Assessment of Molecular Modulation by Multifrequency Electromagnetic Pulses to Preferably Eradicate Tumorigenic cells

Assessment of Molecular Modulation by Multifrequency Electromagnetic Pulses to Preferably Eradicate Tumorigenic cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Help Center Sign In Submit a Preprint Cite Share Download PDF Article Assessment of Molecular Modulation by Multifrequency Electromagnetic Pulses to Preferably Eradicate Tumorigenic cells Roberta Piredda, Luis G. Rodríguez Martínez, kostantinos Stakamakis, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4527641/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 03 Dec, 2024 Read the published version in Scientific Reports → Version 1 posted 11 You are reading this latest preprint version Abstract Physics methods of cancer therapy are extensively used in the clinical practice, but they are invasive and often confront undesired side effects. A fully new equipment that allows sustained emission of intense and time controlled non-ionizing multifrequency electromagnetic pulse (MEMP), has been applied to eukaryotic cells in culture. The equipment discriminates the overall electronegative charge of the cell cultures, and its subsequent proportional emission may thereby become higher and lethal to cancer cells of generally high metabolic activity, whereas low tumorigenic cells would be much less affected. We tested the specificity and efficacy of the equipment against a collection of (i) highly tumorigenic cells of human (glioblastoma, cervical carcinoma, and skin) and mouse (colon adenocarcinoma) origin; (ii) cell lines of much lower tumorigenicity (non-human primate kidney and mouse fibroblasts), and (iii) primary porcine macrophages lacking tumorigenicity. Time and intensity control of the MEMP allowed progressive decay of viability fairly correlating to cell tumorigenicity, which was provoked by a proportional alteration of the cytoplasmic membrane permeability, cell cycle arrest at G2, and general collapse of the actin and intermediate filaments cytoskeleton to the perinuclear region. Correspondingly, these effects drastically inhibited the proliferative capacity of the most tumorigenic cells in clonogenic assays. Moreover, MEMP suppressed in a dose-dependent manner the tumorigenicity of retrovirally transduced luciferase expressing colon adenocarcinoma cells in xenografted immune-competent mice, as determined by tumor growth in a bioluminescence imaging system. Our results support MEMP as an anti-cancer non-invasive physical treatment of substantial specificity for tumorigenic cells with promising therapeutic potential in oncology. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Low-frequency magnetic fields (LMF) are experimentally used to treat tumors, since they induce nonionizing, non-thermal and noninvasive effects on tissues, inhibiting the proliferation of tumor 1-3 . Other in vitro experiments have shown that LMF may limit the growth of tumor cells 4,5 , whereas non tumoral cells do not suffered major alterations 6 . The mechanisms by which LMF exert these effects have been only partially addressed. For example, it has been suggested that LMF affect the cytoplasmic membrane of the tumoral cells, and some apoptotic events have also been shown to be involved 7 . Other studies proposed that the induction of reactive oxygen species (ROS) correlates to the inhibitory effect of LMF, and that the intercellular environment and intercellular aggregation is a necessary event for magnetic inhibition. In a recent report 8 , a fixed magnetic field of 5 mT and 20 Hz was used being the magnetic field generator in direct contact with cells, inducing antiproliferative effects in the tumor cells studied. The equipment used in this report, developed by PASO ALTO BIOTECHNOLOGY INC, consists in a new LM non-ionizing radiation technology that enables the sustained delivery of intense, time-controlled, multi-frequency electromagnetic pulses (MEMP), which can be applied to cells in culture. Major features of the modulator equipment are further explained in the Materials and Methods section, being a new device that discriminates the overall electronegative charge of cell cultures. As cancer cell metabolism may impose drastic differences in their electronegativity 9 , it was of paramount interest to explore whether the modulator equipment can differently impact cells at distinct tumorigenicity stages. Therefore, the MEMP treatment effects on relevant parameters of cell biology were tested in a collection of mammalian cell lines with diverse tumorigenicity. For this, we investigated the effects of the technology on cell viability, cell cycle, and clonogenic capacity of cells with diverse tumorigenicity, suggesting enhanced toxic effects for malignant cells. To further confirm MEMP effects on tumoral cells and to investigate its molecular target, we addressed a confocal IF analysis of the actin and intermediate filaments cytoskeleton before and immediately post-MEMP treatments. Finally, we also investigated the in vivo tumor forming ability of colon cancer cells after MEMP treatment. Our study collectively supports the therapeutic potential and tumor specificity of MEMP that could be translated into the clinical practice. Materials And Methods Cells Cell lines were cultivated in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 2 mM L-glutamine, 0.4 mM non-essential amino acids,100 U/mL gentamicin and 5 or 10% fetal calf serum (FBS; Invitrogen Life Technologies). All cells were grown at 37 °C with 5% of CO 2 in a humidified air (95%). The origin of our cell lines was as follows: COS-1 (CRL-1650), CV-1 cells (CCL-70) from African green monkey kidney, HEK-293T cells (CRL-3216) (Human embryonic kidney cells) and A9 mouse fibroblasts (CRL-3265), were obtained from the American Type Culture Collection (ATCC); U373 MG (HTB-17) human glioblastoma astrocytoma was purchased from ATCC; the MC-38-Luc cells, derived from MC-38 cell line (SCC172, Sigma-Aldrich), C57BL/6 murine colon adenocarcinoma cells and stably expressing luciferase gene, were generated in our laboratory as described below; HeLa cells (CCL-2) from human cervical carcinoma were obtained from the ATCC; and the HaCaT human keratinocyte cell line was kindly provided by Dr. Miguel Quintanilla (Instituto de Investigaciones Biomédicas “Alberto Sols”, Madrid, Spain). Porcine alveolar macrophages (PAM) were obtained by a bronchoalveolar lavage as previously described 10 , and cultivated in DMEM supplemented with 10% porcine serum. Vectors and transfection To obtain MC-38 cells constitutively expressing the biolumiscence marker luciferase, the pLVX-IRES-Luc lentiviral vector was constructed. To this aim, we cloned the luciferase gene from the mammalian pIRES-Luc vector, provided by Encarna, into a pLVX-puro empty vector. For pLVX-IRES-Luc cloning, we used 2X Phusion Maser Mix HF (Thermo Scientific) and In-Fusion technology (Takara) by using the following oligo probes: 5’TCGCTAGCGCTACCGGACTCAGCAGGTTTCCCCAACT3’and5’TAGAATTATCTAGAGTCGCGttacacggcgatctttccgccc3’ to amplify the luciferase gene, and 5’GAGTCCG GTAGCGCTAGC3’ and 5’CGCGACTCTAGATAATT3’ to linearize the pLVX-puro vector and insert the amplification. For the transfection protocol, FuGene HD transfection reagent (Promega) was employed, following the manufacturer’s instructions. Cells transduction The lentivirus was grown in HEK-293T packaging cell lines. Supernatants were harvested and virus luc-transducing was used to inoculate MC-38 cells. Transduced cells were selected with puromycin for 14 days, until death of control cells. To investigate the stable expression of the lentiviral vector, cells were analyzed by Luc-Pair Duo Luciferase HS Assay Kit (Genecopoeia). Luciferase readings were performed using the FLUOstar OPTIMA reader (BMG LabTech). Molecular Modulation The modulator equipment was designed and developed by the North American corporation Paso Alto Biotechnology (inc), (under industrial secret), made up of two fundamental structures, an electromagnetic induction system assisted by sensors, and a high-power hardware system. The modulator was used to irradiate the different cell line samples selected for this study with a powerful multifrequency electromagnetic field of non-ionizing emission. The operational value of electromagnetic flux emitted by this device is greater than 2 Teslas (B > 2 T). All modulated cell lines were exposed to the MEMP treatment by seeding them individually in 12-well Falcon cell culture plates, these plates were placed on the induction system with the addition of sensors per well. These sensors assisting the induction system are designed to safely determine the electrical permeability of the medium and are responsible for sending the necessary operating signal to the switch circuit, which in turn sends sufficient energy to the induction system to generate the electromagnetic field with the required characteristics. The electronic perturbation induced by this MEMP on the culture medium during the corresponding exposure times of 2.5 and 5 minutes (min) may alter the electronic distribution of the biomolecules in a cell type dependent manner. Viability determination by MTT Upon the indicated MEMP treatments, 10 4 cells/well were seeded in a 96 multi-well plate. After 24 hours (h), cell medium was removed, cells were washed with PBS, and medium was replaced. When negative control cells (T0, non-modulated) reached the confluence (between 2 and 4 days), viable cell numbers were estimated by their mitochondrial activity. For this, 20 ml of 5mg/ml MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) were added directly to the medium and incubated at 37 °C in the dark for 4 h. Cells were then washed with PBS for 5 minutes under shaking in the dark, PBS was removed and 100 ml of dimethyl sulfoxide (DMSO) were added. Finally, after incubation for 30 min in the dark under shaking, the absorbance at 570 nm was measured with a spectrophotometric plate reader Claro Star System (BMG LabTech). All experiments were carried out in triplicates. Colony formation assay Variable numbers of cells in the range of 10 3 to 10 4 either control or MEMP-treated were seeded in 60 mm dish plate in their corresponding culture medium with 10% FCS, and incubated at 37 °C for 2-3 weeks under medium replacement every 3 days. Once control cells formed visible colonies of significant size, the cells were washed in PBS and fixed in 4% formaldehyde for at least 2 h at room temperature (RT). Cells were then stained with 0,2% crystal violet diluted in 4% formaldehyde for 1h at RT, washed in water, left to dry, and then the number of colonies for each plate was visually counted. Viability determination by cytometry Control and MEMP-treated cells were collected, centrifuged at 1500 rpm for 5 minutes, and the supernatant was discarded. The cell pellet was washed twice in PBS and centrifuged at 2000 rpm for 4 min to remove the excess of serum. Cells were then suspended in 450 ml of PBS and stained with the Ghost Dye Red 780 (1ul/ml) (TONBO biosciences) for 5 minutes at 37 °C in the dark. Ghost Dye Red 780 is an amine reactive dye able to discriminate viable from necrotic mammalian cells with compromised membrane functioning. Cells were fixed in 4% paraformaldehyde (PFA) for 10 minutes at RT and suspended in 200 ml of PBS-Staining containing 1% of bovine serum albumin (BSA). The cell viability was determined by a FACS Canto (BD bioscience) equipment. A number of 10000 cellular events were analyzed using the Flow-jo I.6.5 software. Cell cycle analysis Cells were collected as above, the pellet washed in PBS, and cells were fixed with 1 ml of 70 % ice-cold ethanol added in a drop by drop way using vortex, followed by an overnight incubation at -20 ºC. Fixed cells were centrifuged for 5 min at 1500 rpm and washed twice with PBS. The residual volume was shaken, and cell samples were labeled incubating with PI/RNase Staining Buffer (BD Pharmingen) for 30 min at RT in the dark. Cell cycle assay was performed by FACS Calibur (Becton Dickinson) and around 10000 events for each sample were collected. Data were analyzed by Flow-jo I.6.5 software. Indirect Immunofluorescence Control and MEMP-treated cells were washed in PBS, fixed with 4% paraformaldehyde for 10 min at RT in the dark, and permeabilized in 0,1% Triton TM X-100 and PBS 1X. Cells were blocked with blocking and binding buffer (0,1% Triton TM X-100, 1% jelly, in PBS 1X) for 1 hour. Cells were then stained for indirect immunofluorescence (IF) with the primary antibodies anti-human Nestin (Millipore; 1:400) diluted in binding buffer for 1h, and then by phalloidin-Alexa 555 (Thermofisher; 1:500) diluted in binding buffer without jelly for 1 h at RT. Cells were washed twice with PBS and incubated with the fluorescent-conjugated secondary antibodies anti-mouse/Alexa Fluor 488 (Thermofisher; 1: 500) diluted in binding buffer for 30 min at RT. Cells were finally washed twice, incubated with DAPI for 10 min, and mounted in Mowiol ® medium (Sigma-Aldrich). Images were taken by using confocal microscopy LSM800 coupled to an inverted Axio observer (Zeiss) with a 60x oil immersion objective lens and imported into Image J software for analysis. Xenograft cancer model All animal care procedures used in this study were carried out in accordance with ARRIVE https://arriveguidelines.org/ guidelines. All animal procedures were performed in strict accordance with the European Commission legislation for the protection of animal used purposes (2010/63/EU). The protocol for the treatment of the animals was approved by the Comité de Ética de la Dirección General del Medio Ambiente de la Comunidad de Madrid, Spain (PROEX 217.4/23) and was supervised by the Ethics Committee of CBM (Madrid, Spain). Mice were purchased from Janvier Labs, Le Genest-Saint-Isle, France. Mice were housed under a 12-h light/dark cycle in a specific pathogen-free facility with controlled temperature and humidity (20–24 °C, 45–65 % humidity) and allowed access to food and water ad libitum. 9 four-week-old female immunodeficient NMRI-Foxn1 nu/un Eight four-week-old female immunocompetent C57BL/6 mice (initial weight 19–21 g), were injected subcutaneously in the right flank 0.5X10 6 colon mouse adenocarcinoma cells (MC-38-Luc). In vivo tumor cell bioluminescence was monitored and quantified using the IVIS Spectrum System (PerkinElmer) after IP injection of D-Luciferin (150 mg/kg). Body weight and general physical status were recorded daily, and the mice were sacrificed by carbon dioxide (CO 2 ) inhalation at the end of every experiment or when reaching endpoint criteria. Tumor forming capacity of MEMP-treated cells MC-38-Luc cancer cells were seeded in 12-multiwell plates and modulated respectively for 1.5 and 2 min, based on previous viability experiments described above. It is important to note that the MEMP treatments were set at short times to avoid cell lyse, in order to be able to collect and inoculate them into mice to test their resulting tumor forming capacity. After MEMP treatment, the collected cells were centrifuged and resuspended in OptiMEM (Gibco) medium and counted to generate cell suspensions of 0.5x10 7 MC-38-Luc cells/ml. The C57BL/6 mice were injected with 100 ml of the cell suspension corresponding to control non-modulated cells (2 mice), cells modulated for 1.5 min (3 mice), and cells modulated for 2 min (3 mice). After injection, mice were evaluated within the same day by IVIS Spectrum Imaging system (PerkinElmer) for luciferase bioluminescence. IVIS evaluation was repeated weekly to determine tumor growth generated by controls and modulated cells. IVIS data were analyzed with Living Image 4.8.0 (PerkinElmer) evaluating total radiance (photons/sec) of the tumors. Results The MEMP treatment inhibits viability of malignant cancer cells whereas low tumorigenic cells are not affected. To study whether the MEMP could impact mammalian cell physiology, we selected a collection of stablished cell lines with well reported origin and tumorigenicity, as well as primary porcine macrophages (see Table I), and compare their viability and growth features in response to a MEMP treatment applied at several times. Table I. Description of MEMP-treated cells NAME a ORIGIN b MALIGNANCY c REFERENCES d MC-38 Murine colon adenocarcinoma derived from primary induced tumors in different inbred strains of mice High in nude and immunocompetent C57BL/6 mice 11-13 U373 MG A human glioblastoma astrocytoma derived from a malignant tumour High as measured in subcutaneously transplanted nude mice 14,15 HeLa Human cervical carcinoma transformed by Papillomavirus HPV18 High as measured by tumor formation after subcutaneous transplantation in nude and other immunodeficient mouse strains. 