Pyrroloquinoline quinone activates lactate production and inhibits NLRP3 to improve the apoptosis of granulosa cells in POI rats

Pyrroloquinoline quinone activates lactate production and inhibits NLRP3 to improve the apoptosis of granulosa cells in POI rats | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Help Center Sign In Submit a Preprint Cite Share Download PDF Article Pyrroloquinoline quinone activates lactate production and inhibits NLRP3 to improve the apoptosis of granulosa cells in POI rats Ke Liu, Peng Huo, BaoXiang Li, Tianlong Li, Yue Ma, Ou Zhong, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4786726/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Chemotherapy-induced premature ovarian insufficiency (POI) is an extreme form of reproductive aging in women, while the inflammatory factors manifest a vital cause of ovarian aging and serve as a research hotspot. However, there is still no effective method to restore the ovarian reserve. In the present study, we investigated the potential association between pyrroloquinoline quinone (PQQ) and chemotherapy-induced POI. To investigate this, a POI rat model was established by cyclophosphamide (CTX) successfully, we demonstrated that PQQ intervention reduced the ovarian injury and improved ovarian function, as well as increased the lactate levels and up-regulated the expression of key rate-limiting enzymes of glycolysis, while inhibited the expression of inflammatory factors such as NLRP3 and so on in the ovarian aging rats. To further explore the mechanisms, KGN cells were treated with Lipopolysaccharide (LPS) to mimic the inflammatory environment. PQQ alleviated the inflammation level and enhanced the glycolysis rate of KGN cells treated by LPS, meanwhile an identical effect was detected by inhibiting NLRP3. Furthermore, PQQ acted as a molecule which could activated the process of glycolysis. Collectively, our findings show that PQQ as an antioxidant may effectively restore the ovarian reserve function, which suggesting that great clinical significance to apply PQQ for prevention and treatment of chemotherapy-induced premature ovarian insufficiency in the future. Biological sciences/Molecular biology Health sciences/Endocrinology Health sciences/Diseases/Endocrine system and metabolic diseases Health sciences/Medical research/Experimental models of disease Pyrroloquinoline quinone Premature ovarian insufficiency Inflammation lactate apoptosis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Introduction Ovarian aging has become one of the most detrimental factors of pregnancy achievement[ 1 ]. In terms of pathological feature, ovarian aging mainly refers to premature ovarian insufficiency (POI), which is an endocrine disorder with chronic hypo-estrogenic state that characterized by premature depletion of the ovarian follicles or folliculogenesis arrest, occurring in approximately 1% of women under the age of 40 years[ 2 , 3 ]. However, the etiology and pathogenesis of POI are quite complex. Clinically, a lot of risk factors like surgery, drugs, autoimmunity, genetic defects, as well as the environmental aspect and so on could trigger the occurrence of POI[ 4 ]. Although chemotherapy is one of the effective ways in treating cancers, its increased risk of ovarian failure is an important cause of infertility in young female cancer survivors[ 5 ]. Previous histological studies have shown that chemotherapy treatments can cause loss of primordial follicles and ovarian atrophy, which characterized primarily by elevated follicle-stimulating hormone (FSH) and luteinizing hormone (LH) levels, decreased estradiol (E2) synthesis and interrupted estrous cycle phases[ 6 ]. Numerous studies have confirmed that the classic chemotherapy drug CTX have serious reproductive toxicity and constantly employed in the POI animal model constructed, which has been widely adopted for studying the pathogenesis and therapeutic targets of POI[ 7 ]. Recently, an extensive body of studies have demonstrated a strong connotation amongst inflammation and POI[ 8 ]. Moreover, the grades of inflammatory mediators include NLRP3, IL-18, IL-1β, and TNF-α are normally increased in follicular fluid of POI patients[ 9 – 11 ]. Similarly, the level of IL-18, and IL-1β were significantly elevated in serum and ovary of POI animal model[ 12 ], which were negatively correlation with the function of ovarian reserve. Nevertheless, when the inflammation was alleviated by reducing the levels of most inflammatory factors, the endocrine dysfunction and the diminished ovarian reserve were significantly repaired, which indicated a new therapeutic target for POI patients[ 9 , 13 – 15 ]. On the other hand, lactate is the key energy source for folliculogenesis and follicular maturation which generated from glycolysis of granule cells (GCs)[ 16 ]. However, the glycolytic capacity and the level of lactate were decreased along with the reduction in the quantity of growing follicles in POI[ 17 , 18 ]. Interestingly, when the level of lactate was significantly decreased due to the inhibited process of glycolysis, the levels of most inflammatory factors include NLRP3, TNF-α, and IL-6 was markedly increased[ 19 , 20 ]. In turn, activation of NLRP3 inflammasome is considered to affect glycolysis as indicated by reduced lactate production. Therefore, it may be a novel solution to improve the ovarian reserve function of POI by exploring the regulatory relationship between lactate production and inflammation of GCs. PQQ is a redox-active quinone that acts as a key nutrient involved in numerous physiological and biochemical processes in mammals, including reproduction, aging, and inflammation[ 21 , 22 ]. Since mammals cannot synthesize PQQ on their own, dietary PQQ supplementation is crucial for maintaining life health[ 23 ]. In a variety of animal models, it was found that oral administration of PQQ could improve the growth performance, antioxidant capacity, and reduce aging[ 24 – 26 ]. In addition, PQQ possesses pharmacological effect of inhibiting NLRP3 inflammasome, which can improve the progression of inflammatory diseases. Early supplementation of PQQ could enhance protection against liver lipotoxicity by reducing NLRP3 and IL-6 levels in obese mice[ 27 ]. Meanwhile, PQQ significantly decreased the levels of IL-6, IL-1β, and TNF-α in kidney of nephrotoxicity mice induced with CTX through inhibiting the NLRP3 pathway[ 28 ]. Notably, PQQ supplementation could increase the ovarian weight and size, partially normalize the disrupted estrous cycle period and prevent the loss of follicles damage by alkylating agents, which appeared to be directly mediated by promoting cell proliferation and inhibiting cell apoptosis of GCs[ 29 ]. Therefore, this study aimed to elucidate whether PQQ can recover ovarian reserve function by ameliorating abnormal lactate level and inflammation response in CTX-induced POI rats. In our study, we developed a POI rat model by CTX in SD rats, and confirmed that PQQ treatment reduced the ovarian injury and improved ovarian reserve. Meanwhile, PQQ treatment also up-regulated the lactate levels and the expression of key rate-limiting enzymes of glycolysis, while down-regulated the expression of inflammatory factors in POI rats. Further experiments showed that inflammatory response, abnormal glycolysis and apoptosis in KGN cells caused by LPS could be recovered through PQQ intervention. Our results imply that the ovarian reserve function in POI rats can be restored by PQQ treatment through reducing inflammation by the glycolytic pathway, PQQ might be an ideal choice to protect fertility in female cancer patients of childbearing age receiving CTX regimen and delay ovarian aging. Materials and Methods Animal care and treatment A total of Sprague Dawley (SD) female rats (n = 30, 8-week-old, 200 g ± 50 g) were provided by Hunan Shrek Jingda Company (permit number: SCXK (Xiang) 2019-0004). All rats were fed adaptively for one week before experiments in a standard environment condition (25°C, 12 h light/dark cycle), with free access to food and water. Thirty rats were randomly divided into the control group (n = 10), the POI group (n = 10) and POI-PQQ group (n = 10). To establish a POI model, the rats of POI group and POI-PQQ group were intraperitoneally injected with CTX (50 mg/kg on the first day and 8 mg/kg on the second day daily for 14 days [ 18 ], while rats in the control group received equivalent volumes of normal saline, for the rats in the POI-PQQ group, oral gavage PQQ (10 mg/kg/day, dissolved in 0.9% NaCl) was provided starting one week before the establishment of the rat model until the date of sacrifice[ 30 , 31 ]. POI model establishment was confirmed based on consecutive presence of metestrus and diestrus stages in the estrous cycle, with vaginal cytology performed from the 26th to the 35th days. Following the treatment period, all rats were the mice were anesthetized with urethane (0.6 mL/100 g). Blood samples were collected from each rat for hormone level analysis. Both ovaries from each rat were surgically excised and weighed. One ovary from each rat was fixed in 4% paraformaldehyde for paraffin embedding, while the other was stored at -80°C for subsequent western blot, qRT-PCR, and transcriptome sequencing. Chemicals and reagents CTX (batch number: 20050712, national drug name: H32020857) was purchased from Jiangsu Hengrui Pharmaceutical. PQQ (batch number: 122628-50-6, SHENZHEN HYGIEIA Huining Biotechnology Co., LTD.). TransScript® One-Step gDNA Removal and cDNA Synthesis SuperMix (AT311-02) was purchased from TransGen Biotech (Beijing, China). AG RNAex Pro RNA (AG21101) was purchased from Accurate Biology (Hunan, China).Wright’s–Giemsa Stain solution (G1020) and 20×Metal Enhanced DAB Substrate Kit (DA1015) was purchased from Beijing Solarbio Science & Technology Co., Ltd (Beijing, China). Diaminobenzidine (DAB) chromogenic kit (ZLI-9018) was purchased from Beijing Zhongshan Jinqiao Biotechnology Co., Ltd (Beijing, China). For antibodies, hexokinase II (HK2) rabbit mAb (#2867), PKM2 (D78A4) XP® mAb (#4053), Caspase-3 Antibody (#9662), and TNF-α (D2D4) XP® Rabbit mAb (#11948) were purchased from Cell Signaling Technology Inc. (Danvers, Massachusetts, USA).Lactate Dehydrogenase Antibody (T55348), Bax Antibody (T40051), and Anti-β-Tubulin (C66) mAb (M20005) was purchased from Abmart Pharmaceutical Technology Co., Ltd. (Shanghai, China). BCL-2 Recombinant Rabbit Monoclonal Antibody (ARC0173) was purchased from Thermo Fisher (Waltham, MA, USA). NLRP3 Rabbit pAb (A12694) and IL-1β Rabbit pAb (A16288) were purchased from Abclonal (Wuhan, China). IL-18 Polyclonal antibody(10663-1-AP), IL-6 Monoclonal antibody (66146-1-Ig), Horseradish peroxidase-conjugated goat anti-rabbit IgG (H + L) (SA00001-2) and biotin-conjugated affinipure goat anti-rabbit IgG (H + L) (SA00004-2) were purchased from Protein Tech Group Inc. (Chicago, USA). Additionally, BCA Protein Assay Kit (CW0014S), eECL Western Blot Kit (CW0049M) and SDS-PAGE Gel Kit (CW0022S) was sourced from Beijing ComWin Biotech Co., Ltd. (Beijing, China). AG RNAex Pro RNA (AG21101) was purchased from Accurate Biology (Hunan, China). All primer design and synthesis were conducted by Shanghai Sangon151 Biotechnology Co., Ltd. (Shanghai, China). Estrous cycle determination Vaginal smears were conducted daily at 12:00 over a span of 10 consecutive days, from the 26th to the 35th day of the experiment. Briefly, 20 µL normal saline (0.9% NaCl) was used to rinse the vagina two or three times, and vaginal fluid was collected and smeared on a slide and air dried at room temperature. Subsequently, the dried smears were stained using Wright’s Giemsa Stain (BASO, Zhuhai, China), following the manufacturer’s instructions. The estrous cycle stages, encompassing proestrus, estrus, metestrus, and diestrus, were discerned, along with the alterations in vaginal epithelial cells, based on the predominant cell type observed under a light microscope [ 32 – 34 ]. Histological analysis and follicular classification Following proper anesthesia administration, the ovaries and uterus were meticulously excised and individually weighed. The uterus and one ovary from each rat were immersed in 4% formaldehyde for 24 h, subsequently undergoing paraffin embedding after a series of dehydration steps. Sections with a thickness of 5 µm were sequentially prepared and stained with hematoxylin and eosin (H&E), followed by microscopic examination. To determine the total follicle count and classification per ovary, every fifth section was meticulously evaluated across the entire ovary, commencing with the initial section, and the resulting tally was multiplied by 5 to yield a correction factor. For the enumeration of ovarian follicles at various developmental stages, all follicles within all sections of an ovary were enumerated, adhering to the established criteria outlined by Pedersen and Peters.[ 35 ]. Immunohistochemistry(IHC) IHC assays were meticulously conducted on formaldehyde-fixed, paraffin-embedded specimens strictly adhering to the protocols provided by the manufacturers. Sections, precisely 5 µm thick, underwent a comprehensive preparation process starting with dewaxing and rehydration, followed by boiling in 0.1 M sodium citrate buffer (pH 6.0) to facilitate antigen retrieval. Permeabilization was achieved using a solution of 1% TritonX-100 in PBST for 30 min, which preceded a 45 min blocking phase with 5% bovine serum albumin to prevent nonspecific binding. Subsequently, the sections were immersed in a carefully optimized dilution of primary antibodies, including HK2 (1:500), PKM2 (1:800), LDHA (1:300), Bax (1:100), Bcl-2 (1:100), Caspase-3 (1:200), NLRP3 (1:200), IL-6 (1:200), IL-18 (1:200), IL-1β (1:200), TNF-α (1:200), and DDX4 (1:200), and incubated at 4°C overnight to ensure maximal binding efficiency. Following a thorough washing with PBST, sections were then exposed to the corresponding secondary antibodies at ambient temperature for 90 min, and subsequent HRP incubation was performed for 45 min to amplify the signal. Visualization of the immunoreactive proteins was achieved through the application of the 3,3-diaminobenzidine (DAB) chromogen, with hematoxylin serving as a counterstain post-PBST wash. PBS was utilized as a negative control throughout the procedure. The prepared sections were then systematically examined and documented using a light microscope (BX43, Olympus). To ensure objective evaluation, immunostaining assessments were independently carried out by two experienced pathologists who were blinded to the sample identities, culminating in a consensus on the staining profiles observed. Determination of hormone levels After the rats were anaesthetised, whole blood was collected immediately by abdominal aortic puncture. Serum samples from rats in the diestrus phase were selected to measure serum hormone levels. Serum was further isolated by centrifugation (3000 g) for 15 min at 4°C. Serum samples from rats in the diestrus phase were chosen to measure hormone concentrations. In the definitive stage of the study, the concentrations of E2, LH, AMH, and FSH were quantified employing a commercially available enzyme-linked immunosorbent assay (ELISA) kit provided by Beijing North Institute of Biotechnology Co., Ltd. Quantitative real-time PCR (qRT-PCR) Following the manufacturer's protocol, total RNA was isolated from ovarian tissues and KGN cells using the AG RNAex Pro RNA. Complementary DNA (cDNA) synthesis was performed with the TransScript® One-Step gDNA Removal and cDNA Synthesis SuperMix. Then qRT-PCR was conducted in a 10 µL reaction volume using the 2× Universal SYBR Green Fast qPCR Mix kit and the Applied Biosystems QuantStudio 3 system (Thermo Fisher Scientific). Gapdh was utilized as the reference gene, and relative gene expression levels were calculated using the comparative CT method. The specific primers used for amplification are detailed in Table 1 . Table 1 Primer sequences used for the qRT-PCR analysis. Target Gene Primer Sequence(5’-3’) GeneBank Accession NO. Rat Bax F:GAGACACCTGAGCTGACCTT R: TCCATGTTGTTGTCCAGTTC XM_032913059 Rat Bcl-2 F: AGTACCTGAACCGGCATCT R: TCTTCAGAGACAGCCAGGA NM_016993 Rat Caspase-3 F: CCGGTTACTATTCCTGGAGA R:TAACACGAGTGAGGATGTGC XM_006253130 Rat LDHA F:GGTTGACAGTGCATACGAAG R: CCGCCTAAGGTTCTTCATTA XM_039082293 Rat PKM2 F:GGAACACTGGCATCATCTGTA R:TCGGATCTCAGGTCCTTTAGT XM_039080895.1 Rat HK2 F: TTGCCTACTTCTTCACGGAG R:TCTGGAGTGGACCTCACAAAG NM_012735.2 Rat NLRP3 F:GAGCTGGACCTCAGACAATGC R:AGAACCAATGCGAGATCCTGACAAC XM_006246457.4 Rat IL-1β F:CCCTTGTCGAGAATGGGCAG R:GACCAGAATGTGCCACGGTT NM_031512.2 Rat IL-18 F:CGACCGAACAGCCAACGAATCC R:GTCACAGCCAGTCCTCTTACTTCAC NM_019165.2 Rat IL-6 F:AGCCACTGCCTTCCCTACTTC R:GGTCCTTAGCCCACTCCTTCTG NM_012589.2 Rat TNF-α F:GTCCCAACAAGGAGGAGAAGT R:CTGGTATGAAATGGCAAATCG NM_012675.3 Rat 3βHSD F:GATGCCCAGTACCTGAGGAGA R:GGACATGTGAGACATCAATGACA NM_001007719 Rat stAR F:GAAGAACTGGTGGACCGCAT R:GTGGAACCTCTACGCTTGGT NM_031558 Rat CYP11A1 F:AGGTCCTTCAATGAGATCCCTT R:TCCCTGTAAATGGGGCCATAC NM_017286 Rat CYP19A1 F:TCCTCCTGATTCGGAATTGTG R:GGCCCGATTCCCAGACA NM_017085.3 Rat GAPDH F: GAGTCCACTGGCGTCTTCAC R:GAGGCATTGCTGATGATCTTGAG XM_032916238 HOMO HK2 F: GTGAACGATGCTCCTGCTCTGAAG R: CTCCTCAACGGCAGCCACAATG M23115.1 HOMO PKM2 F:GAGTCCACTGGCGTCTTCAC R:GAGGCATTGCTGATGATCTTGAG KJ905271.1 HOMO LDHA F: ATGAGTTGGACTGTGCCTGTTGTG R: GTGAAGAGCCAGGTGCCGTTG AY009108.1 HOMO BCL-2 F:CCCTGTGGATGACTGAGTACC R: GCCAAACTGAGCAGAGTCTTC BC027258.1 HOMO BAX F:CAAGAAGCTGAGCGAGTGTC R:CCAGTTGAAGTTGCCGTCAG NM_001291428.2 HOMO Caspase-3 F:ATGGAAGCGAATCAATGGACTC R:CAAGTTTCTGAATGTTTCCCTGAG NM_004346.4 HOMO NLRP3 F: ATGCTGCTTCGACATCTCCT R: AACCAATGCGAGATCCTGAC XM_047443562.1 HOMO IL-1β F:CCGACCACCACTACAGCAAGG R:GGGCAGGGAACCAGCATCTTC NM_000576.3 HOMO IL-18 F: ATGGCTGCTGAACCAGTAGAAGAC R: TCCGGGGTGCATTATCTCTACAGTC NM_001562.4 HOMO 3β-HSD F: ATCCACACCGCCTGTATCAT R: TCTGGATGATTTCCTTGTAGGAG NM_000862 HOMO StAR F: GGCATCCTTAGCAACCAAGA R: TCTCCTTGACATTGGGGTTC NM_000349 HOMO CYP11A1 F: GCTGAGCAAAGACAAGA R: GAATGAGGTTGAATGTGGTG NM_001099773 HOMO CYP19A1 F:CTAACATCATTCTGAACATCGG R: CTGAAAATACCTGTAGGGAAC NM_017085.3 HOMO GAPDH F: GAGTCCACTGGCGTCTTCAC R: GAGGCATTGCTGATGATCTTGAG M33197.1 Western blot analysis Proteins isolated from ovarian tissues and KGN cells lysates were used for Western blot. Protein concentrations were accurately measured using the BCA Protein Assay Kit (CWBIO, China). Proteins were subsequently denatured by boiling at 100°C for 10 min. A total of 40 µg of protein lysates were electrophoretically separated on 10% SDS-polyacrylamide gels and then electrotransferred onto PVDF membranes (Bio-Rad). These membranes were blocked with 5% skim milk for 2 h at room temperature to prevent non-specific binding. Overnight incubation at 4°C followed, using primary antibodies targeted against Tubulin (1:5000 dilution), HK2, PKM2, LDHA, Bax, Bcl-2, Caspase-3, NLRP3, IL-6, IL-1β and TNF-α (all at a dilution of 1:1000), IL-18 (1:2000 dilution). Post-primary antibody incubation, the blots were exposed to HRP-conjugated secondary antibodies for 2 h at room temperature. Detection of chemiluminescent signals was performed using eECL reagent (CW0049M, CWBIO) and visualized on a Tanon-5500 Chemiluminescence Imaging System. Quantitative analysis of blot images was conducted utilizing Image J software from NIH Bethesda. TUNEL staining Ovarian tissue sections underwent sequential dewaxing and hydration, followed by immersion in deionized water (dH 2 O), adhering to the manufacturer's guidelines. Subsequently, these sections were treated with 20 µg/mL proteinase K solution for 20 min at 37°C. After washing with PBS, the sections were incubated with the TUNEL reaction mixture at 37°C for one hour. Post-incubation, the sections were rinsed with PBS and then incubated with HRP-streptavidin reagent (1:200 dilution) for 30 min at room temperature. Protein localization was visualized using DAB and sections were counterstained with hematoxylin. Finally, the stained sections were examined under a light microscope to assess the staining patterns and cellular morphology. UHPLC-MS/MS analysis The UHPLC-MS/MS analysis was conducted by Bioprofile (Shanghai, China). Each serum sample (100 µL) was thoroughly mixed with cold methanol acetonitrile (v/v, 1:1, 400 µL) by vortexing. Following sonication in an ice bath for one hour, the mixture was subsequently subjected to incubation at -20°C for 1 h This was followed by centrifugation at 4°C for 20 min at a velocity of 14,000 g. The resultant supernatants were then meticulously collected and desiccated under vacuum conditions in preparation for liquid chromatography-mass spectrometry (LC-MS) analysis, ensuring the integrity of the samples for accurate analytical outcomes. Transcriptome Sequencing and Bioinformatics Analysis Ovarian RNA sequencing was executed through Novogene (Beijing, China). Initially, RNA integrity and concentration were evaluated utilizing a NanoPhotometer spectrophotometer (Implen Inc., CA, USA) and the Qubit RNA Assay Kit in conjunction with the Qubit 2.0 Fluorometer (Life Technologies, CA, USA) respectively. Transcriptome sequencing libraries were constructed from 3 µg of total RNA per sample using the NEBNext Ultra RNA Library Prep Kit for Illumina (CA, USA) following the protocols provided by the manufacturer. Index codes were applied to facilitate the assignment of sequences to respective samples. Index-coded samples underwent clustering on a cBot Cluster Generation System utilizing the TruSeq PE Cluster Kit v3-cBot-HS (Illumina, CA, USA). Subsequent to clustering, the libraries were sequenced using the Illumina Hiseq platform that produced 150 bp paired-end reads. Further analysis entailed differential expression assessment between two groups, conducted with the DESeq2 R package (version 1.10.1). Genes exhibiting an adjusted p-value of less than 0.05, as determined by DESeq2, were identified as differentially expressed. To explore the functional impacts of these differentially expressed genes (DEGs), Gene Ontology (GO) enrichment analysis was performed using the cluster Profiler R package, where GO terms with a corrected p-value less than 0.05 were considered significantly enriched. Moreover, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis was conducted to assess the statistical enrichment of DEGs, employing the online resource ( http://www.genome.jp/kegg/ ) and the cluster Profiler R package, facilitating a deeper understanding of the biological pathways involved. Cell culture and treatment KGN cells were obtained from Zhejiang Meisen Cell Technology Co., LTD (CTCC-003-0105). The cells were cultured in Dulbecco’s Modified Eagle’s Medium-high glucose (DMEM, Sigma, USA) supplemented with 12% Fetal Bovine Serum (FBS, Invitrogen, Gibco, USA), and maintained at 37°C in a 5% CO2 atmosphere. KGN cells were seeded in 6 cm plates at a density of 10 6 cells per well. Following a 24-h starvation period, the cells were treated without or with LPS (1 µg/mL) (I2643; Sigma, USA), Nigericin sodium salt (10 µmol/L)[ 38 ] (HY-100381, MedChemExpress, USA), MCC950 (100 nmol/L)[ 39 ] (HY-12815, MedChemExpress, USA), PQQ (0.1 µM), and 2-DG (0.2 µM) (HY-13966, MedChemExpress, USA) for 24 h. Cell Counting Kit-8 (CCK-8) KGN cells were seeded into 96-well plates at a density of 10 4 cells per well and subjected to a 24-h starvation period to synchronize cellular metabolism. Post starvation, cells allocated to the LPS treatment groups were exposed to varying concentrations of LPS (0.1, 1, and 10 µg/mL) for 24 h to assess dose-dependent responses. Simultaneously, for the LPS + PQQ intervention, KGN cells were treated with a fixed LPS concentration of 1 µg/mL in the presence of a titrated series of PQQ concentrations (0, 