ZRANB1 promotes cell proliferation and lymph node metastasis through SF3B3-mediated alternative splicing of CHEK2 in urothelial bladder cancer | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article ZRANB1 promotes cell proliferation and lymph node metastasis through SF3B3-mediated alternative splicing of CHEK2 in urothelial bladder cancer Qingqing He, Dong Yan, Wenjie Zhu, Yiran Tao, Lifang Huang, Yunlong Zhang, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8816203/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 9 You are reading this latest preprint version Abstract Urothelial bladder cancer (UBC) poses a considerable threat to public health, and its clinical management is challenged by high recurrence rates and tendency to progression. While dysregulation of the ubiquitin-proteasome system (UPS) is a hallmark of tumourigenesis, the specific landscape of deubiquitinating enzymes (DUBs) in UBC remains largely underexplored. Multiple transcriptomic datasets were applied for a comprehensive screening of ubiquitination-related genes in UBC. And ZRANB1 was identified as a potential oncogenic DUB molecule, whose expression was validated using immunohistochemistry. High ZRANB1 expression was correlated with advanced pathological T stages, lymph node metastasis, and poor overall survival. The oncogenic role of ZRANB1 was assessed by proliferation, migration, and invasion assays in vitro, as well as subcutaneous xenograft and lymph node metastasis models in vivo. By conducting immunoprecipitation coupled with mass spectrometry, we revealed that ZRNAB1 acted as a DUB to prevent the UPS-dependent degradation of SF3B3. The ZRANB1-SF3B3 axis subsequently modulates the alternative splicing of the cell cycle checkpoint kinase CHEK2, specifically inhibiting the production of the exon 4-skipped isoform (CHEK2-e4-). We demonstrated that while full-length CHEK2 is permissive for growth, the CHEK2-e4- isoform exerts a potent tumour-suppressive effect. This study uncovers a novel post-translational mechanism linking the UPS to RNA splicing machinery in UBC. ZRANB1 promotes tumourigenesis by stabilizing SF3B3 to prevent the generation of the tumour-suppressive CHEK2-e4- isoform, suggesting ZRANB1 is a promising prognostic biomarker and therapeutic target. Biological sciences/Cancer/Urological cancer/Bladder cancer Biological sciences/Molecular biology/Transcription/Transcriptional regulatory elements Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction Urothelial bladder cancer (UBC) is the most common malignancy of the urinary system, posing a considerable and growing threat to public health worldwide[ 1 ]. Approximately 614,000 newly diagnosed cases and 220,000 deaths were reported in 2022 and age-standardized incidence (ASIR) is predicted to continuously rise within the next decade[ 2 , 3 ]. The clinical management of UBC is particularly burdensome due to its high tendency of recurrence and progression. About 75% of patients present with non-muscle-invasive bladder cancer (NMIBC) at diagnosis, which, despite favorable initial survival rates, requires lifelong surveillance via cystoscopic, radiologic, and interventional procedures.[ 4 – 6 ]. Consequently, UBC incurs one of the highest lifetime treatment costs per patient among all cancer types, and the economic burden will likely increase on account of population aging[ 7 ]. About 15% to 20% NMIBC will progress to muscle-invasive bladder cancer (MIBC), with a median survival of ~ 15 months[ 8 ]. Despite advances in surgical techniques and immunotherapy, the prognosis for patients with advanced or metastatic disease remains poor, underscoring the urgent need to elucidate the molecular mechanisms driving UBC progression and to identify novel therapeutic targets[ 9 ]. Ubiquitin, a small protein consisting of 76 amino acids, is highly evolutionarily conserved and is found in all eukaryotic organisms[ 10 ]. Poly-ubiquitin or mono-ubiquitin forms covalent attachment to substrate proteins through ATP-dependent enzymatic cascade, including E1(activating enzyme), E2 (conjugating enzyme) and E3 (ligase)[ 11 ]. Ubiquitination modification is dynamic and reversible by deubiquitinating enzymes (DUBs), which function as erasers of the ubiquitin code[ 12 ]. Ubiquitination could result in diverse functional outcomes, such as signal transduction, subcellular localization, and most commonly, degradation[ 13 , 14 ]. The ubiquitin-proteasome system (UPS) is the primary mechanism for intracellular protein homeostasis, regulating the degradation of over 80% of cellular proteins, especially short-lived and soluble misfolded/unfolded proteins[ 15 , 16 ]. The specificity of this system relies on the fine balanced activities of E3 ubiquitin ligases and DUBs[ 17 , 18 ]. Dysregulation of the UPS is a hallmark of tumourigenesis, leading to the aberrant stabilization of oncoproteins or the excessive degradation of tumour suppressors. Emerging evidence suggests that DUBs play critical roles in cancer cell proliferation, metastasis, and chemotherapy resistance, making them attractive targets for drug discovery[ 19 ]. With growing emphasis on UPS and advanced understandings of ubiquitin modification, new methodologies, like small-molecule inhibitor, protein-targeting chimeric molecules (PROTACs) and hydrophobicity tags (HyT), have been developed on tumour treatment[ 20 ]. However, the specific landscape of DUBs in UBC and their functional substrates remain largely underexplored. In this study, we focused on ZRANB1 (Zinc Finger RANBP2-Type Containing 1), also known as TRABID, a DUB belonging to the OTU family. The human ZRANB1 protein comprises three N-terminal Npl4-like zinc finger (NZF) domains and one C-terminal OTU domain[ 21 ]. While ZRANB1 has been implicated in the regulation of ferroptotic resistance and stem-cell-like features in other malignancies, such as non-small cell lung cancer and colorectal cancer, its function in UBC has not been characterized[ 22 , 23 ]. Through a comprehensive screening of ubiquitination-related genes in multiple transcriptomic datasets, we identified ZRANB1 as a key factor in UBC tissues. Herein, we report that ZRANB1 promotes UBC tumourigenesis by stabilizing the splicing factor SF3B3 via deubiquitination. Furthermore, we demonstrate that the ZRANB1-SF3B3 axis modulates the alternative splicing (AS) of the cell cycle checkpoint kinase CHEK2, specifically inhibiting the production of the tumour-suppressive CHEK2-e4- isoform. These findings uncover a novel post-translational mechanism linking the UPS to RNA splicing machinery in UBC. Materials and Methods Data screening Four datasets and one defined gene subset were applied in the study, including GSE190079 (bladder cancer tumour tissues vs adjacent non-tumour tissues control, p 0.3), GSE231383 (SV-HUC-1 vs T24, UM-UC-3, J82 and 5637, p 0.5), GSE236932 (bladder carcinoma tissues vs normal tissues, p 0.4), Gepia (TCGA + GTEx, tumour tissues vs normal tissues, FDR 1) and a collection of ubiquitination-related genes (2 E1, 32 E2, 616 E3, and 91 DUB) as we described[ 24 ]. Patients and samples To compare the ZRANB1 expression, tumour tissues and adjacent normal tissues of 12 UBC patients were obtained for Western blot analysis, and 15 tumour tissues with paired normal tissues were obtained for IHC staining. For survival analysis, a cohort of 110 UBC patients were included. All patients underwent surgery at Sun Yat-sen Memorial Hospital, Sun Yat-sen University whose informed consent was achieved. The pathological diagnosis of all patients was confirmed by two independent pathologists, and the clinicopathological characteristics and ZRANB1 group of the patients are summarized in Table 1 . Table 1 Correlation of ZRANB1 expression evaluated via IHC staining and UBC clinical parameters. Characteristics ZRANB1 expression No. (%) Low (%) High (%) P -value Age < 60 35 23 12 0.274 ≥ 60 75 41 34 Sex Male 97 57 40 0.736 Female 13 7 6 T stage 0.009 ** Ta-T1 47 34 13 T2-T4 63 30 33 LN status 0.008 ** LN- 95 60 35 LN+ 15 4 11 Grade 0.018 * Low 18 15 3 High 92 49 43 Total 110 64 46 Chi-square test. * P < 0.01 ** P < 0.05 Western blot analysis Western blot analysis was conducted as previously described[ 25 ]. The primary antibodies used included anti-ZRANB1 (YT6929, Immunoway, USA), anti-GAPDH (AC001, Abclonal, China), anti-flag (#14793, CST, USA), anti-SF3B3 (YT4262, Immunoway, USA) and anti-ubiquitin (YM3636, ImmunoWay, USA). HRP-conjugated secondary antibodies (Goat Anti-Rabbit IgG, CWBIO, China) were applied as secondary antibody. Immunohistochemistry (IHC) and hematoxylin-eosin (HE) staining Tissue sections were formalin-fixed, paraffin-embedded and dissected. For IHC staining, sections were rehydrated and subjected to antigen retrieval with EDTA. Then tissue sections were incubated with anti-ZRANB1 (PAB22260, Abnova, China), anti-SF3B3 (14577-1-AP, Proteintech, China) or anti-Ki-67 (27309-1-AP, Proteintech, China) at 4℃ overnight. Next day, the sections were incubated with horseradish peroxidase-conjugated secondary antibodies and stained with diaminobenzidine (DAB) and hematoxylin. The H -score was calculated based on the intensity of staining and percentage of differently stained cells as previously described. For HE staining, sections were dewaxed and dehydrated. Then sections were treated with hematoxylin, differentiated with 1% acid alcohol, and blued with water. After subjected to eosin, sections were dehydrated and cleared. CCK-8, colony formation, Transwell migration and invasion assays CCK-8, colony formation, Transwell migration and invasion assays were conducted as we previously described[ 26 ]. Immunoprecipitation (IP) and mass spectrometry Cells were lysed with cell lysis buffer for WB and IP (APE × BIO, USA) and then subjected to centrifugation. The supernatant was collected, 5% of which was taken as input. Magnetic beads were pre-coated with indicated antibodies or IgG and then were incubated with supernatant at 4℃ overnight. Next day, beads were collected and washed and the precipitation complex was diluted and subjected to following Western blot analysis or mass spectrometry. Mass spectrometry was performed by the Bioinformatics and Omics Center, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University. Next-generation sequencing, RNA isolation, reverse transcription, real-time PCR (RT-PCR) and nucleic acid electrophoresis Next-generation sequencing was performed by NovelBio, China. Total RNA was exacted via EZ-press RNA Purification Kit (EZBioscience, USA) according to manufactory’s protocol. Reverse transcription was conducted using HiScript IV All-in-One Ultra RT SuperMix for qPCR (R433-01, Vazyme, China). Briefly, 1000 ng RNA and 5 µl 4 × All-in-One Ultra qRT SuperMix were incubated in 50℃ for 5 min, followed by 85℃ for 5 sec. RT-PCR was performed with Hieff UNICON® Power qPCR SYBR Green Master Mix (YEASEN, China) on a QuantStudio Dx instrument (Applied Biosystem, USA). The relevant abundance was calculated based on the cycle threshold (CT) value. Products from RT-PCR were mixed with 6× loading buffer (TaKaRa, Japan) and GelRed (Biotium, US). Electrophoresis was conducted with constant voltage in 1% agarose with TAE buffer and the bands were visualized by UV irradiation. Primers used in this study: CHEK2-forword TTGCTTTGATGAACCACTGCTG; CHEK2-reverse GAAAGCCAGCTTTACCTCTCCA. Animal experiments All the procedures for animal experiments in this study were approved by the Animal Ethical and Welfare Committee of the Sixth Affiliated Hospital of Sun Yat-sen University before experiment conduction. 4-week-old male BALB/c nude mice were purchased from GemPharmatech Co., Ltd and were randomly divided into NC and sh-ZRANB1 groups. For the subcutaneous xenograft model, 5×10 6 T24 cells were subcutaneously injected into the left flank of each mouse. Tumour size was measured every five days and tumour volume was calculated as tumour length × (tumour width) 2 /2. Mice were euthanized 30 days after the injection. The tumours were harvested, weighted and subjected to IHC and HE staining. For the LN metastasis model, 5×10 6 T24 cells were suspended into 50 µl PBS and injected into right footpad of each mouse. The right popliteal LNs were collected 30 days after the injection and further subjected to weighting and HE staining. Statistical analysis Statistical analysis was performed by SPSS 20.0 (IBM SPSS Statistics, USA). Data from three independent experiments were presented as the mean ± standard deviation (SD) unless noted otherwise. Paired or un-paired Student’s t -test and Mann‒Whitney U test were applied to compare the difference between two groups based on whether data conformed a normal distribution. Chi-square test and one-way analysis of variance (ANOVA) were applied to assess the effects of multiple variants. For Kaplan–Meier survival analysis, the log-rank test was conducted. P < 0.05 was considered statistically significant. Results High expression of DUB ZRANB1 is related to poor survival in UBC To identify the key ubiquitination molecule in UBC, we defined a defined a subset of 741 ubiquitination-related genes, including 2 E1, 32 E2, 616 E3, and 91 DUB, as we described previously[ 24 ]. Then, we cross-compared the subset with Gepia and three GSE datasets (GSE190079, GSE231393, GSE236932). Finally, only ZRANB1 was screened out for the following study (Fig. 1A). In order to assess the clinical relevance of ZRANB1 expression in UBC patients, we detected the protein expression of ZRANB1 in 12 paired UBC tissues (T) and adjacent normal tissues (N) through Western blotting analysis and found that ZRANB1 had higher expression in most UBC tissues (Fig. 1B). Moreover, we assessed the abundance of ZRANB1 in 15 UBC specimen along with their paired normal adjacent tissues and 110 UBC specimen with survival information via IHC analysis (Fig. 1C). It was found that ZRANB1 had higher expression level in UBC tissues compared with adjacent normal sections (Fig. 1D), and higher ZRANB1 expression was associated with more advanced T stage, lymph node positivity, and higher pathological stage (Fig. 1E-G). Furthermore, higher abundance of ZRANB1 expression is related to worse overall survival of UBC patients (Fig. 1H). ZRANB1 influences the proliferation and invasion of UBC in vitro To test