Quercetin modulates Chitinase-3-like protein 1 expression and inflammatory responses in lipopolysaccharide-stimulated buffalo granulosa cells

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

Abstract Ovarian inflammation can impair buffalo fertility by disrupting the granulosa cell function and oocyte development. Chitinase-3-like protein 1 (CHI3L1) is associated with inflammation in other species, whereas quercetin is a flavonoid known for its anti-inflammatory properties. This study aimed to evaluate CHI3L1 expression and effects of quercetin on lipopolysaccharide (LPS)-induced inflammation in buffalo granulosa cells. Buffalo granulosa cells were cultured in vitro and challenged with LPS to induce inflammation with or without quercetin co-treatment. CHI3L1 and pro-inflammatory cytokine levels (IL-1β, IL-6, and TNF-α) were quantified using real-time PCR and ELISA, and intracellular reactive oxygen species (ROS) were measured using a fluorescence assay. The effect on oocyte maturation was assessed by culturing cumulus-oocyte complexes under these conditions. LPS challenge significantly increased CHI3L1 expression, proinflammatory cytokine levels, and ROS production in granulosa cells. These inflammatory changes are associated with reduced oocyte maturation rate. Quercetin treatment markedly downregulated LPS-induced CHI3L1 and cytokine expression, attenuated ROS generation, and significantly improved oocyte maturation. These results indicate that CHI3L1 is a key mediator of LPS-induced ovarian inflammation, and that quercetin effectively mitigates these effects, thereby enhancing the oocyte maturation environment. These findings highlight the potential of quercetin as a therapeutic agent for mitigating ovarian inflammation and improving fertility in buffaloes.
Full text 184,056 characters · extracted from preprint-html · click to expand
Quercetin modulates Chitinase-3-like protein 1 expression and inflammatory responses in lipopolysaccharide-stimulated buffalo granulosa cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Quercetin modulates Chitinase-3-like protein 1 expression and inflammatory responses in lipopolysaccharide-stimulated buffalo granulosa cells S Sandhiya, Vijay Anand, K Brindha, Guru D V Pandiyan, Sathesh Kumar S, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8182389/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 9 You are reading this latest preprint version Abstract Ovarian inflammation can impair buffalo fertility by disrupting the granulosa cell function and oocyte development. Chitinase-3-like protein 1 (CHI3L1) is associated with inflammation in other species, whereas quercetin is a flavonoid known for its anti-inflammatory properties. This study aimed to evaluate CHI3L1 expression and effects of quercetin on lipopolysaccharide (LPS)-induced inflammation in buffalo granulosa cells. Buffalo granulosa cells were cultured in vitro and challenged with LPS to induce inflammation with or without quercetin co-treatment. CHI3L1 and pro-inflammatory cytokine levels (IL-1β, IL-6, and TNF-α) were quantified using real-time PCR and ELISA, and intracellular reactive oxygen species (ROS) were measured using a fluorescence assay. The effect on oocyte maturation was assessed by culturing cumulus-oocyte complexes under these conditions. LPS challenge significantly increased CHI3L1 expression, proinflammatory cytokine levels, and ROS production in granulosa cells. These inflammatory changes are associated with reduced oocyte maturation rate. Quercetin treatment markedly downregulated LPS-induced CHI3L1 and cytokine expression, attenuated ROS generation, and significantly improved oocyte maturation. These results indicate that CHI3L1 is a key mediator of LPS-induced ovarian inflammation, and that quercetin effectively mitigates these effects, thereby enhancing the oocyte maturation environment. These findings highlight the potential of quercetin as a therapeutic agent for mitigating ovarian inflammation and improving fertility in buffaloes. Buffalo Granulosa cell Inflammation Quercetin CHI3L1 ROS Oocyte maturation Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 Figure 13 Introduction Infertility and subfertility in dairy buffaloes are often attributed to postpartum inflammation of the reproductive tract, particularly under conditions such as metritis and endometritis (Magata 2020 ). These inflammatory conditions introduce lipopolysaccharide (LPS), a gram-negative bacterial endotoxin, into the systemic circulation, which disrupts the intrafollicular environment and perturbs ovarian physiology (Sheldon et al. 2009 ; Bidne et al. 2018 ). LPS-induced endotoxemia is a primary factor contributing to ovarian dysfunction in livestock, as it elicits inflammatory responses in ovarian granulosa cells, impairing endocrine function and reducing oocyte developmental competence (Herath et al. 2007 ; Price et al. 2013 ). Granulosa cells (GCs), traditionally recognized for their roles in steroidogenesis and oocyte support, also function as innate immune sensors within the ovary by expressing toll-like receptor 4 (TLR4). Upon LPS binding to TLR4, GCs activate the NF-κB and MAPK signaling pathways, leading to the upregulation of pro-inflammatory cytokines, such as interleukin-6 (IL-6), interleukin-1β(IL-1β), and tumor necrosis factor-α (TNFα) (Bromfield and Sheldon 2011 ). Sustained elevation of these cytokines alters the expression of steroidogenic enzymes, diminishes estradiol synthesis, and can trigger apoptosis or cumulus cell dysfunction (Taylor and Terranova 1996 ). Granulosa cells themselves possess an innate immune capability to detect bacterial infections, and LPS acting directly on granulosa cells perturbs follicular steroidogenesis and follicle growth in the absence of immune leukocytes. Recent evidence has also implicated chitinase-3-like protein 1 (CHI3L1), also known as YKL-40, as a novel inflammation-responsive biomarker in the ovary. CHI3L1 is a glycoprotein involved in tissue remodeling and immune modulation, and its expression is elevated in cells under stress or inflammatory stimulation (Blazevic et al. 2024 ). Within the reproductive system, increased CHI3L1 levels are associated with granulosa cell responses during follicular atresia, polycystic ovary syndrome (PCOS)-like conditions, and oxidative damage (Puttabyatappa et al. 2020 ; Tang et al. 2024 ). Notably, its expression was observed to increase in vitro during maturation of buffalo cumulus–oocyte complexes (Anand et al. 2024 ), suggesting a potential physiological role in follicular remodeling. However, whether CHI3L1 is inducible in buffalo granulosa cells under pathological LPS-driven inflammatory conditions remains unknown. Quercetin, a naturally occurring flavonoid that is abundant in many plant-based foods, exhibits potent anti-inflammatory and antioxidant properties. Mechanistically, quercetin can inhibit the TLR4/NF-κB pathway and activate the Nrf2 pathway, thereby suppressing the production of proinflammatory cytokines and enhancing the expression of antioxidant enzymes (Zhang et al. 2022 ; Khadrawy et al. 2020 ). Previous studies have demonstrated the efficacy of quercetin in protecting bovine and buffalo reproductive cells from oxidative and inflammatory stresses. Supplementation with quercetin has been shown to improve oocyte viability, promote cumulus expansion, and increase subsequent embryo development rates under challenging conditions (Yang et al. 2022 ; Rashidi et al. 2019 ). Despite these promising findings, the influence of quercetin on LPS-challenged buffalo granulosa cells, particularly its potential to modulate CHI3L1 expression during an inflammatory response, remains to be elucidated. Therefore, the present study was designed to examine the expression dynamics of CHI3L1 in buffalo granulosa cells during LPS-induced inflammation and evaluate the protective effects of quercetin on LPS-induced inflammatory responses. Using molecular assays for gene and protein expression, inflammatory cytokine measurements, reactive oxygen species (ROS) assays, and co-culture experiments with oocytes, we explored the diagnostic and therapeutic relevance of CHI3L1 and quercetin in an in vitro ovarian inflammation model. These insights are pertinent to improving in vitro maturation (IVM) and in vitro fertilization (IVF) outcomes in buffaloes because maintaining a healthy granulosa–oocyte microenvironment under both physiological and inflammatory conditions is crucial for optimizing assisted reproductive techniques. Buffaloes are of significant economic importance in tropical and subtropical agricultural systems and enhancing their reproductive efficiency has direct implications for milk and meat production. Addressing postpartum inflammatory disorders is vital for improving conception rates, shortening calving intervals, and reducing economic losses during dairy operations. Notably, buffaloes are prone to developing subclinical uterine infections that are often undiagnosed, which underscores the need for sensitive intra-ovarian biomarkers of inflammation. Identifying ovarian inflammation using a novel marker such as CHI3L1, in conjunction with an anti-inflammatory intervention such as quercetin, could enable both the early detection and therapeutic mitigation of inflammation. Material & Methods Collection of buffalo ovaries Ovaries from domestic buffaloes (Bubalus bubalis) were collected from a local abattoir immediately after slaughter. The ovaries were trimmed of excess connective tissue and immediately placed in a sterile insulated container with warm 0.9% saline (37°C) containing penicillin (100 IU/mL) and streptomycin (100 µg/mL). The container was sealed and transported to the laboratory within 2–4 hours of collection. Upon arrival, ovaries were thoroughly rinsed in fresh sterile saline to remove blood and debris before further processing. Granulosa cell isolation and culture Antral follicles, measuring 2–8 mm in diameter on the ovarian surface, were identified and disinfected by gentle swabbing with 70% isopropanol. Follicular fluid was aspirated from visible, healthy follicles using an 18-gauge hypodermic needle attached to a 10 mL syringe pre-filled with collection medium. The aspirated follicular contents (including follicular fluid, cumulus–oocyte complexes [COCs], and granulosa cells) were expelled into a sterile 15 mL conical tube containing warm collection medium. The tube was kept in a 38.5°C incubator for ~ 15 min to allow COCs to settle at the bottom. The supernatant enriched with granulosa cells was carefully transferred to a fresh tube without disturbing the settled COCs. This cell suspension was diluted with the medium, mixed, and left undisturbed again so that red blood cells and debris remained in the upper phase, which was then removed. Granulosa cells in the remaining suspension were washed with Dulbecco’s phosphate-buffered saline (DPBS; Gibco, Thermo Fisher, USA) and pelleted by centrifugation (2000 rpm, 10 min). The cell pellet was washed twice with DPBS to eliminate residual contaminants. The final granulosa cell pellet was resuspended in warm complete culture medium [Advanced DMEM (Gibco) supplemented with 5% fetal bovine serum (FBS; Gibco), 2 mM L-glutamine (Gibco), and 1× antibiotic–antimycotic solution (100 U/mL penicillin, 100 µg/mL streptomycin, 0.25 µg/mL amphotericin-B; Gibco)]. Cells were seeded into sterile culture plates and incubated at 38.5°C in a humidified atmosphere with 5% CO₂. After approximately 24 h, the medium was replaced to remove non-adherent cells. Granulosa cell cultures were maintained with medium changes every 2–3 d. Cells were grown as adherent monolayers and were used for experiments once they reached approximately 80% confluence. LPS stimulation and gene expression analysis To induce an inflammatory response in vitro, primary granulosa cell cultures (~ 80% confluence) were challenged with lipopolysaccharide (LPS from E. coli O111:B4; Sigma-Aldrich, USA). Cells were exposed to LPS at 0 (control), 10, 100, or 1000 ng/mL and incubated for 6, 12, or 24 h. Untreated control cells were maintained in parallel for each time point. Each treatment condition was performed in triplicate and repeated for three independent cell preparations to account for biological variability. Cell viability was assessed after LPS exposure using the MTT assay (see Cell viability and ROS assays below) to evaluate cytotoxicity. The LPS dose that induced a marked inflammatory effect without causing excessive cell death was identified and used in subsequent quercetin co-treatment experiments. Immediately following LPS treatment, the cells were harvested for RNA isolation and quantitative PCR (qPCR) analysis of inflammatory gene expression. Total RNA was extracted using the NucleoSpin® RNA kit (Macherey-Nagel, Germany), according to the manufacturer’s instructions. The purity and concentration of RNA were verified by spectrophotometry (A₆₀/A₂₈₀ ~2.0). One microgram of each RNA sample was reverse-transcribed into cDNA using a PrimeScript™ RT Reagent Kit (Takara Bio, Japan). For gene expression analysis, qPCR was carried out on a CFX96 real-time PCR system (Bio-Rad Laboratories, USA) to quantify the mRNA levels of chitinase-3-like protein 1 (CHI3L1) and the pro-inflammatory cytokines interleukin-1β (IL1B), interleukin-6 (IL6), and tumor necrosis factor-α (TNFα). Gene-specific primer sets for buffaloes were used (sequences based on published GenBank entries designed to span exon–exon junctions to avoid genomic DNA amplification Table.1). Each 20 µL qPCR reaction contained cDNA (equivalent to ~ 50 ng input RNA), 0.2 µM of forward and reverse primers, and 10 µL of 2× SYBR® Green PCR Master Mix (Takara Bio). Thermal cycling conditions were as follows: initial denaturation at 95°C for 5 min, followed by 40 cycles of 95°C for 15 s and 60°C for 30 s. A melt-curve analysis was performed at the end of each run to confirm the specific products. All samples were run in triplicate, and no-template controls were included for each primer set. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an endogenous reference gene. Relative changes in gene expression between treated and control cells were calculated using the 2^-ΔΔCt method (Livak and Schmittgen 2001 ). Detection of CHI3L1 protein by ELISA The concentration of secreted CHI3L1 protein in granulosa cell culture supernatants was measured using a sandwich ELISA specific for buffalo CHI3L1 (GENLISA™ CHI3L1 ELISA Kit; Krishgen Biosystems, India). The cell culture medium was collected at the end of LPS treatment, centrifuged to remove any cells or debris, and stored at − 20°C until analysis. The ELISA was performed according to the manufacturer’s protocol. In brief, 100 µL of standards or samples was added to microplate wells pre-coated with anti-CHI3L1 capture antibody and incubated to allow CHI3L1 antigen binding. After washing, the biotinylated detection antibody was added, followed by horseradish peroxidase–conjugated streptavidin. The color was developed using tetramethylbenzidine (TMB) substrate, and the reaction was stopped with an acidic stop solution. Absorbance was measured at 450 nm using a microplate reader, and CHI3L1 concentrations in the samples were interpolated from the standard curve of known CHI3L1 concentrations. Quercetin treatment and LPS co-treatment design The potential protective effects of quercetin against LPS-induced inflammation were evaluated in a separate set of experiments. First, the non-cytotoxic concentration of quercetin was determined by treating granulosa cells with quercetin (Sigma-Aldrich, USA) at 1, 10, 20, or 50 µg/mL for 24 h and measuring cell viability. Quercetin stock solution was prepared in dimethyl sulfoxide (DMSO) and diluted in culture medium to achieve the desired final concentrations ( DMSO vehicle concentration was kept below 0.1% in all cases). Cell viability was assessed using the MTT assay, and 1 µg/mL quercetin was identified as a dose that did not significantly affect granulosa cell viability. This concentration was selected for subsequent co-treatment experiments. For co-treatment, granulosa cells at approximately 80% confluence were divided into four treatment groups: control (untreated cells), LPS only (cells exposed to LPS at the selected inflammatory dose, with no quercetin), quercetin only (cells treated with 1 µg/mL quercetin, with no LPS), and LPS + Quercetin (cells simultaneously exposed to LPS and 1 µg/mL quercetin). Treatments were performed for 24 h for all groups. After treatment, the cells were processed for analysis to determine the effects of quercetin on inflammatory outcomes. Total RNA was extracted from each group and subjected to cDNA synthesis and qPCR as described above to compare the expression of CHI3L1 and cytokine genes among the groups. Each complete experiment (all four treatment conditions) was repeated at least three times using independent granulosa cell cultures. Cell viability and ROS assays Cell viability under various treatment conditions was quantified using the colorimetric MTT assay. After the specified treatment period in each experiment, the culture medium was removed and the cells were gently washed with DPBS. MTT solution (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; Sigma-Aldrich) was added to the cells (final concentration ~ 0.5 mg/mL in serum-free medium) and incubated at 37°C for approximately 3 h in the dark. Metabolically active cells reduce MTT to an insoluble purple formazan. After incubation, the MTT-containing solution was removed and the formazan crystals were dissolved by adding DMSO. The absorbance of each well was measured at 550 nm wavelength using a microplate reader (BioTek Instruments, USA). A higher absorbance corresponds to greater viability. This assay was used to evaluate LPS cytotoxicity and confirm that the chosen quercetin dose did not adversely affect cell viability. Intracellular reactive oxygen species (ROS) levels were measured to evaluate oxidative stress in granulosa cells under inflammatory conditions and the potential antioxidant effects of quercetin. After 24 h of treatment for each experimental group (control, LPS, quercetin, LPS + quercetin), the culture medium was removed and cells were washed once with PBS. A cell‑permeable fluorogenic probe, 2′,7′‑dichlorofluorescein diacetate (DCFDA), was used to detect ROS. Working DCFDA solution (10 µM in PBS) was added to each well (in a sufficient volume to cover the cells), and the cells were incubated at 37°C for 30 min in the dark. During this time, DCFDA diffuses into cells and is deacetylated by intracellular esterases to a non‑fluorescent compound, which is then oxidized by ROS to yield 2′,7′‑dichlorofluorescein (DCF), a highly fluorescent molecule. After 30 min of incubation, the DCFDA solution was removed and the cells were washed twice with PBS to remove excess extracellular probe. The DCF fluorescence of stained cells was then visualized and photographed using a fluorescence microscope with identical exposure settings for all treatment groups. Intracellular ROS production levels were quantified using ImageJ image analysis software (National Institutes of Health, Bethesda, MD, USA) by measuring the mean fluorescence intensity in the captured images for each treatment condition. ROS levels are reported as arbitrary units of fluorescence intensity for all treatment groups. Oocyte co-culture and in vitro maturation To assess the functional impact of granulosa cell inflammation (and its mitigation by quercetin) on oocyte maturation, an oocyte–granulosa cell co-culture system was employed. Cumulus–oocyte complexes (COCs) were freshly collected from buffalo ovaries (not used for granulosa cell culture) following the same aspiration procedure described above. Only high-quality COCs with compact, multilayered cumulus cells and a homogeneous ooplasm were selected under a stereomicroscope. Groups of approximately 10–20 COCs were placed in 4-well culture dishes containing 500 µL oocyte maturation medium (TCM-199; Gibco) supplemented with 10% FBS, 10 µg/mL follicle-stimulating hormone (FSH; Sigma-Aldrich), 5 µg/mL luteinizing hormone (LH; Sigma-Aldrich), and 10 ng/mL epidermal growth factor (EGF; Sigma-Aldrich). Each well of COCs was co-cultured with a monolayer of granulosa cells that had been pre-treated under one of four conditions: untreated control, LPS-treated, quercetin-treated, or LPS + quercetin co-treated (using the conditions described above). The co-cultures were covered with sterile mineral oil (Sigma-Aldrich) to prevent evaporation and incubated at 38.5°C in 5% CO₂ for 22–24 h to allow in