10, 1, 0.1, 0.01, and 0.001 µM) over a 24-hour duration to elucidate the modulatory effect of PQQ on LPS-stimulated cells. Cell viability post-treatment was quantitatively evaluated by adding 10 µl of CCK-8 solution (BS350B, Biosharp, China) to each well, adhering to the manufacturer’s recommended guidelines, and subsequently incubating the cells for 30 min to facilitate the reaction. Absorbance measurements were taken using a VersaMax microplate reader, operating at a 450 nm wavelength, to determine the extent of cellular metabolic activity. Enzyme-Linked Immunosorbent Assay (ELISA) Lactate in the ovary or culture supernatant of KGN cells were measured using the Lactic Acid Assay Kit instructions (A019-2-1, Nanjing Jiancheng). Plates were read on a VersaMax microplate reader at 530 nm wavelength. Cell culture media levels of inflammatory cytokines including IL-18 and IL-1β were measured using indicated an ELISA kit according to the Ruixinbio (Quanzhou, China) following the manufacturer’s instructions. Flow Cytometry Analysis with Annexin V/PI Staining KGN cells were assessed for early apoptosis using the FITC-labeled Annexin V/PI Apoptosis Detection Kit (BD Bio-sciences, CA, USA). A seeding density of 2×10 5 cells was used for cultures in 6-well plates. Following treatment, cells were harvested, fixed, and stained in 1× binding buffer composed of 140 mM NaCl, 10 mM HEPES/NaOH, and 2.5 mM CaCl2. In each case, cells were incubated with 5 µL of FITC-conjugated Annexin V and 5 µL of propidium iodide (PI) solution for 30 min at room temperature, shielded from light to prevent photobleaching of fluorochromes. The proportion of apoptotic cells was quantified using a Novo Cyte Flow Cytometer (ACEA Biosciences) and resulting data were processed using the NovoExpress software platform. Statistical analysis All experiments were conducted in triplicate or more. Quantitative data were analyzed using SPSS 26.0 software (SPSS, Inc., Chicago, Illinois, USA). The Shapiro-Wilk test was applied to assess the normality of data distribution. Normally distributed data were evaluated using one-way ANOVA followed by Tukey’s post-hoc test and presented as mean ± standard deviation. Significant differences between groups were assessed with either an unpaired t-test or one-way ANOVA with Bonferroni correction for multiple comparisons. Non-normally distributed data were analyzed using the two-tailed Mann-Whitney U test and presented as medians with interquartile ranges (IQR, 25th to 75th percentile). Spearman’s rank correlation was used for correlation analysis. All statistical analyses were performed using R software (version 4.2.3), with p < 0.05 indicating statistical significance. Results PQQ improved body weight, estrous cycle, and serum hormone levels in POI rats To explore the effects of PQQ, a CTX-induced POI rat model was established, and the experimental design was shown in Fig. 1 A. The mean body mass of rats exposed to CTX for 14 days was much lower than that of the Control group. After PQQ treatment for 21 days (Fig. 1 B-C), the mean body mass of the rats in the POI-PQQ group was significantly higher than that of rats in the POI group. CTX-induced POI is accompanied by prolonged or stopped estrus cycles in female[ 40 ], so the effects of PQQ on the estrous cycle of POI rats were conducted. In the Control group, the rats had a regular estrous cycle (4–5 days) including proestrus, estrous, metestrus, and diestrus phases sequentially (Fig. 1 D-E), which is consistent with previous studies[ 18 ]. In the proestrus phase, there were mainly small and round nucleated epithelial cells with greyish red nucleus and greyish cytoplasm (green arrows point), which were relatively uniform in appearance and size. Estrous phase was predominantly characterized with flat and anucleated keratinized epithelial cells showing as blue or purple-blue stacks or layers (red arrows point). However, in the metestrus phase, neutrophils and nuclear epithelial cells were the predominant compositions, and anucleated keratinized epithelial cells were occasionally observed. In the diestrus phase, there were almost full of neutrophils (blue arrows point)[ 41 ]. Compared with the Control group, rats in the POI group lost their regular estrous cycles and were in proestrus or estrus for a long time (Fig. 1 E-F). Interestingly, the irregular estrous cycle was gradually returned to be normal after PQQ administration (Fig. 1 E-F). Of note, hormones have been identified as major influencers in GCs as ovarian reserve progressively declines[ 42 ]. We further evaluated the effects of PQQ treatment on the hormone levels POI rats. The serum levels of E2 and AMH (Fig. 1 G(1)(2)) were significantly lower in POI group than that in the Control group and POI-PQQ group. The serum levels of FSH and LH (Fig. 1 G(3)(4)) were much higher in the POI group than that in the Control group and POI-PQQ group. During ovarian aging in females, a rise in FSH is regarded as the hallmark of the reduction in the follicle reserve [ 43 ]. Our results indicated that PQQ can regulate reproductive endocrine function. Steroidogenesis in ovarian follicular cells is mediated by a number of well-known enzymes such as 3β-HSD, StAR, CYP11A1, and CYP19A1, which are significantly associated with oocyte quality[ 44 , 45 ]. The steroid hormone synthetase was detected using qRT-PCR. Compared with the Control group, the mRNA expression levels of 3β-hsd , Star , Cyp11a1 , and Cyp19a1 were significantly down-regulated, whereas PQQ administration notably restored the mRNA expression of 3β-hsd , Star , Cyp11a1 , and Cyp19a1 (Fig. 1 H). It is evident that PQQ significantly enhances the body weight and circulating E2 and AMH concentration of rats, while reducing the circulating FSH and LH concentrations. These results revealed that PQQ restores the estrous cycle partially in POI rats induced by CTX and enhances the expression of steroidogenic enzymes. PQQ improve the ovarian index and ovarian morphology in POI rats To evaluate the effects of PQQ on the ovarian reserve and development of rats with POI, we compared the ovarian index and ovarian morphology of the three groups. First of all, we collected the ovaries and uteruses from rats and weighted them. We found that the size and weight of ovaries were signally reduced in POI group compared to Control group and POI-PQQ group (Fig. 2 A-B). Afterwards, we performed HE staining on serial ovarian sections and counted the follicles in different stages. Assessment of the ovarian morphology of the three groups showed disorganized follicles structure and a significant decrease in the number of primordial follicles in POI rats compared with those in the controls, whereas atretic follicles were increased (Fig. 2 C). We observed a significant reduction in the total number of follicles, including primordial, primary, and secondary follicles, as well as corpus luteum, in the POI group compared to the Control and POI-PQQ groups. Additionally, the number of atretic follicles markedly increased in the POI group (Fig. 2 D). Primordial follicles were identified by granulosa cell morphology and DDX4-specific immunostaining. Compared with the Control group, the number of primordial follicles were significantly reduced in POI group, yet POI-PQQ group showed increase in the number of primordial follicles compared with those in the POI group but they did not differ from those in the Control group (Fig. 2 E). In addition, We found that the size and weight of uteruses were signally reduced in POI group compared to Control group and POI-PQQ group (Figure S1 1A-B). These results showed that PQQ treatment was protective against CTX-induced ovarian follicle failure. PQQ ameliorates apoptosis of ovarian granulosa cells in POI rats Chemotherapy drugs are well known to cause ovarian damage in female cancer patients, including granulosa cell apoptosis, ovarian vascular damage, and rapid depletion of the follicle reserve, resulting in POI[ 46 ]. To investigate the effects of PQQ on apoptosis in the ovary, we conducted TUNEL staining on the ovaries. The analysis revealed a prominent occurrence of apoptosis predominantly in granulosa cells (GCs), with the POI group exhibiting a significantly elevated expression of TUNEL-positive cells compared to the Control group. Intriguingly, the incidence of TUNEL-positive cells in the POI-PQQ group was markedly reduced in contrast to the POI group (Fig. 3 A). Additionally, to further substantiate these findings, we employed quantitative real-time PCR (qRT-PCR), Western blot (WB), and immunohistochemistry (IHC) techniques for the assessment of apoptosis-related markers including Bcl-2, Bax, and Caspase-3 (Fig. 3 B-E). It was discerned that the expressions of Bax and Caspase-3 were significantly elevated in the POI group as compared to the Control group, whereas these expressions were notably ameliorated in the POI-PQQ group, indicating a potential protective effect of PQQ (Fig. 3 B). Otherwise, the expression of Bcl-2 was low in the POI group and largely restored in the POI-PQQ group. Ovarian IHC also showed that these proteins were all principally expressed in the GCs (Fig. 3 C). Our findings suggest that PQQ treatment can prevent CTX-induced apoptosis of ovarian GCs. Effects of PQQ on the serum metabolism in POI rats To identify distinct metabolites that may be associated with abnormal metabolism in POI among thousands of variables, a pairwise comparison was conducted between the various group via analysis of serum metabolomics. Firstly, as shown in Fig. 4 A and Figure S2 , PCA score and OPLS-DA supervised model showed that the discrimination between groups was stable and reliable. Although there was overlap between groups, it could indicate that there were differences but not significant or absolute. The generated heat maps of the three groups of altered metabolites showed that metabolites clustered within the same cluster had similar expression patterns, indicating that samples from the Control group and POI group could be separated, and the pattern of the POI-PQQ group was consistent with that of the Control group (Fig. 4 B). KEGG enrichment analysis showed that energy metabolic pathways could be observed between the two groups, although the difference was not significant(Fig. 4 C). In the metabolic pathway analysis, there were 34 main metabolic pathways in the Control group and the POI group, and 5 of them were p < 0.05. A total of 34 pathways were identified between the POI group and POI-PQQ group, of which 7 pathways were p < 0.05, and TCA cycle pathway and glycolysis/gluconeogenesis pathway related to energy metabolism were identified in both comparison groups, respectively (Fig. 4 D). These results suggest that PQQ may play an important role in the improvement of metabolic abnormalities in POI rats, and the underlying mechanism may be related to energy metabolism. Effects of PQQ on the Ovarian Transcriptome To elucidate the underlying mechanisms, we further performed transcriptome analysis of ovarian tissues. In comparison to the control, there were 689 upregulated and 906 downregulated genes in POI rats (Fig. 5 A); there were 2016 upregulated and 1771 downregulated genes between the POI-PQQ group and the PQQ group (Fig. 5 B). Altogether, 1034 genes were differentially expressed between the three groups (Fig. 5 C), and the genes were involved in energy metabolism, hormone metabolism, and inflammasome pathways (Fig. 5 D). Notably, PQQ administration restored these metabolism-related biological processes, which were dysregulated in POI rats. The expression levels of several genes related to glycolysis such as Ldha and Pkm exhibited a reversed phase between the POI and POI-PQQ groups. The expression of NLRP3, which are related to inflammation, showed reversed phase between the POI and POI-PQQ groups (Fig. 5 E). Hence, we hypothesized that PQQ could improve ovarian reserve function in aging rats by inhibiting inflammation and improving glycolysis. PQQ improves the glycolytic pathway of ovarian in POI rats Based on the transcriptome profiling results showing the recovery of the enzymes of glycolysis, we further detected their expression profiles in the three groups. The results of qRT-PCR showed the downregulation of Hk2, Pkm2 , and Ldha in the POI rats (Fig. 6 A). PQQ administration significantly restored the mRNA expression of Hk2, Pkm2 , and Ldha (Fig. 6 A). The level of lactate were signally decreased in POI group and increased after PQQ intervention (Fig. 6 B). IHC analysis confirmed the findings, revealing a decrease in LDHA, HK2, and PKM2 in the POI group and a recovery of values in response to PQQ treatment (Fig. 6 C). Western blot analysis verified the decrease of LDHA, HK2, and PKM2 in the POI group versus the Control group, respectively, and the improvement in response to PQQ treatment (Fig. 6 D-E). The aforementioned findings suggest that the aberrant glucose metabolism induced by CTX may be partially ameliorated through administration of PQQ. PQQ reduced the level of ovarian inflammation in POI rats Given the above-mentioned transcriptome profiling that shows the reversed expression profile of Nlrp3 between the POI and POI-PQQ groups (Fig. 5 E), we further detected the expression levels of the inflammation factors in each group of ovaries, including NLRP3, TNF-α, IL-1β, IL-18, and IL-6. We observed that the expression of Nlrp3, Tnf-α, Il-1β, Il-18 , and Il-6 was significantly upregulated in the POI group compared to the Control and POI-PQQ groups (Fig. 7 A). Next, we performed IHC on ovarian sections to detect the expression of NLRP3, TNF-α, IL-1β, IL-18, and IL-6 in the ovaries. We found that inflammatory factors positive cells were significantly increased in the POI group compared to the Control and POI-PQQ groups (Fig. 7 B). Western blot analysis also showed higher protein expression of NLRP3, TNF-α, IL-1β, IL-18 and IL-6 in the POI group than in the Control group and a similar response to PQQ treatment (Fig. 7 C-D). In recent years, studies have shown that inflammation is closely related to POI[ 47 ]. Recent research has indicated a close correlation between inflammation and POI. Therefore, we conducted spearman correlation analyses to investigate the relationship between inflammatory factors and POI-related indicators, including serum hormones (E2, LH, FSH), glycolytic rate-limiting enzymes (HK2, PKM2, LDHA), lactate levels, and steroid hormone synthesis enzyme genes (StAR, 3β-HSD, CYP19A1, CYP11A1). Our results revealed a significant negative correlation between inflammatory factors and glycolytic rate-limiting enzymes as well as lactate levels (Fig. 7 E). Additionally, spearman correlation analyses were performed to explore the relationship between NLRP3 and lactate levels, and the results indicated a significant negative correlation between them (R=-0.88, P = 0.0031) (Fig. 7 F).These results suggest that PQQ treatment partially prevented ovarian inflammation caused by CTX. Furthermore, by exploring the relationship between glycolysis and inflammation, we may be able to improve the ovarian reserve function of POI. PQQ improved the glycolysis pathway of LPS-treated KGN cells Based on the Fig. 7 , it is evident that there exists a negative correlation between the expression of NLRP3 and glycolytic rate-limiting enzymes. Therefore, we hypothesize that the inhibition of inflammation may activate glycolysis. To test this hypothesis, we employed LPS to simulate the inflammatory state of POI rats in KGN cells, and subsequently added the specific activator of NLRP3, Nigericin. As shown in Fig. 8 A-C, we treated KGN cells with different concentrations of LPS and detected the changes in cell viability. CCK-8 assay results showed that cell viability decreased gradually with increasing LPS concentration in a concentration-dependent manner. Thus, we choose the 1µg/ml LPS for the next experiment. With respect to the concentration of LPS, we added different concentrations of PQQ to KGN cells. The results showed that 0.1µM PQQ increased LPS-induced cells viability, while other concentrations resulted in decreased cell viability. To explore the effect of LPS resistance on glycolysis, we treated KGN cells with NLRP3 inhibitors MCC950 and PQQ respectively. Both MCC950 and PQQ treatments significantly increased lactate levels (Fig. 8 D). We measured the levels of IL-18 and IL-1β in the cell culture supernatant. The findings demonstrate that cells treated with LPS show significantly elevated levels of IL-18 and IL-1β in comparison to those treated with MCC950 and PQQ. Moreover, there is no statistically significant difference in KGN cells treated with MCC950 and PQQ (Fig. 8 E). Next, the consequences of qPCR showed the mRNA expressions of Nlrp3 , Il-18 , and Il-1β were upregulated in KGN cells treated with LPS. While MCC950 and PQQ significantly inhibited the mRNA expression of Nlrp3,Il-18 and Il-1β (Fig. 7 F). Similarly, there is also no statistically significant difference in KGN cells treated with MCC950 and PQQ. The results obtained from the aforementioned experiments were in concordance with those of the Western blot analysis (Fig. 8 G-H).These findings indicate that MCC950 effectively inhibits the expression of NLRP3, and PQQ exerts a similar effect as MCC950. In addition to assessing the expression of inflammation, we also evaluated the expression of glycolytic rate-limiting enzymes. The results of qPCR showed the mRNA expressions of Hk2, Pkm2 , and Ldha were downregulated in KGN cells treated with LPS. MCC950 and PQQ administration significantly restored the mRNA expression of Hk2, Pkm2 , and Ldha (Fig. 8 I). Western blot analysis confirmed that LPS decreased the protein expressions of HK2, PKM2, and LDHA in KGN cells compared with the improvement after MCC950 and PQQ treatment (Fig. 8 J-K). The results showed that PQQ indeed exerts anti-inflammatory effects, which in turn suppress the expression of glycolytic rate-limiting enzymes. However, alleviating inflammation can improve the expression of glycolytic rate-limiting enzymes. PQQ downregulated the expression of inflammatory factors in KGN cells treated with LPS and 2-DG We have discovered that PQQ has the ability to suppress inflammation and activate glycolysis[ 48 ]. However, it remains unclear whether PQQ can suppress inflammation by activating glycolysis. Therefore, we investigated whether PQQ has the ability to activate glycolysis by adding inhibitors of glycolysis. Firstly, we determined the optimal concentration by measuring lactate levels of different concentrations of 2-DG (Fig. 9 A-B). After PQQ treatments memorably increased lactate in KGN cells (Fig. 9 C). We have also detected the expression of IL-18 and IL-1β in the cell culture supernatant. The results showed that the expression of IL-18 and IL-1β in the culture supernatant of PQQ-treated cells was significantly decreased (Fig. 9 D). As shown in Fig. 9 E, the mRNA expression of Hk2 , Pkm2 , and Ldha were both increased after PQQ treatment. The western blot shows the same results, the protein expression of HK2, PKM2, and LDHA were both decreased in KGN cells with LPS, and increased after PQQ treatment(Fig. 9 F-G). In contrast, the levels of inflammatory factors were significantly decreased after PQQ treatment (Fig. 9 H-J). These results suggest that PQQ plays a key role in inhibiting inflammation by activating glycolysis. PQQ improve apoptosis in KGN cells treated with LPS and 2-DG To elucidate the impact of PQQ on the ovarian reserve function of granulosa cells, we detected the mRNA expression of steroidogenic enzyme genes ( Star , 3β-hsd , Cyp11a1 , and Cyp19a1 ) by qRT-PCR. Our findings revealed that the expression of steroidogenic enzyme genes was downregulated in cells treated with LPS, but was upregulated following intervention with PQQ (Fig. 10 A-B). This suggests that PQQ can improve the expression of steroidogenic enzyme genes, regulate the secretion of estradiol, and enhance the ovarian reserve function of granulosa cells. In addition, cell apoptosis is associated with follicular atresia, which impairs ovarian function. Therefore, we examined the level of apoptosis in KGN cells. The results of qRT-PCR showed that the mRNA expression of Bcl-2 decreased while the expression of Bax and Caspase-3 increased in KGN cells treated with LPS. Nevertheless, the expression of these factors was restored after intervention with PQQ (Fig. 10 C, 10 F). The protein expression of apoptotic factors was consistent with the qRT-PCR results (Fig. 10 D, 10 E, 10 G, 10 H). Finally, we used flow cytometry to detect the apoptosis of five groups of cells, and the results showed that the apoptosis rate of cells treated with LPS was significantly higher than that of other groups and the results showed that the apoptosis rate of LPS treated cells was 1.16%, which was significantly higher than that of other groups (Fig. 10 I). These results suggest that PQQ intervention can improve the apoptosis of cells under inflammatory conditions. Discussion Ovarian aging is a common issue in the female reproductive system, which is a major long-term side effect of cancer chemotherapy[ 49 ]. As one of the primary treatment options for young female cancer patients, the ovarian toxicity of chemotherapy drugs has become a significant factor in the development of POI[ 50 , 51 ]. Therefore, exploring potential drugs that can protect the ovaries from chemotherapy damage has a profound impact on women's fertility. Over the past few years, a variety of drugs have been proved to play an important role in protecting ovarian function and delaying ovarian aging[ 52 , 53 ]. Among them, PQQ is a redox cycling coenzyme with anti-inflammatory[ 54 ], antioxidant[ 55 ], and anti-aging[ 56 ] effects. Our in vitro and in vivo studies indicates that protective effects of PQQ treatment on ovarian reserve is related to inflammation and glycolysis in a POI rat model, which recapitulates ovarian alterations and deficits in CTX-induced POI patients. To the best of our knowledge, this is the first comprehensive study that proves PQQ treatment can partially reverse ovarian dysfunction caused by CTX-induced POI, inflammation, glucose metabolism disorders, and apoptosis, while improving ovarian reserve function. This study expands upon earlier research, demonstrating that PQQ effectively protects ovarian dysfunction induced by CTX, maintains the stability of endocrine function, and increase pregnancy rates and litter sizes[ 29 ]. Previous studies have reported that the abnormal apoptosis of GCs can trigger follicular atresia[ 57 ], leading to ovarian aging[ 58 ] and impaired ovarian function[ 59 ]. Consistent with the previous reports, the POI animal model induced by CTX or cisplatin manifested as a plethora of follicular atresia, cell apoptosis, and ovarian aging[ 60 , 61 ]. As expected, the present studies demonstrate that PQQ pre-treatment attenuated granulosa apoptosis in the ovaries of POI rats. The effect of PQQ in inhibiting cell apoptosis of granulosa has also been confirmed in ovarian damage induced by superoxide and alkylating agents[ 29 , 62 ]. This suggests that the effect of PQQ on GCs may play a key role in chemotherapy-induced ovarian reserve dysfunction. Glycolysis is the major energy metabolism pathway in developing ovarian follicles. Studies have shown that developing follicles exhibit high glycolytic activity, and as follicle diameter increases, lactate production rate significantly increases in follicular fluid[ 63 , 64 ]. When the energy metabolism pathway of GCs is abnormal, lactate production decreases, and normal follicular development may be disrupted or even stalled[ 65 , 66 ]. In this study, we found that the expression of glycolytic enzymes and lactate in the ovaries of