the biological role of ZRANB1 in UBC, we transfected siRNAs into T24 and UM-UC-3 cells specifically targeting ZRANB1. Silencing efficacy of siRNA was successfully validated through Western blotting analysis (Fig. 2A). Then, we evaluate the growth rate of UBC cells knocking down of ZRANB1. CCK-8 assays showed that silencing ZRANB1 significantly reduced the viability of T24 and UM-UC-3 cells (Fig. 2B). Cell colony formation assays demonstrated that knocking down of ZRANB1 down-regulated the colony formation abilities of UBC cells (Fig. 2C). We also performed the Transwell migration and invasion assays and found that ZRANB1 silencing inhibited the migration and invasion abilities of T24 and UM-UC-3 cells (Fig. 2D). Then we cloned ZRANB1’ open reading frame (ORF) plus 3x flag tag into pLvx-puro plasmid, and ZRANB1 over-expression cell lines were successfully conducted by lentivirus package, infection, and selection with puromycin. The abundance of ZRANB1 was evaluated via Western blotting analysis (Fig. 2E). Not surprisingly, elevated expression of ZRANB1 promoted the proliferation and colony formation capacities of UBC cells (Fig. 2F-G). Moreover, up-regulated expression of ZRANB1 facilitated the migration and invasion of T24 and UM-UC-3 cells (Fig. 2H). Overall, we revealed that ZRANB1 positively influenced the growth and migration of UBC cells in vitro. ZRANB1 stabilizes SF3B3 through the ubiquitin–proteasome pathway ZRANB1 is previously recognized as a deubiquitinase that plays various functions in multiply physiological and pathological progress[ 27 , 28 ]. We intended to clarify its specific mechanism in UBC. Firstly, we aimed to identify interactive molecules of ZRANB1. We failed to obtain satisfying anti-ZRANB1 antibodies in apply to co-IP assay, as a result, we exogenously expressed ZRNAB1-flag fusing protein in T24 and UM-UC-3 cells. Then we conducted IP followed with mass spectrometry using anti-flag antibodies and IgG. The profile of ZRANB1 interaction network was established, of which SF3B3 was selected for further investigation due to its high coverage and lack of relevant studies (Fig. 3A). In order to validate the binding between ZRANB1 and SF3B3, co-IP coupled with Western blotting analysis in UBC cells expressing ZRANB1-flag showed that anti-flag antibody, instead of IgG could enrich ZRANB1 and SF3B3 (Fig. 3B). We also conducted co-IP coupled with Western blotting analysis in wild type T24 and UM-UC-3 cells with anti-SF3B3 antibody, which validated our finding (Fig. 3C). Then we intended to investigate the regulatory relationship between ZRANB1 and SF3B3. We silenced the expression of ZRANB1, and SF3B3 abundance was reduced (Fig. 3D). When ZRANB1 was over-expressed, the SF3B3 protein level was subsequently increased in UBC cells (Fig. 3E). Since ZRANB1 generally functioned as deubiquitinase to influence target protein post-transcriptionally, we applied CHX to halt transcription in T24 and UM-UC-3 cells and measured SF3B3 abundance at indicated time points. SF3B3 protein degraded slower when ZRANB1 was over expressed (Fig. 3F). To test whether the regulation was dependent of the ubiquitin‒proteasome pathway, we treated cells with proteasome inhibitor MG132. It was demonstrated that when MG132 existed, ZRANB1 silencing failed, at least partly, to lower SF3B3 expression, which suggested proteasome pathway was involved (Fig. 3G). Lastly, we measured the ubiquitination levels of SF3B3 in UBC cells over expressing ZRANB1, and supplemented ZRANB1 boosted the ubiquitination of SF3B3 (Fig. 3H). Overall, we demonstrated that ZRANB1 stabilized SF3B3 through ubiquitin–proteasome pathway. SF3B3 promotes carcinogenesis in UBC Then we determined to understand the role of SF3B3 in UBC carcinogenesis. We transfected T24 and UM-UC-3 cells with siRNAs specifically targeting SF3B3, and the knock down efficiency was proved with Western blot analysis (Fig. 4A). CCK-8 assays and colony formation assays demonstrated that decreased expression of SF3B3 suppressed the viabilities and colony formation abilities of UBC cells (Fig. 4B-C). In accordance with the effect of ZRANB1 silencing, down regulated SF3B3 negatively influenced the migration and invasion of T24 and UM-UC-3 cells in vitro (Fig. 4D). Collectively, SF3B3 played an inhibition role in UBC carcinogenesis. Overexpression of SF3B3 abrogates tumour inhibition of ZRANB1 silencing in UBC cells Based on the date above, we had plenty evidence to assume that ZRANB1 exerted its function through SF3B3. To testify our hypothesis, we exogenously expressed SF3B3 in ZRANB1-NC and ZRANB1-silencing UBC cells. It was revealed that simply elevation of SF3B3 abundance in ZRANB1-NC cells boosted the proliferation, colony formation, migration and invasion abilities. However, when SF3B3 was supplemented in the UBC cells knocking down of ZRANB1, the inhibition effect of silencing ZRANB1 on proliferation and invasion was abolished, which suggested the anti-tumoural effect of ZRANB1 inhibition was achieved through downregulation of SF3B3 (Fig. 5A-C). SF3B3 is involved in the AS of CHEK2 Many previous studies reported that SF3B3 could regulate the AS of various transcripts, which naturally led us to investigate the impact of SF3B3 on AS in UBC[ 29 , 30 ]. We performed next-generation sequencing of T24 and UM-UC-3 cell transfected with siRNAs targeting NC or SF3B3. The AS events were classified into five categories, including alternative 3’ splice-site (A3SS), alternative 5’ splice-site (A5SS), mutually exclusive exons (MXE), retained intron (RI) and skipping exon (SE) (Fig. 6A). As for both total events and significant events, SE was the most common events recognized (Fig. 6B-C). Moreover, more SE events were observed in NC cells than SF3B3 knockdown cells, suggesting SF3B3 functioned as SE effector in most occasions (Fig. 6D-G). We selected five most statistically significant SE events, including exon 28 skipping in DNAH14, exon 6 skipping in LIAS, exon 3 skipping in CCDC163, exon 2 skipping in PHF5A, and exon 4 skipping in CHEK2. We designed and synthesized pairs of primers targeting the upstream and downstream of skipping exons and PCR was applied with cDNA from UBC cells treated with or without siRNAs silencing SF3B3. The PCR products were further conducted to nucleic acid electrophoresis, and it was observed that after knocking down of SF3B3, the shorter product (namely CHEK2-e4-) increased while longer product (namely CHEK2-WT) decreased, which indicated that SF3B3 was essential inhibitor of the exon 4 skipping in CHEK2 transcription (Fig. 6H). CHEK2 was generally regarded as tumour suppressor whose variants shared strong connection with cancer risk[ 31 ]. Therefore, we intended to elucidate the functional role of CHEK2-WT and CHEK2-e4- in UBC cells. Exogenously expression of CHEK2-WT slightly elevated the cell viability, colony formation, migration and invasion of both T24 and UM-UC-3 cells, while supplemented CHEK2-e4- robustly suppressed the proliferation and motivation of UBC cells (Fig. 6I-K). Collectively, SF3B3 was essential for the maintenance of full-length CHEK2 transcription, inhibiting the AS of exon 4 to exert anti-tumour effect. ZRABN1 silencing inhibitor proliferation and lymph node metastasis of UBC cells in vivo To validate ZRNAB1-SF3B3 axis in vivo, we constructed T24 cells stably knocking down of ZRANB1 via shRNAs. Cells with or without ZRANB1 knocking down were subcutaneously injected into left flanks of BALB/c nude mice, separately, and tumour volume was measured every 5 days. The volume and weight of tumour in ZRANB1 silencing group were significantly reduced compared with control group (Fig. 7A-C). We also performed IHC staining on tumour on both groups. Not surprisingly, ZRNAB1 expression, SF3B3 expression, and rate of Ki-67 positivity was lower in ZRANB1 silencing group than NC group (Fig. 7D). For the LN metastasis model, equal amount of NC or ZRANB1-silencing T24 cells were injected into footpads of nude mice, and the popliteal LNs were harvested 30 days later (Fig. 7E). Size and volume of popliteal LNs in ZRANB1 silencing group was smaller than NC group (Fig. 7F-G). Moreover, when LNs were paraffin-embedded and further applied to HE staining, it was revealed that invasiveness to LN was more severe in NC group than ZRANB1 knockdown group (Fig. 7H). In conclusion, ZRANB1 inhibited the proliferation and LN metastasis of UBC in vivo. Discussion Previous studies have identified the deubiquitinase ZRANB1 as a novel oncogenic driver in various malignancies, whose overexpression is correlated with poorer survival. For instance, ZRANB1 is highly expressed in hepatocellular carcinoma (HCC) tissues and ZRANB1 drives HCC progression by deubiquitinating and stabilizing SP1[ 28 ]. It was also reported that ZRANB1 promoted autophagy and suppressed anti-tumour immunity via protecting cGAS from autophagic degradation[ 32 ]. ZRANB1 is generally regarded specifically to hydrolyze both Lys29- and Lys33-linked di-ubiquitin, while intriguingly, Shan Huang, et al. reported that ZRANB1 maintained an E3 ligase activity, which was related to its C-terminal OTU domain[ 21 , 27 ]. In the present study, we clarified the oncogenic role of ZRANB1 in UBC. Our analysis of multiple cohorts (GSE and TCGA) and clinical validation revealed that ZRANB1 is significantly upregulated in UBC tissues compared to adjacent normal tissues, and high ZRANB1 expression correlates with advanced pathological stages, lymph node metastasis, and poor overall survival, which emphasized its clinical value as a potential therapeutic target in UBC. A major novelty of our work lies in the identification of the ZRANB1-SF3B3 axis, linking protein stability to AS regulation. AS is defined as the different combination of intron-removal and exon-connection during the production of mature RNA from pre-RNA, which is a pivotal post-transcriptional process to expand proteomic diversity[ 33 ]. More than 95% of human genes harbor AS events and it is estimated that each protein-coding gene contains 11 exons and produces 5.4 mRNA transcripts on average[ 34 – 36 ]. RNA splicing relies on spliceosome, a large macromolecular complex comprising both RNA and protein to recognize the junction of introns and exons. Certain trans -acting factors and cis -acting elements are also involved[ 37 ]. The main AS patterns can be were divided into five types, of which SE events represent the most prevalent occurrence in higher eukaryotes[ 38 ]. The abnormal AS activities are generally accompanied by the occurrence and development of tumours, including various solid tumours as well as hematological malignancies[ 39 – 43 ]. Tumour cells could hijack AS to produce isoforms that favor tumourigenesis, metastasis, anti-apoptosis, chemoresistance, and radioresistance[ 29 , 44 – 46 ]. These transcripts can also serve as diagnosis biomarkers and therapeutic targets. One famous example is that prostate cancer cells utilize AS to escape broadly applied androgen deprivation therapy (ADT). It is widely accepted that prostate cancer is androgen-dependent and antiandrogens such as enzalutamide which antagonizes the interaction of androgens with androgen receptor (AR), and abiraterone, the inhibitor of androgen biosynthesis, represent the mainstay for locally advanced or metastasis disease[ 47 ]. AR-V7 is a truncated isoform of AR, and it is revealed to be associated with resistance to ADT and increased risk of biochemical recurrence after prostatectomy[ 48 ]. Compared with wild-type AR, AR-V7 lacks the ligand-binding domain, and this confirmatory change allows persistent AR activation and survival signaling in tumour cells despite absence of a ligand[ 49 ]. Regulation of abnormal AS can be achieved through either interfering the spliceosome components/regulators to modulate splicing efficiency or directly abolish specific isoforms[ 50 ]. SF3B1, component of U2 small nuclear ribonucleoprotein (snRNP) has become a research hit. The prototypic compounds include spliceostatin A, meayamycin B, sudemycins, E7107 and H3B-8800, which mainly affect the assemble of spliceosome and further impact the AS patterns of a subset of genes[ 33 ]. However, few compounds targeting specific transcript have been utilized in clinic to date. Risdiplam promotes exon 7 inclusion in SMN2 pre-mRNA and has been approved by FDA for the treatment of spinal muscular atrophy[ 51 ]. Splice-switching antisense oligonucleotides (ASOs) are chemically synthesized short RNA oligos which bind with target pre-mRNA in a reverse complimentary way to alter AS mode[ 50 ]. We found that ZRANB1 physically interacts with and deubiquitinates SF3B3, protecting it from proteasomal degradation. This expands the understanding of how the spliceosome is regulated upstream, suggesting that targeting DUBs like ZRANB1 could be a strategic approach to destabilize the splicing machinery in cancer cells without directly targeting the transcript isoform or spliceosome itself. SF3B3, a member of the SF3B complex within the U2 small nuclear ribonucleoprotein (snRNP) complex, plays a crucial role in recognizing the branch point sequence of pre-mRNA and protecting genome stability by facilitating DNA repair[ 52 , 53 ]. Consistent with our results, overexpression of SF3B3 has been associated with tumourigenesis in colorectal cancer, gastric cancer, hepatocellular carcinoma, estrogen receptor-positive breast cancer and renal cancer[ 29 , 30 , 54 , 55 ]. SF3B3 is involved in the AS of EZH2 pre-mRNA in clear cell renal carcinoma and hepatocellular carcinoma while in colorectal cancer, SF3B3 regulates mTOR exon 8 skipping, leading to lipogenesis via FASN signaling[ 29 , 55 ]. In our study, SF3B3 knockdown phenocopied the effects of ZRANB1 silencing, suppressing UBC cell viability and invasiveness. Importantly, overexpression of SF3B3 rescued the anti-tumour effects induced by ZRANB1 depletion, confirming that SF3B3 is a primary downstream effector of ZRANB1. By using next-generation sequencing, we further elucidated that SF3B3 predominantly modulates exon skipping events in UBC, identifying the cell cycle checkpoint kinase CHEK2 as a critical splicing target. Our mechanistic investigation revealed that SF3B3 is essential for maintaining the expression of full-length CHEK2 while suppressing the exon 