16-18 HaCat Human skin High when injected subcutaneously into thymus aplastic nude mice (Swiss/c nu/nu) 19-21 CV-1 Kidney fibroblasts of a male adult African green monkey Low but significant upon high passages number as tested in anti-thymocyte globulin (ATG) treated newborn Wistar rat 22,23 COS-1 CV-1 simian cells transformed with the early region of the polyomavirus SV40 genome Unpublished 24 A9ouab r 11 Mouse fibroblasts Low and restricted to some clones. Measured in y-irradiated syngeneic newborn and nude mice. 25-27 /PAM Porcine alveolar macrophages isolated from the lungs Null 10 ---------------------------------------------------------------------------------------------------------------------------- a, Common name. b , origin and major features. c , capacity to generate tumors in the outlined experimental animals. d , primary description and malignancy-related references. Firstly, the U373 MG, HeLa and MC-38-Luc highly malignant cell lines were modulated for 2.5, and 5 min in PBS, and cell viability after treatment was primarily evaluated by mitochondrial activity using the MTT colorimetric assay, a marker of cellular metabolic activity 28 , as described in Materials and Methods. The analysis shows a progressive effect of the treatment at 2,5 min of the modulation time, and moreover no cell viability could be detected when either U373, HeLa or MC-38-Luc cells were modulated for 5 min (Fig. 1A). In particular, MC-38-Luc seemed to be more sensitive to the treatments as compared to U373 and Hela cells, since no viable cells were detected after 2,5 minutes of treatment. To further explore the susceptibility of mammalian cells to the MEMP treatment, low-tumorigenicity cells were also evaluated. For this, HaCaT, CV-1, COS-1, A9 cell lines, and importantly PAM primary macrophages, were subjected under identical seeding conditions in M12 dishes to the MEMP treatment at different time points. Figure 1B shows that the viability of these poorly tumorigenic cells was significantly non-affected by the modulation. Overall, the obtained data indicated a very low sensitivity of the non and poorly tumorigenic cells to MEMP, whereas all the malignant cells analyzed were importantly affected by the treatment. The MEMP treatment inhibited the clonogenic capacity of malignant cancer cells but not that of poorly tumorigenic cells The efficacy of MEMP treatment was tested by colony formation assay, that is useful to determine tumor cell lines ability to form colonies after any kind of treatment. U373 MG, HeLa and MC-38-Luc cancer cells were modulated for 2.5 and 5 minutes and their colony-forming ability was evaluated after two weeks (Figure 2A-C). The obtained data supported the previous MTT result, with a progressive, modulation time-dependent, inhibition of colony forming capacity. Thus, similarly to the viability assay, the HeLa cells seem to be a bit more susceptible than U373 cells, with no colony formation after 5 min of modulation, although at 2.5 min a slightly larger percentage of colonies was observed. The susceptibility of MC-38-Luc colony forming ability to MEMP (Fig. 2A-C) confirmed this adenocarcinoma cell line as the most sensitive to the treatment, as a very low percentage of colonies formed when modulated for 2,5 minutes and no colonies were detected at 5 minutes of treatment. To assess the colony forming behavior of poorly tumorigenic cell lines to the MEMP treatment, the HaCaT, COS-1, CV-1 and A9 cell lines were tested. Cells were modulated for 2.5 and 5 min and their colony-forming ability was scored 15 days afterwards. The analysis showed that all tested cell lines of low tumorigenicity were able to form colonies with no significant differences between non-modulated controls and 5 min modulated cells (Figure 2B, C). Figure 2C illustrates representative results on colony forming capacity of the tested cell lines illustrating their distinct resistance to modulation. In summary, this test confirmed the preferable anti-proliferative effect of the MEMP treatment on malignant cells and therefore its therapeutic potential to be used in cancer treatment. Cytometric evaluation of MEMP modulation effect on cell viability U373 and HeLa cells were evaluated by cytometry using the Ghost Dye 780, a marker of cell membrane functioning (see Materials and Methods), to investigate cell viability after the MEMP modulation procedure. Cells were tested at T0 (CTR), T2.5 and T5 (minutes of modulation). As figure 3 shows, the cytometric assay confirmed the progressive effect of the modulation on cell viability during the times of treatment on HeLa, MC-38-Luc, and U373 cells. The percentage of dead cells was higher on Hela and MC-38-Luc than in U373 cells, denoting some difference in their susceptibility to the modulation. In particular, the MEMP effect was especially high on MC-38-Luc cells as upon the T2.5 treatment did not show viable cells. Subsequently, the effect of the treatment on several poorly tumorigenic cell lines was studied to gain a comparative view on susceptibility versus tumorigenicity. To address this, the percentage of death and live cells was evaluated on the poorly tumorigenic HaCaT, COS-1, CV-1, A9 cell lines, as well as in PAM. This cytometric analysis showed that modulation did not significantly affect these cells (Figure 3B). These results were in consistency with the MTT and colony formation assay data described above. and confirmed the resistance of the poorly tumorigenic cells to the MEMP treatment, as compared to the malignant cell lines tested. MEMP modulation induces cell cycle deregulation in human and mouse cancer cell lines In order to investigate the molecular effect of MEMP treatment on malignant and non-malignant cell lines, the cell cycle pattern was analyzed by flow cytometry. In particular, U373 and MC-38-Luc cancer cell lines were analyzed and compared with A9, HaCaT, CV-1 and COS-1 low tumorigenic cell lines. FACS analysis showed a progressive deregulation of cell cycle in all the malignant cells tested, with an increase of G2-phase proportional to the time of modulation (Fig. 4). In particular, in U373 cells (Fig. 4 A and B) we found an important increase of G2-phase arrested cells after 2,5 and 5 min of MEMP treatment, with a progressive decrease of G1-phase. In addition, at T5, a further increase of sub-G1 phase was observed, suggesting apoptotic events in these conditions. Regarding mouse colon adenocarcinoma MC-38-Luc cells, due to their high sensitivity to MEMP, we were able to analyze only cells modulated for 2,5 min, since after that time no intact cells could be collected. Thus, as it is shown in the panels of Figure 4 A and B, the modulation treatment produced a sharp cell cycle deregulation with a marked increase of G2-phase (25,76 %) compared with T0 (no treatment), and a decrease of S-phase (45,4 %). In addition, we observed an increase of sub-G1 phase, suggesting that cells are dying by apoptosis. In parallel, the low tumorigenic A9, HaCaT, CV-1 and COS-1 cells were also analyzed by FACS after 2,5 and 5 min of MEMP treatment. The analysis showed no significant changes, as compared to the non-modulated controls, in the cell cycle phases of all these poorly tumorigenic cell lines at any time of treatment (Figure 4C). These results indicated that under the tested MEMP modulation conditions the physiological control of cell cycle progression of the low tumorigenic cells was not affected. The MEMP treatment induces immediate cytoskeleton collapse of human glioblastoma cells Attempting to identify a major cellular component that could be target of the MEMP, we focused in the cytoskeleton, as this large and highly organized macromolecular entity is stabilized by polar charges and previous reports suggested affectation by electric pulses 29-31 . In our study, a possible direct and immediate effect of MEMP on cell shape and cytoskeleton was examined by confocal microscopy. To this aim, mouse A9 fibroblasts and human U373 glioblastoma cells were submitted to MEMP for a 2 min time treatment and immediately fixed in paraformaldehyde. Confocal IF analysis showed the Actin as well as the Nestin intermediate filaments cytoskeletons immediately collapsed around the nucleus in all the treated human U373 cells. In contrast, the Actin cytoskeleton remained under a normal expanded configuration in about half of the MEMP-treated A9 cells (Figure 5A), which may correspond to the two viable subpopulations resolved by cytometry above (Figure 3C, lower right panel). Importantly, the nuclear envelope was not significantly impaired by MEMP neither in U373 nor in A9 cells as judged by the confined DAPI staining of chromatin (Figure 5A, zoom panels). A quantitative measurement of the cytoskeletal effect of the MEMP is shown in Figure 5B. Of note, the precise time conditions of the MEMP used compromised the colony forming ability in a cell type dependent manner (Figure 5C) as described above, suggesting that the population of A9 fibroblasts with collapsed Actin cytoskeleton recovered nevertheless their proliferative capacity upon culturing to form colonies of normal sizes. The drastic and rapid cytoskeleton collapse in malignant cells may account for their viability decay described above, and suggests that these highly organized macromolecular structures may be a primary target of the MEMP. MEMP treatment inhibits in vivo tumorigenicity of mouse colon cancer cells To test the effect of MEMP on the tumorigenic capacity of cancer cells, Mc-38-Luc tumor cells growing in monolayers were modulated for 1.5 or 2 min in PBS, collected and subsequently subcutaneously injected into immunocompetent C57BL/6 mice in parallel with control non-modulated cells. In order to respect animal welfare, a limited number of mice was used for this experiment. Tumor progression in all mice was monitored by bioluminescence in vivo imaging. Importantly, as shown in Figure 6A, B, all mice (two controls and three per each modulation time) showed the first day of xenografting high luciferase activity at the site of injection, denoting significant metabolic activity of the 1.5 and 2 min modulated cells. As the experiment proceeded, untreated cells formed tumors that show the expected high growth rate characteristic of this in vivo tumor model. In contrast, mice inoculated with cells treated for 1.5 min, had no measurable tumors until day 9, followed by a restricted growth that only overcame the initial light emission by day 19 post-injection. Moreover, mice injected with cells treated for 2 min did not show measurable tumor growth until day 19 post-injection, indicating that the tumor forming capacity of most cells was impaired by the MEMP treatment. Eventually, control mice reached endpoint criteria for tumor size and skin ulcers by day 19 post-injection, however mice of the T1.5 and T2 groups did not reach endpoint criteria and therefore survived until the end of the experiment (Figure 6C). This experiment demonstrated the capacity of MEMP regimes to abruptly suppress the in vivo tumorigenicity of colon adenocarcinoma cells. Discussion Several studies that refer to different electromagnetic fields used to cause effects on cancer cells and tumors 2,4,5,32-34 , as a decrease in cell proliferation 6 and tumor remission in some cases 7 , have been reported. However, current research in this field does not clearly detail the exact mechanisms by which electromagnetic fields interact and impair cancer cell physiology. Other studies have referred to the different electrical characteristics of cancer cells, considering the electronegativity of some of their structures 9,35 , but to date no scientific evidence support the molecular mechanisms that differentiate the electronegativity of a cancer cell from a normal cell. In spite of these uncertainties, this field is currently being widely explored for potential therapies. For the development of this study, we have considered a relationship of relative electronegativity with well-known characteristics of cancer cells, placing several basic physical science concepts in the context of molecular biology. It is known that in physics, relative electronegativity may be affected by diverse elements such as the effective nuclear charge, the size of the atoms, the electronic configuration, the inductive effects, the resonant effects, or the hybridization 36 . The electronic configuration itself may be altered in a controlled manner with electronic perturbations, what would provoke variations in the relative electronegativity of a biological structure such as a cancer cell. It should also be noted that when a more electronegative organic element is exposed to an electromagnetic field, the chemical bonds are more likely to be polarized, triggering a greater response of that element to the electromagnetic field, which may impair the molecular interactions and functions of the molecules themselves. This phenomenon may explain why a specific electronic perturbation have a significant impact on a more electronegative cancer but not on a non-tumorigenic cell. In the context of the aberrant metabolism of cancer cells undergoing the Warburg effect 37 , relative electronegativity is caused by the accumulation of acid metabolites that increase the concentration of ionized hydrogen atoms (H⁺) 38 . Indeed, the biochemical processes that may impact the electronegativity of cancer cells are multiple and complex. Best known examples may be summarized as follows: (I) Abnormal expression of proteins and biomarkers, as the kinesin family members in breast cancer that influence cellular electronegativity through changes in microtubule dynamics and ionic charge distribution 39,40 , the PYCR2 and ADH1A in hepatitis B virus-related hepatocellular carcinoma altering cellular electronegativity 41 , and the NNMT in the tumor stroma regulating histone methylation and other transcriptional changes that are critical for phenotyping of cancer-associated fibroblasts (CAF), which can influence cellular cargo 42 ; (II) Metabolic reprogramming including changes in glucose and other nutrient metabolism, as the regulation of serine metabolism and glycolysis through