNA gene s ubunit-based and 421 species-specific real-time PCR assays. J Clin Microbiol 42:5636-43. 422 12. Dos Santos EH, Yamamoto L, Domingues W, di Santi SM, Kanunfre KA, Okay TS. 2020. A new 423 Real Time PCR with species -specific primers from Plasmodium malariae/P . brasilia num 424 All rights reserved. No reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. The copyright holder for this preprintthis version posted April 16, 2022. ; https://doi.org/10.1101/2022.04.12.22271963doi: medRxiv preprint 15 / 27 mitochondrial cytochrome b gene. Parasitol Int 76:102069. 425 13. Piera KA, Aziz A, William T , Bell D, González IJ, Barber BE, Anstey NM, Grigg MJ. 2017. 426 Detection of Plasmodium knowlesi, Plasmodium falciparum and Plasmodium vivax using 427 loop-mediated isoth ermal amplification (LAMP) in a co -endemic area in Malaysia. Malar J 428 16:29. 429 14. Hashimoto M, Sakamoto H, Ido Y , Tanaka M, Yatsushiro S, Kajimoto K, Kataoka M. 2018. In 430 situ loop-mediated isothermal amplification (LAMP) for identification of Plasmodium spec ies 431 in wide-range thin blood smears. Malar J 17:235. 432 15. Nolasco O, Montoya J, Rosales Rosas AL, Barrientos S, Rosanas -Urgell A, Gamboa D. 2021. 433 Multicopy targets for Plasmodium vivax and Plasmodium falciparum detection by 434 colorimetric LAMP . Malar J 20:225. 435 16. Tambo M, Auala JR, Sturrock HJ, Kleinschmidt I, Bock R, Smith JL, Gosling R, Mumbengegwi 436 DR. 2018. Evaluation of loop -mediated isothermal amplification as a surveillance tool for 437 malaria in reactive case detection moving towards elimination. Malar J 17:255. 438 17. Lalremruata A, Nguyen TT , McCall MBB, Mombo-Ngoma G, Agnandji ST , Adegnika AA, Lell B, 439 Ramharter M, Hoffman SL, Kremsner PG, Mordmüller B. 2020. Recombinase Polymerase 440 Amplification and Lateral Flow Assay for Ultrasensitive Detection of Low -Density Plasmodium 441 falciparum Infection from Controlled Human Malaria Infection Studies and Naturally Acquired 442 Infections. J Clin Microbiol 58. 443 18. Lai MY , Lau YL. 2020. Detection of Plasmodium knowlesi using recombinase polymerase 444 amplification (RPA) combined with SYBR Green I. Acta Trop 208:105511. 445 19. Lai MY , Ooi CH, Lau YL. 2018. Recombinase Polymerase Amplification Combined with a Lateral 446 Flow Strip for the Detection of Plasmodium knowlesi. Am J Trop Med Hyg 98:700-703. 447 20. Lee RA, Puig H, Nguyen PQ, Ange nent-Mari NM, Donghia NM, McGee JP , Dvorin JD, 448 Klapperich CM, Pollock NR, Collins JJ. 2020. Ultrasensitive CRISPR -based diagnostic for 449 field-applicable detection of Plasmodium species in symptomatic and asymptomatic malaria. 450 Proc Natl Acad Sci U S A 117:25722-25731. 451 21. Zhan Y , Zhang J, Yao S, Luo G. 2020. High -Throughput Two -Dimensional Polymerase Chain 452 Reaction Technology. Anal Chem 92:674-682. 453 22. Reller ME, Chen WH, Dalton J, Lichay MA, Dumler JS. 2013. Multiplex 5' nuclease quantitative 454 real-time PCR f or clinical diagnosis of malaria and species -level identification and 455 epidemiologic evaluation of malaria -causing parasites, including Plasmodium knowlesi. J Clin 456 Microbiol 51:2931-8. 457 23. Nuin NA, Tan AF, Lew YL, Piera KA, William T , Rajahram GS, Jelip J, Dony JF, Mohammad R, 458 Cooper DJ, Barber BE, Anstey NM, Chua TH, Grigg MJ. 2020. Comparative evaluation of two 459 commercial real -time PCR kits (QuantiFast™ and abTES™) for the detection of Plasmodium 460 knowlesi and other Plasmodium species in Sabah, Malaysia. Malar J 19:306. 