The role of acetylcholinesterase enzyme inhibitor rivastigmine on spike-wave discharges, learning-memory, anxiety, and TRPV1 channel expression in genetic absence epileptic WAG/Rij rats | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article The role of acetylcholinesterase enzyme inhibitor rivastigmine on spike-wave discharges, learning-memory, anxiety, and TRPV1 channel expression in genetic absence epileptic WAG/Rij rats Elif TÜRKDÖNMEZ AK, Büşra OKUYUCU, ARSLAN Gökhan, Erdal AĞAR, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4724554/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 03 Jan, 2025 Read the published version in Neurochemical Research → Version 1 posted 9 You are reading this latest preprint version Abstract In the present study, the effects of the acetylcholinesterase (AChE) enzyme inhibitor rivastigmine (RIVA) on spike-wave discharges (SWDs), memory impairment, anxiety-like behavior, and TRPV1 gene expression were investigated in genetic absence epileptic Wistar Albino Glaxo/Rijswijk (WAG/Rij) rats. After tripolar electrodes were implanted on the WAG/Rij rats' skulls, single doses of 0.125, 0.25, 0.5, 1, 2 mg/kg RIVA was intraperitoneally (i.p.) administered and electrocorticogram (ECoG) recordings of SWDs were obtained for three hours before and after injections. Additionally, WAG/Rij rats were administered low-dose (0.5 mg/kg) and high-dose (2 mg/kg) of RIVA for consecutive 21 days and SWDs were recorded. Learning-memory abilities (Y-maze test), anxiety-like behavior (elevated plus maze test), and TRPV1 gene expression were determined and compared in 8-month-old WAG/Rij and age-matched Wistar rats. Acute RIVA administration dose-dependently reduced the total number and mean duration of SWDs, even entirely inhibited at the doses of 1 and 2 mg/kg RIVA. Whereas long-term high-dose administration of RIVA increased the total number of SWDs, however, decreased the mean duration. Long-term high-dose RIVA treatment reduced learning-memory and anxiety-like behavior in WAG/Rij rats, while only anxiety-like behavior decreased in Wistar rats. According to the qPCR analysis, long-term RIVA administration reduced the TRPV1 gene expression in WAG/Rij rats, in fact, TRPV1 increased in Wistar rats. These data indicate that single-dose RIVA administration dose-dependently decreases absence seizures, however, long-term administration of RIVA increases absence seizures probably by altering channel expressions such as TRPV1. Epilepsy Absence seizures WAG/Rij Spike-wave discharges Acetylcholinesterase inhibitor Rivastigmine Learning-memory Anxiety TRPV1 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Introduction Non-convulsive absence seizures are characterized by consciousness with the appearance of simultaneous bilateral SWDs on the electroencephalogram with consequent comorbidities such as memory problems and anxiety [ 1 ]. Although the exact mechanism of absence epilepsy is not fully understood, oscillatory burst-firing originating from the thalamocortical circuit is thought to be responsible for the generation of SWDs [ 2 , 3 ]. In thalamus, cells of the reticular thalamus generate strong inhibitory post synaptic potentials onto TC cells which contain high levels of T-type calcium channels. This severe inhibition induces strong postinhibitory rebound bursts which in turn reactivate both reticular thalamus and cortex [ 3 , 4 ]. This phenomenon is called “rebound burst firing” which is seen during normal sleep [ 5 ] or absence epilepsy [ 6 ]. Electrophysiological, pharmacological, and behavioral characteristics of absence seizures in WAG/Rij rats, the most used strain in the studies of absence epilepsy [ 7 ], are similar to those seen in human patients [ 8 ]. Spike-wave discharges become apparent on cortical EEG at 2 to 3 months of age and at 6 months of age, both male and female rats generate approximately 16–20 discharges per hour, and the mean duration of these discharges is around 5 seconds [ 8 ]. Also, WAG/Rij rats exhibit behavioral changes associated with neuropsychiatric comorbidities such as learning-memory impairment [ 9 ], anxiety [ 10 ], and depression-like behavior [ 9 ]. Acetylcholine (ACh), one of the most ubiquitous neurotransmitters in the mammalian brain [ 11 ], has a significant role in the occurrence, propagation, and control of epileptic seizures [ 12 ]. Studies revealed that acetylcholine has a dual role on seizures. While the systemic administration of cholinergic agonists carbachol or pilocarpine induces epileptic seizure [ 13 ], the selective activation of cholinergic neurons could produce obvious anti-seizure effects [ 12 ]. The reason for these different effects may depend on the site of ACh release, receptor subtype, and target neuronal population or neural circuit [ 14 ]. Therefore, understanding the potential role of the cholinergic system is important in elucidating deeper mechanisms in epilepsy. Cholinesterase inhibitor drug RIVA are commonly used as a symptom-therapeutic option for dementia in Alzheimer’s and Parkinson’s diseases [ 15 ]. Anticholinesterases play a significant role on epileptic seizures. Evidence from case reports suggests that acetylcholinesterase inhibitors donepezil [ 16 ] or tacrine [ 17 ] can provoke seizures, while some animal studies demonstrated that acetylcholinesterase inhibitors have anti-seizure effects [ 18 , 19 ]. In the rat study of Joeng et al., while long-term administration of donepezil after pilocarpine-induced seizure activity reduced neuronal death, pretreatment of donepezil even aggravated hippocampal damage. As aforementioned above, anticholinesterase drugs contain conflicting results on epileptic seizures just like acetylcholine. Furthermore, only one study showed the effect of acetylcholinesterase inhibitors on the absence epileptic seizures. Acute injections of the acetylcholinesterase inhibitor physostigmine caused a dose-dependent reduction in the duration of SWDs [ 20 ]. However, no study has investigated the effect of long-term administration of AChE inhibitors on absence seizures so far. TRPV1 is a non-selective calcium-permeable cation channel that is associated with a wide range of biological and pathophysiological functions on neurological diseases such as anxiety, fear, stress, and pain [ 21 ]. In addition, TRPV1 channels are involved in the pathogenesis of epileptic seizures [ 22 ]. The expression of TRPV1 channels mostly increased after generalized tonic-clonic seizures [ 23 , 24 ]. Regarding absence seizures, only one study reported increased TRPV1 expression in the hippocampus and cortex of 4-month-old WAG/Rij rats compared to 2-month-old WAG/Rij rats [ 25 ]. On the other hand, several evidence suggests a possible interaction between the acetylcholine pathway and TRPV1 channels [ 26 , 27 ]. The aim of the present study is to investigate: 1. The effect of single-dose RIVA administrations on the SWD parameters of WAG/Rij rats, 2. The impact of long-term RIVA administrations on the SWD parameters of WAG/Rij rats, 3. The role of long-term RIVA administration on learning-memory and anxiety behaviors in WAG/Rij and age-matched Wistar rats, 4. The effect of long-term RIVA administration on cortical and hippocampal TRPV1 channel expression in WAG/Rij and age-matched Wistar rats. 2. Materials and methods 2.1. Animals and groups After obtaining permission from Ondokuz Mayıs University Animal Experiments Local Ethics Committee (2022/08), male 8-month-old WAG/Rij (n = 60) and age-matched Wistar (n = 12) rats were purchased from Ondokuz Mayıs University Experimental Animal Research Center (OMÜ DEHAM). The rats were kept in separate cages under a temperature (22 ± 1°C) and humidity (60–65%) control unit, on a 12-hour dark-light cycle with free access to standard rat chow and water. All experiments were performed by ARRIVE guidelines and the Guide for the Care and Use of Laboratory Animals (NIH Publication No. 8023, revised 1978) by the US National Institutes of Health. The rats were divided into 12 groups (six animals each). The workflow of the study is shown in Fig. 1 . First, the effect of saline (Saline I) or single-dose (0.125, 0.25, 0.5, 1, 2 mg/kg) of RIVA on SWD parameters was evaluated electrophysiologically in 8-month-old WAG/Rij rats (Fig. 1 A). Then, low-dose (0.5 mg/kg) and high-dose (2 mg/kg) of RIVA was administered for consecutive 21 days to the 8-month-old WAG/Rij rats and ECoG recordings were obtained before and after 1st injection and one day after the 10th and 21st injections (Fig. 1 B). Eventually, in 8-month-old WAG/Rij and age-matched Wistar rats, the effect of long-term saline (Saline II for WAG/Rij and Saline III for Wistar) or high-dose RIVA (2 mg/kg) on learning-memory abilities and anxiety-like behavior were observed one day after the last injections, and subsequently, the right hippocampus and right somatosensory cortex were removed under sterile conditions for TRPV1 channel expressions (Fig. 1 C). For all experimental groups, rats which developed infection despite antibiotics, whose electrode was removed, or whose seizures could not be detected during baseline recordings were excluded from the study (n = 7). The removed animals were replaced with animals of the same age and strain which were kept under the same conditions. 2.2. Placement of electrodes The animals were starved one day before the operation and anesthetized with ketamine/xylazine (90/10 mg/kg). After anesthesia, the head hair was shaved for a clean surgical field then the rats were fixed using a stereotaxic apparatus. Anesthesia of the rats was assessed every 5 minutes through pain responses and ketamine maintenance was performed when necessary. In the first stage, the scalp was opened with an average 3 cm long incision in the rostrocaudal direction. After cleaning the soft tissue on the bone, stainless steel conductive screws were placed at the appropriate coordinates according to Paxinos and Watson's rat brain atlas [ 28 ]: first electrode, 4 mm anterior and 3 mm right lateral to bregma (frontal cortex); second electrode, 4 mm posterior and 3 mm right lateral to bregma (occipital cortex); and reference electrode, 4 mm posterior and 3 mm left lateral to bregma (occipital cortex) [ 29 ]. A tripolar small jack electrode was connected to the screws with 3 pieces of copper wires, then the electrode and screws were fixed with dental acrylic (Fig. 1 A). After this procedure, which lasted for about 45 minutes, buprenorphine hydrochloride (0.1 mg/kg) was given intramuscularly for analgesia. Ampicillin (50 mg/kg) was injected intraperitoneally once a day for 3 days to prevent infection. 2.3. Electrocorticography (ECoG) recordings and drugs After a 7-day healing period, rats were placed in cube-shaped glass cages (40x40x40 cm) where they could freely move. The rats were kept in cages for 2 hours for 3 days to get used to the laboratory environment. After the habituation period, rats were connected to the PowerLab recording system (PowerLab, 16/SP, AD Instruments, Australia) for 6 hours before and after injections (3 + 3 hours) to determine the acute effect of RIVA (Fig. 1 A). To determine the long-term impact of RIVA (0.5 and 2 mg/kg), ECoG recordings were first obtained for 6 hours (before and after RIVA injections), followed by three-hour of ECoG recordings taken from 24 hours after the 10th and 21st injections (Fig. 1 B). Clusters of spike waves that lasted at least one second and had amplitude at least 2 times greater than baseline activity were defined as SWD. The number and mean duration of SWDs were recorded and manually analyzed with the help of the LabChart-7 Pro software which filtered between 0.3 and 120 Hz [ 30 ]. RIVA was purchased from Sigma-Aldrich, dissolved in sterile physiological saline, and given in a constant volume of 1 mL. Since no animal studies have been performed with RIVA in epilepsy, appropriate doses were determined by reviewing the literature [ 31 ]. 2.4. Behavioral tests (Y-maze, elevated plus maze) 8-month-old WAG/Rij rats (n = 12) and 8-month-old Wistar rats (n = 12) were administered 2 mg/kg RIVA or saline for 21 days and 24 hours later they were subjected to behavioral tests. Each test was performed for 5 minutes between 10:00–14:00 under the camera recording with a chronometer. Before the tests, the interior walls and floor of the entire experimental setup were cleaned with 20% alcohol each time and the alcohol was allowed to dry so that no odor from the previous mouse remained. The Y-maze, a test for spatial memory, was performed to evaluate drug-associated learning and memory. The test was performed on absence epileptic 8-month-old WAG/Rij and healthy 8-month-old Wistar rats after 21 days of RIVA or saline administration (Fig. 1 C). Firstly, during the habituation test, arm C (novel arm) of the Y-maze apparatus was closed and rats were allowed to explore only two arms (arms A and B). Secondly, 24 hours later, during the experiment test, arm C was also opened, and the rats were allowed to move freely in three arms. The total number of arm entries, the number of A-B-C arm entries, the spent time in A-B-C arms, and number of spontaneous alternations were noted offline. The alternation index (percentage; %) was calculated by using the number of alternations and the total number of arm entries [ 32 ]. During the elevated plus maze, a test for measuring anxiety-like behavior, rats were placed in the center with their face facing the open arm. The time spent and number of rats in open and closed arms were obtained during the 5-minute experimental period and analyzed offline from camera recordings [ 33 ]. 