vitro maturation (IVM) of the oocytes. During this period, potential paracrine interactions between granulosa cells and oocytes could influence oocyte maturation. After 22–24 h IVM culture, oocytes were examined under a stereomicroscope for evidence of cumulus expansion (degree of cumulus cell dispersion and expansion was noted as a morphological indicator of oocyte maturation). To evaluate nuclear maturation, the oocytes were freed from cumulus cells and assessed for first polar body extrusion. COCs from each co-culture were gently pipetted into a 0.1% hyaluronidase (in PBS) solution to remove cumulus cells, yielding denuded oocytes. Oocytes were washed in PBS and fixed in 4% paraformaldehyde for 15 min at room temperature. The fixed oocytes were stained with Hoechst 33342 fluorescent DNA dye (5 µg/mL in PBS) for 10 min in the dark. The stained oocytes were mounted on glass slides with a drop of antifade medium and covered with coverslips. The slides were observed under a fluorescence microscope (UV excitation filter) to visualize chromatin. Oocytes exhibiting dispersed chromatin and a visible first polar body were recorded as having reached metaphase II stage, indicating successful nuclear maturation. Statistical analysis Data from all experiments are presented as mean ± standard error of the mean (SEM). One-way analysis of variance (ANOVA) was used to compare multiple treatment groups. When ANOVA indicated a significant difference (p < 0.05), pairwise comparisons between group means were made using Tukey’s post hoc test. A significance threshold of p < 0.05 was applied for all analyses. Each experiment was performed with at least three independent biological replicates. Statistical analyses were performed using GraphPad Prism software (version 10.0) and the results were plotted using the same software. Results Granulosa Cell Characterisation Buffalo granulosa cells (GCs) were successfully isolated from antral follicles and cultured. Upon seeding, GCs attached sparsely by 12 h and gradually formed clusters; after 36 h, a confluent monolayer with interconnecting cell processes was observed (Fig. 1 ). The cultured cells displayed different morphologies depending on the media conditions: in standard 10% serum medium, they became elongated and fibroblast-like, whereas in low-serum (1%) medium, they retained a cobblestone epithelial-like shape (Fig. 1 ). Molecular verification confirmed the identity of these cells as granulosa cells, as evidenced by RT-PCR detection of follicle-stimulating hormone receptor (FSHR, ~ 192 bp) and aromatase (CYP19A1, ~ 179 bp) transcripts (Fig. 2 ). Effect of LPS on Granulosa Cell Viability LPS exposure had a significant dose-dependent cytotoxic effect on granulosa cells at 6 h, followed by a return to the baseline viability at later time points. At 6 h, high concentrations of LPS (1,000–2,000 ng/mL) reduced cell viability as measured by MTT, with optical density (OD_550) values dropping to approximately 75–77% of control levels (e.g., 0.401 ± 0.012 in controls vs. 0.304 ± 0.006 at 2,000 ng/mL; p 0.05). After 12 and 24 h of exposure, no significant differences in viability were evident between any LPS-treated group and the control (p > 0.05). Consistent with the quantitative readings, MTT formazan staining showed markedly reduced purple intensity only in the wells with the highest LPS doses at 6 h, whereas at 12 and 24 h, all groups exhibited uniformly intense staining (Fig. 3 ). Table 1 Primer sequences used for PCR amplification of target genes S.NO NAME OF GENE PRIMER SEQUENCE (5’- 3’) LENGTH (bp) AMPLICON SIZE (bp) 1 FSHR FP − 5’ GATGTCTTGGAAGTGATAGA 3’ 20 192 RP- 5’GAGAGACTGAATCTTGTGAA 3’ 20 2 CYP19A1 FP-5’GTAAAGTCGTTCAGTTGTGT 3’ 20 179 RP- 5’TTCAGTGTAGGACAGTAAGG 3’ 20 3 GAPDH FP-5’TCGGAGTGAACGGATTCGG 3’ 19 192 RP-5’TGATGACGAGCTTCCCGTTC 3’ 20 4 CHI3L1 FP-5’GATTCAGTAACGCTGACTAC 3’ 20 202 RP -5’ CAGATCTCATAATAGGCAAG3’ 20 5 IL-6 FP-5’GGGTTCAATCAGGCGATTTGCT 3’ 22 147 RP-5’AGGATCTGGATCAGTGTTCTGC 3’ 22 6 IL-1β FP-5’ GAACTTCACTGTTGTCTGAT 3’ 20 156 RP-5’ GCTTTGAGTGAGTAGAAGTG 3’ 20 7 TNF-α FP-5’ GCCCACGTTGTAGCCGACATCAACTCT 3’ 27 113 RP- 5’ AGCAGGCACCACAGCTGGTTGTC 3’ 23 LPS Induces CHI3L1 and Cytokine Expression CHI3L1 Gene Expression and Protein Secretion In LPS-challenged granulosa cells, Chitinase-3-like Protein 1 (CHI3L1) mRNA was upregulated in a delayed dose-dependent manner, while the corresponding protein levels showed only minor changes. CHI3L1 transcript abundance remained at baseline for up to 12 h after LPS treatment and then rose sharply by 24 h in the high-dose group. Notably, treatment with 1,000 ng/mL LPS for 24 h induced an approximately 8-fold increase in CHI3L1 mRNA relative to untreated cells (p < 0.05). In contrast, low LPS doses (10 ng/mL or 100 ng/mL) produced minimal or no elevation in CHI3L1 expression over 24 h. Despite robust induction at the mRNA level, CHI3L1 protein in culture supernatants increased only slightly after LPS exposure. ELISA at 24 h showed a trend toward higher CHI3L1 protein levels with high-dose LPS, but the differences were not statistically significant compared to controls (p > 0.05; Fig. 4 ). Thus, LPS strongly stimulated CHI3L1 gene expression without a commensurate increase in secreted proteins within the 24 h period. IL-6 mRNA Expression LPS treatment caused a pronounced dose- and time-dependent increase in interleukin-6 (IL-6) gene expression in buffalo granulosa cells. Even at 6 h, IL-6 mRNA was significantly elevated by higher LPS doses: 100 ng/mL and 1,000 ng/mL LPS yielded roughly 12-fold and 22-fold increases, respectively, compared to the control (p < 0.05), whereas 10 ng/mL had no significant effect. The IL-6 response peaked at 12 h, reaching approximately 21-fold (100 ng/mL) to 33-fold (1,000 ng/mL) above the control levels. By 24 h, IL-6 expression declined from its 12 h peak but remained markedly elevated (approximately 13-fold for 100 ng/mL and 28-fold for 1,000 ng/mL vs. control). At all time points, 10 ng/mL failed to induce any significant IL-6 upregulation. IL-1β mRNA Expression Interleukin-1β (IL-1β) transcripts were similarly induced by LPS in a clear dose- and time-dependent manner. High LPS doses were required to trigger IL-1β expression; 10 ng/mL LPS did not cause a significant change at any time (p > 0.05). At 6 h, 100 ng/mL and 1,000 ng/mL LPS led to significant IL-1β increases of approximately 6-fold and 8-fold, respectively, relative to the controls (p < 0.05, vs. 10 ng/mL group). Maximal IL-1β induction occurred at 12 h, with mRNA levels approximately 23-fold (100 ng/mL) to 25-fold (1,000 ng/mL) higher than those in the control. IL-1β expression partially declined by 24 h; the 1,000 ng/mL LPS group still showed ~ 15-fold elevation (p 0.05). TNFα mRNA Expression LPS induced a rapid but transient increase in tumor necrosis factor-α (TNFα) gene expression. The peak TNFα response was observed at the earliest time point (6 h). At 6 h, 100 ng/mL LPS caused approximately a 4-fold rise and 1,000 ng/mL caused about a 6-fold increase in TNFα mRNA relative to the control (p < 0.05, vs. 10 ng/mL), whereas 10 ng/mL induced only ~ 2-fold and was not significant. This upregulation was attenuated over time: by 12 h, overall TNFα levels had decreased, and only the 1,000 ng/mL dose remained significantly above baseline (approximately 4-fold vs. 10 ng/mL; p < 0.05). After 24 h, TNFα expression in LPS-treated cells nearly returned to control levels; the 1,000 ng/mL group maintained a modest 2.5-fold increase (p < 0.05, vs. 10 ng/mL), while lower doses showed no significant increase. Quercetin Cytotoxicity in Granulosa Cells Quercetin reduced granulosa cell viability in a dose-dependent manner Exposure to a low concentration of quercetin (1 µg/mL) had no significant effect on MTT OD readings compared to untreated controls (mean OD ≈ 1.705 ± 0.047 vs. 1.588 ± 0.028; p > 0.05). In contrast, higher quercetin concentrations caused a marked decline in the cell viability. Treatment with 10 µg/mL quercetin reduced the OD to ~ 1.02 ± 0.05 (mean ± SE), and further decreases were observed at 20 µg/mL (≈ 0.92) and 50 µg/mL (≈ 0.85). All doses ≥ 10 µg/mL resulted in significantly lower viability than the control or 1 µg/mL groups (p < 0.05). These findings indicate that while quercetin has no deleterious effects at very low doses, it becomes cytotoxic to GCs at higher concentrations. Quercetin Attenuates LPS-Induced Inflammatory Responses Co-treatment with quercetin markedly attenuated LPS-induced upregulation of CHI3L1 and pro-inflammatory cytokine genes in granulosa cells. Quercetin alone did not alter the expression of CHI3L1, IL-6, IL-1β, or TNFα compared to untreated controls (p > 0.05). As expected, LPS alone significantly elevated the levels of all four markers relative to those in the control (p < 0.05). Specifically, 1,000 ng/mL LPS for 24 h induced CHI3L1 ~ 2.1-fold, IL-6 ~ 18-fold, IL-1β ~ 6-fold, and TNFα ~ 9-fold above baseline levels. The presence of quercetin during LPS exposure substantially suppresses these responses. CHI3L1 induction was reduced by ~ 1.4-fold with LPS + quercetin (versus 2.1-fold with LPS alone). Likewise, the IL-6 mRNA level in the co-treated group was only ~ 4-fold above control, a significant reduction compared to the robust 18-fold increase caused by LPS alone. Quercetin completely abrogated the IL-1β and TNFα responses to LPS; their expression in the LPS + quercetin condition (~ 1.8-fold above control for both) returned to near control levels and was significantly lower than that with LPS treatment alone (p < 0.05). Thus, quercetin co-administration consistently dampened LPS-triggered inflammatory gene expression in GCs across all examined markers. Quercetin Reduces LPS-Induced ROS Generation LPS stimulation led to a significant increase in intracellular reactive oxygen species (ROS) in granulosa cells, and quercetin effectively mitigated this oxidative burst. Fluorescence imaging of the DCFDA probe showed that LPS-treated cells had markedly brighter green fluorescence than controls, indicating elevated ROS, whereas cells treated with quercetin alone appeared similar to controls. Quantitative image analysis confirmed that LPS provoked a ~ 4- to 5-fold increase in mean fluorescence intensity (≈ 45 arbitrary units (A.U.) in LPS vs. ≈10 A.U. in control; p 0.05, vs. control). Importantly, granulosa cells co-treated with LPS and quercetin showed an intermediate ROS level (~ 24 A.U.), approximately half that of the LPS-only group (Fig. 7 ). This represented a significant reduction in ROS relative to LPS treatment (p < 0.05), although the co-treatment ROS remained modestly higher than the basal levels (p < 0.05, vs. control). These results demonstrate that quercetin partially, but significantly, alleviates LPS-induced oxidative stress in granulosa cells. Effects of Granulosa Cell Treatments on Oocyte Maturation The inflammatory status of granulosa cells has a notable impact on the in vitro maturation of co-cultured cumulus-oocyte complexes (COCs). In the control co-culture (untreated GCs + COCs), 79.8 ± 1.2% of oocytes reached maturation (defined by full cumulus expansion and metaphase II nuclear stage). This maturation rate was significantly reduced when COCs were co-cultured with LPS-treated granulosa cells, dropping to 74.3 ± 0.9% (p < 0.05, vs. control). In contrast, granulosa cells treated with quercetin alone supported a high maturation rate of 82.1 ± 2.0%, comparable to the control group (no statistically significant difference). Notably, quercetin co-treatment rescued much of the LPS-induced impairment in oocyte maturation. COCs co-cultured with LPS + quercetin-treated GCs had a maturation frequency of 78.6 ± 1.8%, which was significantly higher than that observed with LPS-treated GCs (p < 0.05). Although maturation was not fully restored to the control level, the co-treatment group showed a clear improvement in cumulus expansion and MII attainment compared with LPS alone (Fig. 8 ). These findings indicate that granulosa cell inflammation adversely affects oocyte developmental competence and that quercetin supplementation can partially counteract these detrimental effects in the co-culture system.. Discussion Our results highlight the remarkable plasticity of buffalo granulosa cells in vitro, as their morphology varies with serum conditions. In low-serum culture, granulosa cells retained a cobblestone and epithelial-like appearance with strong cell–cell adhesion, whereas high-serum conditions induced an elongated, fibroblast-like shape reminiscent of dedifferentiated cells. This phenotypic shift likely reflects differences in differentiation status: lower mitogenic stimulation (low serum) maintains a more quiescent, follicle-like state, while higher serum promotes proliferation and luteinization-like transformation (Amsterdam and Aharoni 1994 ; Yadav et al. 2018 ). Similar observations in other studies confirm that the culture environment can markedly alter granulosa cell behavior and gene expression (Ożegowska et al. 2019 ). These findings underscore the need to optimize culture conditions depending on the experimental goals. To study granulosa cells in a state closer to their in vivo physiology, a low-serum (or defined) medium is preferable, whereas serum supplementation can be used to expand cells at the cost of inducing a less-differentiated phenotype. We selected low-serum conditions to better emulate the pre-ovulatory granulosa cell environment before examining inflammatory challenges. Exposure to lipopolysaccharide (LPS) revealed a biphasic effect on granulosa cell viability. Within 6 h of LPS treatment, especially at high concentrations (≥ 1 µg/mL), cell viability decreased significantly, indicating acute cytotoxicity. This early cell loss is consistent with LPS activating Toll-like receptor 4 on granulosa cells and rapidly triggering an inflammatory cascade that can lead to apoptosis or pyroptosis (Bromfield and Sheldon 2011 ). However, after 24 h, cell viability in LPS-treated cultures stabilized and even recovered to control levels, despite the continued LPS presence of LPS. This suggests that granulosa cells mount adaptive responses to prolonged endotoxin exposure, akin to endotoxin tolerance, which limits cell death. Surviving cells may upregulate anti-inflammatory regulators and proliferate to replenish the monolayer (Williams et al. 2008 ). Thus, while buffalo granulosa cells are acutely susceptible to inflammatory injury, they also display resilience over time, which may help to preserve follicular integrity after transient insults. LPS stimulation induces a robust pro-inflammatory gene response in granulosa cells, notably in interleukin-6 (IL-6), interleukin-1β (IL-1β), and tumor necrosis factor-α (TNF-α). IL-6 mRNA increased dramatically and remained elevated for 24 h, reflecting the capacity of granulosa cells to act as immune-like cells within the follicle (Herath et al. 2007 ). While IL-6 has physiological roles during ovulation, chronic or excessive IL-6 is detrimental because it can suppress granulosa cell steroidogenesis (Taylor and Terranova 1996 ) and has been associated with disrupted folliculogenesis and poor oocyte quality under inflammatory conditions (Magata and Shimizu 2017 ). IL-1β is also rapidly upregulated by LPS, in line with its role as an early “danger signal” that amplifies inflammation. Granulosa cells from cattle similarly produce IL-1β when challenged with endotoxins (Price et al. 2013 ), and this cytokine can recruit immune cells and further disrupt granulosa–thecal functions if persistent. TNF-α transcript levels spiked at 6 h post-LPS and then returned to baseline by 24 h. Such transient TNF-α production is consistent with an acute innate response; importantly, the rapid downregulation of TNF-α likely prevents extended cell damage, as prolonged TNF exposure can induce granulosa cell apoptosis and follicular atresia (Basini et al. 2002 ; Boby et al. 2017 ). In summary, LPS elicits a potent inflammatory cascade in granulosa cells characterized by surges in IL-6, IL-1β, and TNF-α, which, if sustained, could severely impair ovarian function. In addition to classical cytokines, we identified chitinase-3-like protein 1 (CHI3L1, also known as YKL-40) as a novel inflammation-responsive gene in the buffalo granulosa cells. LPS stimulation significantly upregulated CHI3L1 mRNA expression, suggesting that granulosa cells contribute not only to cytokines, but also extracellular matrix-related factors to the ovarian inflammatory milieu. CHI3L1 is increasingly being recognized as a marker of inflammation in reproductive disorders; for example, elevated YKL-40 levels have been observed in women with endometriosis, pelvic inflammatory disease, and polycystic ovary syndrome (Lee et al. 2012 ; Liu et al. 2024 ). Consistent with our findings, a recent study reported that CHI3L1 expression increases in buffalo cumulus–oocyte complexes during in vitro maturation when inflammatory-like stimuli are present (Anand et al. 2024 ). Thus, CHI3L1 induction in granulosa cells may serve as an indicator of intrafollicular inflammation and stress. In addition to being a potential biomarker, CHI3L1 may actively influence granulosa cell survival and follicular outcomes during inflammation. In other biological contexts, transient CHI3L1 elevation aids in cell survival, tissue repair, and angiogenesis, whereas chronic overexpression contributes to pathological fibrosis and sustained inflammation. Recent evidence suggests CHI3L1 can amplify stress responses; knocking down YKL-40 in cultured granulosa cells reduces oxidative damage and inflammatory signaling under stress conditions (Tang et al. 2024 ). CHI3L1 expression also tends to increase in atretic (degenerating) follicles (Meng et al. 2021 ), implying that it is part of the ovarian response to prolonged insults. We observed that CHI3L1 protein did not measurably increase by 24 h despite increased transcript levels, indicating that protein secretion may require more time or additional signals. From a therapeutic perspective, modulation CHI3L1 could be a novel approach for controlling ovarian inflammation. If CHI3L1 exacerbates follicular inflammation, inhibitors or neutralizing antibodies (already under exploration in other diseases) might help protect granulosa cells. Conversely, because CHI3L1 can have pro-survival effects, short-term enhancement might aid tissue recovery following infection. Notably, studies in mice have shown that the loss of CHI3L1 (Brp-39 knockout) alters inflammatory outcomes and can protect against inflammation-driven reproductive damage (Jang et al. 2019 ). Similarly, CHI3L1 deficiency was protective in an LPS-induced liver injury (Kim et al. 2023 ). Thus, CHI3L1 appears to be a double-edged sword in the follicle, and careful tuning of its levels might tilt the balance toward the resolution of inflammation without triggering chronic damage. Quercetin alone had distinct dose-dependent effects on granulosa cell viability. At a low concentration (1 µg/mL), quercetin was non-toxic, with cell viability comparable to that of untreated controls. This is in agreement with reports that low micromolar levels of quercetin are well tolerated by ovarian cells and can even be mildly beneficial (Yang et al. 2022 ). In contrast, high concentrations of quercetin (10–50 µg/mL) significantly reduced the viability of granulosa cells. A dose of 50 µg/mL caused a dramatic loss of cells, indicating that the cytotoxic threshold of quercetin had been exceeded. Such biphasic, hormetic behavior is well documented for quercetin: at low doses it acts as an antioxidant and cytoprotectant, whereas at high doses it becomes pro-oxidant and triggers apoptotic pathways (Li et al. 2021 ; Sirotkin et al. 2019 ). Similar dose-dependent effects have been observed in bovine and porcine granulosa cells, where quercetin concentrations above approximately 10–20 µg/mL impair cell proliferation and viability (Yang et al. 2022 ; Qi et al. 2023 ). Mechanistically, excessive quercetin can induce oxidative stress and activate pro-apoptotic factors, such as BAX, explaining the steep decline in cell numbers at the highest dose (Sirotkin et al. 2019 ). For subsequent experiments, we selected a low non-toxic dose of quercetin to evaluate its protective effects against LPS-induced inflammation. Co-treatment of granulosa cells with quercetin markedly attenuated the inflammatory response to LPS. Quercetin alone did not alter the basal expression of cytokines or CHI3L1, but in the presence of LPS it significantly downregulated all measured inflammatory genes. In LPS-only cultures, IL6, IL1B, and