Effects of Metformin on Metabolic Profile, Cognitive Function, and Neuroinflammation in LDLr⁻/⁻ Mice | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Effects of Metformin on Metabolic Profile, Cognitive Function, and Neuroinflammation in LDLr ⁻/⁻ Mice Natália Baltazar do Nascimento, Hémelin Resende Farias, Tainá Schons, and 12 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7436605/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 24 Jan, 2026 Read the published version in Neurochemical Research → Version 1 posted 9 You are reading this latest preprint version Abstract Familial hypercholesterolemia (FH), caused by mutations in the low-density lipoprotein receptor (LDLr) gene, has been increasingly associated with brain alterations characteristic of neurodegenerative and mood disorders. Studies with LDLR knockout mice (LDLr −/− ) showed that neuroinflammation is a key event in FH-related brain dysfunction. As mTOR inhibition can attenuate these alterations in this model, we hypothesized that metformin, a drug known to modulate mTOR signaling via AMPK activation, could mitigate FH-associated brain changes. To test this, adult LDLr −/− mice received daily oral doses of metformin (200 mg/Kg) or vehicle for 30 days. During the final week, behavioral assessments were conducted, including the open-field test (locomotor activity), novel object recognition and object reallocation tasks (memory), and the tail suspension test (depressive-like behavior). Body weight and metabolic parameters, including cholesterol and glucose plasma levels, were analyzed. The mice’s hippocampal astrocyte and microglial density, and gene expression related to neuroinflammation and synaptic plasticity were evaluated. Metformin did not alter total cholesterol levels but significantly improved cognitive performance and reduced depressive-like behavior. Notably, metformin treatment attenuated hippocampal astrogliosis without affecting microglial reactivity. Molecular analysis revealed a downregulation of genes related to neuroinflammation and an upregulation of genes associated with synaptic plasticity after metformin treatment. Accompanying these neuroprotective effects, a trend toward reduced levels of the phosphorylated-to-total mTOR ratio was observed. Overall, metformin improved memory function and astrocyte reactivity in LDLr −/− mice, effects that were independent of cholesterol reduction, suggesting its potential as a therapeutic strategy for FH-associated brain dysfunction. Familial hypercholesterolemia Metformin LDLr−/− mice Behavioral alterations Astrocytes Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 INTRODUCTION In the past few decades, hypercholesterolemia, a well-known risk factor for cardiovascular disease, has also been considered a causative factor for dementia and mood disorders [ 1 – 6 ]. In particular, familial hypercholesterolemia (FH) patients aged between 18 and 40 years display alterations in their neuropsychological performance [ 7 ], while middle-aged FH individuals have an increased incidence of mild cognitive impairment (MCI) [ 8 ]. FH is caused by a mutation in the gene encoding the low-density lipoprotein (LDL) receptor, which results in high levels of LDL cholesterol and premature cardiovascular disease [ 9 , 10 ]. Our research group, using LDL receptor knockout (LDLr −/− ) mice, corroborated the clinical data from FH patients [ 11 – 13 ]. We observed that these hypercholesterolemic animals present memory impairments and depressive phenotype already at three months, which was associated with hippocampal and prefrontal cortex blood-brain barrier (BBB) leakage and neuroinflammation characterized by astrogliosis and microgliosis [ 11 , 12 , 14 , 15 ]. In addition, it was observed that mTOR signaling is involved in the brain dysfunction induced by FH. As a proof-of-concept, treating LDLr −/− mice with rapamycin, a classical mTOR inhibitor, improved neurovascular function and cognition in these mice [ 16 ]. Another way to attenuate mTOR signaling is through AMPK activation [ 17 – 19 ]. In this context, metformin is a potential molecule that can act via AMPK signaling [ 20 ]. Metformin is a widely used anti-diabetic medication with neuroprotective effects, primarily through the modulation of neuroinflammation [ 21 ]. Rabieipoor and collaborators (2023) reported that a two-week treatment with metformin restored cognitive dysfunction in an experimental model of sporadic Alzheimer’s disease (AD), which was associated with improved astrocyte density and prevented neuronal loss [ 22 ]. In aged mice, metformin treatment attenuated cognitive decline, decreased hippocampal microglial activation and astrocyte hypertrophy, and reduced levels of proinflammatory factors, accompanied by AMPK activation and mTORC inhibition [ 23 ]. Moreover, in LDLr −/− mice, metformin treatment prevented the formation of aortic atherosclerotic plaques [ 24 ]. Therefore, our primary hypothesis was that metformin could be an effective strategy for attenuating the behavioral disorders associated with FH. To test this experimentally, we treated LDLr −/− mice for 30 days with metformin. MATERIALS AND METHODS Animals Male 3-5-month-old C57BL/6 LDLr −/− mice weighing 20–30 g from the Department of Biochemistry at Federal University of Rio Grande do Sul (UFRGS) were used in this study (n = 42). Mouse progenitors were obtained from Jackson Laboratories. The mice were allocated into groups of 5 per housing box (42 × 34 × 17 cm), in controlled temperature (22 ± 1°C) and light (light-dark cycle of 12 hours, lights on from 7 AM to 7 PM), as well as ad libitum access to water and standard chow. The UFRGS Ethics Committee approved the present study (Protocol #41034). Experimental protocol and pharmacological treatment Metformin (200 mg/Kg) [ 25 ] was administered by gavage