tert-Butylhydroquinone alleviates postharvest endocarp browning of longan fruit by regulating antioxidant metabolism

tert-Butylhydroquinone alleviates postharvest endocarp browning of longan fruit by regulating antioxidant metabolism | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article tert-Butylhydroquinone alleviates postharvest endocarp browning of longan fruit by regulating antioxidant metabolism Zhiqian Yu, Wenjing Kang, Zhengke Zhang, Ziqin Yang, Yueming Jiang, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4476184/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 3 You are reading this latest preprint version Abstract Harvested longan fruit is prone to endocarp browning, which restricts preservation quality and shelf life. The antioxidant system defends against oxidative stress-mediated quality deterioration such as fruit browning. The study aimed to evaluate the effect of tert -Butylhydroquinone (TBHQ) on anti-browning ability of longan fruit in association with antioxidant capacity. The results indicated that application of 0.02% TBHQ significantly suppressed the progression of endocarp browning. In comparison with control, TBHQ treatment decreased the levels of hydrogen peroxide (H 2 O 2 ), superoxide radical (O 2 −⋅ ), and malondialdehyde (MDA), and retained high levels of ascorbic acid (AsA), glutathione (GSH), total phenolics as well as 1,1-diphenyl-2-picrylhydrazyl (DPPH) scavenging rate. Enhanced enzymatic activities of superoxide dismutase (SOD), catalase (CAT), ascorbate peroxidase (APX), glutathione reductase (GR), monodehydroascorbate reductase (MDHAR), dehydroascorbate reductase (DHAR), but inhibited polyphenol oxidase (PPO) and peroxidase (POD) activities were also observed in TBHQ-treated fruit. Gene expression analysis suggested oxidative stress-related genes including DlSOD , DlCAT , DlGR , and DlAPX were up-regulated after TBHQ treatment. The results suggest that TBHQ is effective in alleviating endocarp browning by increasing antioxidant capacity of longan fruit. tert-Butylhydroquinone longan fruit postharvest endocarp browning antioxidant Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Introduction Longan ( Dimocarpus longan Lour.) fruit is nutrient-rich and attracts widespread popularity among consumers owing to its distinctive flavor, succulent texture, and multiple health benefits (Lin et al. 2020 ). However, longan fruit is susceptible to endocarp browning and pulp breakdown after harvest, causing a decline in storage quality and severe limitation in commercial trade (Li et al. 2019 ; Liu et al. 2021 ). Hence, developing new strategies is crucial for improving storage quality and prolonging shelf life of longan fruit. Reactive oxygen species (ROS) are acknowledged as signaling molecules in plant cells and are involved in various physiological processes including ripening, senescence, and stress response to harsh environment (Decros et al. 2019 ). However, excess ROS would induce oxidative damage to protein, DNA, and lipid, which accelerates cellular dysfunction and causes postharvest physiological disorders (Tan et al. 2020 ). Mounting evidence suggests that sustained accumulation of ROS is the main factor that causes postharvest endocarp browning of longan fruit. Excessive amounts of ROS accelerate lipid peroxidation in membranes, resulting in the breakdown of cell structure and the following disruption of enzyme-substrate compartmentalization, which allows the interaction between polyphenol oxidases (PPOs) that located in cytoplasm and their phenolic substrates from vacuoles (Pan et al. 2021 ; Yan et al. 2022 ). The browning reactions are then triggered, PPOs catalyze continuous oxidation steps and form redox-active quinones, which subsequently react with amino acids, polyphenols, and proteins, and converted into brown polymers, melanin (Zhang et al. 2021 ). To neutralize the negative effects of ROS, organisms employ antioxidant defense systems to remove damaging radicals and recover oxidatively damaged lipid and protein (Liu et al. 2023 ). Postharvest treatments capable of enhancing organisms’ antioxidant defense systems are beneficial to alleviate postharvest browning and prolong shelf life of longan fruit (Corpas et al. 2022 ). Tert -Butylhydroquinone (TBHQ) is a synthetic phenolic addictive commonly applied in food preservation. This chemical is low cost, wide availability, and high performance, and has been found in various food products that contain animal fats and lipids. Moreover, TBHQ is considered to be safe and can be directly consumed at concentrations no greater than 0.02%, according to the official guidance (Ramis-Ramos 2003 ). It’s evidenced that TBHQ exhibits superior antioxidant and anti-fungi capacity, thus is able to inhibit the oxidative deterioration of oils (Hung et al. 2019 ; Wang et al. 2021 ). However, there exists very scarce information and reports on its application in fruit preservation. This work aimed to evaluate the role of TBHQ against endocarp browning of longan fruit combined with antioxidant capacity during postharvest storage. Specific analyses focused on basic quality parameters (endocarp browning index, pulp breakdown index, MDA content), ROS biosynthesis (contents of H 2 O 2 and O 2 −⋅ , activities and gene expressions of oxidase PPO and POD), endogenous antioxidant defense systems including enzymatic activities and gene expressions as well as non-enzymatic antioxidants. These results are helpful to provide a safe and effective strategy to maintain postharvest quality and extend shelf life of longan fruit. 2. Materials and methods 2.1 Fruit materials and treatments Longan fruit ( Dimocarpus longan Lour.) were picked from an orchard close to Hongqi town in Haikou City, Hainan Province, China, and immediately transferred to our laboratory at Hainan University. Fresh fruit then underwent a 3-min sterilization by being immersed in 0.1% sporgon (w/v) solution. A total of 900 longan fruit with consistent size, maturity, and free of visible flaws were carefully chosen and divided randomly and equally into two groups. One was submerged in a 0.2 g L − 1 TBHQ (w/v) solution at 25°C for 3 min. The other was subjected to a 3-min treatment with distilled water at the same temperature, and serving as control. The optimum concentration of TBHQ (0.2 g L − 1 ) was determined based on our preliminary study of endocarp browning index and aril breakdown index using 0.05, 0.1, 0.2 and 0.5 g L − 1 TBHQ. After TBHQ or distilled water treatment, the fruit were air-dried and subsequently stored at the temperature of 25 ± 1°C and relative humidity of 85–90% for a duration of 8 days. Pericarp tissues were collected at intervals of 2 days, immediately frozen in liquid nitrogen, and preserved at − 80°C for further study. At every time point, three biological replicates were conducted for physiological parameters analysis. 2.2 Endocarp browning and aril breakdown index Endocarp browning was assessed based on the browning area of inner pericarp, which could be divided into 6 grades, with 1 = no browning; 2 = less than 25% browning area; 3 = 25–50% browning area; 4 = 50–75% browning area; 5 = 75–100% browning area; 6 = All browning. Endocarp browning index = ∑ (browning scale × fruit number of corresponding scale) / (total fruit number). Aril breakdown index was determined by referencing Chen et al. ( 2015 ) (Chen et al. 2015 ). According to the extent of aril breakdown area, breakdown index could be divided into 4 grades with 0 = no breakdown, 1 = less than 25% breakdown area, 2 = 25–50% breakdown area, 3 = 50–75% breakdown area, and 4 = more than 75% breakdown area. Aril breakdown index = ∑ (breakdown scale × fruit number of corresponding scale) / (total fruit number). 2.3 ROS and MDA analysis O 2 − · production rate was determined by following the procedure described in the study of Chen et al. (2020) (Chen et al. 2020b ), and expressed as mmol min − 1 kg − 1 on a fresh weight basis. The content of H 2 O 2 was analyzed using an H 2 O 2 content assay kit (G0112W, Grace Biotechnology Co. Ltd., Suzhou, Jiangsu, China) according to the protocols provided by manufacturer, and expressed as mmol kg − 1 on a fresh weight basis. The malondialdehyde (MDA) content was determined according to the method of Lin et al. ( 2014 ) (Lin et al. 2014 ), and the results are presented as mmol kg − 1 on a fresh weight basis. 2.4 Assay of DPPH scavenging rate The assay of DPPH scavenging rate was conducted with reference to methods in Huang et al. ( 2022 ) with slight modifications (Huang et al. 2022 ). Briefly, 1 g of frozen pericarp powder was mixed with 5 mL of methanol. After homogenization, the mixture was subjected to centrifugation with 12 000 × g force, 30 min. The supernatant (2 mL) was collected and added to 2 mL of 0.1 mM DPPH. The mixture was then incubated at 25°C under dark conditions for 20 min. Absorbance at the wavelength of 517 nm was recorded. 2.5 Assays of antioxidant enzyme activities To determine the activities of SOD, CAT, APX, and GR, 1 g of frozen pericarp powder was homogenized in various buffers. Details are described in the study of Zhang et al. ( 2015 ) (Zhang et al. 2015 ). SOD activity was determined according to the inhibition capacity of SOD on nitro blue tetrazolium (NBT) photoreduction. One unit (U) of SOD activity was defined as the amount of enzyme used to inhibit the reduction of 50% NBT per min monitored at the wavelength of 560 nm. CAT activity was assessed by recording the alternation of absorbance at 240 nm based on its decomposing capacity on H 2 O 2 . One unit (U) of activity was defined as the amount of enzyme which catalyzed the degradation of 1 nmol of H 2 O 2 every min. APX activity was determined by measuring the alternation of absorbance at 290 nm caused by APX-catalyzed oxidation of ascorbic acid after adding H 2 O 2 . One unit (U) of APX activity was defined as the enzyme amount required for oxidation of 1 µmol of ascorbic acid every min. The activity of GR was assessed by tracking the glutathione-dependent oxidation of NADPH at 340 nm. One unit (U) of activity was defined as the GR amount required to oxidize 1 nmol of NADPH every min. MDHAR and DHAR activities were measured by following protocols provided by kits of G0213F and G0212F acquired from Suzhou Grace Biotech. One unit (U) of MDHAR activity was defined as the enzyme amount that is required to oxidize 1 nmol of NADH every min. One unit (U) of DHAR activity was defined as the amount of enzyme that generated 1 nmol of AsA every min. 2.6 PPO, POD activities assays PPO activity was assessed using an enzymatic assay kit of PPO-1-Y bought from (Comin Biotech Co. Ltd, Suzhou, Jiangsu, China) with reference to the protocols provided by the manufacturer. One unit (U) of activity was defined as the amount of PPO that gave rise to an increment in absorbance of 0.005 every min. POD activity was analyzed with reference to methods described in Tian et al. ( 2022 ) (Tian et al. 2022 ). One unit (U) of enzyme was defined as the amount of POD that was required to induce a rise in absorbance of 0.01 at 470 nm every min. 2.7 Total phenols, GSH, and AsA analysis The concentrations of GHS and AsA were determined by following approaches described in Zhang et al. ( 2018 ) (Zhang et al. 2018 ). Absorbance at 412 and 534 nm were measured. GSH and ASA were expressed as mmol kg − 1 and g kg − 1 on a fresh weight basis, respectively. 2.8 RT-qPCR analysis Total RNA of pericarp tissues was extracted using a cetyltrimethylammonium bromide (CTAB)-based method reported in Nian et al. ( 2021 ) (Nian et al. 2021 ). The purified RNA served as a template for reverse transcription to synthesize the first strand cDNA by using FastKing First Strand cDNA Synthesis Kit (KR118, Tiangen Biotech Co. Ltd., Beijing, China). Primers used in qPCR reactions were designed using Primer 6.0, which were listed in Table 1 . The reaction system with 20 µL total volume of RT-qPCR was prepared by following the protocol of FastKing One Step RT-PCR Kit (KR123, Tiangen Biotech). After preparation, RT-qPCR was conducted using CFX96 Real-Time PCR system (Bio-Rad, Hercules, CA, USA). The relative expression levels were determined based on the 2 −ΔΔCT method. DlActin was chosen as the reference gene, whose expression was used as internal control. Table 1 Primer sequences for RT-qPCR. Gene Forward Reverse DlActin ACCACTACTGCTGAACGGGAAA GCCTCCAACTCCTGCTCATAGT DlSOD GCACCACCAGAAGCATCACCAG TGCCCTCCGCCGTTGAACTT DlCAT AACGTGTTGTCCATGCAAGAGG CGGAGGATGATAGGCGTCTGAA DlAPX TCACGAGGCTAACAACGGTCTT ACAGCAACAACTCCAGCCAACT DlGR CGCAACTACGACTTCGACCTCT AGCTCGCAGACGGCAACAGA 2.9 Statistical analyses Data were presented as mean value ± standard error (SE) based on measurements from three repeated experiments. The statistical program SPSS 22.0 was employed for means comparison using independent samples t -test analysis. Asterisk denoted significant differences between control and TBHQ-treated group (* P < 0.05, ** P < 0.01). Graphs in this study were prepared by using Origin 9.1. 