4 skipped isoform. CHEK2 is a well-established tumour suppressor which is phosphorylated and activated by ataxia telangiectasia mutated (ATM) during homologous recombination. Its downstream effectors include CDC25C, p53, BRCA1/2 and cyclin D, which further influence DNA repair, cell cycle arrest, apoptosis, senescence, autophagy and aging. The translation product of the most dominant splicing variant consists of three conserved domains, including a serine–glutamine or threonine–glutamine cluster domain (SCD) at the N-terminal, a forkhead-associated (FHA) domain, and a kinase domain (KD) at the C-terminal. The most expressed transcription variant 1 (NM_007194/ENST00000404276.6) consists of 15 exons and exon 4 lies within the FHA domain. Germline mutations in the CHEK2 gene, represented by c.1100delC and p.I157T, and their association with various cancers have been extensively studied. A germline mutation of CHEK2 was more commonly seen in UBC cases than in the controls, yet no impact of CHEK2 mutations on overall survival was observed. Loss of IHC expression of CHEK2 in pT1 UBC was reported to associate with muscle-invasive progression and worse progression-free survival[ 56 ]. However, relevant studies on AS of CHEK2 in UBC are lacking. Interestingly, our experiments demonstrated that the CHEK2-e4- isoform exerts a potent suppressive effect on UBC proliferation and motility, whereas the full-length protein appears permissive for tumour growth in this context. This suggests that the ZRANB1-SF3B3 axis promotes tumourigenesis by "correcting" splicing to prevent the generation of the anti-tumour CHEK2-e4- isoform. These findings parallel reports where cancer cells manipulate splicing factors to shift the balance from pro-apoptotic to anti-apoptotic isoforms, yet the specific molecular mechanisms and the potential clinical relevance require more investigation. In conclusion, our study delineates a novel regulatory signaling axis in UBC: ZRANB1 stabilizes SF3B3 via deubiquitination, which further inhibits the exon 4 skipping of CHEK2, thereby preventing the expression of a tumour-suppressive isoform. This pathway drives unrestrained proliferation and metastasis in UBC. These results not only provide new insights into the crosstalk between the UPS and RNA processing but also highlight ZRANB1 as a promising prognostic biomarker and a potential therapeutic target for UBC treatment. Future studies should explore the development of specific small-molecule inhibitors against ZRANB1 to disrupt this oncogenic axis. Declarations COMPETING INTERESTS The authors declare no competing interests. ETHICS APPROVAL AND CONSENT TO PARTICIPATE All procedures involving human were approved by the Ethics Committees of Sun Yat-sen Memorial Hospital, Sun Yat-sen University (approval no. SYSKY-2023-076-01). Informed consent was obtained from each patient. The procedures for the animal experiments were evaluated and approved by the Animal Ethical and Welfare Committee of the Sixth Affiliated Hospital of Sun Yat-sen University (approval no. SYSU-IACUC-2025-060801) in compliance with the Guide for the Care and Use of Laboratory Animals. AUTHOR CONTRIBUTIONS HQ, DW, and JQ conceived and designed the study. DY and WZ performed most experiments. YT analyzed the data. LH provided support for the mass spectrometry. YZ assisted with animal experiments. WZ helped with data analysis. DY, WZ and HQ drafted and edited the paper, with all authors providing feedback. The order of the authors was assigned on the basis of their relative contributions to the study. ACKNOWLEDGEMENTS This work was supported by the National Natural Science Foundation of China(82203673) and Natural Science Foundation of Guangdong Province(2024A1515013180). References Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin. 2021;71(3):209–49. Li H, Zeng S, Yang C, Yang Y, Cao Z, Hu Z, et al. Global, regional, and national burden and trends of bladder cancer in individuals aged 55 years and older from 1990 to 2021: findings from the Global Burden of Disease Study 2021. Int J Surg. 2025;111(12):8916–33. Wong MCS, Fung FDH, Leung C, Cheung WWL, Goggins WB, Ng CF. The global epidemiology of bladder cancer: a joinpoint regression analysis of its incidence and mortality trends and projection. Sci Rep. 2018;8(1):1129. Grabe-Heyne K, Henne C, Mariappan P, Geiges G, Pohlmann J, Pollock RF. Intermediate and high-risk non-muscle-invasive bladder cancer: an overview of epidemiology, burden, and unmet needs. Front Oncol. 2023;13:1170124. Safiri S, Kolahi AA, Naghavi M, Global Burden of Disease Bladder Cancer C. Global, regional and national burden of bladder cancer and its attributable risk factors in 204 countries and territories, 1990–2019: a systematic analysis for the Global Burden of Disease study 2019. BMJ Glob Health. 2021;6(11). Teoh JY, Huang J, Ko WY, Lok V, Choi P, Ng CF, et al. Global Trends of Bladder Cancer Incidence and Mortality, and Their Associations with Tobacco Use and Gross Domestic Product Per Capita. Eur Urol. 2020;78(6):893–906. Botteman MF, Pashos CL, Redaelli A, Laskin B, Hauser R. The health economics of bladder cancer: a comprehensive review of the published literature. Pharmacoeconomics. 2003;21(18):1315–30. Knowles MA, Hurst CD. Molecular biology of bladder cancer: new insights into pathogenesis and clinical diversity. Nat Rev Cancer. 2015;15(1):25–41. Alfred Witjes J, Max Bruins H, Carrion A, Cathomas R, Comperat E, Efstathiou JA, et al. European Association of Urology Guidelines on Muscle-invasive and Metastatic Bladder Cancer: Summary of the 2023 Guidelines. Eur Urol. 2024;85(1):17–31. Hershko A, Ciechanover A. The ubiquitin system. Annu Rev Biochem. 1998;67:425–79. Shaid S, Brandts CH, Serve H, Dikic I. Ubiquitination and selective autophagy. Cell Death Differ. 2013;20(1):21–30. Gao L, Zhang W, Shi XH, Chang X, Han Y, Liu C, et al. The mechanism of linear ubiquitination in regulating cell death and correlative diseases. Cell Death Dis. 2023;14(10):659. Mevissen TET, Komander D. Mechanisms of Deubiquitinase Specificity and Regulation. Annu Rev Biochem. 2017;86:159–92. Han S, Wang R, Zhang Y, Li X, Gan Y, Gao F, et al. The role of ubiquitination and deubiquitination in tumor invasion and metastasis. Int J Biol Sci. 2022;18(6):2292–303. Groll M, Huber R. Substrate access and processing by the 20S proteasome core particle. Int J Biochem Cell Biol. 2003;35(5):606–16. Klionsky DJ. Autophagy: from phenomenology to molecular understanding in less than a decade. Nat Rev Mol Cell Biol. 2007;8(11):931–7. Schwartz AL, Ciechanover A. Targeting proteins for destruction by the ubiquitin system: implications for human pathobiology. Annu Rev Pharmacol Toxicol. 2009;49:73–96. Han D, Wang L, Jiang S, Yang Q. The ubiquitin-proteasome system in breast cancer. Trends Mol Med. 2023;29(8):599–621. Dewson G, Eichhorn PJA, Komander D. Deubiquitinases in cancer. Nat Rev Cancer. 2023;23(12):842–62. Huang X, Dixit VM. Drugging the undruggables: exploring the ubiquitin system for drug development. Cell Res. 2016;26(4):484–98. Licchesi JD, Mieszczanek J, Mevissen TE, Rutherford TJ, Akutsu M, Virdee S, et al. An ankyrin-repeat ubiquitin-binding domain determines TRABID's specificity for atypical ubiquitin chains. Nat Struct Mol Biol. 2011;19(1):62–71. Miao D, Wang Y, Jia Y, Tong J, Jiang S, Liu L. ZRANB1 enhances stem-cell-like features and accelerates tumor progression by regulating Sox9-mediated USP22/Wnt/beta-catenin pathway in colorectal cancer. Cell Signal. 2022;90:110200. Yan R, Liu D, Guo H, Liu M, Lv D, Bjorkblom B, et al. LAPTM4B counteracts ferroptosis via suppressing the ubiquitin-proteasome degradation of SLC7A11 in non-small cell lung cancer. Cell Death Dis. 2024;15(6):436. Yan D, He Q, Pei L, Yang M, Huang L, Kong J, et al. The APC/C E3 ligase subunit ANAPC11 mediates FOXO3 protein degradation to promote cell proliferation and lymph node metastasis in urothelial bladder cancer. Cell Death Dis. 2023;14(8):516. Pei L, Yan D, He Q, Kong J, Yang M, Ruan H, et al. LncRNA MIR4435-2HG drives cancer progression by modulating cell cycle regulators and mTOR signaling in stroma-enriched subtypes of urothelial carcinoma of the bladder. Cell Oncol (Dordr). 2023;46(5):1509–27. He Q, Huang L, Yan D, Bi J, Yang M, Huang J, et al. CircPTPRA acts as a tumor suppressor in bladder cancer by sponging miR-636 and upregulating KLF9. Aging (Albany NY). 2019;11(23):11314–28. Huang S, Zhang Q, Zhao M, Wang X, Zhang Y, Gan B, et al. The deubiquitinase ZRANB1 is an E3 ubiquitin ligase for SLC7A11 and regulates ferroptotic resistance. J Cell Biol. 2023;222(11). Li Q, Chao Q, Liu Y, Fang J, Xie J, Zhen J, et al. Deubiquitinase ZRANB1 drives hepatocellular carcinoma progression through SP1-LOXL2 axis. Am J Cancer Res. 2021;11(10):4807–25. Xu T, Li X, Zhao W, Wang X, Jin L, Feng Z, et al. SF3B3-regulated mTOR alternative splicing promotes colorectal cancer progression and metastasis. J Exp Clin Cancer Res. 2024;43(1):126. Qiao Y, Shi Q, Yuan X, Ding J, Li X, Shen M, et al. RNA binding protein RALY activates the cholesterol synthesis pathway through an MTA1 splicing switch in hepatocellular carcinoma. Cancer Lett. 2022;538:215711. Stolarova L, Kleiblova P, Janatova M, Soukupova J, Zemankova P, Macurek L, et al. CHEK2 Germline Variants in Cancer Predisposition: Stalemate Rather than Checkmate. Cells. 2020;9(12). Chen YH, Chen HH, Wang WJ, Chen HY, Huang WS, Kao CH, et al. TRABID inhibition activates cGAS/STING-mediated anti-tumor immunity through mitosis and autophagy dysregulation. Nat Commun. 2023;14(1):3050. Zhang Y, Qian J, Gu C, Yang Y. Alternative splicing and cancer: a systematic review. Signal Transduct Target Ther. 2021;6(1):78. Nilsen TW, Graveley BR. Expansion of the eukaryotic proteome by alternative splicing. Nature. 2010;463(7280):457–63. Bonnal SC, Lopez-Oreja I, Valcarcel J. Roles and mechanisms of alternative splicing in cancer - implications for care. Nat Rev Clin Oncol. 2020;17(8):457–74. Piovesan A, Caracausi M, Antonaros F, Pelleri MC, Vitale L. GeneBase 1.1: a tool to summarize data from NCBI gene datasets and its application to an update of human gene statistics. Database (Oxford). 2016;2016. Shenasa H, Movassat M, Forouzmand E, Hertel KJ. Allosteric regulation of U1 snRNP by splicing regulatory proteins controls spliceosomal assembly. RNA. 2020;26(10):1389–99. Keren H, Lev-Maor G, Ast G. Alternative splicing and evolution: diversification, exon definition and function. Nat Rev Genet. 2010;11(5):345–55. Babic I, Anderson ES, Tanaka K, Guo D, Masui K, Li B, et al. EGFR mutation-induced alternative splicing of Max contributes to growth of glycolytic tumors in brain cancer. Cell Metab. 2013;17(6):1000–8. Anczukow O, Rosenberg AZ, Akerman M, Das S, Zhan L, Karni R, et al. The splicing factor SRSF1 regulates apoptosis and proliferation to promote mammary epithelial cell transformation. Nat Struct Mol Biol. 2012;19(2):220–8. Liu F, Dai M, Xu Q, Zhu X, Zhou Y, Jiang S, et al. SRSF10-mediated IL1RAP alternative splicing regulates cervical cancer oncogenesis via mIL1RAP-NF-kappaB-CD47 axis. Oncogene. 2018;37(18):2394–409. Sheng J, Zhao Q, Zhao J, Zhang W, Sun Y, Qin P, et al. SRSF1 modulates PTPMT1 alternative splicing to regulate lung cancer cell radioresistance. EBioMedicine. 2018;38:113–26. Liu J, Huang B, Xiao Y, Xiong HM, Li J, Feng DQ, et al. Aberrant expression of splicing factors in newly diagnosed acute myeloid leukemia. Onkologie. 2012;35(6):335–40. Deng L, Liao L, Zhang YL, Yang SY, Hu SY, Andriani L, et al. SF3A2 promotes progression and cisplatin resistance in triple-negative breast cancer via alternative splicing of MKRN1. Sci Adv. 2024;10(14):eadj4009. Bian Z, Yang F, Xu P, Gao G, Yang C, Cao Y, et al. LINC01852 inhibits the tumorigenesis and chemoresistance in colorectal cancer by suppressing SRSF5-mediated alternative splicing of PKM. Mol Cancer. 2024;23(1):23. He H, Zhou Q, Zhang Y, Li Y, Ding L, Shen T, et al. PTBP1 Regulates DNMT3B Alternative Splicing by Interacting With RALY to Enhance the Radioresistance of Prostate Cancer. Adv Sci (Weinh). 2024;11(42):e2405997. Sciarrillo R, Wojtuszkiewicz A, Assaraf YG, Jansen G, Kaspers GJL, Giovannetti E, et al. The role of alternative splicing in cancer: From oncogenesis to drug resistance. Drug Resist Updat. 2020;53:100728. Munkley J, Livermore K, Rajan P, Elliott DJ. RNA splicing and splicing regulator changes in prostate cancer pathology. Hum Genet. 2017;136(9):1143–54. Paschalis A, Sharp A, Welti JC, Neeb A, Raj GV, Luo J, et al. Alternative splicing in prostate cancer. Nat Rev Clin Oncol. 2018;15(11):663–75. Bradley RK, Anczukow O. RNA splicing dysregulation and the hallmarks of cancer. Nat Rev Cancer. 2023;23(3):135–55. Paik J. Risdiplam: A Review in Spinal Muscular Atrophy. CNS Drugs. 2022;36(4):401–10. Golas MM, Sander B, Will CL, Luhrmann R, Stark H. Molecular architecture of the multiprotein splicing factor SF3b. Science. 2003;300(5621):980–4. Li H, Ding Z, Fang ZY, Long N, Ang HY, Zhang Y, et al. Conserved intronic secondary structures with concealed branch sites regulate alternative splicing of poison exons. Nucleic Acids Res. 2024;52(10):6002–16. Gokmen-Polar Y, Neelamraju Y, Goswami CP, Gu X, Nallamothu G, Janga SC, et al. Expression levels of SF3B3 correlate with prognosis and endocrine resistance in estrogen receptor-positive breast cancer. Mod Pathol. 