daily to the mice for 30 days. The vehicle used was a sodium chloride solution (0.9% in distilled water). The control group received the vehicle solution at the same frequency and period as the metformin group. Both treatment solutions were stored at 2–8 ºC. The animals were divided into two experimental groups (n = 19–24 per group) according to treatment: LDLr −/− mice treated with vehicle and LDLr −/− mice treated with metformin. From the first day of treatment, animals were weighed weekly until the end of the experimental protocol. Capillary blood glucose was measured on day 0 and day 30. Over the last four days of treatment, the mice underwent the following behavioral tests: open field (OF), novel object recognition (NOR), object reallocation (OR), and tail suspension test (TST), to evaluate locomotor activity, hippocampal-linked memory, and a depressive-like phenotype, respectively. Following the behavioral tests, some of the animals were fasted for 12 hours and then anesthetized via intraperitoneal injection with a mixture of xylazine (10 mg/Kg) and ketamine (80 mg/Kg). Blood was collected by cardiac puncture to investigate total cholesterol, and the hippocampus was dissected for Western blotting and RT-qPCR analysis. The remaining mice were anesthetized and perfused with 4% paraformaldehyde, and then their brains were collected for immunofluorescence assays. It is essential to mention that we conducted two different treatment cohorts. The experimental design is illustrated in Fig. 1 below. Behavioral tests OF The OF test was conducted on the 27th day of treatment. The open-field test investigated locomotor and exploratory activity [ 26 ]. The apparatus consists of a grey acrylic box (30 × 40 × 40 cm) with the floor delimited into 9 quadrants. Each mouse was placed in the center square of the arena and allowed to explore for a 5-minute training period. To evaluate locomotor and exploratory activity, crossings and rearings of the animals were counted during a test session of 5 minutes. NOR On the 28th day of treatment, animals were subjected to the NOR test to evaluate their short-term memory. In this test, the mouse was exposed to 2 identical objects, and after a short interval, it was again exposed to 1 of the same object and a novel one [ 27 ]. The test was conducted in the same apparatus used in the OF, in 2 sessions of 5 minutes each. During the training and acquisition sessions, the animals were exposed to two identical objects placed in parallel, and their exploration time was recorded. After 60 minutes, in the test and retention session, the animals explored 1 of the familiar objects and a novel object placed in the same position as the previous one. The exploration time for each object is registered for the determination of the Discrimination Index using the following formula: $$\:Discriminatin\:Index\:\left(\%\right)\:=\:\frac{Time\:exploring\:novel\:object\:\left(s\right)}{\left(Time\:exploring\:novel\:object\:\right(s)\:+\:Time\:exploring\:familiar\:object\:(s\left)\right)}\:\times\:\:100$$ OR On the 29th day of the experimental protocol, we performed the OR test to evaluate the animals’ spatial reference memory [ 28 ]. Like the NOR test, this test is based on the natural rodent's tendency to explore a new or relocated object for longer than a familiar object. In this test, which was also executed in the OF apparatus, we completed a 5-minute training session where two identical objects placed parallel to each other were exposed to the mice to explore freely, and the exploration time for each object was documented. After 180 minutes, in the test session, 1 of the objects was repositioned transversally, and the animal’s exploration time for each object was recorded for 5 minutes. The Location Index is determined by the following equation, based on the object’s total exploration time: $$\:Location\:Index\:\left(\%\right)\:=\:\frac{Time\:exploring\:reallocated\:object\:\left(s\right)}{\left(Time\:exploring\:relocated\:object\:\right(s)\:+\:Time\:exploring\:familiar\:object\:(s\left)\right)}\:\times\:\:100$$ TST On the last day of treatment, the animals were subjected to the TST to evaluate a depressive-like phenotype [ 29 ]. For this test, the mice were suspended 50 centimeters from the ground by their tail’s distal extremity for 6 minutes, and the total immobility time was recorded. Biochemical analysis Metabolic parameters After the behavioral tests, one cohort of animals was anesthetized with xylazine and ketamine for blood collection via cardiac puncture, which was sequentially centrifuged to obtain heparinized plasma. The total cholesterol levels in plasma were determined using a commercial enzymatic kit according to the manufacturer's instructions (Gold Analisa Diagnostica Ltda). On the first and last days of the experimental protocol, a capillary glucose test was conducted with blood from the tail vein. A drop of blood was collected with a test strip and tested by a glucose meter according to the manufacturer's instructions (Accumed Produtos Médico Hospitalares Ltda). The results are expressed as mg/dL. Immunofluorescence Another cohort of animals was anesthetized and perfused via the left ventricle with 0.9% saline solution, followed by 4% paraformaldehyde. After perfusion, whole brains were removed, immersed in 4% paraformaldehyde for 24 hours, and preserved in phosphate-buffered saline (PBS) with 30% sucrose solution. Coronal sequential slices with 30 µm width of the prefrontal cortex and hippocampus were obtained using a vibrating blade microtome (Leica Biosystems VT1000S) and stored in PBS 0.1 M with 0.5% sodium azide. All immunofluorescence assays were performed according to the instructions previously described by Rodrigues et al. (2023) [ 15 ]. Initially, the slices were washed twice with PBS 0.1 M and then blocked