2.5. Tissue replacement and qPCR protocol After behavioral tests, rats (three animals for each group) were anesthetized and perfused with tracer-free saline. After the perfusion process was completed, brains were removed and placed on a sterile cold surface. The right somatosensory cortex [(S1 barrel field; S1BF); coordinates: 1.7–3.1 mm posterior, 5.2–6.6 mm lateral to the bregma [ 28 ], and right hippocampus were placed into the sterile aliquoted eppendorfs and exposed to liquid nitrogen. The tissues were stored at -80 o C till the RNA isolation. Total RNA was extracted according to the TRIzol method (Invitrogen, USA). Firstly, 50-mg tissue samples were weighed with a precision scale. Then TRIzol (1 mL) was added to the mortar-pounded tissue and pounded again with a pestle until it reached a liquid form. Liquidized tissues were placed in a new eppendorf and incubated at room temperature for 5 minutes. The eppendorf was placed in a pre-cooled centrifuge that was set at + 4°C, 12000 G, and centrifuged for 10 minutes. Then 3 visible phases were observed and the uppermost supernatant RNA-containing portion was carefully transferred to a new eppendorf. After chloroform (0.2 mL) was added, the final sample was gently inverted 15 times and incubated at room temperature for 2–3 minutes. Each eppendorf was centrifuged at + 4°C, 12000 G, for 15 minutes. The clear phase was transferred to a new eppendorf and exposed to isopropanol (500 mL) and incubated at room temperature for 10 minutes. After incubation, the final sample was centrifuged at + 4°, 12000 G for 10 minutes, and the upper liquid was removed without touching the pellet. Cold alcohol (75%) was added to the remaining pellet and centrifuged at + 4°C, 7500 G for 5 minutes again. Then the liquid phase was removed and the alcohol was allowed to evaporate completely. After making sure that it was dry, it was dissolved with 20 µl DEPC-ddH 2 O and the purity of RNA was measured by NanoDrop spectrophotometer (Thermo Scientific™ ND2000USCAN) at 260/280 nm absorbance. According to the protocol of the iScript™ cDNA synthesis kit, isolated RNAs were converted to the circular deoxyribonucleic acid (cDNA) related to the purity, and thermal cycles were initiated by selecting the appropriate protocol in the PCR device according to the manufacturer's specifications. The cDNA samples were stored at -20°C up to qPCR analysis day. Primers that bind with high specificity to the target gene regions were tested for qPCR experiments. The target gene TRPV1 (for rats), as a target gene, and GAPDH (for rats), as a housekeeping gene (internal control), were used and the sequences for each target gene were listed in Table 1 . Finally, qPCR was performed by using SsoAdvanced™ Universal SYBR® Green Supermix (Bio-Rad, Hercules, CA) for amplification reactions. The effects of compounds on gene expression levels of TRPV1 were evaluated by the comparative ΔΔCt (delta-delta CT) method [ 34 ] to provide a relative quantification ratio according to calibrator that allows statistical comparisons of gene expression among samples. The comparative threshold (CT) method after determining the CT values for or reference (GAPDH) and target (TRPV1) genes in each sample set according to the 2 −ΔΔCt method. Changes in mRNA expression level were calculated after normalization to GAPDH. cDNA from control groups was used as a calibrator sample. Table 1 Target gene-specific primers used for the qPCR. Target gene (species) Primer sequence (5′–3′) TRPV1 (rattus norvegicus) F: CAAGGC ACTTGCTGGTCTTG R: GTTCCGTGAACGACCAGAAC GAPDH (rattus norvegicus) F: GCATCTTCTTGTGCAGTGCC R: ACCAGCTTCCCATTCTCAGC F: Forward, R: Reverse 2.6 Statistical analysis Electrophysiological, behavioral, and molecular data were compared using SPSS v21 (SPSS Inc., Chicago, IL). Shapiro-Wilk test was used to determine the normal distribution of the data. To compare the dose-dependent effect of RIVA, one-way ANOVA and post-hoc Tukey test were used for parametric data or Kruskal-Wallis and post-hoc Dunn test were used for non-parametric data. For determining the time-dependent effect of RIVA, two-way ANOVA followed by a post-hoc Tukey test was applied. Repeated measures of ANOVA and then the Tukey test were used for the long-term effect of RIVA. Independent sample t-test or Mann-Whitney U test was applied to compare behavioral tests or qPCR analysis. All values of the experimental groups used in graphs and text were expressed as mean ± standard error of mean except qPCR data (mean ± standard deviation). For all statistical tests, p < 0.05 was considered statistically significant. 3. Results 3.1. Effects of RIVA on SWDs parameters ECoG activities were recorded acutely and after the long-term RIVA administrations. No significant difference was found among the baseline ECoG activities of any groups (Supp. Table 1 ). Therefore, after injection data of the acute injection RIVA groups and Saline I group were compared. For the long-term administration groups, ECoG recordings 24 hours after the 10th and 21st injections were compared to the before- and after-injection data of the first day. 3.1.1. The effects of single-dose RIVA administration on SWDs parameters Saline injection did not alter the total number and the mean duration of SWDs compared to the baseline (t 5 = 3.099). During the baseline recording, the total number and the mean duration of SWDs were 99.50 ± 6.13 and 5.63 ± 0.30 sec, respectively. After the saline injection, the total number and mean duration of SWDs were 96.17 ± 6.17 and 5.50 ± 0.26 sec, respectively. RIVA at a dose of 0.125 mg/kg did not cause a change, while 0.25, 0.5, 1, and 2 mg RIVA decreased the total number of SWDs compared to the control group (F 5,30 = 86.11; p < 0.001). The total number of SWDs at the doses of 0.125, 0.25, 0.5, 1, and 2 mg RIVA were 93.00 ± 4.08; 54.83 ± 5.38; 45.50 ± 6.18; 1.80 ± 0.37; and 0.67 ± 0.33, respectively (Fig. 2 A). The anti-seizure effect started after 90 minutes in the 0.25 and 0.5 mg/kg RIVA groups (p = 0.29; p = 0.14, respectively), while it started in the first 30 minutes in the 1 and 2 mg/kg RIVA groups (p < 0.001; p < 0.001, respectively) and continued until the end of the recording (F 8,309 = 39.48). The number of SWDs between 90 to 120 min was 11.4 ± 1.04; 5.83 ± 2.02; 5.33 ± 1.30; 1.66 ± 0.50; 0.00 ± 0.00 in the saline; 0.25, 0.5, 1, and 2 mg RIVA groups, respectively (Fig. 2 B). The mean duration of SWDs only decreased at the doses of 1 and 2 mg/kg RIVA (F 5,30 = 10.72) (p = 0.12; p = 0.004, respectively). After the administration of 1 and 2 mg/kg RIVA, the mean duration of SWDs was 4.31 ± 0.15 and 4.16 ± 0.05 sec, respectively (Fig. 2 C). Representative ECoG recordings were shown in Fig. 2 D. 3.1.2. The effect of long-term administration RIVA on the SWDs parameters Long-term ECoG activities were recorded on the 1st day before (baseline activity) and after (acute) injections, and on the 11th and 22nd days after 24 hours from the last injections of 0.5 and 2 mg/kg RIVA. RIVA, at a dose of 0.5 mg/kg, increased the total number of SWDs on the 11th and 22nd days compared to the single-dose injection (F 3,15 = 29.28; p < 0.001) without affecting the mean duration (F 3,15 = 2.229) (Fig. 3 A, 3 B). The total number of SWDs at the baseline, after single-dose injection, and 11th and 22nd days were 98.00 ± 5.17; 44.83 ± 4.22; 92.67 ± 7.27; 109.70 ± 9.38, respectively. Furthermore, 2 mg/kg RIVA increased the total number of SWDs on the 11th and 22nd day compared to both baseline activity (F 3,15 = 596.4) (p < 0.001; p < 0.001, respectively) and acute injection (p < 0.001; p < 0.001, respectively) (Fig. 3 C). The total number of SWDs at the baseline, after single-dose injection, and 11th and 22nd days were 98.83 ± 5.62; 1.50 ± 0.22; 158.70 ± 5.29; and 233.70 ± 6.25, respectively. Interestingly, the mean duration of SWDs decreased on the 22nd days compared to both baseline activity and acute injection (F 3,15 = 37.50) (p < 0.001; p < 0.001, respectively) (Fig. 3 D). The mean duration of SWDs at the baseline, after single-dose injection, and 11th and 22nd days were 5.60 ± 0.05; 5.07 ± 0.10; 5.11 ± 0.13; and 3.99 ± 0.11 sec, respectively. 3.2. The effect of RIVA on learning-memory and anxiety-like behavior Figure 4 shows the Y-maze test performance results of the WAG/Rij and Wistar rats after RIVA administrations. Only, the number of total entries and new arm entries were less in WAG/Rij rats compared to the naïve Wistar rats [(t 10 = 2.515; p = 0.031), p = 0.006, respectively). In WAG/Rij rats, the number of total arm entries (p = 0.001), the number of spontaneous alternations (p = 0.005), the alternation index (p = 0.041), the number of A, B, C (new) arm entries (p < 0.001; p = 0.009; p = 0.006, respectively), and spent time in B, C arms (p = 0.005; p = 0.002, respectively) decreased after consecutive 21 days of RIVA injection. Only start arm time spend activity increased in the 21-day RIVA-treated WAG/Rij rats compared to the saline group (p = 0.001). In Wistar rats, RIVA treatment did not cause any change on measured parameters compared to the saline group (Fig. 4 A-I). Figure 5 represents open and closed field activities and durations which are anxiety-indicated patterns after RIVA administrations. There were no differences in the open field and closed field activities, whereas the open field duration was lower (t 10 = 3.636; p = 0.007) and the closed field duration was higher (t 10 = 3.598; p = 0.007) in saline-injected WAG/Rij rats compared to the saline-injected Wistar rats. In WAG/Rij rats, RIVA administration increased the open field duration (t 10 = 10.21; p < 0.001), while closed field activity (p = 0.008) and duration (t 10 = 10.21; p < 0.001) were decreased. In Wistar rats, no difference was found in the open field and closed field activities, while open field duration was higher and closed field duration was lower in RIVA-treated rats compared to the saline group (t 10 = 8.929; p < 0.001) (Fig. 5 A-D). 3.3. The effect of long-term RIVA administration on TRPV1 channel expressions There was no difference in the levels of the TRPV1 expression in the somatosensory cortex and hippocampus between saline-injected WAG/Rij and Wistar rats. Long-term RIVA administrations, at a dose of 2 mg/kg, decreased the TRPV1 expression in WAG/Rij rats compared to the WAG/Rij saline group in the somatosensory cortex and the hippocampus [(t 4 = 33.04; p < 0.001), (t 4 = 18.84; p < 0.001), respectively], while TRPV1 expression increased in Wistar rats compared to the Wistar saline group in the somatosensory cortex and the hippocampus [(t 4 = 4.986; p = 0.008), (t 4 = 9.279; p < 0.001), respectively] (Fig. 6 A, 6 B). 4. Discussion Single-dose intraperitoneal administration of AChE inhibitor RIVA dose-dependently reduced the total number and the mean duration of SWDs in WAG/Rij rats. Interestingly, long-term RIVA administration to the WAG/Rij rats increased the number of SWDs and decreased the mean duration of SWDs. Furthermore, long-term RIVA administration decreased learning-memory abilities and anxiety-like behavior in WAG/Rij rats, while RIVA only decreased anxiety-like behavior in Wistar rats. In addition, long-term administration of RIVA caused a decrease in TRPV1 gene expression in epileptic WAG/Rij rats while it caused an increase in in non-epileptic Wistar rats. The cholinergic system has an essential role in many physiological functions in the brain such as neuronal excitability, synaptic transmission, and synaptic plasticity [ 35 ]. In terms of epileptic seizures, the effect of the cholinergic system seems to be double-sided. While the selective activation of cholinergic neurons could produce significant anti-seizure effects [ 12 ], the systemic administration of cholinergic agonists carbachol or pilocarpine has long been reported to trigger seizure activity [ 13 ]. On the other hand, acetylcholinesterase inhibitor drugs contain conflicting results on epileptic seizures. Seizure resistance was increased by an AChE inhibitor donepezil in Scn1a mutant mice and wild-type littermates by the activation of GABA A receptors [ 36 ]. Additionally, Huperzine A, a blood-brain barrier permeable selective reversible inhibitor of AChE, has shown a protective effect against NMDA-induced seizures and status epilepticus [ 37 ]. Contrary to these studies, tacrine, another AChE inhibitor, increased the seizure severity and facilitated the formation of PTZ kindling in mice [ 38 ]. Only a limited number of studies have examined the relationship between the cholinergic system and the absence seizures. Unilateral cholinotoxine injections to the reticular thalamic nucleus decreased the number and duration of SWDs compared to the basal recordings [ 39 ]. Danober et al. reported that acute systemic injections of muscarinic receptor agonists oxotremorine or pilocarpine, and an acetylcholinesterase inhibitor physostigmine reduced the duration of SWDs in a dose-dependent manner in GAERS rat. Interestingly, the muscarinic receptor antagonist scopolamine increased the duration of SWDs at lower doses, while it suppressed SWDs at higher doses [ 20 ]. In the present study, single-dose administration of RIVA dose-dependently decreased the mean duration of SWDs, as physostigmine mentioned above. Also, RIVA decreased the number of SWDs different from Danober et al. [ 20 ]. However, there is no data regarding long-term AChE inhibition in the absence epilepsy. In contrast to the acute effect, long-term high-dose RIVA administration increased the total number of SWDs and decreased the mean duration of SWDs. Moreover, long-term low-dose RIVA administration increased the number of SWDs compared to single-dose administration and similar to the baseline activity without affecting the mean duration. T-type calcium channels [ 4 ] and HCN channels [ 40 , 41 ] are involved in the pathogenesis of absence seizures, which interact with the acetylcholine pathway. This may explain the effect of RIVA on the absence epileptic activity in the present study. The low threshold T-type Ca 2+ conductance of the cat thalamic lateral geniculate nucleus (LGN) relay cells was directly inhibited by ACh when the membrane potential was clamped to the control level and this inhibitory effect was independent of the changes in membrane potential by ACh [ 42 ]. Moreover, in another patch-clamp study, Hildebrandt et al. have noted that activation of M1 muscarinic acetylcholine receptors selectively and reversibly inhibits Cav3.3 channel activity but either no effect on Cav3.1 and Cav3.2 peak current amplitudes and this modulation was observed for both rat and human T-type Ca 2+ channel variants [ 43 ]. On the other hand, neostigmine-stimulated endogenous acetylcholine release showed a selective suppressive effect on I h and resonance in burst firing in Wistar rats [ 44 ]. Furthermore, in the cholinergic interneurons of the striatum, activation of muscarinic receptors downregulates internal cAMP which would result in the reduction of I h and inhibition of spontaneous firing [ 45 ]. In light of the aforementioned studies, since the increase in acetylcholine can suppress both T-type Ca 2+ channels and HCN channels, single-dose RIVA administration may reduce SWDs parameters by this way. Moreover, long-term RIVA administration may alter the expression of these channels, which may lead to an increase in SWDs, just as the suppression of HCN channels caused an increase in HCN channel expression in our previous study [ 41 ]. Learning-memory abilities difficulties and anxiety disorders may frequently occur in individuals with absence epilepsy [ 46 ]. In many studies, genetic absence epileptic WAG/Rij rats exhibited memory and learning problems [ 47 ], depression-like symptoms [ 47 ], and anxiety-related symptoms [ 48 ]. Anticholinergic agent RIVA, which has not been studied in epilepsy, is used to slow down the bad progression of learning-memory abilities and anxiety, which are symptoms of dementia [ 49 – 51 ]. In the present study, long-term (21 days) high-dose of RIVA were administered to both 8-month-old WAG/Rij rats and non-epileptic age-matched Wistar rats. WAG/Rij rats showed a reduction in the total number of arm and new arm entries compared to the Wistar rats. On the other hand, long-term RIVA administration did not affect the learning-memory abilities performance in Wistar rats. However, almost all observed Y-maze parameters were reduced in WAG/Rij rats with the long-term administration of RIVA, which increased SWDs. These findings are in line with Leo et al. (2019)who suggested that learning-memory abilities performance is likely linked to an increase in spike-wave discharges [ 9 ]. Regarding anxiety, as in many studies [ 48 , 52 ], WAG/Rij rats had a higher anxiety-like behavior than Wistar rats in the present study. Also, Fedosova et al. noted that WAG/Rij rats display increased anxiety and higher stress response after 2-month-old compared to the Wistar rats [ 10 ]. Moreover, long-term RIVA administration decreased anxiety-like behavior both in WAG/Rij and Wistar rats. On the other hand, several studies have shown that too high or too low anxiety responses can have negative consequences for both vital responses and some abilities such as learning-memory abilities [ 53 ]. Very low or very high levels of stress