mTOR signaling indirectly affecting the electrical charge in pancreatic cancer; (III) Increased oxidative stress due to excessive production of reactive oxygen species (ROS), which influence the functionality and survival of the cancer cell 43,44 ; (IV) Mechanisms related to cell signaling and the release of inflammatory mediators, which may have domains with different charges and electrical properties or can modify the activity of certain ion pumps and channels in the cell membrane 45,46 ; (V) Changes in the composition of phospholipids and cholesterol of the cytoplasmic membrane in response to inflammation and cancerous transformation may modify its electrical properties and consequently also the electronegativity of the cell 47,48 ; and (VI) Functional integrity of the mitochondrial and of endoplasmic reticulum membranes, as alterations may impact protein synthesis and folding or lead to programmed cell death 49,50 . In this work, we have exposed a collection of mammalian cells with different origin and tumorigenic capacity (see Table I) to MEMP applied at various time points. Tumorigenicity is tightly related to the metabolic activity in a wide sense, including signaling activity, membrane transport and the many other processes that as mentioned above are related to the electronegativity of the cancer cells 12,51 . It is therefore remarkable that our experimental data show a fair correlation between the degree of tumorigenicity and the sensitiveness of the tested cells to the MEMP (Figure 1-4). A possible exception to this correlation was the COS-1 cell line, obtained by SV40 transformation of the CV-1 cells (see Table I) and expressing the tumorigenic T antigen that binds and perturbs the p53 and pRb and others cell major regulators 11 , which was not susceptible to the MEMP treatments (Figure 1-4). Whether this result represent an inconsistency with the overall found correlation between tumorigenicity and MEMP effects is unclear, since COS-1 tumorigenicity in mice remains to be described. Interestingly, our results may suggest that major tumor suppressors (p53 and pRB) and connected transformation processes may not drastically alter the cell metabolic pathways leading to electronegativity, a hypothesis deserving further investigation. Importantly, our study uncovered a series of molecular mechanisms impacted by the MEMP regimes that may account for the compromised vital functions of the malignant cells. For example, a major finding was the capacity of MEMP to induce cell cycle deregulation in several highly tumorigenic cell lines, with a significant increase of the G2-phase. In particular, in the U373 human glioblastoma cells, the MEMP treatment was able to cause a G2-phase block, with a clear arrest of cells at the S-phase and an increase of sub-G1 phase, suggesting apoptotic events. MC-38-Luc colon cancer cells shows also a cell cycle deregulation with an increase of sub-G1 phase (see Figure 4), suggesting that these cells are dying by apoptosis as well. Another important molecular target of the MEMP was the cytoskeleton. We found that this treatment induces an immediate collapse of the actin and nestin cytoskeletons in U373 glioblastoma, which occurs within a 2 min time period post-treatment, while in A9 mouse fibroblasts the cytoskeleton spread configuration remained much less affected (Figure 5). This cytoskeleton collapse may in great extend account for the viability decay and cell cycle deregulation observed in the modulated malignant cells (Figure 1-4). The drastic and rapid cytoskeleton collapse induced by MEMP suggests that these highly organized macromolecular structures may be the primary target of the electromagnetic fields, which collapse would transmit apoptotic and death signaling towards cytosolic mediators. Cytoskeleton collapse may be triggered by altering the polar configuration of the filaments required for their structural integrity. Further research will be required to identify the ionic, factors composition, and configuration features, that may account for the drastic differences between the A9 and U373 cytoskeleton behavior in response to MEMP. In the perspective of the time at which each molecular process was MEMP-affected and detected in malignant cells, we show that cytoskeleton collapse occurs within minutes, cell permeability and cell cycle perturbation in 20-24 h, proliferative clonogenic capacity in two weeks days, and tumorigenicity in vivo in three weeks. Our study illustrates the effective cascade of perturbations that may be caused on the physiology of malignant cells through time limited MEMP regimes. Finally, this study also shows the capacity of the MEMP to drastically suppress the tumorigenicity of malignant colon adenocarcinoma cells when treated for 2 min prior xenograft transplantation in immunocompetent mice (Figure 6). Although the treatment was performed in vitro prior xenografting, the prospective value of the assay relies on the capacity of the treated cells to maintain metabolic activity upon injection, as determined by luciferase expression. However, the treated cells absolutely lost their malignancy as tumor growth was halted and metabolic activity disappeared two weeks post-injection. This assay show promises for the treatment of pre-established tumors with the non-invasive MEMP technology, either alone or in combination with other clinically used anti-cancer therapies. Declarations Acknowledgements We are grateful to Mr David Pérez Pérez for his support, to Mr Fidel Valdés Rodríguez, CEO of Paso Alto Advanced Treatment Center and Mr. F. Rafael López Ferraz, President and CFO of Paso Alto Biotechnology Inc. and Paso Alto Biophysics & Biomedical Engineering for their collaboration and contribution. To Dr. Carlos Gómez Becerra, in memoriam. To Dr. Daniel Pérez-Núñez for critical reading of the manuscript. We also thank the CBMSO-CSIC-UAM animal facility and the Severo Ochoa Foundation (CBMSO). Author contributions R.P. and L.G.R.M. equally contributed to this work. The conception and design of the work, and manuscript writing, was performed by L.G.R., J.M.A. and Y.R. R.P. conducted most experiments and prepared all the figures, assisted by J.M.O. K.S. supervised and supported the mice experiments. All authors reviewed the manuscript. Data availability All data generated or analysed during this study are included in this published article. Funding This project has been funded by PASO ALTO ADVANCED TREATMENT CENTER LLC, USA and PASO ALTO BIOPHYSIC SL, Spain, and by the grant PID2022-141799OB-I00 /AEI (Ministerio de Ciencia e Innovación) to J.M.A. The Centro de Biología Molecular Severo Ochoa (CSIC-UAM) is in part supported by institutional grants from the Fundación Ramón Areces and Banco Santander. Competing interests The authors declare no competing interests. The US company PASO ALTO BIOTECHNOLOGY INC has developed a new non-ionizing radiation technology that enables the sustained delivery of intense, time-controlled, multi-frequency electromagnetic pulses (MEMP). The technology is under industrial secrecy. Additional information Correspondence and requests for materials should be addressed to Y.R. or to J.M.A. References Berg, H. et al. Bioelectromagnetic field effects on cancer cells and mice tumors. Electromagn Biol Med 29 , 132-143, doi:10.3109/15368371003776725 (2010). Williams, C. D., Markov, M. S., Hardman, W. E. & Cameron, I. L. Therapeutic electromagnetic field effects on angiogenesis and tumor growth. Anticancer Res 21 , 3887-3891 (2001). Yamaguchi, S., Ogiue-Ikeda, M., Sekino, M. & Ueno, S. Effects of pulsed magnetic stimulation on tumor development and immune functions in mice. Bioelectromagnetics 27 , 64-72, doi:10.1002/bem.20177 (2006). Koh, E. K. et al. A 60-Hz sinusoidal magnetic field induces apoptosis of prostate cancer cells through reactive oxygen species. Int J Radiat Biol 84 , 945-955, doi:10.1080/09553000802460206 (2008). Li, J., Ma, Y., Li, N., Cao, Y. & Zhu, Y. Natural static magnetic field-induced apoptosis in liver cancer cell. Electromagn Biol Med 33 , 47-50, doi:10.3109/15368378.2013.783850 (2014). Wang, M. H. et al. Effect of extremely low frequency electromagnetic field parameters on the proliferation of human breast cancer. Electromagn Biol Med 40 , 384-392, doi:10.1080/15368378.2021.1891093 (2021). Zhang, X., Liu, X., Pan, L. & Lee, I. Magnetic fields at extremely low-frequency (50 Hz, 0.8 mT) can induce the uptake of intracellular calcium levels in osteoblasts. Biochem Biophys Res Commun 396 , 662-666, doi:10.1016/j.bbrc.2010.04.154 (2010). Sun, J. et al. Effects of extremely low frequency electromagnetic fields on the tumor cell inhibition and the possible mechanism. Sci Rep 13 , 6989, doi:10.1038/s41598-023-34144-5 (2023). Di Gregorio, E. et al. The distinguishing electrical properties of cancer cells. Phys Life Rev 43 , 139-188, doi:10.1016/j.plrev.2022.09.003 (2022). Carrascosa, A. L., Santaren, J. F. & Vinuela, E. Production and titration of African swine fever virus in porcine alveolar macrophages. J Virol Methods 3 , 303-310, doi:10.1016/0166-0934(82)90034-9 (1982). Brough, D., Amos, H., Turley, K. & Murkin, J. Trends in Subcutaneous Tumour Height and Impact on Measurement Accuracy. Cancer Inform 22 , 11769351231165181, doi:10.1177/11769351231165181 (2023). Corbett, T. H., Griswold, D. P., Jr., Roberts, B. J., Peckham, J. C. & Schabel, F. M., Jr. Tumor induction relationships in development of transplantable cancers of the colon in mice for chemotherapy assays, with a note on carcinogen structure. Cancer Res 35 , 2434-2439 (1975). Tan, M. H., Holyoke, E. D. & Goldrosen, M. H. Murine colon adenocarcinomas: methods for selective culture in vitro. J Natl Cancer Inst 56 , 871-873, doi:10.1093/jnci/56.4.871 (1976). Lammering, G. et al. Inhibition of the type III epidermal growth factor receptor variant mutant receptor by dominant-negative EGFR-CD533 enhances malignant glioma cell radiosensitivity. Clin Cancer Res 10 , 6732-6743, doi:10.1158/1078-0432.CCR-04-0393 (2004). Palma, C. et al. Anti-tumour activity of tachykinin NK1 receptor antagonists on human glioma U373 MG xenograft. Br J Cancer 82 , 480-487, doi:10.1054/bjoc.1999.0946 (2000). Gey GO, C. W., Kubicek MT. Tissue culture studies of the proliferative capacity of cervical carcinoma and normal epithelium. . ancer Res. 12 , 264-265 (1952). Kusakawa, S. et al. Characterization of in vivo tumorigenicity tests using severe immunodeficient NOD/Shi-scid IL2Rgamma(null) mice for detection of tumorigenic cellular impurities in human cell-processed therapeutic products. Regen Ther 1 , 30-37, doi:10.1016/j.reth.2014.12.001 (2015). Schwarz, E. et al. Structure and transcription of human papillomavirus sequences in cervical carcinoma cells. Nature 314 , 111-114, doi:10.1038/314111a0 (1985). Boukamp, P. et al. Normal keratinization in a spontaneously immortalized aneuploid human keratinocyte cell line. J Cell Biol 106 , 761-771, doi:10.1083/jcb.106.3.761 (1988). Boukamp, P. et al. Sustained nontumorigenic phenotype correlates with a largely stable chromosome content during long-term culture of the human keratinocyte line HaCaT. Genes Chromosomes Cancer 19 , 201-214, doi:10.1002/(sici)1098-2264(199708)19:43.0.co;2-0 (1997). Mueller, M. M. et al. Tumor progression of skin carcinoma cells in vivo promoted by clonal selection, mutagenesis, and autocrine growth regulation by granulocyte colony-stimulating factor and granulocyte-macrophage colony-stimulating factor. Am J Pathol 159 , 1567-1579, doi:10.1016/S0002-9440(10)62541-2 (2001). Furesz, J., Fanok, A., Contreras, G. & Becker, B. Tumorigenicity testing of various cell substrates for production of biologicals. Dev Biol Stand 70 , 233-243 (1989). Jensen, F. C., Girardi, A. J., Gilden, R. V. & Koprowski, H. Infection of Human and Simian Tissue Cultures with Rous Sarcoma Virus. Proc Natl Acad Sci U S A 52 , 53-59, doi:10.1073/pnas.52.1.53 (1964). Gluzman, Y. SV40-transformed simian cells support the replication of early SV40 mutants. Cell 23 , 175-182, doi:10.1016/0092-8674(81)90282-8 (1981). Clements, E. F., M; Klein, G. In vitro derived mouse A9 cell clones differing in malignancy:Analysis by somatic cell hybridization with YACIR lymphoma cell clones. Proc. Natl. Acad. Sci. USA 6 , 2004-2007 (1976). Klein, G., Bregula, U., Wiener, F. & Harris, H. The analysis of malignancy by cell fusion. I. Hybrids between tumour cells and L cell derivatives. J Cell Sci 8 , 659-672, doi:10.1242/jcs.8.3.659 (1971). Littlefield, J. W. Three Degrees of Guanylic Acid--Inosinic Acid Pyrophosphorylase Deficiency in Mouse Fibroblasts. Nature 203 , 1142-1144, doi:10.1038/2031142a0 (1964). Ghasemi, M., Turnbull, T., Sebastian, S. & Kempson, I. The MTT Assay: Utility, Limitations, Pitfalls, and Interpretation in Bulk and Single-Cell Analysis. Int J Mol Sci 22 , doi:10.3390/ijms222312827 (2021). Grasso, R. et al. Dynamic changes in cytoskeleton proteins of olfactory ensheathing cells induced by radiofrequency electromagnetic fields. J Exp Biol 223 , doi:10.1242/jeb.217190 (2020). Ramalho RR, S. H., Melo LV. Microtubule behavior under strong electromagnetic fields. Materials Science and Engineering 27 , 1207-1210 (2007). Titushkin, I. & Cho, M. Regulation of cell cytoskeleton and membrane mechanics by electric field: role of linker proteins. Biophys J 96 , 717-728, doi:10.1016/j.bpj.2008.09.035 (2009). Barbault, A. et al. Amplitude-modulated electromagnetic fields for the treatment of cancer: discovery of tumor-specific frequencies and assessment of a novel therapeutic approach. J Exp Clin Cancer Res 28 , 51, doi:10.1186/1756-9966-28-51 (2009). Rosen, A. D. Mechanism of action of moderate-intensity static magnetic fields on biological systems. Cell Biochem Biophys 39 , 163-173, doi:10.1385/CBB:39:2:163 (2003). Zimmerman, J. W. et al. Targeted treatment of cancer with radiofrequency electromagnetic fields amplitude-modulated at tumor-specific frequencies. Chin J Cancer 32 , 573-581, doi:10.5732/cjc.013.10177 (2013). Li, C., Jiang, P., Wei, S., Xu, X. & Wang, J. Regulatory T cells in tumor microenvironment: new mechanisms, potential therapeutic strategies and future prospects. Mol Cancer 19 , 116, doi:10.1186/s12943-020-01234-1 (2020). Pauling, L. The Nature of the Chemical Bond and the Structure of Molecules and Crystals: An Introduction to Modern Structural Chemistry . (Cornell University Press, 1960). Vander Heiden, M. G., Cantley, L. C. & Thompson, C. B. Understanding the Warburg effect: the metabolic requirements of cell proliferation. Science 324 , 1029-1033, doi:10.1126/science.1160809 (2009). Corbet, C. & Feron, O. Tumour acidosis: from the passenger to the driver's seat. Nat Rev Cancer 17 , 577-593, doi:10.1038/nrc.2017.77 (2017). Khan, R., Pari, B. & Puszynski, K. Comprehensive Bioinformatic Investigation of TP53 Dysregulation in Diverse Cancer Landscapes. Genes (Basel) 15 , doi:10.3390/genes15050577 (2024). Kotulova, J., Hajduch, M. & Dzubak, P. Current Adenosinergic Therapies: What Do Cancer Cells Stand to Gain and Lose? Int J Mol Sci 22 , doi:10.3390/ijms222212569 (2021). Li, T. F. et al. Overexpression of kinesin superfamily members as prognostic biomarkers of breast cancer. Cancer Cell Int 20 , 123, doi:10.1186/s12935-020-01191-1 (2020). Kwon, Y. W. et al. Application of Proteomics in Cancer: Recent Trends and Approaches for Biomarkers Discovery. Front Med (Lausanne) 8 , 747333, doi:10.3389/fmed.2021.747333 (2021). Gorrini, C., Harris, I. S. & Mak, T. W. Modulation of oxidative stress as an anticancer strategy. Nat Rev Drug Discov 12 , 931-947, doi:10.1038/nrd4002 (2013). Kuo, C. L. et al. Mitochondrial oxidative stress in the tumor microenvironment and cancer immunoescape: foe or friend? J Biomed Sci 29 , 74, doi:10.1186/s12929-022-00859-2 (2022). Arfin, S. et al. Oxidative Stress in Cancer Cell Metabolism. Antioxidants (Basel) 10 , doi:10.3390/antiox10050642 (2021). Glaviano, A. et al. PI3K/AKT/mTOR signaling transduction pathway and targeted therapies in cancer. Mol Cancer 22 , 138, doi:10.1186/s12943-023-01827-6 (2023). Eisenhut, M. Changes in ion transport in inflammatory disease. J Inflamm (Lond) 3 , 5, doi:10.1186/1476-9255-3-5 (2006). Ponnalagu, D. & Singh, H. Insights Into the Role of Mitochondrial Ion Channels in Inflammatory Response. Front Physiol 11 , 258, doi:10.3389/fphys.2020.00258 (2020). Molendijk, J., Robinson, H., Djuric, Z. & Hill, M. M. Lipid mechanisms in hallmarks of cancer. Mol Omics 16 , 6-18, doi:10.1039/c9mo00128j (2020). Saito, R. F., Andrade, L. N. S., Bustos, S. O. & Chammas, R. Phosphatidylcholine-Derived Lipid Mediators: The Crosstalk Between Cancer Cells and Immune Cells. Front Immunol 13 , 768606, doi:10.3389/fimmu.2022.768606 (2022). Cassim, S., Raymond, V. A., Lacoste, B., Lapierre, P. & Bilodeau, M. Metabolite profiling identifies a signature of tumorigenicity in hepatocellular carcinoma. Oncotarget 9 , 26868-26883, doi:10.18632/oncotarget.25525 (2018). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 03 Dec, 2024 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 03 Sep, 2024 Reviews received at journal 02 Sep, 2024 Reviewers agreed at journal 29 Aug, 2024 Reviewers agreed at journal 26 Aug, 2024 Reviews received at journal 16 Aug, 2024 Reviewers agreed at journal 24 Jul, 2024 Reviewers invited by journal 15 Jul, 2024 Editor assigned by journal 11 Jun, 2024 Editor invited by journal 07 Jun, 2024 Submission checks completed at journal 06 Jun, 2024 First submitted to journal 04 Jun, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4527641","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":316500787,"identity":"db8cd7c6-0de7-4857-87c9-e8b04c7cc4b4","order_by":0,"name":"Roberta Piredda","email":"","orcid":"","institution":"1. Centro de Biología Molecular Severo Ochoa (CSIC-UAM). Universidad Autónoma de Madrid.","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Roberta","middleName":"","lastName":"Piredda","suffix":""},{"id":316500788,"identity":"139a2d98-e0cd-4dcb-93cd-25340553e730","order_by":1,"name":"Luis G. Rodríguez Martínez","email":"","orcid":"","institution":"2. Universidad de Sancti Spiritus","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Luis","middleName":"G. Rodríguez","lastName":"Martínez","suffix":""},{"id":316500789,"identity":"d69f0ce2-ccf6-407a-b306-37e68e88e54f","order_by":2,"name":"kostantinos Stakamakis","email":"","orcid":"","institution":"1. Centro de Biología Molecular Severo Ochoa (CSIC-UAM). Universidad Autónoma de Madrid.","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"kostantinos","middleName":"","lastName":"Stakamakis","suffix":""},{"id":316500790,"identity":"2a657c9e-34aa-4588-bc15-e1e8d21243cd","order_by":3,"name":"Jorge Martinez-Ortega","email":"","orcid":"","institution":"1. Centro de Biología Molecular Severo Ochoa (CSIC-UAM). Universidad Autónoma de Madrid.","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jorge","middleName":"","lastName":"Martinez-Ortega","suffix":""},{"id":316500791,"identity":"410526ec-2766-42f9-a1ab-f729486e3b25","order_by":4,"name":"Alejandro López Ferraz","email":"","orcid":"","institution":"3. Universidad de La Laguna, Santa Cruz de Tenerife","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Alejandro","middleName":"López","lastName":"Ferraz","suffix":""},{"id":316500793,"identity":"c315e02e-95f8-4bc5-b98c-90882836bc57","order_by":5,"name":"Jose M. Almendral","email":"","orcid":"","institution":"1. Centro de Biología Molecular Severo Ochoa (CSIC-UAM). Universidad Autónoma de Madrid.","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jose","middleName":"M.","lastName":"Almendral","suffix":""},{"id":316500795,"identity":"813e0d0b-bc8e-49e2-8292-5651c424461c","order_by":6,"name":"Yolanda Revilla","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3UlEQVRIiWNgGAWjYLCChAILBn4GHjCbh0gtBhIMkg0kaWEAajE4QLTi24ePSTwwkJA3Pn726AaGmjoZ/gbmwx/wajmXliYBdJjhtjN5aTcYjh3mkTjAliaBV8sZHmMDoBbGbTd4zG4wNhzgMWDgMcPvsDP8n0Fa7DfPAGupA2rh/4zfYWd4GB8AtSRukABrYQbZwoDXYZJn2AxBWpJngPySAPLLYTYzvFr4zjA/OPijwsa2v/3ssRsfaurs+dubH+N1mMIBZF4CiGDGpx4I5BsIKBgFo2AUjIJRwAAAXFdEJdqg/WUAAAAASUVORK5CYII=","orcid":"","institution":"1. Centro de Biología Molecular Severo Ochoa (CSIC-UAM). Universidad Autónoma de Madrid.","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Yolanda","middleName":"","lastName":"Revilla","suffix":""}],"badges":[],"createdAt":"2024-06-04 11:21:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4527641/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4527641/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-024-81171-x","type":"published","date":"2024-12-03T15:57:41+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":59123208,"identity":"f157b5a8-067c-4b4c-ab99-d5d598a1abd2","added_by":"auto","created_at":"2024-06-26 15:12:10","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":511568,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDegree of inhibition of cell viability caused by MEMP as evaluated by an MTT assay\u003c/strong\u003e. Quantitative determination of cell metabolic activity by MTT in non-treated controls and upon the indicated MEMP treatments. \u003cstrong\u003eA\u003c/strong\u003e, evaluation of cell viability in U373 MG, HeLa and MC-38-Luc cancer cell lines treated from 0 to 5 min. \u003cstrong\u003eB\u003c/strong\u003e, evaluation of viability after MEMP treatment applied for 2,5 and 5 min to HaCaT, CV-1, COS-1, A9 cell lines, and PAM. Data are the mean with standard errors obtained from triplicates and were statistically analyzed by using unpaired t test (*, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; **, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01; ****, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.0001).\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-4527641/v1/6ab2372f1eb8bb190a18df24.png"},{"id":59124086,"identity":"7dda5d6e-a133-4ce3-b694-4bd9a2835051","added_by":"auto","created_at":"2024-06-26 15:20:10","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1400190,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDifferential inhibitory effect of MEMP treatments on cell lines assessed by colony forming ability.\u003c/strong\u003e Control and modulated cell lines at the times indicated in the figure were seeded in triplicate at 10\u003csup\u003e3\u003c/sup\u003e to 10\u003csup\u003e4\u003c/sup\u003e cells onto P60 plates. The percentages of colonies formed in culture were calculated in respect to the number of colonies formed in the control (T0). \u003cstrong\u003eA\u003c/strong\u003e, percentage of colonies formed by U373, HeLa and MC-38-Luc cells upon the MEMP treatments performed between 2.5 to 5 min. \u003cstrong\u003eB\u003c/strong\u003e, analysis of the inhibition of colony forming capacity caused by MEMP applied for 2,5 and 5 min to the HaCaT, COS-1, CV-1 and A9 cell lines. \u003cstrong\u003eC, \u003c/strong\u003erepresentative photographs showing the effect of MEMP treatment on colony formation by different cell lines. Colonies were fixed and stained with crystal violet two to three weeks after treatments. Data were statistically analyzed by using unpaired t test (*,\u0026nbsp;\u003cem\u003eP\u003c/em\u003e\u0026nbsp;\u0026lt; 0.05; **,\u0026nbsp;\u003cem\u003eP\u003c/em\u003e\u0026nbsp;\u0026lt; 0.01; ****,\u0026nbsp;\u003cem\u003eP\u003c/em\u003e\u0026nbsp;\u0026lt; 0.0001).\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4527641/v1/0b7c19c0e080ddee03f23bd0.png"},{"id":59123210,"identity":"2a4e2fb2-baf9-4a88-a80e-ce3e48be5672","added_by":"auto","created_at":"2024-06-26 15:12:10","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":684038,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDetermination of cell viability after MEMP treatment by cytometry.\u003c/strong\u003e Cells modulated at times indicated in the figure were stained with the fixable Viability Dye Ghost Dye Red 780 (1 µg/mL) and fixed. Cells were then analyzed in a FACSCanto flow cytometer (BD Science) to determine the percentage of death and live cells. The figure shows representative data from three experiments on the percentages of live and death cells after each MEMP modulation condition. Data were statistically analyzed by using unpaired t test (*, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; **, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01; ****, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.0001). \u003cstrong\u003eA\u003c/strong\u003e. Evaluation of MEMP effect on the viability of the U373, HeLa and MC-38-Luc cancer cells. Experiment was repeated three times. \u003cstrong\u003eB. \u003c/strong\u003eDetermination of cell viability by FACS after the MEMP treatment in the HaCaT, CV-1, COS-1, A9 cell lines, and PAM. \u003cstrong\u003eC.\u003c/strong\u003eIndicative photograph of dot plots showing the percentage of death and live U373 and A9 cells.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-4527641/v1/e75763c60b21db6046e3d79f.png"},{"id":59124085,"identity":"d98ad759-bb09-468c-b9be-a947c5398817","added_by":"auto","created_at":"2024-06-26 15:20:10","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":915001,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-4527641/v1/a38195e16a8de4418d8adb30.png"},{"id":59123214,"identity":"ac80cdfe-08c3-40b7-87bd-2128f288c894","added_by":"auto","created_at":"2024-06-26 15:12:11","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":6138077,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEvaluation of MEMP effects on cell shape and cytoskeleton organization. \u003c/strong\u003eCells were treated with MEMP for two minutes and immediately fixed for subsequent inspection by confocal microscopy with specific antibodies.\u003cstrong\u003e A.\u003c/strong\u003e Fields of A9 and U373 cells stained with the indicated antibody and phalloidin and analyzed by confocal microscopy at 40x magnification Scale bars, 20 mm. \u003cstrong\u003eB.\u003c/strong\u003eVisual quantitative determination of the collapse of the actin cytoskeleton as observed by confocal microscopy (N, minimun of 100 cells per condition). \u003cstrong\u003eC\u003c/strong\u003e. Representative picture showing the colony forming ability of A9 and U373 cells at the MEMP regime used in A and B.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-4527641/v1/6093c048721102232320c903.png"},{"id":59123213,"identity":"b3956738-7bdb-4628-89f2-ca4251c37e92","added_by":"auto","created_at":"2024-06-26 15:12:11","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1258463,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEvaluation of tumour forming capacity of modulated colon cancer cells in mice.\u003c/strong\u003e Mouse MC-38-Luc adenocarcinoma cells were modulated by MEMP for 0, 1.5 and 2 min and then 0.5x10\u003csup\u003e6\u003c/sup\u003e control and modulated cells were injected per C57BL/6 mouse. \u003cstrong\u003eA.\u003c/strong\u003e In vivo imaging quantification of tumour bioluminescence from day 0 (30 min post- inoculation) until day 19 (sacrifice of untreated cells-inoculated mice). \u003cem\u003eInset\u003c/em\u003e: the same graph in log10 scale. \u003cstrong\u003e(B)\u003c/strong\u003e Representative IVIS images at 0 \u003cem\u003e(upper)\u003c/em\u003e and 19 \u003cem\u003e(lower)\u003c/em\u003e days post-inoculation (radiance p/sec/cm\u003csup\u003e2\u003c/sup\u003e/sr color scale Min= 4.00e4, Max= 2.50e7). \u003cstrong\u003e(C)\u003c/strong\u003e Kaplan-Meier survival plots for the mice of the three groups until reaching endpoint criteria.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-4527641/v1/ff7c7aa0c9ed0bdff2b9defa.png"},{"id":70965328,"identity":"aa427c86-5378-41ff-be9d-e9daf818c41a","added_by":"auto","created_at":"2024-12-09 16:19:09","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":13225655,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4527641/v1/853adc4a-b679-47a9-b7e6-5da2ad1447bc.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Assessment of Molecular Modulation by Multifrequency Electromagnetic Pulses to Preferably Eradicate Tumorigenic cells","fulltext":[{"header":"Introduction","content":"\u003cp\u003eLow-frequency magnetic fields (LMF) are experimentally used to treat tumors, since they induce nonionizing, non-thermal and noninvasive effects on tissues, inhibiting the proliferation of tumor \u003csup\u003e1-3\u003c/sup\u003e.\u0026nbsp;Other \u003cem\u003ein vitro\u003c/em\u003e experiments have shown that LMF may limit the growth of tumor cells \u003csup\u003e4,5\u003c/sup\u003e, whereas non tumoral cells do not suffered major alterations \u003csup\u003e6\u003c/sup\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;The mechanisms by which LMF exert these effects have been only partially addressed. For example, it has been suggested that LMF affect the cytoplasmic membrane of the tumoral cells, and some apoptotic events have also been shown to be involved \u003csup\u003e7\u003c/sup\u003e.\u0026nbsp;Other studies proposed that the induction of reactive oxygen species (ROS) correlates to the inhibitory effect of LMF, and that the intercellular environment and intercellular aggregation is a necessary event for magnetic inhibition. In a recent report \u003csup\u003e8\u003c/sup\u003e, a fixed magnetic field of 5 mT and 20 Hz was used being the magnetic field generator in direct contact with cells, inducing antiproliferative effects in the tumor cells studied.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; The equipment used in this report, developed by PASO ALTO BIOTECHNOLOGY INC, consists in a new LM non-ionizing radiation technology that enables the sustained delivery of intense, time-controlled, multi-frequency electromagnetic pulses (MEMP), which can be applied to cells in culture. Major features of the modulator equipment are further explained in the Materials and Methods section, being a new device that discriminates the overall electronegative charge of cell cultures. As cancer cell metabolism may impose drastic differences in their electronegativity \u003csup\u003e9\u003c/sup\u003e, it was of paramount interest to explore whether the modulator equipment can differently impact cells at distinct tumorigenicity stages.