3. Results and discussion 3.1. Endocarp browning index, aril breakdown index Endocarp browning occurs in deteriorated longan fruit, and is one of the main factors that restrict shelf life of fresh product (Long et al. 2022 ; Sun et al. 2022 ). Our study found that endocarp browning index in control fruit increased continuously at 25 ℃, with values from 1 to 2.62 after 8 d storage (Fig. 1 A). In comparison, exogenous TBHQ treatment significantly decelerated the browning development, and the browning index in TBHQ-treated fruit raised from day 2 and reached to 2.12 at day 8 which was 19.1% lower than in control fruit. Aril breakdown is another noticeable feature of quality deterioration in harvested longan fruit (Thavong et al. 2010 ; Wu et al. 2022 ). Aril breakdown index was calculated based on the average breakdown area that occupies picked fruit, which reflects breakdown severity of edible tissues. Consistent with browning development, aril breakdown index showed continuous increasement in both two groups. However, TBHQ treatment notably suppressed the advancement of aril breakdown as indicated by delayed increases in aril breakdown index (Fig. 1 B). Chemicals that exhibit antioxidant property are supposed to have positive effect on fruit preservation. It has been reported that application of antioxidants such as propyl gallate, α-lipoic acid, sodium para -aminosalicylate, and hydrogen water has successfully alleviated pericarp browning of longan and litchi fruit (He et al. 2021 ; Li et al. 2019 ; Li et al. 2018 ; Lin et al. 2018 ; Liu et al. 2022b ). TBHQ is another well-known antioxidant compound, approved as a food additive widely used in oil preservation. However, its effect on fruit preservation is unknown. In this study, we found TBHQ with percent concentration 0.02% (a safe intake concentration) is effective in suppressing endocarp browning and aril breakdown of longan fruit under ambient conditions, suggesting the great potential of TBHQ in fruit preservation. 3.2 ROS production, MDA content, and DPPH scavenging rate ROS are highly reactive metabolites derived from oxygen during mitochondrial respiration. Its imbalance between production and removal results in oxidative stress which contributes to cellular senescence and affects storage quality of harvested fruit (Tang et al. 2021 ). H 2 O 2 and O 2 − · are the major ROS involved in oxidative stress. As observed in Fig. 2 A, the H 2 O 2 content presented overall increase with fluctuation during storage, rising from an initial value of 27.63 mmol kg − 1 to the peak of 34.13 mmol kg − 1 at day 2, following a drop to 28.41 mmol kg − 1 at day 6 and a subsequent increase to 31.53 mmol kg − 1 at day 8. TBHQ treatment inhibited the production of H 2 O 2 , with H 2 O 2 content at days 2, 4, and 6, being 5.2%, 9.1%, and 11.4% lower, in comparison with control. The production rate of O 2 − · rose steadily during storage regardless of treatment, but at day 6, the O 2 − · production rate was 3.8% lower in TBHQ-treated fruit, compared to control. MDA is a peroxidation biomarker of membrane lipid caused by oxidative damage (Chomkitichai et al. 2014 ; Zhang et al. 2022 ). As observed in Fig. 2 C, the MDA content increased steadily and showed analogous tendencies in both control and TBHQ-treated fruit, but the latter had average 17.53% lower values than the former from day 4 to day 8 storage. DPPH test can be used to assess the antioxidant defense capacity of postharvest fruit by determining ROS scavenging potential (Chen et al. 2020a ). In this work, the DPPH scavenging rate in control fruit presented an overall decline trajectory with fluctuation during storage (Fig. 2 D). TBHQ treatment enhanced the DPPH scavenging rate at days 4 and 6, which was 1.0% and 1.62% higher than control fruit, respectively (Fig. 2 D). Suppressed levels of ROS and MDA and enhanced DPPH scavenging ability suggested the positive effect of TBHQ in alleviating oxidative stress, which might be responsible for attenuation of endocarp browning and quality maintenance of postharvest longan fruit. In consistent, the positive correlation between reduced oxidative stress and alleviated browning development after postharvest treatments has also been evidenced in pear, apple, litchi, and longan fruits (He et al. 2021 ; Jung and Choi 2020 ; Lin et al. 2014 ; Zhai et al. 2018 ). 3.4 PPO and POD activities PPO is the main enzyme involved in enzymatic browning by catalyzing the oxidating reaction of phenolic substances to form quinones, which are substrates of brown polymers (Liu et al. 2022a ; Pan et al. 2021 ). Its activity affects the progression of pericarp browning. In our work, PPO activity in control fruit showed an overall increasing tendency with initial value of 3.56 × 10 4 U kg − 1 to 1.58 × 10 5 U kg − 1 at day 8. TBHQ treatment suppressed the increasement of PPO activity, with notable results, 22.6% and 14.7% lower than control at days 4 and 8 (Fig. 3 A). POD also associates with the onset of fruit browning since it catalyzes the oxidation and polymerization of phenolic substances with H 2 O 2 (Zhang et al. 2015 ). In control longan fruit, POD activity rose initially from 4.77 × 10 4 U kg − 1 to the peak of 1.10 × 10 5 U kg − 1 at day 4, then decreased to 2.42 × 10 4 U kg − 1 at day 8 (Fig. 3 B). The application of TBHQ suppressed POD activity and resulted in significant lower values at days 2 and 6 (Fig. 3 B). PPO and POD are considered as the action targets to control the progression of enzymatic browning in postharvest fruit. Appropriate postharvest strategies offer a promising way to suppress PPO and POD activities. Lin et al. ( 2013 ) reported propyl gallate treatment alleviated longan fruit browning which could be ascribed to the decreased PPO and POD activities (Lin et al. 2013 ). TBHQ treatment is also useful in PPO and POD inhibition. 3.5 Total phenols, GSH, and AsA contents Aerobic organisms have integrated antioxidant systems to defend against oxidative damage triggered by ROS stress and maintain cellular redox homeostasis (Meitha et al. 2020 ; Zhu et al. 2022 ). The antioxidant system consists of two parts, endogenous non-enzymatic and enzymatic antioxidants. Non-enzymatic antioxidants are represented by low-molecular-weight compounds, including phenolics, ASA and GSH (Yun et al. 2021 ). In this work, total phenolics content in control fruit raised initially from 1.63 g kg − 1 and attained the maximum of 1.87 g kg − 1 at day 6, then dropped to 1.59 g kg − 1 at day 8 (Fig. 3 C). In comparison, TBHQ-treated fruit presented noticeably higher levels of total phenolics than control at days 4 and 8 (Fig. 3 C). AsA content in both groups displayed a decreasing trajectory during storage. TBHQ treatment impeded the decrease of AsA content in the last 4-d storage with values of 8.4% and 11.4% higher than control fruit at days 4 and 6 (Fig. 3 D). The GSH content of control fruit dropped from 1.58 mmol kg − 1 to 1.16 mmol kg − 1 within the first 4 d, followed by an increment to 1.34 mmol kg − 1 at day 6, then decreased to 1.03 mmol kg − 1 at day 8 (Fig. 3 E). Comparatively, fruit with TBHQ treatment exhibited significantly higher levels of 13.3% in average GSH content during 4–8 d of storage (Fig. 3 E). Phenolics are secondary metabolites, capable of scavenging oxygen free radicals in response to oxidative environment (Bai et al. 2022 ). AsA is regarded as a ROS detoxifying chemical and facilitates the decomposition of H 2 O 2 under the action of APX (Wang et al. 2018a ; Zhou et al. 2022 ). GSH is a cofactor for glutathione peroxidase and involves in the transformation of oxidated ASA to its active reduced form (Cai et al. 2011 ). These endogenous non-enzymatic antioxidants contribute to the enhanced ROS scavenging ability of longan fruit and attenuate postharvest endocarp browning. TBHQ treatment markedly increased these antioxidants to reduce fruit deterioration. Consistent with our results, higher levels of endogenous AsA, GSH, or phenolics were observed in apple polyphenols-, L-cysteine- or exogenous AsA-treated postharvest fresh products, which led to decreased ROS levels, and thus retarded fruit browning and senescence (Ali et al. 2016 ; Liu et al. 2021 ; Su et al. 2019 ). 3.6 Antioxidant enzymes activities Enzymatic antioxidants are of importance to shield fruit from oxidative stress by scavenging ROS. To investigate ROS scavenging ability of enzymatic antioxidants, we analyzed the activities of SOD, CAT, APX, GR, DHAR, and MDHAR. As shown in Fig. 4 A, SOD activity in control declined initially from 1.32 × 10 6 U kg − 1 to 1.12 × 10 6 U kg − 1 at day 2, followed by a 4-d increment to 1.21 × 10 6 U kg − 1 , and slightly decreased to 1.17 × 10 6 U kg − 1 at day 8. After TBHQ treatment, SOD activity exhibited a similar trajectory, but was averaging 6.4% higher than control during days 2 to 6 (Fig. 4 A). CAT activity in control declined gradually from 2.49 × 10 5 U kg − 1 to 7.73 × 10 4 U kg − 1 throughout storage. TBHQ treatment suppressed the decrement in CAT activity and maintained an averaging 26.8% higher level from days 2 to 6, in comparison with control (Fig. 4 B). APX activity steadily increased from 1.31 × 10 5 U kg − 1 initially to 2.29 × 10 5 U kg − 1 at day 8 in control fruit. TBHQ treatment induced a more rapid increment of APX activity, which was averaging 13.9% higher than control from days 2 to 6 (Fig. 4 C). GR activity in control fruit increased initially from 1.52 × 10 5 U kg − 1 , and reach a peak of 4.16 × 10 5 U kg − 1 at day 6, then dropped to 3.14 × 10 5 U kg − 1 at day 8 (Fig. 4 D). Comparatively, higher GR activity was observed after TBHQ treatment, with values 1.29- and 1.17-fold higher than control at days 4, and 6, respectively (Fig. 4 D). MDHAR activity in control fruit decreased continuously over 6 d from 5.47 × 10 4 U kg − 1 to the minimum of 3.11 × 10 4 U kg − 1 (Fig. 4 E). TBHQ-treated fruit maintained higher MDHAR activity, which was averaging 36.4% higher than control at days 6 to 8 (Fig. 4 E). DHAR activity in control fruit decreased initially from 1.89 × 10 5 U kg − 1 to 1.37 × 10 5 U kg − 1 at day 4, then increased to the peak value of 1.86 × 10 5 U kg − 1 at day 6, then declined to 1.64 × 10 5 U kg − 1 at day 8 (Fig. 4 F). Fruit with TBHQ treatment showed increased DHAR activity. Compared to control fruit, significant difference was observed at days 6 and 8, with values of 21.4% and 16.5% higher after TBHQ treatment (Fig. 4 F). SOD, CAT, APX, GR, DHAR, and MDHAR are essential enzymatic antioxidants directly and/or indirectly involved in scavenging ROS (Zhu et al. 2014 ). Among them, SOD catalyzes the dismutation reaction of O 2 − · to form H 2 O 2 , which is decomposed into H 2 O and O 2 under the action of CAT (Wang et al. 2018b ). APX, GR, MDHAR, and DHAR participate in the ascorbate-glutathione cycle, which provides reducing power to regenerate reduced GSH and AsA (Pan et al. 2022 ). Li et al. ( 2019 ) addressed that the activation of antioxidant enzymes contributes to the reduced oxidative damage and the alleviated endocarp browning of longan fruit (Li et al. 2019 ). In this study, TBHQ treatment led to high levels of SOD, CAT, APX, GR, DHAR, and MDHAR, which might be linked to the suppression of enzymatic browning induced by oxidative stress. 3.7 Gene expression of DlSOD, DlCAT, DlAPX, and DlGR To measure the expression levels of genes that involve in ROS metabolism, we extracted total RNA and conducted RT-qPCR. Results are shown in Fig. 5 . Different from the fluctuating trajectory of SOD activity, DlSOD expression in control fruit raised initially, and peaked at day 4 with 2.3-fold increases, then dropped dramatically to 0.4-fold at day 8. TBHQ treatment significantly elevated the expression of DlSOD at days 2 and 4, which was 1.7- and 2.5-fold of that in control fruit (Fig. 5 A). Similarly, the DlCAT expression in control fruit declined sharply in the first 2 d and reached to 9.3-folds, then decreased to 0.6-fold at day 8. TBHQ treatment significantly upregulated the expression of DlCAT which was 3.4 times of that in control at day 2 (Fig. 5 B). Notably, the changing tendency of DlCAT expression was also different from CAT activity. For DlAPX , TBHQ-treated fruits maintained higher expression levels during the first 6 d of storage, by averaging 35.68% higher than control, which is consistent with the changing trend of APX activity (Fig. 5 C). Similar to DlSOD , DlGR expression presented an upward tendency in the first 4 d, then slightly declined in the latter storage. TBHQ treatment significantly upregulated DlGR expression, with values of 2.91- and 2.11-folds higher than control at days 2 and 4 (Fig. 5 D). The overall trend of DlGR expression was in accordance with GR activity, though the peak value of GR activity was 2 d later in comparison with DlGR expression. The difference between enzymatic activity and gene expression might be explained by the imbalance between biosynthesis and degradation of enzyme, and the complicated regulation in transcription and translation process (Wen et al. 2023 ). The expression of genes relevant to ROS metabolism was stimulated by TBHQ, thereby reinforcing the antioxidant system and the preservation quality of longan fruit. 