TNF transcripts were elevated by approximately 6- to 18-fold. With quercetin, these increases were largely abrogated, and cytokine mRNA levels remained near control values. CHI3L1 induction by LPS was also reduced by co-treatment with quercetin. These results demonstrate the broad anti-inflammatory action of quercetin in granulosa cells. These findings are consistent with the known inhibition of LPS-activated signaling pathways, such as NF-κB and MAPK, in other cell types (Xiong et al. 2019 ; Jiang et al. 2022 ). By suppressing TLR4–NF-κB pathway activation, quercetin likely prevented the transcriptional upregulation of IL-6, IL-1β, TNF-α, and CHI3L1. Notably, our data align with in vivo evidence from a sepsis model, in which quercetin administration reduced circulating YKL-40 (CHI3L1) and other inflammatory markers (Gerin et al. 2016 ). Thus, quercetin effectively curtailed the LPS-triggered cytokine surge in granulosa cells, potentially protecting them from inflammation-induced dysfunctions. LPS challenge also causes oxidative stress in granulosa cells, as indicated by a sharp increase in intracellular reactive oxygen species (ROS). Excess ROS are known mediators of granulosa cell damage under inflammatory conditions, leading to lipid peroxidation, DNA damage, and cell death (Jančar et al. 2007 ; Magata 2020 ). We observed bright DCF fluorescence in LPS-treated cells, confirming an oxidative burst, consistent with reports that endotoxin exposure generates ROS in ovarian cells and suppresses key steroidogenic factors (Qu et al. 2019 ). Importantly, quercetin co-treatment significantly mitigated the oxidative stress. Cells exposed to LPS + quercetin showed much lower ROS levels than those exposed to LPS alone, indicating that quercetin’s antioxidant properties scavenge or prevent ROS formation. Quercetin alone did not increase ROS, highlighting its safe and antioxidative mode of action. This outcome is consistent with the broad literature on quercetin as an antioxidant in reproductive cells. For instance, quercetin reduced ROS accumulation and improved viability in toxin-challenged porcine granulosa cells (Qi et al. 2023 ), and protected bovine granulosa cells from H₂O₂-induced apoptosis by enhancing cellular antioxidant defenses (Duan et al. 2024 ). Likewise, quercetin has been shown to activate the Nrf2 pathway and suppress NADPH oxidase–driven ROS production in other tissues during LPS-induced stress (Sun et al. 2020 ; Sul and Ra 2021 ). Although quercetin did not completely normalize ROS levels in our cultures, a partial reduction in the oxidative burden could be beneficial. By maintaining a more balanced redox state, quercetin may prevent ROS-mediated damage to granulosa cell membranes, DNA, and enzymes, thereby preserving their functions under inflammatory stress. This antioxidant effect likely functions in tandem with the anti-inflammatory action of quercetin to support granulosa cell survival. The deleterious impact of granulosa cell inflammation extended to oocyte maturation in our coculture system. When cumulus–oocyte complexes (COCs) were cultured alongside LPS-exposed granulosa cells, oocyte developmental competence was impaired, cumulus expansion was poor, and the proportion of oocytes reaching the metaphase II stage was reduced. These observations mirror previous findings that bacterial endotoxins in the ovarian environment compromise oocyte maturation (Bromfield and Sheldon 2011 ; Magata and Shimizu 2017 ). Granulosa and cumulus cells express TLR4 and respond to LPS by producing cytokines and reactive species that disrupt supportive crosstalk with the oocyte (Zhao et al. 2017 ; Zhao et al. 2019 ). One hallmark of our LPS co-culture was the failure of the cumulus cells to undergo normal expansion. Cumulus expansion, driven by hyaluronic acid matrix synthesis, is critical for oocyte meiosis and subsequent embryo development (Marei et al. 2012 ). Inflammatory insults likely interfere with the expression of expansion-related genes or induce cumulus cell apoptosis, resulting in a compact cumulus and a consequent reduction in MII oocytes. In addition, LPS suppresses granulosa cell estradiol production (Vashisht et al. 2018 ), depriving oocytes of an important maturation signal (Harl et al. 2025 ). The inflammatory microenvironment (high IL-6, IL-1β, TNF-α and oxidative stress) and loss of hormonal support in LPS-treated co-cultures created suboptimal conditions for oocyte development. Consequently, even a relatively low dose of LPS (1 µg/mL) caused a noticeable drop in buffalo oocyte maturation, highlighting the sensitivity of oocytes to somatic cell inflammatory status. Quercetin supplementation greatly ameliorated the negative effects of LPS on oocyte maturation. In the presence of quercetin, COCs exposed to LPS showed improved cumulus expansion and a higher MII rate than those exposed to LPS alone, approaching the levels observed in control cultures. This suggests that quercetin preserved cumulus–oocyte functionality despite the inflammatory insult. Similarly, in cattle, adding quercetin during in vitro oocyte maturation has been found to increase MII yields and reduce indicators of oocyte apoptosis (Davoodian et al. 2022 ). The protective effects of quercetin in our co-culture likely stem from its dual action in granulosa cells, reducing inflammatory cytokine release and oxidative stress, which in turn creates a healthy microenvironment for the oocyte. From a practical standpoint, these findings have practical implications for buffalo reproduction. Buffalo oocytes are vulnerable to oxidative stress during in vitro culture due to their high lipid content (Dubeibe Marín et al. 2019 ). Therefore, minimizing inflammation and oxidative damage in the follicular environment (for instance, by avoiding the use of granulosa cells from infected follicles or by supplementing with antioxidants such as quercetin) could improve oocyte quality and developmental outcomes in vitro. In our study, quercetin did not completely restore oocyte maturation to the control levels, indicating that severe inflammatory damage may not be fully reversible within a short culture period. Nevertheless, the ability of quercetin to significantly rescue oocyte maturation despite LPS exposure underscores its potential as a therapeutic adjunct to preserve fertility in the face of ovarian inflammation. Importantly, quercetin alone did not adversely affect oocyte maturation or cumulus cell viability, supporting its safety for use in maturation media at effective doses. In summary, this study demonstrated that an LPS-induced inflammatory challenge can detrimentally affect buffalo granulosa cells and oocytes, while the flavonoid quercetin exerts protective effects. LPS triggers acute cytokine release (IL-6, IL-1β, TNF-α) and oxidative stress in granulosa cells, leading to impaired cell viability and oocyte maturation. We also identified CHI3L1 as a novel marker of granulosa cell inflammation that may play a role in the ovarian immune response. Notably, quercetin co-treatment attenuated LPS-induced cytokine surge and ROS accumulation, thereby preserving granulosa cell function and supporting oocyte maturation in an inflammatory environment. These findings highlight the potential of quercetin as an anti-inflammatory and antioxidant agent that safeguards ovarian function during infection or endotoxemia. Further in vivo studies and clinical investigations are warranted to explore the application of quercetin and the relevance of CHI3L1 as a therapeutic target or biomarker for reproductive inflammatory conditions.. Declarations Funding This research did not receive any specific grant from funding agencies in the public, commercial or not‑for‑profit sectors. Competing interests The authors declare that they have no competing interests. Authors’ contributions SS performed the experiments and contributed to data acquisition and interpretation. VAJ conceived and designed the study, performed experiments, and contributed to data interpretation and critical revision of the manuscript. BK contributed to experimental design, data interpretation, and manuscript preparation. GDVP conducted experiments and contributed to manuscript preparation. SKS contributed to manuscript preparation and critical scrutiny of the intellectual content. RP conducted experiments and assisted with data acquisition. PM supervised the study, provided overall scientific guidance, and critically revised the manuscript. All authors read and approved the final manuscript. Ethics approval and animal care This article does not contain any studies with live animals performed by any of the authors. Buffalo ovaries ( Bubalus bubalis ) used for granulosa cell and oocyte collection were obtained as by‑products from adult animals slaughtered for routine meat production at a licensed local abattoir. No animal was killed specifically for this research. Acknowledgements The authors thank the staff of the Department of Animal Biotechnology, Madras Veterinary College (TANUVAS), and the personnel of the local abattoir for their assistance with sample collection and laboratory support. References Magata F (2020) Lipopolysaccharide-induced mechanisms of ovarian dysfunction in cows with uterine inflammatory diseases. J Reprod Dev 66(4):311–317. https://doi.org/10.1262/jrd.2020-021 Sheldon IM, Cronin J, Goetze L et al (2009) Defining postpartum uterine disease and the mechanisms of infection and immunity in the female reproductive tract in cattle. Biol Reprod 81(6):1025–1032. https://doi.org/10.1095/biolreprod.109.077370 Bidne KL, Dickson MJ, Ross JW et al (2018) Disruption of female reproductive function by endotoxins. Reproduction 155(4):R169–R181. https://doi.org/10.1530/REP-17-0406 Herath S, Williams EJ, Lilly ST et al (2007) Ovarian follicular cells have innate immune capabilities that modulate their endocrine function. Reproduction 134(5):683–693. https://doi.org/10.1530/REP-07-0229 Price JC, Bromfield JJ, Sheldon IM (2013) Pathogen-associated molecular patterns initiate inflammation and perturb the endocrine function of bovine granulosa cells from ovarian dominant follicles via TLR2 and TLR4 pathways. Endocrinology 154(9):3377–3386. https://doi.org/10.1210/en.2013-1102 Bromfield JJ, Sheldon IM (2011) Lipopolysaccharide initiates inflammation in bovine granulosa cells via the TLR4 pathway and perturbs oocyte meiotic progression in vitro. Endocrinology 152(12):5029–5040. https://doi.org/10.1210/en.2011-1124 Taylor CC, Terranova PF (1996) Lipopolysaccharide inhibits in vitro luteinizing hormone-stimulated rat ovarian granulosa cell estradiol but not progesterone secretion. Biol Reprod 54(6):1390–1396. https://doi.org/10.1095/biolreprod54.6.1390 Blazevic N, Rogic D, Pelajic S et al (2024) YKL-40 as a biomarker in various inflammatory diseases: a review. Biochem Med (Zagreb) 34(1):010502. https://doi.org/10.11613/BM.2024.010502 Puttabyatappa M, Guo X, Dou J et al (2020) Developmental programming: sheep granulosa and theca cell-specific transcriptional regulation by prenatal testosterone. Endocrinology 161(8):bqaa094. https://doi.org/10.1210/endocr/bqaa094 Tang TT, Gao J, Pan X et al (2024) YKL-40 knockdown decreases oxidative stress damage in ovarian granulosa cells. Genet Test Mol Biomark 28(5):199–206. https://doi.org/10.1089/gtmb.2023.0361 Anand JV, Brindha K, Parthiban M et al (2024) Expression of chitinase-like 3 protein 1 (CHI3L1) in buffalo cumulus–oocyte complexes during in vitro maturation. Indian J Anim Res 58(5):722–728. https://doi.org/10.18805/IJAR.B-5482 Zhang HX, Li YY, Liu ZJ, Wang JF (2022) Quercetin effectively improves LPS-induced intestinal inflammation, pyroptosis, and disruption of the barrier function through the TLR4/NF-κB/NLRP3 signaling pathway in vivo and in vitro . Food Nutr Res 66:8948. https://doi.org/10.29219/fnr.v66.8948 Khadrawy O, Gebremedhn S, Salilew-Wondim D et al (2020) Quercetin supports bovine preimplantation embryo development under oxidative stress via activation of the Nrf2 signalling pathway. Reprod Domest Anim 55(10):1275–1285. https://doi.org/10.1111/rda.13688 Yang W, Liu R, Sun Q et al (2022) Quercetin alleviates endoplasmic reticulum stress–induced apoptosis in buffalo ovarian granulosa cells. Animals 12(6):787. https://doi.org/10.3390/ani12060787 Rashidi Z, Aleyasin A, Eslami M et al (2019) Quercetin protects human granulosa cells against oxidative stress via thioredoxin system. Reprod Biol 19(3):245–254. https://doi.org/10.1016/j.repbio.2019.07.002 Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2 – ∆∆CT method. Methods 25(4):402–408. https://doi.org/10.1006/meth.2001.1262 Amsterdam A, Aharoni D (1994) Plasticity of cell organization during differentiation of normal and oncogene-transformed granulosa cells. Microsc Res Tech 27(2):108–124 (No DOI available) Yadav M, Agrawal H, Pandey M et al (2018) Three-dimensional culture of buffalo granulosa cells in hanging drop mimics the preovulatory follicle stage. J Cell Physiol 233(3):1959–1970 (No DOI available) Ożegowska K, Rękawiecki R, Knapczyk-Stwora K et al (2019) Genes involved in cell proliferation, migration, adhesion, and tissue development as new markers of porcine granulosa cell processes in vitro : a microarray approach. DNA Cell Biol 38(6):549–560 (No DOI available) Williams EJ, Sibley K, Miller AN et al (2008) The effect of Escherichia coli LPS and TNF-α on ovarian function in cattle. Am J Reprod Immunol 60(5):462–473. https://doi.org/10.1111/j.1600-0897.2008.00645.x Magata F, Shimizu T (2017) Effect of lipopolysaccharide on developmental competence of oocytes. Reprod Toxicol 71:1–7. https://doi.org/10.1016/j.reprotox.2017.04.001 Basini G, Mainardi GL, Bussolati S, Tamanini C (2002) Steroidogenesis, proliferation and apoptosis in bovine granulosa cells: role of tumor necrosis factor-α and its possible signaling mechanisms. Reprod Fertil Dev 14(3–4):141–150 (No DOI available) Boby J, Kumar H, Gupta HP et al (2017) Endometritis increases pro-inflammatory cytokines in follicular fluid and cervico-vaginal mucus in the buffalo cow. Anim Biotechnol 28(3):163–167 (No DOI available) Lee SH, Kim MK, Park HY et al (2012) Significant association of elevated plasma YKL-40 with disease severity in patients with pelvic inflammatory disease. J Clin Lab Anal 26(2):136–142. https://doi.org/10.1002/jcla.21500 Liu D, Hu X, Ding X, Li M, Ding L (2024) Inflammatory effects and regulatory mechanisms of chitinase-3-like-1 in multiple human body systems: a comprehensive review. Int J Mol Sci 25(24):13437. https://doi.org/10.3390/ijms252413437 Meng L, Wu Z, Zhao K et al (2021) Transcriptome analysis of porcine granulosa cells in healthy and atretic follicles: role of steroidogenesis and oxidative stress. Antioxidants 10(1):22. https://doi.org/10.3390/antiox10010022 Jang JY, Kim YS, Han YM, Kang SY, Kim J-S (2019) Alteration in uterine protease-activated receptor 2 expression in preterm birth induced in Brp-39 (CHI3L1) null mutant mice. Reprod Sci 26:713–723. https://doi.org/10.1177/1933719118821873 ( CHI3L1 is also known as Brp-39) Kim M, Chang JY, Lee DW et al (2023) Chitinase-3-like 1 deficiency ameliorates LPS-induced acute liver injury by inhibition of M2 macrophage polarization. Mol Immunol 156:98–110. https://doi.org/10.1016/j.molimm.2023.02.012 Li J, Long H, Cong Y et al (2021) Quercetin prevents primordial follicle loss via suppression of PI3K/Akt/Foxo3a pathway activation in cyclophosphamide-treated mice. Reprod Biol Endocrinol 19:63. https://doi.org/10.1186/s12958-021-00743-y Sirotkin AV, Štochmaľová A, Alexa R et al (2019) Quercetin directly inhibits basal ovarian cell functions and their response to FSH. Eur J Pharmacol 860:172560. https://doi.org/10.1016/j.ejphar.2019.172560 Qi N, Xing W, Li M, Liu J (2023) Quercetin alleviates toxicity induced by high copper levels in porcine granulosa cells by scavenging ROS and improving mitochondrial function. Animals 13(17):2745. https://doi.org/10.3390/ani13172745 Duan H, Wang F, Wang K et al (2024) Quercetin ameliorates oxidative stress–induced apoptosis of granulosa cells in dairy cow follicular cysts by activating autophagy via the SIRT1/ROS/AMPK pathway. J Anim Sci Biotechnol 15(1):119. https://doi.org/10.1186/s40104-024-01078-5 Sun L, Xu G, Dong Y et al (2020) Quercetin protects against LPS-induced intestinal oxidative stress in broiler chickens through activation of Nrf2 pathway. Molecules 25(5):1053. https://doi.org/10.3390/molecules25051053 Sul OJ, Ra SW (2021) Quercetin prevents LPS-induced oxidative stress and inflammation by modulating NOX2/ROS/NF-κB in lung epithelial cells. Molecules 26(22):6949. https://doi.org/10.3390/molecules26226949 Xiong G, Ji WS, Wang F et al (2019) Quercetin inhibits inflammatory response induced by Porphyromonas gingivalis LPS in human gingival fibroblasts via suppressing NF-κB signaling. Biomed Res Int 2019:6282635. https://doi.org/10.1155/2019/6282635 Jiang M, Lv Z, Huang Y et al (2022) Quercetin alleviates LPS-induced inflammatory response in bovine mammary epithelial cells by suppressing TLR4/NF-κB signaling. Front Vet Sci 9:915726. https://doi.org/10.3389/fvets.2022.915726 Gerin F, Sener U, Erman H et al (2016) Effects of quercetin on acute lung injury and biomarkers of inflammation and oxidative stress in a rat sepsis model. Inflammation 39(2):700–705. https://doi.org/10.1007/s10753-016-0285-6 Jančar N, Kopitar AN, Ihan A et al (2007) Effect of apoptosis and reactive oxygen species production in human granulosa cells on oocyte fertilization and blastocyst development. J Assist Reprod Genet 24(2–3):91–97. https://doi.org/10.1007/s10815-006-9103-8 Qu X, Yan L, Guo R, Li H, Shi Z (2019) ROS-induced GATA4/GATA6 downregulation inhibits StAR expression in LPS-treated porcine granulosa-lutein cells. Oxid Med Cell Longev 2019:5432792. https://doi.org/10.1155/2019/5432792 Zhao S, Pang Y, Zhao X et al (2017) Effects of lipopolysaccharide on maturation of bovine oocytes in vitro and its possible mechanisms. Oncotarget 8(3):4656–4672. https://doi.org/10.18632/oncotarget.13931 Zhao S, Pang Y, Zhao X et al (2019) Detrimental effects of lipopolysaccharide on maturation of bovine oocytes. Asian-Australas J Anim Sci 32(8):1112–1121. https://doi.org/10.5713/ajas.18.0598 Marei WF, Ghafari F, Fouladi-Nashta AA (2012) Role of hyaluronic acid in maturation and further embryo development of bovine oocytes: regulatory role of cumulus expansion. Theriogenology 78(3):670–677. https://doi.org/10.1016/j.theriogenology.2012.03.015 Vashisht M, Rani P, Dahiya SK, Singh D (2018) Curcumin-primed exosomes reverse LPS-induced pro-inflammatory gene expression in buffalo granulosa cells. J Cell Biochem 119(2):1488–1500. https://doi.org/10.1002/jcb.26307 Harl AW, Negrón-Pérez VM, Stewart JW et al (2025) Maturation of bovine COCs in follicular fluid with or without estradiol and progesterone: impact on cumulus expansion and embryo development. PLoS ONE 20(6):e0321266. https://doi.org/10.1371/journal.pone.0321266 Davoodian N, Kadivar A, Davoodian N et al (2022) Quercetin in maturation media affects cumulus–granulosa cells and developmental competence of bovine oocytes. Theriogenology 189:262–269. https://doi.org/10.1016/j.theriogenology.2022.06.026 Dubeibe Marín DF, da Costa NN, Santana PPB, de Souza EB, Ohashi OM (2019) Importance of lipid metabolism on oocyte maturation and early embryo development: can we apply what we know to buffalo? Anim Reprod Sci 211:106220. https://doi.org/10.1016/j.anireprosci.2019.106220 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 05 Mar, 2026 Reviews received at journal 03 Mar, 2026 Reviewers agreed at journal 16 Feb, 2026 Reviews received at journal 23 Dec, 2025 Reviewers agreed at journal 10 Dec, 2025 Reviewers invited by journal 01 Dec, 2025 Editor assigned by journal 29 Nov, 2025 Submission checks completed at journal 29 Nov, 2025 First submitted to journal 22 Nov, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8182389","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":553470911,"identity":"810b8696-832e-4b40-99f3-38ca8ab4a1e3","order_by":0,"name":"S Sandhiya","email":"","orcid":"","institution":"Madras Veterinary College (TANUVAS)","correspondingAuthor":false,"prefix":"","firstName":"S","middleName":"","lastName":"Sandhiya","suffix":""},{"id":553470912,"identity":"27832cd4-6b64-41bd-a92b-4c6ac39fdfaa","order_by":1,"name":"Vijay Anand","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA+klEQVRIiWNgGAWjYDACZoYEKCsh8cEHIMXGToKWZMMZIC3MxNuXwCbMAzEEPzA4zvDwM0/NHXlz9oRnzDa/tsnzMTMwfviYg0fLYYZkaZ5jzwx39jxIe5zbd9uwjZmBWXLmNtxaJJsZEqR52A4zbriRkG6c23ObEaiFjZkXv5bk3zz/DtsDtaRJW/bctieohZ+ZIU2at+1wIlgLw4/biURpsZzbdzh5w5kHyYa9DbeT25gZm/H6hY3/TPKNN98O2244npP44Mef27bz25sPfviIRwsDA08CEw+UwcDYBmIwNuBTDwTsBxh/QBkMDH8IKB4Fo2AUjIIRCQB571ROTtZnXwAAAABJRU5ErkJggg==","orcid":"","institution":"Madras