lead to learning-memory abilities impairment which is called an “inverted U relationship” [ 53 , 54 ]. In consequence, the increased number of SWDs and low anxiety-like behavior with long-term RIVA administration are likely to cause learning-memory abilities impairment. TRPV1, a calcium-permeable cation channel [ 55 ], is well-studied in the peripheral nervous system, however, its role in the central nervous system remains to be investigated in detail [ 56 , 57 ]. TRPV1 is also associated with a wide range of functions in the central nervous system, such as fear, anxiety, stress, learning-memory abilities, thermoregulation, pain, and synaptic plasticity [ 58 – 60 ]. Moreover, it can also be associated with neurological diseases such as epilepsy [ 61 – 63 ]. Conflicting results have been reported for TRPV1 in convulsive epilepsy. Since TRPV1 channels increase calcium ion accumulation, stimulation of these channels is expected to increase tonic-clonic seizures under normal conditions. However, studies reveal different results. Manna and Umathe (2012) found that intracerebroventricular injection of TRPV1 agonist capsaicin exhibited proconvulsant activity that was blocked by capsazepine pretreatment in PTZ-induced seizures in mice. Conversely, intraperitoneal administration of capsaicin decreased seizure severity and neuronal damage in PTZ-induced seizures in rats [ 63 ]. Furthermore, other TRPV1 agonist piperine delayed the onset of myoclonic jerks and generalized clonic seizures and decreased the seizure stage and mortality in PTZ-induced seizures in mice [ 62 ]. Interestingly, Jia et al. showed that hippocampal administration of both TRPV1 agonists or antagonists reduced the susceptibility to PTZ-induced seizures in mice. Moreover, in the same study, TRPV1 knockout mice and hippocampal TRPV1 overexpression mice showed decreased susceptibility to PTZ-induced seizures [ 24 ]. Increased TRPV1 expression was reported in the temporal cortex and hippocampus of patients with mesial temporal lobe epilepsy [ 64 ]. Moreover, expression levels of TRPV1 mRNA and protein increased after febrile seizures in wild-type mice [ 65 ]. In the status epilepticus model induced by pilocarpine, an acetylcholine agonist acting on muscarinic receptors, the TRPV1 receptor was overexpressed in the dentate gyrus of mice [ 66 ] and the hippocampus of the rats [ 67 ]. Regarding the absence epilepsy, only one study indicated the levels of TRPV1 [ 25 ]. According to the immunoblotting analysis, protein levels of TRPV1 were lower in two- and 6-month-old WAG/Rij rats compared to age-matched Wistar rats in the somatosensory cortex [ 68 ]. Interestingly, TRPV1 protein expression was lower in the 2-month-old and higher in the 6-month-old WAG/Rij rats compared to age-matched Wistar rats in the hippocampus [ 68 ]. In contrast to this study, there was no difference in TRPV1 gene expression in both the somatosensory cortex and hippocampus of 8-month-old WAG/Rij compared to age-matched Wistar rats. The protein levels did not measured in experimental groups which may be considered the major limitation of the present study. On the other hand, long-term RIVA administration decreased the mRNA levels of TRPV1 in WAG/Rij rats in the somatosensory cortex and hippocampus, whereas mRNA levels of TRPV1 were increased in Wistar rats after long-term RIVA administration in both regions. We consider that these different effects may be explained due to genetic defects such as channelopathies in WAG/Rij rats [ 41 , 69 ]. Although the role of activation or inhibition of TRPV1 receptors on SWDs is not known yet, Talebi et al. suggested that reduction of the TRPV1 receptors could play an important role in the pathophysiology of absence epilepsy [ 68 ]. Therefore, we suggest that decreased TRPV1 channel expression may lead to increased absence seizures, however further studies are needed to prove this hypothesis. In conclusion, while single-dose administration of AChE inhibitor RIVA decreased the SWDs parameters, long-term administration caused an increase in the number of SWDs in WAG/Rij rats. This effect may be mediated through altered expressions of calcium channels such as T-type, HCN, and TRPV1 channels. Long-term RIVA treatment decreased learning-memory abilities and anxiety in WAG/Rij rats, but only anxiety in Wistar rats. TRPV1 gene expression was found to be decreased in WAG/Rij rats, however, it increased in Wistar rats suggesting this may be due to the genetic deficiencies of WAG/Rij rats. Declarations Author Contributions G.A., E.A., M.A., and E.T.A. planned the experiments; G.A., E.T.A., and B.O. conducted the electrophysiological experiments; E.T.A. and B.O. applied the behavioral tests; E.T.A. made molecular experiments; G.A. and E.T.A. analyzed the data; G.A. and E.T.A. made the graphics and statistical analysis; G.A., E.A., M.A., and E.T.A. wrote the manuscript. Conflict of interest The authors declare no conflict of interest. Ethics Approval The study was performed by the ethical standards as laid down in the 1964 Declaration of Helsinki and its later amendments or comparable ethical standards. The experimental protocol was approved by Ondokuz Mayıs University Animal Experiments Local Ethics Committee (Approval No: 2022/08). Funding This work was supported by Scientific Research Coordination Unit of Ondokuz Mayıs University (PYO.TIP.1904.22.030). Acknowledgement The authors would like to thank Dr Emre Soner Tiryaki for technical support during the electrophysiological experiments. References Meeren HK, Pijn JPM, Van Luijtelaar EL, Coenen AM, da Silva FHL (2002) Cortical focus drives widespread corticothalamic networks during spontaneous absence seizures in rats. J Neurosci 22:1480–1495 Futatsugi Y, Riviello JJ Jr (1998) Mechanisms of generalized absence epilepsy. Brain Develop 20:75–79 Huguenard J (2019) Current controversy: spikes, bursts, and synchrony in generalized absence epilepsy: unresolved questions regarding thalamocortical synchrony in absence epilepsy. Epilepsy Currents 19:105–111 Cheong E, Shin H-S (2013) T-type Ca2 + channels in absence epilepsy. Biochim et Biophys Acta (BBA)-Biomembranes 1828:1560–1571 Steriade M (2005) Sleep, epilepsy and thalamic reticular inhibitory neurons. Trends Neurosci 28:317–324 Noebels JL (2005) Calcium channel gaiting and absence epilepsy. Epilepsy currents 5:95–97 Jafarian M, Alipour ME, Karimzadeh F (2020) Experimental models of absence epilepsy. Basic Clin Neurosci 11:715 Coenen A, Van Luijtelaar E (2003) Genetic animal models for absence epilepsy: a review of the WAG/Rij strain of rats. Behav Genet 33:635–655 Leo A, Citraro R, Tallarico M, Iannone M, Fedosova E, Nesci V, De Sarro G, Sarkisova K, Russo E (2019) Cognitive impairment in the WAG/Rij rat absence model is secondary to absence seizures and depressive-like behavior. Prog Neuropsychopharmacol Biol Psychiatry 94:109652 Fedosova E, Sarkisova KY, Kudrin V, Narkevich V, Bazyan A (2015) Behavioral and neurochemical characteristics of two months old WAG/Rij rats with genetic absence epilepsy. Intern J Clin Exper Neurol 3:32–44 Allaway KC, Machold R (2017) Developmental specification of forebrain cholinergic neurons. Dev Biol 421:1–7 Wang Y, Wang Y, Xu C, Wang S, Tan N, Chen C, Chen L, Wu X, Fei F, Cheng H (2020) Direct septum-hippocampus cholinergic circuit attenuates seizure through driving somatostatin inhibition. Biol Psychiatry 87:843–856 Curia G, Longo D, Biagini G, Jones RS, Avoli M (2008) The pilocarpine model of temporal lobe epilepsy. J Neurosci Methods 172:143–157 Wang Y, Tan B, Wang Y, Chen Z (2021) Cholinergic signaling, neural excitability, and epilepsy. Molecules 26:2258 Colovic MB, Krstic DZ, Lazarevic-Pasti TD, Bondzic AM, Vasic VM (2013) Acetylcholinesterase inhibitors: pharmacology and toxicology. Curr Neuropharmacol 11:315–335 Babic T, Zurak N (1999) Convulsions induced by donepezil. J Neurol Neurosurg Psychiatry 66:410 Lebert F, Hasenbroekx C, Pasquier F, Petit H (1996) Convulsive effects of tacrine. Lancet 347:1339–1340 Wong JC, Thelin JT, Escayg A (2019) Donepezil increases resistance to induced seizures in a mouse model of Dravet syndrome. Ann Clin Transl Neurol 6:1566–1571 Jeong JH, Choi BY, Kho AR, Lee SH, Hong DK, Lee SH, Lee SY, Song HK, Choi HC, Suh SW (2017) Diverse effects of an acetylcholinesterase inhibitor, donepezil, on hippocampal neuronal death after pilocarpine-induced seizure. Int J Mol Sci 18:2311 Danober L, Depaulis A, Marescaux C, Vergnes M (1993) Effects of cholinergic drugs on genetic absence seizures in rats. Eur J Pharmacol 234:263–268 Aguiar D, Moreira F, Terzian A, Fogaça M, Lisboa S, Wotjak C, Guimaraes F (2014) Modulation of defensive behavior by transient receptor potential vanilloid type-1 (TRPV1) channels. Neurosci Biobehavioral Reviews 46:418–428 Fu M, Xie Z, Zuo H (2009) TRPV1: a potential target for antiepileptogenesis. Med Hypotheses 73:100–102 Lazarini-Lopes W, Silva-Cardoso GK, Leite-Panissi CRA, Garcia-Cairasco N (2022) Increased TRPV1 channels and FosB protein expression are associated with chronic epileptic seizures and anxiogenic-like behaviors in a Preclinical model of temporal lobe epilepsy. Biomedicines 10:416 Jia Y-F, Li Y-C, Tang Y-P, Cao J, Wang L-P, Yang Y-X, Xu L, Mao R-R (2015) Interference of TRPV1 function altered the susceptibility of PTZ-induced seizures. Front Cell Neurosci 9:20 Ghorbani S, Alizadeh L, Akhlaghi F, Moeeni SS, Karimzadeh F (2021) Alteration of Neuregulin 1/Erbb4 in Absence Epilepsy: Regulatory Effect on TRPV1 Expression. Basic and Clinical Neuroscience 12 Li X, Xu Y, Cheng Y, Wang R (2018) α7 Nicotinic acetylcholine receptor contributes to the alleviation of lung ischemia–reperfusion injury by transient receptor potential vanilloid type 1 stimulation. J Surg Res 230:164–174 Arkhipov AY, Fedorov NS, Nurullin LF, Khabibrakhmanov AN, Mukhamedyarov MA, Samigullin DV, Malomouzh AI (2023) Activation of TRPV1 Channels Inhibits the Release of Acetylcholine and Improves Muscle Contractility in Mice. Cell Mol Neurobiol 43:4157–4172 Paxinos G, Watson C (2006) The rat brain in stereotaxic coordinates: hard cover edition. Elsevier Gunes H, Ozdemir E, Arslan G (2019) Coenzyme Q10 increases absence seizures in WAG/Rij rats: The role of the nitric oxide pathway. Epilepsy Res 154:69–73 Doǧan E, Aygün H, Arslan G, Rzayev E, Avcı B, Ayyıldız M, Ağar E (2020) The role of NMDA receptors in the effect of purinergic P2X7 receptor on spontaneous seizure activity in WAG/Rij rats with genetic absence epilepsy. Front NeuroSci 14:414 Abdel-Aal RA, Assi A-AA, Kostandy BB (2011) Rivastigmine reverses aluminum-induced behavioral changes in rats. Eur J Pharmacol 659:169–176 Conrad CD, Galea LA, Kuroda Y, McEwen BS (1996) Chronic stress impairs rat spatial memory on the Y maze, and this effect is blocked by tianeptine treatment. Behav Neurosci 110:1321 Rodgers R, Dalvi A (1997) Anxiety, defence and the elevated plus-maze. Neurosci Biobehavioral Reviews 21:801–810 Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2 – ∆∆CT method. Methods 25:402–408 Picciotto MR, Higley MJ, Mineur YS (2012) Acetylcholine as a neuromodulator: cholinergic signaling shapes nervous system function and behavior. Neuron 76:116–129 Shapiro L, Wong JC, Escayg A (2019) Reduced cannabinoid 2 receptor activity increases susceptibility to induced seizures in mice. Epilepsia 60:2359–2369 Coleman BR, Ratcliffe RH, Oguntayo SA, Shi X, Doctor BP, Gordon RK, Nambiar MP (2008) [+]-Huperzine A treatment protects against N-methyl-D-aspartate-induced seizure/status epilepticus in rats. Chemico-Biol Interact 175:387–395 Getova D, Dimitrova D (2000) Effects of the anticholinesterase drug tacrine on the development of PTZ kindling and on learning and memory processes in mice. Folia medica 42:5–9 Berdiev R, Chepurnov S, Veening J, Chepurnova N, Van Luijtelaar G (2007) The role of the nucleus basalis of Meynert and reticular thalamic nucleus in pathogenesis of genetically determined absence epilepsy in rats: a lesion study. Brain Res 1185:266–274 Crunelli V, David F, Morais TP, Lorincz ML (2023) HCN channels and absence seizures. Neurobiol Dis :106107 Tiryaki ES, Arslan G, Günaydın C, Ayyıldız M, Ağar E (2023) The role of HCN channels on the effects of T-type calcium channels and GABAA receptors in the absence epilepsy model of WAG/Rij rats. Pflügers Archiv-European J Physiol :1–14 Lo F, Sherman S (1997) Acetylcholine decreases low threshold T-type calcium conductance of relay cells in the cat's lateral geniculate nucleus. Sheng li xue bao:[Acta Physiol Sinica] 49:307–313 Hildebrand ME, David LS, Hamid J, Mulatz K, Garcia E, Zamponi GW, Snutch TP (2007) Selective inhibition of CaV3. 3 T-type calcium channels by Gαq/11-coupled muscarinic acetylcholine receptors. J Biol Chem 282:21043–21055 Vasnik S, Sikdar SK (2021) Cholinergic receptor–independent modulation of intrinsic resonance in the rat subiculum neurons through inhibition of hyperpolarization-activated cyclic nucleotide‐gated channels. Acta Physiol 231:e13603 Zhao Z, Zhang K, Liu X, Yan H, Ma X, Zhang S, Zheng J, Wang L, Wei X (2016) Involvement of HCN channel in muscarinic inhibitory action on tonic firing of dorsolateral striatal cholinergic interneurons. Front Cell Neurosci 10:71 Barone V, Van Putten MJ, Visser GH (2020) Absence epilepsy: Characteristics, pathophysiology, attention impairments, and the related risk of accidents. A narrative review. Epilepsy Behav 112:107342 Leo A, Citraro R, Tallarico M, Iannone M, Fedosova E, Nesci V, De Sarro G, Sarkisova K, Russo E (2019) Cognitive impairment in the WAG/Rij rat absence model is secondary to absence seizures and depressive-like behavior. Prog Neuropsychopharmacol Biol Psychiatry 94:109652 Sarkisova K, van Luijtelaar G (2011) The WAG/Rij strain: a genetic animal model of absence epilepsy with comorbidity of depressiony. Prog Neuropsychopharmacol Biol Psychiatry 35:854–876 Gauthier S, Juby A, Rehel B, Schecter R (2007) EXACT: rivastigmine improves the high prevalence of attention deficits and mood and behaviour symptoms in Alzheimer's disease. Int J Clin Pract 61:886–895 Mamikonyan E, Xie SX, Melvin E, Weintraub D (2015) Rivastigmine for mild cognitive impairment in Parkinson disease: A placebo-controlled study. Mov Disord 30:912–918 Thippeswamy AH, Rafiq M, shastry Viswantha GL, Kavya KJ, Anturlikar SD, Patki PS (2013) Evaluation of Bacopa monniera for its synergistic activity with rivastigmine in reversing aluminum-induced memory loss and learning deficit in rats. J Acupunct Meridian Stud 6:208–213 Ari C, Kovács Z, Juhasz G, Murdun C, Goldhagen CR, Koutnik AP, Poff AM, Kesl SL, D’Agostino DP (2016) Exogenous ketone supplements reduce anxiety-related behavior in Sprague-Dawley and Wistar Albino Glaxo/Rijswijk rats. Front Mol Neurosci 9:137 Diamond DM, Bennett MC, Fleshner M, Rose GM (1992) Inverted-U relationship between the level of peripheral corticosterone and the magnitude of hippocampal primed burst potentiation. Hippocampus 2:421–430 Salehi B, Cordero MI, Sandi C (2010) Learning under stress: the inverted-U-shape function revisited. Learn Mem 17:522–530 Szallasi A, Blumberg PM (1999) Vanilloid (Capsaicin) receptors and mechanisms. Pharmacol Rev 51:159–212 Liddle RA (2007) The role of Transient Receptor Potential Vanilloid 1 (TRPV1) channels in pancreatitis. Biochimica et Biophysica Acta (BBA)-Molecular. Basis Disease 1772:869–878 Szallasi A, Gunthorpe MJ (2008) Peripheral TRPV1 receptors as targets for drug development: new molecules and mechanisms. Curr