POI rats was significantly downregulated, which may explain the decline in ovarian reserve capacity. It is worth noting that when GCs are cultured with high concentrations of lactate, their proliferation activity is significantly upregulated, promoting follicular development and ovulation[ 67 ]. PQQ is widely believed to be an important nutrient for animal growth and development[ 68 , 69 ]. It can enhance the enzymatic activity of LDH in mammals, increase the formation of NAD + , and lactate content[ 70 ]. In this study, we found that PQQ can increase lactate levels in POI rats, restore glycolysis rate, and improve ovarian reserve function. Inflammation plays a crucial physiological role in folliculogenesis and ovulation[ 71 ]. However, abnormal inflammation can alter normal follicular dynamics, leading to compromised oocyte quality, anovulation, and associated infertility. Supporting this concept, studies have found that CTX-induced POI rats not only exhibit massive infiltration of macrophages and neutrophils in the ovaries[ 72 ], but also experience an increase in inflammatory factors such as IL-6, TNF-α, and IL-18, disrupting the inflammatory balance within the ovaries[ 73 , 74 ]. Importantly, it has been found that defects in NLPR3 or inhibition of NLRP3 inflammasomes can effectively improve ovarian function and fertility in mice[ 75 ]. Our study expands on previous findings, showing that during POI, levels of inflammatory cytokines increase, but with the recovery of impaired ovarian function, most of these cytokine levels decrease, indicating a positive correlation between POI and inflammation[ 47 ]. Furthermore, ovarian function indicators are negatively correlated with inflammation levels, and most importantly, lactate is significantly negatively correlated with NLRP3 inflammasomes. Additionally, PQQ reduces pro-inflammatory signaling, which Lin et al demonstrated is controlled by the NLRP3 inflammasome both in vivo and in vitro[ 76 ]. Our previous studies have also demonstrated that PQQ inhibits NLRP3 inflammasome-mediated cellular death to improve testicular spermatogenesis in obese mice[ 77 ]. In the current study, the expression of inflammation was significantly increased in POI rats, while PQQ effectively inhibited the inflammatory response, consistent with previous reports that PQQ has anti-inflammatory properties. This mechanism may be the key to improving ovarian reserve function in CTX-induced POI. The key enzymes in glycolysis and the related products could regulate and activate inflammasomes, which in turn are believed to affect glycolysis, as well[ 78 ]. Interestingly, in normal-diet mice, the lack of NLRP3 or IL-1β leads to increased insulin sensitivity, indicating that NLRP3 inflammasomes play an important role in regulating glucose homeostasis[ 79 , 80 ]. Multiple studies have shown that inhibiting the NLRP3 inflammasomes can effectively ameliorates non-alcoholic steatohepatitis[ 81 ], ameliorates neuroinflammation[ 82 ] and alleviates osteoarthritis[ 83 ], and so on. MCC950 is a specific NLRP3 inflammasome inhibitor[ 84 ], and research has shown that using MCC950 can improve the fertility of middle-aged female mice, similar to Nlrp3 knockout mice and effectively delays ovarian senescence and reduces apoptosis[ 75 ], but changes in ovarian glycolysis following inflammatory inhibition are not known. This study further demonstrates at the KGN cell level that PQQ can inhibit NLRP3 inflammasomes, exerting the same effect as MCC950. After NLRP3 inflammasomes are inhibited, the expression of glycolysis-limiting enzymes in KGN cells increases, cell apoptosis decreases, and granulosa cell endocrine function is restored. On the other hand, it has been reported that blocking the glycolysis pathway can lead to inflammation and cell apoptosis in mouse bone marrow-derived cells, and inflammatory factors such as NLRP3 and IL-18 are significantly increased[ 85 ]. Studies have also found that restoring glycolysis by supplementing specific metabolites or activating glycolytic enzymes has therapeutic significance in inhibiting inflammation and related immune pathology[ 19 ]. Further research is needed to determine the effectiveness of PQQ in activating glycolysis and inhibiting inflammation. 2-DG is a glucose analogue and a commonly used glucose metabolism inhibitor that inhibits glycolysis by acting on hexokinase[ 86 ]. It can suppress cancer cell uptake glycogen to inhibit cancer cell growth and metabolism[ 87 ]. In this study, we found that PQQ can activate glycolysis and inhibit the expression of inflammation, while inhibiting cell apoptosis and improving granulosa cell endocrine function. Therefore, the activation of glycolysis and inhibition of inflammation by PQQ play an important role in improving ovarian reserve function in POI rats. Limitations of this study should be emphasized here. Firstly, the modeling method used in this experiment only targeted POI patients caused by chemotherapy commonly seen in clinical practice, and cannot explore the pathogenesis of other types of POI. Future studies will consider designing multiple modeling methods to comprehensively elucidate the mechanism of POI. Secondly, our research only inhibited inflammasomes and glycolysis at the KGN cell level. Although the results showed that PQQ intervention had a significant effect, it would be better to prove the effect of PQQ by subsequent inhibition or knockout at the animal level. Moreover, our study did not fully connect with clinical POI patients, so further exploration is needed to connect PQQ with the prevention and treatment of clinical POI patients. Finally, we did not explore other damage patterns besides glycolysis abnormalities, inflammation, and apoptosis. Therefore, it is currently unclear whether PQQ's improvement of ovarian reserve function has other mechanisms besides activating glycolysis and inhibiting inflammation. Conclusion In conclusion, the rescue of cell apoptosis in POI rats treated with PQQ is accompanied by the activation of lactate and significant anti-inflammatory changes. We hope that our findings will facilitate future endeavors to uncover the specific role of inflammation in chemotherapy-induced POI. Recently, more and more research has recognized the complex role of inflammation in ovarian-related diseases, supporting the concept that drug therapy to improve ovarian inflammation promotes ovarian health. Potentially, the effect of PQQ in activating lactate production and inhibiting NLRP3 mediated inflammatory to improve the apoptosis of granulosa cells can provide new treatment strategies and drug targets for protecting follicular reserve and fertility in POI patients. Declarations Acknowledgements Not applicable. Funding This work was supported by grants from the National Natural Science Foundation of China (82101720), Natural Science Foundation of Guangxi in China (2024GXNSFAA010133)，Guangxi University Young and Middle-aged Teachers Basic Ability Promotion Project (2023KY0514), Hunan Natural Science Foundation (2024JJ0078), Research and Innovation Program for Graduate Students of Hunan Province (QL20230239). Author information These authors contributed equally Ke Liu, Peng Huo, BaoXiang Li and Tianlong Li Authors and Affiliations Hunan Province Innovative Training Base for Medical Postgraduates Hengyang Medical School, University of South China and Yueyang Women & Children’s Medical Center Yueyang, Hunan 416000, China Ke Liu, BaoXiang Li, Tianlong Li, Yue Ma, Ou Zhong, Wanhan Li, Xi Chen and Xiaocan Lei School of Public Health, Guilin Medical University, Guilin, Guangxi, 541001, China Peng Huo Department of Reproductive Medical Center, The Affiliated Hospital of Guilin Medical University, Guilin, Guangxi, 541001, China Shun Zhang Ethical statement All protocols in this study were approved by the Animal Ethics Committee of the University of South China (permit number: USC2020031602) and performed according to the guidelines, in compliance with the ARRIVE guidelines. Declaration of competing interest The authors declared that they have no conflicts of interest to this work. Authors' contributions Ke Liu, Peng Huo, and Tianlong Li designed the study. Ke Liu, Ou Zhong, and BaoXiang Li performed the experiments and drafted the manuscript. Shun Zhang, Wanhan Li, and Yue Ma were responsible for follicle counting and data analyses. Xi Chen and Xiaocan Lei revised the manuscript. All authors read and approved the final manuscript. Data availability statement The data generated in this study are available from the corresponding authors upon reasonable request. References Younis JS. Ovarian aging: latest thoughts on assessment and management. Current Opinion in Obstetrics & Gynecology 2011; 23:427–434. Wu J, Liu Y, Song Y, Wang L, Ai J, Li K. Aging conundrum: A perspective for ovarian aging. Front Endocrinol 2022; 13:952471. ESHRE Guideline: management of women with premature ovarian insufficiency. Hum Reprod 2016; 31:926–937. Ebrahimi M. Pathogenesis and Causes of Premature Ovarian Failure: An Update 2011; 5. Bedoschi G, Navarro PA, Oktay K. Chemotherapy-induced damage to ovary: mechanisms and clinical impact. Future Oncology 2016; 12:2333–2344. Blumenfeld Z. Chemotherapy and fertility. Best Practice & Research Clinical Obstetrics & Gynaecology 2012; 26:379–390. Lu H, Ma L, Zhang Y, Feng Y, Zhang J, Wang S. Current Animal Model Systems for Ovarian Aging Research. Aging and Disease 2022; 13. Mason JB, Habermehl TL, Underwood KB, Schneider A, Brieño-Enriquez MA, Masternak MM, Parkinson KC. The Interrelationship Between Female Reproductive Aging and Survival. The Journals of Gerontology: Series A 2022; 77:75–83. Navarro-Pando JM, Alcocer-Gómez E, Castejón-Vega B, Navarro-Villarán E, Condés-Hervás M, Mundi-Roldan M, Muntané J, Pérez-Pulido AJ, Bullon P, Wang C, Hoffman HM, Sanz A, et al. Inhibition of the NLRP3 inflammasome prevents ovarian aging. Sci Adv 2021; 7. Yang H, Pang H, Miao C. Ovarian IL-1α and IL-1β levels are associated with primary ovarian insufficiency n.d. Huang Y, Hu C, Ye H, Luo R, Fu X, Li X, Huang J, Chen W, Zheng Y. Inflamm-Aging: A New Mechanism Affecting Premature Ovarian Insufficiency. Journal of Immunology Research 2019; 2019:1–7. Jiang Y, Zhang Z, Cha L, Li L, Zhu D, Fang Z, He Z, Huang J, Pan Z. Resveratrol Plays a Protective Role against Premature Ovarian Failure and Prompts Female Germline Stem Cell Survival. IJMS 2019; 20:3605. Uri-Belapolsky S, Shaish A, Eliyahu E, Grossman H, Levi M, Chuderland D, Ninio-Many L, Hasky N, Shashar D, Almog T, Kandel-Kfir M, Harats D, et al. Interleukin-1 deficiency prolongs ovarian lifespan in mice. Proc Natl Acad Sci USA 2014; 111:12492–12497. Cui L, Yang G, Pan J, Zhang C. Tumor necrosis factor α knockout increases fertility of mice. Theriogenology 2011; 75:867–876. Goldberg EL, Dixit VD. Drivers of age-related inflammation and strategies for healthspan extension. Immunol Rev 2015; 265:63–74. Boland NI, Humpherson PG, Leese HJ, Gosden RG. Characterization of follicular energy metabolism. Human Reproduction 1994; 9:604–609. Zhang X, Zhang W, Wang Z, Zheng N, Yuan F, Li B, Li X, Deng L, Lin M, Chen X, Zhang M. Enhanced glycolysis in granulosa cells promotes the activation of primordial follicles through mTOR signaling. Cell Death Dis 2022; 13:87. Li T, Liu J, Liu K, Wang Q, Cao J, Xiao P, Yang W, Li X, Li J, Li M, Tang X, Li M, et al. Alpha-ketoglutarate ameliorates induced premature ovarian insufficiency in rats by inhibiting apoptosis and upregulating glycolysis. Reproductive BioMedicine Online 2023; 46:673–685. Sanman LE, Qian Y, Eisele NA, Ng TM, Van Der Linden WA, Monack DM, Weerapana E, Bogyo M. Disruption of glycolytic flux is a signal for inflammasome signaling and pyroptotic cell death. eLife 2016; 5:e13663. Horlock AD, Ormsby TJR, Clift MJD, Santos JEP, Bromfield JJ, Sheldon IM. Manipulating bovine granulosa cell energy metabolism limits inflammation. Reproduction 2021; 161:499–512. Akagawa M, Nakano M, Ikemoto K. Recent progress in studies on the health benefits of pyrroloquinoline quinone. Bioscience, Biotechnology, and Biochemistry 2016; 80:13–22. Cordell GA, Daley S. Pyrroloquinoline Quinone Chemistry, Biology, and Biosynthesis. Chem Res Toxicol 2022; 35:355–377. Qu X, Zhai B, Hu W, Lou M, Chen Y, Liu Y, Chen J, Mei S, You Z, Liu Z, Zhang L, Zhang Y, et al. Pyrroloquinoline quinone ameliorates diabetic cardiomyopathy by inhibiting the pyroptosis signaling pathway in C57BL/6 mice and AC16 cells. Eur J Nutr 2022; 61:1823–1836. Geng Q, Gao H, Yang R, Guo K, Miao D. Pyrroloquinoline Quinone Prevents Estrogen Deficiency-Induced Osteoporosis by Inhibiting Oxidative Stress and Osteocyte Senescence. Int J Biol Sci 2019; 15:58–68. Qiu K, Zhao Q, Wang J, Qi G-H, Wu S-G, Zhang H-J. Effects of Pyrroloquinoline Quinone on Lipid Metabolism and Anti-Oxidative Capacity in a High-Fat-Diet Metabolic Dysfunction-Associated Fatty Liver Disease Chick Model. IJMS 2021; 22:1458. Shi C, Yu Z, Wang Z, Ning R, Huang C, Gao Y, Wang F. Dietary supplementation with pyrroloquinoline quinone promotes growth, relieves weaning stress, and regulates metabolism of piglets compared with adding zinc oxide. Animal Nutrition 2023; 15:409–419. Lin X, Yang F, Huang J, Jiang S, Tang Y, Li J. Ameliorate effect of pyrroloquinoline quinone against cyclophosphamide-induced nephrotoxicity by activating the Nrf2 pathway and inhibiting the NLRP3 pathway. Life Sciences 2020; 256:117901. Jonscher KR, Stewart MS, Alfonso‐Garcia A, DeFelice BC, Wang XX, Luo Y, Levi M, Heerwagen MJR, Janssen RC, Houssaye BA, Wiitala E, Florey G, et al. Early PQQ supplementation has persistent long‐term protective effects on developmental programming of hepatic lipotoxicity and inflammation in obese mice. FASEB j 2017; 31:1434–1448. Dai X, Yi X, Wang Y, Xia W, Tao J, Wu J, Miao D, Chen L. PQQ Dietary Supplementation Prevents Alkylating Agent-Induced Ovarian Dysfunction in Mice. Front Endocrinol 2022; 13:781404. Dai X, Yi X, Wang Y, Xia W, Tao J, Wu J, Miao D, Chen L. PQQ Dietary Supplementation Prevents Alkylating Agent-Induced Ovarian Dysfunction in Mice. Front Endocrinol 2022; 13:781404. Qu X, Zhai B, Hu W, Lou M, Chen Y, Liu Y, Chen J, Mei S, You Z, Liu Z, Zhang L, Zhang Y, et al. Pyrroloquinoline quinone ameliorates diabetic cardiomyopathy by inhibiting the pyroptosis signaling pathway in C57BL/6 mice and AC16 cells. Eur J Nutr 2022; 61:1823–1836. Cora MC, Kooistra L, Travlos G. Vaginal Cytology of the Laboratory Rat and Mouse: Review and Criteria for the Staging of the Estrous Cycle Using Stained Vaginal Smears. Toxicol Pathol 2015; 43:776–793. Marcondes FK, Bianchi FJ, Tanno AP. Determination of the estrous cycle phases of rats: some helpful considerations. Braz J Biol 2002; 62:609–614. Liang A, Huang L, Liu H, He W, Lei X, Li M, Li S, Liang H, Chen G, Tang J, Chen F, Cao X, et al. Resveratrol Improves Follicular Development of PCOS Rats by Regulating the Glycolytic Pathway. Molecular Nutrition Food Res 2021; 65:2100457. Pedersen T, Peters H. PROPOSAL FOR A CLASSIFICATION OF OOCYTES AND FOLLICLES IN THE MOUSE OVARY. Reproduction 1968; 17:555–557. Liang A, Zhang W, Wang Q, Huang L, Zhang J, Ma D, Liu K, Li S, Chen X, Li S, Lei X. Resveratrol regulates insulin resistance to improve the glycolytic pathway by activating SIRT2 in PCOS granulosa cells. Front Nutr 2023; 9:1019562. Nishi Y, Yanase T, Mu Y-M, Oba K, Ichino I, Saito M, Nomura M, Mukasa C, Okabe T, Goto K, Takayanagi R, Kashimura Y, et al. Establishment and Characterization of a Steroidogenic Human Granulosa-Like Tumor Cell Line, KGN, That Expresses Functional Follicle-Stimulating Hormone Receptor 2001; 142. Cao J, Li L, Yao Y, Xing Y, Ma H. Dehydroepiandrosterone exacerbates nigericin-induced abnormal autophagy and pyroptosis via GPER activation in LPS-primed macrophages. Cell Death Dis 2022; 13:372. Deora V, Lee JD, Albornoz EA, McAlary L, Jagaraj CJ, Robertson AAB, Atkin JD, Cooper MA, Schroder K, Yerbury JJ, Gordon R, Woodruff TM. The microglial NLRP3 inflammasome is activated by amyotrophic lateral sclerosis proteins. Glia 2020; 68:407–421. Shin E-Y, Kim D-S, Lee MJ, Lee AR, Shim SH, Baek SW, Han DK, Lee DR. Prevention of chemotherapy-induced premature ovarian insufficiency in mice by scaffold-based local delivery of human embryonic stem cell-derived mesenchymal progenitor cells. Stem Cell Res Ther 2021; 12:431. Huang L, Liang A, Li T, Lei X, Chen X, Liao B, Tang J, Cao X, Chen G, Chen F, Wang Y, Hu L, et al. Mogroside V Improves Follicular Development and Ovulation in Young-Adult PCOS Rats Induced by Letrozole and High-Fat Diet Through Promoting Glycolysis. Front Endocrinol 2022; 13:838204. Wang S, Lin S, Zhu M, Li C, Chen S, Pu L, Lin J, Cao L, Zhang Y. Acupuncture Reduces Apoptosis of Granulosa Cells in Rats with Premature Ovarian Failure Via Restoring the PI3K/Akt Signaling Pathway. IJMS 2019; 20:6311. Coss D. Commentary on the Recent FSH Collection: Known Knowns and Known Unknowns. Endocrinology 2020; 161:bqz035. Bao B, Garverick HA. Expression of steroidogenic enzyme and gonadotropin receptor genes in bovine follicles during ovarian follicular waves: a review. Journal of Animal Science 1998; 76:1903. Sreerangaraja Urs DB, Wu W-H, Komrskova K, Postlerova P, Lin Y-F, Tzeng C-R, Kao S-H. Mitochondrial Function in Modulating Human Granulosa Cell Steroidogenesis and Female Fertility. IJMS 2020; 21:3592. Bedoschi G, Navarro PA, Oktay K. Chemotherapy-induced damage to ovary: mechanisms and clinical impact. Future Oncology 2016; 12:2333–2344. Ali I, Padhiar AA, Wang T, He L, Chen M, Wu S, Zhou Y, Zhou G. Stem Cell-Based Therapeutic Strategies for Premature Ovarian Insufficiency and Infertility: A Focus on Aging. Cells 2022; 11:3713. Jonscher KR, Chowanadisai W, Rucker RB. Pyrroloquinoline-Quinone Is More Than an Antioxidant: A Vitamin-like Accessory Factor Important in Health and Disease Prevention. Biomolecules 2021; 11:1441. Wu M, Ma L, Xue L, Ye W, Lu Z, Li X, Jin Y, Qin X, Chen D, Tang W, Chen Y, Hong Z, et al. Resveratrol alleviates chemotherapy-induced oogonial stem cell apoptosis and ovarian aging in mice. Aging 2019; 11:1030–1044. Blumenfeld Z. Chemotherapy and fertility. Best Practice & Research Clinical Obstetrics & Gynaecology 2012; 26:379–390. Loren AW, Mangu PB, Beck LN, Brennan L, Magdalinski AJ, Partridge AH, Quinn G, Wallace WH, Oktay K. Fertility Preservation for Patients With Cancer: American Society of Clinical Oncology Clinical Practice Guideline Update. JCO 2013; 31:2500–2510. Zhang J, Chen Q, Du D, Wu T, Wen J, Wu M, Zhang Y, Yan W, Zhou S, Li Y, Jin Y, Luo A, et al. Can ovarian aging be delayed by pharmacological strategies? Aging 2019; 11:817–832. Xueling L, Kun M, Wenhua T, Zhongkun X, Gang L, Chunyan H, Weiwei M, Chang G, Qi G. Natural products for treatment of premature ovarian failure: a narrative review. Journal of Traditional Chinese Medicine 2023. Devasani K, Kaul R, Majumdar A. Supplementation of pyrroloquinoline quinone with atorvastatin augments mitochondrial biogenesis and attenuates low grade inflammation in obese rats. European Journal of Pharmacology 2020; 881:173273. Wu X, Zhou X, Liang S, Zhu X, Dong Z. The mechanism of pyrroloquinoline quinone influencing the fracture healing process of estrogen-deficient mice by inhibiting oxidative stress. Biomedicine & Pharmacotherapy 2021; 139:111598. Long C, Wang Z, Guo Y, Sheng X, Xing K, Ni H, Wang X, Xiao L, Qi X. Research Note: Dietary supplementation with pyrroloquinoline quinone disodium (PQQ.Na2) improves oxidative status and semen quality in aging layer breeder roosters. Poultry Science 2022; 101:101812. Cheng J, Wei Y, Zhao Z, Xing Q, Gao Z, Cheng J, Yu C, Pan Y, Yang Y, Shi D, Deng Y. MiR-29c-5p regulates the function of buffalo granulosa cells to induce follicular atresia by targeting INHBA. Theriogenology 2023; 205:50–62. Yuan S, Wen J, Cheng J, Shen W, Zhou S, Yan W, Shen L, Luo A, Wang S. Age-associated up-regulation of EGR1 promotes granulosa cell apoptosis during follicle atresia in mice through the NF-κB pathway. Cell Cycle 2016; 15:2895–2905. Glamočlija V, Vilović K, Saraga-Babić M, Baranović A, Sapunar D. Apoptosis and active caspase-3 expression in human granulosa cells. Fertility and Sterility 2005; 83:426–431. Tang D, Feng X, Ling L, Zhang W, Luo Y, Wang Y, Xiong Z. Experimental study for the establishment of a chemotherapy-induced ovarian insufficiency model in rats by using cyclophosphamide combined with busulfan. Regulatory Toxicology and Pharmacology 2021; 122:104915. Ai G, Meng M, Guo J, Li C, Zhu J, Liu L, Liu B, Yang W, Shao X, Cheng Z, Wang L. Adipose-derived stem cells promote the repair of chemotherapy-induced premature ovarian failure by inhibiting granulosa cells apoptosis and senescence. Stem Cell Res Ther 2023; 14:75. Wu Y, Zhao M, Lin Z. Pyrroloquinoline quinone (PQQ) alleviated sepsis-induced acute liver injury, inflammation, oxidative stress and cell apoptosis by downregulating CUL3 expression. Bioengineered 2021; 12:2459–2468. Cinco R, Digman MA, Gratton E, Luderer U. Spatial Characterization of Bioenergetics and Metabolism of Primordial to Preovulatory Follicles in Whole Ex Vivo Murine Ovary. Biology of Reproduction 2016; 95:129–129. Boland NI, Humpherson PG, Leese HJ, Gosden RG. Characterization of follicular energy metabolism. Human Reproduction 1994; 9:604–609. Huang L, Liang A, Li T, Lei X, Chen X, Liao B, Tang J, Cao X, Chen G, Chen F, Wang Y, Hu L, et al. Mogroside V Improves Follicular Development and Ovulation in Young-Adult PCOS Rats Induced by Letrozole and High-Fat Diet Through Promoting Glycolysis. Front Endocrinol 2022; 13:838204. Liang A, Huang L, Liu H, He W, Lei X, Li M, Li S, Liang H, Chen G, Tang J, Chen F, Cao X, et al. Resveratrol Improves Follicular Development of PCOS Rats by Regulating the Glycolytic Pathway. Molecular Nutrition Food Res 2021; 65:2100457. Boland NI, Humpherson PG, Leese HJ, Gosden RG. The effect of glucose metabolism on murine follicle development and steroidogenesis in vitro. Human Reproduction 1994; 9:617–623. Huang C, Shi C, Li Z, Wang W, Ming D, Gao Y, Liu H, Ma X, Wang F. Pyrroloquinoline quinone regulates glycolipid metabolism in the jejunum via inhibiting AMPK phosphorylation of weaned pigs. Food Funct 2022; 13:9610–9621. Tamakoshi M, Suzuki T, Nishihara E, Nakamura S, Ikemoto K. Pyrroloquinoline quinone disodium salt improves brain function in both younger and older adults. Food Funct 2023; 14:2496–2501. Akagawa M, Minematsu K, Shibata T, Kondo T, Ishii T, Uchida K. Identification of lactate dehydrogenase as a mammalian pyrroloquinoline quinone (PQQ)-binding protein. Sci Rep 2016; 6:26723. Boots C, Jungheim E. Inflammation and Human Ovarian Follicular Dynamics. Semin Reprod Med 2015; 33:270–275. Deng T, He J, Yao Q, Wu L, Xue L, Wu M, Wu D, Li C, Li Y. Human Umbilical Cord Mesenchymal Stem Cells Improve Ovarian Function in Chemotherapy-Induced Premature Ovarian Failure Mice Through Inhibiting Apoptosis and Inflammation via a Paracrine Mechanism. Reprod Sci 2021; 28:1718–1732. Lai D, Wang F, Dong Z, Zhang Q. Skin-Derived Mesenchymal Stem Cells Help Restore Function to Ovaries in a Premature Ovarian Failure Mouse Model. PLoS ONE 2014; 9:e98749. Gabr H, Rateb MA, El Sissy MH, Ahmed Seddiek Hanan, Ali Abdelhameed Gouda S. The effect of bone marrow-derived mesenchymal stem cells on chemotherapy induced ovarian failure in albino rats: Mscs and Ovarian Failure. Microsc Res Tech 2016; 79:938–947. Navarro-Pando JM, Alcocer-Gómez E, Castejón-Vega B, Navarro-Villarán E, Condés-Hervás M, Mundi-Roldan M, Muntané J, Pérez-Pulido AJ, Bullon P, Wang C, Hoffman HM, Sanz A, et al. Inhibition of the NLRP3 inflammasome prevents ovarian aging. Sci Adv 2021; 7. Lin X, Yang F, Huang J, Jiang S, Tang Y, Li J. Ameliorate effect of pyrroloquinoline quinone against cyclophosphamide-induced