4. Conclusion In conclusion, application of TBHQ effectively suppressed the endocarp browning of longan fruit at 25°C storage. This treatment alleviated oxidative stress, which might be linked to its positive effect in enhancing ROS-defensing system by upregulating gene expression of antioxidant enzymes, improving enzymatic oxidant activities, as well as maintaining high levels of non-enzymatic oxidants. The proposed mechanism of TBHQ-induced quality maintenance in postharvest longan fruit is presented in Fig. 6 . Our study suggested that TBHQ might be a promising chemical in fruit preservation due to its inducing effect in antioxidant capacity. Declarations Author Contribution Zhiqian Yu performed the experiments and wrote the main manuscript. Wenjing Kang performed formal analysis. Zhengke Zhang reviewed this manuscript. Ziqin Yang acquired funding for this project. Yueming Jiang reviewed this manuscript. Yonggui Pan supervised this project, and reviewed this manuscript. Jiali Yang conceptualized this project, acquired funding, critically reviewed and revised this manuscript. Funding This work was supported by Natural Science Foundation of Hainan Province, China (223RC403 and 323RC535), Collaborative Innovation Center of Hainan University (XTCX2022NYC07), and Hainan Provincial Key Laboratory of Food Nutrition and Functional Food (KF202207). Conflicts of interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. References Ali S, Khan AS & Malik AU. (2016). Postharvest l-cysteine application delayed pericarp browning, suppressed lipid peroxidation and maintained antioxidative activities of litchi fruit. Postharvest Biology and Technology, 121 , 135-142. https://dx.doi.org/10.1016/j.postharvbio.2016.07.015. Bai X, Yang Z, Shen W, Shao Y, Zeng J & Li W. (2022). Polyphenol treatment delays the browning of litchi pericarps and promotes the total antioxidant capacity of litchi fruit. Scientia Horticulturae, 291 , 110563. https://dx.doi.org/10.101 6/j.scienta.2021.110563. Cai Y, Cao S, Yang Z & Zheng Y. (2011). MeJA regulates enzymes involved in ascorbic acid and glutathione metabolism and improves chilling tolerance in loquat fruit. Postharvest Biology and Technology, 59 , 324-326. https://dx.doi.org/1 0.1016/j.postharvbio.2010.08.020. Chen M, Lin H, Zhang S, Lin Y, Chen Y & Lin Y. (2015). Effects of adenosine triphosphate (ATP) treatment on postharvest physiology, quality and storage behavior of longan fruit. Food and Bioprocess Technology, 8 (5), 971-982. https://dx.doi.org/10.1007/s11947-014-1462-z. Chen X, Liang L & Han C. (2020a). Borate suppresses the scavenging activity of gallic acid and plant polyphenol extracts on DPPH radical: A potential interference to DPPH assay. LWT - Food Science and Technology, 131 , 109769. https://dx.doi. org/10.1016/j.lwt.2020.109769. Chen Y, Sun J, Lin H, Lin M, Lin Y, Wang H & Hung Y. (2020b). Salicylic acid treatment suppresses Phomopsis longanae Chi-induced disease development of postharvest longan fruit by modulating membrane lipid metabolism. Postharvest Biology and Technology, 164 , 111168. https://dx.doi.org/10.1016/ j.postharvbio.2020.111168. Chomkitichai W, Chumyam A, Rachtanapun P, Uthaibutra J & Saengnil K. (2014). Reduction of reactive oxygen species production and membrane damage during storage of ‘Daw’ longan fruit by chlorine dioxide. Scientia Horticulturae, 170 , 143-149. https://dx.doi.org/10.1016/j.scienta.2014.02.036. Corpas FJ, Rodríguez-Ruiz M, Muñoz-Vargas MA, González-Gordo S, Reiter RJ & Palma JM. (2022). Interactions of melatonin, ROS and NO during fruit ripening: An update and prospective view. Journal of Experimental Botany, 24 , 5948-5960. https://dx.doi.org/10.1093/jxb/erac128. Decros G, Baldet P, Beauvoit B, Stevens R, Flandin A, Colombié S, Gibon Y & Pétriacq P. (2019). Get the balance right: ROS homeostasis and redox signalling in fruit. Frontiers in Plant Science, 10 , 1091. https://dx.doi.org/10.3389/fpls.2019.01091. He M, Wu Y, Hong M, Yun Z, Li T & Jiang Y. (2021). α-Lipoic acid treatment alleviates postharvest pericarp browning of litchi fruit by regulating antioxidant ability and energy metabolism. Postharvest Biology and Technology, 180 , 111629. https://dx.doi.org/10.1016/j.postharvbio.2021.111629. Huang H, Wang L, Bi F & Xiang X. (2022). Combined application of malic acid and lycopene maintains content of phenols, antioxidant activity, and membrane integrity to delay the pericarp browning of litchi fruit during storage. Frontiers in Nutrition, 9 , 849385. https://dx.doi.org/10.3389/fnut.2022.849385. Hung YT, Hanson AR, Urriola PE, Johnston LJ, Kerr BJ & Shurson GC. (2019). Addition of tert-butylhydroquinone (TBHQ) to maize oil reduces lipid oxidation but does not prevent reductions in serum vitamin E in nursery pigs. Journal of Animal Science and Biotechnology, 10 , 51-62. https://dx.doi.org/10.1186/s40104-019-0362-5. Jung S-K & Choi H-S. (2020). Browning of ‘Empire’ and ‘Fuji’ apples as affected by antioxidant activities. Agronomy, 10 , 1883. https://dx.doi.org/10.3390/ agronomy10121883. Li T, Shi D, Wu Q, Zhang Z, Qu H & Jiang Y. (2019). Sodium para -aminosalicylate delays pericarp browning of litchi fruit by inhibiting ROS-mediated senescence during postharvest storage. Food Chemistry, 278 , 552-559. https://dx.doi.org /10.1016/j.foodchem.2018.11.099. Li T, Wu Q, Zhou Y, Yun Z, Duan X & Jiang Y. (2018). l -Cysteine hydrochloride delays senescence of harvested longan fruit in relation to modification of redox status. Postharvest Biology and Technology, 143 , 35-42. https://dx.doi.org/10.1016/ j.postharvbio.2018.04.011. Lin Y, Li N, Lin H, Lin M, Chen Y, Wang H, Ritenour MA & Lin Y. (2020). Effects of chitosan treatment on the storability and quality properties of longan fruit during storage. Food Chemistry, 306 , 125627. https://dx.doi.org/10.1016/j. foodchem.2019.125627. Lin Y, Lin H, Zhang S, Chen Y, Chen M & Lin Y. (2014). The role of active oxygen metabolism in hydrogen peroxide-induced pericarp browning of harvested longan fruit. Postharvest Biology and Technology, 96 , 42-48. https://dx.doi.org/10.1016 /j.postharvbio.2014.05.001. Lin Y, Lin Y, Lin H, Chen Y, Wang H & Shi J. (2018). Application of propyl gallate alleviates pericarp browning in harvested longan fruit by modulating metabolisms of respiration and energy. Food Chemistry, 240 , 863-869. https://dx.doi.org/ 10.1016/j.foodchem.2017.07.118. Lin YF, Hu YH, Lin HT, Liu X, Chen YH, Zhang S & Chen QX. (2013). Inhibitory effects of propyl gallate on tyrosinase and its application in controlling pericarp browning of harvested longan fruits. Journal of Agricultural and Food Chemistry, 61 (11), 2889-2895. https://dx.doi.org/10.1021/jf305481h. Liu B, Zhu Q, Zhou X, Zhang X, Dang Z, Liang S, Li G, Zhang Z, Fang F & Pang X. (2022a). Characterization of a pericarp browning related LACCASE 14-4 from longan fruit with a focus on (epi)catechin oxidative polymerization. Postharvest Biology and Technology, 185 , 111802. https://dx.doi.org/10.1016 /j.postharvbio.2021.111802. Liu J, Lin Y, Lin H, Lin M & Fan Z. (2021). Impacts of exogenous ROS scavenger ascorbic acid on the storability and quality attributes of fresh longan fruit. Food Chemistry X, 12 , 100167. https://dx.doi.org/10.1016/j.fochx.2021.100167. Liu J, Zhang W, Hu M, Pan Y, Jiang Y, Zhang Z & Jiang G. (2023). Nitric oxide is involved in melatonin-induced cold tolerance in postharvest litchi fruit. Postharvest Biology and Technology, 196 , 112157. https://dx.doi.org/ 10.1016/j.postharvbio.2022.112157. Liu Q, Xie H, Chen Y, Lin M, Hung Y & Lin H. (2022b). Alleviation of pulp breakdown in harvested longan fruit by acidic electrolyzed water in relation to membrane lipid metabolism. Scientia Horticulturae, 304 (26), 111288-111297. https://dx.doi.org /10.1016/j.scienta.2022.111288. Long L, Lai T, Han D, Lin X, Xu J, Zhu D, Guo X, Lin Y, Pan F, Wang Y, Lai Z, Du X, Fang D, Shuai L, Wu Z & Luo T. (2022). A Comprehensive Analysis of Physiologic and Hormone Basis for the Difference in Room-Temperature Storability between 'Shixia' and 'Luosanmu' Longan Fruits. Plants (Basel), 11 (19), 2503. https://dx.doi.org/10.3390/plants11192503. Meitha K, Pramesti Y & Suhandono S. (2020). Reactive oxygen species and antioxidants in postharvest vegetables and fruits. International Journal of Food Science & Technology, 2020 , 8817778. https://dx.doi.org/10.1155/2020/8817778. Nian Y, Nan W, Rui L, Yuanzhi S & Wen L. (2021). Cold shock treatment alleviates chilling injury in papaya fruit during storage by improving antioxidant capacity and related gene expression. Scientia Horticulturae, 294 , 110784. https://dx.doi.org/10.1016/j.scienta.2021.110784. Pan Y, Guo Y, Huang Q, Zhang W & Zhang Z. (2021). Enzymatic browning in relation to permeation of oxygen into the kernel of postharvest areca nut under different storage temperatures. Food Science & Nutrition, 9 (7), 3768-3776. https://dx.doi.org/10.1002/fsn3.2341. Pan Y, Jiang Y, Huang Q, Zhu Y, Nie Y, Yuan R & Zhang Z. (2022). Abnormal chilling injury of postharvest papaya is associated with the antioxidant response. Journal of Food Biochemistry, 46 (10), 14272. https://dx.doi.org/10.1111/jfbc.14272. Ramis-Ramos G. (2003). Antioxidants | synthetic antioxidants. Encyclopedia of Food Sciences and Nutrition (Second Edition) , 265-275. https://dx.doi.org/https:// doi.org/10.1016/B0-12-227055-X/00054-7. Su Z, Hu M, Gao Z, Li M, Yun Z, Pan Y, Zhang Z & Jiang Y. (2019). Apple polyphenols delay senescence and maintain edible quality in litchi fruit during storage. Postharvest Biology and Technology, 157 , 110976. https://dx.doi.org/1 0.1016/j.postharvbio.2019.110976. Sun Y, Luo M, Ge W, Zhou X, Zhou Q, Wei B, Cheng S & Ji S. (2022). Phenylpropanoid metabolism in relation to peel browning development of cold-stored 'Nanguo' pears. Plant Science, 322 , 111363. https://dx.doi.org/ 10.1016/j.plantsci.2022.111363. Tan X, Zhao Y, Shan W, Kuang J, Lu W, Su X, Tao N, Lakshmanan P & Chen J. (2020). Melatonin delays leaf senescence of postharvest Chinese flowering cabbage through ROS homeostasis. Food Research International, 138 , 109790. https://dx.doi.org/10.1016/j.foodres.2020.109790. Tang J, Chen H, Lin H, Hung Y-C, Xie H & Chen Y. (2021). Acidic electrolyzed water treatment delayed fruit disease development of harvested longans through inducing the disease resistance and maintaining the ROS metabolism systems. Postharvest Biology and Technology, 171 , 111349-111358. https:// dx.doi.org/10.1016/j.postharvbio.2020.111349. Thavong P, Archbold DD, Pankasemsuk T & Koslanund R. (2010). Effect of hexanal vapour on longan fruit decay, quality and phenolic metabolism during cold storage. International Journal of Food Science & Technology, 45 (11), 2313-2320. https://dx.doi.org/10.1111/j.1365-2621.2010.02401.x. Tian J, Xie S, Zhang P, Wang Q, Li J & Xu X. (2022). Attenuation of postharvest peel browning and chilling injury of banana fruit by astragalus polysaccharides. Postharvest Biology and Technology, 184 , 111783. https://dx.doi.org/ 10.1016/j.postharvbio.2021.111783. Wang H, Chen YH, Sun JZ, Lin YF, Lin YX, Lin M, Hung YC, Ritenour MA & Lin HT. (2018a). The changes in metabolisms of membrane lipids and phenolics induced by phomopsis longanae chi infection in association with pericarp browning and disease occurrence of postharvest longan fruit. Journal of Agricultural and Food Chemistry, 66 , 12794-12804. https://dx.doi.org/ 10.1021/acs.jafc.8b04616. Wang W, Xiong P, Zhang H, Zhu Q, Liao C & Jiang G. (2021). Analysis, occurrence, toxicity and environmental health risks of synthetic phenolic antioxidants: A review. Environmental Research, 201 , 111531. https://dx.doi.org/ 10.1016 /j.envres.2021.111531. Wang Y, Branicky R, Noë A & Hekimi S. (2018b). Superoxide dismutases: Dual roles in controlling ROS damage and regulating ROS signaling. Journal of Cell Biology, 217 , 1915-1928. https://dx.doi.org/10.1083/jcb.201708007. Wen B, Cui S, Suo X & Supapvanich S. (2023). Stress response of fresh-cut potatoes to laser irradiation before processing can prevent discoloration and maintain overall quality. Postharvest Biology and Technology, 197 , 112213. https:// dx.doi.org/10.1016/j.postharvbio.2022.112213. Wu Y, Xie L, Li Z, Li T & Jiang Y. (2022). Valeric acid delays aril breakdown of longan ( Dimocarpus longan Lour.) fruit in relation to the regulation of histone deacetylase activity. LWT - Food Science and Technology, 168 , 113959. https:// dx.doi.org/10.1016/j.lwt.2022.113959. Yan H, Hongxu C, Jianglin Z, Tian Y & Xiaochun D. (2022). Postharvest H 2 O 2 treatment affects flavor quality, texture quality and ROS metabolism of ‘Hongshi’ kiwifruit fruit kept at ambient conditions. Food Chemistry, 405 , 134908. https://dx.doi.org/10.1016/j.foodchem.2022.134908. Yun Z, Gao H, Chen X, Chen Z, Zhang Z, Li T, Qu H & Jiang Y. (2021). Effects of hydrogen water treatment on antioxidant system of litchi fruit during the pericarp browning. Food Chemistry, 336 , 127618. https://dx.doi.org/10.1016/j. foodchem.2020.127618. Zhai R, Liu J, Liu F, Zhao Y, Liu L, Fang C, Wang H, Li X, Wang Z, Ma F & Xu L. (2018). Melatonin limited ethylene production, softening and reduced physiology disorder in pear ( Pyrus communis L.) fruit during senescence. Postharvest Biology and Technology, 139 , 38-46. https://dx.doi.org/10.1016/j.postharvbio.2018.01.017. Zhang D, Xu X, Zhang Z, Jiang G, Feng L, Duan X & Jiang Y. (2018). 