Pharm Design 14:32–41 Edwards JG (2014) TRPV1 in the central nervous system: synaptic plasticity, function, and pharmacological implications. Capsaicin as a therapeutic molecule:77–104 Iglesias LP, Aguiar DC, Moreira FA (2022) TRPV1 blockers as potential new treatments for psychiatric disorders. Behav Pharmacol 33:2–14 Topuz RD, Cetinkaya MZ, Erumit D, Aydemir KD, Gunduz O, Karadag CH, Ulugol A (2021) The role of endocannabinoid system and TRPV1 receptors in the antidepressant and anxiolytic effects of dipyrone in chronic unpredictable mild stress in mice. Eur J Pharmacol 908:174315 Manna SS, Umathe SN (2012) Involvement of transient receptor potential vanilloid type 1 channels in the pro-convulsant effect of anandamide in pentylenetetrazole-induced seizures. Epilepsy Res 100:113–124 Chen C-Y, Li W, Qu K-P, Chen C-R (2013) Piperine exerts anti-seizure effects via the TRPV1 receptor in mice. Eur J Pharmacol 714:288–294 Abdel-Salam OM, Sleem AA, Sayed MAEBM, Youness ER, Shaffie N (2020) Capsaicin exerts anti-convulsant and neuroprotective effects in pentylenetetrazole-induced seizures. Neurochem Res 45:1045–1061 Sun F-J, Guo W, Zheng D-H, Zhang C-Q, Li S, Liu S-Y, Yin Q, Yang H, Shu H-F (2013) Increased expression of TRPV1 in the cortex and hippocampus from patients with mesial temporal lobe epilepsy. J Mol Neurosci 49:182–193 Huang W-X, Yu F, Sanchez RM, Liu Y-Q, Min J-W, Hu J-J, Bsoul NB, Han S, Yin J, Liu W-H (2015) TRPV1 promotes repetitive febrile seizures by pro-inflammatory cytokines in immature brain. Brain, Behavior, and Immunity 48:68–77 Bhaskaran MD, Smith BN (2010) Effects of TRPV1 activation on synaptic excitation in the dentate gyrus of a mouse model of temporal lobe epilepsy. Exp Neurol 223:529–536 Tan X, Zeng Y, Tu Z, Li P, Chen H, Cheng L, Tu S, Jiang L (2020) TRPV1 contributes to the neuroprotective effect of dexmedetomidine in pilocarpine-induced status epilepticus juvenile rats. BioMed Research International 2020 Talebi F, Ghorbani S, Alizadeh L, Akhlaghi F, Moeeni SS, Karimzadeh F (2022) Alteration in Neuregulin 1/ERbB4 in Absence Epilepsy: Regulatory Effect on TRPV1 Expression. Basic Clin Neurosci 13:777 Broicher T, Kanyshkova T, Meuth P, Pape H-C, Budde T (2008) Correlation of T-channel coding gene expression, IT, and the low threshold Ca2 + spike in the thalamus of a rat model of absence epilepsy. Mol Cell Neurosci 39:384–399 Additional Declarations No competing interests reported. Supplementary Files Supp.Table1.docx Cite Share Download PDF Status: Published Journal Publication published 03 Jan, 2025 Read the published version in Neurochemical Research → Version 1 posted Editorial decision: Revision requested 10 Aug, 2024 Reviews received at journal 09 Aug, 2024 Reviews received at journal 02 Aug, 2024 Reviewers agreed at journal 19 Jul, 2024 Reviewers agreed at journal 14 Jul, 2024 Reviewers invited by journal 12 Jul, 2024 Editor assigned by journal 12 Jul, 2024 Submission checks completed at journal 12 Jul, 2024 First submitted to journal 11 Jul, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4724554","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":335191319,"identity":"50aa6f64-6f36-4270-8259-2108df9c59b5","order_by":0,"name":"Elif TÜRKDÖNMEZ AK","email":"","orcid":"","institution":"Department of Physiology, Faculty of Medicine, University of Ondokuz Mayıs, Samsun","correspondingAuthor":false,"prefix":"","firstName":"Elif","middleName":"TÜRKDÖNMEZ","lastName":"AK","suffix":""},{"id":335191320,"identity":"1cc8c118-64ae-4d77-9280-630aab093a18","order_by":1,"name":"Büşra OKUYUCU","email":"","orcid":"","institution":"Department of Physiology, Faculty of Medicine, University of Ondokuz Mayıs, Samsun","correspondingAuthor":false,"prefix":"","firstName":"Büşra","middleName":"","lastName":"OKUYUCU","suffix":""},{"id":335191321,"identity":"4ac88ce0-3ef2-4322-97a0-a99335d2ae36","order_by":2,"name":"ARSLAN Gökhan","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA/klEQVRIiWNgGAWjYFACNjYog7mBgaECwpQgUgsjUMsZuBYDIrUwthGhRd69Le3Bzx0M8ub9Bxs/F86ziTY4wHzwNg/Dn3xcWgzPHDtu2HuGwXDOjcRm6Znb0nI3HGBLtuZhMLBswKVlRnqbBG8bA+MMCcYGad5th4FaeMykgVpwugykRfJvG4P9DP6Dzb9554C08H/Dq0VeIu2YNNCWxBkMiW3SvA1gW9jwajHgOZYmLdsmkTxDIrHNGsjJnXmYzdhyjoExblva28wk37bZ2M7gP3z4Nk+NTW7f8eaHN95UyOG25QCYQo5uZrA4Lg1AWxpwy42CUTAKRsEogAAAs2ZPcymmqW8AAAAASUVORK5CYII=","orcid":"","institution":"Department of Physiology, Faculty of Medicine, University of Ondokuz Mayıs, Samsun","correspondingAuthor":true,"prefix":"","firstName":"ARSLAN","middleName":"","lastName":"Gökhan","suffix":""},{"id":335191322,"identity":"4df63250-114d-45b5-8dc4-b7a6db321187","order_by":3,"name":"Erdal AĞAR","email":"","orcid":"","institution":"Department of Physiology, Faculty of Medicine, University of Ondokuz Mayıs, Samsun","correspondingAuthor":false,"prefix":"","firstName":"Erdal","middleName":"","lastName":"AĞAR","suffix":""},{"id":335191323,"identity":"02bce41b-deb3-4a3d-98d6-dd9efce854f7","order_by":4,"name":"Mustafa AYYILDIZ","email":"","orcid":"","institution":"Department of Physiology, Faculty of Medicine, University of Ondokuz Mayıs, Samsun","correspondingAuthor":false,"prefix":"","firstName":"Mustafa","middleName":"","lastName":"AYYILDIZ","suffix":""}],"badges":[],"createdAt":"2024-07-11 13:46:14","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4724554/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4724554/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s11064-024-04318-2","type":"published","date":"2025-01-03T15:57:14+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":61889049,"identity":"8ac363dd-a34c-4c0a-893a-df15a6da52ef","added_by":"auto","created_at":"2024-08-06 17:43:45","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":552651,"visible":true,"origin":"","legend":"\u003cp\u003eSchematic representation of the experimental groups. A) ECoG recordings of saline and single-dose RIVA injections to the WAG/Rij rats, B) ECoG recordings of long-term RIVA injections to the WAG/Rij rats, C) Learning-memory and anxiety tests, and qPCR procedures after long-term RIVA administration to the WAG/Rij and Wistar rats.\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4724554/v1/aee7989c14514b439989ec4f.jpg"},{"id":61889048,"identity":"a285d5c7-bf20-4e57-8452-25c94f90051f","added_by":"auto","created_at":"2024-08-06 17:43:45","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1234510,"visible":true,"origin":"","legend":"\u003cp\u003eECoG recording analysis and SWDs images. A) The total number of SWDs in three hours after single-dose saline or RIVA administrations, B) Time-dependent graph of SWDs count at 30-minute intervals after acute saline or RIVA treatments, C) The mean duration of SWDs in three hours after single-dose RIVA injections, D) Representative ECoG recordings obtained from 120 min after single-dose saline or RIVA administrations. *=p\u0026lt;0.05; **=p\u0026lt;0.01; ***=p\u0026lt;0.001 compared to the saline group.\u003c/p\u003e","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4724554/v1/1a295e4c19cd8c853acd2ec5.jpg"},{"id":61889046,"identity":"4211b244-f9a1-4fe1-b37b-34ffefe4e31d","added_by":"auto","created_at":"2024-08-06 17:43:44","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":2681430,"visible":true,"origin":"","legend":"\u003cp\u003eThe total number and the mean duration of SWDs after long-term RIVA injections. A) The total number of SWDs (for three hours) before, after, 24 hours from 10\u003csup\u003eth\u003c/sup\u003e and 24 hours from 21\u003csup\u003eth\u003c/sup\u003e injections of low-dose of RIVA, B) The mean duration of SWDs (for three hours) before, after, 24 hours from 10\u003csup\u003eth\u003c/sup\u003e and 24 hours from 21\u003csup\u003eth\u003c/sup\u003e injections of low-dose of RIVA, C) The total number of SWDs (for three hours) before, after, 24 hours from 10\u003csup\u003eth\u003c/sup\u003e and 24 hours from 21\u003csup\u003eth\u003c/sup\u003e injections of high-dose of RIVA, B) The mean duration of SWDs (for three hours) before, after, 24 hours from 10\u003csup\u003eth\u003c/sup\u003e and 24 hours from 21\u003csup\u003eth\u003c/sup\u003e injections of high-dose of RIVA. *p\u0026lt;0.05; ** p\u0026lt;0.01; ***p\u0026lt;0.001 compared to before injection (basal activity), \u003csup\u003e+++\u003c/sup\u003ep\u0026lt;0.001 compared to the after injection (acute administration).\u003c/p\u003e","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4724554/v1/84c4101f115eac45e26334aa.jpg"},{"id":61889340,"identity":"0f723ccb-6063-4c43-8808-fc959064e15e","added_by":"auto","created_at":"2024-08-06 17:51:44","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1333603,"visible":true,"origin":"","legend":"\u003cp\u003e(A-I)\u003cstrong\u003e \u003c/strong\u003eY-maze performance parameters of 8-months-old WAG/Rij and age-matched Wistar rats 24 hours after the long-term saline or high-dose RIVA administrations. *p\u0026lt;0.05; ** p\u0026lt;0.01; ***p\u0026lt;0.001 compared to the WAG/Rij saline group, \u003csup\u003e+\u003c/sup\u003ep\u0026lt;0.05; \u003csup\u003e++\u003c/sup\u003ep\u0026lt;0.01 compared to the Wistar saline group.\u003c/p\u003e","description":"","filename":"Figure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4724554/v1/3958bde6e4654a70d8e8d043.jpg"},{"id":61889050,"identity":"119c7e2c-cbfb-4ec4-ba59-174a2c23f3cb","added_by":"auto","created_at":"2024-08-06 17:43:45","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":2052169,"visible":true,"origin":"","legend":"\u003cp\u003eElevated-plus maze test parameters of 8-months-old WAG/Rij and age-matched Wistar rats 24 hours after the long-term saline or high-dose (2 mg/kg) RIVA administrations. **p\u0026lt;0.01; ***p\u0026lt;0.001 compared to the WAG/Rij saline group, \u003csup\u003e++\u003c/sup\u003ep\u0026lt;0.01; \u003csup\u003e++\u003c/sup\u003ep\u0026lt;0.001 compared to the Wistar saline group.\u003c/p\u003e","description":"","filename":"Figure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4724554/v1/7ac21eb579dab4f8073d7241.jpg"},{"id":61889341,"identity":"98ddf803-cb58-4d8f-9747-b1a888140322","added_by":"auto","created_at":"2024-08-06 17:51:45","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1042189,"visible":true,"origin":"","legend":"\u003cp\u003eComparisons of the ∆CT values of TRPV1 gene expressions in the somatosensory cortex (A) and hippocampus (B) of both saline (n=3) or RIVA (n=3) administered 8-month-old WAG/Rij and age-matched saline (n=3) or RIVA (n=3) administered Wistar rats. **p\u0026lt;0.01; ***p\u0026lt;0.001 compared to the WAG/Rij saline group, \u003csup\u003e++\u003c/sup\u003ep\u0026lt;0.01; \u003csup\u003e+++\u003c/sup\u003ep\u0026lt;0.001 compared to the Wistar saline group.\u003c/p\u003e","description":"","filename":"Figure6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4724554/v1/31e4cfe331d85427cb89c251.jpg"},{"id":73093278,"identity":"d4bf69b1-4ef1-4ba5-822a-0dbf05d0f051","added_by":"auto","created_at":"2025-01-06 16:12:42","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":9488789,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4724554/v1/bdd72ba4-b11a-477d-bfdc-901912a0ceea.pdf"},{"id":61889044,"identity":"9909e80d-4d6f-49fc-aa83-9856056dd0ec","added_by":"auto","created_at":"2024-08-06 17:43:44","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":15078,"visible":true,"origin":"","legend":"","description":"","filename":"Supp.Table1.docx","url":"https://assets-eu.researchsquare.com/files/rs-4724554/v1/532b3258f53ab384b7b67212.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"The role of acetylcholinesterase enzyme inhibitor rivastigmine on spike-wave discharges, learning-memory, anxiety, and TRPV1 channel expression in genetic absence epileptic WAG/Rij rats","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eNon-convulsive absence seizures are characterized by consciousness with the appearance of simultaneous bilateral SWDs on the electroencephalogram with consequent comorbidities such as memory problems and anxiety [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Although the exact mechanism of absence epilepsy is not fully understood, oscillatory burst-firing originating from the thalamocortical circuit is thought to be responsible for the generation of SWDs [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. In thalamus, cells of the reticular thalamus generate strong inhibitory post synaptic potentials onto TC cells which contain high levels of T-type calcium channels. This severe inhibition induces strong postinhibitory rebound bursts which in turn reactivate both reticular thalamus and cortex [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. This phenomenon is called \u0026ldquo;rebound burst firing\u0026rdquo; which is seen during normal sleep [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e] or absence epilepsy [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eElectrophysiological, pharmacological, and behavioral characteristics of absence seizures in WAG/Rij rats, the most used strain in the studies of absence epilepsy [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e], are similar to those seen in human patients [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Spike-wave discharges become apparent on cortical EEG at 2 to 3 months of age and at 6 months of age, both male and female rats generate approximately 16\u0026ndash;20 discharges per hour, and the mean duration of these discharges is around 5 seconds [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Also, WAG/Rij rats exhibit behavioral changes associated with neuropsychiatric comorbidities such as learning-memory impairment [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e], anxiety [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e], and depression-like behavior [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAcetylcholine (ACh), one of the most ubiquitous neurotransmitters in the mammalian brain [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e], has a significant role in the occurrence, propagation, and control of epileptic seizures [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Studies revealed that acetylcholine has a dual role on seizures. While the systemic administration of cholinergic agonists carbachol or pilocarpine induces epileptic seizure [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], the selective activation of cholinergic neurons could produce obvious anti-seizure effects [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. The reason for these different effects may depend on the site of ACh release, receptor subtype, and target neuronal population or neural circuit [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Therefore, understanding the potential role of the cholinergic system is important in elucidating deeper mechanisms in epilepsy.