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; Therefore, the MEMP treatment effects on relevant parameters of cell biology were tested in a collection of mammalian cell lines with diverse tumorigenicity. For this, we investigated the effects of the technology on cell viability, cell cycle, and clonogenic capacity of cells with diverse tumorigenicity, suggesting enhanced toxic effects for malignant cells. To further confirm MEMP effects on tumoral cells and to investigate its molecular target, we addressed a confocal IF analysis of the actin and intermediate filaments cytoskeleton before and immediately post-MEMP treatments. Finally, we also investigated the \u003cem\u003ein vivo\u003c/em\u003e tumor forming ability of colon cancer cells after MEMP treatment. Our study collectively supports the therapeutic potential and tumor specificity of MEMP that could be translated into the clinical practice. \u0026nbsp;\u003c/p\u003e"},{"header":"Materials And Methods","content":"\u003cp\u003e\u003cstrong\u003eCells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCell lines were cultivated in Dulbecco\u0026apos;s Modified Eagle Medium (DMEM) supplemented with 2\u0026thinsp;mM\u0026thinsp;L-glutamine, 0.4\u0026thinsp;mM non-essential amino acids,100\u0026thinsp;U/mL gentamicin and 5 or 10% fetal calf serum (FBS; Invitrogen Life Technologies). All cells were grown at 37 \u0026deg;C with 5% of CO\u003csub\u003e2\u003c/sub\u003e in a humidified air (95%). The origin of our cell lines was as follows: COS-1 (CRL-1650), CV-1 cells (CCL-70) from African green monkey kidney,\u0026nbsp;HEK-293T cells (CRL-3216) (Human embryonic kidney cells)\u0026nbsp;and A9 mouse fibroblasts (CRL-3265), were obtained from the American Type Culture Collection (ATCC); \u0026nbsp;U373 MG (HTB-17) human glioblastoma astrocytoma was purchased from ATCC; the MC-38-Luc cells, derived from MC-38 cell line (SCC172, Sigma-Aldrich), C57BL/6 murine colon adenocarcinoma cells and stably expressing luciferase gene, were generated in our laboratory as described below; HeLa cells (CCL-2) from human cervical carcinoma were obtained from the ATCC; and the HaCaT human keratinocyte cell line was kindly provided by Dr. Miguel Quintanilla (Instituto de Investigaciones Biom\u0026eacute;dicas \u0026ldquo;Alberto Sols\u0026rdquo;, Madrid, Spain). Porcine alveolar macrophages (PAM) were obtained by a bronchoalveolar lavage as previously described \u003csup\u003e10\u003c/sup\u003e,\u0026nbsp;and cultivated in DMEM supplemented with 10% porcine serum.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eVectors and transfection\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo obtain MC-38 cells constitutively expressing the biolumiscence marker luciferase, the pLVX-IRES-Luc lentiviral vector was constructed. To this aim, we cloned the luciferase gene from the mammalian pIRES-Luc vector, provided by Encarna, into a pLVX-puro empty vector. For pLVX-IRES-Luc cloning, we used 2X Phusion Maser Mix HF (Thermo Scientific) and In-Fusion technology (Takara) by using the following oligo probes: \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003cbr\u003e\u0026nbsp;5\u0026rsquo;TCGCTAGCGCTACCGGACTCAGCAGGTTTCCCCAACT3\u0026rsquo;and5\u0026rsquo;TAGAATTATCTAGAGTCGCGttacacggcgatctttccgccc3\u0026rsquo; to amplify the luciferase gene, and 5\u0026rsquo;GAGTCCG\u003cbr\u003e\u0026nbsp;GTAGCGCTAGC3\u0026rsquo; and 5\u0026rsquo;CGCGACTCTAGATAATT3\u0026rsquo; to linearize the pLVX-puro vector and insert the amplification. For the transfection protocol, FuGene HD transfection reagent (Promega) was employed, following the manufacturer\u0026rsquo;s instructions.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCells transduction\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe lentivirus was grown in HEK-293T packaging cell lines. Supernatants were harvested and virus luc-transducing was used to inoculate MC-38 cells. Transduced cells were selected with puromycin for 14 days, until death of control cells. To investigate the stable expression of the lentiviral vector, cells were analyzed by Luc-Pair Duo Luciferase HS Assay Kit (Genecopoeia). Luciferase readings were performed using the FLUOstar OPTIMA reader (BMG LabTech).\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMolecular Modulation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe modulator equipment was designed and developed by the North American corporation Paso Alto Biotechnology (inc), (under industrial secret), made up of two fundamental structures, an electromagnetic induction system assisted by sensors, and a high-power hardware system. The modulator was used to irradiate the different cell line samples selected for this study with a powerful multifrequency electromagnetic field of non-ionizing emission. The operational value of electromagnetic flux emitted by this device is greater than 2 Teslas (B \u0026gt; 2 T). All modulated cell lines were exposed to the MEMP treatment by seeding them individually in 12-well Falcon cell culture plates, these plates were placed on the induction system with the addition of sensors per well. These sensors assisting the induction system are designed to safely determine the electrical permeability of the medium and are responsible for sending the necessary operating signal to the switch circuit, which in turn sends sufficient energy to the induction system to generate the electromagnetic field with the required characteristics. The electronic perturbation induced by this MEMP on the culture medium during the corresponding exposure times of 2.5 and 5 minutes (min) may alter the electronic distribution of the biomolecules in a cell type dependent manner.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eViability determination by MTT\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eUpon the indicated MEMP treatments, 10\u003csup\u003e4\u003c/sup\u003e cells/well were seeded in a 96 multi-well plate. After 24 hours (h), cell medium was removed, cells were washed with PBS, and medium was replaced. When negative control cells (T0, non-modulated) reached the confluence (between 2 and 4 days), viable cell numbers were estimated by their mitochondrial activity. For this, 20 ml of 5mg/ml MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) were added directly to the medium and incubated at 37 \u0026deg;C in the dark for 4 h. Cells were then washed with PBS for 5 minutes under shaking in the dark, PBS was removed and 100 ml of dimethyl sulfoxide (DMSO) were added. Finally, after incubation for 30 min in the dark under shaking, the absorbance at 570 nm was measured with a spectrophotometric plate reader Claro Star System (BMG LabTech). All experiments were carried out in triplicates.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eColony formation assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eVariable numbers of cells in the range of 10\u003csup\u003e3\u003c/sup\u003e to 10\u003csup\u003e4\u003c/sup\u003e either control or MEMP-treated were seeded in 60 mm dish plate in their corresponding culture medium with 10% FCS, and incubated at 37 \u0026deg;C for 2-3 weeks under medium replacement every 3 days. Once control cells formed visible colonies of significant size, the\u0026nbsp;cells were washed in PBS and fixed in 4% formaldehyde for at least 2 h at room temperature (RT). Cells were then stained with 0,2% crystal violet diluted in 4% formaldehyde for 1h at RT, washed in water, left to dry, and then the number of colonies for each plate was visually counted.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eViability determination by cytometry\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eControl and MEMP-treated cells were collected, centrifuged at 1500 rpm for 5 minutes, and the supernatant was discarded. The cell pellet was washed twice in PBS and centrifuged at 2000 rpm for 4 min to remove the excess of serum. Cells were then suspended in 450\u0026nbsp;ml of PBS and stained with the Ghost Dye Red 780 (1ul/ml) (TONBO biosciences) for 5 minutes at 37 \u0026deg;C in the dark. Ghost Dye Red 780 is an amine reactive dye able to discriminate viable from necrotic mammalian cells with compromised membrane functioning.\u003cem\u003e\u0026nbsp;\u003c/em\u003eCells were fixed in 4% paraformaldehyde (PFA) for 10 minutes at RT and suspended in 200\u0026nbsp;ml of PBS-Staining containing 1% of bovine serum albumin (BSA). The cell viability was determined by a FACS Canto (BD bioscience) equipment. A number of 10000 cellular events were analyzed using the Flow-jo I.6.5 software.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell cycle analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCells were collected as above, the pellet washed in PBS, and cells were fixed with 1 ml of 70 % ice-cold ethanol added in a drop by drop way using vortex, followed by an overnight incubation at -20 \u0026ordm;C. Fixed cells were centrifuged for 5 min at 1500 rpm and washed twice with PBS. The residual volume was shaken, and cell samples were labeled incubating with PI/RNase Staining Buffer (BD Pharmingen) for 30 min at RT in the dark. Cell cycle assay was performed by FACS Calibur (Becton Dickinson) and around 10000 events for each sample were collected. Data were analyzed by Flow-jo I.6.5 software.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIndirect Immunofluorescence\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eControl and MEMP-treated cells were washed in PBS, fixed with 4% paraformaldehyde for 10 min at RT in the dark, and permeabilized in 0,1% Triton\u003csup\u003eTM\u0026nbsp;\u003c/sup\u003eX-100 and PBS 1X. Cells were blocked with blocking and binding buffer (0,1% Triton\u003csup\u003eTM\u0026nbsp;\u003c/sup\u003eX-100, 1% jelly, in PBS 1X) for 1 hour. Cells were then stained for indirect immunofluorescence (IF) with the primary antibodies anti-human Nestin (Millipore; 1:400) diluted in binding buffer for 1h, and then by phalloidin-Alexa 555 (Thermofisher; 1:500) diluted in binding buffer without jelly for 1 h at RT. Cells were washed twice with PBS and incubated with the fluorescent-conjugated secondary antibodies anti-mouse/Alexa Fluor 488 (Thermofisher; 1: 500) diluted in binding buffer for 30 min at RT. \u0026nbsp;Cells were finally washed twice, incubated with DAPI for 10 min, and mounted in Mowiol\u003csup\u003e\u0026reg;\u0026nbsp;\u003c/sup\u003emedium (Sigma-Aldrich). Images were taken by using confocal microscopy LSM800 coupled to an inverted Axio observer (Zeiss) with a 60x oil immersion objective lens and imported into Image J software for analysis. \u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eXenograft cancer model\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll animal care procedures used in this study were carried out in accordance with ARRIVE https://arriveguidelines.org/ guidelines. All animal procedures were performed in strict accordance with the European Commission legislation for the protection of animal used purposes (2010/63/EU). The protocol for the treatment of the animals was approved by the Comit\u0026eacute; de \u0026Eacute;tica de la Direcci\u0026oacute;n General del Medio Ambiente de la Comunidad de Madrid, Spain (PROEX 217.4/23) and was supervised by the Ethics Committee of CBM (Madrid, Spain). Mice were purchased from Janvier Labs, Le Genest-Saint-Isle, France. Mice were housed under a 12-h light/dark cycle in a specific pathogen-free facility with controlled temperature and humidity (20\u0026ndash;24 \u0026deg;C, 45\u0026ndash;65 % humidity) and allowed access to food and water ad libitum. 9 four-week-old female immunodeficient NMRI-Foxn1\u003csup\u003enu/un\u0026nbsp;\u003c/sup\u003eEight four-week-old female immunocompetent C57BL/6 mice (initial weight 19\u0026ndash;21 g), were injected subcutaneously in the right flank 0.5X10\u003csup\u003e6\u003c/sup\u003e colon mouse adenocarcinoma cells (MC-38-Luc). \u003cem\u003eIn vivo\u003c/em\u003e tumor cell bioluminescence was monitored and quantified using the IVIS Spectrum System (PerkinElmer) after IP injection of D-Luciferin (150 mg/kg). Body weight and general physical status were recorded daily, and the mice were sacrificed by carbon dioxide (CO\u003csub\u003e2\u003c/sub\u003e) inhalation at the end of every experiment or when reaching endpoint criteria.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTumor forming capacity of MEMP-treated cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMC-38-Luc cancer cells were seeded in 12-multiwell plates and modulated respectively for 1.5 and 2 min, based on previous viability experiments described above. It is important to note that the MEMP treatments were set at short times to avoid cell lyse, in order to be able to collect and inoculate them into mice to test their resulting tumor forming capacity. After MEMP treatment, the collected cells were centrifuged and resuspended in OptiMEM (Gibco) medium and counted to generate cell suspensions of 0.5x10\u003csup\u003e7\u0026nbsp;\u003c/sup\u003eMC-38-Luc cells/ml. The C57BL/6 mice were injected with 100\u0026nbsp;ml of the cell suspension corresponding to control non-modulated cells (2 mice), cells modulated for 1.5 min (3 mice), and cells modulated for 2 min (3 mice). After injection, mice were evaluated within the same day by IVIS Spectrum Imaging system (PerkinElmer) for luciferase bioluminescence. IVIS evaluation was repeated weekly to determine tumor growth generated by controls and modulated cells. IVIS data were analyzed with Living Image 4.8.0 (PerkinElmer) evaluating total radiance (photons/sec) of the tumors.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eThe MEMP treatment inhibits viability of malignant cancer cells whereas low tumorigenic cells are not affected.\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo study whether the MEMP could impact mammalian cell physiology, we selected a collection of stablished cell lines with well reported origin and tumorigenicity, as well as primary porcine macrophages (see Table I), and compare their viability and growth features in response to a MEMP treatment applied at several times.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cu\u003eTable I. Description of MEMP-treated cells\u003c/u\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"100%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"14.141414141414142%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eNAME\u003c/u\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cu\u003e\u003csup\u003ea\u003c/sup\u003e\u003c/u\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"35.35353535353536%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eORIGIN\u003c/u\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cu\u003e\u003csup\u003eb\u003c/sup\u003e\u003c/u\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"33.333333333333336%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eMALIGNANCY\u003c/u\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cu\u003e\u003csup\u003ec\u003c/sup\u003e\u003c/u\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.171717171717173%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cu\u003eREFERENCES\u003c/u\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cu\u003e\u003csup\u003ed\u003c/sup\u003e\u003c/u\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"14.141414141414142%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eMC-38\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"35.35353535353536%\" valign=\"top\"\u003e\n \u003cp\u003eMurine colon adenocarcinoma derived from primary induced tumors in different inbred strains of mice\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"33.333333333333336%\" valign=\"top\"\u003e\n \u003cp\u003eHigh in nude and immunocompetent C57BL/6 mice\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.171717171717173%\" valign=\"top\"\u003e\n \u003cp\u003e\u003csup\u003e11-13\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"14.141414141414142%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eU373 MG\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"35.35353535353536%\" valign=\"top\"\u003e\n \u003cp\u003eA human glioblastoma astrocytoma derived from a malignant tumour\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"33.333333333333336%\" valign=\"top\"\u003e\n \u003cp\u003eHigh as measured in subcutaneously transplanted nude mice\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.171717171717173%\" valign=\"top\"\u003e\n \u003cp\u003e\u003csup\u003e14,15\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"14.141414141414142%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eHeLa\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"35.35353535353536%\" valign=\"top\"\u003e\n \u003cp\u003eHuman cervical carcinoma transformed by Papillomavirus HPV18\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"33.333333333333336%\" valign=\"top\"\u003e\n \u003cp\u003eHigh as measured by tumor formation after subcutaneous transplantation in nude and other immunodeficient mouse strains.