Veterinary College (TANUVAS)","correspondingAuthor":true,"prefix":"","firstName":"Vijay","middleName":"","lastName":"Anand","suffix":""},{"id":553470914,"identity":"fb188572-c02d-4416-9389-b70042256766","order_by":2,"name":"K Brindha","email":"","orcid":"","institution":"Veterinary College and Research Institute","correspondingAuthor":false,"prefix":"","firstName":"K","middleName":"","lastName":"Brindha","suffix":""},{"id":553470916,"identity":"f7aef616-7bd6-49c5-a23b-0ca4316f43bd","order_by":3,"name":"Guru D V Pandiyan","email":"","orcid":"","institution":"Madras Veterinary College (TANUVAS)","correspondingAuthor":false,"prefix":"","firstName":"Guru","middleName":"D V","lastName":"Pandiyan","suffix":""},{"id":553470922,"identity":"3a21b5d4-09f9-4fe9-9230-190b48719ed0","order_by":4,"name":"Sathesh Kumar S","email":"","orcid":"","institution":"Madras Veterinary College (TANUVAS)","correspondingAuthor":false,"prefix":"","firstName":"Sathesh","middleName":"Kumar","lastName":"S","suffix":""},{"id":553470923,"identity":"57e339ff-fcf3-43cd-8b49-5000371f7c08","order_by":5,"name":"Raja P","email":"","orcid":"","institution":"Madras Veterinary College (TANUVAS)","correspondingAuthor":false,"prefix":"","firstName":"Raja","middleName":"","lastName":"P","suffix":""},{"id":553470924,"identity":"107f86e4-de3a-4ed3-8069-b676dd9a0bd2","order_by":6,"name":"Parthiban M","email":"","orcid":"","institution":"Madras Veterinary College (TANUVAS)","correspondingAuthor":false,"prefix":"","firstName":"Parthiban","middleName":"","lastName":"M","suffix":""}],"badges":[],"createdAt":"2025-11-22 20:08:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8182389/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8182389/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":97345676,"identity":"a3d91be0-2c64-474a-8a8d-8ec2c3836700","added_by":"auto","created_at":"2025-12-03 11:45:53","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5074057,"visible":true,"origin":"","legend":"","description":"","filename":"BuffaloGCFinalManuscriptVRC261125.docx","url":"https://assets-eu.researchsquare.com/files/rs-8182389/v1/00b60ac2670db077c25539b4.docx"},{"id":97370621,"identity":"5b3a6fcb-b2d3-4880-aeef-d87242d05cc0","added_by":"auto","created_at":"2025-12-03 16:27:42","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":8631,"visible":true,"origin":"","legend":"","description":"","filename":"928efa4d9ccc496eb8bb81ab7b983626.json","url":"https://assets-eu.researchsquare.com/files/rs-8182389/v1/d10587c9c03873719703de4d.json"},{"id":97345663,"identity":"a102cd4b-b7b8-4330-ae7e-9c0cc882e9ed","added_by":"auto","created_at":"2025-12-03 11:45:53","extension":"xml","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":154382,"visible":true,"origin":"","legend":"","description":"","filename":"928efa4d9ccc496eb8bb81ab7b9836261enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8182389/v1/83d103a27bb5fc7c6ef2b0fe.xml"},{"id":97371282,"identity":"190692f4-1b1b-4d26-964f-4f6ef5724d4a","added_by":"auto","created_at":"2025-12-03 16:28:41","extension":"jpeg","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1460397,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8182389/v1/1363ce6f4ae34e715cf5d0fd.jpeg"},{"id":97345660,"identity":"bda103b2-6eaa-49e9-be4f-c74441bac9cd","added_by":"auto","created_at":"2025-12-03 11:45:52","extension":"png","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1223437,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage10.png","url":"https://assets-eu.researchsquare.com/files/rs-8182389/v1/a0c1ed731ba833513e6572ad.png"},{"id":97371277,"identity":"10496ef7-b571-4d09-a812-c475dab0d1ac","added_by":"auto","created_at":"2025-12-03 16:28:40","extension":"jpeg","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":517690,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8182389/v1/8b271fa51490b711e2e2dff3.jpeg"},{"id":97371157,"identity":"3fa76260-20c6-4b55-bca9-649cb8dbddd0","added_by":"auto","created_at":"2025-12-03 16:28:28","extension":"png","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":86004,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8182389/v1/cf7e86fff8ef9c497cc8dbe8.png"},{"id":97345672,"identity":"41f5b487-e4c0-47b1-8452-cbeae4a8a0fb","added_by":"auto","created_at":"2025-12-03 11:45:53","extension":"jpeg","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":226525,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8182389/v1/1698b387f20093cd3b36a4f4.jpeg"},{"id":97370485,"identity":"cf4a7924-47b2-4ed1-8612-33ef2c2d14f1","added_by":"auto","created_at":"2025-12-03 16:27:28","extension":"png","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":83349,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-8182389/v1/671ad3882598a49de5c904cd.png"},{"id":97345681,"identity":"72374d9c-46a4-4662-aea3-c984d1f26abe","added_by":"auto","created_at":"2025-12-03 11:45:53","extension":"jpeg","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":412962,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8182389/v1/cdbfcae1bb2af2e4e07e9869.jpeg"},{"id":97345679,"identity":"f6f90a34-80ce-4f76-86ed-7ece4cdab059","added_by":"auto","created_at":"2025-12-03 11:45:53","extension":"png","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1467734,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-8182389/v1/b52653715af812fcc5487369.png"},{"id":97345687,"identity":"5e29d3d2-387d-4233-aed3-a71d3cfe8e93","added_by":"auto","created_at":"2025-12-03 11:45:53","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":109283,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-8182389/v1/b00daeb1076d085ff8bda7b0.png"},{"id":97371301,"identity":"fcd61a19-a51e-4bdf-8c6a-b2a65893bf63","added_by":"auto","created_at":"2025-12-03 16:28:42","extension":"jpeg","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":444362,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage9.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8182389/v1/fb09e77716aaac68894d51f0.jpeg"},{"id":97345684,"identity":"c4fbb280-19d8-476d-ad90-8fff406fb15c","added_by":"auto","created_at":"2025-12-03 11:45:53","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":433115,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8182389/v1/df3d359e756b33c2d2a95281.png"},{"id":97345680,"identity":"c3a1b354-f259-4d08-b817-f24aa08967a2","added_by":"auto","created_at":"2025-12-03 11:45:53","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":132987,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage10.png","url":"https://assets-eu.researchsquare.com/files/rs-8182389/v1/f3143b6c1a5e20fd3ea9e45a.png"},{"id":97370642,"identity":"993d4076-f22c-4a6a-954e-7dfc30cf8836","added_by":"auto","created_at":"2025-12-03 16:27:44","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":126703,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8182389/v1/fcd16628b5caaf894794e241.png"},{"id":97370665,"identity":"7248fbc0-5039-4423-af40-aa09d02ae0a5","added_by":"auto","created_at":"2025-12-03 16:27:45","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":23458,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8182389/v1/39f9f1ba59d52ffcb9cbdec6.png"},{"id":97345686,"identity":"3f335d8d-0caa-44cd-a49f-0f274ffeaa31","added_by":"auto","created_at":"2025-12-03 11:45:53","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":57279,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-8182389/v1/eeb37c2b8659cc7a4b95df1f.png"},{"id":97345695,"identity":"83fb5664-ca49-4d81-92ef-86940b7f8d44","added_by":"auto","created_at":"2025-12-03 11:45:54","extension":"png","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":18724,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-8182389/v1/564bd28cd71f13e7da4c8fbd.png"},{"id":97371151,"identity":"51de54e8-5859-47f7-9d1d-65239fe08f7d","added_by":"auto","created_at":"2025-12-03 16:28:28","extension":"png","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":97302,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-8182389/v1/636debaa2a7108e5a9568831.png"},{"id":97370394,"identity":"65b85707-3444-48f3-a958-244c1250cf61","added_by":"auto","created_at":"2025-12-03 16:27:16","extension":"png","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":220109,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-8182389/v1/3d6d518d63fe637c30c33f19.png"},{"id":97345678,"identity":"d1c0ab88-96d3-4ebe-a27f-f242d23fded5","added_by":"auto","created_at":"2025-12-03 11:45:53","extension":"png","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":23618,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-8182389/v1/f079cbfaf31d19aa97828eb8.png"},{"id":97345682,"identity":"6ab50701-e179-470e-9ffe-d97251937cb8","added_by":"auto","created_at":"2025-12-03 11:45:53","extension":"png","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":169482,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage9.png","url":"https://assets-eu.researchsquare.com/files/rs-8182389/v1/6135f3a394b63eeebf31ec26.png"},{"id":97345685,"identity":"6cdfb127-e7eb-4e98-bce1-35edaaa6ca98","added_by":"auto","created_at":"2025-12-03 11:45:53","extension":"xml","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":150937,"visible":true,"origin":"","legend":"","description":"","filename":"928efa4d9ccc496eb8bb81ab7b9836261structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8182389/v1/2af39214fc878cc30e829805.xml"},{"id":97345692,"identity":"88fa0889-3a0e-4d50-803a-6844d9b4fd17","added_by":"auto","created_at":"2025-12-03 11:45:54","extension":"html","order_by":24,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":163572,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8182389/v1/9d8be6251c34f6307ab9ee24.html"},{"id":97345656,"identity":"6d923163-2b6b-4cdf-8513-91b7f01b2f33","added_by":"auto","created_at":"2025-12-03 11:45:52","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":81451,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIsolation, culture and morphology of buffalo granulosa cells.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Stepwise schematic of granulosa cell isolation from ovarian follicles, including aspiration of follicular fluid, removal of cumulus–oocyte complexes (COCs), washing of granulosa cells and seeding of cells. (B) Phase contrast micrographs of granulosa cells at 12 h, 24 h and 36 h after seeding, showing progressive cell attachment and cluster formation. (C) Morphology of granulosa cells after 48 h in standard DMEM/F 12 with 10% serum (top; fibroblastic morphology) compared with cells cultured in Advanced DMEM containing 1% serum (bottom; more epithelial like morphology).\u003c/p\u003e","description":"","filename":"Picture1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8182389/v1/dbe8066604b12151a1e4d2be.jpg"},{"id":97345657,"identity":"7249588c-077e-4bef-83cb-ab8311d8467e","added_by":"auto","created_at":"2025-12-03 11:45:52","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":18382,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAnalysis of FSH receptor and aromatase mRNA expression in cultured granulosa cells using RT-PCR.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAgarose gel (2%) showing RT-PCR amplification of two marker genes from buffalo granulosa cell RNA. Lanes include a 100 bp DNA ladder (left) for size reference. Lane L1- PCR product showing 192 bp amplicon specific for FSH receptor (FSHR) Lane L2- PCR product showing 179bp amplicon specific for aromatase (CYP19A1)\u003c/p\u003e","description":"","filename":"Picture2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8182389/v1/d8de527b7f53f7f858629c81.jpg"},{"id":97371187,"identity":"5cf4296e-a903-433f-8834-a83ea55a4bf3","added_by":"auto","created_at":"2025-12-03 16:28:30","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":42001,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eQuantification of cell viability by MTT assay expressed as optical density (OD) at 550 nm (mean ± SE).\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Effect of LPS on granulosa cell viability after 6 h of exposure.Cell viability was significantly reduced at 1000 and 2000 ng/mL LPS compared with the control (*p \u0026lt; 0.05), whereas 10 and 100 ng/mL LPS showed no significant difference (ns)\u003c/p\u003e\n\u003cp\u003e(B) Effect of LPS on granulosa cell viability after 12 h of exposure. No significant (ns) difference in viability was observed between the control and any LPS-treated group (p \u0026gt; 0.05).\u003c/p\u003e\n\u003cp\u003e(C) Effect of LPS on granulosa cell viability after 24 h of exposure. No significant (ns) difference in viability was observed between the control and any LPS-treated group (p \u0026gt; 0.05).\u003c/p\u003e","description":"","filename":"Picture3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8182389/v1/2b2bd5abb21b0e035e0594e9.jpg"},{"id":97345666,"identity":"ae0ccc92-26a3-43a0-8ae4-a2648d4e7cd5","added_by":"auto","created_at":"2025-12-03 11:45:53","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":30119,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTime dependent effect of LPS on CHI3L1 gene expression in granulosa cells.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGranulosa cells were treated with LPS (0, 10, 100, and 1000 ng/mL) for (A) 6 h, (B) 12 h, and (C) 24 h. Relative CHI3L1 mRNA levels were measured by qPCR, normalized to GAPDH, and expressed as 2⁻ΔΔCt relative to the untreated control. Data are shown as individual replicates (dots) with the mean value (horizontal line). No significant (ns) changes in CHI3L1 expression were detected at 6 or 12 h. At 24 h, treatment with 1000 ng/mL LPS significantly increased CHI3L1 expression compared with the control (p \u0026lt; 0.05), whereas 10 and 100 ng/mL LPS had no significant effect (ns)\u003c/p\u003e","description":"","filename":"Picture4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8182389/v1/45b301240c5f40d7cdd52bdd.jpg"},{"id":97371377,"identity":"979fe561-94fd-4908-8021-747d2e699934","added_by":"auto","created_at":"2025-12-03 16:28:50","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":31251,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSecreted CHI3L1 protein levels in granulosa cell culture supernatant following LPS treatment (ELISA).\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Representative ELISA microplate showing colorimetric reactions for CHI3L1 standards, blanks, and samples from granulosa cell culture media.\u003c/p\u003e\n\u003cp\u003e(B) Quantification of CHI3L1 protein concentration (ng/mL) in conditioned media after 24 h treatment with LPS (0, 10, 100, or 1000 ng/mL). Data are shown as individual replicates (dots) with the mean (horizontal line). No significant (ns) differences in secreted CHI3L1 levels were detected between the control and any LPS treated group (p \u0026gt; 0.05).\u003c/p\u003e","description":"","filename":"Picture5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8182389/v1/085a3eb500304e938df3d692.jpg"},{"id":97345661,"identity":"eaea9f35-2778-4103-8a56-6284ce774975","added_by":"auto","created_at":"2025-12-03 11:45:52","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":31053,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLPS-induced IL-6 gene expression in granulosa cells at 6 h, 12 h, and 24 h.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRelative IL-6 mRNA levels (\u003cstrong\u003e2\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003e-ΔΔCt\u003c/strong\u003e\u003c/sup\u003e) in granulosa cells treated with LPS (0, 10, 100, 1000 ng/ml) for \u003cstrong\u003e(A)\u003c/strong\u003e 6 h, \u003cstrong\u003e(B)\u003c/strong\u003e 12 h, and \u003cstrong\u003e(C)\u003c/strong\u003e 24 h. Data are plotted as individual replicates (dots) with the mean (line). IL-6 expression was significantly upregulated in a dose-dependent manner by 100 ng/ml and 1000 ng/ml LPS at all time points. The 10 ng/ml dose had no significant (ns) effect. (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"Picture6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8182389/v1/bf4987dabbdae6a87cfb451e.jpg"},{"id":97345662,"identity":"f793543e-80d6-40bc-9119-caa93ab236df","added_by":"auto","created_at":"2025-12-03 11:45:52","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":31143,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLPS-induced IL-1β gene expression in granulosa cells at 6 h, 12 h, and 24 h.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRelative IL-1β mRNA levels (\u003cstrong\u003e2\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003e-ΔΔCt\u003c/strong\u003e\u003c/sup\u003e) in granulosa cells treated with LPS (0, 10, 100, 1000 ng/ml) for \u003cstrong\u003e(A)\u003c/strong\u003e 6 h, \u003cstrong\u003e(B)\u003c/strong\u003e 12 h, and \u003cstrong\u003e(C) \u003c/strong\u003e24 h. Data are plotted as individual replicates (dots) with the mean (line). LPS caused a rapid and significant dose-dependent upregulation of IL-1β at all time points. Expression was significantly increased by 100 ng/ml and 1000 ng/ml LPS at 6 h (A) , 12 h (B) , and 24 h (C). The 10 ng/ml dose had no significant (ns) effect at any time point. (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"Picture7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8182389/v1/f15a9b68ceb2e1f852473e42.jpg"},{"id":97369795,"identity":"626bd2cf-4710-435e-8d2e-dbad7534195b","added_by":"auto","created_at":"2025-12-03 16:25:49","extension":"jpg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":32394,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTime-dependent TNF-α gene expression in granulosa cells with LPS treatment.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRelative TNF-α mRNA levels (\u003cstrong\u003e2\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003e-ΔΔCt\u003c/strong\u003e\u003c/sup\u003e) in granulosa cells treated with LPS (0, 10, 100, 1000 ng/ml) for \u003cstrong\u003e(A)\u003c/strong\u003e 6 h, \u003cstrong\u003e(B)\u003c/strong\u003e 12 h, and \u003cstrong\u003e(C) \u003c/strong\u003e24 h. Data are plotted as individual replicates (dots) with the mean (line). TNF-α expression showed a rapid and transient increase, peaking at 6 h with significant upregulation at 100 and 1000 ng/ml LPS. Expression declined at 12 h and 24 h, though 1000 ng/ml LPS remained significantly higher than control. The 10 ng/ml dose had no significant (ns) effect at any time point.\u003c/p\u003e","description":"","filename":"Picture8.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8182389/v1/d46bc8aff0580765db0bf330.jpg"},{"id":97345694,"identity":"4f224dc4-26be-45f1-bcc0-5dd045332ce4","added_by":"auto","created_at":"2025-12-03 11:45:54","extension":"jpg","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":21017,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDose-dependent effect of quercetin on granulosa cell viability (MTT assay).\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe bar diagram shows quantified data of cell viability (OD at 550 nm) presented as mean ± SE\u003c/p\u003e","description":"","filename":"Picture9.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8182389/v1/daf46f149f6f299cb1c99f20.jpg"},{"id":97345670,"identity":"adbe5155-2cf5-4c5e-bf05-22af8875dc39","added_by":"auto","created_at":"2025-12-03 11:45:53","extension":"jpg","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":123159,"visible":true,"origin":"","legend":"\u003cp\u003ePhase-contrast micrographs (100x) of granulosa cells cultured under control, LPS, \u0026nbsp;and quercetin treatments after 24 h.\u003c/p\u003e","description":"","filename":"Picture10.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8182389/v1/7e7b03e7f560eac392372b9a.jpg"},{"id":97370997,"identity":"22e3e190-19a6-4615-87f8-b000bd59c7f2","added_by":"auto","created_at":"2025-12-03 16:28:15","extension":"jpg","order_by":11,"title":"Figure 11","display":"","copyAsset":false,"role":"figure","size":52813,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eQuercetin modulation of LPS-induced gene expression in granulosa cells (24 h).\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRelative mRNA expression (\u003cstrong\u003e2\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003e-ΔΔCt\u003c/strong\u003e\u003c/sup\u003e) of (A) \u003cstrong\u003eCHI3L1\u003c/strong\u003e, (B) \u003cstrong\u003eIL-6\u003c/strong\u003e, (C) \u003cstrong\u003eIL-1β\u003c/strong\u003e, and (D) \u003cstrong\u003eTNF-α\u003c/strong\u003e in granulosa cells after 24 h incubation under four conditions: Control, LPS, Quercetin, and LPS + Quercetin. Data are plotted as individual replicates (dots) with the mean (line). LPS significantly upregulated all genes compared to the control. Co-treatment with quercetin significantly attenuated the LPS-induced expression of all genes (p \u0026lt; 0.05; ns = not significant)\u003c/p\u003e","description":"","filename":"Picture11.