6-Benzylaminopurine improves the quality of harvested litchi fruit. Postharvest Biology and Technology, 143 , 137-142. https://dx.doi.org/10.1016/j. postharvbio.2018.05.002. Zhang W, Jiang H, Cao J & Jiang W. (2021). UV-C treatment controls brown rot in postharvest nectarine by regulating ROS metabolism and anthocyanin synthesis. Postharvest Biology and Technology, 180 , 111613. https://dx.doi.org/10.1016 /j.postharvbio.2021.111613. Zhang X, Liu T, Zhu S, Wang D, Sun S & Xin L. (2022). Short-term hypobaric treatment alleviates chilling injury by regulating membrane fatty acids metabolism in peach fruit. Journal of Food Biochemistry, 46 (7), e14113. https://dx.doi.org/10.1111/jfbc.14113. Zhang Z, Huber DJ, Qu H, Yun Z, Wang H, Huang Z, Huang H & Jiang Y. (2015). Enzymatic browning and antioxidant activities in harvested litchi fruit as influenced by apple polyphenols. Food Chemistry, 171 , 191-1999. https://dx.doi.org/10.1016/j.foodchem.2014.09.001. Zhou C, Dong W, Jin S, Liu Q, Shi L, Cao S, Li S, Chen W & Yang Z. (2022). γ-Aminobutyric acid treatment induced chilling tolerance in postharvest peach fruit by upregulating ascorbic acid and glutathione contents at the molecular level. Frontiers in Plant Science, 13 , 1059979. https://dx.doi.org/10.3389 /fpls.2022.1059979. Zhu L, Wang W, Shi J, Zhang W, Shen Y, Du H & Wu S. (2014). Hydrogen sulfide extends the postharvest life and enhances antioxidant activity of kiwifruit during storage. Journal of the Science of Food and Agriculture, 94 (13), 2699-2704. https://dx.doi.org/10.1002/jsfa.6613. Zhu L, Yu H, Dai X, Yu M & Yu Z. (2022). Effect of methyl jasmonate on the quality and antioxidant capacity by modulating ascorbate-glutathione cycle in peach fruit. Scientia Horticulturae, 303 (20), 111216. https://dx.doi.org/10.1016 /j.scienta.2022.111216. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Editor assigned by journal 28 May, 2024 Submission checks completed at journal 27 May, 2024 First submitted to journal 25 May, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4476184","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":307566670,"identity":"fac873b1-aee5-4ba8-91f0-b916f6009c4b","order_by":0,"name":"Zhiqian Yu","email":"","orcid":"","institution":"Hainan University","correspondingAuthor":false,"prefix":"","firstName":"Zhiqian","middleName":"","lastName":"Yu","suffix":""},{"id":307566671,"identity":"63c2bdfe-43d6-4d63-80eb-889123a230f4","order_by":1,"name":"Wenjing Kang","email":"","orcid":"","institution":"Hainan University","correspondingAuthor":false,"prefix":"","firstName":"Wenjing","middleName":"","lastName":"Kang","suffix":""},{"id":307566676,"identity":"1eeef148-1861-4601-becc-dbcfa413f35c","order_by":2,"name":"Zhengke Zhang","email":"","orcid":"","institution":"Hainan University","correspondingAuthor":false,"prefix":"","firstName":"Zhengke","middleName":"","lastName":"Zhang","suffix":""},{"id":307566677,"identity":"11071ea5-4d2c-4ff3-9457-6e60063f6dc1","order_by":3,"name":"Ziqin Yang","email":"","orcid":"","institution":"Chinese Academy of Tropical Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Ziqin","middleName":"","lastName":"Yang","suffix":""},{"id":307566679,"identity":"ee0d2b99-2daa-4877-856c-881af35757a1","order_by":4,"name":"Yueming Jiang","email":"","orcid":"","institution":"Chinese Academy of Sciences","correspondingAuthor":false,"prefix":"","firstName":"Yueming","middleName":"","lastName":"Jiang","suffix":""},{"id":307566680,"identity":"cb01d9e3-d3cd-4af2-9ae5-60d7d282cd7e","order_by":5,"name":"Yonggui Pan","email":"","orcid":"","institution":"Hainan University","correspondingAuthor":false,"prefix":"","firstName":"Yonggui","middleName":"","lastName":"Pan","suffix":""},{"id":307566682,"identity":"63e5dc27-d92e-4599-baed-f901b15bdd91","order_by":6,"name":"Jiali Yang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABA0lEQVRIiWNgGAWjYBACxmYGxgMJIBZ7DwNDAlRUgoAWBogWnjNEagGBAxBlOQgRvFqY25kfHHjYZpcnH/n24IeHO+zyDA4wH7zNw2CXh9thbAYHEtuSiw1v5yVLJJ5JLjY4wJZszcOQXIzHLyAtzIkbZ+cYSIAYGw7wmEnzMBxIbMCphf0DUEt94saZZ4x/gBgbDvB/I6CFB2TL4cT5EjxmEiAG0BY2QloKDiScO564gSfHzCKx7XjizMNsxpZzDJJxajHsP77x4Y+y6sT57WeMb/5sq07sO9788MabCjvcWkASjGwMwECACTGDCAMc6oFAHkz+ATJwGToKRsEoGAWjAADBgF5CpHyGnAAAAABJRU5ErkJggg==","orcid":"","institution":"Hainan University","correspondingAuthor":true,"prefix":"","firstName":"Jiali","middleName":"","lastName":"Yang","suffix":""}],"badges":[],"createdAt":"2024-05-25 09:31:54","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4476184/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4476184/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":58055538,"identity":"36af3858-7948-4729-a6bb-913f3f4dfac2","added_by":"auto","created_at":"2024-06-10 14:02:53","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":115412,"visible":true,"origin":"","legend":"\u003cp\u003eEndocarp browning index (A) and aril breakdown index (B) in control and 0.02% TBHQ-treated longan fruit stored at 25 °C. Each bar indicates the standard error (SE) of the means (n = 3). *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-4476184/v1/310a835495fa0460a301229a.png"},{"id":58055541,"identity":"5551c388-d8e7-4f9d-85b8-0c4f643fdc75","added_by":"auto","created_at":"2024-06-10 14:02:53","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":338151,"visible":true,"origin":"","legend":"\u003cp\u003eH\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2 \u003c/sub\u003econtent (A), production rate of O\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e-. \u003c/sup\u003e(B), MDA content (C) and DPPH scavenging rate (D) in control and 0.02% TBHQ-treated longan fruit stored at 25 °C. Each bar indicates the standard error (SE) of the means (n = 3). *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-4476184/v1/7f46c72fdcc4cab4d0df7efe.png"},{"id":58056004,"identity":"c8162ea3-68ce-490d-964f-81ceeddad921","added_by":"auto","created_at":"2024-06-10 14:10:54","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":248803,"visible":true,"origin":"","legend":"\u003cp\u003eThe activities of PPO (A), POD (B)and content of total phenolic (C), ASA (D), GSH (E) in control and 0.02% TBHQ-treated longan fruit stored at 25 °C. Each bar indicates the standard error (SE) of the means (n = 3). *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-4476184/v1/621dda12c1fcb452b3492897.png"},{"id":58055542,"identity":"419556c2-94bd-4881-9469-866685b9e865","added_by":"auto","created_at":"2024-06-10 14:02:54","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":293818,"visible":true,"origin":"","legend":"\u003cp\u003eThe activities of SOD (A), CAT (B), APX (C), GR (D), MDHAR (E) and DHAR (F) in control and 0.02% TBHQ-treated longan fruit stored at 25 °C. Each bar indicates the standard error (SE) of the means (n = 3). *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-4476184/v1/fe56d589d2cb907ea6afec10.png"},{"id":58055543,"identity":"2df4fb71-0c0b-4457-8920-eed7865b6f34","added_by":"auto","created_at":"2024-06-10 14:02:54","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":195758,"visible":true,"origin":"","legend":"\u003cp\u003eThe expression level of \u003cem\u003eDlSOD \u003c/em\u003e(A),\u003cem\u003eDlCAT \u003c/em\u003e(B),\u003cem\u003e DlAPX \u003c/em\u003e(C), \u003cem\u003eDlGR \u003c/em\u003e(D) in longan fruit. Each bar indicates the standard error (SE) of the means (n = 3). *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-4476184/v1/3c9e5d3ab4863fecf241d65f.png"},{"id":58055539,"identity":"98b71506-ef40-4491-bc57-a1ed4177972b","added_by":"auto","created_at":"2024-06-10 14:02:53","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":129983,"visible":true,"origin":"","legend":"\u003cp\u003eProposed mechanism of TBHQ in alleviating endocarp browning of longan fruit by regulating antioxidant metabolism.\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-4476184/v1/6208b45aa15bb204ac964c95.png"},{"id":58056503,"identity":"e289bfab-6c95-4573-b934-93d926ca317b","added_by":"auto","created_at":"2024-06-10 14:18:54","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1916863,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4476184/v1/e9f98c4e-ff21-4d89-8513-91b44405906a.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"tert-Butylhydroquinone alleviates postharvest endocarp browning of longan fruit by regulating antioxidant metabolism","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eLongan (\u003cem\u003eDimocarpus longan\u003c/em\u003e Lour.) fruit is nutrient-rich and attracts widespread popularity among consumers owing to its distinctive flavor, succulent texture, and multiple health benefits (Lin et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). However, longan fruit is susceptible to endocarp browning and pulp breakdown after harvest, causing a decline in storage quality and severe limitation in commercial trade (Li et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Liu et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Hence, developing new strategies is crucial for improving storage quality and prolonging shelf life of longan fruit.\u003c/p\u003e \u003cp\u003eReactive oxygen species (ROS) are acknowledged as signaling molecules in plant cells and are involved in various physiological processes including ripening, senescence, and stress response to harsh environment (Decros et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). However, excess ROS would induce oxidative damage to protein, DNA, and lipid, which accelerates cellular dysfunction and causes postharvest physiological disorders (Tan et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Mounting evidence suggests that sustained accumulation of ROS is the main factor that causes postharvest endocarp browning of longan fruit. Excessive amounts of ROS accelerate lipid peroxidation in membranes, resulting in the breakdown of cell structure and the following disruption of enzyme-substrate compartmentalization, which allows the interaction between polyphenol oxidases (PPOs) that located in cytoplasm and their phenolic substrates from vacuoles (Pan et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Yan et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The browning reactions are then triggered, PPOs catalyze continuous oxidation steps and form redox-active quinones, which subsequently react with amino acids, polyphenols, and proteins, and converted into brown polymers, melanin (Zhang et al. \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). To neutralize the negative effects of ROS, organisms employ antioxidant defense systems to remove damaging radicals and recover oxidatively damaged lipid and protein (Liu et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Postharvest treatments capable of enhancing organisms\u0026rsquo; antioxidant defense systems are beneficial to alleviate postharvest browning and prolong shelf life of longan fruit (Corpas et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cem\u003eTert\u003c/em\u003e-Butylhydroquinone (TBHQ) is a synthetic phenolic addictive commonly applied in food preservation. This chemical is low cost, wide availability, and high performance, and has been found in various food products that contain animal fats and lipids. Moreover, TBHQ is considered to be safe and can be directly consumed at concentrations no greater than 0.02%, according to the official guidance (Ramis-Ramos \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2003\u003c/span\u003e). It\u0026rsquo;s evidenced that TBHQ exhibits superior antioxidant and anti-fungi capacity, thus is able to inhibit the oxidative deterioration of oils (Hung et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Wang et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). However, there exists very scarce information and reports on its application in fruit preservation.\u003c/p\u003e \u003cp\u003eThis work aimed to evaluate the role of TBHQ against endocarp browning of longan fruit combined with antioxidant capacity during postharvest storage. Specific analyses focused on basic quality parameters (endocarp browning index, pulp breakdown index, MDA content), ROS biosynthesis (contents of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e and O\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e\u0026minus;\u0026sdot;\u003c/sup\u003e, activities and gene expressions of oxidase PPO and POD), endogenous antioxidant defense systems including enzymatic activities and gene expressions as well as non-enzymatic antioxidants. These results are helpful to provide a safe and effective strategy to maintain postharvest quality and extend shelf life of longan fruit.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Fruit materials and treatments\u003c/h2\u003e \u003cp\u003eLongan fruit (\u003cem\u003eDimocarpus longan\u003c/em\u003e Lour.) were picked from an orchard close to Hongqi town in Haikou City, Hainan Province, China, and immediately transferred to our laboratory at Hainan University. Fresh fruit then underwent a 3-min sterilization by being immersed in 0.1% sporgon (w/v) solution. A total of 900 longan fruit with consistent size, maturity, and free of visible flaws were carefully chosen and divided randomly and equally into two groups. One was submerged in a 0.2 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e TBHQ (w/v) solution at 25\u0026deg;C for 3 min. The other was subjected to a 3-min treatment with distilled water at the same temperature, and serving as control. The optimum concentration of TBHQ (0.2 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) was determined based on our preliminary study of endocarp browning index and aril breakdown index using 0.05, 0.1, 0.2 and 0.5 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e TBHQ.