nephrotoxicity by activating the Nrf2 pathway and inhibiting the NLRP3 pathway. Life Sciences 2020; 256:117901. Wang J, Zhang S, Hu L, Wang Y, Liu K, Le J, Tan Y, Li T, Xue H, Wei Y, Zhong O, He J, et al. Pyrroloquinoline quinone inhibits PCSK9-NLRP3 mediated pyroptosis of Leydig cells in obese mice. Cell Death Dis 2023; 14:723. Yu Q, Guo M, Zeng W, Zeng M, Zhang X, Zhang Y, Zhang W, Jiang X, Yu B. Interactions between NLRP3 inflammasome and glycolysis in macrophages: New insights into chronic inflammation pathogenesis. Immunity Inflam & Disease 2022; 10. Dinarello CA. Immunological and Inflammatory Functions of the Interleukin-1 Family. Annu Rev Immunol 2009; 27:519–550. Vandanmagsar B, Youm Y-H, Ravussin A, Galgani JE, Stadler K, Mynatt RL, Ravussin E, Stephens JM, Dixit VD. The NLRP3 inflammasome instigates obesity-induced inflammation and insulin resistance. Nat Med 2011; 17:179–188. Yu X, Hao M, Liu Y, Ma X, Lin W, Xu Q, Zhou H, Shao N, Kuang H. Liraglutide ameliorates non-alcoholic steatohepatitis by inhibiting NLRP3 inflammasome and pyroptosis activation via mitophagy. European Journal of Pharmacology 2019; 864:172715. Zhu H, Jian Z, Zhong Y, Ye Y, Zhang Y, Hu X, Pu B, Gu L, Xiong X. Janus Kinase Inhibition Ameliorates Ischemic Stroke Injury and Neuroinflammation Through Reducing NLRP3 Inflammasome Activation via JAK2/STAT3 Pathway Inhibition. Front Immunol 2021; 12:714943. Chen Z, Zhong H, Wei J, Lin S, Zong Z, Gong F, Huang X, Sun J, Li P, Lin H, Wei B, Chu J. Inhibition of Nrf2/HO-1 signaling leads to increased activation of the NLRP3 inflammasome in osteoarthritis. Arthritis Res Ther 2019; 21:300. Coll RC, Hill JR, Day CJ, Zamoshnikova A, Boucher D, Massey NL, Chitty JL, Fraser JA, Jennings MP, Robertson AAB, Schroder K. MCC950 directly targets the NLRP3 ATP-hydrolysis motif for inflammasome inhibition. Nat Chem Biol 2019; 15:556–559. Kaushik DK, Bhattacharya A, Mirzaei R, Rawji KS, Ahn Y, Rho JM, Yong VW. Enhanced glycolytic metabolism supports transmigration of brain-infiltrating macrophages in multiple sclerosis. Journal of Clinical Investigation 2019; 129:3277–3292. Laussel C, Léon S. Cellular toxicity of the metabolic inhibitor 2-deoxyglucose and associated resistance mechanisms. Biochemical Pharmacology 2020; 182:114213. Pelicano H, Martin DS, Xu R-H, Huang P. Glycolysis inhibition for anticancer treatment. Oncogene 2006; 25:4633–4646. Additional Declarations No competing interests reported. Supplementary Files GraphicalAbstract.jpg Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4786726","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":344585650,"identity":"2da672b7-456c-4a89-a432-e2d474af1309","order_by":0,"name":"Ke Liu","email":"","orcid":"","institution":"University of South China and Yueyang Women \u0026 Children’s Medical Center Yueyang","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Ke","middleName":"","lastName":"Liu","suffix":""},{"id":344585652,"identity":"cbd2c28c-1996-4259-8b8c-d3557b83574f","order_by":1,"name":"Peng Huo","email":"","orcid":"","institution":"Guilin Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Peng","middleName":"","lastName":"Huo","suffix":""},{"id":344585654,"identity":"a89062f6-6cf3-4b01-8d3f-885b7dcb887a","order_by":2,"name":"BaoXiang Li","email":"","orcid":"","institution":"University of South China and Yueyang Women \u0026 Children’s Medical Center Yueyang","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"BaoXiang","middleName":"","lastName":"Li","suffix":""},{"id":344585656,"identity":"34795b52-4358-4b21-a496-05f2416d931d","order_by":3,"name":"Tianlong Li","email":"","orcid":"","institution":"University of South China and Yueyang Women \u0026 Children’s Medical Center Yueyang","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Tianlong","middleName":"","lastName":"Li","suffix":""},{"id":344585658,"identity":"5a1f584f-15d6-4240-920c-50c34db219c6","order_by":4,"name":"Yue Ma","email":"","orcid":"","institution":"University of South China and Yueyang Women \u0026 Children’s Medical Center Yueyang","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yue","middleName":"","lastName":"Ma","suffix":""},{"id":344585660,"identity":"21fda912-6821-45a5-8e9d-130504b2eb67","order_by":5,"name":"Ou Zhong","email":"","orcid":"","institution":"University of South China and Yueyang Women \u0026 Children’s Medical Center Yueyang","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Ou","middleName":"","lastName":"Zhong","suffix":""},{"id":344585662,"identity":"2043fb6f-2d2d-4b27-bbc8-15c981844947","order_by":6,"name":"Wanhan Li","email":"","orcid":"","institution":"University of South China and Yueyang Women \u0026 Children’s Medical Center Yueyang","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Wanhan","middleName":"","lastName":"Li","suffix":""},{"id":344585663,"identity":"15db44ba-f8ba-4563-b29c-967b27ed4242","order_by":7,"name":"Shun Zhang","email":"","orcid":"","institution":"The Affiliated Hospital of Guilin Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Shun","middleName":"","lastName":"Zhang","suffix":""},{"id":344585664,"identity":"23911e80-1b3f-4528-9025-4851691f7372","order_by":8,"name":"Xi Chen","email":"","orcid":"","institution":"University of South China and Yueyang Women \u0026 Children’s Medical Center Yueyang","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xi","middleName":"","lastName":"Chen","suffix":""},{"id":344585665,"identity":"4bcdd9a6-d62f-4e91-b16a-804402cfefed","order_by":9,"name":"Xiaocan Lei","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABBElEQVRIie3RMUvDQBTA8RcOLstLs14o+BkeBASJNINfJOHALiJKlw4OkYAu+QAZip+hU+cLDzL5AQoudXJxOBdxcJA2bpqQscP9hxuO9+O4OwCX6wibAHi7jM5RCq9o7LLbVUNEAgiyN5cnoV82rJ7HERnVluOoarUJHsYQpXdTJM7X2ysy0ROnYSGaF4TZdS/BlmKkeUduN5zXRuoEQS96iV+BRkp+T9lwRoCnUwSTF31EIDCS6Eiw4pQg/BwmfuXd13Sxv35mgoK9NaAcJtjGYOnwyIZVO89rlvHZinQvCZV++8q+D19Zfti7JA0fy9ft+3LWS/5J7BcaP+9yuVyuv/0AWhtWPlBRAgEAAAAASUVORK5CYII=","orcid":"","institution":"University of South China and Yueyang Women \u0026 Children’s Medical Center Yueyang","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Xiaocan","middleName":"","lastName":"Lei","suffix":""}],"badges":[],"createdAt":"2024-07-23 08:00:16","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4786726/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4786726/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":63303254,"identity":"5bfeebf7-90b3-4a6a-8abf-d89c9b28df1d","added_by":"auto","created_at":"2024-08-26 16:44:09","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":11374201,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePQQ improved body weight, estrous cycle and serum hormone levels in POI rats\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA. Schematic diagram showing the experimental treatment of POI and POI-PQQ rats.\u003c/p\u003e\n\u003cp\u003eB. Body weight of rats after the induction of POI.\u003c/p\u003e\n\u003cp\u003eC. Body weight of the rats after PQQ treatment.\u003c/p\u003e\n\u003cp\u003eD. Cytological assessment of vaginal smears during each phase of the estrous cycle, Green arrows, nuclear epithelial cells; red arrows, cornified squamous epithelial cells; blue arrows, leucocytes.\u003c/p\u003e\n\u003cp\u003eE. Linear chart of the estrous cycle.\u003c/p\u003e\n\u003cp\u003eF. Quantitative analysis about the percentage of time on different phase of estrous cycles (n=10 rats per group)\u003c/p\u003e\n\u003cp\u003eG. Serum concentrations of E2 (1) , FSH (2) and LH(3) (n=5 rats per group).\u003c/p\u003e\n\u003cp\u003eH. Relative mRNA expression of \u003cem\u003e3β-hsd\u003c/em\u003e(1)\u003cem\u003e, Star\u003c/em\u003e(2)\u003cem\u003e, Cyp11a1\u003c/em\u003e(3)\u003cem\u003e, Cyp19a1\u003c/em\u003e(4) in the ovaries of the rats, analyzed using qRT-PCR.\u003c/p\u003e\n\u003cp\u003eAll data are presented as median with interquartile range or mean ± SEM. *\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05; **\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-4786726/v1/bb802377c2878dfbf30eb8c6.png"},{"id":63303251,"identity":"cbad7dbf-6a7b-4afd-8af4-673c9f9f3b45","added_by":"auto","created_at":"2024-08-26 16:44:09","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":2217860,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePQQ improve the ovarian index and ovarian morphology in POI rats\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA. Appearance of representative ovaries.\u003c/p\u003e\n\u003cp\u003eB. Ovarian index (n=10 rats per group).\u003c/p\u003e\n\u003cp\u003eC. Representative photos of ovarian sections stained with hematoxylin and eosin. Red triangles, atretic follicles, blue triangles, primordial follicle.\u003c/p\u003e\n\u003cp\u003eD. Follicle counts for each stage of development Follicle counts in each stage, Pr, primordial follicle; Pm, primary follicles; Se, secondary follicle; De, degenerative follicle; CL, corpus luteum.\u003c/p\u003e\n\u003cp\u003eE. Immunohistochemical analysis of DDX4 expression in the ovaries, red arrows, primordial follicle.\u003c/p\u003e\n\u003cp\u003eAll data are presented as median with interquartile range or mean ± SEM. *\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05; **\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4786726/v1/95df8c20a2c60dfbd604bb3d.png"},{"id":63303261,"identity":"8c2af4a9-c3ea-4db9-86d0-e9411f0579e7","added_by":"auto","created_at":"2024-08-26 16:44:10","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":29950669,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePQQ ameliorates apoptosis of ovarian granulosa cells in POI rats\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA. Representative photos of TUNEL-stained ovarian sections.\u003c/p\u003e\n\u003cp\u003eB. Relative mRNA expression of \u003cem\u003eBax, Bcl‑2\u003c/em\u003e and\u003cem\u003e Caspase-3\u003c/em\u003ein the ovaries, assessed using qRT‑PCR.\u003c/p\u003e\n\u003cp\u003eC. Immunohistochemical analysis of Bax, Bcl-2, and Caspase-3 expression in the ovaries, PBS was used as the negative control.\u003c/p\u003e\n\u003cp\u003eD. Protein expression of Bcl-2, Bax and caspase-3 in the ovaries of the rats, determined using western blot analysis; β-tubulin served as the loading control.\u003c/p\u003e\n\u003cp\u003eE. Relative protein expression of Bax, Bcl-2, and caspase3 was used to analyze heat map of gray value (n=3 rats per group).\u003c/p\u003e\n\u003cp\u003eAll data are presented as means ± SEM.*\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05; **\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-4786726/v1/b87fd7e20fa6f85161d10398.png"},{"id":63303822,"identity":"9aa129a3-0be1-474f-83cf-69c370cc3f2d","added_by":"auto","created_at":"2024-08-26 16:52:09","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":3724166,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of PQQ on the serum metabolism in POI rats\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA. Orthogonal partial least square discriminant analysis (OPLS-DA) score plots of Control and POI group (1) , POI and POI-PQQ group (2). (Control, n = 8; POI, n = 8; POI-PQQ, n = 8).\u003c/p\u003e\n\u003cp\u003eB. Heat maps of differential metabolites identified for lipid and steroid metabolism in serum samples were analyzed.\u003c/p\u003e\n\u003cp\u003eC. Functional enrichment analysis of differentially pathway between Control and POI group, POI and POI-PQQ group.\u003c/p\u003e\n\u003cp\u003eD. Summary plot for computed metabolic pathway analysis of differential metabolites identified pathways as a function of log(p) (y-axis) and the pathway impacts of the key metabolites (x-axis) that differed between Control and POI group, POI and POI-PQQ group.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-4786726/v1/520c648185878fc578fd1811.png"},{"id":63303253,"identity":"25c31b90-da6c-4e41-a1fc-2fe075b65f9b","added_by":"auto","created_at":"2024-08-26 16:44:09","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":581624,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of PQQ on the ovarian transcriptome\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA. Volcano plots of differentially expressed genes in Control versus POI groups.\u003c/p\u003e\n\u003cp\u003eB. Volcano plots of differentially expressed genes in POI versus POI-PQQ groups.\u003c/p\u003e\n\u003cp\u003eC. Venn diagram of differentially expressed genes in the three groups.\u003c/p\u003e\n\u003cp\u003eD. Functional enrichment analysis of differentially expressed genes in the three groups.\u003c/p\u003e\n\u003cp\u003eE. Cluster analysis of differentially expressed genes enriched in energy metabolism, hormone metabolism and inflammasome (n = 3 rats per group).\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-4786726/v1/50fd98fe7abd6ee24ccede75.png"},{"id":63303823,"identity":"380797d9-ac48-46c9-beba-00e9cbe15de9","added_by":"auto","created_at":"2024-08-26 16:52:10","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":15373164,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePQQ improves the glycolytic pathway of ovarian in POI rats\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA. Relative mRNA expression of \u003cem\u003eHk2, Pkm2 \u003c/em\u003eand\u003cem\u003e Ldha \u003c/em\u003ein ovarian of the rats, analyzed using qRT-PCR.\u003c/p\u003e\n\u003cp\u003eB. The level of lactate in the ovaries using ELISA.\u003c/p\u003e\n\u003cp\u003eC. Immunohistochemical analysis of HK2, PKM2, and LDHA expression in the ovaries, PBS was used as the negative control.\u003c/p\u003e\n\u003cp\u003eD. Protein expression of HK2 , PKM2 and LDHA in the ovaries, determined using western blot analysis; β-tubulin served as the loading control.\u003c/p\u003e\n\u003cp\u003eE. Relative protein expression of HK2 , PKM2 and LDHA in the ovaries was used to analyze heat map of gray value (n=3 rats per group).\u003c/p\u003e\n\u003cp\u003eAll data are presented as means ± SEM.*\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05; **\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-4786726/v1/dafdc20ef6eba7b6d1e7947f.png"},{"id":63303824,"identity":"f11bb3fb-31dc-41e2-81cb-8503ee4efd58","added_by":"auto","created_at":"2024-08-26 16:52:10","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":14030327,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePQQ reduced the level of ovarian inflammation in POI rats\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA. Relative mRNA expression of \u003cem\u003eNlrp3, Tnf-α, Il-1β, Il-18\u003c/em\u003e and \u003cem\u003eIl-6\u003c/em\u003ein the ovaries of the rats, analyzed using qRT-PCR.\u003c/p\u003e\n\u003cp\u003eB. Immunohistochemical analysis of NLRP3, TNF-α, IL-1β,IL-18 and IL-6 expression in the ovaries, PBS was used as the negative control.\u003c/p\u003e\n\u003cp\u003eC. Protein expression of NLRP3, TNF-α, IL-1β,IL-18 and IL-6 in the ovaries, determined using western blot analysis; β-tubulin served as the loading control.\u003c/p\u003e\n\u003cp\u003eD. Relative protein expression of NLRP3, TNF-α, IL-1β,IL-18 and IL-6 in the ovaries was used to analyze heat map of gray value (n=3 rats per group).\u003c/p\u003e\n\u003cp\u003eE. Spearman correlation analysis of that ovarian indexes, uterus indexes, serum hormones (E2, LH, FSH), glycolytic rate-limiting enzymes (HK2, PKM2, LDHA), lactate levels, innflammation cytokines (NLRP3, TNF-α, IL-1β, IL-18 and IL-6),and testosterone synthesis rate-limiting enzyme gene (StAR, 3β-HSD, CYP11A1 and CYP19A1).\u003c/p\u003e\n\u003cp\u003eF. Spearman correlation analysis of NLRP3 and lactate .\u003c/p\u003e\n\u003cp\u003eAll data are presented as means ± SEM.*\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05; **\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-4786726/v1/712991c52f4a287522926977.png"},{"id":63303258,"identity":"1393f90f-d94b-4616-9b29-6331ca275fd7","added_by":"auto","created_at":"2024-08-26 16:44:09","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":2935030,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePQQ improved the glycolysis pathway of LPS-treated KGN cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA. Cell viability of KGN cells in which treatment with LPS was determined using CCK8.\u003c/p\u003e\n\u003cp\u003eB. Cell viability of KGN cells in which treatment with PQQ was determined using CCK8.\u003c/p\u003e\n\u003cp\u003eC. Cell viability of KGN cells in which treatment with LPS and PQQ was determined using CCK8.\u003c/p\u003e\n\u003cp\u003eD. The level of lactate in the KGN cells using ELISA.\u003c/p\u003e\n\u003cp\u003eE. Cell culture media levels of IL-18 and IL-1β were measured using ELISA.\u003c/p\u003e\n\u003cp\u003eF. Relative mRNA expression of \u003cem\u003eNlrp3, Il-18 \u003c/em\u003eand\u003cem\u003e Il-1β \u003c/em\u003ein the KGN cells, analyzed using qRT-PCR.\u003c/p\u003e\n\u003cp\u003eG. Protein expression of NLRP3, IL-1β and IL-18 in the KGN cells , determined using western blot analysis; β-tubulin served as the loading control.\u003c/p\u003e\n\u003cp\u003eH. Relative protein expression of NLRP3, IL-1β and IL-18 in the KGN cells was used to analyze heat map of gray value.\u003c/p\u003e\n\u003cp\u003eI. Relative mRNA expression of \u003cem\u003eHk2, Pkm2 \u003c/em\u003eand\u003cem\u003e Ldha\u003c/em\u003e in the KGN cells analyzed using qRT-PCR.\u003c/p\u003e\n\u003cp\u003eJ. Protein expression of HK2 , PKM2 and LDHA in the KGN cells , determined using western blot analysis; β-tubulin served as the loading control.\u003c/p\u003e\n\u003cp\u003eK. Relative protein expression of HK2 , PKM2 and LDHA in the KGN cells was used to analyze heat map of gray value.\u003c/p\u003e\n\u003cp\u003eAll data are presented as means ± SEM.*\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05; **\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.01, and ns, \u003cem\u003ep\u003c/em\u003e \u0026gt; 0.05.\u003c/p\u003e","description":"","filename":"Figure8.png","url":"https://assets-eu.researchsquare.com/files/rs-4786726/v1/83ba477b994e5f2162000b94.png"},{"id":63303256,"identity":"3b7237f0-e21e-497e-95cd-1345ca9f8c53","added_by":"auto","created_at":"2024-08-26 16:44:09","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":2856226,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePQQ downregulated the expression of inflammatory factors in KGN cells treated with LPS and 2-DG\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA. The level of lactate in the KGN cells treat with 2-DG using ELISA.\u003c/p\u003e\n\u003cp\u003eB. The level of lactate in the KGN cells treat with 2-DG and PQQ using ELISA.\u003c/p\u003e\n\u003cp\u003eC. The level of lactate in the KGN cells using ELISA.\u003c/p\u003e\n\u003cp\u003eD. Relative mRNA expression of \u003cem\u003eHk2, Pkm2 \u003c/em\u003eand\u003cem\u003e Ldha\u003c/em\u003e in the KGN cells analyzed using qRT-PCR.\u003c/p\u003e\n\u003cp\u003eE. Protein expression of HK2 , PKM2 and LDHA in the KGN cells, determined using western blot analysis; β-tubulin served as the loading control.\u003c/p\u003e\n\u003cp\u003eF. Relative protein expression of HK2 , PKM2 and LDHA in the KGN cells was used to analyze heat map of gray value.\u003c/p\u003e\n\u003cp\u003eG. Relative mRNA expression of \u003cem\u003eNlrp3, Il-18 \u003c/em\u003eand\u003cem\u003e Il-1β\u003c/em\u003e in the KGN cells analyzed using qRT-PCR.\u003c/p\u003e\n\u003cp\u003eH. Protein expression of NLRP3, IL-1β and IL-18 in the KGN cells, determined using western blot analysis; β-tubulin served as the loading control\u003c/p\u003e\n\u003cp\u003eI. Relative protein expression of NLRP3, IL-1β and IL-18 in the KGN cells was used to analyze heat map of gray value.\u003c/p\u003e\n\u003cp\u003eAll data are presented as means ± SEM.*\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05; **\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"Figure9.png","url":"https://assets-eu.researchsquare.com/files/rs-4786726/v1/16b1dabdbf9bfd86e8924750.png"},{"id":63303260,"identity":"f2d852b8-448e-409d-813a-66c5aa03b32b","added_by":"auto","created_at":"2024-08-26 16:44:10","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":5176411,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePQQ improve apoptosis in KGN cells treated with LPS and 2-DG\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA. Relative mRNA expression of \u003cem\u003e3β-hsd, Star, Cyp11a1, Cyp19a1\u003c/em\u003e in the KGN cells with LPS, analyzed using qRT-PCR.\u003c/p\u003e\n\u003cp\u003eB. Relative mRNA expression of \u003cem\u003e3β-hsd, Star, Cyp11a1, Cyp19a1\u003c/em\u003e in the KGN cells with 2-DG, analyzed using qRT-PCR.\u003c/p\u003e\n\u003cp\u003eC. Relative mRNA expression of \u003cem\u003eBax, Bcl‑2\u003c/em\u003e and\u003cem\u003e Caspase-3\u003c/em\u003ein the KGN cells with LPS analyzed using qRT-PCR.\u003c/p\u003e\n\u003cp\u003eD. Protein expression of Bax, Bcl‑2 and Caspase-3 in the KGN cells with LPS , determined using western blot analysis; β-tubulin served as the loading control.\u003c/p\u003e\n\u003cp\u003eE. Relative protein expression of Bax, Bcl‑2 and Caspase-3 in the KGN cells with LPS was used to analyze heat map of gray value.\u003c/p\u003e\n\u003cp\u003eF. Relative mRNA expression of \u003cem\u003eBax, Bcl‑2 \u003c/em\u003eand\u003cem\u003e Caspase-3\u003c/em\u003ein the KGN cells with 2-DG of the rats, analyzed using qRT-PCR.\u003c/p\u003e\n\u003cp\u003eG. Protein expression of Bax, Bcl‑2 and Caspase-3 in the KGN cells with 2-DG , determined using western blot analysis; β-tubulin served as the loading control\u003c/p\u003e\n\u003cp\u003eH. Relative protein expression of Bax, Bcl‑2 and Caspase-3 in the KGN cells with 2-DG was used to analyze heat map of gray value.\u003c/p\u003e\n\u003cp\u003eI. Cell apoptosis detection with flow cytometry are proceeded by adopting the Annexin-V/phosphatidylinositol (PI) Apoptosis Detection Kit.\u003c/p\u003e\n\u003cp\u003eAll data are presented as means ± SEM.*\u003cem\u003ep\u003c/em\u003e \u0026lt;0.05; **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01 and ns, \u003cem\u003ep\u003c/em\u003e \u0026gt; 0.05.\u003c/p\u003e","description":"","filename":"Figure10.png","url":"https://assets-eu.researchsquare.com/files/rs-4786726/v1/32059b66ce53334024390e9d.png"},{"id":68473092,"identity":"d0261ac2-4a24-421c-8c6c-e58d7fd2df6a","added_by":"auto","created_at":"2024-11-07 15:32:41","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":119729656,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4786726/v1/d2a1d245-e9a0-4f25-8267-0d026bfa34ae.pdf"},{"id":63303821,"identity":"3db6de20-f466-4a45-a051-2c60ed145ac7","added_by":"auto","created_at":"2024-08-26 16:52:09","extension":"jpg","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":95094,"visible":true,"origin":"","legend":"","description":"","filename":"GraphicalAbstract.