\u003c/p\u003e \u003cp\u003eCholinesterase inhibitor drug RIVA are commonly used as a symptom-therapeutic option for dementia in Alzheimer\u0026rsquo;s and Parkinson\u0026rsquo;s diseases [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Anticholinesterases play a significant role on epileptic seizures. Evidence from case reports suggests that acetylcholinesterase inhibitors donepezil [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e] or tacrine [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e] can provoke seizures, while some animal studies demonstrated that acetylcholinesterase inhibitors have anti-seizure effects [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. In the rat study of Joeng et al., while long-term administration of donepezil after pilocarpine-induced seizure activity reduced neuronal death, pretreatment of donepezil even aggravated hippocampal damage. As aforementioned above, anticholinesterase drugs contain conflicting results on epileptic seizures just like acetylcholine. Furthermore, only one study showed the effect of acetylcholinesterase inhibitors on the absence epileptic seizures. Acute injections of the acetylcholinesterase inhibitor physostigmine caused a dose-dependent reduction in the duration of SWDs [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. However, no study has investigated the effect of long-term administration of AChE inhibitors on absence seizures so far.\u003c/p\u003e \u003cp\u003eTRPV1 is a non-selective calcium-permeable cation channel that is associated with a wide range of biological and pathophysiological functions on neurological diseases such as anxiety, fear, stress, and pain [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. In addition, TRPV1 channels are involved in the pathogenesis of epileptic seizures [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. The expression of TRPV1 channels mostly increased after generalized tonic-clonic seizures [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Regarding absence seizures, only one study reported increased TRPV1 expression in the hippocampus and cortex of 4-month-old WAG/Rij rats compared to 2-month-old WAG/Rij rats [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. On the other hand, several evidence suggests a possible interaction between the acetylcholine pathway and TRPV1 channels [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe aim of the present study is to investigate: 1. The effect of single-dose RIVA administrations on the SWD parameters of WAG/Rij rats, 2. The impact of long-term RIVA administrations on the SWD parameters of WAG/Rij rats, 3. The role of long-term RIVA administration on learning-memory and anxiety behaviors in WAG/Rij and age-matched Wistar rats, 4. The effect of long-term RIVA administration on cortical and hippocampal TRPV1 channel expression in WAG/Rij and age-matched Wistar rats.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Animals and groups\u003c/h2\u003e \u003cp\u003e After obtaining permission from Ondokuz Mayıs University Animal Experiments Local Ethics Committee (2022/08), male 8-month-old WAG/Rij (n\u0026thinsp;=\u0026thinsp;60) and age-matched Wistar (n\u0026thinsp;=\u0026thinsp;12) rats were purchased from Ondokuz Mayıs University Experimental Animal Research Center (OM\u0026Uuml; DEHAM). The rats were kept in separate cages under a temperature (22\u0026thinsp;\u0026plusmn;\u0026thinsp;1\u0026deg;C) and humidity (60\u0026ndash;65%) control unit, on a 12-hour dark-light cycle with free access to standard rat chow and water. All experiments were performed by ARRIVE guidelines and the Guide for the Care and Use of Laboratory Animals (NIH Publication No. 8023, revised 1978) by the US National Institutes of Health. The rats were divided into 12 groups (six animals each).\u003c/p\u003e \u003cp\u003eThe workflow of the study is shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. First, the effect of saline (Saline I) or single-dose (0.125, 0.25, 0.5, 1, 2 mg/kg) of RIVA on SWD parameters was evaluated electrophysiologically in 8-month-old WAG/Rij rats (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Then, low-dose (0.5 mg/kg) and high-dose (2 mg/kg) of RIVA was administered for consecutive 21 days to the 8-month-old WAG/Rij rats and ECoG recordings were obtained before and after 1st injection and one day after the 10th and 21st injections (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Eventually, in 8-month-old WAG/Rij and age-matched Wistar rats, the effect of long-term saline (Saline II for WAG/Rij and Saline III for Wistar) or high-dose RIVA (2 mg/kg) on learning-memory abilities and anxiety-like behavior were observed one day after the last injections, and subsequently, the right hippocampus and right somatosensory cortex were removed under sterile conditions for TRPV1 channel expressions (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eFor all experimental groups, rats which developed infection despite antibiotics, whose electrode was removed, or whose seizures could not be detected during baseline recordings were excluded from the study (n\u0026thinsp;=\u0026thinsp;7). The removed animals were replaced with animals of the same age and strain which were kept under the same conditions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. Placement of electrodes\u003c/h2\u003e \u003cp\u003eThe animals were starved one day before the operation and anesthetized with ketamine/xylazine (90/10 mg/kg). After anesthesia, the head hair was shaved for a clean surgical field then the rats were fixed using a stereotaxic apparatus. Anesthesia of the rats was assessed every 5 minutes through pain responses and ketamine maintenance was performed when necessary. In the first stage, the scalp was opened with an average 3 cm long incision in the rostrocaudal direction. After cleaning the soft tissue on the bone, stainless steel conductive screws were placed at the appropriate coordinates according to Paxinos and Watson's rat brain atlas [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]: first electrode, 4 mm anterior and 3 mm right lateral to bregma (frontal cortex); second electrode, 4 mm posterior and 3 mm right lateral to bregma (occipital cortex); and reference electrode, 4 mm posterior and 3 mm left lateral to bregma (occipital cortex) [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. A tripolar small jack electrode was connected to the screws with 3 pieces of copper wires, then the electrode and screws were fixed with dental acrylic (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). After this procedure, which lasted for about 45 minutes, buprenorphine hydrochloride (0.1 mg/kg) was given intramuscularly for analgesia. Ampicillin (50 mg/kg) was injected intraperitoneally once a day for 3 days to prevent infection.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3. Electrocorticography (ECoG) recordings and drugs\u003c/h2\u003e \u003cp\u003eAfter a 7-day healing period, rats were placed in cube-shaped glass cages (40x40x40 cm) where they could freely move. The rats were kept in cages for 2 hours for 3 days to get used to the laboratory environment. After the habituation period, rats were connected to the PowerLab recording system (PowerLab, 16/SP, AD Instruments, Australia) for 6 hours before and after injections (3\u0026thinsp;+\u0026thinsp;3 hours) to determine the acute effect of RIVA (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). To determine the long-term impact of RIVA (0.5 and 2 mg/kg), ECoG recordings were first obtained for 6 hours (before and after RIVA injections), followed by three-hour of ECoG recordings taken from 24 hours after the 10th and 21st injections (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Clusters of spike waves that lasted at least one second and had amplitude at least 2 times greater than baseline activity were defined as SWD. The number and mean duration of SWDs were recorded and manually analyzed with the help of the LabChart-7 Pro software which filtered between 0.3 and 120 Hz [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eRIVA was purchased from Sigma-Aldrich, dissolved in sterile physiological saline, and given in a constant volume of 1 mL. Since no animal studies have been performed with RIVA in epilepsy, appropriate doses were determined by reviewing the literature [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Behavioral tests (Y-maze, elevated plus maze)\u003c/h2\u003e \u003cp\u003e8-month-old WAG/Rij rats (n\u0026thinsp;=\u0026thinsp;12) and 8-month-old Wistar rats (n\u0026thinsp;=\u0026thinsp;12) were administered 2 mg/kg RIVA or saline for 21 days and 24 hours later they were subjected to behavioral tests. Each test was performed for 5 minutes between 10:00\u0026ndash;14:00 under the camera recording with a chronometer. Before the tests, the interior walls and floor of the entire experimental setup were cleaned with 20% alcohol each time and the alcohol was allowed to dry so that no odor from the previous mouse remained.\u003c/p\u003e \u003cp\u003eThe Y-maze, a test for spatial memory, was performed to evaluate drug-associated learning and memory. The test was performed on absence epileptic 8-month-old WAG/Rij and healthy 8-month-old Wistar rats after 21 days of RIVA or saline administration (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). Firstly, during the habituation test, arm C (novel arm) of the Y-maze apparatus was closed and rats were allowed to explore only two arms (arms A and B). Secondly, 24 hours later, during the experiment test, arm C was also opened, and the rats were allowed to move freely in three arms. The total number of arm entries, the number of A-B-C arm entries, the spent time in A-B-C arms, and number of spontaneous alternations were noted offline. The alternation index (percentage; %) was calculated by using the number of alternations and the total number of arm entries [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eDuring the elevated plus maze, a test for measuring anxiety-like behavior, rats were placed in the center with their face facing the open arm. The time spent and number of rats in open and closed arms were obtained during the 5-minute experimental period and analyzed offline from camera recordings [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5. Tissue replacement and qPCR protocol\u003c/h2\u003e \u003cp\u003eAfter behavioral tests, rats (three animals for each group) were anesthetized and perfused with tracer-free saline. After the perfusion process was completed, brains were removed and placed on a sterile cold surface. The right somatosensory cortex [(S1 barrel field; S1BF); coordinates: 1.7\u0026ndash;3.1 mm posterior, 5.2\u0026ndash;6.6 mm lateral to the bregma [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], and right hippocampus were placed into the sterile aliquoted eppendorfs and exposed to liquid nitrogen. The tissues were stored at -80\u003csup\u003eo\u003c/sup\u003eC till the RNA isolation. Total RNA was extracted according to the TRIzol method (Invitrogen, USA). Firstly, 50-mg tissue samples were weighed with a precision scale. Then TRIzol (1 mL) was added to the mortar-pounded tissue and pounded again with a pestle until it reached a liquid form. Liquidized tissues were placed in a new eppendorf and incubated at room temperature for 5 minutes. The eppendorf was placed in a pre-cooled centrifuge that was set at +\u0026thinsp;4\u0026deg;C, 12000 G, and centrifuged for 10 minutes. Then 3 visible phases were observed and the uppermost supernatant RNA-containing portion was carefully transferred to a new eppendorf. After chloroform (0.2 mL) was added, the final sample was gently inverted 15 times and incubated at room temperature for 2\u0026ndash;3 minutes. Each eppendorf was centrifuged at +\u0026thinsp;4\u0026deg;C, 12000 G, for 15 minutes. The clear phase was transferred to a new eppendorf and exposed to isopropanol (500 mL) and incubated at room temperature for 10 minutes. After incubation, the final sample was centrifuged at +\u0026thinsp;4\u0026deg;, 12000 G for 10 minutes, and the upper liquid was removed without touching the pellet. Cold alcohol (75%) was added to the remaining pellet and centrifuged at +\u0026thinsp;4\u0026deg;C, 7500 G for 5 minutes again. Then the liquid phase was removed and the alcohol was allowed to evaporate completely. After making sure that it was dry, it was dissolved with 20 \u0026micro;l DEPC-ddH\u003csub\u003e2\u003c/sub\u003eO and the purity of RNA was measured by NanoDrop spectrophotometer (Thermo Scientific\u0026trade; ND2000USCAN) at 260/280 nm absorbance. According to the protocol of the iScript\u0026trade; cDNA synthesis kit, isolated RNAs were converted to the circular deoxyribonucleic acid (cDNA) related to the purity, and thermal cycles were initiated by selecting the appropriate protocol in the PCR device according to the manufacturer's specifications. The cDNA samples were stored at -20\u0026deg;C up to qPCR analysis day.\u003c/p\u003e \u003cp\u003ePrimers that bind with high specificity to the target gene regions were tested for qPCR experiments. The target gene TRPV1 (for rats), as a target gene, and GAPDH (for rats), as a housekeeping gene (internal control), were used and the sequences for each target gene were listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Finally, qPCR was performed by using SsoAdvanced\u0026trade; Universal SYBR\u0026reg; Green Supermix (Bio-Rad, Hercules, CA) for amplification reactions. The effects of compounds on gene expression levels of TRPV1 were evaluated by the comparative ΔΔCt (delta-delta CT) method [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e] to provide a relative quantification ratio according to calibrator that allows statistical comparisons of gene expression among samples. The comparative threshold (CT) method after determining the CT values for or reference (GAPDH) and target (TRPV1) genes in each sample set according to the 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e method. Changes in mRNA expression level were calculated after normalization to GAPDH. cDNA from control groups was used as a calibrator sample.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eTarget gene-specific primers used for the qPCR.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTarget gene (species)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer sequence (5\u0026prime;\u0026ndash;3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTRPV1 (rattus norvegicus)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: CAAGGC ACTTGCTGGTCTTG\u003c/p\u003e \u003cp\u003eR: GTTCCGTGAACGACCAGAAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH (rattus norvegicus)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GCATCTTCTTGTGCAGTGCC\u003c/p\u003e \u003cp\u003eR: ACCAGCTTCCCATTCTCAGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eF: Forward, R: Reverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Statistical analysis\u003c/h2\u003e \u003cp\u003eElectrophysiological, behavioral, and molecular data were compared using SPSS v21 (SPSS Inc., Chicago, IL). Shapiro-Wilk test was used to determine the normal distribution of the data. To compare the dose-dependent effect of RIVA, one-way ANOVA and post-hoc Tukey test were used for parametric data or Kruskal-Wallis and post-hoc Dunn test were used for non-parametric data. For determining the time-dependent effect of RIVA, two-way ANOVA followed by a post-hoc Tukey test was applied. Repeated measures of ANOVA and then the Tukey test were used for the long-term effect of RIVA. Independent sample t-test or Mann-Whitney U test was applied to compare behavioral tests or qPCR analysis. All values of the experimental groups used in graphs and text were expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error of mean except qPCR data (mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation). For all statistical tests, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e3.1. Effects of RIVA on SWDs parameters\u003c/h2\u003e \u003cp\u003eECoG activities were recorded acutely and after the long-term RIVA administrations. No significant difference was found among the baseline ECoG activities of any groups (Supp. Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Therefore, after injection data of the acute injection RIVA groups and Saline I group were compared. For the long-term administration groups, ECoG recordings 24 hours after the 10th and 21st injections were compared to the before- and after-injection data of the first day.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section3\"\u003e \u003ch2\u003e3.1.1. The effects of single-dose RIVA administration on SWDs parameters\u003c/h2\u003e \u003cp\u003eSaline injection did not alter the total number and the mean duration of SWDs compared to the baseline (t\u003csub\u003e5\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;3.099). During the baseline recording, the total number and the mean duration of SWDs were 99.50\u0026thinsp;\u0026plusmn;\u0026thinsp;6.13 and 5.63\u0026thinsp;\u0026plusmn;\u0026thinsp;0.30 sec, respectively. After the saline injection, the total number and mean duration of SWDs were 96.17\u0026thinsp;\u0026plusmn;\u0026thinsp;6.17 and 5.50\u0026thinsp;\u0026plusmn;\u0026thinsp;0.26 sec, respectively.\u003c/p\u003e \u003cp\u003eRIVA at a dose of 0.125 mg/kg did not cause a change, while 0.25, 0.5, 1, and 2 mg RIVA decreased the total number of SWDs compared to the control group (F\u003csub\u003e5,30\u003c/sub\u003e = 86.11; p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). The total number of SWDs at the doses of 0.125, 0.25, 0.5, 1, and 2 mg RIVA were 93.00\u0026thinsp;\u0026plusmn;\u0026thinsp;4.08; 54.83\u0026thinsp;\u0026plusmn;\u0026thinsp;5.38; 45.50\u0026thinsp;\u0026plusmn;\u0026thinsp;6.18; 1.80\u0026thinsp;\u0026plusmn;\u0026thinsp;0.37; and 0.67\u0026thinsp;\u0026plusmn;\u0026thinsp;0.33, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). The anti-seizure effect started after 90 minutes in the 0.25 and 0.5 mg/kg RIVA groups (p\u0026thinsp;=\u0026thinsp;0.29; p\u0026thinsp;=\u0026thinsp;0.14, respectively), while it started in the first 30 minutes in the 1 and 2 mg/kg RIVA groups (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001; p\u0026thinsp;\u0026lt;\u0026thinsp;0.001, respectively) and continued until the end of the recording (F\u003csub\u003e8,309\u003c/sub\u003e = 39.48). The number of SWDs between 90 to 120 min was 11.4\u0026thinsp;\u0026plusmn;\u0026thinsp;1.04; 5.83\u0026thinsp;\u0026plusmn;\u0026thinsp;2.02; 5.33\u0026thinsp;\u0026plusmn;\u0026thinsp;1.30; 1.66\u0026thinsp;\u0026plusmn;\u0026thinsp;0.50; 0.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00 in the saline; 0.25, 0.5, 1, and 2 mg RIVA groups, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). The mean duration of SWDs only decreased at the doses of 1 and 2 mg/kg RIVA (F\u003csub\u003e5,30\u003c/sub\u003e = 10.72) (p\u0026thinsp;=\u0026thinsp;0.12; p\u0026thinsp;=\u0026thinsp;0.004, respectively). After the administration of 1 and 2 mg/kg RIVA, the mean duration of SWDs was 4.31\u0026thinsp;\u0026plusmn;\u0026thinsp;0.15 and 4.16\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05 sec, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). Representative ECoG recordings were shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section3\"\u003e \u003ch2\u003e3.1.2. The effect of long-term administration RIVA on the SWDs parameters\u003c/h2\u003e \u003cp\u003eLong-term ECoG activities were recorded on the 1st day before (baseline activity) and after (acute) injections, and on the 11th and 22nd days after 24 hours from the last injections of 0.5 and 2 mg/kg RIVA.\u003c/p\u003e \u003cp\u003eRIVA, at a dose of 0.5 mg/kg, increased the total number of SWDs on the 11th and 22nd days compared to the single-dose injection (F\u003csub\u003e3,15\u003c/sub\u003e = 29.28; p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) without affecting the mean duration (F\u003csub\u003e3,15\u003c/sub\u003e = 2.229) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). The total number of SWDs at the baseline, after single-dose injection, and 11th and 22nd days were 98.00\u0026thinsp;\u0026plusmn;\u0026thinsp;5.17; 44.83\u0026thinsp;\u0026plusmn;\u0026thinsp;4.22; 92.67\u0026thinsp;\u0026plusmn;\u0026thinsp;7.27; 109.70\u0026thinsp;\u0026plusmn;\u0026thinsp;9.38, respectively. Furthermore, 2 mg/kg RIVA increased the total number of SWDs on the 11th and 22nd day compared to both baseline activity (F\u003csub\u003e3,15\u003c/sub\u003e = 596.4) (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001; p\u0026thinsp;\u0026lt;\u0026thinsp;0.001, respectively) and acute injection (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001; p\u0026thinsp;\u0026lt;\u0026thinsp;0.001, respectively) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). The total number of SWDs at the baseline, after single-dose injection, and 11th and 22nd days were 98.83\u0026thinsp;\u0026plusmn;\u0026thinsp;5.62; 1.50\u0026thinsp;\u0026plusmn;\u0026thinsp;0.22; 158.70\u0026thinsp;\u0026plusmn;\u0026thinsp;5.29; and 233.70\u0026thinsp;\u0026plusmn;\u0026thinsp;6.25, respectively. Interestingly, the mean duration of SWDs decreased on the 22nd days compared to both baseline activity and acute injection (F\u003csub\u003e3,15\u003c/sub\u003e = 37.50) (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001; p\u0026thinsp;\u0026lt;\u0026thinsp;0.001, respectively) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). The mean duration of SWDs at the baseline, after single-dose injection, and 11th and 22nd days were 5.60\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05; 5.07\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10; 5.11\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13; and 3.99\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11 sec, respectively.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e3.2. The effect of RIVA on learning-memory and anxiety-like behavior\u003c/h2\u003e \u003cp\u003eFigure \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e shows the Y-maze test performance results of the WAG/Rij and Wistar rats after RIVA administrations. Only, the number of total entries and new arm entries were less in WAG/Rij rats compared to the na\u0026iuml;ve Wistar rats [(t\u003csub\u003e10\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;2.515; p\u0026thinsp;=\u0026thinsp;0.031), p\u0026thinsp;=\u0026thinsp;0.006, respectively). In WAG/Rij rats, the number of total arm entries (p\u0026thinsp;=\u0026thinsp;0.001), the number of spontaneous alternations (p\u0026thinsp;=\u0026thinsp;0.005), the alternation index (p\u0026thinsp;=\u0026thinsp;0.041), the number of A, B, C (new) arm entries (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001; p\u0026thinsp;=\u0026thinsp;0.009; p\u0026thinsp;=\u0026thinsp;0.006, respectively), and spent time in B, C arms (p\u0026thinsp;=\u0026thinsp;0.005; p\u0026thinsp;=\u0026thinsp;0.002, respectively) decreased after consecutive 21 days of RIVA injection. Only start arm time spend activity increased in the 21-day RIVA-treated WAG/Rij rats compared to the saline group (p\u0026thinsp;=\u0026thinsp;0.001). In Wistar rats, RIVA treatment did not cause any change on measured parameters compared to the saline group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA-I).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eFigure \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e represents open and closed field activities and durations which are anxiety-indicated patterns after RIVA administrations. There were no differences in the open field and closed field activities, whereas the open field duration was lower (t\u003csub\u003e10\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;3.636; p\u0026thinsp;=\u0026thinsp;0.007) and the closed field duration was higher (t\u003csub\u003e10\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;3.598; p\u0026thinsp;=\u0026thinsp;0.007) in saline-injected WAG/Rij rats compared to the saline-injected Wistar rats. In WAG/Rij rats, RIVA administration increased the open field duration (t\u003csub\u003e10\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;10.21; p\u0026thinsp;\u0026lt;\u0026thinsp;0.001), while closed field activity (p\u0026thinsp;=\u0026thinsp;0.008) and duration (t\u003csub\u003e10\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;10.21; p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) were decreased. In Wistar rats, no difference was found in the open field and closed field activities, while open field duration was higher and closed field duration was lower in RIVA-treated rats compared to the saline group (t\u003csub\u003e10\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;8.929; p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA-D).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e3.3. The effect of long-term RIVA administration on TRPV1 channel expressions\u003c/h2\u003e \u003cp\u003eThere was no difference in the levels of the TRPV1 expression in the somatosensory cortex and hippocampus between saline-injected WAG/Rij and Wistar rats. Long-term RIVA administrations, at a dose of 2 mg/kg, decreased the TRPV1 expression in WAG/Rij rats compared to the WAG/Rij saline group in the somatosensory cortex and the hippocampus [(t\u003csub\u003e4\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;33.04; p\u0026thinsp;\u0026lt;\u0026thinsp;0.001), (t\u003csub\u003e4\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;18.84; p\u0026thinsp;\u0026lt;\u0026thinsp;0.001), respectively], while TRPV1 expression increased in Wistar rats compared to the Wistar saline group in the somatosensory cortex and the hippocampus [(t\u003csub\u003e4\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;4.986; p\u0026thinsp;=\u0026thinsp;0.008), (t\u003csub\u003e4\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;9.279; p\u0026thinsp;\u0026lt;\u0026thinsp;0.001), respectively] (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA, \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eSingle-dose intraperitoneal administration of AChE inhibitor RIVA dose-dependently reduced the total number and the mean duration of SWDs in WAG/Rij rats. Interestingly, long-term RIVA administration to the WAG/Rij rats increased the number of SWDs and decreased the mean duration of SWDs. Furthermore, long-term RIVA administration decreased learning-memory abilities and anxiety-like behavior in WAG/Rij rats, while RIVA only decreased anxiety-like behavior in Wistar rats. In addition, long-term administration of RIVA caused a decrease in TRPV1 gene expression in epileptic WAG/Rij rats while it caused an increase in in non-epileptic Wistar rats.\u003c/p\u003e \u003cp\u003eThe cholinergic system has an essential role in many physiological functions in the brain such as neuronal excitability, synaptic transmission, and synaptic plasticity [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. In terms of epileptic seizures, the effect of the cholinergic system seems to be double-sided. While the selective activation of cholinergic neurons could produce significant anti-seizure effects [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], the systemic administration of cholinergic agonists carbachol or pilocarpine has long been reported to trigger seizure activity [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. On the other hand, acetylcholinesterase inhibitor drugs contain conflicting results on epileptic seizures. Seizure resistance was increased by an AChE inhibitor donepezil in Scn1a mutant mice and wild-type littermates by the activation of GABA\u003csub\u003eA\u003c/sub\u003e receptors [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Additionally, Huperzine A, a blood-brain barrier permeable selective reversible inhibitor of AChE, has shown a protective effect against NMDA-induced seizures and status epilepticus [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Contrary to these studies, tacrine, another AChE inhibitor, increased the seizure severity and facilitated the formation of PTZ kindling in mice [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eOnly a limited number of studies have examined the relationship between the cholinergic system and the absence seizures. Unilateral cholinotoxine injections to the reticular thalamic nucleus decreased the number and duration of SWDs compared to the basal recordings [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Danober et al. reported that acute systemic injections of muscarinic receptor agonists oxotremorine or pilocarpine, and an acetylcholinesterase inhibitor physostigmine reduced the duration of SWDs in a dose-dependent manner in GAERS rat. Interestingly, the muscarinic receptor antagonist scopolamine increased the duration of SWDs at lower doses, while it suppressed SWDs at higher doses [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. In the present study, single-dose administration of RIVA dose-dependently decreased the mean duration of SWDs, as physostigmine mentioned above. Also, RIVA decreased the number of SWDs different from Danober et al. [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. However, there is no data regarding long-term AChE inhibition in the absence epilepsy. In contrast to the acute effect, long-term high-dose RIVA administration increased the total number of SWDs and decreased the mean duration of SWDs. Moreover, long-term low-dose RIVA administration increased the number of SWDs compared to single-dose administration and similar to the baseline activity without affecting the mean duration. T-type calcium channels [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e] and HCN channels [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e] are involved in the pathogenesis of absence seizures, which interact with the acetylcholine pathway. This may explain the effect of RIVA on the absence epileptic activity in the present study. The low threshold T-type Ca\u003csup\u003e2+\u003c/sup\u003e conductance of the cat thalamic lateral geniculate nucleus (LGN) relay cells was directly inhibited by ACh when the membrane potential was clamped to the control level and this inhibitory effect was independent of the changes in membrane potential by ACh [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. Moreover, in another patch-clamp study, Hildebrandt et al. have noted that activation of M1 muscarinic acetylcholine receptors selectively and reversibly inhibits Cav3.3 channel activity but either no effect on Cav3.1 and Cav3.2 peak current amplitudes and this modulation was observed for both rat and human T-type Ca\u003csup\u003e2+\u003c/sup\u003e channel variants [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. On the other hand, neostigmine-stimulated endogenous acetylcholine release showed a selective suppressive effect on \u003cem\u003eI\u003c/em\u003e\u003csub\u003e\u003cem\u003eh\u003c/em\u003e\u003c/sub\u003e and resonance in burst firing in Wistar rats [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. Furthermore, in the cholinergic interneurons of the striatum, activation of muscarinic receptors downregulates internal cAMP which would result in the reduction of \u003cem\u003eI\u003c/em\u003e\u003csub\u003e\u003cem\u003eh\u003c/em\u003e\u003c/sub\u003e and inhibition of spontaneous firing [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. In light