\u003c/p\u003e \u003cp\u003eAfter TBHQ or distilled water treatment, the fruit were air-dried and subsequently stored at the temperature of 25\u0026thinsp;\u0026plusmn;\u0026thinsp;1\u0026deg;C and relative humidity of 85\u0026ndash;90% for a duration of 8 days. Pericarp tissues were collected at intervals of 2 days, immediately frozen in liquid nitrogen, and preserved at \u0026minus;\u0026thinsp;80\u0026deg;C for further study. At every time point, three biological replicates were conducted for physiological parameters analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Endocarp browning and aril breakdown index\u003c/h2\u003e \u003cp\u003eEndocarp browning was assessed based on the browning area of inner pericarp, which could be divided into 6 grades, with 1\u0026thinsp;=\u0026thinsp;no browning; 2\u0026thinsp;=\u0026thinsp;less than 25% browning area; 3\u0026thinsp;=\u0026thinsp;25\u0026ndash;50% browning area; 4\u0026thinsp;=\u0026thinsp;50\u0026ndash;75% browning area; 5\u0026thinsp;=\u0026thinsp;75\u0026ndash;100% browning area; 6\u0026thinsp;=\u0026thinsp;All browning. Endocarp browning index = \u0026sum; (browning scale \u0026times; fruit number of corresponding scale) / (total fruit number).\u003c/p\u003e \u003cp\u003eAril breakdown index was determined by referencing Chen et al. (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2015\u003c/span\u003e) (Chen et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). According to the extent of aril breakdown area, breakdown index could be divided into 4 grades with 0\u0026thinsp;=\u0026thinsp;no breakdown, 1\u0026thinsp;=\u0026thinsp;less than 25% breakdown area, 2\u0026thinsp;=\u0026thinsp;25\u0026ndash;50% breakdown area, 3\u0026thinsp;=\u0026thinsp;50\u0026ndash;75% breakdown area, and 4\u0026thinsp;=\u0026thinsp;more than 75% breakdown area. Aril breakdown index = \u0026sum; (breakdown scale \u0026times; fruit number of corresponding scale) / (total fruit number).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 ROS and MDA analysis\u003c/h2\u003e \u003cp\u003eO\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e\u0026middot; production rate was determined by following the procedure described in the study of Chen et al. (2020) (Chen et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2020b\u003c/span\u003e), and expressed as mmol min\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e kg \u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e on a fresh weight basis. The content of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e was analyzed using an H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e content assay kit (G0112W, Grace Biotechnology Co. Ltd., Suzhou, Jiangsu, China) according to the protocols provided by manufacturer, and expressed as mmol kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e on a fresh weight basis. The malondialdehyde (MDA) content was determined according to the method of Lin et al. (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2014\u003c/span\u003e) (Lin et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2014\u003c/span\u003e), and the results are presented as mmol kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e on a fresh weight basis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Assay of DPPH scavenging rate\u003c/h2\u003e \u003cp\u003eThe assay of DPPH scavenging rate was conducted with reference to methods in Huang et al. (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) with slight modifications (Huang et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Briefly, 1 g of frozen pericarp powder was mixed with 5 mL of methanol. After homogenization, the mixture was subjected to centrifugation with 12 000 \u0026times; g force, 30 min. The supernatant (2 mL) was collected and added to 2 mL of 0.1 mM DPPH. The mixture was then incubated at 25\u0026deg;C under dark conditions for 20 min. Absorbance at the wavelength of 517 nm was recorded.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Assays of antioxidant enzyme activities\u003c/h2\u003e \u003cp\u003eTo determine the activities of SOD, CAT, APX, and GR, 1 g of frozen pericarp powder was homogenized in various buffers. Details are described in the study of Zhang et al. (\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2015\u003c/span\u003e) (Zhang et al. \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2015\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eSOD activity was determined according to the inhibition capacity of SOD on nitro blue tetrazolium (NBT) photoreduction. One unit (U) of SOD activity was defined as the amount of enzyme used to inhibit the reduction of 50% NBT per min monitored at the wavelength of 560 nm.\u003c/p\u003e \u003cp\u003eCAT activity was assessed by recording the alternation of absorbance at 240 nm based on its decomposing capacity on H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e. One unit (U) of activity was defined as the amount of enzyme which catalyzed the degradation of 1 nmol of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e every min.\u003c/p\u003e \u003cp\u003eAPX activity was determined by measuring the alternation of absorbance at 290 nm caused by APX-catalyzed oxidation of ascorbic acid after adding H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e. One unit (U) of APX activity was defined as the enzyme amount required for oxidation of 1 \u0026micro;mol of ascorbic acid every min.\u003c/p\u003e \u003cp\u003eThe activity of GR was assessed by tracking the glutathione-dependent oxidation of NADPH at 340 nm. One unit (U) of activity was defined as the GR amount required to oxidize 1 nmol of NADPH every min.\u003c/p\u003e \u003cp\u003eMDHAR and DHAR activities were measured by following protocols provided by kits of G0213F and G0212F acquired from Suzhou Grace Biotech. One unit (U) of MDHAR activity was defined as the enzyme amount that is required to oxidize 1 nmol of NADH every min. One unit (U) of DHAR activity was defined as the amount of enzyme that generated 1 nmol of AsA every min.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 PPO, POD activities assays\u003c/h2\u003e \u003cp\u003ePPO activity was assessed using an enzymatic assay kit of PPO-1-Y bought from (Comin Biotech Co. Ltd, Suzhou, Jiangsu, China) with reference to the protocols provided by the manufacturer. One unit (U) of activity was defined as the amount of PPO that gave rise to an increment in absorbance of 0.005 every min.\u003c/p\u003e \u003cp\u003ePOD activity was analyzed with reference to methods described in Tian et al. (\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) (Tian et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). One unit (U) of enzyme was defined as the amount of POD that was required to induce a rise in absorbance of 0.01 at 470 nm every min.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Total phenols, GSH, and AsA analysis\u003c/h2\u003e \u003cp\u003eThe concentrations of GHS and AsA were determined by following approaches described in Zhang et al. (\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2018\u003c/span\u003e) (Zhang et al. \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Absorbance at 412 and 534 nm were measured. GSH and ASA were expressed as mmol kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e and g kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e on a fresh weight basis, respectively.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8 RT-qPCR analysis\u003c/h2\u003e \u003cp\u003eTotal RNA of pericarp tissues was extracted using a cetyltrimethylammonium bromide (CTAB)-based method reported in Nian et al. (\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) (Nian et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). The purified RNA served as a template for reverse transcription to synthesize the first strand cDNA by using FastKing First Strand cDNA Synthesis Kit (KR118, Tiangen Biotech Co. Ltd., Beijing, China). Primers used in qPCR reactions were designed using Primer 6.0, which were listed in Table \u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. The reaction system with 20 \u0026micro;L total volume of RT-qPCR was prepared by following the protocol of FastKing One Step RT-PCR Kit (KR123, Tiangen Biotech). After preparation, RT-qPCR was conducted using CFX96 Real-Time PCR system (Bio-Rad, Hercules, CA, USA). The relative expression levels were determined based on the 2\u003csup\u003e\u0026minus;ΔΔCT\u003c/sup\u003e method. \u003cem\u003eDlActin\u003c/em\u003e was chosen as the reference gene, whose expression was used as internal control.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences for RT-qPCR.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eDlActin\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACCACTACTGCTGAACGGGAAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCCTCCAACTCCTGCTCATAGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eDlSOD\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCACCACCAGAAGCATCACCAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGCCCTCCGCCGTTGAACTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eDlCAT\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAACGTGTTGTCCATGCAAGAGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGGAGGATGATAGGCGTCTGAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eDlAPX\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCACGAGGCTAACAACGGTCTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACAGCAACAACTCCAGCCAACT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eDlGR\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGCAACTACGACTTCGACCTCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGCTCGCAGACGGCAACAGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9 Statistical analyses\u003c/h2\u003e \u003cp\u003eData were presented as mean value\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error (SE) based on measurements from three repeated experiments. The statistical program SPSS 22.0 was employed for means comparison using independent samples \u003cem\u003et\u003c/em\u003e-test analysis. Asterisk denoted significant differences between control and TBHQ-treated group (*\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, **\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Graphs in this study were prepared by using Origin 9.1.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results and discussion","content":"\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e3.1. Endocarp browning index, aril breakdown index\u003c/h2\u003e \u003cp\u003eEndocarp browning occurs in deteriorated longan fruit, and is one of the main factors that restrict shelf life of fresh product (Long et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Sun et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Our study found that endocarp browning index in control fruit increased continuously at 25 ℃, with values from 1 to 2.62 after 8 d storage (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). In comparison, exogenous TBHQ treatment significantly decelerated the browning development, and the browning index in TBHQ-treated fruit raised from day 2 and reached to 2.12 at day 8 which was 19.1% lower than in control fruit.\u003c/p\u003e \u003cp\u003eAril breakdown is another noticeable feature of quality deterioration in harvested longan fruit (Thavong et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Wu et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Aril breakdown index was calculated based on the average breakdown area that occupies picked fruit, which reflects breakdown severity of edible tissues. Consistent with browning development, aril breakdown index showed continuous increasement in both two groups. However, TBHQ treatment notably suppressed the advancement of aril breakdown as indicated by delayed increases in aril breakdown index (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e1\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003eChemicals that exhibit antioxidant property are supposed to have positive effect on fruit preservation. It has been reported that application of antioxidants such as propyl gallate, α-lipoic acid, sodium \u003cem\u003epara\u003c/em\u003e-aminosalicylate, and hydrogen water has successfully alleviated pericarp browning of longan and litchi fruit (He et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Li et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Li et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Lin et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Liu et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2022b\u003c/span\u003e). TBHQ is another well-known antioxidant compound, approved as a food additive widely used in oil preservation. However, its effect on fruit preservation is unknown. In this study, we found TBHQ with percent concentration 0.02% (a safe intake concentration) is effective in suppressing endocarp browning and aril breakdown of longan fruit under ambient conditions, suggesting the great potential of TBHQ in fruit preservation.