with 1% bovine serum albumin diluted in PBS 0.1 M and 0.3% Triton X for 45 minutes. The slices were incubated overnight with primary antibodies for glial fibrillary acidic protein (GFAP, 1:1000 dilution, Sigma-Aldrich G3893) or ionized calcium-binding adapter molecule 1 (IBA-1, 1:500 dilution, FUJIFILM Wako 019-19741), markers for astrocytes and microglia, respectively. After 5 washes with PBS 0.1 M, the slices were incubated with secondary fluorescent antibodies (Alexa Fluor™ 488, 1:1000 dilution, Invitrogen A-11001; Alexa Fluor™ 647, 1:1000 dilution, Invitrogen A-21246) diluted in PBS 0.1 M and 0.3% Triton X for 2 hours. Lastly, the slices were washed 3 times with PBS 0.1 M, mounted on glass slides with CC/mount, and covered with coverslips. For each slide, 2 whole hippocampus and 2 prefrontal cortices from different coronal slices where imaged under 20x and 40x magnification using the Olympus®FV1000 confocal microscope from the UFRGS Centro de Microscopia e Microanálise. ImageJ software was used to crop the interest regions and measure mean fluorescence intensity (MFI). Western blotting The protein content was quantified through immunodetection in the hippocampal tissue [ 30 ]. The samples were homogenized in ice-cold lysis buffer pH 7.9: 2.5 M KCl, 10 mM Hepes, 0.6 mM EDTA, 0.1% NP 40, and 1% protease inhibitor cocktail (PIC). Equal protein concentrations (40 µg/lane of total protein, determined using a commercial kit BCA Protein Assay [Thermo Scientific Cat. no. A53225, U.S.A.]) were loaded onto NuPAGE® 4%12% BisTris Gels. After electrophoresis, proteins were transferred (XCell SureLock® MiniCell, Invitrogen Cat. no. EI0001) to nitrocellulose membranes (1 hour at 50 volts in transfer buffer [48 mM Trizma, 39 mM glycine, 20% methanol, and 0.25% sodium dodecyl sulfate]). The membranes were incubated for 2 hours in a blocking solution (Tris-buffered saline [TBS] plus 5% bovine serum albumin). After incubation, the membranes were incubated overnight at 4°C in a blocking solution containing one of the following antibodies: antimTOR (1:1000, Cell Signaling, Cat. no. #2983), anti-pmTOR (1:1000, Cell Signaling, Cat. no. #2971), anti-AMPK (1:1000, Abcam, Cat. no. #AB80039), anti-pAMPK (1:1000, Abcam, Cat. no. #AB133448 or anti-βactin (1:1000, SigmaAldrich, Cat. no. #A4700). The blot was then washed three times for 5 minutes with TTBS and incubated for 2 hours in a solution containing peroxidaseconjugated antirabbit IgG (1:1000, Millipore, Cat. no. AP132P) and peroxidaseconjugated antimouse IgG (1:1000, Millipore, Cat. no. AP124P). The blot was again washed four times for 5 minutes with TTBS and then left in TBS. The blot was developed using a chemiluminescent ECL kit (Amersham, Oakville, Ontario; Cat. no. RPN 3004). The chemiluminescence was detected using a digital imaging system (Image Quant LAS 4000; GE Healthcare LifeSciences) and analyzed using the Image Studio Lite Software 5.2 (RRID: SCR_013715). The quantification of protein content involves calculating a ratio of intensity. The intensity of the protein of interest was measured and compared to that of antiβ-actin on the same membrane. All results are expressed as % of the control. RT-qPCR Hippocampal RNA extraction was done using TRIzol® Reagent (Thermo Fisher Scientific, USA) and 2-Mercaptoethanol (Sigma-Aldrich, M3148), following the manufacturer’s instructions and a protocol previously described by Santos et al. (2024) [ 31 ]. RNA purity (absorbance ratio at 260 nm and 280 nm [A260/A280]) and concentration were assessed by the I-Quant equipment (Loccus, BR). For cDNA synthesis, 2 µg of RNA per sample was used with the High-Capacity cDNA Reverse Transcription® kit (Thermo Fisher Scientific, USA). Gene-specific primers were designed using the NCBI’s Primer-BLAST tool (National Library of Medicine, USA), ensuring no secondary structures were formed. Primer efficiency was evaluated to confirm the absence of nonspecific amplifications. Gene expression analysis was performed for proteins involved in neuroplasticity, neuroinflammation, and the β-actin housekeeping gene, using the sequences in Table 1 . RT-qPCR reactions were conducted in triplicate with the PowerUp™ SYBR® Green Master Mix kit (Thermo Fisher Scientific, USA), following the manufacturer’s instructions. Results were analyzed using the \(\:{2}^{-\varDelta\:\varDelta\:CT}\) method. Table 1 Primers used for RT-qPCR. Forward (F) and reverse (R) primer sequences used for RT-qPCR analysis of genes related to inflammation and synaptic plasticity Gene Forward sequence (5’ to 3’) Reverse sequence (5’ to 3) TNF-α ATGTCTCAGCCTCTTCTCATTC GCTTGTCACTCGAATTTTGAGA TLR4 CTGGGGCTCATTCACTCACTA CTCAGACTCGGCACTTAGCA TGF-β ATGGTGGACCGCAACAACGC GGCACTGCTTCCCGAATGTCTG CD68 CTTCCCACAGGCAGCACAG AATGATGAGAGGCAGCAAGAGG BDNF TGACGACGACATCACTGGCT ACAAGTCCGCGTCCTTATGGTT SYP CCACCTCCTTCTCCAATCAG CAGCAAAGACAGGGTCTCCT TrkB AACGGAGACTACACCCTGATGG GCAATCACCACCACGGCATA PSD-95 CGATTACCACTTTGTCTCCTCCC ACGGATGAAGATGGCGATAGG β-actin TCAAGATCATTGCTCCTCCTGAG ACATCTGCTGGAAGGTGGACA Statistical analysis All data were tested for normality using the Shapiro-Wilk test. Differences in glucose levels between groups were evaluated by paired t-test. Unpaired t-tests were used for the remaining comparisons when data distribution was normal, and the Mann-Whitney test was used for non-normal data distribution. For the NOR and OR behavioral tests, the groups were compared to a hypothetical value of 50% using one-sample t-tests to analyze the chance levels. All data are presented as the mean ± standard error of the mean (SEM). Statistical significance was set at p < 0.05. Statistical analyses were performed using Statistica© 10 (StatSoft Inc., Tulsa, OK, USA) or GraphPad Prism© 8 (GraphPad Inc., San Diego, CA, USA). RESULTS Effects of Metformin treatment on metabolic alterations