461 24. Lee PC, Chong ET , Anderios F, Al Lim Y , Chew CH, Chua KH. 2015. Molecular detection of 462 human Plasmodium species in Sabah using PlasmoNex™ multiplex PCR and hydrolysis probes 463 real-time PCR. Malar J 14:28. 464 465 Table.1 Probes and Primers sequence of UP -MCA assay for plasmodium 466 genotyping 467 All rights reserved. No reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. The copyright holder for this preprintthis version posted April 16, 2022. ; https://doi.org/10.1101/2022.04.12.22271963doi: medRxiv preprint 16 / 27 Species Name Sequence Plasmodium genus Forward primer 5’-ACGATCAGATACCGTCGTAATCTT-3’ P . falciparum Reverse primer 1 5’-CCATTAGAACCCTTAAGCTACTCCACGGTACT GAAGGAAGCAATCTAAAAGTCA-3’ Reverse primer 2 5’-CCATTACAACCCAAAAAAAAAAAAAAAAAGG TACTGAAGGAAGCAATCTAAAAGTCA-3’ P . vivax Reverse primer 1 5’-CCATTACTTGCCTTATACTACTCCACCAATCT AAGAATAAACTCCGAAGAGAAAATT-3’ Reverse primer 2 5’-CCATTACAACCCTTATAAAAAAAAAAAAACAA TCTAAGAATAAACTCCGAAGAGAAAATT-3’ P . malariae Reverse primer 1 5’-CCATTACTACCCTTATACTACTCCACGGAAGC TATCTAAAAGAAACACTCATATATAAGAAT-3’ Reverse primer 2 5’-CCATTACAACCCTTATACTAAAAAAAAAAGGA AGCTATCTAAAAGAAACACTCATATATAAGAAT-3’ P . ovale Reverse primer 1 5’-CCTATCTCTTAACCTCCACTGCTTTCACCAAT CTAAGAAATTTCCCCRAAAGGAATT-3’ Reverse primer 2 5’-CCATTACAACCCTTATACTACTCAAAAAACAA TCTAAGAAATTTCCCCRAAAGGAATT-3’ P . knowlesi Reverse primer 1 5’-CCTATCTCGTAACCTCCACCCCTTTCACCTAA GAGTTCTAATCTCCGGAGAGAAAAGAA-3’ Reverse primer 2 5’-CCATTACAACCCTTATACTACTCCACAAACTA AGAGTTCTAATCTCCGGAGAGAAAAGAA-3’ RNase P Forward primer 5’-CCATCAACCACGCCATCAACAT-3’ Reverse primer 1 5’-CCTATCTCTCAACCTCCACCCCTTTCACTTGG GTGTGACCCTGAAGACTC-3’ Reverse primer 2 5’-CCATTACAACCCTTATACTACTCCACCCATTG GGTGTGACCCTGAAGACTC-3’ - Universal probe 1 5’-FAM-CCATTACAACCCTTATACTACTCCAC-P or -BHQ1-3’ - Universal probe 2 5’-HEX-CCTATCTCTCAACCTCCACCCCTTTCAC-P or -BHQ1-3’ - Universal probe 3 5’-FAM-CCATTACAACCCTTATACTACTCCACCCA-P -3’ * Reverse primer 1 and 2 were used in the final plasmodium UP -MCA assay and the 468 assay used universal probe depend on Tm values of effective length of hybridization 469 between tag and probe. The parts of underlined and bold were tag sequence. P 470 represents phosphate group. 471 472 All rights reserved. No reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. The copyright holder for this preprintthis version posted April 16, 2022. ; https://doi.org/10.1101/2022.04.12.22271963doi: medRxiv preprint 17 / 27 Table.2 Results of UP-MCA assay & microscopy for plasmodium detection 473

method

UP-MCA assay Total Positive Negative Microscopy Positive 164 0 164 Negative 0 20 20 Total 164 20 184 474 All rights reserved. No reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. The copyright holder for this preprintthis version posted April 16, 2022. ; https://doi.org/10.1101/2022.04.12.22271963doi: medRxiv preprint 18 / 27 Figure Legends 475 Figure 1. Schematic diagram of universal two -dimensional labe lled probe 476 mediated melting curve analysis (UP -MCA) based on multiplex PCR assay for 477 plasmodium species genotyping. Genome of clinical plasmodium sample was put 478 into multiplex PCR reaction for asymmetric amplification and u niversal fluorescence 479 probe mediated melting curve analysis. The detailed object was judged by 480 fluorescence channel and specific Tm value from melt peak automatically analyzed by 481 instrument software (BioRad CFX Manager software in this paper). 