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e3.2 ROS production, MDA content, and DPPH scavenging rate\u003c/h2\u003e \u003cp\u003eROS are highly reactive metabolites derived from oxygen during mitochondrial respiration. Its imbalance between production and removal results in oxidative stress which contributes to cellular senescence and affects storage quality of harvested fruit (Tang et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e and O\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e\u0026middot; are the major ROS involved in oxidative stress. As observed in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, the H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e content presented overall increase with fluctuation during storage, rising from an initial value of 27.63 mmol kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e to the peak of 34.13 mmol kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e at day 2, following a drop to 28.41 mmol kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e at day 6 and a subsequent increase to 31.53 mmol kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e at day 8. TBHQ treatment inhibited the production of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e, with H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e content at days 2, 4, and 6, being 5.2%, 9.1%, and 11.4% lower, in comparison with control. The production rate of O\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e\u0026middot; rose steadily during storage regardless of treatment, but at day 6, the O\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e\u0026middot; production rate was 3.8% lower in TBHQ-treated fruit, compared to control.\u003c/p\u003e \u003cp\u003eMDA is a peroxidation biomarker of membrane lipid caused by oxidative damage (Chomkitichai et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Zhang et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). As observed in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003eC, the MDA content increased steadily and showed analogous tendencies in both control and TBHQ-treated fruit, but the latter had average 17.53% lower values than the former from day 4 to day 8 storage.\u003c/p\u003e \u003cp\u003eDPPH test can be used to assess the antioxidant defense capacity of postharvest fruit by determining ROS scavenging potential (Chen et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2020a\u003c/span\u003e). In this work, the DPPH scavenging rate in control fruit presented an overall decline trajectory with fluctuation during storage (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). TBHQ treatment enhanced the DPPH scavenging rate at days 4 and 6, which was 1.0% and 1.62% higher than control fruit, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003eSuppressed levels of ROS and MDA and enhanced DPPH scavenging ability suggested the positive effect of TBHQ in alleviating oxidative stress, which might be responsible for attenuation of endocarp browning and quality maintenance of postharvest longan fruit. In consistent, the positive correlation between reduced oxidative stress and alleviated browning development after postharvest treatments has also been evidenced in pear, apple, litchi, and longan fruits (He et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Jung and Choi \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Lin et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Zhai et al. \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2018\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e3.4 PPO and POD activities\u003c/h2\u003e \u003cp\u003ePPO is the main enzyme involved in enzymatic browning by catalyzing the oxidating reaction of phenolic substances to form quinones, which are substrates of brown polymers (Liu et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2022a\u003c/span\u003e; Pan et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Its activity affects the progression of pericarp browning. In our work, PPO activity in control fruit showed an overall increasing tendency with initial value of 3.56 \u0026times; 10\u003csup\u003e4\u003c/sup\u003e U kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e to 1.58 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e U kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e at day 8. TBHQ treatment suppressed the increasement of PPO activity, with notable results, 22.6% and 14.7% lower than control at days 4 and 8 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003ePOD also associates with the onset of fruit browning since it catalyzes the oxidation and polymerization of phenolic substances with H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e (Zhang et al. \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). In control longan fruit, POD activity rose initially from 4.77 \u0026times; 10\u003csup\u003e4\u003c/sup\u003e U kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e to the peak of 1.10 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e U kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e at day 4, then decreased to 2.42 \u0026times; 10\u003csup\u003e4\u003c/sup\u003e U kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e at day 8 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). The application of TBHQ suppressed POD activity and resulted in significant lower values at days 2 and 6 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003ePPO and POD are considered as the action targets to control the progression of enzymatic browning in postharvest fruit. Appropriate postharvest strategies offer a promising way to suppress PPO and POD activities. Lin et al. (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2013\u003c/span\u003e) reported propyl gallate treatment alleviated longan fruit browning which could be ascribed to the decreased PPO and POD activities (Lin et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). TBHQ treatment is also useful in PPO and POD inhibition.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e3.5 Total phenols, GSH, and AsA contents\u003c/h2\u003e \u003cp\u003eAerobic organisms have integrated antioxidant systems to defend against oxidative damage triggered by ROS stress and maintain cellular redox homeostasis (Meitha et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Zhu et al. \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The antioxidant system consists of two parts, endogenous non-enzymatic and enzymatic antioxidants. Non-enzymatic antioxidants are represented by low-molecular-weight compounds, including phenolics, ASA and GSH (Yun et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In this work, total phenolics content in control fruit raised initially from 1.63 g kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e and attained the maximum of 1.87 g kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e at day 6, then dropped to 1.59 g kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e at day 8 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). In comparison, TBHQ-treated fruit presented noticeably higher levels of total phenolics than control at days 4 and 8 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). AsA content in both groups displayed a decreasing trajectory during storage. TBHQ treatment impeded the decrease of AsA content in the last 4-d storage with values of 8.4% and 11.4% higher than control fruit at days 4 and 6 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). The GSH content of control fruit dropped from 1.58 mmol kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e to 1.16 mmol kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e within the first 4 d, followed by an increment to 1.34 mmol kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e at day 6, then decreased to 1.03 mmol kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e at day 8 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). Comparatively, fruit with TBHQ treatment exhibited significantly higher levels of 13.3% in average GSH content during 4\u0026ndash;8 d of storage (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003eE).\u003c/p\u003e \u003cp\u003ePhenolics are secondary metabolites, capable of scavenging oxygen free radicals in response to oxidative environment (Bai et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). AsA is regarded as a ROS detoxifying chemical and facilitates the decomposition of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e under the action of APX (Wang et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2018a\u003c/span\u003e; Zhou et al. \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). GSH is a cofactor for glutathione peroxidase and involves in the transformation of oxidated ASA to its active reduced form (Cai et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). These endogenous non-enzymatic antioxidants contribute to the enhanced ROS scavenging ability of longan fruit and attenuate postharvest endocarp browning. TBHQ treatment markedly increased these antioxidants to reduce fruit deterioration. Consistent with our results, higher levels of endogenous AsA, GSH, or phenolics were observed in apple polyphenols-, L-cysteine- or exogenous AsA-treated postharvest fresh products, which led to decreased ROS levels, and thus retarded fruit browning and senescence (Ali et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Liu et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Su et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e3.6 Antioxidant enzymes activities\u003c/h2\u003e \u003cp\u003eEnzymatic antioxidants are of importance to shield fruit from oxidative stress by scavenging ROS. To investigate ROS scavenging ability of enzymatic antioxidants, we analyzed the activities of SOD, CAT, APX, GR, DHAR, and MDHAR.\u003c/p\u003e \u003cp\u003eAs shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, SOD activity in control declined initially from 1.32 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e U kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e to 1.12 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e U kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e at day 2, followed by a 4-d increment to 1.21 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e U kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, and slightly decreased to 1.17 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e U kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e at day 8. After TBHQ treatment, SOD activity exhibited a similar trajectory, but was averaging 6.4% higher than control during days 2 to 6 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). CAT activity in control declined gradually from 2.49 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e U kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e to 7.73 \u0026times; 10\u003csup\u003e4\u003c/sup\u003e U kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e throughout storage. TBHQ treatment suppressed the decrement in CAT activity and maintained an averaging 26.8% higher level from days 2 to 6, in comparison with control (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). APX activity steadily increased from 1.31 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e U kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e initially to 2.29 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e U kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e at day 8 in control fruit. TBHQ treatment induced a more rapid increment of APX activity, which was averaging 13.9% higher than control from days 2 to 6 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). GR activity in control fruit increased initially from 1.52 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e U kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, and reach a peak of 4.16 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e U kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e at day 6, then dropped to 3.14 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e U kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e at day 8 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). Comparatively, higher GR activity was observed after TBHQ treatment, with values 1.29- and 1.17-fold higher than control at days 4, and 6, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). MDHAR activity in control fruit decreased continuously over 6 d from 5.47 \u0026times; 10\u003csup\u003e4\u003c/sup\u003e U kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e to the minimum of 3.11 \u0026times; 10\u003csup\u003e4\u003c/sup\u003e U kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). TBHQ-treated fruit maintained higher MDHAR activity, which was averaging 36.4% higher than control at days 6 to 8 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). DHAR activity in control fruit decreased initially from 1.89 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e U kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e to 1.37 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e U kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e at day 4, then increased to the peak value of 1.86 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e U kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e at day 6, then declined to 1.64 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e U kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e at day 8 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e4\u003c/span\u003eF). Fruit with TBHQ treatment showed increased DHAR activity. Compared to control fruit, significant difference was observed at days 6 and 8, with values of 21.4% and 16.5% higher after TBHQ treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e4\u003c/span\u003eF).