2015;28(5):677–85. Chen K, Xiao H, Zeng J, Yu G, Zhou H, Huang C, et al. Alternative Splicing of EZH2 pre-mRNA by SF3B3 Contributes to the Tumorigenic Potential of Renal Cancer. Clin Cancer Res. 2017;23(13):3428–41. Spachmann PJ, Azzolina V, Weber F, Evert M, Eckstein M, Denzinger S, et al. Loss of CHEK2 Predicts Progression in Stage pT1 Non-Muscle-Invasive Bladder Cancer (NMIBC). Pathol Oncol Res. 2020;26(3):1625–32. Additional Declarations (Not answered) Supplementary Files Supplementarytable1.docx Supplementary table 1 WBori1.jpg original images of Western blot-1 WBori2.jpg original images of Western blot-2 Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: revise 09 Mar, 2026 Review # 2 received at journal 01 Mar, 2026 Review # 1 received at journal 01 Mar, 2026 Reviewer # 2 agreed at journal 28 Feb, 2026 Reviewer # 1 agreed at journal 23 Feb, 2026 Reviewers invited by journal 23 Feb, 2026 Submission checks completed at journal 09 Feb, 2026 First submitted to journal 07 Feb, 2026 Editor assigned by journal 07 Feb, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8816203","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":595551927,"identity":"39d7736a-f216-40d7-9d5a-ec7a898be08b","order_by":0,"name":"Qingqing He","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA9ElEQVRIiWNgGAWjYBACAxDxoYKBgY0dLpZAWAvjjDNALcykaGHmbQORxGoxZ2/eeJt33jZ5PmYG5s88fw4z8LPnGDD83IFbi2XPsWLLudtuG7YxM7BJ87YdZpDseWPA2HsGj8Nu5JhJvN12mxGkhZm34TBIxICZsQ2PlvtvzCR459y2b4M5zJ6glhs8ZpK8DbcTgVoYpHnYgLZIENJyJq3Ycsax28ltQGWSc9vSeSTOPCs42ItPy/HDG298qLltO7+9+fCHN3+s5fjbkzc++IlHC0iXBIRmbGDiYWDgATEP4NWA0ALU9IOA0lEwCkbBKBiZAAAX7E2fIMJzpAAAAABJRU5ErkJggg==","orcid":"","institution":"Sun Yat-Sen University, Guangzhou, China","correspondingAuthor":true,"prefix":"","firstName":"Qingqing","middleName":"","lastName":"He","suffix":""},{"id":595551928,"identity":"16e7278d-5425-4dbf-82c6-179e95963fb5","order_by":1,"name":"Dong Yan","email":"","orcid":"","institution":"The Sixth Affiliated Hospital, Sun Yat-sen University","correspondingAuthor":false,"prefix":"","firstName":"Dong","middleName":"","lastName":"Yan","suffix":""},{"id":595551929,"identity":"4bf976cb-6f7d-442e-ab28-7e38c63002c6","order_by":2,"name":"Wenjie Zhu","email":"","orcid":"","institution":"The Sixth Affiliated Hospital, Sun Yat-sen University","correspondingAuthor":false,"prefix":"","firstName":"Wenjie","middleName":"","lastName":"Zhu","suffix":""},{"id":595551930,"identity":"02ab508b-b0af-49b7-a135-0008638467f5","order_by":3,"name":"Yiran Tao","email":"","orcid":"","institution":"The sixth affilated hospital, Sun-yat sen university","correspondingAuthor":false,"prefix":"","firstName":"Yiran","middleName":"","lastName":"Tao","suffix":""},{"id":595551931,"identity":"126c74d6-e1aa-4666-9a29-35e739ae641a","order_by":4,"name":"Lifang Huang","email":"","orcid":"","institution":"Sun Yat-sen Memorial Hospital, Sun Yat-sen University","correspondingAuthor":false,"prefix":"","firstName":"Lifang","middleName":"","lastName":"Huang","suffix":""},{"id":595551932,"identity":"d2e96630-0e76-4136-aa2f-8d0c3c4a2492","order_by":5,"name":"Yunlong Zhang","email":"","orcid":"","institution":"The Sixth Affiliated Hospital Yuexi Hospital/Xinyi People's Hospital, Sun Yat-sen University","correspondingAuthor":false,"prefix":"","firstName":"Yunlong","middleName":"","lastName":"Zhang","suffix":""},{"id":595551933,"identity":"237e2071-5125-4152-9a5d-e4a14a40fdbe","order_by":6,"name":"Wenliang Zhu","email":"","orcid":"","institution":"The Sixth Affiliated Hospital, Sun Yat-sen University","correspondingAuthor":false,"prefix":"","firstName":"Wenliang","middleName":"","lastName":"Zhu","suffix":""},{"id":595551934,"identity":"e14ff8a1-dc2e-4b03-9dfd-4983960001f0","order_by":7,"name":"Dejuan Wang","email":"","orcid":"https://orcid.org/0000-0002-0335-706X","institution":"Depatrment of Urology, Sun-Yat Sen university, The sixth afflilated hospital","correspondingAuthor":false,"prefix":"","firstName":"Dejuan","middleName":"","lastName":"Wang","suffix":""},{"id":595551935,"identity":"bf7f3fcb-8907-4feb-99be-17e25d04a2d0","order_by":8,"name":"Jianguang Qiu","email":"","orcid":"https://orcid.org/0000-0002-3517-4110","institution":"The sixth affilated hospital, Sun-yat sen university","correspondingAuthor":false,"prefix":"","firstName":"Jianguang","middleName":"","lastName":"Qiu","suffix":""}],"badges":[],"createdAt":"2026-02-07 14:30:20","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8816203/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8816203/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":103414243,"identity":"c61dfa19-cfc5-4f3e-9dbc-67567625d89e","added_by":"auto","created_at":"2026-02-25 11:42:58","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":3791359,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe overexpression of ZRANB1 is associated with poor survival of UBC patients. A\u003c/strong\u003e The Venn diagram demonstrated a brief illustration of how ZRANB1 was screened out. \u003cstrong\u003eB\u003c/strong\u003e Western blot analysis of ZRANB1 expression in 12 UBC specimens (T) and matched normal adjacent tissues (N). \u003cstrong\u003eC\u003c/strong\u003e Representative images of UBC in different T stages and normal adjacent tissue (NAT) applied to IHC staining with anti-ZRANB1. \u003cstrong\u003eD\u003c/strong\u003e \u003cem\u003eH\u003c/em\u003e-scores of 15 paired UBC specimens (T) and matched normal adjacent tissues (N), evaluated by IHC staining. Paired, two-tailed, Mann-Whitney \u003cem\u003eU\u003c/em\u003e test. \u003cstrong\u003eE-G\u003c/strong\u003e H-scores of ZRANB1 in 110 UBC specimens, compared by T stage (\u003cstrong\u003eE\u003c/strong\u003e), LN status (\u003cstrong\u003eF\u003c/strong\u003e), and pathological grade (\u003cstrong\u003eG\u003c/strong\u003e). Mann-Whitney \u003cem\u003eU\u003c/em\u003e test. \u003cstrong\u003eH\u003c/strong\u003e 110 UBC specimens were divided into low or high ZRANB1 expression and the cutoff was determined by Youden’s Index. The Kaplan–Meier survival curve was plotted to compare the survival between two groups. Log-rank test. Data are shown as mean ± SD. \u003csup\u003e*\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01. Scale bar = 100 μm.\u003c/p\u003e","description":"","filename":"Fig.1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8816203/v1/270930867152d29bb5af587d.jpg"},{"id":103414248,"identity":"5023eff0-704f-410d-93da-83559c2e349d","added_by":"auto","created_at":"2026-02-25 11:42:59","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":4145874,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eZRANB1 promotes the proliferation and migration of UBC cells in vitro. A\u003c/strong\u003e Western blot analysis showed the ZRANB1 expression in T24 and UM-UC-3 cell treated with siRNAs. \u003cstrong\u003eB\u003c/strong\u003e Cell viabilities of T24 and UM-UC-3 cells treated with ZRANB1 siRNAs, measured with CCK-8 assays. ANOVA. \u003cstrong\u003eC\u003c/strong\u003e Representative images and histogram analysis of colony formation assays with UBC cells silencing ZRANB1. Unpaired, two-tailed student’s \u003cem\u003et\u003c/em\u003e-test. \u003cstrong\u003eD\u003c/strong\u003e Representative images and quantification of Transwell migration and invasion assays with T24 and UM-UC-3 cells treated with ZRANB1 siRNAs. Unpaired, two-tailed student’s \u003cem\u003et\u003c/em\u003e-test. \u003cstrong\u003eE\u003c/strong\u003e The abundance of ZRANB1 in UBC cells infected with indicated lentivirus was measured via Western blot analysis. \u003cstrong\u003eF\u003c/strong\u003e Cell viabilities of T24 and UM-UC-3 cells overexpressing ZRANB1, measured with CCK-8 assays. ANOVA. \u003cstrong\u003eG\u003c/strong\u003e Representative images and histogram analysis of colony formation assays with UBC cells overexpressing ZRANB1. Unpaired, two-tailed student’s \u003cem\u003et\u003c/em\u003e-test. \u003cstrong\u003eH\u003c/strong\u003e The Transwell migration and invasion assays were conducted in ZRANB1 overexpressing T24 and UM-UC-3 cells. Unpaired, two-tailed student’s \u003cem\u003et\u003c/em\u003e-test. Data are shown as mean ± SD. \u003csup\u003e*\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01. Scale bar = 100 μm.\u003c/p\u003e","description":"","filename":"Fig.2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8816203/v1/9d1b486f1dada81e3833d533.jpg"},{"id":103507817,"identity":"280ef246-320a-4ef7-bb82-d01f50e90dd6","added_by":"auto","created_at":"2026-02-26 13:45:31","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":3011047,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eZRANB1 interacts with SF3B3 to prevent ubiquitin mediated degradation. A\u003c/strong\u003e The mass spectrum of SF3B3 identified in T24 cells exogenously expressing ZRANB1-flag fusion protein followed by co-IP with anti-flag. \u003cstrong\u003eB\u003c/strong\u003e UBC cells expressing ZRANB1-flag were applied to Western blot analysis after co-IP with anti-flag or IgG. \u003cstrong\u003eC\u003c/strong\u003e Co-IP in T24 and UM-UC-3 cells with indicated antibodies. \u003cstrong\u003eD-E\u003c/strong\u003e The protein levels of ZRANB1 and SF3B3 were measured in UBC cells down-(\u003cstrong\u003eD\u003c/strong\u003e) or up-regulation(\u003cstrong\u003eE\u003c/strong\u003e) of ZRANB1, via Western blot analysis. \u003cstrong\u003eF\u003c/strong\u003e T24 and UM-UC-3 cells were treated with CHX and then collected at indicated time points, and relative SF3B3 expression was determined via Western blot analysis. The signal intensities were normalized to the intensity at initial time. ANOVA. \u003cstrong\u003eG\u003c/strong\u003e Western blot analysis demonstrated the expression of ZRANB1 and SF3B3 in sh-NC or sh-ZRANB1 UBC cells treated with PBS or MG132. \u003cstrong\u003eH\u003c/strong\u003e Western blot analysis followed by co-IP evaluated the ubiquitination levels of UBC cells overexpressing ZRANB1. Data are shown as mean ± SD. \u003csup\u003e*\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"Fig.3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8816203/v1/d53820f8055662b80776ae3b.jpg"},{"id":103414235,"identity":"ce17cbfe-a63d-4f37-80ce-82c059724d1f","added_by":"auto","created_at":"2026-02-25 11:42:56","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":2699193,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSilencing SF3B3 inhibits the proliferation and invasion of UBC cells in vitro. A\u003c/strong\u003e The knockdown efficiency of siRNAs targeting SF3B3 in T24 and UM-UC-3 cells, validated by Western blot. \u003cstrong\u003eB\u003c/strong\u003e CCK-8 assays with UBC cells silencing SF3B3. ANOVA. \u003cstrong\u003eC\u003c/strong\u003e Representative images and quantification of colony formation assays with UBC cells downregulation of SF3B3. ANOVA. \u003cstrong\u003eD\u003c/strong\u003e Transwell migration and invasion assays evaluated the migration and invasion abilities of UBC cells knocking down of SF3B3. ANOVA. Data are shown as mean ± SD. \u003csup\u003e*\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01. Scale bar = 100 μm.\u003c/p\u003e","description":"","filename":"Fig.4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8816203/v1/5eac1039e513eeacb145ac95.jpg"},{"id":103414245,"identity":"376d2086-59e2-4670-ab51-d83c4a2570a8","added_by":"auto","created_at":"2026-02-25 11:42:58","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":3664050,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplement of SF3B3 abolishes the anti-tumour effect brought by ZRANB1 silencing. A-C\u003c/strong\u003e UBC cells transfected with si-NC or si-ZRANB1-1 along with pcDNA3.1 plasmids containing an NC sequence or the SF3B3 ORF. The growth rates in vitro were evaluated by CCK-8 assays(\u003cstrong\u003eA\u003c/strong\u003e). The colony formation abilities were measured by colony formation assays(\u003cstrong\u003eB\u003c/strong\u003e). The migration and invasion of T24 and UM-UC-3 cells were quantified by Transwell migration and invasion assays(\u003cstrong\u003eC\u003c/strong\u003e). ANOVA. Data are shown as mean ± SD. \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01. Scale bar = 100 μm.\u003c/p\u003e","description":"","filename":"Fig.5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8816203/v1/a78a7405907d625546636b2c.jpg"},{"id":103414236,"identity":"d04f5df6-ce63-4f10-9080-bbbb5e81fc78","added_by":"auto","created_at":"2026-02-25 11:42:56","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":3855205,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSF3B3 regulates the AS of CHEK2. A\u003c/strong\u003e Illustrations of five most common types of AS. \u003cstrong\u003eB-C\u003c/strong\u003e Total(\u003cstrong\u003eB\u003c/strong\u003e) and significant(\u003cstrong\u003eC\u003c/strong\u003e) AS events identified via next-generation sequencing categorized into RI, MXE, A3SS, A5SS and SE. \u003cstrong\u003eD-G\u003c/strong\u003e Volcano plots of SE events in T24(\u003cstrong\u003eD-E\u003c/strong\u003e) and UM-UC-3(\u003cstrong\u003eF-G\u003c/strong\u003e) cells silencing SF3B3. \u003cstrong\u003eH\u003c/strong\u003e Nucleic acid electrophoresis with specific primers targeting upstream and downstream of exon4 in \u003cem\u003eCHEK2\u003c/em\u003e, performed with T24 and UM-UC-3 cells. \u003cstrong\u003eI\u003c/strong\u003e The growth rates of UBC cells expressing CHEK2-WT or CHEK2-e4- transcript, evaluated by CCK-8 assays. ANOVA. \u003cstrong\u003eJ\u003c/strong\u003e The representative images and quantification of Transwell migration and invasion assays with T24 and UM-UC-3 cells supplemented by CHEK2-WT or CHEK2-e4-. ANOVA. \u003cstrong\u003eK\u003c/strong\u003e The representative images and quantification of colony formation assays with indicated cells. ANOVA. Data are shown as mean ± SD. \u003csup\u003e*\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"Fig.6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8816203/v1/9392c0d4e0248a4110c47d14.jpg"},{"id":103414238,"identity":"b617f5ea-195d-485b-993c-13f39d5420d6","added_by":"auto","created_at":"2026-02-25 11:42:57","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":8583413,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eZRANB1 promotes proliferation and LN metastasis of UBC cells in vivo. A\u003c/strong\u003e The overview(left) and tumours(right) of subcutaneous xenograft model. 5×10\u003csup\u003e6\u003c/sup\u003e T24 cells were subcutaneously injected into the left flank of each mouse and tumours were harvested 30 days after the injection. \u003cstrong\u003eB\u003c/strong\u003e The volumes of tumours were measured every 5 days. ANOVA. \u003cstrong\u003eC\u003c/strong\u003e The tumour weight at the 30 days after injection. Mann–Whitney \u003cem\u003eU\u003c/em\u003e test. \u003cstrong\u003eD\u003c/strong\u003e Representative images of HE staining and IHC staining with anti-ZRANB1, -SF3B3 or Ki-67 with subcutaneous tumours. \u003cstrong\u003eE\u003c/strong\u003e A representative image of in vivo footpad model. \u003cstrong\u003eF\u003c/strong\u003e 5×10\u003csup\u003e6\u003c/sup\u003e T24 cells were injected into footpad of each mouse and the popliteal LNs were collected 30 days after the injection. \u003cstrong\u003eG\u003c/strong\u003e The volumes of popliteal LN in the LN metastasis model. \u003cstrong\u003eH\u003c/strong\u003e HE staining of LN demonstrated the invasiveness of T24 cells with indicated treatment. Data are shown as mean ± SD(\u003cstrong\u003eB\u003c/strong\u003e) or min to max(\u003cstrong\u003eC, G\u003c/strong\u003e). \u003csup\u003e*\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01. Scale bar = 100 μm.