related to FH First, we evaluated the metabolic parameters of animals that received metformin treatment. Figure 2 shows the total cholesterol levels, glucose levels pre- and post-treatment, and total body weight of the LDLr −/− mice. The metformin treatment did not reduce cholesterol levels (t(10) = 0.1694, P = 0.8689) of the FH animal model (Fig. 2 a). Importantly, animals that received metformin administration showed reduced blood glucose levels on day 30 compared to day 0 (t(8) = 3.021, P = 0.0165) (Fig. 2 b). Finally, metformin treatment didn’t alter the body mass (t(40) = 0.9432, P = 0.3512) of LDLr −/− mice (Fig. 2 c). METFORMIN TREATMENT ATTENUATED BEHAVIORAL ALTERATIONS IN LDLR −/− MICE Analysis of the behavioral test data is shown in Fig. 3 . The OF test was used to evaluate locomotor and exploratory activities by analyzing the number of crossings and rearings during the animals’ permanence in the apparatus. Metformin treatment caused no alteration in the crossing (t(39) = 0.6161, P = 0.5414) and rearing (t(39) = 0.6397, P = 0.5261) numbers in LDLr −/− mice (Fig. 3 a, b). To evaluate a depressive-like phenotype, the tail suspension test was performed. The unpaired t-test highlighted a trend (t(39) = 1.941, P = 0.0596) toward reduction of immobility time in metformin-treated animals compared to the vehicle-treated group (Fig. 3 c). Analysis of the effect size of treatment on immobility time by Cohen’s d showed a medium effect (d = 0.6). In addition, the OR (Fig. 3 d) and NOR (Fig. 3 e) tests were performed to evaluate hippocampal-dependent memories. One sample t-test revealed that LDLr −/− + vehicle groups showed memory and learning deficits (OR: t(17) = 1.989, P = 0.0630 vs 50%; NOR: t(15) = 1.627, P = 0.1246 vs 50%). Moreover, the unpaired t-test displayed that the metformin group had a higher location index than the vehicle-administered group (t(37) = 2.790, P = 0.0083) and a trend toward an increased location index versus chance levels (t(20) = 1.927, P = 0.0683 vs 50%). Mice treated with metformin also showed an elevated discrimination index compared to chance levels by one-sample t-test (t(19) = 2.391, P = 0.0273 vs 50%). These findings suggest that Metformin administration can mitigate hippocampal-associated memory deficit in the FH mice model and ameliorate their depressive phenotype. METFORMIN DECREASES HIPPOCAMPAL ASTROGLIOSIS IN LDLR −/− MICE Astroglial density and reactivity were evaluated by GFAP immunoreactivity in the hippocampus. Figure 4 a shows representative images of the hippocampus labeled with GFAP in 20x, 40x (+), and digital zoom (++). The unpaired t-test pointed to a significant decrease (t(13) = 2.726, P = 0.0173) in GFAP immunoreactivity in the group treated with metformin (Fig. 4 a). To investigate the effects of metformin treatment on microglial density in the hippocampus, we performed immunofluorescence assays with IBA1. Figure 4 b presents a representative panel with images of the hippocampus with IBA1 signal in 20x, 40x (+), and digital zoom (++) magnification. The unpaired t-test analysis did not detect significant statistical differences (t(13) = 0.6761, P = 0.5109) between groups (Fig. 4 b). METFORMIN MODULATES GENE EXPRESSION RELATED TO NEUROINFLAMMATION AND SYNAPTIC PLASTICITY IN LDLR −/− MICE We also analyzed the gene expression of proteins associated with neuroinflammation and synaptic plasticity in the hippocampus of the animals. Our findings suggest that metformin treatment may downregulate the expression of genes involved in inflammatory pathways, while upregulating the expression of proteins related to neuroplasticity. In particular, the hippocampus of LDLr −/− treated with metformin presented a decrease in the gene expression of TGF-β (t(7) = 2.991, P = 0.0202) and an increase in the gene expression of PSD-95 (t(5) = 2.904, P = 0.0336) (Fig. 5 a, b, f, h). In addition, we observed lower TLR-4 (t(7) = 1.533, P = 0.1692, Cohen’s d = 1.16) and higher BDNF (t(7) = 1.886, P = 0.1013, Cohen’s d = 0.422) expression in the hippocampus of mice treated with metformin (Fig. 5 d, j), although no significant statistical difference was detected. No significant changes were observed in the expression levels of TNF-α (t(7) = 0.5474, P = 0.6011), CD68 (t(8) = 0.2370, P = 0.8186), TrkB (t(7) = 0.3857, P = 0.7112), or SYP (U = 3, P = 0.25) following metformin treatment (Fig. 5 c, e, g, i). METFORMIN EFFECTS ARE AMPK/mTOR INDEPENDENT Considering that most of the effects of metformin treatment are associated with its modulation of the AMPK/mTOR signaling pathway, total and phosphorylated AMPK and mTOR content were assessed using Western blotting. The content of both proteins, total and phosphorylated fractions, was not significantly different (AMPK: t(10) = 0.3415, P = 0.7398; p-AMPK: t(10) = 0.1813, P = 0.8597; mTOR: t(7) = 0.1434, P = 0.89; p-mTOR: t(10) = 0.4766, P = 0.6439) when comparing the groups (Fig. 6 a, 6 b and 6 c). However, a tendency towards a lower phospho:total mTOR ratio (mTOR: t(8) = 1.487, P = 0.1753; AMPK: t(10) = 0.6548, P = 0.5274) was evidenced by the unpaired t-test (Fig. 6 d) in the LDLr −/− mice treated with metformin. Additionally, when analyzing the effect size of phospho:total mTOR ratio, Cohen’s d pointed to a large effect (d = 0.94). DISCUSSION In this study, we investigated the effects of metformin on metabolic, behavioral, molecular, and cellular alterations in LDLr −/− mice, a well-established model of FH. Our findings reveal that, although metformin did not reduce cholesterol levels or body mass, it significantly reduced blood glucose levels after 30 days of treatment. Behaviorally, metformin improved hippocampal-dependent cognitive performance in object reallocation and novel object recognition tasks and showed a trend toward alleviating depressive-like behavior. At the cellular