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.171717171717173%\" valign=\"top\"\u003e\n \u003cp\u003e\u003csup\u003e16-18\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"14.141414141414142%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eHaCat\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"35.35353535353536%\" valign=\"top\"\u003e\n \u003cp\u003eHuman skin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"33.333333333333336%\" valign=\"top\"\u003e\n \u003cp\u003eHigh when injected subcutaneously into thymus aplastic nude mice (Swiss/c nu/nu)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.171717171717173%\" valign=\"top\"\u003e\n \u003cp\u003e\u003csup\u003e19-21\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"14.141414141414142%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eCV-1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"35.35353535353536%\" valign=\"top\"\u003e\n \u003cp\u003eKidney fibroblasts of a male adult African green monkey\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"33.333333333333336%\" valign=\"top\"\u003e\n \u003cp\u003eLow but significant upon high passages number as tested in anti-thymocyte globulin (ATG) treated newborn Wistar rat\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.171717171717173%\" valign=\"top\"\u003e\n \u003cp\u003e\u003csup\u003e22,23\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"14.141414141414142%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eCOS-1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"35.35353535353536%\" valign=\"top\"\u003e\n \u003cp\u003eCV-1 simian cells transformed with the early region of the polyomavirus SV40 genome\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"33.333333333333336%\" valign=\"top\"\u003e\n \u003cp\u003eUnpublished\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.171717171717173%\" valign=\"top\"\u003e\n \u003cp\u003e\u003csup\u003e24\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"14.141414141414142%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eA9ouab\u003csup\u003er\u003c/sup\u003e11\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"35.35353535353536%\" valign=\"top\"\u003e\n \u003cp\u003eMouse fibroblasts\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"33.333333333333336%\" valign=\"top\"\u003e\n \u003cp\u003eLow and restricted to some clones. Measured in y-irradiated syngeneic newborn and nude mice.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.171717171717173%\" valign=\"top\"\u003e\n \u003cp\u003e\u003csup\u003e25-27\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"14.141414141414142%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e/PAM\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"35.35353535353536%\" valign=\"top\"\u003e\n \u003cp\u003ePorcine alveolar macrophages isolated from the lungs\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"33.333333333333336%\" valign=\"top\"\u003e\n \u003cp\u003eNull\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.171717171717173%\" valign=\"top\"\u003e\n \u003cp\u003e\u003csup\u003e10\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e----------------------------------------------------------------------------------------------------------------------------\u003cstrong\u003ea,\u003c/strong\u003e Common name. \u003cstrong\u003eb\u003c/strong\u003e, origin and major features.\u003cstrong\u003e\u0026nbsp;c\u003c/strong\u003e, capacity to generate tumors in the outlined experimental animals. \u003cstrong\u003ed\u003c/strong\u003e, primary description and malignancy-related references.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;Firstly, the U373 MG, HeLa and MC-38-Luc highly malignant cell lines were modulated for 2.5, and 5 min in PBS, and cell viability after treatment was primarily evaluated by mitochondrial activity using the MTT colorimetric assay, a marker of cellular metabolic activity \u003csup\u003e28\u003c/sup\u003e, as described in Materials and Methods. The analysis shows a progressive effect of the treatment at 2,5 min of the modulation time, and moreover no cell viability could be detected when either U373, HeLa or MC-38-Luc cells were modulated for 5 min (Fig. 1A). In particular, MC-38-Luc seemed to be more sensitive to the treatments as compared to U373 and Hela cells, since no viable cells were detected after 2,5 minutes of treatment.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; To further explore the susceptibility of mammalian cells to the MEMP treatment, low-tumorigenicity cells were also evaluated. For this, HaCaT, CV-1, COS-1, A9 cell lines, and importantly PAM primary macrophages, were subjected under identical seeding conditions in M12 dishes to the MEMP treatment at different time points. Figure 1B shows that the viability of these poorly tumorigenic cells was significantly non-affected by the modulation. Overall, the obtained data indicated a very low sensitivity of the non and poorly tumorigenic cells to MEMP, whereas all the malignant cells analyzed were importantly affected by the treatment.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eThe MEMP treatment inhibited the clonogenic capacity of malignant cancer cells but not that of poorly tumorigenic cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe efficacy of MEMP treatment was tested by colony formation assay, that is useful to determine tumor cell lines ability to form colonies after any kind of treatment. U373 MG, HeLa and MC-38-Luc cancer cells were modulated for 2.5 and 5 minutes and their colony-forming ability was evaluated after two weeks (Figure 2A-C). The obtained data supported the previous MTT result, with a progressive, modulation time-dependent, inhibition of colony forming capacity. Thus, similarly to the viability assay, the HeLa cells seem to be a bit more susceptible than U373 cells, with no colony formation after 5 min of modulation, although at 2.5 min a slightly larger percentage of colonies was observed. The susceptibility of MC-38-Luc colony forming ability to MEMP (Fig. 2A-C) confirmed this adenocarcinoma cell line as the most sensitive to the treatment, as a very low percentage of colonies formed when modulated for 2,5 minutes and no colonies were detected at 5 minutes of treatment.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; To assess the colony forming behavior of poorly tumorigenic cell lines to the MEMP treatment, the HaCaT, COS-1, CV-1 and A9 cell lines were tested. Cells were modulated for 2.5 and 5 min and their colony-forming ability was scored 15 days afterwards. The analysis showed that all tested cell lines of low tumorigenicity were able to form colonies with no significant differences between non-modulated controls and 5 min modulated cells (Figure 2B, C). Figure 2C illustrates representative results on colony forming capacity of the tested cell lines illustrating their distinct resistance to modulation. In summary, this test confirmed the preferable anti-proliferative effect of the MEMP treatment on malignant cells and therefore its therapeutic potential to be used in cancer treatment.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCytometric evaluation of MEMP modulation effect on cell viability\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eU373 and HeLa cells were evaluated by cytometry using the Ghost Dye 780, a marker of cell membrane functioning (see Materials and Methods), to investigate cell viability after the MEMP modulation procedure. Cells were tested at T0 (CTR), T2.5 and T5 (minutes of modulation). As figure 3 shows, the cytometric assay confirmed the progressive effect of the modulation on cell viability during the times of treatment on HeLa, MC-38-Luc, and U373 cells. The percentage of dead cells was higher on Hela and MC-38-Luc than in U373 cells, denoting some difference in their susceptibility to the modulation. In particular, the MEMP effect was especially high on MC-38-Luc cells as upon the T2.5 treatment did not show viable cells.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; Subsequently, the effect of the treatment on several poorly tumorigenic cell lines was studied to gain a comparative view on susceptibility versus tumorigenicity. To address this, the percentage of death and live cells was evaluated on the poorly tumorigenic HaCaT, COS-1, CV-1, A9 cell lines, as well as in PAM. This cytometric analysis showed that modulation did not significantly affect these cells (Figure 3B). These results were in consistency with the MTT and colony formation assay data described above. and confirmed the resistance of the poorly tumorigenic cells to the MEMP treatment, as compared to the malignant cell lines tested.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMEMP modulation induces cell cycle deregulation in human and mouse cancer cell lines\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn order to investigate the molecular effect of MEMP treatment on malignant and non-malignant cell lines, the cell cycle pattern was analyzed by flow cytometry. In particular, U373 and MC-38-Luc cancer cell lines were analyzed and compared with A9, HaCaT, CV-1 and COS-1 low tumorigenic cell lines. FACS analysis showed a progressive deregulation of cell cycle in all the malignant cells tested, with an increase of G2-phase proportional to the time of modulation (Fig. 4). In particular, in U373 cells (Fig. 4 A and B) we found an important increase of G2-phase arrested cells after 2,5 and 5 min of MEMP treatment, with a progressive decrease of G1-phase. In addition, at T5, a further increase of sub-G1 phase was observed, suggesting apoptotic events in these conditions. Regarding mouse colon adenocarcinoma MC-38-Luc cells, due to their high sensitivity to MEMP, we were able to analyze only cells modulated for 2,5 min, since after that time no intact cells could be collected. Thus, as it is shown in the panels of Figure 4 A and B, the modulation treatment produced a sharp cell cycle deregulation with a marked increase of G2-phase (25,76 %) compared with T0 (no treatment), and a decrease of S-phase (45,4 %). In addition, we observed an increase of sub-G1 phase, suggesting that cells are dying by apoptosis. \u0026nbsp;In parallel, the low tumorigenic A9, HaCaT, CV-1 and COS-1 cells were also analyzed by FACS after 2,5 and 5 min of MEMP treatment. The analysis showed no significant changes, as compared to the non-modulated controls, in the cell cycle phases of all these poorly tumorigenic cell lines at any time of treatment (Figure 4C). These results indicated that under the tested MEMP modulation conditions the physiological control of cell cycle progression of the low tumorigenic cells was not affected.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eThe MEMP treatment induces immediate cytoskeleton collapse of human glioblastoma cells\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAttempting to identify a major cellular component that could be target of the MEMP, we focused in the cytoskeleton, as this large and highly organized macromolecular entity is stabilized by polar charges and previous reports suggested affectation by electric pulses \u003csup\u003e29-31\u003c/sup\u003e. In our study, a possible direct and immediate effect of MEMP on cell shape and cytoskeleton was examined by confocal microscopy. To this aim, mouse A9 fibroblasts and human U373 glioblastoma cells were submitted to MEMP for a 2 min time treatment and immediately fixed in paraformaldehyde. Confocal IF analysis showed the Actin as well as the Nestin intermediate filaments cytoskeletons immediately collapsed around the nucleus in all the treated human U373 cells. In contrast, the Actin cytoskeleton remained under a normal expanded configuration in about half of the MEMP-treated A9 cells (Figure 5A), which may correspond to the two viable subpopulations resolved by cytometry above (Figure 3C, lower right panel). Importantly, the nuclear envelope was not significantly impaired by MEMP neither in U373 nor in A9 cells as judged by the confined DAPI staining of chromatin (Figure 5A, zoom panels). A quantitative measurement of the cytoskeletal effect of the MEMP is shown in Figure 5B. Of note, the precise time conditions of the MEMP used compromised the colony forming ability in a cell type dependent manner (Figure 5C) as described above, suggesting that the population of A9 fibroblasts with collapsed Actin cytoskeleton recovered nevertheless their proliferative capacity upon culturing to form colonies of normal sizes. The drastic and rapid cytoskeleton collapse in malignant cells may account for their viability decay described above, and suggests that these highly organized macromolecular structures may be a primary target of the MEMP.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMEMP treatment inhibits \u003cem\u003ein vivo\u0026nbsp;\u003c/em\u003etumorigenicity of mouse colon cancer cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo test the effect of MEMP on the tumorigenic capacity of cancer cells, Mc-38-Luc tumor cells growing in monolayers were modulated for 1.5 or 2 min in PBS, collected and subsequently subcutaneously injected into immunocompetent C57BL/6 mice in parallel with control non-modulated cells. In order to respect animal welfare, a limited number of mice was used for this experiment. Tumor progression in all mice was monitored by bioluminescence \u003cem\u003ein vivo\u003c/em\u003e imaging. \u0026nbsp;Importantly, as shown in Figure 6A, B, all mice (two controls and three per each modulation time) showed the first day of xenografting high luciferase activity at the site of injection, denoting significant metabolic activity of the 1.5 and 2 min modulated cells. As the experiment proceeded, untreated cells formed tumors that show the expected high growth rate characteristic of this \u003cem\u003ein vivo\u003c/em\u003e tumor model. In contrast, mice inoculated with cells treated for 1.5 min, had no measurable tumors until day 9, followed by a restricted growth that only overcame the initial light emission by day 19 post-injection. Moreover, mice injected with cells treated for 2 min did not show measurable tumor growth until day 19 post-injection, indicating that the tumor forming capacity of most cells was impaired by the MEMP treatment. Eventually, control mice reached endpoint criteria for tumor size and skin ulcers by day 19 post-injection, however mice of the T1.5 and T2 groups did not reach endpoint criteria and therefore survived until the end of the experiment (Figure 6C). This experiment demonstrated the capacity of MEMP regimes to abruptly suppress the in vivo tumorigenicity of colon adenocarcinoma cells.