482 483 484 All rights reserved. No reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. The copyright holder for this preprintthis version posted April 16, 2022. ; https://doi.org/10.1101/2022.04.12.22271963doi: medRxiv preprint 19 / 27 Figure 2. Performance of different kinds of quenched method probe and effective 485 length of hybridization between tag and probe determined Tm value. 486 Performance of base -quenched probe and self -quenched probe for UP -MCA assay. 487 (A). Only one universal probe (universal probe 3) depends on effective length of 488 hybridization between tag and probe for six object UP -MCA detection at a single 489 fluorescence (B). 490 491 492 All rights reserved. No reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. The copyright holder for this preprintthis version posted April 16, 2022. ; https://doi.org/10.1101/2022.04.12.22271963doi: medRxiv preprint 20 / 27 Figure 3. Optimizations of plasmodium UP -MCA assay. Performance of enzymes 493 used for plasmodium UP -MCA assay (A). Performance of different buffers used for 494 plasmodium UP-MCA assay (B). 495 496 497 All rights reserved. No reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. The copyright holder for this preprintthis version posted April 16, 2022. ; https://doi.org/10.1101/2022.04.12.22271963doi: medRxiv preprint 21 / 27 Figure 4. Performance of plasmodium UP -MCA assay. The sensitivity of 498 plasmodium species in the plasmodium UP-MCA assay (A). The specificity of 499 plasmodium UP-MCA assay. The objects u sed for specificity investigation including 500 Babesia, Borrelia burgdorferi, Chikungunya virus, Human immunodeficiency virus, 501 Hepatitis B virus, Hepatitis C virus, Novel coronavirus (2019) and plasmodium 502 species (B). The selectivity of Plasmodium falciparum and plasmodium vivax in the 503 established plasmodium UP-MCA detection assay (C). 504 505 506 All rights reserved. No reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. The copyright holder for this preprintthis version posted April 16, 2022. ; https://doi.org/10.1101/2022.04.12.22271963doi: medRxiv preprint 22 / 27 Figure 5. The clinical sample detection example of plasmodium UP-MCA assay. 507 508 509 All rights reserved. No reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. The copyright holder for this preprintthis version posted April 16, 2022. ; https://doi.org/10.1101/2022.04.12.22271963doi: medRxiv preprint 23 / 27 Supplemental file 510 Table.S1 Nucleic acid sequence of SSU rRNA gene from species -specific 511 plasmodium or human ribonuclease P gene embedded in PUC57 vector for 512 plasmid standards. 513 Name Sequence Plasmodium falciparum 5’-CTTTTTTCTTATTTTGGCTTAGTT ACGATTAATAGGAGTAGCTTGGGGA CATTCGTATTCAGATGTCAGAGGTG AAATTCTTAGATTTTCTGGAGACGA ACAACTGCGAAAGCATTTGTCTAA AATACTTCCATTAATCAAGAACGAA AGTTAAGGGAGTGAAGACGATCAG ATACCGTCGTAATCTTAACCATAAA CTATGCCGACTAGGTGTTGGATGAA AGTGTTAAAAATAAAAGTCATCTTT CGAGGTGACTTTTAGATTGCTTCCT TCAGTACCTTATGAGAAATCAAAGT CTTTGGGTTCTGGGGCGAGTATTCG CGCAAGCGAGAAAGTTAAAAGAAT TGACGGAAGGGCACCACCAGGCGT GGAGCTTGCGGCTTAATTTGACTCA ACACGGGGAAACTCACTAG-3’ Plasmodium vivax 5’-TGGCTTAGTTACGATTAATAGGA GTAGCTTGGGGGCATTTGTATTCAG ATGTCAGAGGTGAAATTCTTAGATT TTCTGGAGACAAACAACTGCGAAA GCATTTGCCTAAAATACTTCCATTAA TCAAGAACGAAAGTTAAGGGAGTG AAGACGATCAGATACCGTCGTAATC All rights reserved. No reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. The copyright holder for this preprintthis version posted April 16, 