\u003c/p\u003e \u003cp\u003eSOD, CAT, APX, GR, DHAR, and MDHAR are essential enzymatic antioxidants directly and/or indirectly involved in scavenging ROS (Zhu et al. \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Among them, SOD catalyzes the dismutation reaction of O\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e\u0026middot; to form H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e, which is decomposed into H\u003csub\u003e2\u003c/sub\u003eO and O\u003csub\u003e2\u003c/sub\u003e under the action of CAT (Wang et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2018b\u003c/span\u003e). APX, GR, MDHAR, and DHAR participate in the ascorbate-glutathione cycle, which provides reducing power to regenerate reduced GSH and AsA (Pan et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Li et al. (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) addressed that the activation of antioxidant enzymes contributes to the reduced oxidative damage and the alleviated endocarp browning of longan fruit (Li et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). In this study, TBHQ treatment led to high levels of SOD, CAT, APX, GR, DHAR, and MDHAR, which might be linked to the suppression of enzymatic browning induced by oxidative stress.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e3.7 Gene expression of DlSOD, DlCAT, DlAPX, and DlGR\u003c/h2\u003e \u003cp\u003eTo measure the expression levels of genes that involve in ROS metabolism, we extracted total RNA and conducted RT-qPCR. Results are shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e5\u003c/span\u003e. Different from the fluctuating trajectory of SOD activity, \u003cem\u003eDlSOD\u003c/em\u003e expression in control fruit raised initially, and peaked at day 4 with 2.3-fold increases, then dropped dramatically to 0.4-fold at day 8. TBHQ treatment significantly elevated the expression of \u003cem\u003eDlSOD\u003c/em\u003e at days 2 and 4, which was 1.7- and 2.5-fold of that in control fruit (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). Similarly, the \u003cem\u003eDlCAT\u003c/em\u003e expression in control fruit declined sharply in the first 2 d and reached to 9.3-folds, then decreased to 0.6-fold at day 8. TBHQ treatment significantly upregulated the expression of \u003cem\u003eDlCAT\u003c/em\u003e which was 3.4 times of that in control at day 2 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). Notably, the changing tendency of \u003cem\u003eDlCAT\u003c/em\u003e expression was also different from CAT activity. For \u003cem\u003eDlAPX\u003c/em\u003e, TBHQ-treated fruits maintained higher expression levels during the first 6 d of storage, by averaging 35.68% higher than control, which is consistent with the changing trend of APX activity (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). Similar to \u003cem\u003eDlSOD\u003c/em\u003e, \u003cem\u003eDlGR\u003c/em\u003e expression presented an upward tendency in the first 4 d, then slightly declined in the latter storage. TBHQ treatment significantly upregulated \u003cem\u003eDlGR\u003c/em\u003e expression, with values of 2.91- and 2.11-folds higher than control at days 2 and 4 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). The overall trend of \u003cem\u003eDlGR\u003c/em\u003e expression was in accordance with GR activity, though the peak value of GR activity was 2 d later in comparison with \u003cem\u003eDlGR\u003c/em\u003e expression. The difference between enzymatic activity and gene expression might be explained by the imbalance between biosynthesis and degradation of enzyme, and the complicated regulation in transcription and translation process (Wen et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). The expression of genes relevant to ROS metabolism was stimulated by TBHQ, thereby reinforcing the antioxidant system and the preservation quality of longan fruit.\u003c/p\u003e \u003c/div\u003e"},{"header":"4. Conclusion","content":"\u003cp\u003eIn conclusion, application of TBHQ effectively suppressed the endocarp browning of longan fruit at 25\u0026deg;C storage. This treatment alleviated oxidative stress, which might be linked to its positive effect in enhancing ROS-defensing system by upregulating gene expression of antioxidant enzymes, improving enzymatic oxidant activities, as well as maintaining high levels of non-enzymatic oxidants. The proposed mechanism of TBHQ-induced quality maintenance in postharvest longan fruit is presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e6\u003c/span\u003e. Our study suggested that TBHQ might be a promising chemical in fruit preservation due to its inducing effect in antioxidant capacity.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor Contribution\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eZhiqian Yu performed the experiments and wrote the main manuscript. Wenjing Kang performed formal analysis. Zhengke Zhang reviewed this manuscript. Ziqin Yang acquired funding for this project. Yueming Jiang reviewed this manuscript. Yonggui Pan supervised this project, and reviewed this manuscript. Jiali Yang conceptualized this project, acquired funding, critically reviewed and revised this manuscript.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by Natural Science Foundation of Hainan Province, China\u0026nbsp;(223RC403 and 323RC535), Collaborative Innovation Center of Hainan University (XTCX2022NYC07), and Hainan Provincial Key Laboratory of Food Nutrition and Functional Food (KF202207).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eConflicts of interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAli S, Khan AS \u0026amp; Malik AU. (2016). Postharvest l-cysteine application delayed pericarp browning, suppressed lipid peroxidation and maintained antioxidative activities of litchi fruit. \u003cem\u003ePostharvest Biology and Technology, 121\u003c/em\u003e, 135-142. https://dx.doi.org/10.1016/j.postharvbio.2016.07.015.\u003c/li\u003e\n\u003cli\u003eBai X, Yang Z, Shen W, Shao Y, Zeng J \u0026amp; Li W. (2022). Polyphenol treatment delays the browning of litchi pericarps and promotes the total antioxidant capacity of litchi fruit. \u003cem\u003eScientia Horticulturae, 291\u003c/em\u003e, 110563. https://dx.doi.org/10.101 6/j.scienta.2021.110563.\u003c/li\u003e\n\u003cli\u003eCai Y, Cao S, Yang Z \u0026amp; Zheng Y. (2011). MeJA regulates enzymes involved in ascorbic acid and glutathione metabolism and improves chilling tolerance in loquat fruit. \u003cem\u003ePostharvest Biology and Technology, 59\u003c/em\u003e, 324-326. https://dx.doi.org/1 0.1016/j.postharvbio.2010.08.020.\u003c/li\u003e\n\u003cli\u003eChen M, Lin H, Zhang S, Lin Y, Chen Y \u0026amp; Lin Y. (2015). Effects of adenosine triphosphate (ATP) treatment on postharvest physiology, quality and storage behavior of longan fruit. \u003cem\u003eFood and Bioprocess Technology, 8\u003c/em\u003e(5), 971-982. https://dx.doi.org/10.1007/s11947-014-1462-z.\u003c/li\u003e\n\u003cli\u003eChen X, Liang L \u0026amp; Han C. (2020a). Borate suppresses the scavenging activity of gallic acid and plant polyphenol extracts on DPPH radical: A potential interference to DPPH assay. \u003cem\u003eLWT - Food Science and Technology, 131\u003c/em\u003e, 109769. https://dx.doi. org/10.1016/j.lwt.2020.109769.\u003c/li\u003e\n\u003cli\u003eChen Y, Sun J, Lin H, Lin M, Lin Y, Wang H \u0026amp; Hung Y. (2020b). Salicylic acid treatment suppresses \u003cem\u003ePhomopsis longanae\u003c/em\u003e Chi-induced disease development of postharvest longan fruit by modulating membrane lipid metabolism. \u003cem\u003ePostharvest Biology and Technology, 164\u003c/em\u003e, 111168. https://dx.doi.org/10.1016/ j.postharvbio.2020.111168.\u003c/li\u003e\n\u003cli\u003eChomkitichai W, Chumyam A, Rachtanapun P, Uthaibutra J \u0026amp; Saengnil K. (2014). Reduction of reactive oxygen species production and membrane damage during storage of \u0026lsquo;Daw\u0026rsquo; longan fruit by chlorine dioxide. \u003cem\u003eScientia Horticulturae, 170\u003c/em\u003e, 143-149. https://dx.doi.org/10.1016/j.scienta.2014.02.036.\u003c/li\u003e\n\u003cli\u003eCorpas FJ, Rodr\u0026iacute;guez-Ruiz M, Mu\u0026ntilde;oz-Vargas MA, Gonz\u0026aacute;lez-Gordo S, Reiter RJ \u0026amp; Palma JM. (2022). Interactions of melatonin, ROS and NO during fruit ripening: An update and prospective view. \u003cem\u003eJournal of Experimental Botany, 24\u003c/em\u003e, 5948-5960. https://dx.doi.org/10.1093/jxb/erac128.\u003c/li\u003e\n\u003cli\u003eDecros G, Baldet P, Beauvoit B, Stevens R, Flandin A, Colombi\u0026eacute; S, Gibon Y \u0026amp; P\u0026eacute;triacq P. (2019). Get the balance right: ROS homeostasis and redox signalling in fruit. \u003cem\u003eFrontiers in Plant Science, 10\u003c/em\u003e, 1091. https://dx.doi.org/10.3389/fpls.2019.01091.\u003c/li\u003e\n\u003cli\u003eHe M, Wu Y, Hong M, Yun Z, Li T \u0026amp; Jiang Y. (2021). \u0026alpha;-Lipoic acid treatment alleviates postharvest pericarp browning of litchi fruit by regulating antioxidant ability and energy metabolism. \u003cem\u003ePostharvest Biology and Technology, 180\u003c/em\u003e, 111629. https://dx.doi.org/10.1016/j.postharvbio.2021.111629.\u003c/li\u003e\n\u003cli\u003eHuang H, Wang L, Bi F \u0026amp; Xiang X. (2022). Combined application of malic acid and lycopene maintains content of phenols, antioxidant activity, and membrane integrity to delay the pericarp browning of litchi fruit during storage. \u003cem\u003eFrontiers in Nutrition, 9\u003c/em\u003e, 849385. https://dx.doi.org/10.3389/fnut.2022.849385.\u003c/li\u003e\n\u003cli\u003eHung YT, Hanson AR, Urriola PE, Johnston LJ, Kerr BJ \u0026amp; Shurson GC. (2019). Addition of tert-butylhydroquinone (TBHQ) to maize oil reduces lipid oxidation but does not prevent reductions in serum vitamin E in nursery pigs. \u003cem\u003eJournal of Animal Science and Biotechnology, 10\u003c/em\u003e, 51-62. https://dx.doi.org/10.1186/s40104-019-0362-5.\u003c/li\u003e\n\u003cli\u003eJung S-K \u0026amp; Choi H-S. (2020). Browning of \u0026lsquo;Empire\u0026rsquo; and \u0026lsquo;Fuji\u0026rsquo; apples as affected by antioxidant activities. \u003cem\u003eAgronomy, 10\u003c/em\u003e, 1883. https://dx.doi.org/10.3390/ agronomy10121883.\u003c/li\u003e\n\u003cli\u003eLi T, Shi D, Wu Q, Zhang Z, Qu H \u0026amp; Jiang Y. (2019). Sodium \u003cem\u003epara\u003c/em\u003e-aminosalicylate delays pericarp browning of litchi fruit by inhibiting ROS-mediated senescence during postharvest storage. \u003cem\u003eFood Chemistry, 278\u003c/em\u003e, 552-559. https://dx.doi.org /10.1016/j.foodchem.2018.11.099.\u003c/li\u003e\n\u003cli\u003eLi T, Wu Q, Zhou Y, Yun Z, Duan X \u0026amp; Jiang Y. (2018). l -Cysteine hydrochloride delays senescence of harvested longan fruit in relation to modification of redox status. \u003cem\u003ePostharvest Biology and Technology, 143\u003c/em\u003e, 35-42. https://dx.doi.org/10.1016/ j.postharvbio.2018.04.011.\u003c/li\u003e\n\u003cli\u003eLin Y, Li N, Lin H, Lin M, Chen Y, Wang H, Ritenour MA \u0026amp; Lin Y. (2020). Effects of chitosan treatment on the storability and quality properties of longan fruit during storage. \u003cem\u003eFood Chemistry, 306\u003c/em\u003e, 125627. https://dx.doi.org/10.1016/j. foodchem.2019.125627.\u003c/li\u003e\n\u003cli\u003eLin Y, Lin H, Zhang S, Chen Y, Chen M \u0026amp; Lin Y. (2014). The role of active oxygen metabolism in hydrogen peroxide-induced pericarp browning of harvested longan fruit. \u003cem\u003ePostharvest Biology and Technology, 96\u003c/em\u003e, 42-48. https://dx.doi.org/10.1016 /j.postharvbio.2014.05.001.\u003c/li\u003e\n\u003cli\u003eLin Y, Lin Y, Lin H, Chen Y, Wang H \u0026amp; Shi J. (2018). Application of propyl gallate alleviates pericarp browning in harvested longan fruit by modulating metabolisms of respiration and energy. \u003cem\u003eFood Chemistry, 240\u003c/em\u003e, 863-869. https://dx.doi.org/ 10.1016/j.foodchem.2017.07.118.\u003c/li\u003e\n\u003cli\u003eLin YF, Hu YH, Lin HT, Liu X, Chen YH, Zhang S \u0026amp; Chen QX. (2013). Inhibitory effects of propyl gallate on tyrosinase and its application in controlling pericarp browning of harvested longan fruits. \u003cem\u003eJournal of Agricultural and Food Chemistry, 61\u003c/em\u003e(11), 2889-2895. https://dx.doi.org/10.1021/jf305481h.\u003c/li\u003e\n\u003cli\u003eLiu B, Zhu Q, Zhou X, Zhang X, Dang Z, Liang S, Li G, Zhang Z, Fang F \u0026amp; Pang X. (2022a). Characterization of a pericarp browning related LACCASE 14-4 from longan fruit with a focus on (epi)catechin oxidative polymerization. \u003cem\u003ePostharvest Biology and Technology, 185\u003c/em\u003e, 111802. https://dx.doi.org/10.1016 /j.postharvbio.2021.111802.\u003c/li\u003e\n\u003cli\u003eLiu J, Lin Y, Lin H, Lin M \u0026amp; Fan Z. (2021). Impacts of exogenous ROS scavenger ascorbic acid on the storability and quality attributes of fresh longan fruit. \u003cem\u003eFood Chemistry X, 12\u003c/em\u003e, 100167. https://dx.doi.org/10.1016/j.fochx.2021.100167.\u003c/li\u003e\n\u003cli\u003eLiu J, Zhang W, Hu M, Pan Y, Jiang Y, Zhang Z \u0026amp; Jiang G. (2023). Nitric oxide is involved in melatonin-induced cold tolerance in postharvest litchi fruit. \u003cem\u003ePostharvest Biology and Technology, 196\u003c/em\u003e, 112157. https://dx.doi.org/ 10.1016/j.postharvbio.2022.112157.