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4786726/v1/df8fa86a790aeaa564359f52.jpg"}],"financialInterests":"No competing interests reported.","formattedTitle":"Pyrroloquinoline quinone activates lactate production and inhibits NLRP3 to improve the apoptosis of granulosa cells in POI rats","fulltext":[{"header":"Introduction","content":"\u003cp\u003eOvarian aging has become one of the most detrimental factors of pregnancy achievement[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. In terms of pathological feature, ovarian aging mainly refers to premature ovarian insufficiency (POI), which is an endocrine disorder with chronic hypo-estrogenic state that characterized by premature depletion of the ovarian follicles or folliculogenesis arrest, occurring in approximately 1% of women under the age of 40 years[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. However, the etiology and pathogenesis of POI are quite complex. Clinically, a lot of risk factors like surgery, drugs, autoimmunity, genetic defects, as well as the environmental aspect and so on could trigger the occurrence of POI[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Although chemotherapy is one of the effective ways in treating cancers, its increased risk of ovarian failure is an important cause of infertility in young female cancer survivors[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Previous histological studies have shown that chemotherapy treatments can cause loss of primordial follicles and ovarian atrophy, which characterized primarily by elevated follicle-stimulating hormone (FSH) and luteinizing hormone (LH) levels, decreased estradiol (E2) synthesis and interrupted estrous cycle phases[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Numerous studies have confirmed that the classic chemotherapy drug CTX have serious reproductive toxicity and constantly employed in the POI animal model constructed, which has been widely adopted for studying the pathogenesis and therapeutic targets of POI[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eRecently, an extensive body of studies have demonstrated a strong connotation amongst inflammation and POI[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Moreover, the grades of inflammatory mediators include NLRP3, IL-18, IL-1β, and TNF-α are normally increased in follicular fluid of POI patients[\u003cspan additionalcitationids=\"CR10\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Similarly, the level of IL-18, and IL-1β were significantly elevated in serum and ovary of POI animal model[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], which were negatively correlation with the function of ovarian reserve. Nevertheless, when the inflammation was alleviated by reducing the levels of most inflammatory factors, the endocrine dysfunction and the diminished ovarian reserve were significantly repaired, which indicated a new therapeutic target for POI patients[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan additionalcitationids=\"CR14\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. On the other hand, lactate is the key energy source for folliculogenesis and follicular maturation which generated from glycolysis of granule cells (GCs)[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. However, the glycolytic capacity and the level of lactate were decreased along with the reduction in the quantity of growing follicles in POI[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Interestingly, when the level of lactate was significantly decreased due to the inhibited process of glycolysis, the levels of most inflammatory factors include NLRP3, TNF-α, and IL-6 was markedly increased[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. In turn, activation of NLRP3 inflammasome is considered to affect glycolysis as indicated by reduced lactate production. Therefore, it may be a novel solution to improve the ovarian reserve function of POI by exploring the regulatory relationship between lactate production and inflammation of GCs.\u003c/p\u003e \u003cp\u003ePQQ is a redox-active quinone that acts as a key nutrient involved in numerous physiological and biochemical processes in mammals, including reproduction, aging, and inflammation[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Since mammals cannot synthesize PQQ on their own, dietary PQQ supplementation is crucial for maintaining life health[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. In a variety of animal models, it was found that oral administration of PQQ could improve the growth performance, antioxidant capacity, and reduce aging[\u003cspan additionalcitationids=\"CR25\" citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. In addition, PQQ possesses pharmacological effect of inhibiting NLRP3 inflammasome, which can improve the progression of inflammatory diseases. Early supplementation of PQQ could enhance protection against liver lipotoxicity by reducing NLRP3 and IL-6 levels in obese mice[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Meanwhile, PQQ significantly decreased the levels of IL-6, IL-1β, and TNF-α in kidney of nephrotoxicity mice induced with CTX through inhibiting the NLRP3 pathway[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Notably, PQQ supplementation could increase the ovarian weight and size, partially normalize the disrupted estrous cycle period and prevent the loss of follicles damage by alkylating agents, which appeared to be directly mediated by promoting cell proliferation and inhibiting cell apoptosis of GCs[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Therefore, this study aimed to elucidate whether PQQ can recover ovarian reserve function by ameliorating abnormal lactate level and inflammation response in CTX-induced POI rats.\u003c/p\u003e \u003cp\u003eIn our study, we developed a POI rat model by CTX in SD rats, and confirmed that PQQ treatment reduced the ovarian injury and improved ovarian reserve. Meanwhile, PQQ treatment also up-regulated the lactate levels and the expression of key rate-limiting enzymes of glycolysis, while down-regulated the expression of inflammatory factors in POI rats. Further experiments showed that inflammatory response, abnormal glycolysis and apoptosis in KGN cells caused by LPS could be recovered through PQQ intervention. Our results imply that the ovarian reserve function in POI rats can be restored by PQQ treatment through reducing inflammation by the glycolytic pathway, PQQ might be an ideal choice to protect fertility in female cancer patients of childbearing age receiving CTX regimen and delay ovarian aging.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eAnimal care and treatment\u003c/h2\u003e \u003cp\u003eA total of Sprague Dawley (SD) female rats (n\u0026thinsp;=\u0026thinsp;30, 8-week-old, 200 g\u0026thinsp;\u0026plusmn;\u0026thinsp;50 g) were provided by Hunan Shrek Jingda Company (permit number: SCXK (Xiang) 2019-0004). All rats were fed adaptively for one week before experiments in a standard environment condition (25\u0026deg;C, 12 h light/dark cycle), with free access to food and water. Thirty rats were randomly divided into the control group (n\u0026thinsp;=\u0026thinsp;10), the POI group (n\u0026thinsp;=\u0026thinsp;10) and POI-PQQ group (n\u0026thinsp;=\u0026thinsp;10). To establish a POI model, the rats of POI group and POI-PQQ group were intraperitoneally injected with CTX (50 mg/kg on the first day and 8 mg/kg on the second day daily for 14 days [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e], while rats in the control group received equivalent volumes of normal saline, for the rats in the POI-PQQ group, oral gavage PQQ (10 mg/kg/day, dissolved in 0.9% NaCl) was provided starting one week before the establishment of the rat model until the date of sacrifice[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. POI model establishment was confirmed based on consecutive presence of metestrus and diestrus stages in the estrous cycle, with vaginal cytology performed from the 26th to the 35th days. Following the treatment period, all rats were the mice were anesthetized with urethane (0.6 mL/100 g). Blood samples were collected from each rat for hormone level analysis. Both ovaries from each rat were surgically excised and weighed. One ovary from each rat was fixed in 4% paraformaldehyde for paraffin embedding, while the other was stored at -80\u0026deg;C for subsequent western blot, qRT-PCR, and transcriptome sequencing.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eChemicals and reagents\u003c/h2\u003e \u003cp\u003eCTX (batch number: 20050712, national drug name: H32020857) was purchased from Jiangsu Hengrui Pharmaceutical. PQQ (batch number: 122628-50-6, SHENZHEN HYGIEIA Huining Biotechnology Co., LTD.). TransScript\u0026reg; One-Step gDNA Removal and cDNA Synthesis SuperMix (AT311-02) was purchased from TransGen Biotech (Beijing, China). AG RNAex Pro RNA (AG21101) was purchased from Accurate Biology (Hunan, China).Wright\u0026rsquo;s\u0026ndash;Giemsa Stain solution (G1020) and 20\u0026times;Metal Enhanced DAB Substrate Kit (DA1015) was purchased from Beijing Solarbio Science \u0026amp; Technology Co., Ltd (Beijing, China). Diaminobenzidine (DAB) chromogenic kit (ZLI-9018) was purchased from Beijing Zhongshan Jinqiao Biotechnology Co., Ltd (Beijing, China). For antibodies, hexokinase II (HK2) rabbit mAb (#2867), PKM2 (D78A4) XP\u0026reg; mAb (#4053), Caspase-3 Antibody (#9662), and TNF-α (D2D4) XP\u0026reg; Rabbit mAb (#11948) were purchased from Cell Signaling Technology Inc. (Danvers, Massachusetts, USA).Lactate Dehydrogenase Antibody (T55348), Bax Antibody (T40051), and Anti-β-Tubulin (C66) mAb (M20005) was purchased from Abmart Pharmaceutical Technology Co., Ltd. (Shanghai, China). BCL-2 Recombinant Rabbit Monoclonal Antibody (ARC0173) was purchased from Thermo Fisher (Waltham, MA, USA). NLRP3 Rabbit pAb (A12694) and IL-1β Rabbit pAb (A16288) were purchased from Abclonal (Wuhan, China). IL-18 Polyclonal antibody(10663-1-AP), IL-6 Monoclonal antibody (66146-1-Ig), Horseradish peroxidase-conjugated goat anti-rabbit IgG (H\u0026thinsp;+\u0026thinsp;L) (SA00001-2) and biotin-conjugated affinipure goat anti-rabbit IgG (H\u0026thinsp;+\u0026thinsp;L) (SA00004-2) were purchased from Protein Tech Group Inc. (Chicago, USA). Additionally, BCA Protein Assay Kit (CW0014S), eECL Western Blot Kit (CW0049M) and SDS-PAGE Gel Kit (CW0022S) was sourced from Beijing ComWin Biotech Co., Ltd. (Beijing, China). AG RNAex Pro RNA (AG21101) was purchased from Accurate Biology (Hunan, China). All primer design and synthesis were conducted by Shanghai Sangon151 Biotechnology Co., Ltd. (Shanghai, China).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eEstrous cycle determination\u003c/h2\u003e \u003cp\u003eVaginal smears were conducted daily at 12:00 over a span of 10 consecutive days, from the 26th to the 35th day of the experiment. Briefly, 20 \u0026micro;L normal saline (0.9% NaCl) was used to rinse the vagina two or three times, and vaginal fluid was collected and smeared on a slide and air dried at room temperature. Subsequently, the dried smears were stained using Wright\u0026rsquo;s Giemsa Stain (BASO, Zhuhai, China), following the manufacturer\u0026rsquo;s instructions. The estrous cycle stages, encompassing proestrus, estrus, metestrus, and diestrus, were discerned, along with the alterations in vaginal epithelial cells, based on the predominant cell type observed under a light microscope [\u003cspan additionalcitationids=\"CR33\" citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eHistological analysis and follicular classification\u003c/h2\u003e \u003cp\u003eFollowing proper anesthesia administration, the ovaries and uterus were meticulously excised and individually weighed. The uterus and one ovary from each rat were immersed in 4% formaldehyde for 24 h, subsequently undergoing paraffin embedding after a series of dehydration steps. Sections with a thickness of 5 \u0026micro;m were sequentially prepared and stained with hematoxylin and eosin (H\u0026amp;E), followed by microscopic examination. To determine the total follicle count and classification per ovary, every fifth section was meticulously evaluated across the entire ovary, commencing with the initial section, and the resulting tally was multiplied by 5 to yield a correction factor. For the enumeration of ovarian follicles at various developmental stages, all follicles within all sections of an ovary were enumerated, adhering to the established criteria outlined by Pedersen and Peters.[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eImmunohistochemistry(IHC)\u003c/h2\u003e \u003cp\u003eIHC assays were meticulously conducted on formaldehyde-fixed, paraffin-embedded specimens strictly adhering to the protocols provided by the manufacturers. Sections, precisely 5 \u0026micro;m thick, underwent a comprehensive preparation process starting with dewaxing and rehydration, followed by boiling in 0.1 M sodium citrate buffer (pH 6.0) to facilitate antigen retrieval. Permeabilization was achieved using a solution of 1% TritonX-100 in PBST for 30 min, which preceded a 45 min blocking phase with 5% bovine serum albumin to prevent nonspecific binding. Subsequently, the sections were immersed in a carefully optimized dilution of primary antibodies, including HK2 (1:500), PKM2 (1:800), LDHA (1:300), Bax (1:100), Bcl-2 (1:100), Caspase-3 (1:200), NLRP3 (1:200), IL-6 (1:200), IL-18 (1:200), IL-1β (1:200), TNF-α (1:200), and DDX4 (1:200), and incubated at 4\u0026deg;C overnight to ensure maximal binding efficiency. Following a thorough washing with PBST, sections were then exposed to the corresponding secondary antibodies at ambient temperature for 90 min, and subsequent HRP incubation was performed for 45 min to amplify the signal. Visualization of the immunoreactive proteins was achieved through the application of the 3,3-diaminobenzidine (DAB) chromogen, with hematoxylin serving as a counterstain post-PBST wash. PBS was utilized as a negative control throughout the procedure. The prepared sections were then systematically examined and documented using a light microscope (BX43, Olympus). To ensure objective evaluation, immunostaining assessments were independently carried out by two experienced pathologists who were blinded to the sample identities, culminating in a consensus on the staining profiles observed.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eDetermination of hormone levels\u003c/h2\u003e \u003cp\u003eAfter the rats were anaesthetised, whole blood was collected immediately by abdominal aortic puncture. Serum samples from rats in the diestrus phase were selected to measure serum hormone levels. Serum was further isolated by centrifugation (3000 g) for 15 min at 4\u0026deg;C. Serum samples from rats in the diestrus phase were chosen to measure hormone concentrations. In the definitive stage of the study, the concentrations of E2, LH, AMH, and FSH were quantified employing a commercially available enzyme-linked immunosorbent assay (ELISA) kit provided by Beijing North Institute of Biotechnology Co., Ltd.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eQuantitative real-time PCR (qRT-PCR)\u003c/h2\u003e \u003cp\u003eFollowing the manufacturer's protocol, total RNA was isolated from ovarian tissues and KGN cells using the AG RNAex Pro RNA. Complementary DNA (cDNA) synthesis was performed with the TransScript\u0026reg; One-Step gDNA Removal and cDNA Synthesis SuperMix. Then qRT-PCR was conducted in a 10 \u0026micro;L reaction volume using the 2\u0026times; Universal SYBR Green Fast qPCR Mix kit and the Applied Biosystems QuantStudio 3 system (Thermo Fisher Scientific). \u003cem\u003eGapdh\u003c/em\u003e was utilized as the reference gene, and relative gene expression levels were calculated using the comparative CT method. The specific primers used for amplification are detailed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences used for the qRT-PCR analysis.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTarget Gene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer Sequence(5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGeneBank Accession NO.\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRat Bax\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:GAGACACCTGAGCTGACCTT\u003c/p\u003e \u003cp\u003eR: TCCATGTTGTTGTCCAGTTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eXM_032913059\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRat Bcl-2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: AGTACCTGAACCGGCATCT\u003c/p\u003e \u003cp\u003eR: TCTTCAGAGACAGCCAGGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_016993\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRat Caspase-3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: CCGGTTACTATTCCTGGAGA\u003c/p\u003e \u003cp\u003eR:TAACACGAGTGAGGATGTGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eXM_006253130\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRat LDHA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:GGTTGACAGTGCATACGAAG\u003c/p\u003e \u003cp\u003eR: CCGCCTAAGGTTCTTCATTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eXM_039082293\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRat PKM2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:GGAACACTGGCATCATCTGTA\u003c/p\u003e \u003cp\u003eR:TCGGATCTCAGGTCCTTTAGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eXM_039080895.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRat HK2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TTGCCTACTTCTTCACGGAG\u003c/p\u003e \u003cp\u003eR:TCTGGAGTGGACCTCACAAAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_012735.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRat NLRP3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:GAGCTGGACCTCAGACAATGC\u003c/p\u003e \u003cp\u003eR:AGAACCAATGCGAGATCCTGACAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eXM_006246457.4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRat IL-1β\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:CCCTTGTCGAGAATGGGCAG\u003c/p\u003e \u003cp\u003eR:GACCAGAATGTGCCACGGTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_031512.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRat IL-18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:CGACCGAACAGCCAACGAATCC\u003c/p\u003e \u003cp\u003eR:GTCACAGCCAGTCCTCTTACTTCAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_019165.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRat IL-6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:AGCCACTGCCTTCCCTACTTC\u003c/p\u003e \u003cp\u003eR:GGTCCTTAGCCCACTCCTTCTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_012589.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRat TNF-α\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:GTCCCAACAAGGAGGAGAAGT R:CTGGTATGAAATGGCAAATCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_012675.3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRat 3βHSD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:GATGCCCAGTACCTGAGGAGA\u003c/p\u003e \u003cp\u003eR:GGACATGTGAGACATCAATGACA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_001007719\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRat stAR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:GAAGAACTGGTGGACCGCAT\u003c/p\u003e \u003cp\u003eR:GTGGAACCTCTACGCTTGGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_031558\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRat CYP11A1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:AGGTCCTTCAATGAGATCCCTT\u003c/p\u003e \u003cp\u003eR:TCCCTGTAAATGGGGCCATAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_017286\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRat CYP19A1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:TCCTCCTGATTCGGAATTGTG\u003c/p\u003e \u003cp\u003eR:GGCCCGATTCCCAGACA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_017085.3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRat GAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GAGTCCACTGGCGTCTTCAC\u003c/p\u003e \u003cp\u003eR:GAGGCATTGCTGATGATCTTGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eXM_032916238\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHOMO HK2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GTGAACGATGCTCCTGCTCTGAAG\u003c/p\u003e \u003cp\u003eR: CTCCTCAACGGCAGCCACAATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eM23115.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHOMO PKM2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:GAGTCCACTGGCGTCTTCAC\u003c/p\u003e \u003cp\u003eR:GAGGCATTGCTGATGATCTTGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eKJ905271.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHOMO LDHA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: ATGAGTTGGACTGTGCCTGTTGTG\u003c/p\u003e \u003cp\u003eR: GTGAAGAGCCAGGTGCCGTTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAY009108.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHOMO BCL-2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:CCCTGTGGATGACTGAGTACC\u003c/p\u003e \u003cp\u003eR: GCCAAACTGAGCAGAGTCTTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eBC027258.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHOMO BAX\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:CAAGAAGCTGAGCGAGTGTC\u003c/p\u003e \u003cp\u003eR:CCAGTTGAAGTTGCCGTCAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_001291428.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHOMO Caspase-3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:ATGGAAGCGAATCAATGGACTC\u003c/p\u003e \u003cp\u003eR:CAAGTTTCTGAATGTTTCCCTGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_004346.4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHOMO NLRP3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: ATGCTGCTTCGACATCTCCT\u003c/p\u003e \u003cp\u003eR: AACCAATGCGAGATCCTGAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eXM_047443562.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHOMO IL-1β\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:CCGACCACCACTACAGCAAGG\u003c/p\u003e \u003cp\u003eR:GGGCAGGGAACCAGCATCTTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_000576.3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHOMO IL-18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: ATGGCTGCTGAACCAGTAGAAGAC\u003c/p\u003e \u003cp\u003eR: TCCGGGGTGCATTATCTCTACAGTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_001562.4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHOMO 3β-HSD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: ATCCACACCGCCTGTATCAT\u003c/p\u003e \u003cp\u003eR: TCTGGATGATTTCCTTGTAGGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_000862\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHOMO StAR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GGCATCCTTAGCAACCAAGA\u003c/p\u003e \u003cp\u003eR: TCTCCTTGACATTGGGGTTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_000349\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHOMO CYP11A1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GCTGAGCAAAGACAAGA\u003c/p\u003e \u003cp\u003eR: GAATGAGGTTGAATGTGGTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_001099773\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHOMO CYP19A1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:CTAACATCATTCTGAACATCGG\u003c/p\u003e \u003cp\u003eR: CTGAAAATACCTGTAGGGAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_017085.3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHOMO GAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GAGTCCACTGGCGTCTTCAC\u003c/p\u003e \u003cp\u003eR: GAGGCATTGCTGATGATCTTGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eM33197.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eWestern blot analysis\u003c/h2\u003e \u003cp\u003eProteins isolated from ovarian tissues and KGN cells lysates were used for Western blot. Protein concentrations were accurately measured using the BCA Protein Assay Kit (CWBIO, China). Proteins were subsequently denatured by boiling at 100\u0026deg;C for 10 min. A total of 40 \u0026micro;g of protein lysates were electrophoretically separated on 10% SDS-polyacrylamide gels and then electrotransferred onto PVDF membranes (Bio-Rad). These membranes were blocked with 5% skim milk for 2 h at room temperature to prevent non-specific binding. Overnight incubation at 4\u0026deg;C followed, using primary antibodies targeted against Tubulin (1:5000 dilution), HK2, PKM2, LDHA, Bax, Bcl-2, Caspase-3, NLRP3, IL-6, IL-1β and TNF-α (all at a dilution of 1:1000), IL-18 (1:2000 dilution). Post-primary antibody incubation, the blots were exposed to HRP-conjugated secondary antibodies for 2 h at room temperature. Detection of chemiluminescent signals was performed using eECL reagent (CW0049M, CWBIO) and visualized on a Tanon-5500 Chemiluminescence Imaging System. Quantitative analysis of blot images was conducted utilizing Image J software from NIH Bethesda.