2022. ; https://doi.org/10.1101/2022.04.12.22271963doi: medRxiv preprint 24 / 27 TTAACCATAAACTATGCCGACTAGG CTTTGGATGAAAGATTTTAAAATAA GAATTTTCTCTTCGGAGTTTATTCTT AGATTGCTTCCTTCAGTGCCTTATG AGAAATCAAAGTCTTTGGGTTCTG GGGCGAGTATTCGCGCAAGCGAGA AAGTTAAAAGAATTCGGAAGGGCA CCACCAGGCGTGGAGCTTGCGGCT TAATTTGACTCAACACGGGAAAAC TCACTAGTTTAAGACAAGA-3’ Plasmodium ovale 5’-TCTTATTTTGGCTTAGTTACGATT AATAGGAGTAGCTTGGAGGCATTTG TATTCAGATGTCAGAGGTGAAATTC TTAGATTTTCTGGAGACAAACAACT GCGAAAGCATTTGCCTAAAATACTT CCATTAATCAAGAACGAAAGTTAA GGGAGTGAAGACGATCAGATACCG TCGTAATCTTAACCATAAACTATGCC GACTAGGTTTTGGATGAAAGATTTT TAAATAAGAAAATTCCTTTCGGGGA AATTTCTTAGATTGCTTCCTTCAGTA CCTTATGAGAAATCAAAGTCTTTGG GTTCTGGGGCGAGTATTCGCGCAA GCGAGAAAGTTAAAAGAATTGACG GAAGGGCACCACCAGGCGTGGAGC TTGCGCTTAATTTGACTCAACACGG GGAAACTCACTAGTTTA-3’ Plasmodium malariae 5’-AATAGGAGTAGCTTGGGGGCATT TGTATTCAGATGTCAGAGGTGAAAT All rights reserved. No reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. The copyright holder for this preprintthis version posted April 16, 2022. ; https://doi.org/10.1101/2022.04.12.22271963doi: medRxiv preprint 25 / 27 TCTTAGATTTTCTGGAGACAAGCAA CTGCGAAAGCATTTGCCTAAAATAC TTCCATTAATCAAGAACGAAAGTTA AGGGAGTGAAGACGATCAGATACC GTCGTAATCTTAACCATAAACTATG CCGACTAGGTGTTGGATGATAGAGT AAAAAATAAAAGAGACATTCATATA TATGAGTGTTTCTTTTAGATAGCTTC CTTCAGTACCTTATGAGAAATCAAA GTCTTTGGGTTCTGGGGCGAGTATT CGCGCAAGCGAGAAAGTTAAAAGA ATTGACGGAAGGGCACCACCAGGC GTGGAGCTTGCGGCTTAATTTGACT CAACACGGGGAAACTCACTAGTTT AAGACAAGAGTAGGATTG-3’ Plasmodium knowlesi 5’-GGGGGCATTTGTATTCAGATGTC AGAGGTGAAATTCTTAGATTTTCTG GAGACAAACAACTGCGAAAGCATT TGCCTAAAATACTTCCATTAATCAA GAACGAAAGTTAAGGGAGTGAAG ACGATCAGATACCGTCGTAATCTTA ACCATAAACTATGCCGACTAGGCTT TGGATGAAAGATTTTAAAATAAGAG TTTTTCTTTTCTCTCCGGAGATTAG AACTCTTAGATTGCTTCCTTCAGTG CCTTATGAGAAATCAAAGTCTTTGG GTTCTGGGGCGAGTATTCGCGCAA GCGAGAAAGTTAAAAGAATTGACG GAAGGGCACCACCAGGCGTGGAGC All rights reserved. No reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. The copyright holder for this preprintthis version posted April 16, 2022. ; https://doi.org/10.1101/2022.04.12.22271963doi: medRxiv preprint 26 / 27 TTGCGGCTTAATTTGACTCAACACG GGAAAACTCACTAGTTTAAGACAA GAGTAG-3’ human ribonuclease P gene ( RNase P ) sepecific sequence 5’-GGGTCAGAACGCGTGCTCTGAG ATCTACATTCACGGCTTGGGCCTGG CCATCAACCACGCCA TCAACATCGC GCTGCAGCTGCAGGCGGGCAGCTT CGGGTCCTTGCAGGTGGCTGCCAAT ACCTCCACCGTGGAGCTTGTTGATG AGCTGGAGCCAGAGACCGACACAC GGGAGCCACTGACTCGGATCCGCA ACAACTCAGCCATCCACATCCGAGT CTTCAGGGTCACACCCAAGTAATTG AAAAGACACTCCTCCAGAATTCGG CACGAGGTGGGACTTCAGCATGGC GGTGTTTGCAGATTTGGACCTGCGA GCGGGTTCTGACCTGAAGGCTCTG CGCGGACTTGTGGAGACAGCCGCT CACCTTGGCTATTCAGTTGTTGCTAT CAATCATAT-3’ 514 All rights reserved. No reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. The copyright holder for this preprintthis version posted April 16, 2022. ; https://doi.org/10.1101/2022.04.12.22271963doi: medRxiv preprint 27 / 27 Figure Legends 515 Figure.S1 Optimizations of plasmodium UP-MCA assay. Detection performance of 516 plasmodium UP-MCA assay at different annealing temperature (A). The efficiency of 517 plasmodium UP -MCA assay at different concentration of Mg ion (3 mM, 4 mM, 5 518 mM, 6 mM) (B). The amplification efficiency for plasmodium UP -MCA detection 519 assay at different concentration of ET SSB (C). 520 521 522 All rights reserved. No reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. The copyright holder for this preprintthis version posted April 16, 2022. ; https://doi.org/10.1101/2022.04.12.22271963doi: medRxiv preprint