\u003c/p\u003e","description":"","filename":"Fig.7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8816203/v1/4c33bcd0f3d8601fc2928468.jpg"},{"id":103414234,"identity":"8bf120cc-8f2a-43d8-9552-a8ecb87007e8","added_by":"auto","created_at":"2026-02-25 11:42:56","extension":"jpg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":1680382,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSchematic model of the mechanism underlying the role of ZRANB1 in UBC.\u003c/strong\u003e ZRANB1 binds with and deubiquitinates SF3B3. SF3B3 plays a role in the AS of CHEK2 transcription.\u003c/p\u003e","description":"","filename":"Fig.8.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8816203/v1/9044cb1c7504d094239f71b7.jpg"},{"id":103513261,"identity":"256c1471-3dbf-43d6-8af1-0a0fcbb0ad54","added_by":"auto","created_at":"2026-02-26 14:17:25","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":26208810,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8816203/v1/b9089f39-05ce-47a1-86eb-2105a3eb637a.pdf"},{"id":103414247,"identity":"bb2b2026-60c6-4d90-91f8-bc92a63a1024","added_by":"auto","created_at":"2026-02-25 11:42:58","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":14892,"visible":true,"origin":"","legend":"Supplementary table 1","description":"","filename":"Supplementarytable1.docx","url":"https://assets-eu.researchsquare.com/files/rs-8816203/v1/a4b4785a927562e863f161e8.docx"},{"id":103508026,"identity":"85f3ef11-d1eb-44c1-bbc4-5864dd2f7af8","added_by":"auto","created_at":"2026-02-26 13:46:55","extension":"jpg","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":12380193,"visible":true,"origin":"","legend":"original images of Western blot-1","description":"","filename":"WBori1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8816203/v1/b51163fca528c31d2ba67e20.jpg"},{"id":103414266,"identity":"4e0b71db-d2ce-4563-9675-54c5d85afd38","added_by":"auto","created_at":"2026-02-25 11:42:59","extension":"jpg","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":12996548,"visible":true,"origin":"","legend":"original images of Western blot-2","description":"","filename":"WBori2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8816203/v1/1bee3a5212af8eb08ed9a7b3.jpg"}],"financialInterests":"(Not answered)","formattedTitle":"ZRANB1 promotes cell proliferation and lymph node metastasis through SF3B3-mediated alternative splicing of CHEK2 in urothelial bladder cancer","fulltext":[{"header":"Introduction","content":"\u003cp\u003eUrothelial bladder cancer (UBC) is the most common malignancy of the urinary system, posing a considerable and growing threat to public health worldwide[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Approximately 614,000 newly diagnosed cases and 220,000 deaths were reported in 2022 and age-standardized incidence (ASIR) is predicted to continuously rise within the next decade[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. The clinical management of UBC is particularly burdensome due to its high tendency of recurrence and progression. About 75% of patients present with non-muscle-invasive bladder cancer (NMIBC) at diagnosis, which, despite favorable initial survival rates, requires lifelong surveillance via cystoscopic, radiologic, and interventional procedures.[\u003cspan additionalcitationids=\"CR5\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Consequently, UBC incurs one of the highest lifetime treatment costs per patient among all cancer types, and the economic burden will likely increase on account of population aging[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. About 15% to 20% NMIBC will progress to muscle-invasive bladder cancer (MIBC), with a median survival of ~\u0026thinsp;15 months[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Despite advances in surgical techniques and immunotherapy, the prognosis for patients with advanced or metastatic disease remains poor, underscoring the urgent need to elucidate the molecular mechanisms driving UBC progression and to identify novel therapeutic targets[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eUbiquitin, a small protein consisting of 76 amino acids, is highly evolutionarily conserved and is found in all eukaryotic organisms[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Poly-ubiquitin or mono-ubiquitin forms covalent attachment to substrate proteins through ATP-dependent enzymatic cascade, including E1(activating enzyme), E2 (conjugating enzyme) and E3 (ligase)[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Ubiquitination modification is dynamic and reversible by deubiquitinating enzymes (DUBs), which function as erasers of the ubiquitin code[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Ubiquitination could result in diverse functional outcomes, such as signal transduction, subcellular localization, and most commonly, degradation[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. The ubiquitin-proteasome system (UPS) is the primary mechanism for intracellular protein homeostasis, regulating the degradation of over 80% of cellular proteins, especially short-lived and soluble misfolded/unfolded proteins[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. The specificity of this system relies on the fine balanced activities of E3 ubiquitin ligases and DUBs[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Dysregulation of the UPS is a hallmark of tumourigenesis, leading to the aberrant stabilization of oncoproteins or the excessive degradation of tumour suppressors. Emerging evidence suggests that DUBs play critical roles in cancer cell proliferation, metastasis, and chemotherapy resistance, making them attractive targets for drug discovery[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. With growing emphasis on UPS and advanced understandings of ubiquitin modification, new methodologies, like small-molecule inhibitor, protein-targeting chimeric molecules (PROTACs) and hydrophobicity tags (HyT), have been developed on tumour treatment[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. However, the specific landscape of DUBs in UBC and their functional substrates remain largely underexplored.\u003c/p\u003e \u003cp\u003eIn this study, we focused on ZRANB1 (Zinc Finger RANBP2-Type Containing 1), also known as TRABID, a DUB belonging to the OTU family. The human ZRANB1 protein comprises three N-terminal Npl4-like zinc finger (NZF) domains and one C-terminal OTU domain[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. While ZRANB1 has been implicated in the regulation of ferroptotic resistance and stem-cell-like features in other malignancies, such as non-small cell lung cancer and colorectal cancer, its function in UBC has not been characterized[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Through a comprehensive screening of ubiquitination-related genes in multiple transcriptomic datasets, we identified ZRANB1 as a key factor in UBC tissues. Herein, we report that ZRANB1 promotes UBC tumourigenesis by stabilizing the splicing factor SF3B3 via deubiquitination. Furthermore, we demonstrate that the ZRANB1-SF3B3 axis modulates the alternative splicing (AS) of the cell cycle checkpoint kinase CHEK2, specifically inhibiting the production of the tumour-suppressive CHEK2-e4- isoform. These findings uncover a novel post-translational mechanism linking the UPS to RNA splicing machinery in UBC.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eData screening\u003c/h2\u003e \u003cp\u003eFour datasets and one defined gene subset were applied in the study, including GSE190079 (bladder cancer tumour tissues vs adjacent non-tumour tissues control, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01, log\u003csub\u003e2\u003c/sub\u003e|FC| \u0026gt; 0.3), GSE231383 (SV-HUC-1 vs T24, UM-UC-3, J82 and 5637, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, log\u003csub\u003e2\u003c/sub\u003e|FC| \u0026gt; 0.5), GSE236932 (bladder carcinoma tissues vs normal tissues, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01, log\u003csub\u003e2\u003c/sub\u003e|FC| \u0026gt; 0.4), Gepia (TCGA\u0026thinsp;+\u0026thinsp;GTEx, tumour tissues vs normal tissues, FDR\u0026thinsp;\u0026lt;\u0026thinsp;0.05, log\u003csub\u003e2\u003c/sub\u003e|FC| \u0026gt; 1) and a collection of ubiquitination-related genes (2 E1, 32 E2, 616 E3, and 91 DUB) as we described[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003ePatients and samples\u003c/h3\u003e\n\u003cp\u003eTo compare the ZRANB1 expression, tumour tissues and adjacent normal tissues of 12 UBC patients were obtained for Western blot analysis, and 15 tumour tissues with paired normal tissues were obtained for IHC staining. For survival analysis, a cohort of 110 UBC patients were included. All patients underwent surgery at Sun Yat-sen Memorial Hospital, Sun Yat-sen University whose informed consent was achieved. The pathological diagnosis of all patients was confirmed by two independent pathologists, and the clinicopathological characteristics and ZRANB1 group of the patients are summarized in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eCorrelation of ZRANB1 expression evaluated via IHC staining and UBC clinical parameters.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCharacteristics\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eZRANB1 expression\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNo. (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLow (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHigh (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e-value\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAge\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.274\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e75\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSex\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e57\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.736\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eT stage\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.009\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTa-T1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e47\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eT2-T4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e63\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e33\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLN status\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.008\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLN-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e95\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLN+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGrade\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.018\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLow\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHigh\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e92\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e49\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e110\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003eChi-square test.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003e\u003csup\u003e*\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003e\u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e\n\u003ch3\u003eWestern blot analysis\u003c/h3\u003e\n\u003cp\u003eWestern blot analysis was conducted as previously described[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. The primary antibodies used included anti-ZRANB1 (YT6929, Immunoway, USA), anti-GAPDH (AC001, Abclonal, China), anti-flag (#14793, CST, USA), anti-SF3B3 (YT4262, Immunoway, USA) and anti-ubiquitin (YM3636, ImmunoWay, USA). HRP-conjugated secondary antibodies (Goat Anti-Rabbit IgG, CWBIO, China) were applied as secondary antibody.\u003c/p\u003e\n\u003ch3\u003eImmunohistochemistry (IHC) and hematoxylin-eosin (HE) staining\u003c/h3\u003e\n\u003cp\u003eTissue sections were formalin-fixed, paraffin-embedded and dissected. For IHC staining, sections were rehydrated and subjected to antigen retrieval with EDTA. Then tissue sections were incubated with anti-ZRANB1 (PAB22260, Abnova, China), anti-SF3B3 (14577-1-AP, Proteintech, China) or anti-Ki-67 (27309-1-AP, Proteintech, China) at 4℃ overnight. Next day, the sections were incubated with horseradish peroxidase-conjugated secondary antibodies and stained with diaminobenzidine (DAB) and hematoxylin. The \u003cem\u003eH\u003c/em\u003e-score was calculated based on the intensity of staining and percentage of differently stained cells as previously described. For HE staining, sections were dewaxed and dehydrated. Then sections were treated with hematoxylin, differentiated with 1% acid alcohol, and blued with water. After subjected to eosin, sections were dehydrated and cleared.\u003c/p\u003e\n\u003ch3\u003eCCK-8, colony formation, Transwell migration and invasion assays\u003c/h3\u003e\n\u003cp\u003eCCK-8, colony formation, Transwell migration and invasion assays were conducted as we previously described[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e].