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eTUNEL staining\u003c/h2\u003e \u003cp\u003eOvarian tissue sections underwent sequential dewaxing and hydration, followed by immersion in deionized water (dH\u003csub\u003e2\u003c/sub\u003eO), adhering to the manufacturer's guidelines. Subsequently, these sections were treated with 20 \u0026micro;g/mL proteinase K solution for 20 min at 37\u0026deg;C. After washing with PBS, the sections were incubated with the TUNEL reaction mixture at 37\u0026deg;C for one hour. Post-incubation, the sections were rinsed with PBS and then incubated with HRP-streptavidin reagent (1:200 dilution) for 30 min at room temperature. Protein localization was visualized using DAB and sections were counterstained with hematoxylin. Finally, the stained sections were examined under a light microscope to assess the staining patterns and cellular morphology.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eUHPLC-MS/MS analysis\u003c/h2\u003e \u003cp\u003eThe UHPLC-MS/MS analysis was conducted by Bioprofile (Shanghai, China). Each serum sample (100 \u0026micro;L) was thoroughly mixed with cold methanol acetonitrile (v/v, 1:1, 400 \u0026micro;L) by vortexing. Following sonication in an ice bath for one hour, the mixture was subsequently subjected to incubation at -20\u0026deg;C for 1 h This was followed by centrifugation at 4\u0026deg;C for 20 min at a velocity of 14,000 g. The resultant supernatants were then meticulously collected and desiccated under vacuum conditions in preparation for liquid chromatography-mass spectrometry (LC-MS) analysis, ensuring the integrity of the samples for accurate analytical outcomes.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eTranscriptome Sequencing and Bioinformatics Analysis\u003c/h2\u003e \u003cp\u003eOvarian RNA sequencing was executed through Novogene (Beijing, China). Initially, RNA integrity and concentration were evaluated utilizing a NanoPhotometer spectrophotometer (Implen Inc., CA, USA) and the Qubit RNA Assay Kit in conjunction with the Qubit 2.0 Fluorometer (Life Technologies, CA, USA) respectively. Transcriptome sequencing libraries were constructed from 3 \u0026micro;g of total RNA per sample using the NEBNext Ultra RNA Library Prep Kit for Illumina (CA, USA) following the protocols provided by the manufacturer. Index codes were applied to facilitate the assignment of sequences to respective samples. Index-coded samples underwent clustering on a cBot Cluster Generation System utilizing the TruSeq PE Cluster Kit v3-cBot-HS (Illumina, CA, USA). Subsequent to clustering, the libraries were sequenced using the Illumina Hiseq platform that produced 150 bp paired-end reads. Further analysis entailed differential expression assessment between two groups, conducted with the DESeq2 R package (version 1.10.1). Genes exhibiting an adjusted p-value of less than 0.05, as determined by DESeq2, were identified as differentially expressed. To explore the functional impacts of these differentially expressed genes (DEGs), Gene Ontology (GO) enrichment analysis was performed using the cluster Profiler R package, where GO terms with a corrected p-value less than 0.05 were considered significantly enriched. Moreover, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis was conducted to assess the statistical enrichment of DEGs, employing the online resource (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.genome.jp/kegg/\u003c/span\u003e\u003cspan address=\"http://www.genome.jp/kegg/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and the cluster Profiler R package, facilitating a deeper understanding of the biological pathways involved.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eCell culture and treatment\u003c/h2\u003e \u003cp\u003eKGN cells were obtained from Zhejiang Meisen Cell Technology Co., LTD (CTCC-003-0105). The cells were cultured in Dulbecco\u0026rsquo;s Modified Eagle\u0026rsquo;s Medium-high glucose (DMEM, Sigma, USA) supplemented with 12% Fetal Bovine Serum (FBS, Invitrogen, Gibco, USA), and maintained at 37\u0026deg;C in a 5% CO2 atmosphere. KGN cells were seeded in 6 cm plates at a density of 10\u003csup\u003e6\u003c/sup\u003e cells per well. Following a 24-h starvation period, the cells were treated without or with LPS (1 \u0026micro;g/mL) (I2643; Sigma, USA), Nigericin sodium salt (10 \u0026micro;mol/L)[\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e] (HY-100381, MedChemExpress, USA), MCC950 (100 nmol/L)[\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e] (HY-12815, MedChemExpress, USA), PQQ (0.1 \u0026micro;M), and 2-DG (0.2 \u0026micro;M) (HY-13966, MedChemExpress, USA) for 24 h.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eCell Counting Kit-8 (CCK-8)\u003c/h2\u003e \u003cp\u003eKGN cells were seeded into 96-well plates at a density of 10\u003csup\u003e4\u003c/sup\u003e cells per well and subjected to a 24-h starvation period to synchronize cellular metabolism. Post starvation, cells allocated to the LPS treatment groups were exposed to varying concentrations of LPS (0.1, 1, and 10 \u0026micro;g/mL) for 24 h to assess dose-dependent responses. Simultaneously, for the LPS\u0026thinsp;+\u0026thinsp;PQQ intervention, KGN cells were treated with a fixed LPS concentration of 1 \u0026micro;g/mL in the presence of a titrated series of PQQ concentrations (0, 10, 1, 0.1, 0.01, and 0.001 \u0026micro;M) over a 24-hour duration to elucidate the modulatory effect of PQQ on LPS-stimulated cells.\u003c/p\u003e \u003cp\u003eCell viability post-treatment was quantitatively evaluated by adding 10 \u0026micro;l of CCK-8 solution (BS350B, Biosharp, China) to each well, adhering to the manufacturer\u0026rsquo;s recommended guidelines, and subsequently incubating the cells for 30 min to facilitate the reaction. Absorbance measurements were taken using a VersaMax microplate reader, operating at a 450 nm wavelength, to determine the extent of cellular metabolic activity.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eEnzyme-Linked Immunosorbent Assay (ELISA)\u003c/h2\u003e \u003cp\u003eLactate in the ovary or culture supernatant of KGN cells were measured using the Lactic Acid Assay Kit instructions (A019-2-1, Nanjing Jiancheng). Plates were read on a VersaMax microplate reader at 530 nm wavelength.\u003c/p\u003e \u003cp\u003eCell culture media levels of inflammatory cytokines including IL-18 and IL-1β were measured using indicated an ELISA kit according to the Ruixinbio (Quanzhou, China) following the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eFlow Cytometry Analysis with Annexin V/PI Staining\u003c/h2\u003e \u003cp\u003eKGN cells were assessed for early apoptosis using the FITC-labeled Annexin V/PI Apoptosis Detection Kit (BD Bio-sciences, CA, USA). A seeding density of 2\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells was used for cultures in 6-well plates. Following treatment, cells were harvested, fixed, and stained in 1\u0026times; binding buffer composed of 140 mM NaCl, 10 mM HEPES/NaOH, and 2.5 mM CaCl2. In each case, cells were incubated with 5 \u0026micro;L of FITC-conjugated Annexin V and 5 \u0026micro;L of propidium iodide (PI) solution for 30 min at room temperature, shielded from light to prevent photobleaching of fluorochromes. The proportion of apoptotic cells was quantified using a Novo Cyte Flow Cytometer (ACEA Biosciences) and resulting data were processed using the NovoExpress software platform.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eAll experiments were conducted in triplicate or more. Quantitative data were analyzed using SPSS 26.0 software (SPSS, Inc., Chicago, Illinois, USA). The Shapiro-Wilk test was applied to assess the normality of data distribution. Normally distributed data were evaluated using one-way ANOVA followed by Tukey\u0026rsquo;s post-hoc test and presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation. Significant differences between groups were assessed with either an unpaired t-test or one-way ANOVA with Bonferroni correction for multiple comparisons. Non-normally distributed data were analyzed using the two-tailed Mann-Whitney U test and presented as medians with interquartile ranges (IQR, 25th to 75th percentile). Spearman\u0026rsquo;s rank correlation was used for correlation analysis. All statistical analyses were performed using R software (version 4.2.3), with \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 indicating statistical significance.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003ePQQ improved body weight, estrous cycle, and serum hormone levels in POI rats\u003c/h2\u003e \u003cp\u003eTo explore the effects of PQQ, a CTX-induced POI rat model was established, and the experimental design was shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA. The mean body mass of rats exposed to CTX for 14 days was much lower than that of the Control group. After PQQ treatment for 21 days (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB-C), the mean body mass of the rats in the POI-PQQ group was significantly higher than that of rats in the POI group. CTX-induced POI is accompanied by prolonged or stopped estrus cycles in female[\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e], so the effects of PQQ on the estrous cycle of POI rats were conducted. In the Control group, the rats had a regular estrous cycle (4\u0026ndash;5 days) including proestrus, estrous, metestrus, and diestrus phases sequentially (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD-E), which is consistent with previous studies[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. In the proestrus phase, there were mainly small and round nucleated epithelial cells with greyish red nucleus and greyish cytoplasm (green arrows point), which were relatively uniform in appearance and size. Estrous phase was predominantly characterized with flat and anucleated keratinized epithelial cells showing as blue or purple-blue stacks or layers (red arrows point). However, in the metestrus phase, neutrophils and nuclear epithelial cells were the predominant compositions, and anucleated keratinized epithelial cells were occasionally observed. In the diestrus phase, there were almost full of neutrophils (blue arrows point)[\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. Compared with the Control group, rats in the POI group lost their regular estrous cycles and were in proestrus or estrus for a long time (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE-F). Interestingly, the irregular estrous cycle was gradually returned to be normal after PQQ administration (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE-F). Of note, hormones have been identified as major influencers in GCs as ovarian reserve progressively declines[\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. We further evaluated the effects of PQQ treatment on the hormone levels POI rats. The serum levels of E2 and AMH (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG(1)(2)) were significantly lower in POI group than that in the Control group and POI-PQQ group. The serum levels of FSH and LH (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG(3)(4)) were much higher in the POI group than that in the Control group and POI-PQQ group. During ovarian aging in females, a rise in FSH is regarded as the hallmark of the reduction in the follicle reserve [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Our results indicated that PQQ can regulate reproductive endocrine function. Steroidogenesis in ovarian follicular cells is mediated by a number of well-known enzymes such as 3β-HSD, StAR, CYP11A1, and CYP19A1, which are significantly associated with oocyte quality[\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. The steroid hormone synthetase was detected using qRT-PCR. Compared with the Control group, the mRNA expression levels of \u003cem\u003e3β-hsd\u003c/em\u003e, \u003cem\u003eStar\u003c/em\u003e, \u003cem\u003eCyp11a1\u003c/em\u003e, and \u003cem\u003eCyp19a1\u003c/em\u003e were significantly down-regulated, whereas PQQ administration notably restored the mRNA expression of \u003cem\u003e3β-hsd\u003c/em\u003e, \u003cem\u003eStar\u003c/em\u003e, \u003cem\u003eCyp11a1\u003c/em\u003e, and \u003cem\u003eCyp19a1\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eH). It is evident that PQQ significantly enhances the body weight and circulating E2 and AMH concentration of rats, while reducing the circulating FSH and LH concentrations. These results revealed that PQQ restores the estrous cycle partially in POI rats induced by CTX and enhances the expression of steroidogenic enzymes.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003ePQQ improve the ovarian index and ovarian morphology in POI rats\u003c/h2\u003e \u003cp\u003eTo evaluate the effects of PQQ on the ovarian reserve and development of rats with POI, we compared the ovarian index and ovarian morphology of the three groups. First of all, we collected the ovaries and uteruses from rats and weighted them. We found that the size and weight of ovaries were signally reduced in POI group compared to Control group and POI-PQQ group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA-B). Afterwards, we performed HE staining on serial ovarian sections and counted the follicles in different stages. Assessment of the ovarian morphology of the three groups showed disorganized follicles structure and a significant decrease in the number of primordial follicles in POI rats compared with those in the controls, whereas atretic follicles were increased (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). We observed a significant reduction in the total number of follicles, including primordial, primary, and secondary follicles, as well as corpus luteum, in the POI group compared to the Control and POI-PQQ groups. Additionally, the number of atretic follicles markedly increased in the POI group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). Primordial follicles were identified by granulosa cell morphology and DDX4-specific immunostaining. Compared with the Control group, the number of primordial follicles were significantly reduced in POI group, yet POI-PQQ group showed increase in the number of primordial follicles compared with those in the POI group but they did not differ from those in the Control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). In addition, We found that the size and weight of uteruses were signally reduced in POI group compared to Control group and POI-PQQ group (Figure\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003eS1\u003c/span\u003e 1A-B). These results showed that PQQ treatment was protective against CTX-induced ovarian follicle failure.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003ePQQ ameliorates apoptosis of ovarian granulosa cells in POI rats\u003c/h2\u003e \u003cp\u003eChemotherapy drugs are well known to cause ovarian damage in female cancer patients, including granulosa cell apoptosis, ovarian vascular damage, and rapid depletion of the follicle reserve, resulting in POI[\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. To investigate the effects of PQQ on apoptosis in the ovary, we conducted TUNEL staining on the ovaries. The analysis revealed a prominent occurrence of apoptosis predominantly in granulosa cells (GCs), with the POI group exhibiting a significantly elevated expression of TUNEL-positive cells compared to the Control group. Intriguingly, the incidence of TUNEL-positive cells in the POI-PQQ group was markedly reduced in contrast to the POI group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Additionally, to further substantiate these findings, we employed quantitative real-time PCR (qRT-PCR), Western blot (WB), and immunohistochemistry (IHC) techniques for the assessment of apoptosis-related markers including Bcl-2, Bax, and Caspase-3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eB-E). It was discerned that the expressions of Bax and Caspase-3 were significantly elevated in the POI group as compared to the Control group, whereas these expressions were notably ameliorated in the POI-PQQ group, indicating a potential protective effect of PQQ (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Otherwise, the expression of \u003cem\u003eBcl-2\u003c/em\u003e was low in the POI group and largely restored in the POI-PQQ group. Ovarian IHC also showed that these proteins were all principally expressed in the GCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). Our findings suggest that PQQ treatment can prevent CTX-induced apoptosis of ovarian GCs.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003eEffects of PQQ on the serum metabolism in POI rats\u003c/h2\u003e \u003cp\u003eTo identify distinct metabolites that may be associated with abnormal metabolism in POI among thousands of variables, a pairwise comparison was conducted between the various group via analysis of serum metabolomics. Firstly, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eA and Figure\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003eS2\u003c/span\u003e, PCA score and OPLS-DA supervised model showed that the discrimination between groups was stable and reliable. Although there was overlap between groups, it could indicate that there were differences but not significant or absolute. The generated heat maps of the three groups of altered metabolites showed that metabolites clustered within the same cluster had similar expression patterns, indicating that samples from the Control group and POI group could be separated, and the pattern of the POI-PQQ group was consistent with that of the Control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). KEGG enrichment analysis showed that energy metabolic pathways could be observed between the two groups, although the difference was not significant(Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). In the metabolic pathway analysis, there were 34 main metabolic pathways in the Control group and the POI group, and 5 of them were \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05. A total of 34 pathways were identified between the POI group and POI-PQQ group, of which 7 pathways were \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, and TCA cycle pathway and glycolysis/gluconeogenesis pathway related to energy metabolism were identified in both comparison groups, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). These results suggest that PQQ may play an important role in the improvement of metabolic abnormalities in POI rats, and the underlying mechanism may be related to energy metabolism.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003eEffects of PQQ on the Ovarian Transcriptome\u003c/h2\u003e \u003cp\u003eTo elucidate the underlying mechanisms, we further performed transcriptome analysis of ovarian tissues. In comparison to the control, there were 689 upregulated and 906 downregulated genes in POI rats (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e5\u003c/span\u003eA); there were 2016 upregulated and 1771 downregulated genes between the POI-PQQ group and the PQQ group (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). Altogether, 1034 genes were differentially expressed between the three groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e5\u003c/span\u003eC), and the genes were involved in energy metabolism, hormone metabolism, and inflammasome pathways (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). Notably, PQQ administration restored these metabolism-related biological processes, which were dysregulated in POI rats. The expression levels of several genes related to glycolysis such as Ldha and Pkm exhibited a reversed phase between the POI and POI-PQQ groups. The expression of NLRP3, which are related to inflammation, showed reversed phase between the POI and POI-PQQ groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e5\u003c/span\u003eE). Hence, we hypothesized that PQQ could improve ovarian reserve function in aging rats by inhibiting inflammation and improving glycolysis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec25\" class=\"Section3\"\u003e \u003ch2\u003ePQQ improves the glycolytic pathway of ovarian in POI rats\u003c/h2\u003e \u003cp\u003eBased on the transcriptome profiling results showing the recovery of the enzymes of glycolysis, we further detected their expression profiles in the three groups. The results of qRT-PCR showed the downregulation of \u003cem\u003eHk2, Pkm2\u003c/em\u003e, and \u003cem\u003eLdha\u003c/em\u003e in the POI rats (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). PQQ administration significantly restored the mRNA expression of \u003cem\u003eHk2, Pkm2\u003c/em\u003e, and \u003cem\u003eLdha\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). The level of lactate were signally decreased in POI group and increased after PQQ intervention (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). IHC analysis confirmed the findings, revealing a decrease in LDHA, HK2, and PKM2 in the POI group and a recovery of values in response to PQQ treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e6\u003c/span\u003eC). Western blot analysis verified the decrease of LDHA, HK2, and PKM2 in the POI group versus the Control group, respectively, and the improvement in response to PQQ treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e6\u003c/span\u003eD-E). The aforementioned findings suggest that the aberrant glucose metabolism induced by CTX may be partially ameliorated through administration of PQQ.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec26\" class=\"Section3\"\u003e \u003ch2\u003ePQQ reduced the level of ovarian inflammation in POI rats\u003c/h2\u003e \u003cp\u003eGiven the above-mentioned transcriptome profiling that shows the reversed expression profile of Nlrp3 between the POI and POI-PQQ groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e5\u003c/span\u003eE), we further detected the expression levels of the inflammation factors in each group of ovaries, including NLRP3, TNF-α, IL-1β, IL-18, and IL-6. We observed that the expression of \u003cem\u003eNlrp3, Tnf-α, Il-1β, Il-18\u003c/em\u003e, \u003cem\u003eand Il-6\u003c/em\u003e was significantly upregulated in the POI group compared to the Control and POI-PQQ groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e7\u003c/span\u003eA). Next, we performed IHC on ovarian sections to detect the expression of NLRP3, TNF-α, IL-1β, IL-18, and IL-6 in the ovaries. We found that inflammatory factors positive cells were significantly increased in the POI group compared to the Control and POI-PQQ groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e7\u003c/span\u003eB). Western blot analysis also showed higher protein expression of NLRP3, TNF-α, IL-1β, IL-18 and IL-6 in the POI group than in the Control group and a similar response to PQQ treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e7\u003c/span\u003eC-D). In recent years, studies have shown that inflammation is closely related to POI[\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. Recent research has indicated a close correlation between inflammation and POI. Therefore, we conducted spearman correlation analyses to investigate the relationship between inflammatory factors and POI-related indicators, including serum hormones (E2, LH, FSH), glycolytic rate-limiting enzymes (HK2, PKM2, LDHA), lactate levels, and steroid hormone synthesis enzyme genes (StAR, 3β-HSD, CYP19A1, CYP11A1). Our results revealed a significant negative correlation between inflammatory factors and glycolytic rate-limiting enzymes as well as lactate levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e7\u003c/span\u003eE). Additionally, spearman correlation analyses were performed to explore the relationship between NLRP3 and lactate levels, and the results indicated a significant negative correlation between them (R=-0.88, P\u0026thinsp;=\u0026thinsp;0.0031) (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e7\u003c/span\u003eF).These results suggest that PQQ treatment partially prevented ovarian inflammation caused by CTX. Furthermore, by exploring the relationship between glycolysis and inflammation, we may be able to improve the ovarian reserve function of POI.