level, metformin significantly reduced astroglial reactivity in the hippocampus, without altering microglial density. On the molecular level, metformin downregulated the expression of TGF-β and upregulated PSD-95, while also showing trends toward reduced TLR-4 and increased BDNF expression. These effects may occur independently of canonical AMPK/mTOR signaling, although a trend toward a lower phospho/total mTOR ratio was observed (d = 0.94). Collectively, these findings suggest that metformin exerts neuroprotective effects in FH, potentially by modulating neuroinflammation and synaptic plasticity through alternative molecular pathways. Hypercholesterolemia is a well-established risk factor for the development of cardiovascular diseases, which remain the leading cause of mortality worldwide [ 32 ]. Over the past decades, hypercholesterolemia has been associated with the development of neurodegenerative diseases, such as AD [ 1 ]. More recently, high plasmatic LDL-cholesterol levels during midlife have been recognized as a significant risk factor for dementia [ 6 ]. The most common form of genetic hypercholesterolemia, FH, is typically caused by mutations that impair LDLr function and reduce LDL clearance from the circulation [ 33 , 34 ]. Notably, a clinical study demonstrated that FH individuals can present executive function impairment as early as 18 to 40 years old [ 7 ]. Complementing these findings, experimental studies using LDLr ⁻/⁻ mice—a widely used model of FH—have demonstrated hippocampal neuroinflammation [ 35 ], astrogliosis and blood-brain barrier disruption [ 12 ], depressive-like behavior [ 11 ], and memory deficits as early as 3 months of age [ 36 ]. These observations underscore the urgent need for effective therapeutic strategies to prevent or mitigate the neurological consequences of FH. In this context, we investigated the effects of metformin administration on metabolic, behavioral, and glial alterations in LDLr −/− mice. Metformin is a first-line oral antidiabetic drug widely used to improve insulin sensitivity and regulate glucose metabolism, particularly in individuals with type 2 diabetes [ 37 , 38 ]. Beyond its effects on blood glucose levels, metformin has also been associated with cardiovascular benefits, including lipid-lowering properties [ 39 , 40 ]. Human studies have shown that metformin reduces the risk of cardiovascular disease in diabetic patients by lowering circulating LDL cholesterol levels and reducing atherosclerotic plaque thickness [ 41 , 42 ]. Both acute and chronic metformin treatment tend to reduce total and LDL cholesterol levels, while having minimal effects on plasma triglycerides and HDL cholesterol [ 39 , 40 , 43 , 44 ]. These effects are supported by preclinical data. In hyperglycemic mice exposed to an atherogenic diet, metformin reduced atherosclerotic lesion formation by nearly 60% [ 45 ]. Likewise, in ApoE −/− mice fed a high-fat diet, metformin treatment reduced atherosclerotic burden and was associated with lower body weight [ 46 – 49 ]. However, findings in non-diabetic hypercholesterolemic models have been more variable. Some studies report that metformin does not significantly affect circulating lipid levels in these models [ 24 , 50 ]. Consistent with these reports, our study found that metformin did not reduce total cholesterol or body weight in FH mice. Nevertheless, it significantly lowered blood glucose levels after 30 days of treatment, suggesting a selective metabolic benefit that could still support vascular and cognitive health. As previously demonstrated, LDLr ⁻/⁻ mice between 3 and 5 months of age already exhibit significant memory impairments [ 13 ]. In the present study, metformin treatment improved learning and spatial memory deficits in these hypercholesterolemic mice. Animals receiving metformin spent more time exploring novel or reallocated objects in recognition-based memory tasks compared to vehicle-treated controls. However, while a group difference was observed in the OR, metformin did not fully reverse memory impairment: the location index did not significantly differ from the hypothetical 50% chance level. These findings are in line with previous studies demonstrating that metformin can improve cognitive performance in various models of neurological dysfunction, including AD, obesity, and diabetes [ 25 , 51 – 53 ]. For example, genetically diabetic mice treated with 200 mg/Kg of metformin for six weeks showed enhanced learning and memory performance in the Morris water maze [ 52 ]. Likewise, rats fed a high-fat diet recovered learning behavior in the same task following a 12-week treatment with 30 mg/Kg of metformin [ 53 ]. Another behavioral alteration frequently reported in animal models of hypercholesterolemia is a depressive-like phenotype [ 11 , 54 ]. Increased immobility in the forced swim test and TST—hallmarks of depressive-like behavior—has been consistently observed in mice subjected to diet-induced hypercholesterolemia [ 4 , 54 ]. Similarly, Engel et al. (2016) demonstrated that LDLr −/− mice exhibit depressive-like behavior across multiple paradigms, including the TST, sucrose preference, and sucrose splash tests [ 11 ]. In the present study, metformin treatment tended to reduce immobility time in LDLr −/− mice, suggesting a potential improvement in depressive-like behavior. This finding aligns with clinical evidence; for instance, Guo et al. (2014) reported that metformin treatment in diabetic patients with comorbid depression led to a reduction in depressive symptoms [ 55 ]. Moreover, experimental data from C57BL/6J male mice fed a high-fat diet showed that chronic administration of metformin (300 mg/Kg) produced antidepressant-like effects, further supporting the psychotropic potential of the drug in metabolically compromised conditions [ 56 ]. Collectively, these findings reinforce the hypothesis that metformin may grant mood-stabilizing or antidepressant-like benefits in the context of metabolic disturbances, such as those associated with FH. Neuroinflammation is increasingly recognized as a central mechanism linking hypercholesterolemia to the pathogenesis of neurodegenerative diseases, including AD [ 12 , 13 , 57 ]. Clinical studies have shown that elevated levels of pro-inflammatory cytokines correlate with cognitive impairment in AD patients and elderly individuals [ 58 – 60 ], while anti-inflammatory interventions in animal models of AD improve memory outcomes [ 61 , 62 ]. In hypercholesterolemic conditions, both systemic and cerebral inflammation have been documented [ 35 , 63 , 64 ], with glial reactivity—particularly of astrocytes and microglia—playing a key role in the propagation of neuroinflammatory responses [ 12 , 65 ]. Astrocytes, which normally regulate metabolism, support neurons, and facilitate synaptogenesis, can be activated via NF-κB-mediated inflammatory pathways [ 66 , 67 ]. In this inflammatory milieu, activated astrocytes contribute to the production of reactive nitrogen species and other inflammatory mediators[ 68 , 69 ] and exhibit increased expression of GFAP, which is a key cytoskeletal protein that serves as a marker of astrocytic reactivity [ 70 ]. Similarly, metformin has been shown to attenuate astrocyte reactivity in models of diabetes [ 71 , 72 ], Parkinson’s disease [ 73 ], and fetal alcohol syndrome [ 74 ], highlighting its potential as a therapeutic modulator of neuroinflammation. Microglia play a central role in the innate immune response of the central nervous system, acting as key regulators of neuroinflammation and homeostasis [ 75 ]. In addition to its immune surveillance function, microglia contribute to neurogenesis, synaptic pruning, and the secretion of pro-inflammatory cytokines in response to pathological stimuli [ 76 , 77 ]. Their activation profile is highly context-dependent and varies according to the nature, intensity, and chronicity of the triggering insult [ 78 ]. In a previous study from our group, we demonstrated that LDLr ⁻/⁻ mice exhibit increased hippocampal IBA1 immunoreactivity at 3, 6, and 14 months of age, indicative of heightened microglial activation compared to wild-type controls [ 15 ]. In the present study, however, metformin treatment did not reduce hippocampal microglial density in LDLr ⁻/⁻ mice. This finding contrasts with previous reports showing that metformin attenuates microgliosis in models of high-fat diet-induced neuroinflammation. For example, Ma et al. (2021) reported a significant reduction in IBA1-positive microglia in the hippocampus of 8-month-old C57BL/6J male mice following 3 months of treatment with 250 mg/Kg/day of metformin [ 79 ]. Importantly, discrepancies in the observed effects may stem from differences in treatment duration, animal age, or disease context. Supporting this, Kodali et al. (2021) found that metformin administration for 10 weeks in aged mice did not reduce overall IBA1 expression in the hippocampus but did diminish the tendency of microglia to form pro-inflammatory clusters [ 23 ]. These findings suggest that metformin’s effects on microglial activation may depend on the stage of disease progression and specific microglial phenotypes rather than simply reducing cell density. Although we did not observe changes in microglial density following metformin treatment in LDLr ⁻/⁻ mice, we further explored potential molecular shifts in neuroinflammatory signaling and neuroplasticity by analyzing hippocampal gene expression profiles. This approach provides insights into metformin’s modulatory effects beyond its effects on microglial morphology or density. Notably, our results demonstrated a significant downregulation of TGF-β gene expression in the hippocampus of metformin-treated LDLr ⁻/⁻ mice, which suggests a potential attenuation of pro-inflammatory signaling. Although TGF-β plays context-dependent roles in the central nervous system, exerting both neuroprotective and neuroinflammatory effects, its reduced expression may reflect a shift toward a less reactive glial environment. These findings align with previous reports showing that metformin suppresses TGF-β1 signaling in various models. For instance, in a chronic colitis mouse model, metformin reduced TGF-β1 expression and Smad3 phosphorylation, mitigating inflammation and fibrosis [ 80 ]. Moreover, Xiao et al. (2022) showed that metformin downregulated INHBA, a key ligand of TGF-β signaling, in colorectal cancer cells, thereby inhibiting PI3K/Akt activation and cell proliferation [ 81 ]. Together, these data support the hypothesis that metformin may reduce TGF-β–mediated glial activation in neuroinflammatory contexts, contributing to its neuroprotective effects in LDLr⁻/⁻ mice. In parallel, metformin treatment increased the gene expression of PSD-95, a key synaptic scaffolding protein associated with synaptic stability and plasticity, indicating a potential enhancement of hippocampal synaptic function. Given the established role of PSD-95 in anchoring NMDA and AMPA receptors and supporting synaptic strength [ 82 ], its upregulation likely contributes to the observed improvements in hippocampal-dependent memory. This finding aligns with prior evidence showing that, in a rat sepsis model, metformin restored PSD‑95 levels along with other synaptic markers disrupted by systemic inflammation [ 83 ]. Similarly, in APP/PS1 transgenic mice, metformin improved synaptic integrity and increased PSD-95 expression [ 84 ]. However, in contrast, Cho et al. (2024) reported that long-term metformin administration (1–2 years) in 3xTg-AD mice resulted in decreased PSD-95 expression, suggesting model- and time-dependent effects [ 85 ]. Together, these