\u0026nbsp;\u003c/p\u003e\n"},{"header":"Discussion","content":"\u003cp\u003eSeveral studies that refer to different electromagnetic fields used to cause effects on cancer cells and tumors \u003csup\u003e2,4,5,32-34\u003c/sup\u003e, as a decrease in cell proliferation \u003csup\u003e6\u003c/sup\u003e and tumor remission in some cases \u003csup\u003e7\u003c/sup\u003e, have been reported. However, current research in this field does not clearly detail the exact mechanisms by which electromagnetic fields interact and impair cancer cell physiology. Other studies have referred to the different electrical characteristics of cancer cells, considering the electronegativity of some of their structures \u003csup\u003e9,35\u003c/sup\u003e,\u0026nbsp;but to date no scientific evidence support the molecular mechanisms that differentiate the electronegativity of a cancer cell from a normal cell. In spite of these uncertainties, this field is currently being widely explored for potential therapies.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;For the development of this study, we have considered a relationship of relative electronegativity with well-known characteristics of cancer cells, placing several basic physical science concepts in the context of molecular biology.\u0026nbsp;It is known that in physics, relative electronegativity may be affected by diverse elements such as the effective nuclear charge, the size of the atoms, the electronic configuration, the inductive effects, the resonant effects, or the hybridization \u003csup\u003e36\u003c/sup\u003e. The electronic configuration itself may be altered in a controlled manner with electronic perturbations, what would provoke variations in the relative electronegativity of a biological structure such as a cancer cell. It should also be noted that when a more electronegative organic element is exposed to an electromagnetic field, the chemical bonds are more likely to be polarized, triggering a greater response of that element to the electromagnetic field, which may impair the molecular interactions and functions of the molecules themselves. This phenomenon may explain why a specific electronic perturbation have a significant impact on a more electronegative cancer but not on a non-tumorigenic cell.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;In the context of the aberrant metabolism of cancer cells undergoing the Warburg effect\u0026nbsp;\u003csup\u003e37\u003c/sup\u003e, relative electronegativity is caused by the accumulation of acid metabolites that increase the concentration of ionized hydrogen atoms (H⁺)\u0026nbsp;\u003csup\u003e38\u003c/sup\u003e. Indeed, the biochemical processes that may impact the electronegativity of cancer cells are multiple and complex. Best known examples may be summarized as follows: (I) Abnormal expression of proteins and biomarkers, as the kinesin family members in breast cancer that \u0026nbsp; influence cellular electronegativity through changes in microtubule dynamics and ionic charge distribution \u003csup\u003e39,40\u003c/sup\u003e, the \u0026nbsp;PYCR2 and ADH1A in hepatitis B virus-related hepatocellular carcinoma altering cellular electronegativity \u003csup\u003e41\u003c/sup\u003e, and the NNMT in the tumor stroma regulating histone methylation and other transcriptional changes that are critical for phenotyping of cancer-associated fibroblasts (CAF), which can influence cellular cargo \u003csup\u003e42\u003c/sup\u003e; (II) Metabolic reprogramming including changes in glucose and other nutrient metabolism, as the regulation of serine metabolism and glycolysis through mTOR signaling indirectly affecting the electrical charge in pancreatic cancer; (III) Increased oxidative stress due to excessive production of reactive oxygen species (ROS), which influence the functionality and survival of the cancer cell \u003csup\u003e43,44\u003c/sup\u003e; (IV) Mechanisms related to cell signaling and the release of inflammatory mediators, which may have domains with different charges and electrical properties or can modify the activity of certain ion pumps and channels in the cell membrane \u003csup\u003e45,46\u003c/sup\u003e; (V) Changes in the composition of phospholipids and cholesterol of the cytoplasmic membrane in response to inflammation and cancerous transformation may modify its electrical properties and consequently also the electronegativity of the cell \u003csup\u003e47,48\u003c/sup\u003e; and (VI) Functional integrity of the mitochondrial and of endoplasmic reticulum membranes, as alterations may impact \u0026nbsp; protein synthesis and folding or lead to programmed cell death \u003csup\u003e49,50\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;In this work, we have exposed a collection of mammalian cells with different origin and tumorigenic capacity (see Table I) to MEMP applied at various time points. Tumorigenicity is tightly related to the metabolic activity in a wide sense, including signaling activity, membrane transport and the many other processes that as mentioned above are related to the electronegativity of the cancer cells \u003csup\u003e12,51\u003c/sup\u003e.\u0026nbsp;It is therefore remarkable that our experimental data show a fair correlation between the degree of tumorigenicity and the sensitiveness of the tested cells to the MEMP (Figure 1-4). A possible exception to this correlation was the COS-1 cell line, obtained by SV40 transformation of the CV-1 cells (see Table I) and expressing the tumorigenic T antigen that binds and perturbs the p53 and pRb and others cell major regulators \u003csup\u003e11\u003c/sup\u003e, which was not susceptible to the MEMP treatments (Figure 1-4). Whether this result represent an inconsistency with the overall found correlation between tumorigenicity and MEMP effects is unclear, since COS-1 tumorigenicity in mice remains to be described. Interestingly, our results may suggest that major tumor suppressors (p53 and pRB) and connected transformation processes may not drastically alter the cell metabolic pathways leading to electronegativity, a hypothesis deserving further investigation.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Importantly, our study uncovered a series of molecular mechanisms impacted by the MEMP regimes that may account for the compromised vital functions of the malignant cells. For example, a major finding was the capacity of MEMP\u0026nbsp;to induce cell cycle deregulation in several highly tumorigenic cell lines,\u0026nbsp;with a significant increase of the G2-phase. In particular, in the U373 human glioblastoma cells, the MEMP treatment was able to cause a G2-phase block, with a clear arrest of cells at the S-phase and an increase of sub-G1 phase, suggesting apoptotic events. MC-38-Luc colon cancer cells shows also a cell cycle deregulation with an increase of sub-G1 phase (see Figure 4), suggesting that these cells are dying by apoptosis as well. \u0026nbsp;Another important molecular target of the MEMP was the cytoskeleton. We found that this treatment induces an immediate collapse of the actin and nestin cytoskeletons in U373 glioblastoma, which occurs within a 2 min time period post-treatment, while in A9 mouse fibroblasts the cytoskeleton spread configuration remained much less affected (Figure 5). This cytoskeleton collapse may in great extend account for the viability decay and cell cycle deregulation observed in the modulated malignant cells (Figure 1-4). The drastic and rapid cytoskeleton collapse induced by MEMP suggests that these highly organized macromolecular structures may be the primary target of the electromagnetic fields, which collapse would transmit apoptotic and death signaling towards cytosolic mediators. Cytoskeleton collapse may be triggered by altering the polar configuration of the filaments required for their structural integrity. Further research will be required to identify the ionic, factors composition, and configuration features, that may account for the drastic differences between the A9 and U373 cytoskeleton behavior in response to MEMP. In the perspective of the time at which each molecular process was MEMP-affected and detected in malignant cells, we show that cytoskeleton collapse occurs within minutes, cell permeability and cell cycle perturbation in 20-24 h, proliferative clonogenic capacity in two weeks days, and tumorigenicity \u003cem\u003ein vivo\u003c/em\u003e in three weeks. Our study illustrates the effective cascade of perturbations that may be caused on the physiology of malignant cells through time limited MEMP regimes. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Finally, this study also shows the capacity of the MEMP to drastically suppress the tumorigenicity of malignant colon adenocarcinoma cells when treated for 2 min prior xenograft transplantation in immunocompetent mice (Figure 6). Although the treatment was performed in vitro prior xenografting, the prospective value of the assay relies on the capacity of the treated cells to maintain metabolic activity upon injection, as determined by luciferase expression. However, the treated cells absolutely lost their malignancy as tumor growth was halted and metabolic activity disappeared two weeks post-injection. This assay show promises for the treatment of pre-established tumors with the non-invasive MEMP technology, either alone or in combination with other clinically used anti-cancer therapies.\u0026nbsp;\u003c/p\u003e\n"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe are grateful to Mr David P\u0026eacute;rez P\u0026eacute;rez for his support, to Mr Fidel Vald\u0026eacute;s Rodr\u0026iacute;guez, CEO of Paso Alto Advanced Treatment Center and Mr. F. Rafael L\u0026oacute;pez Ferraz, President and CFO of Paso Alto Biotechnology Inc. and Paso Alto Biophysics \u0026amp; Biomedical Engineering for their collaboration and contribution. To Dr. Carlos G\u0026oacute;mez Becerra, in memoriam. To Dr. Daniel P\u0026eacute;rez-N\u0026uacute;\u0026ntilde;ez for critical reading of the manuscript. We also thank the CBMSO-CSIC-UAM animal facility and the Severo Ochoa Foundation (CBMSO).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eR.P. and L.G.R.M.\u0026nbsp;equally contributed to this work. The conception and design of the work, and manuscript writing, was performed by L.G.R., J.M.A. and Y.R. R.P. conducted most experiments and prepared all the figures, assisted by J.M.O. K.S. supervised and supported the mice experiments. All authors reviewed the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analysed during this study are included in this published article.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis project has been funded by PASO ALTO ADVANCED TREATMENT CENTER LLC, USA and PASO ALTO BIOPHYSIC SL, Spain, and by the grant PID2022-141799OB-I00 /AEI (Ministerio de Ciencia e Innovaci\u0026oacute;n) to J.M.A. The Centro de Biolog\u0026iacute;a Molecular Severo Ochoa (CSIC-UAM) is in part supported by institutional grants from the Fundaci\u0026oacute;n Ram\u0026oacute;n Areces and Banco Santander.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests. The US company PASO ALTO BIOTECHNOLOGY INC has developed a new non-ionizing radiation technology that enables the sustained delivery of intense, time-controlled, multi-frequency electromagnetic pulses (MEMP). The technology is under industrial secrecy.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAdditional information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCorrespondence and requests for materials should be addressed to Y.R. or to J.M.A.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBerg, H.\u003cem\u003e et al.\u003c/em\u003e Bioelectromagnetic field effects on cancer cells and mice tumors. \u003cem\u003eElectromagn Biol Med\u003c/em\u003e \u003cstrong\u003e29\u003c/strong\u003e, 132-143, doi:10.3109/15368371003776725 (2010).\u003c/li\u003e\n\u003cli\u003eWilliams, C. D., Markov, M. S., Hardman, W. E. \u0026amp; Cameron, I. L. Therapeutic electromagnetic field effects on angiogenesis and tumor growth. \u003cem\u003eAnticancer Res\u003c/em\u003e \u003cstrong\u003e21\u003c/strong\u003e, 3887-3891 (2001).\u003c/li\u003e\n\u003cli\u003eYamaguchi, S., Ogiue-Ikeda, M., Sekino, M. \u0026amp; Ueno, S. Effects of pulsed magnetic stimulation on tumor development and immune functions in mice. \u003cem\u003eBioelectromagnetics\u003c/em\u003e \u003cstrong\u003e27\u003c/strong\u003e, 64-72, doi:10.1002/bem.20177 (2006).\u003c/li\u003e\n\u003cli\u003eKoh, E. K.\u003cem\u003e et al.\u003c/em\u003e A 60-Hz sinusoidal magnetic field induces apoptosis of prostate cancer cells through reactive oxygen species. \u003cem\u003eInt J Radiat Biol\u003c/em\u003e \u003cstrong\u003e84\u003c/strong\u003e, 945-955, doi:10.1080/09553000802460206 (2008).\u003c/li\u003e\n\u003cli\u003eLi, J., Ma, Y., Li, N., Cao, Y. \u0026amp; Zhu, Y. Natural static magnetic field-induced apoptosis in liver cancer cell. \u003cem\u003eElectromagn Biol Med\u003c/em\u003e \u003cstrong\u003e33\u003c/strong\u003e, 47-50, doi:10.3109/15368378.2013.783850 (2014).\u003c/li\u003e\n\u003cli\u003eWang, M. H.\u003cem\u003e et al.\u003c/em\u003e Effect of extremely low frequency electromagnetic field parameters on the proliferation of human breast cancer. \u003cem\u003eElectromagn Biol Med\u003c/em\u003e \u003cstrong\u003e40\u003c/strong\u003e, 384-392, doi:10.1080/15368378.2021.1891093 (2021).\u003c/li\u003e\n\u003cli\u003eZhang, X., Liu, X., Pan, L. \u0026amp; Lee, I. Magnetic fields at extremely low-frequency (50 Hz, 0.8 mT) can induce the uptake of intracellular calcium levels in osteoblasts. \u003cem\u003eBiochem Biophys Res Commun\u003c/em\u003e \u003cstrong\u003e396\u003c/strong\u003e, 662-666, doi:10.1016/j.bbrc.2010.04.154 (2010).\u003c/li\u003e\n\u003cli\u003eSun, J.\u003cem\u003e et al.\u003c/em\u003e Effects of extremely low frequency electromagnetic fields on the tumor cell inhibition and the possible mechanism. \u003cem\u003eSci Rep\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 6989, doi:10.1038/s41598-023-34144-5 (2023).\u003c/li\u003e\n\u003cli\u003eDi Gregorio, E.\u003cem\u003e et al.\u003c/em\u003e The distinguishing electrical properties of cancer cells. \u003cem\u003ePhys Life Rev\u003c/em\u003e \u003cstrong\u003e43\u003c/strong\u003e, 139-188, doi:10.1016/j.plrev.2022.09.003 (2022).\u003c/li\u003e\n\u003cli\u003eCarrascosa, A. L., Santaren, J. F. \u0026amp; Vinuela, E. Production and titration of African swine fever virus in porcine alveolar macrophages. \u003cem\u003eJ Virol Methods\u003c/em\u003e \u003cstrong\u003e3\u003c/strong\u003e, 303-310, doi:10.1016/0166-0934(82)90034-9 (1982).\u003c/li\u003e\n\u003cli\u003eBrough, D., Amos, H., Turley, K. \u0026amp; Murkin, J. Trends in Subcutaneous Tumour Height and Impact on Measurement Accuracy. \u003cem\u003eCancer Inform\u003c/em\u003e \u003cstrong\u003e22\u003c/strong\u003e, 11769351231165181, doi:10.1177/11769351231165181 (2023).\u003c/li\u003e\n\u003cli\u003eCorbett, T. H., Griswold, D. P., Jr., Roberts, B. J., Peckham, J. C. \u0026amp; Schabel, F. M., Jr. Tumor induction relationships in development of transplantable cancers of the colon in mice for chemotherapy assays, with a note on carcinogen structure. \u003cem\u003eCancer Res\u003c/em\u003e \u003cstrong\u003e35\u003c/strong\u003e, 2434-2439 (1975).