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec27\" class=\"Section3\"\u003e \u003ch2\u003ePQQ improved the glycolysis pathway of LPS-treated KGN cells\u003c/h2\u003e \u003cp\u003eBased on the Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e7\u003c/span\u003e, it is evident that there exists a negative correlation between the expression of NLRP3 and glycolytic rate-limiting enzymes. Therefore, we hypothesize that the inhibition of inflammation may activate glycolysis. To test this hypothesis, we employed LPS to simulate the inflammatory state of POI rats in KGN cells, and subsequently added the specific activator of NLRP3, Nigericin. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e8\u003c/span\u003eA-C, we treated KGN cells with different concentrations of LPS and detected the changes in cell viability. CCK-8 assay results showed that cell viability decreased gradually with increasing LPS concentration in a concentration-dependent manner. Thus, we choose the 1\u0026micro;g/ml LPS for the next experiment. With respect to the concentration of LPS, we added different concentrations of PQQ to KGN cells. The results showed that 0.1\u0026micro;M PQQ increased LPS-induced cells viability, while other concentrations resulted in decreased cell viability. To explore the effect of LPS resistance on glycolysis, we treated KGN cells with NLRP3 inhibitors MCC950 and PQQ respectively. Both MCC950 and PQQ treatments significantly increased lactate levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e8\u003c/span\u003eD). We measured the levels of IL-18 and IL-1β in the cell culture supernatant. The findings demonstrate that cells treated with LPS show significantly elevated levels of IL-18 and IL-1β in comparison to those treated with MCC950 and PQQ. Moreover, there is no statistically significant difference in KGN cells treated with MCC950 and PQQ (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e8\u003c/span\u003eE). Next, the consequences of qPCR showed the mRNA expressions of \u003cem\u003eNlrp3\u003c/em\u003e, \u003cem\u003eIl-18\u003c/em\u003e, and \u003cem\u003eIl-1β\u003c/em\u003e were upregulated in KGN cells treated with LPS. While MCC950 and PQQ significantly inhibited the mRNA expression of \u003cem\u003eNlrp3,Il-18\u003c/em\u003e and \u003cem\u003eIl-1β\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e7\u003c/span\u003eF). Similarly, there is also no statistically significant difference in KGN cells treated with MCC950 and PQQ. The results obtained from the aforementioned experiments were in concordance with those of the Western blot analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e8\u003c/span\u003eG-H).These findings indicate that MCC950 effectively inhibits the expression of NLRP3, and PQQ exerts a similar effect as MCC950. In addition to assessing the expression of inflammation, we also evaluated the expression of glycolytic rate-limiting enzymes. The results of qPCR showed the mRNA expressions of \u003cem\u003eHk2, Pkm2\u003c/em\u003e, and \u003cem\u003eLdha\u003c/em\u003e were downregulated in KGN cells treated with LPS. MCC950 and PQQ administration significantly restored the mRNA expression of \u003cem\u003eHk2, Pkm2\u003c/em\u003e, and \u003cem\u003eLdha\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e8\u003c/span\u003eI). Western blot analysis confirmed that LPS decreased the protein expressions of HK2, PKM2, and LDHA in KGN cells compared with the improvement after MCC950 and PQQ treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e8\u003c/span\u003eJ-K). The results showed that PQQ indeed exerts anti-inflammatory effects, which in turn suppress the expression of glycolytic rate-limiting enzymes. However, alleviating inflammation can improve the expression of glycolytic rate-limiting enzymes.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec28\" class=\"Section2\"\u003e \u003ch2\u003ePQQ downregulated the expression of inflammatory factors in KGN cells treated with LPS and 2-DG\u003c/h2\u003e \u003cp\u003eWe have discovered that PQQ has the ability to suppress inflammation and activate glycolysis[\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. However, it remains unclear whether PQQ can suppress inflammation by activating glycolysis. Therefore, we investigated whether PQQ has the ability to activate glycolysis by adding inhibitors of glycolysis. Firstly, we determined the optimal concentration by measuring lactate levels of different concentrations of 2-DG (Fig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e9\u003c/span\u003eA-B). After PQQ treatments memorably increased lactate in KGN cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e9\u003c/span\u003eC). We have also detected the expression of IL-18 and IL-1β in the cell culture supernatant. The results showed that the expression of IL-18 and IL-1β in the culture supernatant of PQQ-treated cells was significantly decreased (Fig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e9\u003c/span\u003eD). As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e9\u003c/span\u003eE, the mRNA expression of \u003cem\u003eHk2\u003c/em\u003e, \u003cem\u003ePkm2\u003c/em\u003e, and \u003cem\u003eLdha\u003c/em\u003e were both increased after PQQ treatment. The western blot shows the same results, the protein expression of HK2, PKM2, and LDHA were both decreased in KGN cells with LPS, and increased after PQQ treatment(Fig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e9\u003c/span\u003eF-G). In contrast, the levels of inflammatory factors were significantly decreased after PQQ treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e9\u003c/span\u003eH-J). These results suggest that PQQ plays a key role in inhibiting inflammation by activating glycolysis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec29\" class=\"Section2\"\u003e \u003ch2\u003ePQQ improve apoptosis in KGN cells treated with LPS and 2-DG\u003c/h2\u003e \u003cp\u003eTo elucidate the impact of PQQ on the ovarian reserve function of granulosa cells, we detected the mRNA expression of steroidogenic enzyme genes (\u003cem\u003eStar\u003c/em\u003e, \u003cem\u003e3β-hsd\u003c/em\u003e, \u003cem\u003eCyp11a1\u003c/em\u003e, \u003cem\u003eand Cyp19a1\u003c/em\u003e) by qRT-PCR. Our findings revealed that the expression of steroidogenic enzyme genes was downregulated in cells treated with LPS, but was upregulated following intervention with PQQ (Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e10\u003c/span\u003eA-B). This suggests that PQQ can improve the expression of steroidogenic enzyme genes, regulate the secretion of estradiol, and enhance the ovarian reserve function of granulosa cells. In addition, cell apoptosis is associated with follicular atresia, which impairs ovarian function. Therefore, we examined the level of apoptosis in KGN cells. The results of qRT-PCR showed that the mRNA expression of \u003cem\u003eBcl-2\u003c/em\u003e decreased while the expression of \u003cem\u003eBax\u003c/em\u003e and \u003cem\u003eCaspase-3\u003c/em\u003e increased in KGN cells treated with LPS. Nevertheless, the expression of these factors was restored after intervention with PQQ (Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e10\u003c/span\u003eC, \u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e10\u003c/span\u003eF). The protein expression of apoptotic factors was consistent with the qRT-PCR results (Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e10\u003c/span\u003eD, \u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e10\u003c/span\u003eE, \u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e10\u003c/span\u003eG, \u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e10\u003c/span\u003eH). Finally, we used flow cytometry to detect the apoptosis of five groups of cells, and the results showed that the apoptosis rate of cells treated with LPS was significantly higher than that of other groups and the results showed that the apoptosis rate of LPS treated cells was 1.16%, which was significantly higher than that of other groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e10\u003c/span\u003eI). These results suggest that PQQ intervention can improve the apoptosis of cells under inflammatory conditions.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eOvarian aging is a common issue in the female reproductive system, which is a major long-term side effect of cancer chemotherapy[\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. As one of the primary treatment options for young female cancer patients, the ovarian toxicity of chemotherapy drugs has become a significant factor in the development of POI[\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e, \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. Therefore, exploring potential drugs that can protect the ovaries from chemotherapy damage has a profound impact on women's fertility. Over the past few years, a variety of drugs have been proved to play an important role in protecting ovarian function and delaying ovarian aging[\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e, \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. Among them, PQQ is a redox cycling coenzyme with anti-inflammatory[\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e], antioxidant[\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e], and anti-aging[\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e] effects. Our in vitro and in vivo studies indicates that protective effects of PQQ treatment on ovarian reserve is related to inflammation and glycolysis in a POI rat model, which recapitulates ovarian alterations and deficits in CTX-induced POI patients.\u003c/p\u003e \u003cp\u003eTo the best of our knowledge, this is the first comprehensive study that proves PQQ treatment can partially reverse ovarian dysfunction caused by CTX-induced POI, inflammation, glucose metabolism disorders, and apoptosis, while improving ovarian reserve function. This study expands upon earlier research, demonstrating that PQQ effectively protects ovarian dysfunction induced by CTX, maintains the stability of endocrine function, and increase pregnancy rates and litter sizes[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Previous studies have reported that the abnormal apoptosis of GCs can trigger follicular atresia[\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e], leading to ovarian aging[\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e] and impaired ovarian function[\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e]. Consistent with the previous reports, the POI animal model induced by CTX or cisplatin manifested as a plethora of follicular atresia, cell apoptosis, and ovarian aging[\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e, \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e]. As expected, the present studies demonstrate that PQQ pre-treatment attenuated granulosa apoptosis in the ovaries of POI rats. The effect of PQQ in inhibiting cell apoptosis of granulosa has also been confirmed in ovarian damage induced by superoxide and alkylating agents[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e]. This suggests that the effect of PQQ on GCs may play a key role in chemotherapy-induced ovarian reserve dysfunction.\u003c/p\u003e \u003cp\u003eGlycolysis is the major energy metabolism pathway in developing ovarian follicles. Studies have shown that developing follicles exhibit high glycolytic activity, and as follicle diameter increases, lactate production rate significantly increases in follicular fluid[\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e, \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e]. When the energy metabolism pathway of GCs is abnormal, lactate production decreases, and normal follicular development may be disrupted or even stalled[\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e, \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e]. In this study, we found that the expression of glycolytic enzymes and lactate in the ovaries of POI rats was significantly downregulated, which may explain the decline in ovarian reserve capacity. It is worth noting that when GCs are cultured with high concentrations of lactate, their proliferation activity is significantly upregulated, promoting follicular development and ovulation[\u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e]. PQQ is widely believed to be an important nutrient for animal growth and development[\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e, \u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e]. It can enhance the enzymatic activity of LDH in mammals, increase the formation of NAD\u003csup\u003e+\u003c/sup\u003e, and lactate content[\u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e]. In this study, we found that PQQ can increase lactate levels in POI rats, restore glycolysis rate, and improve ovarian reserve function.\u003c/p\u003e \u003cp\u003eInflammation plays a crucial physiological role in folliculogenesis and ovulation[\u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e71\u003c/span\u003e]. However, abnormal inflammation can alter normal follicular dynamics, leading to compromised oocyte quality, anovulation, and associated infertility. Supporting this concept, studies have found that CTX-induced POI rats not only exhibit massive infiltration of macrophages and neutrophils in the ovaries[\u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e], but also experience an increase in inflammatory factors such as IL-6, TNF-α, and IL-18, disrupting the inflammatory balance within the ovaries[\u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e73\u003c/span\u003e, \u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e74\u003c/span\u003e]. Importantly, it has been found that defects in NLPR3 or inhibition of NLRP3 inflammasomes can effectively improve ovarian function and fertility in mice[\u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e75\u003c/span\u003e]. Our study expands on previous findings, showing that during POI, levels of inflammatory cytokines increase, but with the recovery of impaired ovarian function, most of these cytokine levels decrease, indicating a positive correlation between POI and inflammation[\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. Furthermore, ovarian function indicators are negatively correlated with inflammation levels, and most importantly, lactate is significantly negatively correlated with NLRP3 inflammasomes. Additionally, PQQ reduces pro-inflammatory signaling, which Lin et al demonstrated is controlled by the NLRP3 inflammasome both in vivo and in vitro[\u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e76\u003c/span\u003e]. Our previous studies have also demonstrated that PQQ inhibits NLRP3 inflammasome-mediated cellular death to improve testicular spermatogenesis in obese mice[\u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e77\u003c/span\u003e]. In the current study, the expression of inflammation was significantly increased in POI rats, while PQQ effectively inhibited the inflammatory response, consistent with previous reports that PQQ has anti-inflammatory properties. This mechanism may be the key to improving ovarian reserve function in CTX-induced POI.\u003c/p\u003e \u003cp\u003eThe key enzymes in glycolysis and the related products could regulate and activate inflammasomes, which in turn are believed to affect glycolysis, as well[\u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e78\u003c/span\u003e]. Interestingly, in normal-diet mice, the lack of NLRP3 or IL-1β leads to increased insulin sensitivity, indicating that NLRP3 inflammasomes play an important role in regulating glucose homeostasis[\u003cspan citationid=\"CR79\" class=\"CitationRef\"\u003e79\u003c/span\u003e, \u003cspan citationid=\"CR80\" class=\"CitationRef\"\u003e80\u003c/span\u003e]. Multiple studies have shown that inhibiting the NLRP3 inflammasomes can effectively ameliorates non-alcoholic steatohepatitis[\u003cspan citationid=\"CR81\" class=\"CitationRef\"\u003e81\u003c/span\u003e], ameliorates neuroinflammation[\u003cspan citationid=\"CR82\" class=\"CitationRef\"\u003e82\u003c/span\u003e] and alleviates osteoarthritis[\u003cspan citationid=\"CR83\" class=\"CitationRef\"\u003e83\u003c/span\u003e], and so on. MCC950 is a specific NLRP3 inflammasome inhibitor[\u003cspan citationid=\"CR84\" class=\"CitationRef\"\u003e84\u003c/span\u003e], and research has shown that using MCC950 can improve the fertility of middle-aged female mice, similar to \u003cem\u003eNlrp3\u003c/em\u003e knockout mice and effectively delays ovarian senescence and reduces apoptosis[\u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e75\u003c/span\u003e], but changes in ovarian glycolysis following inflammatory inhibition are not known. This study further demonstrates at the KGN cell level that PQQ can inhibit NLRP3 inflammasomes, exerting the same effect as MCC950. After NLRP3 inflammasomes are inhibited, the expression of glycolysis-limiting enzymes in KGN cells increases, cell apoptosis decreases, and granulosa cell endocrine function is restored. On the other hand, it has been reported that blocking the glycolysis pathway can lead to inflammation and cell apoptosis in mouse bone marrow-derived cells, and inflammatory factors such as NLRP3 and IL-18 are significantly increased[\u003cspan citationid=\"CR85\" class=\"CitationRef\"\u003e85\u003c/span\u003e]. Studies have also found that restoring glycolysis by supplementing specific metabolites or activating glycolytic enzymes has therapeutic significance in inhibiting inflammation and related immune pathology[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Further research is needed to determine the effectiveness of PQQ in activating glycolysis and inhibiting inflammation. 2-DG is a glucose analogue and a commonly used glucose metabolism inhibitor that inhibits glycolysis by acting on hexokinase[\u003cspan citationid=\"CR86\" class=\"CitationRef\"\u003e86\u003c/span\u003e]. It can suppress cancer cell uptake glycogen to inhibit cancer cell growth and metabolism[\u003cspan citationid=\"CR87\" class=\"CitationRef\"\u003e87\u003c/span\u003e]. In this study, we found that PQQ can activate glycolysis and inhibit the expression of inflammation, while inhibiting cell apoptosis and improving granulosa cell endocrine function. Therefore, the activation of glycolysis and inhibition of inflammation by PQQ play an important role in improving ovarian reserve function in POI rats.\u003c/p\u003e \u003cp\u003eLimitations of this study should be emphasized here. Firstly, the modeling method used in this experiment only targeted POI patients caused by chemotherapy commonly seen in clinical practice, and cannot explore the pathogenesis of other types of POI. Future studies will consider designing multiple modeling methods to comprehensively elucidate the mechanism of POI. Secondly, our research only inhibited inflammasomes and glycolysis at the KGN cell level. Although the results showed that PQQ intervention had a significant effect, it would be better to prove the effect of PQQ by subsequent inhibition or knockout at the animal level. Moreover, our study did not fully connect with clinical POI patients, so further exploration is needed to connect PQQ with the prevention and treatment of clinical POI patients. Finally, we did not explore other damage patterns besides glycolysis abnormalities, inflammation, and apoptosis. Therefore, it is currently unclear whether PQQ's improvement of ovarian reserve function has other mechanisms besides activating glycolysis and inhibiting inflammation.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn conclusion, the rescue of cell apoptosis in POI rats treated with PQQ is accompanied by the activation of lactate and significant anti-inflammatory changes. We hope that our findings will facilitate future endeavors to uncover the specific role of inflammation in chemotherapy-induced POI. Recently, more and more research has recognized the complex role of inflammation in ovarian-related diseases, supporting the concept that drug therapy to improve ovarian inflammation promotes ovarian health. Potentially, the effect of PQQ in activating lactate production and inhibiting NLRP3 mediated inflammatory to improve the apoptosis of granulosa cells can provide new treatment strategies and drug targets for protecting follicular reserve and fertility in POI patients.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by grants from the National Natural Science Foundation of China (82101720), Natural Science Foundation of Guangxi in China (2024GXNSFAA010133)，Guangxi University Young and Middle-aged Teachers Basic\u003c/p\u003e\n\u003cp\u003eAbility Promotion Project (2023KY0514), Hunan Natural Science Foundation (2024JJ0078), Research and Innovation Program for Graduate Students of Hunan Province (QL20230239).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThese authors contributed equally Ke Liu, Peng Huo, BaoXiang Li and\u003c/p\u003e\n\u003cp\u003eTianlong Li\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors and Affiliations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHunan Province Innovative Training Base for Medical Postgraduates Hengyang Medical School, University of South China and Yueyang Women \u0026amp; Children’s Medical Center Yueyang, Hunan 416000, China\u003c/p\u003e\n\u003cp\u003eKe Liu, BaoXiang Li, Tianlong Li, Yue Ma, Ou Zhong, Wanhan Li, Xi Chen and Xiaocan Lei\u003c/p\u003e\n\u003cp\u003eSchool of Public Health, Guilin Medical University, Guilin, Guangxi, 541001, China\u003c/p\u003e\n\u003cp\u003ePeng Huo\u003c/p\u003e\n\u003cp\u003eDepartment of Reproductive Medical Center, The Affiliated Hospital of Guilin Medical University, Guilin, Guangxi, 541001, China\u003c/p\u003e\n\u003cp\u003eShun Zhang\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll protocols in this study were approved by the Animal Ethics Committee of the University of South China (permit number: USC2020031602) and performed according\u003c/p\u003e\n\u003cp\u003eto the guidelines, in compliance with the ARRIVE guidelines.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of competing interest\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declared that they have no conflicts of interest to this work.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors' contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eKe Liu, Peng Huo, and Tianlong Li designed the study. Ke Liu, Ou Zhong, and BaoXiang Li performed the experiments and drafted the manuscript. Shun Zhang, Wanhan Li, and Yue Ma were responsible for follicle counting and data analyses. Xi Chen and Xiaocan Lei revised the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data generated in this study are available from the corresponding authors upon reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eYounis JS. Ovarian aging: latest thoughts on assessment and management. Current Opinion in Obstetrics \u0026amp; Gynecology 2011; 23:427\u0026ndash;434.