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8182389/v1/fffc2fd5ef10db9b7b9f9966.jpg"},{"id":97371189,"identity":"fc78cdc7-3abe-46fb-a60a-12d4535087a3","added_by":"auto","created_at":"2025-12-03 16:28:30","extension":"jpg","order_by":12,"title":"Figure 12","display":"","copyAsset":false,"role":"figure","size":39965,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of LPS and quercetin on intracellular reactive oxygen species (ROS) in granulosa cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Representative fluorescence micrographs of DCF‑DA–stained granulosa cells (100×) after 24 h treatment with culture medium (control), LPS, quercetin, or LPS + quercetin. (B) Quantification of intracellular ROS levels expressed as mean DCF fluorescence intensity (arbitrary units, mean ± SE; n = 3) (\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"Picture12.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8182389/v1/fb93f958b689647e3c35f765.jpg"},{"id":97345673,"identity":"9994c53b-8602-4861-a7f6-c40806be8ccb","added_by":"auto","created_at":"2025-12-03 11:45:53","extension":"jpg","order_by":13,"title":"Figure 13","display":"","copyAsset":false,"role":"figure","size":83654,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of granulosa cell (GC) treatments on cumulus expansion and oocyte maturation in GC–COC co‑culture.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Representative bright‑field images of COCs after 24 h co‑culture with GCs from four groups: control GC+COC (full cumulus expansion), LPS‑treated GC+COC (poor expansion), quercetin‑treated GC+COC (full expansion), and LPS+quercetin‑treated GC+COC (intermediate/rescued expansion). (B) Hoechst 33342 staining of oocytes showing nuclear maturation to the metaphase II (MII) stage, identified by the presence of a polar body. (C) Micrograph of the GC–COC co‑culture under a phase contrast microscope (100 X).(D) Bar graph showing the percentage of matured oocytes (mean ± SEM). LPS‑treated GCs significantly reduced the oocyte maturation rate, whereas co‑treatment with quercetin significantly improved maturation compared with LPS alone (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"Picture13.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8182389/v1/eacc74a91bf342991b4fa888.jpg"},{"id":97373160,"identity":"cefc74d7-0fbc-4443-8e41-01cfb217e76c","added_by":"auto","created_at":"2025-12-03 16:34:30","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1965542,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8182389/v1/51f04cdc-556d-47a9-b72c-3f68acb1350b.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Quercetin modulates Chitinase-3-like protein 1 expression and inflammatory responses in lipopolysaccharide-stimulated buffalo granulosa cells","fulltext":[{"header":"Introduction","content":"\u003cp\u003eInfertility and subfertility in dairy buffaloes are often attributed to postpartum inflammation of the reproductive tract, particularly under conditions such as metritis and endometritis (Magata \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). These inflammatory conditions introduce lipopolysaccharide (LPS), a gram-negative bacterial endotoxin, into the systemic circulation, which disrupts the intrafollicular environment and perturbs ovarian physiology (Sheldon et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Bidne et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). LPS-induced endotoxemia is a primary factor contributing to ovarian dysfunction in livestock, as it elicits inflammatory responses in ovarian granulosa cells, impairing endocrine function and reducing oocyte developmental competence (Herath et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Price et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2013\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eGranulosa cells (GCs), traditionally recognized for their roles in steroidogenesis and oocyte support, also function as innate immune sensors within the ovary by expressing toll-like receptor 4 (TLR4). Upon LPS binding to TLR4, GCs activate the NF-κB and MAPK signaling pathways, leading to the upregulation of pro-inflammatory cytokines, such as interleukin-6 (IL-6), interleukin-1β(IL-1β), and tumor necrosis factor-α (TNFα) (Bromfield and Sheldon \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Sustained elevation of these cytokines alters the expression of steroidogenic enzymes, diminishes estradiol synthesis, and can trigger apoptosis or cumulus cell dysfunction (Taylor and Terranova \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e1996\u003c/span\u003e). Granulosa cells themselves possess an innate immune capability to detect bacterial infections, and LPS acting directly on granulosa cells perturbs follicular steroidogenesis and follicle growth in the absence of immune leukocytes. Recent evidence has also implicated chitinase-3-like protein 1 (CHI3L1), also known as YKL-40, as a novel inflammation-responsive biomarker in the ovary. CHI3L1 is a glycoprotein involved in tissue remodeling and immune modulation, and its expression is elevated in cells under stress or inflammatory stimulation (Blazevic et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Within the reproductive system, increased CHI3L1 levels are associated with granulosa cell responses during follicular atresia, polycystic ovary syndrome (PCOS)-like conditions, and oxidative damage (Puttabyatappa et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Tang et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Notably, its expression was observed to increase in vitro during maturation of buffalo cumulus\u0026ndash;oocyte complexes (Anand et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2024\u003c/span\u003e), suggesting a potential physiological role in follicular remodeling. However, whether CHI3L1 is inducible in buffalo granulosa cells under pathological LPS-driven inflammatory conditions remains unknown.\u003c/p\u003e\u003cp\u003eQuercetin, a naturally occurring flavonoid that is abundant in many plant-based foods, exhibits potent anti-inflammatory and antioxidant properties. Mechanistically, quercetin can inhibit the TLR4/NF-κB pathway and activate the Nrf2 pathway, thereby suppressing the production of proinflammatory cytokines and enhancing the expression of antioxidant enzymes (Zhang et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Khadrawy et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Previous studies have demonstrated the efficacy of quercetin in protecting bovine and buffalo reproductive cells from oxidative and inflammatory stresses. Supplementation with quercetin has been shown to improve oocyte viability, promote cumulus expansion, and increase subsequent embryo development rates under challenging conditions (Yang et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Rashidi et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Despite these promising findings, the influence of quercetin on LPS-challenged buffalo granulosa cells, particularly its potential to modulate CHI3L1 expression during an inflammatory response, remains to be elucidated.\u003c/p\u003e\u003cp\u003eTherefore, the present study was designed to examine the expression dynamics of CHI3L1 in buffalo granulosa cells during LPS-induced inflammation and evaluate the protective effects of quercetin on LPS-induced inflammatory responses. Using molecular assays for gene and protein expression, inflammatory cytokine measurements, reactive oxygen species (ROS) assays, and co-culture experiments with oocytes, we explored the diagnostic and therapeutic relevance of CHI3L1 and quercetin in an in vitro ovarian inflammation model. These insights are pertinent to improving in vitro maturation (IVM) and in vitro fertilization (IVF) outcomes in buffaloes because maintaining a healthy granulosa\u0026ndash;oocyte microenvironment under both physiological and inflammatory conditions is crucial for optimizing assisted reproductive techniques. Buffaloes are of significant economic importance in tropical and subtropical agricultural systems and enhancing their reproductive efficiency has direct implications for milk and meat production. Addressing postpartum inflammatory disorders is vital for improving conception rates, shortening calving intervals, and reducing economic losses during dairy operations. Notably, buffaloes are prone to developing subclinical uterine infections that are often undiagnosed, which underscores the need for sensitive intra-ovarian biomarkers of inflammation. Identifying ovarian inflammation using a novel marker such as CHI3L1, in conjunction with an anti-inflammatory intervention such as quercetin, could enable both the early detection and therapeutic mitigation of inflammation.\u003c/p\u003e"},{"header":"Material \u0026 Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eCollection of buffalo ovaries\u003c/h2\u003e\u003cp\u003eOvaries from domestic buffaloes (Bubalus bubalis) were collected from a local abattoir immediately after slaughter. The ovaries were trimmed of excess connective tissue and immediately placed in a sterile insulated container with warm 0.9% saline (37\u0026deg;C) containing penicillin (100 IU/mL) and streptomycin (100 \u0026micro;g/mL). The container was sealed and transported to the laboratory within 2\u0026ndash;4 hours of collection. Upon arrival, ovaries were thoroughly rinsed in fresh sterile saline to remove blood and debris before further processing.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eGranulosa cell isolation and culture\u003c/h3\u003e\n\u003cp\u003eAntral follicles, measuring 2\u0026ndash;8 mm in diameter on the ovarian surface, were identified and disinfected by gentle swabbing with 70% isopropanol. Follicular fluid was aspirated from visible, healthy follicles using an 18-gauge hypodermic needle attached to a 10 mL syringe pre-filled with collection medium. The aspirated follicular contents (including follicular fluid, cumulus\u0026ndash;oocyte complexes [COCs], and granulosa cells) were expelled into a sterile 15 mL conical tube containing warm collection medium. The tube was kept in a 38.5\u0026deg;C incubator for ~\u0026thinsp;15 min to allow COCs to settle at the bottom. The supernatant enriched with granulosa cells was carefully transferred to a fresh tube without disturbing the settled COCs. This cell suspension was diluted with the medium, mixed, and left undisturbed again so that red blood cells and debris remained in the upper phase, which was then removed. Granulosa cells in the remaining suspension were washed with Dulbecco\u0026rsquo;s phosphate-buffered saline (DPBS; Gibco, Thermo Fisher, USA) and pelleted by centrifugation (2000 rpm, 10 min). The cell pellet was washed twice with DPBS to eliminate residual contaminants.\u003c/p\u003e\u003cp\u003eThe final granulosa cell pellet was resuspended in warm complete culture medium [Advanced DMEM (Gibco) supplemented with 5% fetal bovine serum (FBS; Gibco), 2 mM L-glutamine (Gibco), and 1\u0026times; antibiotic\u0026ndash;antimycotic solution (100 U/mL penicillin, 100 \u0026micro;g/mL streptomycin, 0.25 \u0026micro;g/mL amphotericin-B; Gibco)]. Cells were seeded into sterile culture plates and incubated at 38.5\u0026deg;C in a humidified atmosphere with 5% CO₂. After approximately 24 h, the medium was replaced to remove non-adherent cells. Granulosa cell cultures were maintained with medium changes every 2\u0026ndash;3 d. Cells were grown as adherent monolayers and were used for experiments once they reached approximately 80% confluence.\u003c/p\u003e\n\u003ch3\u003eLPS stimulation and gene expression analysis\u003c/h3\u003e\n\u003cp\u003eTo induce an inflammatory response in vitro, primary granulosa cell cultures (~\u0026thinsp;80% confluence) were challenged with lipopolysaccharide (LPS from E. coli O111:B4; Sigma-Aldrich, USA). Cells were exposed to LPS at 0 (control), 10, 100, or 1000 ng/mL and incubated for 6, 12, or 24 h. Untreated control cells were maintained in parallel for each time point. Each treatment condition was performed in triplicate and repeated for three independent cell preparations to account for biological variability. Cell viability was assessed after LPS exposure using the MTT assay (see Cell viability and ROS assays below) to evaluate cytotoxicity. The LPS dose that induced a marked inflammatory effect without causing excessive cell death was identified and used in subsequent quercetin co-treatment experiments.\u003c/p\u003e\u003cp\u003eImmediately following LPS treatment, the cells were harvested for RNA isolation and quantitative PCR (qPCR) analysis of inflammatory gene expression. Total RNA was extracted using the NucleoSpin\u0026reg; RNA kit (Macherey-Nagel, Germany), according to the manufacturer\u0026rsquo;s instructions. The purity and concentration of RNA were verified by spectrophotometry (A₆₀/A₂₈₀ ~2.0). One microgram of each RNA sample was reverse-transcribed into cDNA using a PrimeScript\u0026trade; RT Reagent Kit (Takara Bio, Japan). For gene expression analysis, qPCR was carried out on a CFX96 real-time PCR system (Bio-Rad Laboratories, USA) to quantify the mRNA levels of chitinase-3-like protein 1 (CHI3L1) and the pro-inflammatory cytokines interleukin-1β (IL1B), interleukin-6 (IL6), and tumor necrosis factor-α (TNFα). Gene-specific primer sets for buffaloes were used (sequences based on published GenBank entries designed to span exon\u0026ndash;exon junctions to avoid genomic DNA amplification Table.1). Each 20 \u0026micro;L qPCR reaction contained cDNA (equivalent to ~\u0026thinsp;50 ng input RNA), 0.2 \u0026micro;M of forward and reverse primers, and 10 \u0026micro;L of 2\u0026times; SYBR\u0026reg; Green PCR Master Mix (Takara Bio). Thermal cycling conditions were as follows: initial denaturation at 95\u0026deg;C for 5 min, followed by 40 cycles of 95\u0026deg;C for 15 s and 60\u0026deg;C for 30 s. A melt-curve analysis was performed at the end of each run to confirm the specific products. All samples were run in triplicate, and no-template controls were included for each primer set. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an endogenous reference gene. Relative changes in gene expression between treated and control cells were calculated using the 2^-ΔΔCt method (Livak and Schmittgen \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2001\u003c/span\u003e).\u003c/p\u003e\n\u003ch3\u003eDetection of CHI3L1 protein by ELISA\u003c/h3\u003e\n\u003cp\u003eThe concentration of secreted CHI3L1 protein in granulosa cell culture supernatants was measured using a sandwich ELISA specific for buffalo CHI3L1 (GENLISA\u0026trade; CHI3L1 ELISA Kit; Krishgen Biosystems, India). The cell culture medium was collected at the end of LPS treatment, centrifuged to remove any cells or debris, and stored at \u0026minus;\u0026thinsp;20\u0026deg;C until analysis. The ELISA was performed according to the manufacturer\u0026rsquo;s protocol. In brief, 100 \u0026micro;L of standards or samples was added to microplate wells pre-coated with anti-CHI3L1 capture antibody and incubated to allow CHI3L1 antigen binding. After washing, the biotinylated detection antibody was added, followed by horseradish peroxidase\u0026ndash;conjugated streptavidin. The color was developed using tetramethylbenzidine (TMB) substrate, and the reaction was stopped with an acidic stop solution. Absorbance was measured at 450 nm using a microplate reader, and CHI3L1 concentrations in the samples were interpolated from the standard curve of known CHI3L1 concentrations.\u003c/p\u003e\n\u003ch3\u003eQuercetin treatment and LPS co-treatment design\u003c/h3\u003e\n\u003cp\u003eThe potential protective effects of quercetin against LPS-induced inflammation were evaluated in a separate set of experiments. First, the non-cytotoxic concentration of quercetin was determined by treating granulosa cells with quercetin (Sigma-Aldrich, USA) at 1, 10, 20, or 50 \u0026micro;g/mL for 24 h and measuring cell viability. Quercetin stock solution was prepared in dimethyl sulfoxide (DMSO) and diluted in culture medium to achieve the desired final concentrations ( DMSO vehicle concentration was kept below 0.1% in all cases). Cell viability was assessed using the MTT assay, and 1 \u0026micro;g/mL quercetin was identified as a dose that did not significantly affect granulosa cell viability. This concentration was selected for subsequent co-treatment experiments.\u003c/p\u003e\u003cp\u003eFor co-treatment, granulosa cells at approximately 80% confluence were divided into four treatment groups: control (untreated cells), LPS only (cells exposed to LPS at the selected inflammatory dose, with no quercetin), quercetin only (cells treated with 1 \u0026micro;g/mL quercetin, with no LPS), and LPS\u0026thinsp;+\u0026thinsp;Quercetin (cells simultaneously exposed to LPS and 1 \u0026micro;g/mL quercetin). Treatments were performed for 24 h for all groups. After treatment, the cells were processed for analysis to determine the effects of quercetin on inflammatory outcomes. Total RNA was extracted from each group and subjected to cDNA synthesis and qPCR as described above to compare the expression of CHI3L1 and cytokine genes among the groups. Each complete experiment (all four treatment conditions) was repeated at least three times using independent granulosa cell cultures.\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eCell viability and ROS assays\u003c/h2\u003e\u003cp\u003eCell viability under various treatment conditions was quantified using the colorimetric MTT assay. After the specified treatment period in each experiment, the culture medium was removed and the cells were gently washed with DPBS. MTT solution (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; Sigma-Aldrich) was added to the cells (final concentration\u0026thinsp;~\u0026thinsp;0.5 mg/mL in serum-free medium) and incubated at 37\u0026deg;C for approximately 3 h in the dark. Metabolically active cells reduce MTT to an insoluble purple formazan. After incubation, the MTT-containing solution was removed and the formazan crystals were dissolved by adding DMSO. The absorbance of each well was measured at 550 nm wavelength using a microplate reader (BioTek Instruments, USA). A higher absorbance corresponds to greater viability. This assay was used to evaluate LPS cytotoxicity and confirm that the chosen quercetin dose did not adversely affect cell viability.\u003c/p\u003e\u003cp\u003eIntracellular reactive oxygen species (ROS) levels were measured to evaluate oxidative stress in granulosa cells under inflammatory conditions and the potential antioxidant effects of quercetin. After 24 h of treatment for each experimental group (control, LPS, quercetin, LPS\u0026thinsp;+\u0026thinsp;quercetin), the culture medium was removed and cells were washed once with PBS. A cell‑permeable fluorogenic probe, 2\u0026prime;,7\u0026prime;‑dichlorofluorescein diacetate (DCFDA), was used to detect ROS. Working DCFDA solution (10 \u0026micro;M in PBS) was added to each well (in a sufficient volume to cover the cells), and the cells were incubated at 37\u0026deg;C for 30 min in the dark. During this time, DCFDA diffuses into cells and is deacetylated by intracellular esterases to a non‑fluorescent compound, which is then oxidized by ROS to yield 2\u0026prime;,7\u0026prime;‑dichlorofluorescein (DCF), a highly fluorescent molecule. After 30 min of incubation, the DCFDA solution was removed and the cells were washed twice with PBS to remove excess extracellular probe. The DCF fluorescence of stained cells was then visualized and photographed using a fluorescence microscope with identical exposure settings for all treatment groups. Intracellular ROS production levels were quantified using ImageJ image analysis software (National Institutes of Health, Bethesda, MD, USA) by measuring the mean fluorescence intensity in the captured images for each treatment condition. ROS levels are reported as arbitrary units of fluorescence intensity for all treatment groups.