of the aforementioned studies, since the increase in acetylcholine can suppress both T-type Ca\u003csup\u003e2+\u003c/sup\u003e channels and HCN channels, single-dose RIVA administration may reduce SWDs parameters by this way. Moreover, long-term RIVA administration may alter the expression of these channels, which may lead to an increase in SWDs, just as the suppression of HCN channels caused an increase in HCN channel expression in our previous study [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eLearning-memory abilities difficulties and anxiety disorders may frequently occur in individuals with absence epilepsy [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. In many studies, genetic absence epileptic WAG/Rij rats exhibited memory and learning problems [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e], depression-like symptoms [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e], and anxiety-related symptoms [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. Anticholinergic agent RIVA, which has not been studied in epilepsy, is used to slow down the bad progression of learning-memory abilities and anxiety, which are symptoms of dementia [\u003cspan additionalcitationids=\"CR50\" citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. In the present study, long-term (21 days) high-dose of RIVA were administered to both 8-month-old WAG/Rij rats and non-epileptic age-matched Wistar rats. WAG/Rij rats showed a reduction in the total number of arm and new arm entries compared to the Wistar rats. On the other hand, long-term RIVA administration did not affect the learning-memory abilities performance in Wistar rats. However, almost all observed Y-maze parameters were reduced in WAG/Rij rats with the long-term administration of RIVA, which increased SWDs. These findings are in line with Leo et al. (2019)who suggested that learning-memory abilities performance is likely linked to an increase in spike-wave discharges [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Regarding anxiety, as in many studies [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e, \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e], WAG/Rij rats had a higher anxiety-like behavior than Wistar rats in the present study. Also, Fedosova et al. noted that WAG/Rij rats display increased anxiety and higher stress response after 2-month-old compared to the Wistar rats [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Moreover, long-term RIVA administration decreased anxiety-like behavior both in WAG/Rij and Wistar rats. On the other hand, several studies have shown that too high or too low anxiety responses can have negative consequences for both vital responses and some abilities such as learning-memory abilities [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. Very low or very high levels of stress lead to learning-memory abilities impairment which is called an \u0026ldquo;inverted U relationship\u0026rdquo; [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e, \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. In consequence, the increased number of SWDs and low anxiety-like behavior with long-term RIVA administration are likely to cause learning-memory abilities impairment.\u003c/p\u003e \u003cp\u003eTRPV1, a calcium-permeable cation channel [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e], is well-studied in the peripheral nervous system, however, its role in the central nervous system remains to be investigated in detail [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e, \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]. TRPV1 is also associated with a wide range of functions in the central nervous system, such as fear, anxiety, stress, learning-memory abilities, thermoregulation, pain, and synaptic plasticity [\u003cspan additionalcitationids=\"CR59\" citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e]. Moreover, it can also be associated with neurological diseases such as epilepsy [\u003cspan additionalcitationids=\"CR62\" citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e]. Conflicting results have been reported for TRPV1 in convulsive epilepsy. Since TRPV1 channels increase calcium ion accumulation, stimulation of these channels is expected to increase tonic-clonic seizures under normal conditions. However, studies reveal different results. Manna and Umathe (2012) found that intracerebroventricular injection of TRPV1 agonist capsaicin exhibited proconvulsant activity that was blocked by capsazepine pretreatment in PTZ-induced seizures in mice. Conversely, intraperitoneal administration of capsaicin decreased seizure severity and neuronal damage in PTZ-induced seizures in rats [\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e]. Furthermore, other TRPV1 agonist piperine delayed the onset of myoclonic jerks and generalized clonic seizures and decreased the seizure stage and mortality in PTZ-induced seizures in mice [\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e]. Interestingly, Jia et al. showed that hippocampal administration of both TRPV1 agonists or antagonists reduced the susceptibility to PTZ-induced seizures in mice. Moreover, in the same study, TRPV1 knockout mice and hippocampal TRPV1 overexpression mice showed decreased susceptibility to PTZ-induced seizures [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIncreased TRPV1 expression was reported in the temporal cortex and hippocampus of patients with mesial temporal lobe epilepsy [\u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e]. Moreover, expression levels of TRPV1 mRNA and protein increased after febrile seizures in wild-type mice [\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e]. In the status epilepticus model induced by pilocarpine, an acetylcholine agonist acting on muscarinic receptors, the TRPV1 receptor was overexpressed in the dentate gyrus of mice [\u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e] and the hippocampus of the rats [\u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e]. Regarding the absence epilepsy, only one study indicated the levels of TRPV1 [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. According to the immunoblotting analysis, protein levels of TRPV1 were lower in two- and 6-month-old WAG/Rij rats compared to age-matched Wistar rats in the somatosensory cortex [\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e]. Interestingly, TRPV1 protein expression was lower in the 2-month-old and higher in the 6-month-old WAG/Rij rats compared to age-matched Wistar rats in the hippocampus [\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e]. In contrast to this study, there was no difference in TRPV1 gene expression in both the somatosensory cortex and hippocampus of 8-month-old WAG/Rij compared to age-matched Wistar rats. The protein levels did not measured in experimental groups which may be considered the major limitation of the present study. On the other hand, long-term RIVA administration decreased the mRNA levels of TRPV1 in WAG/Rij rats in the somatosensory cortex and hippocampus, whereas mRNA levels of TRPV1 were increased in Wistar rats after long-term RIVA administration in both regions. We consider that these different effects may be explained due to genetic defects such as channelopathies in WAG/Rij rats [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e]. Although the role of activation or inhibition of TRPV1 receptors on SWDs is not known yet, Talebi et al. suggested that reduction of the TRPV1 receptors could play an important role in the pathophysiology of absence epilepsy [\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e]. Therefore, we suggest that decreased TRPV1 channel expression may lead to increased absence seizures, however further studies are needed to prove this hypothesis.\u003c/p\u003e \u003cp\u003eIn conclusion, while single-dose administration of AChE inhibitor RIVA decreased the SWDs parameters, long-term administration caused an increase in the number of SWDs in WAG/Rij rats. This effect may be mediated through altered expressions of calcium channels such as T-type, HCN, and TRPV1 channels. Long-term RIVA treatment decreased learning-memory abilities and anxiety in WAG/Rij rats, but only anxiety in Wistar rats. TRPV1 gene expression was found to be decreased in WAG/Rij rats, however, it increased in Wistar rats suggesting this may be due to the genetic deficiencies of WAG/Rij rats.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eG.A., E.A., M.A., and E.T.A. planned the experiments; G.A., E.T.A., and B.O. conducted the electrophysiological experiments; E.T.A. and B.O. applied the behavioral tests; E.T.A. made molecular experiments; G.A. and E.T.A. analyzed the data; G.A. and E.T.A. made the graphics and statistical analysis; G.A., E.A., M.A., and E.T.A. wrote the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics Approval\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study was performed by the ethical standards as laid down in the 1964 Declaration of Helsinki and its later amendments or comparable ethical standards. The experimental protocol was approved by Ondokuz Mayıs University Animal Experiments Local Ethics Committee (Approval No: 2022/08).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e This work was supported by Scientific Research Coordination Unit of Ondokuz Mayıs University (PYO.TIP.1904.22.030).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors would like to thank Dr Emre Soner Tiryaki for technical support during the electrophysiological experiments. \u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eMeeren HK, Pijn JPM, Van Luijtelaar EL, Coenen AM, da Silva FHL (2002) Cortical focus drives widespread corticothalamic networks during spontaneous absence seizures in rats. J Neurosci 22:1480\u0026ndash;1495\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFutatsugi Y, Riviello JJ Jr (1998) Mechanisms of generalized absence epilepsy. Brain Develop 20:75\u0026ndash;79\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuguenard J (2019) Current controversy: spikes, bursts, and synchrony in generalized absence epilepsy: unresolved questions regarding thalamocortical synchrony in absence epilepsy. Epilepsy Currents 19:105\u0026ndash;111\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCheong E, Shin H-S (2013) T-type Ca2\u0026thinsp;+\u0026thinsp;channels in absence epilepsy. Biochim et Biophys Acta (BBA)-Biomembranes 1828:1560\u0026ndash;1571\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSteriade M (2005) Sleep, epilepsy and thalamic reticular inhibitory neurons. Trends Neurosci 28:317\u0026ndash;324\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNoebels JL (2005) Calcium channel gaiting and absence epilepsy. Epilepsy currents 5:95\u0026ndash;97\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJafarian M, Alipour ME, Karimzadeh F (2020) Experimental models of absence epilepsy. Basic Clin Neurosci 11:715\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCoenen A, Van Luijtelaar E (2003) Genetic animal models for absence epilepsy: a review of the WAG/Rij strain of rats. Behav Genet 33:635\u0026ndash;655\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLeo A, Citraro R, Tallarico M, Iannone M, Fedosova E, Nesci V, De Sarro G, Sarkisova K, Russo E (2019) Cognitive impairment in the WAG/Rij rat absence model is secondary to absence seizures and depressive-like behavior. Prog Neuropsychopharmacol Biol Psychiatry 94:109652\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFedosova E, Sarkisova KY, Kudrin V, Narkevich V, Bazyan A (2015) Behavioral and neurochemical characteristics of two months old WAG/Rij rats with genetic absence epilepsy. Intern J Clin Exper Neurol 3:32\u0026ndash;44\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAllaway KC, Machold R (2017) Developmental specification of forebrain cholinergic neurons. Dev Biol 421:1\u0026ndash;7\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Y, Wang Y, Xu C, Wang S, Tan N, Chen C, Chen L, Wu X, Fei F, Cheng H (2020) Direct septum-hippocampus cholinergic circuit attenuates seizure through driving somatostatin inhibition. Biol Psychiatry 87:843\u0026ndash;856\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCuria G, Longo D, Biagini G, Jones RS, Avoli M (2008) The pilocarpine model of temporal lobe epilepsy. J Neurosci Methods 172:143\u0026ndash;157\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Y, Tan B, Wang Y, Chen Z (2021) Cholinergic signaling, neural excitability, and epilepsy. Molecules 26:2258\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eColovic MB, Krstic DZ, Lazarevic-Pasti TD, Bondzic AM, Vasic VM (2013) Acetylcholinesterase inhibitors: pharmacology and toxicology. Curr Neuropharmacol 11:315\u0026ndash;335\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBabic T, Zurak N (1999) Convulsions induced by donepezil. J Neurol Neurosurg Psychiatry 66:410\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLebert F, Hasenbroekx C, Pasquier F, Petit H (1996) Convulsive effects of tacrine. Lancet 347:1339\u0026ndash;1340\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWong JC, Thelin JT, Escayg A (2019) Donepezil increases resistance to induced seizures in a mouse model of Dravet syndrome. Ann Clin Transl Neurol 6:1566\u0026ndash;1571\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJeong JH, Choi BY, Kho AR, Lee SH, Hong DK, Lee SH, Lee SY, Song HK, Choi HC, Suh SW (2017) Diverse effects of an acetylcholinesterase inhibitor, donepezil, on hippocampal neuronal death after pilocarpine-induced seizure. Int J Mol Sci 18:2311\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDanober L, Depaulis A, Marescaux C, Vergnes M (1993) Effects of cholinergic drugs on genetic absence seizures in rats. Eur J Pharmacol 234:263\u0026ndash;268\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAguiar D, Moreira F, Terzian A, Foga\u0026ccedil;a M, Lisboa S, Wotjak C, Guimaraes F (2014) Modulation of defensive behavior by transient receptor potential vanilloid type-1 (TRPV1) channels. Neurosci Biobehavioral Reviews 46:418\u0026ndash;428\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFu M, Xie Z, Zuo H (2009) TRPV1: a potential target for antiepileptogenesis. Med Hypotheses 73:100\u0026ndash;102\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLazarini-Lopes W, Silva-Cardoso GK, Leite-Panissi CRA, Garcia-Cairasco N (2022) Increased TRPV1 channels and FosB protein expression are associated with chronic epileptic seizures and anxiogenic-like behaviors in a Preclinical model of temporal lobe epilepsy. Biomedicines 10:416\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJia Y-F, Li Y-C, Tang Y-P, Cao J, Wang L-P, Yang Y-X, Xu L, Mao R-R (2015) Interference of TRPV1 function altered the susceptibility of PTZ-induced seizures. Front Cell Neurosci 9:20\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGhorbani S, Alizadeh L, Akhlaghi F, Moeeni SS, Karimzadeh F (2021) Alteration of Neuregulin 1/Erbb4 in Absence Epilepsy: Regulatory Effect on TRPV1 Expression. Basic and Clinical Neuroscience 12\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi X, Xu Y, Cheng Y, Wang R (2018) α7 Nicotinic acetylcholine receptor contributes to the alleviation of lung ischemia\u0026ndash;reperfusion injury by transient receptor potential vanilloid type 1 stimulation. J Surg Res 230:164\u0026ndash;174\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eArkhipov