\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eImmunoprecipitation (IP) and mass spectrometry\u003c/h2\u003e \u003cp\u003eCells were lysed with cell lysis buffer for WB and IP (APE \u0026times; BIO, USA) and then subjected to centrifugation. The supernatant was collected, 5% of which was taken as input. Magnetic beads were pre-coated with indicated antibodies or IgG and then were incubated with supernatant at 4℃ overnight. Next day, beads were collected and washed and the precipitation complex was diluted and subjected to following Western blot analysis or mass spectrometry. Mass spectrometry was performed by the Bioinformatics and Omics Center, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eNext-generation sequencing, RNA isolation, reverse transcription, real-time PCR (RT-PCR) and nucleic acid electrophoresis\u003c/h3\u003e\n\u003cp\u003eNext-generation sequencing was performed by NovelBio, China. Total RNA was exacted via EZ-press RNA Purification Kit (EZBioscience, USA) according to manufactory\u0026rsquo;s protocol. Reverse transcription was conducted using HiScript IV All-in-One Ultra RT SuperMix for qPCR (R433-01, Vazyme, China). Briefly, 1000 ng RNA and 5 \u0026micro;l 4 \u0026times; All-in-One Ultra qRT SuperMix were incubated in 50℃ for 5 min, followed by 85℃ for 5 sec. RT-PCR was performed with Hieff UNICON\u0026reg; Power qPCR SYBR Green Master Mix (YEASEN, China) on a QuantStudio Dx instrument (Applied Biosystem, USA). The relevant abundance was calculated based on the cycle threshold (CT) value. Products from RT-PCR were mixed with 6\u0026times; loading buffer (TaKaRa, Japan) and GelRed (Biotium, US). Electrophoresis was conducted with constant voltage in 1% agarose with TAE buffer and the bands were visualized by UV irradiation. Primers used in this study: CHEK2-forword TTGCTTTGATGAACCACTGCTG; CHEK2-reverse GAAAGCCAGCTTTACCTCTCCA.\u003c/p\u003e\n\u003ch3\u003eAnimal experiments\u003c/h3\u003e\n\u003cp\u003eAll the procedures for animal experiments in this study were approved by the Animal Ethical and Welfare Committee of the Sixth Affiliated Hospital of Sun Yat-sen University before experiment conduction. 4-week-old male BALB/c nude mice were purchased from GemPharmatech Co., Ltd and were randomly divided into NC and sh-ZRANB1 groups. For the subcutaneous xenograft model, 5\u0026times;10\u003csup\u003e6\u003c/sup\u003e T24 cells were subcutaneously injected into the left flank of each mouse. Tumour size was measured every five days and tumour volume was calculated as tumour length \u0026times; (tumour width)\u003csup\u003e2\u003c/sup\u003e/2. Mice were euthanized 30 days after the injection. The tumours were harvested, weighted and subjected to IHC and HE staining. For the LN metastasis model, 5\u0026times;10\u003csup\u003e6\u003c/sup\u003e T24 cells were suspended into 50 \u0026micro;l PBS and injected into right footpad of each mouse. The right popliteal LNs were collected 30 days after the injection and further subjected to weighting and HE staining.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eStatistical analysis was performed by SPSS 20.0 (IBM SPSS Statistics, USA). Data from three independent experiments were presented as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD) unless noted otherwise. Paired or un-paired Student\u0026rsquo;s \u003cem\u003et\u003c/em\u003e-test and Mann‒Whitney \u003cem\u003eU\u003c/em\u003e test were applied to compare the difference between two groups based on whether data conformed a normal distribution. Chi-square test and one-way analysis of variance (ANOVA) were applied to assess the effects of multiple variants. For Kaplan\u0026ndash;Meier survival analysis, the log-rank test was conducted. \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eHigh expression of DUB ZRANB1 is related to poor survival in UBC\u003c/h2\u003e \u003cp\u003eTo identify the key ubiquitination molecule in UBC, we defined a defined a subset of 741 ubiquitination-related genes, including 2 E1, 32 E2, 616 E3, and 91 DUB, as we described previously[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Then, we cross-compared the subset with Gepia and three GSE datasets (GSE190079, GSE231393, GSE236932). Finally, only ZRANB1 was screened out for the following study (Fig.\u0026nbsp;1A).\u003c/p\u003e \u003cp\u003eIn order to assess the clinical relevance of ZRANB1 expression in UBC patients, we detected the protein expression of ZRANB1 in 12 paired UBC tissues (T) and adjacent normal tissues (N) through Western blotting analysis and found that ZRANB1 had higher expression in most UBC tissues (Fig.\u0026nbsp;1B). Moreover, we assessed the abundance of ZRANB1 in 15 UBC specimen along with their paired normal adjacent tissues and 110 UBC specimen with survival information via IHC analysis (Fig.\u0026nbsp;1C). It was found that ZRANB1 had higher expression level in UBC tissues compared with adjacent normal sections (Fig.\u0026nbsp;1D), and higher ZRANB1 expression was associated with more advanced T stage, lymph node positivity, and higher pathological stage (Fig.\u0026nbsp;1E-G). Furthermore, higher abundance of ZRANB1 expression is related to worse overall survival of UBC patients (Fig.\u0026nbsp;1H).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eZRANB1 influences the proliferation and invasion of UBC in vitro\u003c/h2\u003e \u003cp\u003eTo test the biological role of ZRANB1 in UBC, we transfected siRNAs into T24 and UM-UC-3 cells specifically targeting ZRANB1. Silencing efficacy of siRNA was successfully validated through Western blotting analysis (Fig.\u0026nbsp;2A). Then, we evaluate the growth rate of UBC cells knocking down of ZRANB1. CCK-8 assays showed that silencing ZRANB1 significantly reduced the viability of T24 and UM-UC-3 cells (Fig.\u0026nbsp;2B). Cell colony formation assays demonstrated that knocking down of ZRANB1 down-regulated the colony formation abilities of UBC cells (Fig.\u0026nbsp;2C). We also performed the Transwell migration and invasion assays and found that ZRANB1 silencing inhibited the migration and invasion abilities of T24 and UM-UC-3 cells (Fig.\u0026nbsp;2D).\u003c/p\u003e \u003cp\u003eThen we cloned ZRANB1\u0026rsquo; open reading frame (ORF) plus 3x flag tag into pLvx-puro plasmid, and ZRANB1 over-expression cell lines were successfully conducted by lentivirus package, infection, and selection with puromycin. The abundance of ZRANB1 was evaluated via Western blotting analysis (Fig.\u0026nbsp;2E). Not surprisingly, elevated expression of ZRANB1 promoted the proliferation and colony formation capacities of UBC cells (Fig.\u0026nbsp;2F-G). Moreover, up-regulated expression of ZRANB1 facilitated the migration and invasion of T24 and UM-UC-3 cells (Fig.\u0026nbsp;2H). Overall, we revealed that ZRANB1 positively influenced the growth and migration of UBC cells in vitro.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eZRANB1 stabilizes SF3B3 through the ubiquitin\u0026ndash;proteasome pathway\u003c/h2\u003e \u003cp\u003eZRANB1 is previously recognized as a deubiquitinase that plays various functions in multiply physiological and pathological progress[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. We intended to clarify its specific mechanism in UBC. Firstly, we aimed to identify interactive molecules of ZRANB1. We failed to obtain satisfying anti-ZRANB1 antibodies in apply to co-IP assay, as a result, we exogenously expressed ZRNAB1-flag fusing protein in T24 and UM-UC-3 cells. Then we conducted IP followed with mass spectrometry using anti-flag antibodies and IgG. The profile of ZRANB1 interaction network was established, of which SF3B3 was selected for further investigation due to its high coverage and lack of relevant studies (Fig.\u0026nbsp;3A). In order to validate the binding between ZRANB1 and SF3B3, co-IP coupled with Western blotting analysis in UBC cells expressing ZRANB1-flag showed that anti-flag antibody, instead of IgG could enrich ZRANB1 and SF3B3 (Fig.\u0026nbsp;3B). We also conducted co-IP coupled with Western blotting analysis in wild type T24 and UM-UC-3 cells with anti-SF3B3 antibody, which validated our finding (Fig.\u0026nbsp;3C).\u003c/p\u003e \u003cp\u003eThen we intended to investigate the regulatory relationship between ZRANB1 and SF3B3. We silenced the expression of ZRANB1, and SF3B3 abundance was reduced (Fig.\u0026nbsp;3D). When ZRANB1 was over-expressed, the SF3B3 protein level was subsequently increased in UBC cells (Fig.\u0026nbsp;3E). Since ZRANB1 generally functioned as deubiquitinase to influence target protein post-transcriptionally, we applied CHX to halt transcription in T24 and UM-UC-3 cells and measured SF3B3 abundance at indicated time points. SF3B3 protein degraded slower when ZRANB1 was over expressed (Fig.\u0026nbsp;3F). To test whether the regulation was dependent of the ubiquitin‒proteasome pathway, we treated cells with proteasome inhibitor MG132. It was demonstrated that when MG132 existed, ZRANB1 silencing failed, at least partly, to lower SF3B3 expression, which suggested proteasome pathway was involved (Fig.\u0026nbsp;3G). Lastly, we measured the ubiquitination levels of SF3B3 in UBC cells over expressing ZRANB1, and supplemented ZRANB1 boosted the ubiquitination of SF3B3 (Fig.\u0026nbsp;3H). Overall, we demonstrated that ZRANB1 stabilized SF3B3 through ubiquitin\u0026ndash;proteasome pathway.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eSF3B3 promotes carcinogenesis in UBC\u003c/h2\u003e \u003cp\u003eThen we determined to understand the role of SF3B3 in UBC carcinogenesis. We transfected T24 and UM-UC-3 cells with siRNAs specifically targeting SF3B3, and the knock down efficiency was proved with Western blot analysis (Fig.\u0026nbsp;4A). CCK-8 assays and colony formation assays demonstrated that decreased expression of SF3B3 suppressed the viabilities and colony formation abilities of UBC cells (Fig.\u0026nbsp;4B-C). In accordance with the effect of ZRANB1 silencing, down regulated SF3B3 negatively influenced the migration and invasion of T24 and UM-UC-3 cells in vitro (Fig.\u0026nbsp;4D). Collectively, SF3B3 played an inhibition role in UBC carcinogenesis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eOverexpression of SF3B3 abrogates tumour inhibition of ZRANB1 silencing in UBC cells\u003c/h2\u003e \u003cp\u003eBased on the date above, we had plenty evidence to assume that ZRANB1 exerted its function through SF3B3. To testify our hypothesis, we exogenously expressed SF3B3 in ZRANB1-NC and ZRANB1-silencing UBC cells. It was revealed that simply elevation of SF3B3 abundance in ZRANB1-NC cells boosted the proliferation, colony formation, migration and invasion abilities. However, when SF3B3 was supplemented in the UBC cells knocking down of ZRANB1, the inhibition effect of silencing ZRANB1 on proliferation and invasion was abolished, which suggested the anti-tumoural effect of ZRANB1 inhibition was achieved through downregulation of SF3B3 (Fig.\u0026nbsp;5A-C).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eSF3B3 is involved in the AS of CHEK2\u003c/h2\u003e \u003cp\u003eMany previous studies reported that SF3B3 could regulate the AS of various transcripts, which naturally led us to investigate the impact of SF3B3 on AS in UBC[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. We performed next-generation sequencing of T24 and UM-UC-3 cell transfected with siRNAs targeting NC or SF3B3. The AS events were classified into five categories, including alternative 3\u0026rsquo; splice-site (A3SS), alternative 5\u0026rsquo; splice-site (A5SS), mutually exclusive exons (MXE), retained intron (RI) and skipping exon (SE) (Fig.\u0026nbsp;6A). As for both total events and significant events, SE was the most common events recognized (Fig.\u0026nbsp;6B-C). Moreover, more SE events were observed in NC cells than SF3B3 knockdown cells, suggesting SF3B3 functioned as SE effector in most occasions (Fig.\u0026nbsp;6D-G). We selected five most statistically significant SE events, including exon 28 skipping in DNAH14, exon 6 skipping in LIAS, exon 3 skipping in CCDC163, exon 2 skipping in PHF5A, and exon 4 skipping in CHEK2. We designed and synthesized pairs of primers targeting the upstream and downstream of skipping exons and PCR was applied with cDNA from UBC cells treated with or without siRNAs silencing SF3B3. The PCR products were further conducted to nucleic acid electrophoresis, and it was observed that after knocking down of SF3B3, the shorter product (namely CHEK2-e4-) increased while longer product (namely CHEK2-WT) decreased, which indicated that SF3B3 was essential inhibitor of the exon 4 skipping in CHEK2 transcription (Fig.\u0026nbsp;6H).\u003c/p\u003e \u003cp\u003eCHEK2 was generally regarded as tumour suppressor whose variants shared strong connection with cancer risk[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Therefore, we intended to elucidate the functional role of CHEK2-WT and CHEK2-e4- in UBC cells. Exogenously expression of CHEK2-WT slightly elevated the cell viability, colony formation, migration and invasion of both T24 and UM-UC-3 cells, while supplemented CHEK2-e4- robustly suppressed the proliferation and motivation of UBC cells (Fig.\u0026nbsp;6I-K). Collectively, SF3B3 was essential for the maintenance of full-length CHEK2 transcription, inhibiting the AS of exon 4 to exert anti-tumour effect.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eZRABN1 silencing inhibitor proliferation and lymph node metastasis of UBC cells in vivo\u003c/h2\u003e \u003cp\u003eTo validate ZRNAB1-SF3B3 axis in vivo, we constructed T24 cells stably knocking down of ZRANB1 via shRNAs. Cells with or without ZRANB1 knocking down were subcutaneously injected into left flanks of BALB/c nude mice, separately, and tumour volume was measured every 5 days. The volume and weight of tumour in ZRANB1 silencing group were significantly reduced compared with control group (Fig.\u0026nbsp;7A-C). We also performed IHC staining on tumour on both groups. Not surprisingly, ZRNAB1 expression, SF3B3 expression, and rate of Ki-67 positivity was lower in ZRANB1 silencing group than NC group (Fig.\u0026nbsp;7D).\u003c/p\u003e \u003cp\u003eFor the LN metastasis model, equal amount of NC or ZRANB1-silencing T24 cells were injected into footpads of nude mice, and the popliteal LNs were harvested 30 days later (Fig.\u0026nbsp;7E). Size and volume of popliteal LNs in ZRANB1 silencing group was smaller than NC group (Fig.\u0026nbsp;7F-G). Moreover, when LNs were paraffin-embedded and further applied to HE staining, it was revealed that invasiveness to LN was more severe in NC group than ZRANB1 knockdown group (Fig.\u0026nbsp;7H). In conclusion, ZRANB1 inhibited the proliferation and LN metastasis of UBC in vivo.