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eOocyte co-culture and in vitro maturation\u003c/h3\u003e\n\u003cp\u003eTo assess the functional impact of granulosa cell inflammation (and its mitigation by quercetin) on oocyte maturation, an oocyte\u0026ndash;granulosa cell co-culture system was employed. Cumulus\u0026ndash;oocyte complexes (COCs) were freshly collected from buffalo ovaries (not used for granulosa cell culture) following the same aspiration procedure described above. Only high-quality COCs with compact, multilayered cumulus cells and a homogeneous ooplasm were selected under a stereomicroscope. Groups of approximately 10\u0026ndash;20 COCs were placed in 4-well culture dishes containing 500 \u0026micro;L oocyte maturation medium (TCM-199; Gibco) supplemented with 10% FBS, 10 \u0026micro;g/mL follicle-stimulating hormone (FSH; Sigma-Aldrich), 5 \u0026micro;g/mL luteinizing hormone (LH; Sigma-Aldrich), and 10 ng/mL epidermal growth factor (EGF; Sigma-Aldrich). Each well of COCs was co-cultured with a monolayer of granulosa cells that had been pre-treated under one of four conditions: untreated control, LPS-treated, quercetin-treated, or LPS\u0026thinsp;+\u0026thinsp;quercetin co-treated (using the conditions described above). The co-cultures were covered with sterile mineral oil (Sigma-Aldrich) to prevent evaporation and incubated at 38.5\u0026deg;C in 5% CO₂ for 22\u0026ndash;24 h to allow in vitro maturation (IVM) of the oocytes. During this period, potential paracrine interactions between granulosa cells and oocytes could influence oocyte maturation. After 22\u0026ndash;24 h IVM culture, oocytes were examined under a stereomicroscope for evidence of cumulus expansion (degree of cumulus cell dispersion and expansion was noted as a morphological indicator of oocyte maturation).\u003c/p\u003e\u003cp\u003eTo evaluate nuclear maturation, the oocytes were freed from cumulus cells and assessed for first polar body extrusion. COCs from each co-culture were gently pipetted into a 0.1% hyaluronidase (in PBS) solution to remove cumulus cells, yielding denuded oocytes. Oocytes were washed in PBS and fixed in 4% paraformaldehyde for 15 min at room temperature. The fixed oocytes were stained with Hoechst 33342 fluorescent DNA dye (5 \u0026micro;g/mL in PBS) for 10 min in the dark. The stained oocytes were mounted on glass slides with a drop of antifade medium and covered with coverslips. The slides were observed under a fluorescence microscope (UV excitation filter) to visualize chromatin. Oocytes exhibiting dispersed chromatin and a visible first polar body were recorded as having reached metaphase II stage, indicating successful nuclear maturation.\u003c/p\u003e\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\u003ch2\u003eStatistical analysis\u003c/h2\u003e\u003cp\u003eData from all experiments are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error of the mean (SEM). One-way analysis of variance (ANOVA) was used to compare multiple treatment groups. When ANOVA indicated a significant difference (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), pairwise comparisons between group means were made using Tukey\u0026rsquo;s post hoc test. A significance threshold of p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was applied for all analyses. Each experiment was performed with at least three independent biological replicates. Statistical analyses were performed using GraphPad Prism software (version 10.0) and the results were plotted using the same software.\u003c/p\u003e\u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eGranulosa Cell Characterisation\u003c/h2\u003e\u003cp\u003eBuffalo granulosa cells (GCs) were successfully isolated from antral follicles and cultured. Upon seeding, GCs attached sparsely by 12 h and gradually formed clusters; after 36 h, a confluent monolayer with interconnecting cell processes was observed (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The cultured cells displayed different morphologies depending on the media conditions: in standard 10% serum medium, they became elongated and fibroblast-like, whereas in low-serum (1%) medium, they retained a cobblestone epithelial-like shape (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Molecular verification confirmed the identity of these cells as granulosa cells, as evidenced by RT-PCR detection of follicle-stimulating hormone receptor (FSHR, ~\u0026thinsp;192 bp) and aromatase (CYP19A1, ~\u0026thinsp;179 bp) transcripts (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003eEffect of LPS on Granulosa Cell Viability\u003c/h2\u003e\u003cp\u003eLPS exposure had a significant dose-dependent cytotoxic effect on granulosa cells at 6 h, followed by a return to the baseline viability at later time points. At 6 h, high concentrations of LPS (1,000\u0026ndash;2,000 ng/mL) reduced cell viability as measured by MTT, with optical density (OD_550) values dropping to approximately 75\u0026ndash;77% of control levels (e.g., 0.401\u0026thinsp;\u0026plusmn;\u0026thinsp;0.012 in controls vs. 0.304\u0026thinsp;\u0026plusmn;\u0026thinsp;0.006 at 2,000 ng/mL; p\u0026thinsp;\u0026lt;\u0026thinsp;0.05; Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Lower LPS doses (1\u0026ndash;100 ng/mL) did not significantly affect viability at 6 h (no difference in OD compared to the control; p\u0026thinsp;\u0026gt;\u0026thinsp;0.05). After 12 and 24 h of exposure, no significant differences in viability were evident between any LPS-treated group and the control (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05). Consistent with the quantitative readings, MTT formazan staining showed markedly reduced purple intensity only in the wells with the highest LPS doses at 6 h, whereas at 12 and 24 h, all groups exhibited uniformly intense staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimer sequences used for PCR amplification of target genes\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"5\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eS.NO\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eNAME OF GENE\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003ePRIMER SEQUENCE (5\u0026rsquo;- 3\u0026rsquo;)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eLENGTH (bp)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eAMPLICON SIZE (bp)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eFSHR\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eFP \u0026minus;\u0026thinsp;5\u0026rsquo; GATGTCTTGGAAGTGATAGA 3\u0026rsquo;\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e20\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e192\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eRP- 5\u0026rsquo;GAGAGACTGAATCTTGTGAA 3\u0026rsquo;\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e20\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eCYP19A1\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eFP-5\u0026rsquo;GTAAAGTCGTTCAGTTGTGT 3\u0026rsquo;\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e20\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e179\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eRP- 5\u0026rsquo;TTCAGTGTAGGACAGTAAGG 3\u0026rsquo;\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e20\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eGAPDH\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eFP-5\u0026rsquo;TCGGAGTGAACGGATTCGG 3\u0026rsquo;\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e19\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e192\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eRP-5\u0026rsquo;TGATGACGAGCTTCCCGTTC 3\u0026rsquo;\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e20\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eCHI3L1\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eFP-5\u0026rsquo;GATTCAGTAACGCTGACTAC 3\u0026rsquo;\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e20\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e202\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eRP -5\u0026rsquo; CAGATCTCATAATAGGCAAG3\u0026rsquo;\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e20\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eIL-6\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eFP-5\u0026rsquo;GGGTTCAATCAGGCGATTTGCT 3\u0026rsquo;\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e22\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e147\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eRP-5\u0026rsquo;AGGATCTGGATCAGTGTTCTGC 3\u0026rsquo;\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e22\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eIL-1β\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eFP-5\u0026rsquo; GAACTTCACTGTTGTCTGAT 3\u0026rsquo;\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e20\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e156\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eRP-5\u0026rsquo; GCTTTGAGTGAGTAGAAGTG 3\u0026rsquo;\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e20\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e7\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eTNF-α\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eFP-5\u0026rsquo; GCCCACGTTGTAGCCGACATCAACTCT 3\u0026rsquo;\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e27\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e113\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eRP- 5\u0026rsquo; AGCAGGCACCACAGCTGGTTGTC 3\u0026rsquo;\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e23\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003eLPS Induces CHI3L1 and Cytokine Expression\u003c/h2\u003e\u003cdiv id=\"Sec15\" class=\"Section3\"\u003e\u003ch2\u003eCHI3L1 Gene Expression and Protein Secretion\u003c/h2\u003e\u003cp\u003eIn LPS-challenged granulosa cells, Chitinase-3-like Protein 1 (CHI3L1) mRNA was upregulated in a delayed dose-dependent manner, while the corresponding protein levels showed only minor changes. CHI3L1 transcript abundance remained at baseline for up to 12 h after LPS treatment and then rose sharply by 24 h in the high-dose group. Notably, treatment with 1,000 ng/mL LPS for 24 h induced an approximately 8-fold increase in CHI3L1 mRNA relative to untreated cells (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). In contrast, low LPS doses (10 ng/mL or 100 ng/mL) produced minimal or no elevation in CHI3L1 expression over 24 h. Despite robust induction at the mRNA level, CHI3L1 protein in culture supernatants increased only slightly after LPS exposure. ELISA at 24 h showed a trend toward higher CHI3L1 protein levels with high-dose LPS, but the differences were not statistically significant compared to controls (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05; Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Thus, LPS strongly stimulated CHI3L1 gene expression without a commensurate increase in secreted proteins within the 24 h period.\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003eIL-6 mRNA Expression\u003c/h2\u003e\u003cp\u003eLPS treatment caused a pronounced dose- and time-dependent increase in interleukin-6 (IL-6) gene expression in buffalo granulosa cells. Even at 6 h, IL-6 mRNA was significantly elevated by higher LPS doses: 100 ng/mL and 1,000 ng/mL LPS yielded roughly 12-fold and 22-fold increases, respectively, compared to the control (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), whereas 10 ng/mL had no significant effect. The IL-6 response peaked at 12 h, reaching approximately 21-fold (100 ng/mL) to 33-fold (1,000 ng/mL) above the control levels. By 24 h, IL-6 expression declined from its 12 h peak but remained markedly elevated (approximately 13-fold for 100 ng/mL and 28-fold for 1,000 ng/mL vs. control). At all time points, 10 ng/mL failed to induce any significant IL-6 upregulation.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003eIL-1β mRNA Expression\u003c/h2\u003e\u003cp\u003eInterleukin-1β (IL-1β) transcripts were similarly induced by LPS in a clear dose- and time-dependent manner. High LPS doses were required to trigger IL-1β expression; 10 ng/mL LPS did not cause a significant change at any time (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05). At 6 h, 100 ng/mL and 1,000 ng/mL LPS led to significant IL-1β increases of approximately 6-fold and 8-fold, respectively, relative to the controls (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05, vs. 10 ng/mL group). Maximal IL-1β induction occurred at 12 h, with mRNA levels approximately 23-fold (100 ng/mL) to 25-fold (1,000 ng/mL) higher than those in the control. IL-1β expression partially declined by 24 h; the 1,000 ng/mL LPS group still showed\u0026thinsp;~\u0026thinsp;15-fold elevation (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), whereas the 100 ng/mL group fell to ~\u0026thinsp;7-fold and was no longer significantly different from the low-dose baseline (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003eTNFα mRNA Expression\u003c/h2\u003e\u003cp\u003eLPS induced a rapid but transient increase in tumor necrosis factor-α (TNFα) gene expression. The peak TNFα response was observed at the earliest time point (6 h). At 6 h, 100 ng/mL LPS caused approximately a 4-fold rise and 1,000 ng/mL caused about a 6-fold increase in TNFα mRNA relative to the control (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05, vs. 10 ng/mL), whereas 10 ng/mL induced only\u0026thinsp;~\u0026thinsp;2-fold and was not significant. This upregulation was attenuated over time: by 12 h, overall TNFα levels had decreased, and only the 1,000 ng/mL dose remained significantly above baseline (approximately 4-fold vs. 10 ng/mL; p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). After 24 h, TNFα expression in LPS-treated cells nearly returned to control levels; the 1,000 ng/mL group maintained a modest 2.5-fold increase (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05, vs. 10 ng/mL), while lower doses showed no significant increase.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003eQuercetin Cytotoxicity in Granulosa Cells\u003c/h2\u003e\u003cp\u003eQuercetin reduced granulosa cell viability in a dose-dependent manner Exposure to a low concentration of quercetin (1 \u0026micro;g/mL) had no significant effect on MTT OD readings compared to untreated controls (mean OD\u0026thinsp;\u0026asymp;\u0026thinsp;1.705\u0026thinsp;\u0026plusmn;\u0026thinsp;0.047 vs. 1.588\u0026thinsp;\u0026plusmn;\u0026thinsp;0.028; p\u0026thinsp;\u0026gt;\u0026thinsp;0.05). In contrast, higher quercetin concentrations caused a marked decline in the cell viability. Treatment with 10 \u0026micro;g/mL quercetin reduced the OD to ~\u0026thinsp;1.02\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05 (mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SE), and further decreases were observed at 20 \u0026micro;g/mL (\u0026asymp;\u0026thinsp;0.92) and 50 \u0026micro;g/mL (\u0026asymp;\u0026thinsp;0.85). All doses\u0026thinsp;\u0026ge;\u0026thinsp;10 \u0026micro;g/mL resulted in significantly lower viability than the control or 1 \u0026micro;g/mL groups (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). These findings indicate that while quercetin has no deleterious effects at very low doses, it becomes cytotoxic to GCs at higher concentrations.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003ch2\u003eQuercetin Attenuates LPS-Induced Inflammatory Responses\u003c/h2\u003e\u003cp\u003eCo-treatment with quercetin markedly attenuated LPS-induced upregulation of CHI3L1 and pro-inflammatory cytokine genes in granulosa cells. Quercetin alone did not alter the expression of CHI3L1, IL-6, IL-1β, or TNFα compared to untreated controls (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05). As expected, LPS alone significantly elevated the levels of all four markers relative to those in the control (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Specifically, 1,000 ng/mL LPS for 24 h induced CHI3L1\u0026thinsp;~\u0026thinsp;2.1-fold, IL-6\u0026thinsp;~\u0026thinsp;18-fold, IL-1β\u0026thinsp;~\u0026thinsp;6-fold, and TNFα\u0026thinsp;~\u0026thinsp;9-fold above baseline levels. The presence of quercetin during LPS exposure substantially suppresses these responses. CHI3L1 induction was reduced by ~\u0026thinsp;1.4-fold with LPS\u0026thinsp;+\u0026thinsp;quercetin (versus 2.1-fold with LPS alone). Likewise, the IL-6 mRNA level in the co-treated group was only\u0026thinsp;~\u0026thinsp;4-fold above control, a significant reduction compared to the robust 18-fold increase caused by LPS alone. Quercetin completely abrogated the IL-1β and TNFα responses to LPS; their expression in the LPS\u0026thinsp;+\u0026thinsp;quercetin condition (~\u0026thinsp;1.8-fold above control for both) returned to near control levels and was significantly lower than that with LPS treatment alone (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Thus, quercetin co-administration consistently dampened LPS-triggered inflammatory gene expression in GCs across all examined markers.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\u003ch2\u003eQuercetin Reduces LPS-Induced ROS Generation\u003c/h2\u003e\u003cp\u003eLPS stimulation led to a significant increase in intracellular reactive oxygen species (ROS) in granulosa cells, and quercetin effectively mitigated this oxidative burst. Fluorescence imaging of the DCFDA probe showed that LPS-treated cells had markedly brighter green fluorescence than controls, indicating elevated ROS, whereas cells treated with quercetin alone appeared similar to controls. Quantitative image analysis confirmed that LPS provoked a\u0026thinsp;~\u0026thinsp;4- to 5-fold increase in mean fluorescence intensity (\u0026asymp;\u0026thinsp;45 arbitrary units (A.U.) in LPS vs. \u0026asymp;10 A.U. in control; p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Quercetin alone did not significantly change ROS levels (~\u0026thinsp;12 A.U.; p\u0026thinsp;\u0026gt;\u0026thinsp;0.05, vs. control). Importantly, granulosa cells co-treated with LPS and quercetin showed an intermediate ROS level (~\u0026thinsp;24 A.U.), approximately half that of the LPS-only group (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e7\u003c/span\u003e). This represented a significant reduction in ROS relative to LPS treatment (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), although the co-treatment ROS remained modestly higher than the basal levels (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05, vs. control). These results demonstrate that quercetin partially, but significantly, alleviates LPS-induced oxidative stress in granulosa cells.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec22\" class=\"Section2\"\u003e\u003ch2\u003eEffects of Granulosa Cell Treatments on Oocyte Maturation\u003c/h2\u003e\u003cp\u003eThe inflammatory status of granulosa cells has a notable impact on the in vitro maturation of co-cultured cumulus-oocyte complexes (COCs). In the control co-culture (untreated GCs\u0026thinsp;+\u0026thinsp;COCs), 79.8\u0026thinsp;\u0026plusmn;\u0026thinsp;1.2% of oocytes reached maturation (defined by full cumulus expansion and metaphase II nuclear stage). This maturation rate was significantly reduced when COCs were co-cultured with LPS-treated granulosa cells, dropping to 74.3\u0026thinsp;\u0026plusmn;\u0026thinsp;0.9% (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05, vs. control). In contrast, granulosa cells treated with quercetin alone supported a high maturation rate of 82.1\u0026thinsp;\u0026plusmn;\u0026thinsp;2.0%, comparable to the control group (no statistically significant difference). Notably, quercetin co-treatment rescued much of the LPS-induced impairment in oocyte maturation. COCs co-cultured with LPS\u0026thinsp;+\u0026thinsp;quercetin-treated GCs had a maturation frequency of 78.6\u0026thinsp;\u0026plusmn;\u0026thinsp;1.8%, which was significantly higher than that observed with LPS-treated GCs (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Although maturation was not fully restored to the control level, the co-treatment group showed a clear improvement in cumulus expansion and MII attainment compared with LPS alone (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e8\u003c/span\u003e). These findings indicate that granulosa cell inflammation adversely affects oocyte developmental competence and that quercetin supplementation can partially counteract these detrimental effects in the co-culture system..