\u003c/li\u003e\n\u003cli\u003eWu J, Liu Y, Song Y, Wang L, Ai J, Li K. Aging conundrum: A perspective for ovarian aging. Front Endocrinol 2022; 13:952471.\u003c/li\u003e\n\u003cli\u003eESHRE Guideline: management of women with premature ovarian insufficiency. Hum Reprod 2016; 31:926\u0026ndash;937.\u003c/li\u003e\n\u003cli\u003eEbrahimi M. Pathogenesis and Causes of Premature Ovarian Failure: An Update 2011; 5.\u003c/li\u003e\n\u003cli\u003eBedoschi G, Navarro PA, Oktay K. Chemotherapy-induced damage to ovary: mechanisms and clinical impact. Future Oncology 2016; 12:2333\u0026ndash;2344.\u003c/li\u003e\n\u003cli\u003eBlumenfeld Z. Chemotherapy and fertility. Best Practice \u0026amp; Research Clinical Obstetrics \u0026amp; Gynaecology 2012; 26:379\u0026ndash;390.\u003c/li\u003e\n\u003cli\u003eLu H, Ma L, Zhang Y, Feng Y, Zhang J, Wang S. Current Animal Model Systems for Ovarian Aging Research. Aging and Disease 2022; 13.\u003c/li\u003e\n\u003cli\u003eMason JB, Habermehl TL, Underwood KB, Schneider A, Brie\u0026ntilde;o-Enriquez MA, Masternak MM, Parkinson KC. The Interrelationship Between Female Reproductive Aging and Survival. The Journals of Gerontology: Series A 2022; 77:75\u0026ndash;83.\u003c/li\u003e\n\u003cli\u003eNavarro-Pando JM, Alcocer-G\u0026oacute;mez E, Castej\u0026oacute;n-Vega B, Navarro-Villar\u0026aacute;n E, Cond\u0026eacute;s-Herv\u0026aacute;s M, Mundi-Roldan M, Muntan\u0026eacute; J, P\u0026eacute;rez-Pulido AJ, Bullon P, Wang C, Hoffman HM, Sanz A, et al. Inhibition of the NLRP3 inflammasome prevents ovarian aging. Sci Adv 2021; 7.\u003c/li\u003e\n\u003cli\u003eYang H, Pang H, Miao C. Ovarian IL-1\u0026alpha; and IL-1\u0026beta; levels are associated with primary ovarian insufficiency n.d.\u003c/li\u003e\n\u003cli\u003eHuang Y, Hu C, Ye H, Luo R, Fu X, Li X, Huang J, Chen W, Zheng Y. Inflamm-Aging: A New Mechanism Affecting Premature Ovarian Insufficiency. Journal of Immunology Research 2019; 2019:1\u0026ndash;7.\u003c/li\u003e\n\u003cli\u003eJiang Y, Zhang Z, Cha L, Li L, Zhu D, Fang Z, He Z, Huang J, Pan Z. Resveratrol Plays a Protective Role against Premature Ovarian Failure and Prompts Female Germline Stem Cell Survival. IJMS 2019; 20:3605.\u003c/li\u003e\n\u003cli\u003eUri-Belapolsky S, Shaish A, Eliyahu E, Grossman H, Levi M, Chuderland D, Ninio-Many L, Hasky N, Shashar D, Almog T, Kandel-Kfir M, Harats D, et al. Interleukin-1 deficiency prolongs ovarian lifespan in mice. Proc Natl Acad Sci USA 2014; 111:12492\u0026ndash;12497.\u003c/li\u003e\n\u003cli\u003eCui L, Yang G, Pan J, Zhang C. Tumor necrosis factor \u0026alpha; knockout increases fertility of mice. Theriogenology 2011; 75:867\u0026ndash;876.\u003c/li\u003e\n\u003cli\u003eGoldberg EL, Dixit VD. Drivers of age-related inflammation and strategies for healthspan extension. Immunol Rev 2015; 265:63\u0026ndash;74.\u003c/li\u003e\n\u003cli\u003eBoland NI, Humpherson PG, Leese HJ, Gosden RG. Characterization of follicular energy metabolism. Human Reproduction 1994; 9:604\u0026ndash;609.\u003c/li\u003e\n\u003cli\u003eZhang X, Zhang W, Wang Z, Zheng N, Yuan F, Li B, Li X, Deng L, Lin M, Chen X, Zhang M. Enhanced glycolysis in granulosa cells promotes the activation of primordial follicles through mTOR signaling. Cell Death Dis 2022; 13:87.\u003c/li\u003e\n\u003cli\u003eLi T, Liu J, Liu K, Wang Q, Cao J, Xiao P, Yang W, Li X, Li J, Li M, Tang X, Li M, et al. Alpha-ketoglutarate ameliorates induced premature ovarian insufficiency in rats by inhibiting apoptosis and upregulating glycolysis. Reproductive BioMedicine Online 2023; 46:673\u0026ndash;685.\u003c/li\u003e\n\u003cli\u003eSanman LE, Qian Y, Eisele NA, Ng TM, Van Der Linden WA, Monack DM, Weerapana E, Bogyo M. Disruption of glycolytic flux is a signal for inflammasome signaling and pyroptotic cell death. eLife 2016; 5:e13663.\u003c/li\u003e\n\u003cli\u003eHorlock AD, Ormsby TJR, Clift MJD, Santos JEP, Bromfield JJ, Sheldon IM. Manipulating bovine granulosa cell energy metabolism limits inflammation. Reproduction 2021; 161:499\u0026ndash;512.\u003c/li\u003e\n\u003cli\u003eAkagawa M, Nakano M, Ikemoto K. Recent progress in studies on the health benefits of pyrroloquinoline quinone. Bioscience, Biotechnology, and Biochemistry 2016; 80:13\u0026ndash;22.\u003c/li\u003e\n\u003cli\u003eCordell GA, Daley S. Pyrroloquinoline Quinone Chemistry, Biology, and Biosynthesis. Chem Res Toxicol 2022; 35:355\u0026ndash;377.\u003c/li\u003e\n\u003cli\u003eQu X, Zhai B, Hu W, Lou M, Chen Y, Liu Y, Chen J, Mei S, You Z, Liu Z, Zhang L, Zhang Y, et al. Pyrroloquinoline quinone ameliorates diabetic cardiomyopathy by inhibiting the pyroptosis signaling pathway in C57BL/6 mice and AC16 cells. Eur J Nutr 2022; 61:1823\u0026ndash;1836.\u003c/li\u003e\n\u003cli\u003eGeng Q, Gao H, Yang R, Guo K, Miao D. Pyrroloquinoline Quinone Prevents Estrogen Deficiency-Induced Osteoporosis by Inhibiting Oxidative Stress and Osteocyte Senescence. Int J Biol Sci 2019; 15:58\u0026ndash;68.\u003c/li\u003e\n\u003cli\u003eQiu K, Zhao Q, Wang J, Qi G-H, Wu S-G, Zhang H-J. Effects of Pyrroloquinoline Quinone on Lipid Metabolism and Anti-Oxidative Capacity in a High-Fat-Diet Metabolic Dysfunction-Associated Fatty Liver Disease Chick Model. IJMS 2021; 22:1458.\u003c/li\u003e\n\u003cli\u003eShi C, Yu Z, Wang Z, Ning R, Huang C, Gao Y, Wang F. Dietary supplementation with pyrroloquinoline quinone promotes growth, relieves weaning stress, and regulates metabolism of piglets compared with adding zinc oxide. Animal Nutrition 2023; 15:409\u0026ndash;419.\u003c/li\u003e\n\u003cli\u003eLin X, Yang F, Huang J, Jiang S, Tang Y, Li J. Ameliorate effect of pyrroloquinoline quinone against cyclophosphamide-induced nephrotoxicity by activating the Nrf2 pathway and inhibiting the NLRP3 pathway. Life Sciences 2020; 256:117901.\u003c/li\u003e\n\u003cli\u003eJonscher KR, Stewart MS, Alfonso‐Garcia A, DeFelice BC, Wang XX, Luo Y, Levi M, Heerwagen MJR, Janssen RC, Houssaye BA, Wiitala E, Florey G, et al. Early PQQ supplementation has persistent long‐term protective effects on developmental programming of hepatic lipotoxicity and inflammation in obese mice. FASEB j 2017; 31:1434\u0026ndash;1448.\u003c/li\u003e\n\u003cli\u003eDai X, Yi X, Wang Y, Xia W, Tao J, Wu J, Miao D, Chen L. PQQ Dietary Supplementation Prevents Alkylating Agent-Induced Ovarian Dysfunction in Mice. Front Endocrinol 2022; 13:781404.\u003c/li\u003e\n\u003cli\u003eDai X, Yi X, Wang Y, Xia W, Tao J, Wu J, Miao D, Chen L. PQQ Dietary Supplementation Prevents Alkylating Agent-Induced Ovarian Dysfunction in Mice. Front Endocrinol 2022; 13:781404.\u003c/li\u003e\n\u003cli\u003eQu X, Zhai B, Hu W, Lou M, Chen Y, Liu Y, Chen J, Mei S, You Z, Liu Z, Zhang L, Zhang Y, et al. Pyrroloquinoline quinone ameliorates diabetic cardiomyopathy by inhibiting the pyroptosis signaling pathway in C57BL/6 mice and AC16 cells. Eur J Nutr 2022; 61:1823\u0026ndash;1836.\u003c/li\u003e\n\u003cli\u003eCora MC, Kooistra L, Travlos G. Vaginal Cytology of the Laboratory Rat and Mouse: Review and Criteria for the Staging of the Estrous Cycle Using Stained Vaginal Smears. Toxicol Pathol 2015; 43:776\u0026ndash;793.\u003c/li\u003e\n\u003cli\u003eMarcondes FK, Bianchi FJ, Tanno AP. Determination of the estrous cycle phases of rats: some helpful considerations. Braz J Biol 2002; 62:609\u0026ndash;614.\u003c/li\u003e\n\u003cli\u003eLiang A, Huang L, Liu H, He W, Lei X, Li M, Li S, Liang H, Chen G, Tang J, Chen F, Cao X, et al. Resveratrol Improves Follicular Development of PCOS Rats by Regulating the Glycolytic Pathway. Molecular Nutrition Food Res 2021; 65:2100457.\u003c/li\u003e\n\u003cli\u003ePedersen T, Peters H. PROPOSAL FOR A CLASSIFICATION OF OOCYTES AND FOLLICLES IN THE MOUSE OVARY. Reproduction 1968; 17:555\u0026ndash;557.\u003c/li\u003e\n\u003cli\u003eLiang A, Zhang W, Wang Q, Huang L, Zhang J, Ma D, Liu K, Li S, Chen X, Li S, Lei X. Resveratrol regulates insulin resistance to improve the glycolytic pathway by activating SIRT2 in PCOS granulosa cells. Front Nutr 2023; 9:1019562.\u003c/li\u003e\n\u003cli\u003eNishi Y, Yanase T, Mu Y-M, Oba K, Ichino I, Saito M, Nomura M, Mukasa C, Okabe T, Goto K, Takayanagi R, Kashimura Y, et al. Establishment and Characterization of a Steroidogenic Human Granulosa-Like Tumor Cell Line, KGN, That Expresses Functional Follicle-Stimulating Hormone Receptor 2001; 142.\u003c/li\u003e\n\u003cli\u003eCao J, Li L, Yao Y, Xing Y, Ma H. Dehydroepiandrosterone exacerbates nigericin-induced abnormal autophagy and pyroptosis via GPER activation in LPS-primed macrophages. Cell Death Dis 2022; 13:372.\u003c/li\u003e\n\u003cli\u003eDeora V, Lee JD, Albornoz EA, McAlary L, Jagaraj CJ, Robertson AAB, Atkin JD, Cooper MA, Schroder K, Yerbury JJ, Gordon R, Woodruff TM. The microglial NLRP3 inflammasome is activated by amyotrophic lateral sclerosis proteins. Glia 2020; 68:407\u0026ndash;421.\u003c/li\u003e\n\u003cli\u003eShin E-Y, Kim D-S, Lee MJ, Lee AR, Shim SH, Baek SW, Han DK, Lee DR. Prevention of chemotherapy-induced premature ovarian insufficiency in mice by scaffold-based local delivery of human embryonic stem cell-derived mesenchymal progenitor cells. Stem Cell Res Ther 2021; 12:431.\u003c/li\u003e\n\u003cli\u003eHuang L, Liang A, Li T, Lei X, Chen X, Liao B, Tang J, Cao X, Chen G, Chen F, Wang Y, Hu L, et al. Mogroside V Improves Follicular Development and Ovulation in Young-Adult PCOS Rats Induced by Letrozole and High-Fat Diet Through Promoting Glycolysis. Front Endocrinol 2022; 13:838204.\u003c/li\u003e\n\u003cli\u003eWang S, Lin S, Zhu M, Li C, Chen S, Pu L, Lin J, Cao L, Zhang Y. Acupuncture Reduces Apoptosis of Granulosa Cells in Rats with Premature Ovarian Failure Via Restoring the PI3K/Akt Signaling Pathway. IJMS 2019; 20:6311.\u003c/li\u003e\n\u003cli\u003eCoss D. Commentary on the Recent FSH Collection: Known Knowns and Known Unknowns. Endocrinology 2020; 161:bqz035.\u003c/li\u003e\n\u003cli\u003eBao B, Garverick HA. Expression of steroidogenic enzyme and gonadotropin receptor genes in bovine follicles during ovarian follicular waves: a review. Journal of Animal Science 1998; 76:1903.\u003c/li\u003e\n\u003cli\u003eSreerangaraja Urs DB, Wu W-H, Komrskova K, Postlerova P, Lin Y-F, Tzeng C-R, Kao S-H. Mitochondrial Function in Modulating Human Granulosa Cell Steroidogenesis and Female Fertility. IJMS 2020; 21:3592.\u003c/li\u003e\n\u003cli\u003eBedoschi G, Navarro PA, Oktay K. Chemotherapy-induced damage to ovary: mechanisms and clinical impact. Future Oncology 2016; 12:2333\u0026ndash;2344.\u003c/li\u003e\n\u003cli\u003eAli I, Padhiar AA, Wang T, He L, Chen M, Wu S, Zhou Y, Zhou G. Stem Cell-Based Therapeutic Strategies for Premature Ovarian Insufficiency and Infertility: A Focus on Aging. Cells 2022; 11:3713.\u003c/li\u003e\n\u003cli\u003eJonscher KR, Chowanadisai W, Rucker RB. Pyrroloquinoline-Quinone Is More Than an Antioxidant: A Vitamin-like Accessory Factor Important in Health and Disease Prevention. Biomolecules 2021; 11:1441.\u003c/li\u003e\n\u003cli\u003eWu M, Ma L, Xue L, Ye W, Lu Z, Li X, Jin Y, Qin X, Chen D, Tang W, Chen Y, Hong Z, et al. Resveratrol alleviates chemotherapy-induced oogonial stem cell apoptosis and ovarian aging in mice. Aging 2019; 11:1030\u0026ndash;1044.\u003c/li\u003e\n\u003cli\u003eBlumenfeld Z. Chemotherapy and fertility. Best Practice \u0026amp; Research Clinical Obstetrics \u0026amp; Gynaecology 2012; 26:379\u0026ndash;390.\u003c/li\u003e\n\u003cli\u003eLoren AW, Mangu PB, Beck LN, Brennan L, Magdalinski AJ, Partridge AH, Quinn G, Wallace WH, Oktay K. Fertility Preservation for Patients With Cancer: American Society of Clinical Oncology Clinical Practice Guideline Update. JCO 2013; 31:2500\u0026ndash;2510.\u003c/li\u003e\n\u003cli\u003eZhang J, Chen Q, Du D, Wu T, Wen J, Wu M, Zhang Y, Yan W, Zhou S, Li Y, Jin Y, Luo A, et al. Can ovarian aging be delayed by pharmacological strategies? Aging 2019; 11:817\u0026ndash;832.\u003c/li\u003e\n\u003cli\u003eXueling L, Kun M, Wenhua T, Zhongkun X, Gang L, Chunyan H, Weiwei M, Chang G, Qi G. Natural products for treatment of premature ovarian failure: a narrative review. Journal of Traditional Chinese Medicine 2023.\u003c/li\u003e\n\u003cli\u003eDevasani K, Kaul R, Majumdar A. Supplementation of pyrroloquinoline quinone with atorvastatin augments mitochondrial biogenesis and attenuates low grade inflammation in obese rats. European Journal of Pharmacology 2020; 881:173273.\u003c/li\u003e\n\u003cli\u003eWu X, Zhou X, Liang S, Zhu X, Dong Z. The mechanism of pyrroloquinoline quinone influencing the fracture healing process of estrogen-deficient mice by inhibiting oxidative stress. Biomedicine \u0026amp; Pharmacotherapy 2021; 139:111598.\u003c/li\u003e\n\u003cli\u003eLong C, Wang Z, Guo Y, Sheng X, Xing K, Ni H, Wang X, Xiao L, Qi X. Research Note: Dietary supplementation with pyrroloquinoline quinone disodium (PQQ.Na2) improves oxidative status and semen quality in aging layer breeder roosters. Poultry Science 2022; 101:101812.\u003c/li\u003e\n\u003cli\u003eCheng J, Wei Y, Zhao Z, Xing Q, Gao Z, Cheng J, Yu C, Pan Y, Yang Y, Shi D, Deng Y. MiR-29c-5p regulates the function of buffalo granulosa cells to induce follicular atresia by targeting INHBA. Theriogenology 2023; 205:50\u0026ndash;62.\u003c/li\u003e\n\u003cli\u003eYuan S, Wen J, Cheng J, Shen W, Zhou S, Yan W, Shen L, Luo A, Wang S. Age-associated up-regulation of EGR1 promotes granulosa cell apoptosis during follicle atresia in mice through the NF-\u0026kappa;B pathway. Cell Cycle 2016; 15:2895\u0026ndash;2905.\u003c/li\u003e\n\u003cli\u003eGlamočlija V, Vilović K, Saraga-Babić M, Baranović A, Sapunar D. Apoptosis and active caspase-3 expression in human granulosa cells. Fertility and Sterility 2005; 83:426\u0026ndash;431.\u003c/li\u003e\n\u003cli\u003eTang D, Feng X, Ling L, Zhang W, Luo Y, Wang Y, Xiong Z. Experimental study for the establishment of a chemotherapy-induced ovarian insufficiency model in rats by using cyclophosphamide combined with busulfan. Regulatory Toxicology and Pharmacology 2021; 122:104915.\u003c/li\u003e\n\u003cli\u003eAi G, Meng M, Guo J, Li C, Zhu J, Liu L, Liu B, Yang W, Shao X, Cheng Z, Wang L. Adipose-derived stem cells promote the repair of chemotherapy-induced premature ovarian failure by inhibiting granulosa cells apoptosis and senescence. Stem Cell Res Ther 2023; 14:75.\u003c/li\u003e\n\u003cli\u003eWu Y, Zhao M, Lin Z. Pyrroloquinoline quinone (PQQ) alleviated sepsis-induced acute liver injury, inflammation, oxidative stress and cell apoptosis by downregulating CUL3 expression. Bioengineered 2021; 12:2459\u0026ndash;2468.\u003c/li\u003e\n\u003cli\u003eCinco R, Digman MA, Gratton E, Luderer U. Spatial Characterization of Bioenergetics and Metabolism of Primordial to Preovulatory Follicles in Whole Ex Vivo Murine Ovary. Biology of Reproduction 2016; 95:129\u0026ndash;129.\u003c/li\u003e\n\u003cli\u003eBoland NI, Humpherson PG, Leese HJ, Gosden RG. Characterization of follicular energy metabolism. Human Reproduction 1994; 9:604\u0026ndash;609.\u003c/li\u003e\n\u003cli\u003eHuang L, Liang A, Li T, Lei X, Chen X, Liao B, Tang J, Cao X, Chen G, Chen F, Wang Y, Hu L, et al. Mogroside V Improves Follicular Development and Ovulation in Young-Adult PCOS Rats Induced by Letrozole and High-Fat Diet Through Promoting Glycolysis. Front Endocrinol 2022; 13:838204.\u003c/li\u003e\n\u003cli\u003eLiang A, Huang L, Liu H, He W, Lei X, Li M, Li S, Liang H, Chen G, Tang J, Chen F, Cao X, et al. Resveratrol Improves Follicular Development of PCOS Rats by Regulating the Glycolytic Pathway. Molecular Nutrition Food Res 2021; 65:2100457.\u003c/li\u003e\n\u003cli\u003eBoland NI, Humpherson PG, Leese HJ, Gosden RG. The effect of glucose metabolism on murine follicle development and steroidogenesis in vitro. Human Reproduction 1994; 9:617\u0026ndash;623.\u003c/li\u003e\n\u003cli\u003eHuang C, Shi C, Li Z, Wang W, Ming D, Gao Y, Liu H, Ma X, Wang F. Pyrroloquinoline quinone regulates glycolipid metabolism in the jejunum \u003cem\u003evia\u003c/em\u003e inhibiting AMPK phosphorylation of weaned pigs. Food Funct 2022; 13:9610\u0026ndash;9621.\u003c/li\u003e\n\u003cli\u003eTamakoshi M, Suzuki T, Nishihara E, Nakamura S, Ikemoto K. Pyrroloquinoline quinone disodium salt improves brain function in both younger and older adults. Food Funct 2023; 14:2496\u0026ndash;2501.\u003c/li\u003e\n\u003cli\u003eAkagawa M, Minematsu K, Shibata T, Kondo T, Ishii T, Uchida K. Identification of lactate dehydrogenase as a mammalian pyrroloquinoline quinone (PQQ)-binding protein. Sci Rep 2016; 6:26723.\u003c/li\u003e\n\u003cli\u003eBoots C, Jungheim E. Inflammation and Human Ovarian Follicular Dynamics. Semin Reprod Med 2015; 33:270\u0026ndash;275.\u003c/li\u003e\n\u003cli\u003eDeng T, He J, Yao Q, Wu L, Xue L, Wu M, Wu D, Li C, Li Y. Human Umbilical Cord Mesenchymal Stem Cells Improve Ovarian Function in Chemotherapy-Induced Premature Ovarian Failure Mice Through Inhibiting Apoptosis and Inflammation via a Paracrine Mechanism. Reprod Sci 2021; 28:1718\u0026ndash;1732.\u003c/li\u003e\n\u003cli\u003eLai D, Wang F, Dong Z, Zhang Q. Skin-Derived Mesenchymal Stem Cells Help Restore Function to Ovaries in a Premature Ovarian Failure Mouse Model. PLoS ONE 2014; 9:e98749.\u003c/li\u003e\n\u003cli\u003eGabr H, Rateb MA, El Sissy MH, Ahmed Seddiek Hanan, Ali Abdelhameed Gouda S. The effect of bone marrow-derived mesenchymal stem cells on chemotherapy induced ovarian failure in albino rats: Mscs and Ovarian Failure. Microsc Res Tech 2016; 79:938\u0026ndash;947.\u003c/li\u003e\n\u003cli\u003eNavarro-Pando JM, Alcocer-G\u0026oacute;mez E, Castej\u0026oacute;n-Vega B, Navarro-Villar\u0026aacute;n E, Cond\u0026eacute;s-Herv\u0026aacute;s M, Mundi-Roldan M, Muntan\u0026eacute; J, P\u0026eacute;rez-Pulido AJ, Bullon P, Wang C, Hoffman HM, Sanz A, et al. Inhibition of the NLRP3 inflammasome prevents ovarian aging. Sci Adv 2021; 7.\u003c/li\u003e\n\u003cli\u003eLin X, Yang F, Huang J, Jiang S, Tang Y, Li J. Ameliorate effect of pyrroloquinoline quinone against cyclophosphamide-induced nephrotoxicity by activating the Nrf2 pathway and inhibiting the NLRP3 pathway. Life Sciences 2020; 256:117901.\u003c/li\u003e\n\u003cli\u003eWang J, Zhang S, Hu L, Wang Y, Liu K, Le J, Tan Y, Li T, Xue H, Wei Y, Zhong O, He J, et al. Pyrroloquinoline quinone inhibits PCSK9-NLRP3 mediated pyroptosis of Leydig cells in obese mice. Cell Death Dis 2023; 14:723.\u003c/li\u003e\n\u003cli\u003eYu Q, Guo M, Zeng W, Zeng M, Zhang X, Zhang Y, Zhang W, Jiang X, Yu B. Interactions between NLRP3 inflammasome and glycolysis in macrophages: New insights into chronic inflammation pathogenesis. Immunity Inflam \u0026amp;amp; Disease 2022; 10.\u003c/li\u003e\n\u003cli\u003eDinarello CA. Immunological and Inflammatory Functions of the Interleukin-1 Family. Annu Rev Immunol 2009; 27:519\u0026ndash;550.\u003c/li\u003e\n\u003cli\u003eVandanmagsar B, Youm Y-H, Ravussin A, Galgani JE, Stadler K, Mynatt RL, Ravussin E, Stephens JM, Dixit VD. The NLRP3 inflammasome instigates obesity-induced inflammation and insulin resistance. Nat Med 2011; 17:179\u0026ndash;188.\u003c/li\u003e\n\u003cli\u003eYu X, Hao M, Liu Y, Ma X, Lin W, Xu Q, Zhou H, Shao N, Kuang H. Liraglutide ameliorates non-alcoholic steatohepatitis by inhibiting NLRP3 inflammasome and pyroptosis activation via mitophagy. European Journal of Pharmacology 2019; 864:172715.\u003c/li\u003e\n\u003cli\u003eZhu H, Jian Z, Zhong Y, Ye Y, Zhang Y, Hu X, Pu B, Gu L, Xiong X. Janus Kinase Inhibition Ameliorates Ischemic Stroke Injury and Neuroinflammation Through Reducing NLRP3 Inflammasome Activation via JAK2/STAT3 Pathway Inhibition. Front Immunol 2021; 12:714943.\u003c/li\u003e\n\u003cli\u003eChen Z, Zhong H, Wei J, Lin S, Zong Z, Gong F, Huang X, Sun J, Li P, Lin H, Wei B, Chu J. Inhibition of Nrf2/HO-1 signaling leads to increased activation of the NLRP3 inflammasome in osteoarthritis. Arthritis Res Ther 2019; 21:300.\u003c/li\u003e\n\u003cli\u003eColl RC, Hill JR, Day CJ, Zamoshnikova A, Boucher D, Massey NL, Chitty JL, Fraser JA, Jennings MP, Robertson AAB, Schroder K. MCC950 directly targets the NLRP3 ATP-hydrolysis motif for inflammasome inhibition. Nat Chem Biol 2019; 15:556\u0026ndash;559.\u003c/li\u003e\n\u003cli\u003eKaushik DK, Bhattacharya A, Mirzaei R, Rawji KS, Ahn Y, Rho JM, Yong VW. Enhanced glycolytic metabolism supports transmigration of brain-infiltrating macrophages in multiple sclerosis. Journal of Clinical Investigation 2019; 129:3277\u0026ndash;3292.\u003c/li\u003e\n\u003cli\u003eLaussel C, L\u0026eacute;on S. Cellular toxicity of the metabolic inhibitor 2-deoxyglucose and associated resistance mechanisms. Biochemical Pharmacology 2020; 182:114213.\u003c/li\u003e\n\u003cli\u003ePelicano H, Martin DS, Xu R-H, Huang P. Glycolysis inhibition for anticancer treatment. Oncogene 2006; 25:4633\u0026ndash;4646.\u003cstrong\u003e\u003c/strong\u003e\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Pyrroloquinoline quinone, Premature ovarian insufficiency, Inflammation, lactate, apoptosis","lastPublishedDoi":"10.21203/rs.3.rs-4786726/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4786726/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eChemotherapy-induced premature ovarian insufficiency (POI) is an extreme form of reproductive aging in women, while the inflammatory factors manifest a vital cause of ovarian aging and serve as a research hotspot. However, there is still no effective method to restore the ovarian reserve. In the present study, we investigated the potential association between pyrroloquinoline quinone (PQQ) and chemotherapy-induced POI. To investigate this, a POI rat model was established by cyclophosphamide (CTX) successfully, we demonstrated that PQQ intervention reduced the ovarian injury and improved ovarian function, as well as increased the lactate levels and up-regulated the expression of key rate-limiting enzymes of glycolysis, while inhibited the expression of inflammatory factors such as NLRP3 and so on in the ovarian aging rats. To further explore the mechanisms, KGN cells were treated with Lipopolysaccharide (LPS) to mimic the inflammatory environment. PQQ alleviated the inflammation level and enhanced the glycolysis rate of KGN cells treated by LPS, meanwhile an identical effect was detected by inhibiting NLRP3. Furthermore, PQQ acted as a molecule which could activated the process of glycolysis. Collectively, our findings show that PQQ as an antioxidant may effectively restore the ovarian reserve function, which suggesting that great clinical significance to apply PQQ for prevention and treatment of chemotherapy-induced premature ovarian insufficiency in the future.\u003c/p\u003e","manuscriptTitle":"Pyrroloquinoline quinone activates lactate production and inhibits NLRP3 to improve the apoptosis of granulosa cells in POI rats","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-08-26 16:44:04","doi":"10.21203/rs.3.rs-4786726/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"1725cab1-253a-41a2-b7d6-38dd49a7a4e6","owner":[],"postedDate":"August 26th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":36523999,"name":"Biological sciences/Molecular biology"},{"id":36524000,"name":"Health sciences/Endocrinology"},{"id":36524001,"name":"Health sciences/Diseases/Endocrine system and metabolic diseases"},{"id":36524002,"name":"Health sciences/Medical research/Experimental models of disease"}],"tags":[],"updatedAt":"2024-11-07T15:23:48+00:00","versionOfRecord":[],"versionCreatedAt":"2024-08-26 16:44:04","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4786726","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4786726","identity":"rs-4786726","version":["v1"]},"buildId":"zQwnuV7TCBrMSSSToR1PI","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}