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003ePrevious studies have identified the deubiquitinase ZRANB1 as a novel oncogenic driver in various malignancies, whose overexpression is correlated with poorer survival. For instance, ZRANB1 is highly expressed in hepatocellular carcinoma (HCC) tissues and ZRANB1 drives HCC progression by deubiquitinating and stabilizing SP1[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. It was also reported that ZRANB1 promoted autophagy and suppressed anti-tumour immunity via protecting cGAS from autophagic degradation[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. ZRANB1 is generally regarded specifically to hydrolyze both Lys29- and Lys33-linked di-ubiquitin, while intriguingly, Shan Huang, et al. reported that ZRANB1 maintained an E3 ligase activity, which was related to its C-terminal OTU domain[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. In the present study, we clarified the oncogenic role of ZRANB1 in UBC. Our analysis of multiple cohorts (GSE and TCGA) and clinical validation revealed that ZRANB1 is significantly upregulated in UBC tissues compared to adjacent normal tissues, and high ZRANB1 expression correlates with advanced pathological stages, lymph node metastasis, and poor overall survival, which emphasized its clinical value as a potential therapeutic target in UBC.\u003c/p\u003e \u003cp\u003eA major novelty of our work lies in the identification of the ZRANB1-SF3B3 axis, linking protein stability to AS regulation. AS is defined as the different combination of intron-removal and exon-connection during the production of mature RNA from pre-RNA, which is a pivotal post-transcriptional process to expand proteomic diversity[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. More than 95% of human genes harbor AS events and it is estimated that each protein-coding gene contains 11 exons and produces 5.4 mRNA transcripts on average[\u003cspan additionalcitationids=\"CR35\" citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. RNA splicing relies on spliceosome, a large macromolecular complex comprising both RNA and protein to recognize the junction of introns and exons. Certain \u003cem\u003etrans\u003c/em\u003e-acting factors and \u003cem\u003ecis\u003c/em\u003e-acting elements are also involved[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. The main AS patterns can be were divided into five types, of which SE events represent the most prevalent occurrence in higher eukaryotes[\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. The abnormal AS activities are generally accompanied by the occurrence and development of tumours, including various solid tumours as well as hematological malignancies[\u003cspan additionalcitationids=\"CR40 CR41 CR42\" citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Tumour cells could hijack AS to produce isoforms that favor tumourigenesis, metastasis, anti-apoptosis, chemoresistance, and radioresistance[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan additionalcitationids=\"CR45\" citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. These transcripts can also serve as diagnosis biomarkers and therapeutic targets. One famous example is that prostate cancer cells utilize AS to escape broadly applied androgen deprivation therapy (ADT). It is widely accepted that prostate cancer is androgen-dependent and antiandrogens such as enzalutamide which antagonizes the interaction of androgens with androgen receptor (AR), and abiraterone, the inhibitor of androgen biosynthesis, represent the mainstay for locally advanced or metastasis disease[\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. AR-V7 is a truncated isoform of AR, and it is revealed to be associated with resistance to ADT and increased risk of biochemical recurrence after prostatectomy[\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. Compared with wild-type AR, AR-V7 lacks the ligand-binding domain, and this confirmatory change allows persistent AR activation and survival signaling in tumour cells despite absence of a ligand[\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. Regulation of abnormal AS can be achieved through either interfering the spliceosome components/regulators to modulate splicing efficiency or directly abolish specific isoforms[\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. SF3B1, component of U2 small nuclear ribonucleoprotein (snRNP) has become a research hit. The prototypic compounds include spliceostatin A, meayamycin B, sudemycins, E7107 and H3B-8800, which mainly affect the assemble of spliceosome and further impact the AS patterns of a subset of genes[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. However, few compounds targeting specific transcript have been utilized in clinic to date. Risdiplam promotes exon 7 inclusion in SMN2 pre-mRNA and has been approved by FDA for the treatment of spinal muscular atrophy[\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. Splice-switching antisense oligonucleotides (ASOs) are chemically synthesized short RNA oligos which bind with target pre-mRNA in a reverse complimentary way to alter AS mode[\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. We found that ZRANB1 physically interacts with and deubiquitinates SF3B3, protecting it from proteasomal degradation. This expands the understanding of how the spliceosome is regulated upstream, suggesting that targeting DUBs like ZRANB1 could be a strategic approach to destabilize the splicing machinery in cancer cells without directly targeting the transcript isoform or spliceosome itself.\u003c/p\u003e \u003cp\u003eSF3B3, a member of the SF3B complex within the U2 small nuclear ribonucleoprotein (snRNP) complex, plays a crucial role in recognizing the branch point sequence of pre-mRNA and protecting genome stability by facilitating DNA repair[\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e, \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. Consistent with our results, overexpression of SF3B3 has been associated with tumourigenesis in colorectal cancer, gastric cancer, hepatocellular carcinoma, estrogen receptor-positive breast cancer and renal cancer[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e, \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]. SF3B3 is involved in the AS of EZH2 pre-mRNA in clear cell renal carcinoma and hepatocellular carcinoma while in colorectal cancer, SF3B3 regulates mTOR exon 8 skipping, leading to lipogenesis via FASN signaling[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]. In our study, SF3B3 knockdown phenocopied the effects of ZRANB1 silencing, suppressing UBC cell viability and invasiveness. Importantly, overexpression of SF3B3 rescued the anti-tumour effects induced by ZRANB1 depletion, confirming that SF3B3 is a primary downstream effector of ZRANB1. By using next-generation sequencing, we further elucidated that SF3B3 predominantly modulates exon skipping events in UBC, identifying the cell cycle checkpoint kinase CHEK2 as a critical splicing target.\u003c/p\u003e \u003cp\u003eOur mechanistic investigation revealed that SF3B3 is essential for maintaining the expression of full-length CHEK2 while suppressing the exon 4 skipped isoform. CHEK2 is a well-established tumour suppressor which is phosphorylated and activated by ataxia telangiectasia mutated (ATM) during homologous recombination. Its downstream effectors include CDC25C, p53, BRCA1/2 and cyclin D, which further influence DNA repair, cell cycle arrest, apoptosis, senescence, autophagy and aging. The translation product of the most dominant splicing variant consists of three conserved domains, including a serine\u0026ndash;glutamine or threonine\u0026ndash;glutamine cluster domain (SCD) at the N-terminal, a forkhead-associated (FHA) domain, and a kinase domain (KD) at the C-terminal. The most expressed transcription variant 1 (NM_007194/ENST00000404276.6) consists of 15 exons and exon 4 lies within the FHA domain. Germline mutations in the CHEK2 gene, represented by c.1100delC and p.I157T, and their association with various cancers have been extensively studied. A germline mutation of CHEK2 was more commonly seen in UBC cases than in the controls, yet no impact of CHEK2 mutations on overall survival was observed. Loss of IHC expression of CHEK2 in pT1 UBC was reported to associate with muscle-invasive progression and worse progression-free survival[\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. However, relevant studies on AS of CHEK2 in UBC are lacking. Interestingly, our experiments demonstrated that the CHEK2-e4- isoform exerts a potent suppressive effect on UBC proliferation and motility, whereas the full-length protein appears permissive for tumour growth in this context. This suggests that the ZRANB1-SF3B3 axis promotes tumourigenesis by \"correcting\" splicing to prevent the generation of the anti-tumour CHEK2-e4- isoform. These findings parallel reports where cancer cells manipulate splicing factors to shift the balance from pro-apoptotic to anti-apoptotic isoforms, yet the specific molecular mechanisms and the potential clinical relevance require more investigation.\u003c/p\u003e \u003cp\u003eIn conclusion, our study delineates a novel regulatory signaling axis in UBC: ZRANB1 stabilizes SF3B3 via deubiquitination, which further inhibits the exon 4 skipping of CHEK2, thereby preventing the expression of a tumour-suppressive isoform. This pathway drives unrestrained proliferation and metastasis in UBC. These results not only provide new insights into the crosstalk between the UPS and RNA processing but also highlight ZRANB1 as a promising prognostic biomarker and a potential therapeutic target for UBC treatment. Future studies should explore the development of specific small-molecule inhibitors against ZRANB1 to disrupt this oncogenic axis.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eCOMPETING INTERESTS\u003c/h2\u003e \u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eETHICS APPROVAL AND CONSENT TO PARTICIPATE\u003c/strong\u003e \u003cp\u003eAll procedures involving human were approved by the Ethics Committees of Sun Yat-sen Memorial Hospital, Sun Yat-sen University (approval no. SYSKY-2023-076-01). Informed consent was obtained from each patient. The procedures for the animal experiments were evaluated and approved by the Animal Ethical and Welfare Committee of the Sixth Affiliated Hospital of Sun Yat-sen University (approval no. SYSU-IACUC-2025-060801) in compliance with the Guide for the Care and Use of Laboratory Animals.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eAUTHOR CONTRIBUTIONS\u003c/h2\u003e \u003cp\u003eHQ, DW, and JQ conceived and designed the study. DY and WZ performed most experiments. YT analyzed the data. LH provided support for the mass spectrometry. YZ assisted with animal experiments. WZ helped with data analysis. DY, WZ and HQ drafted and edited the paper, with all authors providing feedback. The order of the authors was assigned on the basis of their relative contributions to the study.\u003c/p\u003e\u003ch2\u003eACKNOWLEDGEMENTS\u003c/h2\u003e \u003cp\u003eThis work was supported by the National Natural Science Foundation of China(82203673) and Natural Science Foundation of Guangdong Province(2024A1515013180).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eSung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin. 2021;71(3):209\u0026ndash;49.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi H, Zeng S, Yang C, Yang Y, Cao Z, Hu Z, et al. Global, regional, and national burden and trends of bladder cancer in individuals aged 55 years and older from 1990 to 2021: findings from the Global Burden of Disease Study 2021. Int J Surg. 2025;111(12):8916\u0026ndash;33.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWong MCS, Fung FDH, Leung C, Cheung WWL, Goggins WB, Ng CF. The global epidemiology of bladder cancer: a joinpoint regression analysis of its incidence and mortality trends and projection. Sci Rep. 2018;8(1):1129.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGrabe-Heyne K, Henne C, Mariappan P, Geiges G, Pohlmann J, Pollock RF. Intermediate and high-risk non-muscle-invasive bladder cancer: an overview of epidemiology, burden, and unmet needs. Front Oncol. 2023;13:1170124.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSafiri S, Kolahi AA, Naghavi M, Global Burden of Disease Bladder Cancer C. Global, regional and national burden of bladder cancer and its attributable risk factors in 204 countries and territories, 1990\u0026ndash;2019: a systematic analysis for the Global Burden of Disease study 2019. BMJ Glob Health. 2021;6(11).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTeoh JY, Huang J, Ko WY, Lok V, Choi P, Ng CF, et al. Global Trends of Bladder Cancer Incidence and Mortality, and Their Associations with Tobacco Use and Gross Domestic Product Per Capita. Eur Urol. 2020;78(6):893\u0026ndash;906.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBotteman MF, Pashos CL, Redaelli A, Laskin B, Hauser R. The health economics of bladder cancer: a comprehensive review of the published literature. Pharmacoeconomics. 2003;21(18):1315\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKnowles MA, Hurst CD. Molecular biology of bladder cancer: new insights into pathogenesis and clinical diversity. Nat Rev Cancer. 2015;15(1):25\u0026ndash;41.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlfred Witjes J, Max Bruins H, Carrion A, Cathomas R, Comperat E, Efstathiou JA, et al. European Association of Urology Guidelines on Muscle-invasive and Metastatic Bladder Cancer: Summary of the 2023 Guidelines. Eur Urol. 2024;85(1):17\u0026ndash;31.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHershko A, Ciechanover A. The ubiquitin system. Annu Rev Biochem. 1998;67:425\u0026ndash;79.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShaid S, Brandts CH, Serve H, Dikic I. Ubiquitination and selective autophagy. Cell Death Differ. 2013;20(1):21\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGao L, Zhang W, Shi XH, Chang X, Han Y, Liu C, et al. The mechanism of linear ubiquitination in regulating cell death and correlative diseases. Cell Death Dis. 2023;14(10):659.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMevissen TET, Komander D. Mechanisms of Deubiquitinase Specificity and Regulation. Annu Rev Biochem. 2017;86:159\u0026ndash;92.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHan S, Wang R, Zhang Y, Li X, Gan Y, Gao F, et al. The role of ubiquitination and deubiquitination in tumor invasion and metastasis. Int J Biol Sci. 2022;18(6):2292\u0026ndash;303.