\u003c/p\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eOur results highlight the remarkable plasticity of buffalo granulosa cells in vitro, as their morphology varies with serum conditions. In low-serum culture, granulosa cells retained a cobblestone and epithelial-like appearance with strong cell\u0026ndash;cell adhesion, whereas high-serum conditions induced an elongated, fibroblast-like shape reminiscent of dedifferentiated cells. This phenotypic shift likely reflects differences in differentiation status: lower mitogenic stimulation (low serum) maintains a more quiescent, follicle-like state, while higher serum promotes proliferation and luteinization-like transformation (Amsterdam and Aharoni \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e1994\u003c/span\u003e; Yadav et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Similar observations in other studies confirm that the culture environment can markedly alter granulosa cell behavior and gene expression (Ożegowska et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). These findings underscore the need to optimize culture conditions depending on the experimental goals. To study granulosa cells in a state closer to their in vivo physiology, a low-serum (or defined) medium is preferable, whereas serum supplementation can be used to expand cells at the cost of inducing a less-differentiated phenotype. We selected low-serum conditions to better emulate the pre-ovulatory granulosa cell environment before examining inflammatory challenges.\u003c/p\u003e\u003cp\u003eExposure to lipopolysaccharide (LPS) revealed a biphasic effect on granulosa cell viability. Within 6 h of LPS treatment, especially at high concentrations (\u0026ge;\u0026thinsp;1 \u0026micro;g/mL), cell viability decreased significantly, indicating acute cytotoxicity. This early cell loss is consistent with LPS activating Toll-like receptor 4 on granulosa cells and rapidly triggering an inflammatory cascade that can lead to apoptosis or pyroptosis (Bromfield and Sheldon \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). However, after 24 h, cell viability in LPS-treated cultures stabilized and even recovered to control levels, despite the continued LPS presence of LPS. This suggests that granulosa cells mount adaptive responses to prolonged endotoxin exposure, akin to endotoxin tolerance, which limits cell death. Surviving cells may upregulate anti-inflammatory regulators and proliferate to replenish the monolayer (Williams et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). Thus, while buffalo granulosa cells are acutely susceptible to inflammatory injury, they also display resilience over time, which may help to preserve follicular integrity after transient insults.\u003c/p\u003e\u003cp\u003eLPS stimulation induces a robust pro-inflammatory gene response in granulosa cells, notably in interleukin-6 (IL-6), interleukin-1β (IL-1β), and tumor necrosis factor-α (TNF-α). IL-6 mRNA increased dramatically and remained elevated for 24 h, reflecting the capacity of granulosa cells to act as immune-like cells within the follicle (Herath et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). While IL-6 has physiological roles during ovulation, chronic or excessive IL-6 is detrimental because it can suppress granulosa cell steroidogenesis (Taylor and Terranova \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e1996\u003c/span\u003e) and has been associated with disrupted folliculogenesis and poor oocyte quality under inflammatory conditions (Magata and Shimizu \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). IL-1β is also rapidly upregulated by LPS, in line with its role as an early \u0026ldquo;danger signal\u0026rdquo; that amplifies inflammation. Granulosa cells from cattle similarly produce IL-1β when challenged with endotoxins (Price et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2013\u003c/span\u003e), and this cytokine can recruit immune cells and further disrupt granulosa\u0026ndash;thecal functions if persistent. TNF-α transcript levels spiked at 6 h post-LPS and then returned to baseline by 24 h. Such transient TNF-α production is consistent with an acute innate response; importantly, the rapid downregulation of TNF-α likely prevents extended cell damage, as prolonged TNF exposure can induce granulosa cell apoptosis and follicular atresia (Basini et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2002\u003c/span\u003e; Boby et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). In summary, LPS elicits a potent inflammatory cascade in granulosa cells characterized by surges in IL-6, IL-1β, and TNF-α, which, if sustained, could severely impair ovarian function.\u003c/p\u003e\u003cp\u003eIn addition to classical cytokines, we identified chitinase-3-like protein 1 (CHI3L1, also known as YKL-40) as a novel inflammation-responsive gene in the buffalo granulosa cells. LPS stimulation significantly upregulated CHI3L1 mRNA expression, suggesting that granulosa cells contribute not only to cytokines, but also extracellular matrix-related factors to the ovarian inflammatory milieu. CHI3L1 is increasingly being recognized as a marker of inflammation in reproductive disorders; for example, elevated YKL-40 levels have been observed in women with endometriosis, pelvic inflammatory disease, and polycystic ovary syndrome (Lee et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Liu et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Consistent with our findings, a recent study reported that CHI3L1 expression increases in buffalo cumulus\u0026ndash;oocyte complexes during in vitro maturation when inflammatory-like stimuli are present (Anand et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Thus, CHI3L1 induction in granulosa cells may serve as an indicator of intrafollicular inflammation and stress.\u003c/p\u003e\u003cp\u003eIn addition to being a potential biomarker, CHI3L1 may actively influence granulosa cell survival and follicular outcomes during inflammation. In other biological contexts, transient CHI3L1 elevation aids in cell survival, tissue repair, and angiogenesis, whereas chronic overexpression contributes to pathological fibrosis and sustained inflammation. Recent evidence suggests CHI3L1 can amplify stress responses; knocking down YKL-40 in cultured granulosa cells reduces oxidative damage and inflammatory signaling under stress conditions (Tang et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). CHI3L1 expression also tends to increase in atretic (degenerating) follicles (Meng et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), implying that it is part of the ovarian response to prolonged insults. We observed that CHI3L1 protein did not measurably increase by 24 h despite increased transcript levels, indicating that protein secretion may require more time or additional signals. From a therapeutic perspective, modulation CHI3L1 could be a novel approach for controlling ovarian inflammation. If CHI3L1 exacerbates follicular inflammation, inhibitors or neutralizing antibodies (already under exploration in other diseases) might help protect granulosa cells. Conversely, because CHI3L1 can have pro-survival effects, short-term enhancement might aid tissue recovery following infection. Notably, studies in mice have shown that the loss of CHI3L1 (Brp-39 knockout) alters inflammatory outcomes and can protect against inflammation-driven reproductive damage (Jang et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Similarly, CHI3L1 deficiency was protective in an LPS-induced liver injury (Kim et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Thus, CHI3L1 appears to be a double-edged sword in the follicle, and careful tuning of its levels might tilt the balance toward the resolution of inflammation without triggering chronic damage.\u003c/p\u003e\u003cp\u003eQuercetin alone had distinct dose-dependent effects on granulosa cell viability. At a low concentration (1 \u0026micro;g/mL), quercetin was non-toxic, with cell viability comparable to that of untreated controls. This is in agreement with reports that low micromolar levels of quercetin are well tolerated by ovarian cells and can even be mildly beneficial (Yang et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). In contrast, high concentrations of quercetin (10\u0026ndash;50 \u0026micro;g/mL) significantly reduced the viability of granulosa cells. A dose of 50 \u0026micro;g/mL caused a dramatic loss of cells, indicating that the cytotoxic threshold of quercetin had been exceeded. Such biphasic, hormetic behavior is well documented for quercetin: at low doses it acts as an antioxidant and cytoprotectant, whereas at high doses it becomes pro-oxidant and triggers apoptotic pathways (Li et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Sirotkin et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Similar dose-dependent effects have been observed in bovine and porcine granulosa cells, where quercetin concentrations above approximately 10\u0026ndash;20 \u0026micro;g/mL impair cell proliferation and viability (Yang et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Qi et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Mechanistically, excessive quercetin can induce oxidative stress and activate pro-apoptotic factors, such as BAX, explaining the steep decline in cell numbers at the highest dose (Sirotkin et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). For subsequent experiments, we selected a low non-toxic dose of quercetin to evaluate its protective effects against LPS-induced inflammation.\u003c/p\u003e\u003cp\u003eCo-treatment of granulosa cells with quercetin markedly attenuated the inflammatory response to LPS. Quercetin alone did not alter the basal expression of cytokines or CHI3L1, but in the presence of LPS it significantly downregulated all measured inflammatory genes. In LPS-only cultures, IL6, IL1B, and TNF transcripts were elevated by approximately 6- to 18-fold. With quercetin, these increases were largely abrogated, and cytokine mRNA levels remained near control values. CHI3L1 induction by LPS was also reduced by co-treatment with quercetin. These results demonstrate the broad anti-inflammatory action of quercetin in granulosa cells. These findings are consistent with the known inhibition of LPS-activated signaling pathways, such as NF-κB and MAPK, in other cell types (Xiong et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Jiang et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). By suppressing TLR4\u0026ndash;NF-κB pathway activation, quercetin likely prevented the transcriptional upregulation of IL-6, IL-1β, TNF-α, and CHI3L1. Notably, our data align with in vivo evidence from a sepsis model, in which quercetin administration reduced circulating YKL-40 (CHI3L1) and other inflammatory markers (Gerin et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Thus, quercetin effectively curtailed the LPS-triggered cytokine surge in granulosa cells, potentially protecting them from inflammation-induced dysfunctions.\u003c/p\u003e\u003cp\u003eLPS challenge also causes oxidative stress in granulosa cells, as indicated by a sharp increase in intracellular reactive oxygen species (ROS). Excess ROS are known mediators of granulosa cell damage under inflammatory conditions, leading to lipid peroxidation, DNA damage, and cell death (Jančar et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Magata \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). We observed bright DCF fluorescence in LPS-treated cells, confirming an oxidative burst, consistent with reports that endotoxin exposure generates ROS in ovarian cells and suppresses key steroidogenic factors (Qu et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Importantly, quercetin co-treatment significantly mitigated the oxidative stress. Cells exposed to LPS\u0026thinsp;+\u0026thinsp;quercetin showed much lower ROS levels than those exposed to LPS alone, indicating that quercetin\u0026rsquo;s antioxidant properties scavenge or prevent ROS formation. Quercetin alone did not increase ROS, highlighting its safe and antioxidative mode of action. This outcome is consistent with the broad literature on quercetin as an antioxidant in reproductive cells. For instance, quercetin reduced ROS accumulation and improved viability in toxin-challenged porcine granulosa cells (Qi et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), and protected bovine granulosa cells from H₂O₂-induced apoptosis by enhancing cellular antioxidant defenses (Duan et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Likewise, quercetin has been shown to activate the Nrf2 pathway and suppress NADPH oxidase\u0026ndash;driven ROS production in other tissues during LPS-induced stress (Sun et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Sul and Ra \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Although quercetin did not completely normalize ROS levels in our cultures, a partial reduction in the oxidative burden could be beneficial. By maintaining a more balanced redox state, quercetin may prevent ROS-mediated damage to granulosa cell membranes, DNA, and enzymes, thereby preserving their functions under inflammatory stress. This antioxidant effect likely functions in tandem with the anti-inflammatory action of quercetin to support granulosa cell survival.\u003c/p\u003e\u003cp\u003eThe deleterious impact of granulosa cell inflammation extended to oocyte maturation in our coculture system. When cumulus\u0026ndash;oocyte complexes (COCs) were cultured alongside LPS-exposed granulosa cells, oocyte developmental competence was impaired, cumulus expansion was poor, and the proportion of oocytes reaching the metaphase II stage was reduced. These observations mirror previous findings that bacterial endotoxins in the ovarian environment compromise oocyte maturation (Bromfield and Sheldon \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Magata and Shimizu \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Granulosa and cumulus cells express TLR4 and respond to LPS by producing cytokines and reactive species that disrupt supportive crosstalk with the oocyte (Zhao et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Zhao et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). One hallmark of our LPS co-culture was the failure of the cumulus cells to undergo normal expansion. Cumulus expansion, driven by hyaluronic acid matrix synthesis, is critical for oocyte meiosis and subsequent embryo development (Marei et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). Inflammatory insults likely interfere with the expression of expansion-related genes or induce cumulus cell apoptosis, resulting in a compact cumulus and a consequent reduction in MII oocytes. In addition, LPS suppresses granulosa cell estradiol production (Vashisht et al. \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), depriving oocytes of an important maturation signal (Harl et al. \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). The inflammatory microenvironment (high IL-6, IL-1β, TNF-α and oxidative stress) and loss of hormonal support in LPS-treated co-cultures created suboptimal conditions for oocyte development. Consequently, even a relatively low dose of LPS (1 \u0026micro;g/mL) caused a noticeable drop in buffalo oocyte maturation, highlighting the sensitivity of oocytes to somatic cell inflammatory status.\u003c/p\u003e\u003cp\u003eQuercetin supplementation greatly ameliorated the negative effects of LPS on oocyte maturation. In the presence of quercetin, COCs exposed to LPS showed improved cumulus expansion and a higher MII rate than those exposed to LPS alone, approaching the levels observed in control cultures. This suggests that quercetin preserved cumulus\u0026ndash;oocyte functionality despite the inflammatory insult. Similarly, in cattle, adding quercetin during in vitro oocyte maturation has been found to increase MII yields and reduce indicators of oocyte apoptosis (Davoodian et al. \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The protective effects of quercetin in our co-culture likely stem from its dual action in granulosa cells, reducing inflammatory cytokine release and oxidative stress, which in turn creates a healthy microenvironment for the oocyte. From a practical standpoint, these findings have practical implications for buffalo reproduction. Buffalo oocytes are vulnerable to oxidative stress during in vitro culture due to their high lipid content (Dubeibe Mar\u0026iacute;n et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Therefore, minimizing inflammation and oxidative damage in the follicular environment (for instance, by avoiding the use of granulosa cells from infected follicles or by supplementing with antioxidants such as quercetin) could improve oocyte quality and developmental outcomes in vitro. In our study, quercetin did not completely restore oocyte maturation to the control levels, indicating that severe inflammatory damage may not be fully reversible within a short culture period. Nevertheless, the ability of quercetin to significantly rescue oocyte maturation despite LPS exposure underscores its potential as a therapeutic adjunct to preserve fertility in the face of ovarian inflammation. Importantly, quercetin alone did not adversely affect oocyte maturation or cumulus cell viability, supporting its safety for use in maturation media at effective doses.\u003c/p\u003e\u003cp\u003eIn summary, this study demonstrated that an LPS-induced inflammatory challenge can detrimentally affect buffalo granulosa cells and oocytes, while the flavonoid quercetin exerts protective effects. LPS triggers acute cytokine release (IL-6, IL-1β, TNF-α) and oxidative stress in granulosa cells, leading to impaired cell viability and oocyte maturation. We also identified CHI3L1 as a novel marker of granulosa cell inflammation that may play a role in the ovarian immune response. Notably, quercetin co-treatment attenuated LPS-induced cytokine surge and ROS accumulation, thereby preserving granulosa cell function and supporting oocyte maturation in an inflammatory environment. These findings highlight the potential of quercetin as an anti-inflammatory and antioxidant agent that safeguards ovarian function during infection or endotoxemia. Further in vivo studies and clinical investigations are warranted to explore the application of quercetin and the relevance of CHI3L1 as a therapeutic target or biomarker for reproductive inflammatory conditions..\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding\u003cbr\u003e\u003c/strong\u003eThis research did not receive any specific grant from funding agencies in the public, commercial or not‑for‑profit sectors.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003cbr\u003e\u0026nbsp;The authors declare that they have no competing interests.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003cbr\u003e\u0026nbsp;SS performed the experiments and contributed to data acquisition and interpretation. VAJ conceived and designed the study, performed experiments, and contributed to data interpretation and critical revision of the manuscript. BK contributed to experimental design, data interpretation, and manuscript preparation. GDVP conducted experiments and contributed to manuscript preparation. SKS contributed to manuscript preparation and critical scrutiny of the intellectual content. RP conducted experiments and assisted with data acquisition. PM supervised the study, provided overall scientific guidance, and critically revised the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and animal care\u003c/strong\u003e\u003cbr\u003eThis article does not contain any studies with live animals performed by any of the authors. Buffalo ovaries (\u003cem\u003eBubalus bubalis\u003c/em\u003e) used for granulosa cell and oocyte collection were obtained as by‑products from adult animals slaughtered for routine meat production at a licensed local abattoir. No animal was killed specifically for this research.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors thank the staff of the Department of Animal Biotechnology, Madras Veterinary College (TANUVAS), and the personnel of the local abattoir for their assistance with sample collection and laboratory support.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eMagata F (2020) Lipopolysaccharide-induced mechanisms of ovarian dysfunction in cows with uterine inflammatory diseases. J Reprod Dev 66(4):311\u0026ndash;317. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1262/jrd.2020-021\u003c/span\u003e\u003cspan address=\"10.1262/jrd.2020-021\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSheldon IM, Cronin J, Goetze L et al (2009) Defining postpartum uterine disease and the mechanisms of infection and immunity in the female reproductive tract in cattle. Biol Reprod 81(6):1025\u0026ndash;1032. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1095/biolreprod.109.077370\u003c/span\u003e\u003cspan address=\"10.1095/biolreprod.109.077370\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBidne KL, Dickson MJ, Ross JW et al (2018) Disruption of female reproductive function by endotoxins. Reproduction 155(4):R169\u0026ndash;R181. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1530/REP-17-0406\u003c/span\u003e\u003cspan address=\"10.1530/REP-17-0406\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHerath S, Williams EJ, Lilly ST et al (2007) Ovarian follicular cells have innate immune capabilities that modulate their endocrine function. Reproduction 134(5):683\u0026ndash;693. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1530/REP-07-0229\u003c/span\u003e\u003cspan address=\"10.1530/REP-07-0229\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePrice JC, Bromfield JJ, Sheldon IM (2013) Pathogen-associated molecular patterns initiate inflammation and perturb the endocrine function of bovine granulosa cells from ovarian dominant follicles via TLR2 and TLR4 pathways. Endocrinology 154(9):3377\u0026ndash;3386. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1210/en.2013-1102\u003c/span\u003e\u003cspan address=\"10.1210/en.2013-1102\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBromfield JJ, Sheldon IM (2011) Lipopolysaccharide initiates inflammation in bovine granulosa cells via the TLR4 pathway and perturbs oocyte meiotic progression in vitro. Endocrinology 152(12):5029\u0026ndash;5040. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1210/en.2011-1124\u003c/span\u003e\u003cspan address=\"10.1210/en.2011-1124\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTaylor CC, Terranova PF (1996) Lipopolysaccharide inhibits in vitro luteinizing hormone-stimulated rat ovarian granulosa cell estradiol but not progesterone secretion. Biol Reprod 54(6):1390\u0026ndash;1396. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1095/biolreprod54.6.1390\u003c/span\u003e\u003cspan address=\"10.1095/biolreprod54.6.1390\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBlazevic N, Rogic D, Pelajic S et al (2024) YKL-40 as a biomarker in various inflammatory diseases: a review. Biochem Med (Zagreb) 34(1):010502. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.11613/BM.2024.010502\u003c/span\u003e\u003cspan address=\"10.11613/BM.2024.010502\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePuttabyatappa M, Guo X, Dou J et al (2020) Developmental programming: sheep granulosa and theca cell-specific transcriptional regulation by prenatal testosterone. Endocrinology 161(8):bqaa094. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1210/endocr/bqaa094\u003c/span\u003e\u003cspan address=\"10.1210/endocr/bqaa094\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTang TT, Gao J, Pan X et al (2024) YKL-40 knockdown decreases oxidative stress damage in ovarian granulosa cells. Genet Test Mol Biomark 28(5):199\u0026ndash;206. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1089/gtmb.2023.0361\u003c/span\u003e\u003cspan address=\"10.1089/gtmb.2023.0361\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAnand JV, Brindha K, Parthiban M et al (2024) Expression of chitinase-like 3 protein 1 (CHI3L1) in buffalo cumulus\u0026ndash;oocyte complexes during in vitro maturation. Indian J Anim Res 58(5):722\u0026ndash;728. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.18805/IJAR.B-5482\u003c/span\u003e\u003cspan address=\"10.18805/IJAR.B-5482\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang HX, Li YY, Liu ZJ, Wang JF (2022) Quercetin effectively improves LPS-induced intestinal inflammation, pyroptosis, and disruption of the barrier function through the TLR4/NF-κB/NLRP3 signaling pathway \u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003ein vitro\u003c/em\u003e. Food Nutr Res 66:8948. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.29219/fnr.v66.8948\u003c/span\u003e\u003cspan address=\"10.29219/fnr.v66.8948\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKhadrawy O, Gebremedhn S, Salilew-Wondim D et al (2020) Quercetin supports bovine preimplantation embryo development under oxidative stress via activation of the Nrf2 signalling pathway. Reprod Domest Anim 55(10):1275\u0026ndash;1285. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/rda.13688\u003c/span\u003e\u003cspan address=\"10.1111/rda.13688\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYang W, Liu R, Sun Q et al (2022) Quercetin alleviates endoplasmic reticulum stress\u0026ndash;induced apoptosis in buffalo ovarian granulosa cells. Animals 12(6):787. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ani12060787\u003c/span\u003e\u003cspan address=\"10.3390/ani12060787\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRashidi Z, Aleyasin A, Eslami M et al (2019) Quercetin protects human granulosa cells against oxidative stress via thioredoxin system. Reprod Biol 19(3):245\u0026ndash;254. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.repbio.2019.07.002\u003c/span\u003e\u003cspan address=\"10.1016/j.repbio.2019.07.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLivak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2\u0026thinsp;\u0026ndash; ∆∆CT method. Methods 25(4):402\u0026ndash;408. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1006/meth.2001.1262\u003c/span\u003e\u003cspan address=\"10.1006/meth.2001.1262\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAmsterdam A, Aharoni D (1994) Plasticity of cell organization during differentiation of normal and oncogene-transformed granulosa cells. Microsc Res Tech 27(2):108\u0026ndash;124 (No DOI available)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYadav M, Agrawal H, Pandey M et al (2018) Three-dimensional culture of buffalo granulosa cells in hanging drop mimics the preovulatory follicle stage. J Cell Physiol 233(3):1959\u0026ndash;1970 (No DOI available)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eOżegowska K, Rękawiecki R, Knapczyk-Stwora K et al (2019) Genes involved in cell proliferation, migration, adhesion, and tissue development as new markers of porcine granulosa cell processes \u003cem\u003ein vitro\u003c/em\u003e: a microarray approach. DNA Cell Biol 38(6):549\u0026ndash;560 (No DOI available)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWilliams EJ, Sibley K, Miller AN et al (2008) The effect of \u003cem\u003eEscherichia coli\u003c/em\u003e LPS and TNF-α on ovarian function in cattle. Am J Reprod Immunol 60(5):462\u0026ndash;473. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1600-0897.2008.00645.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1600-0897.2008.00645.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMagata F, Shimizu T (2017) Effect of lipopolysaccharide on developmental competence of oocytes. Reprod Toxicol 71:1\u0026ndash;7. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.reprotox.2017.04.001\u003c/span\u003e\u003cspan address=\"10.1016/j.reprotox.2017.04.001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBasini G, Mainardi GL, Bussolati S, Tamanini C (2002) Steroidogenesis, proliferation and apoptosis in bovine granulosa cells: role of tumor necrosis factor-α and its possible signaling mechanisms. Reprod Fertil Dev 14(3\u0026ndash;4):141\u0026ndash;150 (No DOI available)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBoby J, Kumar H, Gupta HP et al (2017) Endometritis increases pro-inflammatory cytokines in follicular fluid and cervico-vaginal mucus in the buffalo cow. Anim Biotechnol 28(3):163\u0026ndash;167 (No DOI available)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLee SH, Kim MK, Park HY et al (2012) Significant association of elevated plasma YKL-40 with disease severity in patients with pelvic inflammatory disease. J Clin Lab Anal 26(2):136\u0026ndash;142. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/jcla.21500\u003c/span\u003e\u003cspan address=\"10.1002/jcla.21500\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu D, Hu X, Ding X, Li M, Ding L (2024) Inflammatory effects and regulatory mechanisms of chitinase-3-like-1 in multiple human body systems: a comprehensive review. Int J Mol Sci 25(24):13437. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms252413437\u003c/span\u003e\u003cspan address=\"10.3390/ijms252413437\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMeng L, Wu Z, Zhao K et al (2021) Transcriptome analysis of porcine granulosa cells in healthy and atretic follicles: role of steroidogenesis and oxidative stress. Antioxidants 10(1):22. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/antiox10010022\u003c/span\u003e\u003cspan address=\"10.3390/antiox10010022\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJang JY, Kim YS, Han YM, Kang SY, Kim J-S (2019) Alteration in uterine protease-activated receptor 2 expression in preterm birth induced in \u003cem\u003eBrp-39\u003c/em\u003e (CHI3L1) null mutant mice. Reprod Sci 26:713\u0026ndash;723. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1177/1933719118821873 (\u003c/span\u003e\u003cspan address=\"10.1177/1933719118821873 (\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003eCHI3L1 is also known as Brp-39)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKim M, Chang JY, Lee DW et al (2023) Chitinase-3-like 1 deficiency ameliorates LPS-induced acute liver injury by inhibition of M2 macrophage polarization. Mol Immunol 156:98\u0026ndash;110. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.molimm.2023.02.012\u003c/span\u003e\u003cspan address=\"10.1016/j.molimm.2023.02.012\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi J, Long H, Cong Y et al (2021) Quercetin prevents primordial follicle loss via suppression of PI3K/Akt/Foxo3a pathway activation in cyclophosphamide-treated mice. Reprod Biol Endocrinol 19:63. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12958-021-00743-y\u003c/span\u003e\u003cspan address=\"10.1186/s12958-021-00743-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSirotkin AV, Štochmaľov\u0026aacute; A, Alexa R et al (2019) Quercetin directly inhibits basal ovarian cell functions and their response to FSH. Eur J Pharmacol 860:172560. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ejphar.2019.172560\u003c/span\u003e\u003cspan address=\"10.1016/j.ejphar.2019.172560\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eQi N, Xing W, Li M, Liu J (2023) Quercetin alleviates toxicity induced by high copper levels in porcine granulosa cells by scavenging ROS and improving mitochondrial function. Animals 13(17):2745. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ani13172745\u003c/span\u003e\u003cspan address=\"10.3390/ani13172745\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDuan H, Wang F, Wang K et al (2024) Quercetin ameliorates oxidative stress\u0026ndash;induced apoptosis of granulosa cells in dairy cow follicular cysts by activating autophagy via the SIRT1/ROS/AMPK pathway. J Anim Sci Biotechnol 15(1):119. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s40104-024-01078-5\u003c/span\u003e\u003cspan address=\"10.1186/s40104-024-01078-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSun L, Xu G, Dong Y et al (2020) Quercetin protects against LPS-induced intestinal oxidative stress in broiler chickens through activation of Nrf2 pathway. Molecules 25(5):1053. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/molecules25051053\u003c/span\u003e\u003cspan address=\"10.3390/molecules25051053\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSul OJ, Ra SW (2021) Quercetin prevents LPS-induced oxidative stress and inflammation by modulating NOX2/ROS/NF-κB in lung epithelial cells. Molecules 26(22):6949. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/molecules26226949\u003c/span\u003e\u003cspan address=\"10.3390/molecules26226949\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXiong G, Ji WS, Wang F et al (2019) Quercetin inhibits inflammatory response induced by \u003cem\u003ePorphyromonas gingivalis\u003c/em\u003e LPS in human gingival fibroblasts via suppressing NF-κB signaling. Biomed Res Int 2019:6282635. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1155/2019/6282635\u003c/span\u003e\u003cspan address=\"10.1155/2019/6282635\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJiang M, Lv Z, Huang Y et al (2022) Quercetin alleviates LPS-induced inflammatory response in bovine mammary epithelial cells by suppressing TLR4/NF-κB signaling. Front Vet Sci 9:915726. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fvets.2022.915726\u003c/span\u003e\u003cspan address=\"10.3389/fvets.2022.915726\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGerin F, Sener U, Erman H et al (2016) Effects of quercetin on acute lung injury and biomarkers of inflammation and oxidative stress in a rat sepsis model. Inflammation 39(2):700\u0026ndash;705. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10753-016-0285-6\u003c/span\u003e\u003cspan address=\"10.1007/s10753-016-0285-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJančar N, Kopitar AN, Ihan A et al (2007) Effect of apoptosis and reactive oxygen species production in human granulosa cells on oocyte fertilization and blastocyst development. J Assist Reprod Genet 24(2\u0026ndash;3):91\u0026ndash;97. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10815-006-9103-8\u003c/span\u003e\u003cspan address=\"10.1007/s10815-006-9103-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eQu X, Yan L, Guo R, Li H, Shi Z (2019) ROS-induced GATA4/GATA6 downregulation inhibits StAR expression in LPS-treated porcine granulosa-lutein cells. Oxid Med Cell Longev 2019:5432792. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1155/2019/5432792\u003c/span\u003e\u003cspan address=\"10.1155/2019/5432792\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhao S, Pang Y, Zhao X et al (2017) Effects of lipopolysaccharide on maturation of bovine oocytes \u003cem\u003ein vitro\u003c/em\u003e and its possible mechanisms. Oncotarget 8(3):4656\u0026ndash;4672. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.18632/oncotarget.13931\u003c/span\u003e\u003cspan address=\"10.18632/oncotarget.13931\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhao S, Pang Y, Zhao X et al (2019) Detrimental effects of lipopolysaccharide on maturation of bovine oocytes. Asian-Australas J Anim Sci 32(8):1112\u0026ndash;1121. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.5713/ajas.18.0598\u003c/span\u003e\u003cspan address=\"10.5713/ajas.18.0598\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMarei WF, Ghafari F, Fouladi-Nashta AA (2012) Role of hyaluronic acid in maturation and further embryo development of bovine oocytes: regulatory role of cumulus expansion. Theriogenology 78(3):670\u0026ndash;677. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.theriogenology.2012.03.015\u003c/span\u003e\u003cspan address=\"10.1016/j.theriogenology.2012.03.015\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVashisht M, Rani P, Dahiya SK, Singh D (2018) Curcumin-primed exosomes reverse LPS-induced pro-inflammatory gene expression in buffalo granulosa cells. J Cell Biochem 119(2):1488\u0026ndash;1500. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/jcb.26307\u003c/span\u003e\u003cspan address=\"10.1002/jcb.26307\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHarl AW, Negr\u0026oacute;n-P\u0026eacute;rez VM, Stewart JW et al (2025) Maturation of bovine COCs in follicular fluid with or without estradiol and progesterone: impact on cumulus expansion and embryo development. PLoS ONE 20(6):e0321266. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0321266\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0321266\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDavoodian N, Kadivar A, Davoodian N et al (2022) Quercetin in maturation media affects cumulus\u0026ndash;granulosa cells and developmental competence of bovine oocytes. Theriogenology 189:262\u0026ndash;269. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.theriogenology.2022.06.026\u003c/span\u003e\u003cspan address=\"10.1016/j.theriogenology.2022.06.026\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDubeibe Mar\u0026iacute;n DF, da Costa NN, Santana PPB, de Souza EB, Ohashi OM (2019) Importance of lipid metabolism on oocyte maturation and early embryo development: can we apply what we know to buffalo? Anim Reprod Sci 211:106220. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.anireprosci.2019.106220\u003c/span\u003e\u003cspan address=\"10.1016/j.anireprosci.2019.106220\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"veterinary-research-communications","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"verc","sideBox":"Learn more about [Veterinary Research Communications](https://www.springer.com/journal/11259)","snPcode":"11259","submissionUrl":"https://submission.nature.com/new-submission/11259/3","title":"Veterinary Research Communications","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Buffalo, Granulosa cell, Inflammation, Quercetin, CHI3L1, ROS, Oocyte maturation","lastPublishedDoi":"10.21203/rs.3.rs-8182389/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8182389/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eOvarian inflammation can impair buffalo fertility by disrupting the granulosa cell function and oocyte development. Chitinase-3-like protein 1 (CHI3L1) is associated with inflammation in other species, whereas quercetin is a flavonoid known for its anti-inflammatory properties. This study aimed to evaluate CHI3L1 expression and effects of quercetin on lipopolysaccharide (LPS)-induced inflammation in buffalo granulosa cells. Buffalo granulosa cells were cultured in vitro and challenged with LPS to induce inflammation with or without quercetin co-treatment. CHI3L1 and pro-inflammatory cytokine levels (IL-1β, IL-6, and TNF-α) were quantified using real-time PCR and ELISA, and intracellular reactive oxygen species (ROS) were measured using a fluorescence assay. The effect on oocyte maturation was assessed by culturing cumulus-oocyte complexes under these conditions. LPS challenge significantly increased CHI3L1 expression, proinflammatory cytokine levels, and ROS production in granulosa cells. These inflammatory changes are associated with reduced oocyte maturation rate. Quercetin treatment markedly downregulated LPS-induced CHI3L1 and cytokine expression, attenuated ROS generation, and significantly improved oocyte maturation. These results indicate that CHI3L1 is a key mediator of LPS-induced ovarian inflammation, and that quercetin effectively mitigates these effects, thereby enhancing the oocyte maturation environment. These findings highlight the potential of quercetin as a therapeutic agent for mitigating ovarian inflammation and improving fertility in buffaloes.\u003c/p\u003e","manuscriptTitle":"Quercetin modulates Chitinase-3-like protein 1 expression and inflammatory responses in lipopolysaccharide-stimulated buffalo granulosa cells","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-12-03 11:45:48","doi":"10.21203/rs.3.rs-8182389/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-03-05T13:49:54+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-03-03T20:01:09+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"198501409086541169158016318120098220632","date":"2026-02-16T10:35:27+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-12-23T13:32:45+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"239179623422335414159685331640538101482","date":"2025-12-10T10:50:56+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-12-01T13:43:48+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-11-29T06:55:31+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-11-29T06:53:27+00:00","index":"","fulltext":""},{"type":"submitted","content":"Veterinary Research Communications","date":"2025-11-22T19:57:00+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"veterinary-research-communications","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"verc","sideBox":"Learn more about [Veterinary Research Communications](https://www.springer.com/journal/11259)","snPcode":"11259","submissionUrl":"https://submission.nature.com/new-submission/11259/3","title":"Veterinary Research Communications","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"2495deb5-4afa-4757-9d30-b1bcfd124709","owner":[],"postedDate":"December 3rd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-05-04T12:10:16+00:00","versionOfRecord":[],"versionCreatedAt":"2025-12-03 11:45:48","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8182389","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8182389","identity":"rs-8182389","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-22T02:00:06.705733+00:00
License: CC-BY-4.0