findings reinforce the notion that metformin supports hippocampal synaptic plasticity, which may underlie the cognitive improvements observed in our LDLr⁻/⁻ mouse model. While changes in TLR4 and BDNF expression did not reach statistical significance, the moderate-to-large effect sizes observed (Cohen’s d = 1.16 for TLR4 and d = 0.42 for BDNF) indicate potential biological trends toward reduced innate immune activation and enhanced neurotrophic support. Although non-significant, the observed trend toward increased BDNF expression aligns with prior reports demonstrating metformin-induced upregulation of BDNF in models of depression and cognitive impairment [ 86 , 87 ]. These molecular shifts complement our behavioral findings, which showed improved memory performance and reduced depressive-like behavior in metformin-treated animals. Altogether, the data support the hypothesis that metformin may exert neuroprotective effects in FH by modulating inflammatory signaling and enhancing synaptic resilience. Interestingly, we observed a trend toward a reduced phospho/total mTOR ratio in the hippocampus of metformin-treated LDLr −/− mice, with a large effect size, suggesting a potential downregulation of mTOR activity. This observation is consistent with previous findings indicating that metformin can suppress mTOR signaling, most commonly via activation of AMPK, a key energy sensor that negatively regulates the mTOR pathway [ 20 , 88 ]. Given that phosphorylated mTOR—particularly within the mTORC1 complex—represents its active state, the observed reduction in phosphorylation likely reflects decreased mTORC1 activity. In the central nervous system, inhibition of mTORC1 has been associated with multiple neuroprotective mechanisms, including enhanced autophagy, reduced neuroinflammation, and improved synaptic plasticity. Indeed, in animal models, pharmacological inhibition of mTOR with rapamycin has been shown to rescue behavioral deficits, including depressive-like behavior and cognitive deficits [ 89 , 90 ]. Of particular relevance, rapamycin-mediated mTOR inhibition has been shown to restore neurovascular coupling and memory performance in AD mouse models by reversing both nitric oxide synthase-dependent and independent cerebrovascular deficits [ 91 ]. Although we did not detect significant changes in AMPK phosphorylation in the hippocampus, this does not exclude its participation. Transient or localized AMPK activation may have occurred at earlier time points not captured in our analysis. Moreover, metformin has also been shown to inhibit mTOR via AMPK-independent mechanisms, including through REDD1 induction or Rag GTPase modulation [ 92 ]. Therefore, the trend toward mTOR inhibition observed here may reflect a cumulative outcome of multiple upstream regulatory inputs, potentially amplified by the metabolic disturbances inherent to LDLr −/− mice. Collectively, our findings suggest that metformin may contribute to neuroprotective effects in hypercholesterolemic conditions (Fig. 7 ), at least in part, by modulating the AMPK/mTOR axis. This pathway is of particular interest in the context of aging and neurodegeneration, as its dysregulation has been implicated in both processes. In line with this, large-scale clinical trials such as “Targeting Aging with Metformin” and “Investigation of Metformin in Pre-Diabetes on Atherosclerotic Cardiovascular OuTcomes” are currently investigating the broader systemic and neurological benefits of metformin in non-diabetic populations [ 93 ]. Our results contribute to this growing body of evidence by highlighting potential central mechanisms through which metformin may exert protective actions on brain health. CONCLUSION In conclusion, our findings suggest that metformin improves cognitive and mood-related behaviors in LDLr⁻/⁻ mice, likely through modulation of neuroinflammatory and synaptic pathways. While canonical metabolic pathways like AMPK and mTOR may play a role, our data point to additional mechanisms, including suppression of TGF-β and upregulation of PSD-95. These results add to the growing body of evidence supporting metformin’s pleiotropic benefits on brain health and support further investigation into its potential use in FH and other hypercholesterolemic conditions. Declarations Acknowledgments Henrique Beck Biehl (Centro de Microscopia e Microanálise — CMM, Federal University of Rio Grande do Sul, Brazil) for the contribution to the immunofluorescence imaging. Figures created with BioRender. Funding This work was supported by the Universidade Federal do Rio Grande do Sul (UFGRS), Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) [CNPq/MCTI/FNDCT Nº 18/2021 - Faixa A - Grupos Emergentes No do Processo: 407006/2021 - 4], Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (Capes), Fundação de Amparo à pesquisa do Estado do RS [21/2551-0000 740-0 Edital FAPERGS | 10/2020 Auxílio Recem Doutor-ARD], Brazilian National Institute of Science and Technology on Excitoxicity and neuroprotection (INEN 2014-465671/2014-4), Instituto Nacional Saúde Cerebral (INSC, No 406020/2022–1/ CNPq, Brazil (INSC 406020/2022-1), and L’Oréal-UNESCO-ABC program Brazil para Mulheres na Ciência. Competing interest The authors declare that they have no competing interests. Author Contributions Methodology, analyses, manuscript writing and review, NBN; Methodology and analyses, HRF; Analyses, TS; Methodology, APZP; Methodology, MVC; Methodology, AMP; Methodology, LSS; Methodology, JMOR; Methodology, MSR; Manuscript writing and review, FT; Work supervision and manuscript review, FTCRG; Work supervision and manuscript review, JCFM; Work supervision and manuscript review, RKSSB; Interpretation of results and manuscript review, AFB; Elaboration of the main hypothesis and experimental protocol, work supervision, manuscript