AY, Fedorov NS, Nurullin LF, Khabibrakhmanov AN, Mukhamedyarov MA, Samigullin DV, Malomouzh AI (2023) Activation of TRPV1 Channels Inhibits the Release of Acetylcholine and Improves Muscle Contractility in Mice. Cell Mol Neurobiol 43:4157\u0026ndash;4172\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePaxinos G, Watson C (2006) The rat brain in stereotaxic coordinates: hard cover edition. Elsevier\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGunes H, Ozdemir E, Arslan G (2019) Coenzyme Q10 increases absence seizures in WAG/Rij rats: The role of the nitric oxide pathway. Epilepsy Res 154:69\u0026ndash;73\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDoǧan E, Ayg\u0026uuml;n H, Arslan G, Rzayev E, Avcı B, Ayyıldız M, Ağar E (2020) The role of NMDA receptors in the effect of purinergic P2X7 receptor on spontaneous seizure activity in WAG/Rij rats with genetic absence epilepsy. Front NeuroSci 14:414\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbdel-Aal RA, Assi A-AA, Kostandy BB (2011) Rivastigmine reverses aluminum-induced behavioral changes in rats. Eur J Pharmacol 659:169\u0026ndash;176\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eConrad CD, Galea LA, Kuroda Y, McEwen BS (1996) Chronic stress impairs rat spatial memory on the Y maze, and this effect is blocked by tianeptine treatment. Behav Neurosci 110:1321\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRodgers R, Dalvi A (1997) Anxiety, defence and the elevated plus-maze. Neurosci Biobehavioral Reviews 21:801\u0026ndash;810\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLivak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2\u0026thinsp;\u0026ndash; ∆∆CT method. Methods 25:402\u0026ndash;408\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePicciotto MR, Higley MJ, Mineur YS (2012) Acetylcholine as a neuromodulator: cholinergic signaling shapes nervous system function and behavior. Neuron 76:116\u0026ndash;129\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShapiro L, Wong JC, Escayg A (2019) Reduced cannabinoid 2 receptor activity increases susceptibility to induced seizures in mice. Epilepsia 60:2359\u0026ndash;2369\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eColeman BR, Ratcliffe RH, Oguntayo SA, Shi X, Doctor BP, Gordon RK, Nambiar MP (2008) [+]-Huperzine A treatment protects against N-methyl-D-aspartate-induced seizure/status epilepticus in rats. Chemico-Biol Interact 175:387\u0026ndash;395\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGetova D, Dimitrova D (2000) Effects of the anticholinesterase drug tacrine on the development of PTZ kindling and on learning and memory processes in mice. Folia medica 42:5\u0026ndash;9\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBerdiev R, Chepurnov S, Veening J, Chepurnova N, Van Luijtelaar G (2007) The role of the nucleus basalis of Meynert and reticular thalamic nucleus in pathogenesis of genetically determined absence epilepsy in rats: a lesion study. Brain Res 1185:266\u0026ndash;274\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCrunelli V, David F, Morais TP, Lorincz ML (2023) HCN channels and absence seizures. Neurobiol Dis :106107\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTiryaki ES, Arslan G, G\u0026uuml;naydın C, Ayyıldız M, Ağar E (2023) The role of HCN channels on the effects of T-type calcium channels and GABAA receptors in the absence epilepsy model of WAG/Rij rats. Pfl\u0026uuml;gers Archiv-European J Physiol :1\u0026ndash;14\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLo F, Sherman S (1997) Acetylcholine decreases low threshold T-type calcium conductance of relay cells in the cat's lateral geniculate nucleus. Sheng li xue bao:[Acta Physiol Sinica] 49:307\u0026ndash;313\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHildebrand ME, David LS, Hamid J, Mulatz K, Garcia E, Zamponi GW, Snutch TP (2007) Selective inhibition of CaV3. 3 T-type calcium channels by Gαq/11-coupled muscarinic acetylcholine receptors. J Biol Chem 282:21043\u0026ndash;21055\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVasnik S, Sikdar SK (2021) Cholinergic receptor\u0026ndash;independent modulation of intrinsic resonance in the rat subiculum neurons through inhibition of hyperpolarization-activated cyclic nucleotide‐gated channels. Acta Physiol 231:e13603\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao Z, Zhang K, Liu X, Yan H, Ma X, Zhang S, Zheng J, Wang L, Wei X (2016) Involvement of HCN channel in muscarinic inhibitory action on tonic firing of dorsolateral striatal cholinergic interneurons. Front Cell Neurosci 10:71\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarone V, Van Putten MJ, Visser GH (2020) Absence epilepsy: Characteristics, pathophysiology, attention impairments, and the related risk of accidents. A narrative review. Epilepsy Behav 112:107342\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLeo A, Citraro R, Tallarico M, Iannone M, Fedosova E, Nesci V, De Sarro G, Sarkisova K, Russo E (2019) Cognitive impairment in the WAG/Rij rat absence model is secondary to absence seizures and depressive-like behavior. Prog Neuropsychopharmacol Biol Psychiatry 94:109652\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSarkisova K, van Luijtelaar G (2011) The WAG/Rij strain: a genetic animal model of absence epilepsy with comorbidity of depressiony. Prog Neuropsychopharmacol Biol Psychiatry 35:854\u0026ndash;876\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGauthier S, Juby A, Rehel B, Schecter R (2007) EXACT: rivastigmine improves the high prevalence of attention deficits and mood and behaviour symptoms in Alzheimer's disease. Int J Clin Pract 61:886\u0026ndash;895\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMamikonyan E, Xie SX, Melvin E, Weintraub D (2015) Rivastigmine for mild cognitive impairment in Parkinson disease: A placebo-controlled study. Mov Disord 30:912\u0026ndash;918\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThippeswamy AH, Rafiq M, shastry Viswantha GL, Kavya KJ, Anturlikar SD, Patki PS (2013) Evaluation of Bacopa monniera for its synergistic activity with rivastigmine in reversing aluminum-induced memory loss and learning deficit in rats. J Acupunct Meridian Stud 6:208\u0026ndash;213\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAri C, Kov\u0026aacute;cs Z, Juhasz G, Murdun C, Goldhagen CR, Koutnik AP, Poff AM, Kesl SL, D\u0026rsquo;Agostino DP (2016) Exogenous ketone supplements reduce anxiety-related behavior in Sprague-Dawley and Wistar Albino Glaxo/Rijswijk rats. Front Mol Neurosci 9:137\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDiamond DM, Bennett MC, Fleshner M, Rose GM (1992) Inverted-U relationship between the level of peripheral corticosterone and the magnitude of hippocampal primed burst potentiation. Hippocampus 2:421\u0026ndash;430\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSalehi B, Cordero MI, Sandi C (2010) Learning under stress: the inverted-U-shape function revisited. Learn Mem 17:522\u0026ndash;530\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSzallasi A, Blumberg PM (1999) Vanilloid (Capsaicin) receptors and mechanisms. Pharmacol Rev 51:159\u0026ndash;212\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiddle RA (2007) The role of Transient Receptor Potential Vanilloid 1 (TRPV1) channels in pancreatitis. Biochimica et Biophysica Acta (BBA)-Molecular. Basis Disease 1772:869\u0026ndash;878\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSzallasi A, Gunthorpe MJ (2008) Peripheral TRPV1 receptors as targets for drug development: new molecules and mechanisms. Curr Pharm Design 14:32\u0026ndash;41\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEdwards JG (2014) TRPV1 in the central nervous system: synaptic plasticity, function, and pharmacological implications. Capsaicin as a therapeutic molecule:77\u0026ndash;104\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIglesias LP, Aguiar DC, Moreira FA (2022) TRPV1 blockers as potential new treatments for psychiatric disorders. Behav Pharmacol 33:2\u0026ndash;14\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTopuz RD, Cetinkaya MZ, Erumit D, Aydemir KD, Gunduz O, Karadag CH, Ulugol A (2021) The role of endocannabinoid system and TRPV1 receptors in the antidepressant and anxiolytic effects of dipyrone in chronic unpredictable mild stress in mice. Eur J Pharmacol 908:174315\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eManna SS, Umathe SN (2012) Involvement of transient receptor potential vanilloid type 1 channels in the pro-convulsant effect of anandamide in pentylenetetrazole-induced seizures. Epilepsy Res 100:113\u0026ndash;124\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen C-Y, Li W, Qu K-P, Chen C-R (2013) Piperine exerts anti-seizure effects via the TRPV1 receptor in mice. Eur J Pharmacol 714:288\u0026ndash;294\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbdel-Salam OM, Sleem AA, Sayed MAEBM, Youness ER, Shaffie N (2020) Capsaicin exerts anti-convulsant and neuroprotective effects in pentylenetetrazole-induced seizures. Neurochem Res 45:1045\u0026ndash;1061\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun F-J, Guo W, Zheng D-H, Zhang C-Q, Li S, Liu S-Y, Yin Q, Yang H, Shu H-F (2013) Increased expression of TRPV1 in the cortex and hippocampus from patients with mesial temporal lobe epilepsy. J Mol Neurosci 49:182\u0026ndash;193\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang W-X, Yu F, Sanchez RM, Liu Y-Q, Min J-W, Hu J-J, Bsoul NB, Han S, Yin J, Liu W-H (2015) TRPV1 promotes repetitive febrile seizures by pro-inflammatory cytokines in immature brain. Brain, Behavior, and Immunity 48:68\u0026ndash;77\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBhaskaran MD, Smith BN (2010) Effects of TRPV1 activation on synaptic excitation in the dentate gyrus of a mouse model of temporal lobe epilepsy. Exp Neurol 223:529\u0026ndash;536\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTan X, Zeng Y, Tu Z, Li P, Chen H, Cheng L, Tu S, Jiang L (2020) TRPV1 contributes to the neuroprotective effect of dexmedetomidine in pilocarpine-induced status epilepticus juvenile rats. BioMed Research International 2020\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTalebi F, Ghorbani S, Alizadeh L, Akhlaghi F, Moeeni SS, Karimzadeh F (2022) Alteration in Neuregulin 1/ERbB4 in Absence Epilepsy: Regulatory Effect on TRPV1 Expression. Basic Clin Neurosci 13:777\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBroicher T, Kanyshkova T, Meuth P, Pape H-C, Budde T (2008) Correlation of T-channel coding gene expression, IT, and the low threshold Ca2\u0026thinsp;+\u0026thinsp;spike in the thalamus of a rat model of absence epilepsy. Mol Cell Neurosci 39:384\u0026ndash;399\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"neurochemical-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"nere","sideBox":"Learn more about [Neurochemical Research](https://www.springer.com/journal/11064)","snPcode":"11064","submissionUrl":"https://submission.nature.com/new-submission/11064/3","title":"Neurochemical Research","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Epilepsy, Absence seizures, WAG/Rij, Spike-wave discharges, Acetylcholinesterase inhibitor, Rivastigmine, Learning-memory, Anxiety, TRPV1","lastPublishedDoi":"10.21203/rs.3.rs-4724554/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4724554/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eIn the present study, the effects of the acetylcholinesterase (AChE) enzyme inhibitor rivastigmine (RIVA) on spike-wave discharges (SWDs), memory impairment, anxiety-like behavior, and TRPV1 gene expression were investigated in genetic absence epileptic Wistar Albino Glaxo/Rijswijk (WAG/Rij) rats. After tripolar electrodes were implanted on the WAG/Rij rats' skulls, single doses of 0.125, 0.25, 0.5, 1, 2 mg/kg RIVA was intraperitoneally (i.p.) administered and electrocorticogram (ECoG) recordings of SWDs were obtained for three hours before and after injections. Additionally, WAG/Rij rats were administered low-dose (0.5 mg/kg) and high-dose (2 mg/kg) of RIVA for consecutive 21 days and SWDs were recorded. Learning-memory abilities (Y-maze test), anxiety-like behavior (elevated plus maze test), and TRPV1 gene expression were determined and compared in 8-month-old WAG/Rij and age-matched Wistar rats. Acute RIVA administration dose-dependently reduced the total number and mean duration of SWDs, even entirely inhibited at the doses of 1 and 2 mg/kg RIVA. Whereas long-term high-dose administration of RIVA increased the total number of SWDs, however, decreased the mean duration. Long-term high-dose RIVA treatment reduced learning-memory and anxiety-like behavior in WAG/Rij rats, while only anxiety-like behavior decreased in Wistar rats. According to the qPCR analysis, long-term RIVA administration reduced the TRPV1 gene expression in WAG/Rij rats, in fact, TRPV1 increased in Wistar rats. These data indicate that single-dose RIVA administration dose-dependently decreases absence seizures, however, long-term administration of RIVA increases absence seizures probably by altering channel expressions such as TRPV1.\u003c/p\u003e","manuscriptTitle":"The role of acetylcholinesterase enzyme inhibitor rivastigmine on spike-wave discharges, learning-memory, anxiety, and TRPV1 channel expression in genetic absence epileptic WAG/Rij rats","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-08-06 17:43:40","doi":"10.21203/rs.3.rs-4724554/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-08-10T13:31:15+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-08-10T01:23:13+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-08-02T11:20:53+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"20301828986761127055878050870825797704","date":"2024-07-19T15:20:40+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"296700497522057568731128085643271601993","date":"2024-07-14T10:44:39+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-07-12T22:02:24+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-07-12T18:00:44+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-07-12T05:12:01+00:00","index":"","fulltext":""},{"type":"submitted","content":"Neurochemical Research","date":"2024-07-11T13:44:51+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"neurochemical-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"nere","sideBox":"Learn more about [Neurochemical Research](https://www.springer.com/journal/11064)","snPcode":"11064","submissionUrl":"https://submission.nature.com/new-submission/11064/3","title":"Neurochemical Research","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"2d6688a9-08d8-40a1-86a4-cbe2ba2fb332","owner":[],"postedDate":"August 6th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-01-06T16:00:20+00:00","versionOfRecord":{"articleIdentity":"rs-4724554","link":"https://doi.org/10.1007/s11064-024-04318-2","journal":{"identity":"neurochemical-research","isVorOnly":false,"title":"Neurochemical Research"},"publishedOn":"2025-01-03 15:57:14","publishedOnDateReadable":"January 3rd, 2025"},"versionCreatedAt":"2024-08-06 17:43:40","video":"","vorDoi":"10.1007/s11064-024-04318-2","vorDoiUrl":"https://doi.org/10.1007/s11064-024-04318-2","workflowStages":[]},"version":"v1","identity":"rs-4724554","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4724554","identity":"rs-4724554","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.