\u003c/li\u003e\n\u003cli\u003eTan, M. H., Holyoke, E. D. \u0026amp; Goldrosen, M. H. Murine colon adenocarcinomas: methods for selective culture in vitro. \u003cem\u003eJ Natl Cancer Inst\u003c/em\u003e \u003cstrong\u003e56\u003c/strong\u003e, 871-873, doi:10.1093/jnci/56.4.871 (1976).\u003c/li\u003e\n\u003cli\u003eLammering, G.\u003cem\u003e et al.\u003c/em\u003e Inhibition of the type III epidermal growth factor receptor variant mutant receptor by dominant-negative EGFR-CD533 enhances malignant glioma cell radiosensitivity. \u003cem\u003eClin Cancer Res\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, 6732-6743, doi:10.1158/1078-0432.CCR-04-0393 (2004).\u003c/li\u003e\n\u003cli\u003ePalma, C.\u003cem\u003e et al.\u003c/em\u003e Anti-tumour activity of tachykinin NK1 receptor antagonists on human glioma U373 MG xenograft. \u003cem\u003eBr J Cancer\u003c/em\u003e \u003cstrong\u003e82\u003c/strong\u003e, 480-487, doi:10.1054/bjoc.1999.0946 (2000).\u003c/li\u003e\n\u003cli\u003eGey GO, C. W., Kubicek MT. Tissue culture studies of the proliferative capacity of cervical carcinoma and normal epithelium. . \u003cem\u003eancer Res.\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 264-265 (1952).\u003c/li\u003e\n\u003cli\u003eKusakawa, S.\u003cem\u003e et al.\u003c/em\u003e Characterization of in vivo tumorigenicity tests using severe immunodeficient NOD/Shi-scid IL2Rgamma(null) mice for detection of tumorigenic cellular impurities in human cell-processed therapeutic products. \u003cem\u003eRegen Ther\u003c/em\u003e \u003cstrong\u003e1\u003c/strong\u003e, 30-37, doi:10.1016/j.reth.2014.12.001 (2015).\u003c/li\u003e\n\u003cli\u003eSchwarz, E.\u003cem\u003e et al.\u003c/em\u003e Structure and transcription of human papillomavirus sequences in cervical carcinoma cells. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e314\u003c/strong\u003e, 111-114, doi:10.1038/314111a0 (1985).\u003c/li\u003e\n\u003cli\u003eBoukamp, P.\u003cem\u003e et al.\u003c/em\u003e Normal keratinization in a spontaneously immortalized aneuploid human keratinocyte cell line. \u003cem\u003eJ Cell Biol\u003c/em\u003e \u003cstrong\u003e106\u003c/strong\u003e, 761-771, doi:10.1083/jcb.106.3.761 (1988).\u003c/li\u003e\n\u003cli\u003eBoukamp, P.\u003cem\u003e et al.\u003c/em\u003e Sustained nontumorigenic phenotype correlates with a largely stable chromosome content during long-term culture of the human keratinocyte line HaCaT. \u003cem\u003eGenes Chromosomes Cancer\u003c/em\u003e \u003cstrong\u003e19\u003c/strong\u003e, 201-214, doi:10.1002/(sici)1098-2264(199708)19:4\u0026lt;201::aid-gcc1\u0026gt;3.0.co;2-0 (1997).\u003c/li\u003e\n\u003cli\u003eMueller, M. M.\u003cem\u003e et al.\u003c/em\u003e Tumor progression of skin carcinoma cells in vivo promoted by clonal selection, mutagenesis, and autocrine growth regulation by granulocyte colony-stimulating factor and granulocyte-macrophage colony-stimulating factor. \u003cem\u003eAm J Pathol\u003c/em\u003e \u003cstrong\u003e159\u003c/strong\u003e, 1567-1579, doi:10.1016/S0002-9440(10)62541-2 (2001).\u003c/li\u003e\n\u003cli\u003eFuresz, J., Fanok, A., Contreras, G. \u0026amp; Becker, B. Tumorigenicity testing of various cell substrates for production of biologicals. \u003cem\u003eDev Biol Stand\u003c/em\u003e \u003cstrong\u003e70\u003c/strong\u003e, 233-243 (1989).\u003c/li\u003e\n\u003cli\u003eJensen, F. C., Girardi, A. J., Gilden, R. V. \u0026amp; Koprowski, H. Infection of Human and Simian Tissue Cultures with Rous Sarcoma Virus. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e \u003cstrong\u003e52\u003c/strong\u003e, 53-59, doi:10.1073/pnas.52.1.53 (1964).\u003c/li\u003e\n\u003cli\u003eGluzman, Y. SV40-transformed simian cells support the replication of early SV40 mutants. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, 175-182, doi:10.1016/0092-8674(81)90282-8 (1981).\u003c/li\u003e\n\u003cli\u003eClements, E. F., M; Klein, G. In vitro derived mouse A9 cell clones differing in malignancy:Analysis by somatic cell hybridization with YACIR lymphoma cell clones. \u003cem\u003eProc. Natl. Acad. Sci. USA \u003c/em\u003e\u003cstrong\u003e6\u003c/strong\u003e, 2004-2007 (1976).\u003c/li\u003e\n\u003cli\u003eKlein, G., Bregula, U., Wiener, F. \u0026amp; Harris, H. The analysis of malignancy by cell fusion. I. Hybrids between tumour cells and L cell derivatives. \u003cem\u003eJ Cell Sci\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, 659-672, doi:10.1242/jcs.8.3.659 (1971).\u003c/li\u003e\n\u003cli\u003eLittlefield, J. W. Three Degrees of Guanylic Acid--Inosinic Acid Pyrophosphorylase Deficiency in Mouse Fibroblasts. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e203\u003c/strong\u003e, 1142-1144, doi:10.1038/2031142a0 (1964).\u003c/li\u003e\n\u003cli\u003eGhasemi, M., Turnbull, T., Sebastian, S. \u0026amp; Kempson, I. The MTT Assay: Utility, Limitations, Pitfalls, and Interpretation in Bulk and Single-Cell Analysis. \u003cem\u003eInt J Mol Sci\u003c/em\u003e \u003cstrong\u003e22\u003c/strong\u003e, doi:10.3390/ijms222312827 (2021).\u003c/li\u003e\n\u003cli\u003eGrasso, R.\u003cem\u003e et al.\u003c/em\u003e Dynamic changes in cytoskeleton proteins of olfactory ensheathing cells induced by radiofrequency electromagnetic fields. \u003cem\u003eJ Exp Biol\u003c/em\u003e \u003cstrong\u003e223\u003c/strong\u003e, doi:10.1242/jeb.217190 (2020).\u003c/li\u003e\n\u003cli\u003eRamalho RR, S. H., Melo LV. Microtubule behavior under strong electromagnetic fields. \u003cem\u003eMaterials Science and Engineering\u003c/em\u003e \u003cstrong\u003e27\u003c/strong\u003e, 1207-1210 (2007).\u003c/li\u003e\n\u003cli\u003eTitushkin, I. \u0026amp; Cho, M. Regulation of cell cytoskeleton and membrane mechanics by electric field: role of linker proteins. \u003cem\u003eBiophys J\u003c/em\u003e \u003cstrong\u003e96\u003c/strong\u003e, 717-728, doi:10.1016/j.bpj.2008.09.035 (2009).\u003c/li\u003e\n\u003cli\u003eBarbault, A.\u003cem\u003e et al.\u003c/em\u003e Amplitude-modulated electromagnetic fields for the treatment of cancer: discovery of tumor-specific frequencies and assessment of a novel therapeutic approach. \u003cem\u003eJ Exp Clin Cancer Res\u003c/em\u003e \u003cstrong\u003e28\u003c/strong\u003e, 51, doi:10.1186/1756-9966-28-51 (2009).\u003c/li\u003e\n\u003cli\u003eRosen, A. D. Mechanism of action of moderate-intensity static magnetic fields on biological systems. \u003cem\u003eCell Biochem Biophys\u003c/em\u003e \u003cstrong\u003e39\u003c/strong\u003e, 163-173, doi:10.1385/CBB:39:2:163 (2003).\u003c/li\u003e\n\u003cli\u003eZimmerman, J. W.\u003cem\u003e et al.\u003c/em\u003e Targeted treatment of cancer with radiofrequency electromagnetic fields amplitude-modulated at tumor-specific frequencies. \u003cem\u003eChin J Cancer\u003c/em\u003e \u003cstrong\u003e32\u003c/strong\u003e, 573-581, doi:10.5732/cjc.013.10177 (2013).\u003c/li\u003e\n\u003cli\u003eLi, C., Jiang, P., Wei, S., Xu, X. \u0026amp; Wang, J. Regulatory T cells in tumor microenvironment: new mechanisms, potential therapeutic strategies and future prospects. \u003cem\u003eMol Cancer\u003c/em\u003e \u003cstrong\u003e19\u003c/strong\u003e, 116, doi:10.1186/s12943-020-01234-1 (2020).\u003c/li\u003e\n\u003cli\u003ePauling, L. \u003cem\u003eThe Nature of the Chemical Bond and the Structure of Molecules and Crystals: An Introduction to Modern Structural Chemistry\u003c/em\u003e. (Cornell University Press, 1960).\u003c/li\u003e\n\u003cli\u003eVander Heiden, M. G., Cantley, L. C. \u0026amp; Thompson, C. B. Understanding the Warburg effect: the metabolic requirements of cell proliferation. \u003cem\u003eScience\u003c/em\u003e \u003cstrong\u003e324\u003c/strong\u003e, 1029-1033, doi:10.1126/science.1160809 (2009).\u003c/li\u003e\n\u003cli\u003eCorbet, C. \u0026amp; Feron, O. Tumour acidosis: from the passenger to the driver\u0026apos;s seat. \u003cem\u003eNat Rev Cancer\u003c/em\u003e \u003cstrong\u003e17\u003c/strong\u003e, 577-593, doi:10.1038/nrc.2017.77 (2017).\u003c/li\u003e\n\u003cli\u003eKhan, R., Pari, B. \u0026amp; Puszynski, K. Comprehensive Bioinformatic Investigation of TP53 Dysregulation in Diverse Cancer Landscapes. \u003cem\u003eGenes (Basel)\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, doi:10.3390/genes15050577 (2024).\u003c/li\u003e\n\u003cli\u003eKotulova, J., Hajduch, M. \u0026amp; Dzubak, P. Current Adenosinergic Therapies: What Do Cancer Cells Stand to Gain and Lose? \u003cem\u003eInt J Mol Sci\u003c/em\u003e \u003cstrong\u003e22\u003c/strong\u003e, doi:10.3390/ijms222212569 (2021).\u003c/li\u003e\n\u003cli\u003eLi, T. F.\u003cem\u003e et al.\u003c/em\u003e Overexpression of kinesin superfamily members as prognostic biomarkers of breast cancer. \u003cem\u003eCancer Cell Int\u003c/em\u003e \u003cstrong\u003e20\u003c/strong\u003e, 123, doi:10.1186/s12935-020-01191-1 (2020).\u003c/li\u003e\n\u003cli\u003eKwon, Y. W.\u003cem\u003e et al.\u003c/em\u003e Application of Proteomics in Cancer: Recent Trends and Approaches for Biomarkers Discovery. \u003cem\u003eFront Med (Lausanne)\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, 747333, doi:10.3389/fmed.2021.747333 (2021).\u003c/li\u003e\n\u003cli\u003eGorrini, C., Harris, I. S. \u0026amp; Mak, T. W. Modulation of oxidative stress as an anticancer strategy. \u003cem\u003eNat Rev Drug Discov\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 931-947, doi:10.1038/nrd4002 (2013).\u003c/li\u003e\n\u003cli\u003eKuo, C. L.\u003cem\u003e et al.\u003c/em\u003e Mitochondrial oxidative stress in the tumor microenvironment and cancer immunoescape: foe or friend? \u003cem\u003eJ Biomed Sci\u003c/em\u003e \u003cstrong\u003e29\u003c/strong\u003e, 74, doi:10.1186/s12929-022-00859-2 (2022).\u003c/li\u003e\n\u003cli\u003eArfin, S.\u003cem\u003e et al.\u003c/em\u003e Oxidative Stress in Cancer Cell Metabolism. \u003cem\u003eAntioxidants (Basel)\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, doi:10.3390/antiox10050642 (2021).\u003c/li\u003e\n\u003cli\u003eGlaviano, A.\u003cem\u003e et al.\u003c/em\u003e PI3K/AKT/mTOR signaling transduction pathway and targeted therapies in cancer. \u003cem\u003eMol Cancer\u003c/em\u003e \u003cstrong\u003e22\u003c/strong\u003e, 138, doi:10.1186/s12943-023-01827-6 (2023).\u003c/li\u003e\n\u003cli\u003eEisenhut, M. Changes in ion transport in inflammatory disease. \u003cem\u003eJ Inflamm (Lond)\u003c/em\u003e \u003cstrong\u003e3\u003c/strong\u003e, 5, doi:10.1186/1476-9255-3-5 (2006).\u003c/li\u003e\n\u003cli\u003ePonnalagu, D. \u0026amp; Singh, H. Insights Into the Role of Mitochondrial Ion Channels in Inflammatory Response. \u003cem\u003eFront Physiol\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 258, doi:10.3389/fphys.2020.00258 (2020).\u003c/li\u003e\n\u003cli\u003eMolendijk, J., Robinson, H., Djuric, Z. \u0026amp; Hill, M. M. Lipid mechanisms in hallmarks of cancer. \u003cem\u003eMol Omics\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, 6-18, doi:10.1039/c9mo00128j (2020).\u003c/li\u003e\n\u003cli\u003eSaito, R. F., Andrade, L. N. S., Bustos, S. O. \u0026amp; Chammas, R. Phosphatidylcholine-Derived Lipid Mediators: The Crosstalk Between Cancer Cells and Immune Cells. \u003cem\u003eFront Immunol\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 768606, doi:10.3389/fimmu.2022.768606 (2022).\u003c/li\u003e\n\u003cli\u003eCassim, S., Raymond, V. A., Lacoste, B., Lapierre, P. \u0026amp; Bilodeau, M. Metabolite profiling identifies a signature of tumorigenicity in hepatocellular carcinoma. \u003cem\u003eOncotarget\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, 26868-26883, doi:10.18632/oncotarget.25525 (2018).\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-4527641/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4527641/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"Physics methods of cancer therapy are extensively used in the clinical practice, but they are invasive and often confront undesired side effects. A fully new equipment that allows sustained emission of intense and time controlled non-ionizing multifrequency electromagnetic pulse (MEMP), has been applied to eukaryotic cells in culture. The equipment discriminates the overall electronegative charge of the cell cultures, and its subsequent proportional emission may thereby become higher and lethal to cancer cells of generally high metabolic activity, whereas low tumorigenic cells would be much less affected. We tested the specificity and efficacy of the equipment against a collection of (i) highly tumorigenic cells of human (glioblastoma, cervical carcinoma, and skin) and mouse (colon adenocarcinoma) origin; (ii) cell lines of much lower tumorigenicity (non-human primate kidney and mouse fibroblasts), and (iii) primary porcine macrophages lacking tumorigenicity. Time and intensity control of the MEMP allowed progressive decay of viability fairly correlating to cell tumorigenicity, which was provoked by a proportional alteration of the cytoplasmic membrane permeability, cell cycle arrest at G2, and general collapse of the actin and intermediate filaments cytoskeleton to the perinuclear region. Correspondingly, these effects drastically inhibited the proliferative capacity of the most tumorigenic cells in clonogenic assays. Moreover, MEMP suppressed in a dose-dependent manner the tumorigenicity of retrovirally transduced luciferase expressing colon adenocarcinoma cells in xenografted immune-competent mice, as determined by tumor growth in a bioluminescence imaging system. Our results support MEMP as an anti-cancer non-invasive physical treatment of substantial specificity for tumorigenic cells with promising therapeutic potential in oncology.","manuscriptTitle":"Assessment of Molecular Modulation by Multifrequency Electromagnetic Pulses to Preferably Eradicate Tumorigenic cells","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-06-26 15:12:06","doi":"10.21203/rs.3.rs-4527641/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-09-03T04:47:33+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-09-02T12:44:25+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"42165253226269423608430532144888540827","date":"2024-08-29T10:51:38+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"315100083071317809230758712828830504557","date":"2024-08-26T14:38:46+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-08-16T07:01:00+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"261152929263852797875596086976756869451","date":"2024-07-25T00:31:45+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-07-15T11:09:41+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-06-11T15:50:55+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2024-06-08T01:38:20+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-06-06T10:11:01+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2024-06-04T11:19:12+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"1454ce46-1f23-4a99-b808-a60232322110","owner":[],"postedDate":"June 26th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-12-09T16:10:37+00:00","versionOfRecord":{"articleIdentity":"rs-4527641","link":"https://doi.org/10.1038/s41598-024-81171-x","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2024-12-03 15:57:41","publishedOnDateReadable":"December 3rd, 2024"},"versionCreatedAt":"2024-06-26 15:12:06","video":"","vorDoi":"10.1038/s41598-024-81171-x","vorDoiUrl":"https://doi.org/10.1038/s41598-024-81171-x","workflowStages":[]},"version":"v1","identity":"rs-4527641","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4527641","identity":"rs-4527641","version":["v1"]},"buildId":"zQwnuV7TCBrMSSSToR1PI","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}