\u003c/li\u003e\n\u003cli\u003eLiu Q, Xie H, Chen Y, Lin M, Hung Y \u0026amp; Lin H. (2022b). Alleviation of pulp breakdown in harvested longan fruit by acidic electrolyzed water in relation to membrane lipid metabolism. \u003cem\u003eScientia Horticulturae, 304\u003c/em\u003e(26), 111288-111297. https://dx.doi.org /10.1016/j.scienta.2022.111288.\u003c/li\u003e\n\u003cli\u003eLong L, Lai T, Han D, Lin X, Xu J, Zhu D, Guo X, Lin Y, Pan F, Wang Y, Lai Z, Du X, Fang D, Shuai L, Wu Z \u0026amp; Luo T. (2022). A Comprehensive Analysis of Physiologic and Hormone Basis for the Difference in Room-Temperature Storability between \u0026apos;Shixia\u0026apos; and \u0026apos;Luosanmu\u0026apos; Longan Fruits. \u003cem\u003ePlants (Basel), 11\u003c/em\u003e(19), 2503. https://dx.doi.org/10.3390/plants11192503.\u003c/li\u003e\n\u003cli\u003eMeitha K, Pramesti Y \u0026amp; Suhandono S. (2020). Reactive oxygen species and antioxidants in postharvest vegetables and fruits. \u003cem\u003eInternational Journal of Food Science \u0026amp; Technology, 2020\u003c/em\u003e, 8817778. https://dx.doi.org/10.1155/2020/8817778.\u003c/li\u003e\n\u003cli\u003eNian Y, Nan W, Rui L, Yuanzhi S \u0026amp; Wen L. (2021). Cold shock treatment alleviates chilling injury in papaya fruit during storage by improving antioxidant capacity and related gene expression. \u003cem\u003eScientia Horticulturae, 294\u003c/em\u003e, 110784. https://dx.doi.org/10.1016/j.scienta.2021.110784.\u003c/li\u003e\n\u003cli\u003ePan Y, Guo Y, Huang Q, Zhang W \u0026amp; Zhang Z. (2021). Enzymatic browning in relation to permeation of oxygen into the kernel of postharvest areca nut under different storage temperatures. \u003cem\u003eFood Science \u0026amp; Nutrition, 9\u003c/em\u003e(7), 3768-3776. https://dx.doi.org/10.1002/fsn3.2341.\u003c/li\u003e\n\u003cli\u003ePan Y, Jiang Y, Huang Q, Zhu Y, Nie Y, Yuan R \u0026amp; Zhang Z. (2022). Abnormal chilling injury of postharvest papaya is associated with the antioxidant response. \u003cem\u003eJournal of Food Biochemistry, 46\u003c/em\u003e(10), 14272. https://dx.doi.org/10.1111/jfbc.14272.\u003c/li\u003e\n\u003cli\u003eRamis-Ramos G. (2003). Antioxidants | synthetic antioxidants. \u003cem\u003eEncyclopedia of Food Sciences and Nutrition (Second Edition)\u003c/em\u003e, 265-275. https://dx.doi.org/https:// doi.org/10.1016/B0-12-227055-X/00054-7.\u003c/li\u003e\n\u003cli\u003eSu Z, Hu M, Gao Z, Li M, Yun Z, Pan Y, Zhang Z \u0026amp; Jiang Y. (2019). Apple polyphenols delay senescence and maintain edible quality in litchi fruit during storage. \u003cem\u003ePostharvest Biology and Technology, 157\u003c/em\u003e, 110976. https://dx.doi.org/1 0.1016/j.postharvbio.2019.110976.\u003c/li\u003e\n\u003cli\u003eSun Y, Luo M, Ge W, Zhou X, Zhou Q, Wei B, Cheng S \u0026amp; Ji S. (2022). Phenylpropanoid metabolism in relation to peel browning development of cold-stored \u0026apos;Nanguo\u0026apos; pears. \u003cem\u003ePlant Science, 322\u003c/em\u003e, 111363. https://dx.doi.org/ 10.1016/j.plantsci.2022.111363.\u003c/li\u003e\n\u003cli\u003eTan X, Zhao Y, Shan W, Kuang J, Lu W, Su X, Tao N, Lakshmanan P \u0026amp; Chen J. (2020). Melatonin delays leaf senescence of postharvest Chinese flowering cabbage through ROS homeostasis. \u003cem\u003eFood Research International, 138\u003c/em\u003e, 109790. https://dx.doi.org/10.1016/j.foodres.2020.109790.\u003c/li\u003e\n\u003cli\u003eTang J, Chen H, Lin H, Hung Y-C, Xie H \u0026amp; Chen Y. (2021). Acidic electrolyzed water treatment delayed fruit disease development of harvested longans through inducing the disease resistance and maintaining the ROS metabolism systems. \u003cem\u003ePostharvest Biology and Technology, 171\u003c/em\u003e, 111349-111358. https:// dx.doi.org/10.1016/j.postharvbio.2020.111349.\u003c/li\u003e\n\u003cli\u003eThavong P, Archbold DD, Pankasemsuk T \u0026amp; Koslanund R. (2010). Effect of hexanal vapour on longan fruit decay, quality and phenolic metabolism during cold storage. \u003cem\u003eInternational Journal of Food Science \u0026amp; Technology, 45\u003c/em\u003e(11), 2313-2320. https://dx.doi.org/10.1111/j.1365-2621.2010.02401.x.\u003c/li\u003e\n\u003cli\u003eTian J, Xie S, Zhang P, Wang Q, Li J \u0026amp; Xu X. (2022). Attenuation of postharvest peel browning and chilling injury of banana fruit by astragalus polysaccharides. \u003cem\u003ePostharvest Biology and Technology, 184\u003c/em\u003e, 111783. https://dx.doi.org/ 10.1016/j.postharvbio.2021.111783.\u003c/li\u003e\n\u003cli\u003eWang H, Chen YH, Sun JZ, Lin YF, Lin YX, Lin M, Hung YC, Ritenour MA \u0026amp; Lin HT. (2018a). The changes in metabolisms of membrane lipids and phenolics induced by phomopsis longanae chi infection in association with pericarp browning and disease occurrence of postharvest longan fruit. \u003cem\u003eJournal of Agricultural and Food Chemistry, 66\u003c/em\u003e, 12794-12804. https://dx.doi.org/ 10.1021/acs.jafc.8b04616.\u003c/li\u003e\n\u003cli\u003eWang W, Xiong P, Zhang H, Zhu Q, Liao C \u0026amp; Jiang G. (2021). Analysis, occurrence, toxicity and environmental health risks of synthetic phenolic antioxidants: A review. \u003cem\u003eEnvironmental Research, 201\u003c/em\u003e, 111531. https://dx.doi.org/ 10.1016 /j.envres.2021.111531.\u003c/li\u003e\n\u003cli\u003eWang Y, Branicky R, No\u0026euml; A \u0026amp; Hekimi S. (2018b). Superoxide dismutases: Dual roles in controlling ROS damage and regulating ROS signaling. \u003cem\u003eJournal of Cell Biology, 217\u003c/em\u003e, 1915-1928. https://dx.doi.org/10.1083/jcb.201708007.\u003c/li\u003e\n\u003cli\u003eWen B, Cui S, Suo X \u0026amp; Supapvanich S. (2023). Stress response of fresh-cut potatoes to laser irradiation before processing can prevent discoloration and maintain overall quality. \u003cem\u003ePostharvest Biology and Technology, 197\u003c/em\u003e, 112213. https:// dx.doi.org/10.1016/j.postharvbio.2022.112213.\u003c/li\u003e\n\u003cli\u003eWu Y, Xie L, Li Z, Li T \u0026amp; Jiang Y. (2022). Valeric acid delays aril breakdown of longan (\u003cem\u003eDimocarpus longan \u003c/em\u003eLour.) fruit in relation to the regulation of histone deacetylase activity. \u003cem\u003eLWT - Food Science and Technology, 168\u003c/em\u003e, 113959. https:// dx.doi.org/10.1016/j.lwt.2022.113959.\u003c/li\u003e\n\u003cli\u003eYan H, Hongxu C, Jianglin Z, Tian Y \u0026amp; Xiaochun D. (2022). Postharvest H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e treatment affects flavor quality, texture quality and ROS metabolism of \u0026lsquo;Hongshi\u0026rsquo; kiwifruit fruit kept at ambient conditions. \u003cem\u003eFood Chemistry, 405\u003c/em\u003e, 134908. https://dx.doi.org/10.1016/j.foodchem.2022.134908.\u003c/li\u003e\n\u003cli\u003eYun Z, Gao H, Chen X, Chen Z, Zhang Z, Li T, Qu H \u0026amp; Jiang Y. (2021). Effects of hydrogen water treatment on antioxidant system of litchi fruit during the pericarp browning. \u003cem\u003eFood Chemistry, 336\u003c/em\u003e, 127618. https://dx.doi.org/10.1016/j. foodchem.2020.127618.\u003c/li\u003e\n\u003cli\u003eZhai R, Liu J, Liu F, Zhao Y, Liu L, Fang C, Wang H, Li X, Wang Z, Ma F \u0026amp; Xu L. (2018). Melatonin limited ethylene production, softening and reduced physiology disorder in pear (\u003cem\u003ePyrus communis\u003c/em\u003e L.) fruit during senescence. \u003cem\u003ePostharvest Biology and Technology, 139\u003c/em\u003e, 38-46. https://dx.doi.org/10.1016/j.postharvbio.2018.01.017.\u003c/li\u003e\n\u003cli\u003eZhang D, Xu X, Zhang Z, Jiang G, Feng L, Duan X \u0026amp; Jiang Y. (2018). 6-Benzylaminopurine improves the quality of harvested litchi fruit. \u003cem\u003ePostharvest Biology and Technology, 143\u003c/em\u003e, 137-142. https://dx.doi.org/10.1016/j. postharvbio.2018.05.002.\u003c/li\u003e\n\u003cli\u003eZhang W, Jiang H, Cao J \u0026amp; Jiang W. (2021). UV-C treatment controls brown rot in postharvest nectarine by regulating ROS metabolism and anthocyanin synthesis. \u003cem\u003ePostharvest Biology and Technology, 180\u003c/em\u003e, 111613. https://dx.doi.org/10.1016 /j.postharvbio.2021.111613.\u003c/li\u003e\n\u003cli\u003eZhang X, Liu T, Zhu S, Wang D, Sun S \u0026amp; Xin L. (2022). Short-term hypobaric treatment alleviates chilling injury by regulating membrane fatty acids metabolism in peach fruit. \u003cem\u003eJournal of Food Biochemistry, 46\u003c/em\u003e(7), e14113. https://dx.doi.org/10.1111/jfbc.14113.\u003c/li\u003e\n\u003cli\u003eZhang Z, Huber DJ, Qu H, Yun Z, Wang H, Huang Z, Huang H \u0026amp; Jiang Y. (2015). Enzymatic browning and antioxidant activities in harvested litchi fruit as influenced by apple polyphenols. \u003cem\u003eFood Chemistry, 171\u003c/em\u003e, 191-1999. https://dx.doi.org/10.1016/j.foodchem.2014.09.001.\u003c/li\u003e\n\u003cli\u003eZhou C, Dong W, Jin S, Liu Q, Shi L, Cao S, Li S, Chen W \u0026amp; Yang Z. (2022). \u0026gamma;-Aminobutyric acid treatment induced chilling tolerance in postharvest peach fruit by upregulating ascorbic acid and glutathione contents at the molecular level. \u003cem\u003eFrontiers in Plant Science, 13\u003c/em\u003e, 1059979. https://dx.doi.org/10.3389 /fpls.2022.1059979.\u003c/li\u003e\n\u003cli\u003eZhu L, Wang W, Shi J, Zhang W, Shen Y, Du H \u0026amp; Wu S. (2014). Hydrogen sulfide extends the postharvest life and enhances antioxidant activity of kiwifruit during storage. \u003cem\u003eJournal of the Science of Food and Agriculture, 94\u003c/em\u003e(13), 2699-2704. https://dx.doi.org/10.1002/jsfa.6613.\u003c/li\u003e\n\u003cli\u003eZhu L, Yu H, Dai X, Yu M \u0026amp; Yu Z. (2022). Effect of methyl jasmonate on the quality and antioxidant capacity by modulating ascorbate-glutathione cycle in peach fruit. \u003cem\u003eScientia Horticulturae, 303\u003c/em\u003e(20), 111216. https://dx.doi.org/10.1016 /j.scienta.2022.111216.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"food-and-bioprocess-technology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [Food and Bioprocess Technology](https://www.springer.com/journal/11947)","snPcode":"11947","submissionUrl":"https://submission.nature.com/new-submission/11947/3","title":"Food and Bioprocess Technology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"tert-Butylhydroquinone, longan fruit, postharvest, endocarp browning, antioxidant","lastPublishedDoi":"10.21203/rs.3.rs-4476184/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4476184/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eHarvested longan fruit is prone to endocarp browning, which restricts preservation quality and shelf life. The antioxidant system defends against oxidative stress-mediated quality deterioration such as fruit browning. The study aimed to evaluate the effect of \u003cem\u003etert\u003c/em\u003e-Butylhydroquinone (TBHQ) on anti-browning ability of longan fruit in association with antioxidant capacity. The results indicated that application of 0.02% TBHQ significantly suppressed the progression of endocarp browning. In comparison with control, TBHQ treatment decreased the levels of hydrogen peroxide (H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e), superoxide radical (O\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e\u0026minus;\u0026sdot;\u003c/sup\u003e), and malondialdehyde (MDA), and retained high levels of ascorbic acid (AsA), glutathione (GSH), total phenolics as well as 1,1-diphenyl-2-picrylhydrazyl (DPPH) scavenging rate. Enhanced enzymatic activities of superoxide dismutase (SOD), catalase (CAT), ascorbate peroxidase (APX), glutathione reductase (GR), monodehydroascorbate reductase (MDHAR), dehydroascorbate reductase (DHAR), but inhibited polyphenol oxidase (PPO) and peroxidase (POD) activities were also observed in TBHQ-treated fruit. Gene expression analysis suggested oxidative stress-related genes including \u003cem\u003eDlSOD\u003c/em\u003e, \u003cem\u003eDlCAT\u003c/em\u003e, \u003cem\u003eDlGR\u003c/em\u003e, and \u003cem\u003eDlAPX\u003c/em\u003e were up-regulated after TBHQ treatment. The results suggest that TBHQ is effective in alleviating endocarp browning by increasing antioxidant capacity of longan fruit.\u003c/p\u003e","manuscriptTitle":"tert-Butylhydroquinone alleviates postharvest endocarp browning of longan fruit by regulating antioxidant metabolism","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-06-10 14:02:49","doi":"10.21203/rs.3.rs-4476184/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"editorAssigned","content":"","date":"2024-05-28T07:14:22+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-05-28T02:02:59+00:00","index":"","fulltext":""},{"type":"submitted","content":"Food and Bioprocess Technology","date":"2024-05-25T09:30:42+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"food-and-bioprocess-technology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [Food and Bioprocess Technology](https://www.springer.com/journal/11947)","snPcode":"11947","submissionUrl":"https://submission.nature.com/new-submission/11947/3","title":"Food and Bioprocess Technology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"c5742cfd-e611-4d8e-a7f3-2aa2271bc649","owner":[],"postedDate":"June 10th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2024-06-10T14:02:49+00:00","versionOfRecord":[],"versionCreatedAt":"2024-06-10 14:02:49","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4476184","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4476184","identity":"rs-4476184","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}