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGroll M, Huber R. Substrate access and processing by the 20S proteasome core particle. Int J Biochem Cell Biol. 2003;35(5):606\u0026ndash;16.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKlionsky DJ. Autophagy: from phenomenology to molecular understanding in less than a decade. Nat Rev Mol Cell Biol. 2007;8(11):931\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchwartz AL, Ciechanover A. Targeting proteins for destruction by the ubiquitin system: implications for human pathobiology. Annu Rev Pharmacol Toxicol. 2009;49:73\u0026ndash;96.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHan D, Wang L, Jiang S, Yang Q. The ubiquitin-proteasome system in breast cancer. Trends Mol Med. 2023;29(8):599\u0026ndash;621.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDewson G, Eichhorn PJA, Komander D. Deubiquitinases in cancer. Nat Rev Cancer. 2023;23(12):842\u0026ndash;62.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang X, Dixit VM. Drugging the undruggables: exploring the ubiquitin system for drug development. Cell Res. 2016;26(4):484\u0026ndash;98.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLicchesi JD, Mieszczanek J, Mevissen TE, Rutherford TJ, Akutsu M, Virdee S, et al. An ankyrin-repeat ubiquitin-binding domain determines TRABID's specificity for atypical ubiquitin chains. Nat Struct Mol Biol. 2011;19(1):62\u0026ndash;71.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMiao D, Wang Y, Jia Y, Tong J, Jiang S, Liu L. ZRANB1 enhances stem-cell-like features and accelerates tumor progression by regulating Sox9-mediated USP22/Wnt/beta-catenin pathway in colorectal cancer. Cell Signal. 2022;90:110200.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYan R, Liu D, Guo H, Liu M, Lv D, Bjorkblom B, et al. LAPTM4B counteracts ferroptosis via suppressing the ubiquitin-proteasome degradation of SLC7A11 in non-small cell lung cancer. Cell Death Dis. 2024;15(6):436.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYan D, He Q, Pei L, Yang M, Huang L, Kong J, et al. The APC/C E3 ligase subunit ANAPC11 mediates FOXO3 protein degradation to promote cell proliferation and lymph node metastasis in urothelial bladder cancer. Cell Death Dis. 2023;14(8):516.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePei L, Yan D, He Q, Kong J, Yang M, Ruan H, et al. LncRNA MIR4435-2HG drives cancer progression by modulating cell cycle regulators and mTOR signaling in stroma-enriched subtypes of urothelial carcinoma of the bladder. Cell Oncol (Dordr). 2023;46(5):1509\u0026ndash;27.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHe Q, Huang L, Yan D, Bi J, Yang M, Huang J, et al. CircPTPRA acts as a tumor suppressor in bladder cancer by sponging miR-636 and upregulating KLF9. Aging (Albany NY). 2019;11(23):11314\u0026ndash;28.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang S, Zhang Q, Zhao M, Wang X, Zhang Y, Gan B, et al. The deubiquitinase ZRANB1 is an E3 ubiquitin ligase for SLC7A11 and regulates ferroptotic resistance. J Cell Biol. 2023;222(11).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Q, Chao Q, Liu Y, Fang J, Xie J, Zhen J, et al. Deubiquitinase ZRANB1 drives hepatocellular carcinoma progression through SP1-LOXL2 axis. Am J Cancer Res. 2021;11(10):4807\u0026ndash;25.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu T, Li X, Zhao W, Wang X, Jin L, Feng Z, et al. SF3B3-regulated mTOR alternative splicing promotes colorectal cancer progression and metastasis. J Exp Clin Cancer Res. 2024;43(1):126.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQiao Y, Shi Q, Yuan X, Ding J, Li X, Shen M, et al. RNA binding protein RALY activates the cholesterol synthesis pathway through an MTA1 splicing switch in hepatocellular carcinoma. Cancer Lett. 2022;538:215711.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStolarova L, Kleiblova P, Janatova M, Soukupova J, Zemankova P, Macurek L, et al. CHEK2 Germline Variants in Cancer Predisposition: Stalemate Rather than Checkmate. Cells. 2020;9(12).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen YH, Chen HH, Wang WJ, Chen HY, Huang WS, Kao CH, et al. TRABID inhibition activates cGAS/STING-mediated anti-tumor immunity through mitosis and autophagy dysregulation. Nat Commun. 2023;14(1):3050.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Y, Qian J, Gu C, Yang Y. Alternative splicing and cancer: a systematic review. Signal Transduct Target Ther. 2021;6(1):78.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNilsen TW, Graveley BR. Expansion of the eukaryotic proteome by alternative splicing. Nature. 2010;463(7280):457\u0026ndash;63.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBonnal SC, Lopez-Oreja I, Valcarcel J. Roles and mechanisms of alternative splicing in cancer - implications for care. Nat Rev Clin Oncol. 2020;17(8):457\u0026ndash;74.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePiovesan A, Caracausi M, Antonaros F, Pelleri MC, Vitale L. GeneBase 1.1: a tool to summarize data from NCBI gene datasets and its application to an update of human gene statistics. Database (Oxford). 2016;2016.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShenasa H, Movassat M, Forouzmand E, Hertel KJ. Allosteric regulation of U1 snRNP by splicing regulatory proteins controls spliceosomal assembly. RNA. 2020;26(10):1389\u0026ndash;99.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKeren H, Lev-Maor G, Ast G. Alternative splicing and evolution: diversification, exon definition and function. Nat Rev Genet. 2010;11(5):345\u0026ndash;55.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBabic I, Anderson ES, Tanaka K, Guo D, Masui K, Li B, et al. EGFR mutation-induced alternative splicing of Max contributes to growth of glycolytic tumors in brain cancer. Cell Metab. 2013;17(6):1000\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAnczukow O, Rosenberg AZ, Akerman M, Das S, Zhan L, Karni R, et al. The splicing factor SRSF1 regulates apoptosis and proliferation to promote mammary epithelial cell transformation. Nat Struct Mol Biol. 2012;19(2):220\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu F, Dai M, Xu Q, Zhu X, Zhou Y, Jiang S, et al. SRSF10-mediated IL1RAP alternative splicing regulates cervical cancer oncogenesis via mIL1RAP-NF-kappaB-CD47 axis. Oncogene. 2018;37(18):2394\u0026ndash;409.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSheng J, Zhao Q, Zhao J, Zhang W, Sun Y, Qin P, et al. SRSF1 modulates PTPMT1 alternative splicing to regulate lung cancer cell radioresistance. EBioMedicine. 2018;38:113\u0026ndash;26.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu J, Huang B, Xiao Y, Xiong HM, Li J, Feng DQ, et al. Aberrant expression of splicing factors in newly diagnosed acute myeloid leukemia. Onkologie. 2012;35(6):335\u0026ndash;40.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeng L, Liao L, Zhang YL, Yang SY, Hu SY, Andriani L, et al. SF3A2 promotes progression and cisplatin resistance in triple-negative breast cancer via alternative splicing of MKRN1. Sci Adv. 2024;10(14):eadj4009.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBian Z, Yang F, Xu P, Gao G, Yang C, Cao Y, et al. LINC01852 inhibits the tumorigenesis and chemoresistance in colorectal cancer by suppressing SRSF5-mediated alternative splicing of PKM. Mol Cancer. 2024;23(1):23.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHe H, Zhou Q, Zhang Y, Li Y, Ding L, Shen T, et al. PTBP1 Regulates DNMT3B Alternative Splicing by Interacting With RALY to Enhance the Radioresistance of Prostate Cancer. Adv Sci (Weinh). 2024;11(42):e2405997.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSciarrillo R, Wojtuszkiewicz A, Assaraf YG, Jansen G, Kaspers GJL, Giovannetti E, et al. The role of alternative splicing in cancer: From oncogenesis to drug resistance. Drug Resist Updat. 2020;53:100728.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMunkley J, Livermore K, Rajan P, Elliott DJ. RNA splicing and splicing regulator changes in prostate cancer pathology. Hum Genet. 2017;136(9):1143\u0026ndash;54.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePaschalis A, Sharp A, Welti JC, Neeb A, Raj GV, Luo J, et al. Alternative splicing in prostate cancer. Nat Rev Clin Oncol. 2018;15(11):663\u0026ndash;75.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBradley RK, Anczukow O. RNA splicing dysregulation and the hallmarks of cancer. Nat Rev Cancer. 2023;23(3):135\u0026ndash;55.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePaik J. Risdiplam: A Review in Spinal Muscular Atrophy. CNS Drugs. 2022;36(4):401\u0026ndash;10.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGolas MM, Sander B, Will CL, Luhrmann R, Stark H. Molecular architecture of the multiprotein splicing factor SF3b. Science. 2003;300(5621):980\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi H, Ding Z, Fang ZY, Long N, Ang HY, Zhang Y, et al. Conserved intronic secondary structures with concealed branch sites regulate alternative splicing of poison exons. Nucleic Acids Res. 2024;52(10):6002\u0026ndash;16.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGokmen-Polar Y, Neelamraju Y, Goswami CP, Gu X, Nallamothu G, Janga SC, et al. Expression levels of SF3B3 correlate with prognosis and endocrine resistance in estrogen receptor-positive breast cancer. Mod Pathol. 2015;28(5):677\u0026ndash;85.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen K, Xiao H, Zeng J, Yu G, Zhou H, Huang C, et al. Alternative Splicing of EZH2 pre-mRNA by SF3B3 Contributes to the Tumorigenic Potential of Renal Cancer. Clin Cancer Res. 2017;23(13):3428\u0026ndash;41.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSpachmann PJ, Azzolina V, Weber F, Evert M, Eckstein M, Denzinger S, et al. Loss of CHEK2 Predicts Progression in Stage pT1 Non-Muscle-Invasive Bladder Cancer (NMIBC). Pathol Oncol Res. 2020;26(3):1625\u0026ndash;32.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"cell-death-and-disease","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"cddis","sideBox":"Learn more about [Cell Death \u0026 Disease](http://www.nature.com/cddis/)","snPcode":"41419","submissionUrl":"https://mts-cddis.nature.com/cgi-bin/main.plex","title":"Cell Death \u0026 Disease","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-8816203/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8816203/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eUrothelial bladder cancer (UBC) poses a considerable threat to public health, and its clinical management is challenged by high recurrence rates and tendency to progression. While dysregulation of the ubiquitin-proteasome system (UPS) is a hallmark of tumourigenesis, the specific landscape of deubiquitinating enzymes (DUBs) in UBC remains largely underexplored. Multiple transcriptomic datasets were applied for a comprehensive screening of ubiquitination-related genes in UBC. And ZRANB1 was identified as a potential oncogenic DUB molecule, whose expression was validated using immunohistochemistry. High ZRANB1 expression was correlated with advanced pathological T stages, lymph node metastasis, and poor overall survival. The oncogenic role of ZRANB1 was assessed by proliferation, migration, and invasion assays in vitro, as well as subcutaneous xenograft and lymph node metastasis models in vivo. By conducting immunoprecipitation coupled with mass spectrometry, we revealed that ZRNAB1 acted as a DUB to prevent the UPS-dependent degradation of SF3B3. The ZRANB1-SF3B3 axis subsequently modulates the alternative splicing of the cell cycle checkpoint kinase CHEK2, specifically inhibiting the production of the exon 4-skipped isoform (CHEK2-e4-). We demonstrated that while full-length CHEK2 is permissive for growth, the CHEK2-e4- isoform exerts a potent tumour-suppressive effect. This study uncovers a novel post-translational mechanism linking the UPS to RNA splicing machinery in UBC. ZRANB1 promotes tumourigenesis by stabilizing SF3B3 to prevent the generation of the tumour-suppressive CHEK2-e4- isoform, suggesting ZRANB1 is a promising prognostic biomarker and therapeutic target.\u003c/p\u003e","manuscriptTitle":"ZRANB1 promotes cell proliferation and lymph node metastasis through SF3B3-mediated alternative splicing of CHEK2 in urothelial bladder cancer","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-02-25 11:42:40","doi":"10.21203/rs.3.rs-8816203/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"revise","date":"2026-03-09T09:55:37+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"This content is not available.","date":"2026-03-01T14:33:24+00:00","index":2,"fulltext":"This content is not available."},{"type":"editorInvitedReview","content":"This content is not available.","date":"2026-03-01T07:25:17+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2026-02-28T14:44:22+00:00","index":2,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2026-02-23T15:56:52+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewersInvited","content":"","date":"2026-02-23T10:14:10+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-02-09T17:06:04+00:00","index":"","fulltext":""},{"type":"submitted","content":"Cell Death \u0026 Disease","date":"2026-02-07T14:27:56+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-02-07T14:27:56+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"cell-death-and-disease","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"cddis","sideBox":"Learn more about [Cell Death \u0026 Disease](http://www.nature.com/cddis/)","snPcode":"41419","submissionUrl":"https://mts-cddis.nature.com/cgi-bin/main.plex","title":"Cell Death \u0026 Disease","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"eb6c8a3b-8538-41cc-abdf-853fcb66b392","owner":[],"postedDate":"February 25th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":63366894,"name":"Biological sciences/Cancer/Urological cancer/Bladder cancer"},{"id":63366895,"name":"Biological sciences/Molecular biology/Transcription/Transcriptional regulatory elements"}],"tags":[],"updatedAt":"2026-05-05T07:55:47+00:00","versionOfRecord":[],"versionCreatedAt":"2026-02-25 11:42:40","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8816203","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8816203","identity":"rs-8816203","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.