review, JO. All authors read and approved the final manuscript. Data Availability The data that support this study are available from the corresponding author upon reasonable request. Ethics approval All applicable international, national, and/or institutional guidelines for the care and use of animals were followed. All procedures performed in studies involving animals were in accordance with the ethical standards of the institution or practice at which the studies were conducted. References Kivipelto M, Helkala EL, Laakso MP, Hänninen T, Hallikainen M, Alhainen K, Soininen H, Tuomilehto J, Nissien A (2001) Midlife vascular risk factors and Alzheimer’s disease in later life: longitudinal, population based study. BMJ 322:1447–1451. https://doi.org/10.1136/BMJ.322.7300.1447 Solomon A, Kivipelto M, Wolozin B, Zhou J, Whitmer RA (2009) Midlife Serum Cholesterol and Increased Risk of Alzheimer’s and Vascular Dementia Three Decades Later. Dement Geriatr Cogn Disord 28:75. https://doi.org/10.1159/000231980 Tyrovolas S, Lionis C, Zeimbekis A, Bountziouka V, Micheli M, Katsarou A, Papairakleous N, Metallinos G, Makri K, Polychronopoulos E, Panagiotakos DB (2009) Increased body mass and depressive symptomatology are associated with hypercholesterolemia, among elderly individuals; Results from the MEDIS study. Lipids Health Dis 8:1–7. https://doi.org/10.1186/1476-511X-8-10/TABLES/2 Strekalova T, Evans M, Costa-Nunes J, Bachurin S, Yeritsyan N, Couch Y, Steinbusch HMW, Köhler SE, Lesch KP, Anthony DC (2015) Tlr4 upregulation in the brain accompanies depression- and anxiety-like behaviors induced by a high-cholesterol diet. Brain Behav Immun 48:42–47. https://doi.org/10.1016/J.BBI.2015.02.015 Anstey KJ, Ashby-Mitchell K, Peters R (2017) Updating the Evidence on the Association between Serum Cholesterol and Risk of Late-Life Dementia: Review and Meta-Analysis. Journal of Alzheimer’s Disease 56:215–228. https://doi.org/10.3233/JAD-160826 Livingston G, Huntley J, Liu KY, Costafreda SG, Selbæk G, Alladi S, Ames D, Banerjee S, Burns A, Brayne C, Fox NC, Ferri CP, Gitlin LN, Howard R, Kales HC, Kivimäki M, Larson EB, Nakasujja N, Rockwood K, Samus Q, Shirai K, Singh-Manoux A, Schneider LS, Walsh S, Yao Y, Sommerlad A, Mukadam N (2024) Dementia prevention, intervention, and care: 2024 report of the Lancet standing Commission. The Lancet 404:572–628. https://doi.org/10.1016/S0140-6736(24)01296-0 Ariza M, Cuenca N, Mauri M, Jurado MA, Garolera M (2016) Neuropsychological performance of young familial hypercholesterolemia patients. Eur J Intern Med 34:e29–e31. https://doi.org/10.1016/j.ejim.2016.05.009 Zambón D, Quintana M, Mata P, Alonso R, Benavent J, Cruz-Sánchez F, Gich J, Pocoví M, Civeira F, Capurro S, Bachman D, Sambamurti K, Nicholas J, Pappolla MA (2010) Higher incidence of mild cognitive impairment in familial hypercholesterolemia. American Journal of Medicine 123:267–274. https://doi.org/10.1016/j.amjmed.2009.08.015 Kane JP, Malloy MJ, Ports TA, Phillips NR, Diehl JC, Havel RJ (1990) Regression of Coronary Atherosclerosis During Treatment of Familial Hypercholesterolemia With Combined Drug Regimens. JAMA 264:3007–3012. https://doi.org/10.1001/JAMA.1990.03450230043027 Mytilinaiou M, Kyrou I, Khan M, Grammatopoulos DK, Randeva HS (2018) Familial hypercholesterolemia: New horizons for diagnosis and effective management. Front Pharmacol 9:378217. https://doi.org/10.3389/FPHAR.2018.00707/XML Engel DF, de Oliveira J, Lopes JB, Santos DB, Moreira ELG, Farina M, Rodrigues ALS, de Souza Brocardo P, de Bem AF (2016) Is there an association between hypercholesterolemia and depression? Behavioral evidence from the LDLr(-/-) mouse experimental model. Behavioural brain research 311:31–38. https://doi.org/10.1016/J.BBR.2016.05.029 De Oliveira J, Engel DF, De Paula GC, Dos Santos DB, Lopes JB, Farina M, Moreira ELG, De Bem AF (2020) High Cholesterol Diet Exacerbates Blood-Brain Barrier Disruption in LDLr-/- Mice: Impact on Cognitive Function. Journal of Alzheimer’s Disease 78:97–115. https://doi.org/10.3233/JAD-200541 de Oliveira J, Moreira ELG, de Bem AF (2024) Beyond cardiovascular risk: Implications of Familial hypercholesterolemia on cognition and brain function. Ageing Res Rev 93:. https://doi.org/10.1016/J.ARR.2023.102149 De Oliveira J, Moreira ELG, Dos Santos DB, Piermartiri TC, Dutra RC, Pinton S, Tasca CI, Farina M, Prediger RDS, De Bem AF (2014) Increased susceptibility to amyloid-β-induced neurotoxicity in mice lacking the low-density lipoprotein receptor. Journal of Alzheimer’s Disease 41:43–60. https://doi.org/10.3233/JAD-132228 Rodrigues MS, do Nascimento NB, Farias HR, Schons T, Machado AG, Behenck E, Mesquita A, Krolow Bast R, Budni J, Engblom D, de Bem AF, de Oliveira J (2024) Microglia contribute to cognitive decline in hypercholesterolemic LDLr−/− mice. J Neurochem 168:1565–1586. https://doi.org/10.1111/jnc.15952 Jahrling JB, Lin AL, DeRosa N, Hussong SA, Van Skike CE, Girotti M, Javors M, Zhao Q, Maslin LA, Asmis R, Galvan V (2018) mTOR drives cerebral blood flow and memory deficits in LDLR−/− mice modeling atherosclerosis and vascular cognitive impairment. Journal of Cerebral Blood Flow and Metabolism 38:58–74. https://doi.org/10.1177/0271678X17705973 Gwinn DM, Shackelford DB, Egan DF, Mihaylova MM, Mery A, Vasquez DS, Turk BE, Shaw RJ (2008) AMPK phosphorylation of raptor mediates a metabolic checkpoint. Mol Cell 30:214–226. https://doi.org/10.1016/J.MOLCEL.2008.03.003 Ning J, Clemmons DR (2010) AMP-Activated Protein Kinase Inhibits IGF-I Signaling and Protein Synthesis in Vascular Smooth Muscle Cells via Stimulation of Insulin Receptor Substrate 1 S794 and Tuberous Sclerosis 2 S1345 Phosphorylation. Molecular Endocrinology 24:1218. https://doi.org/10.1210/ME.2009-0474 Hindupur SK, González A, Hall MN (2015) The Opposing Actions of Target of Rapamycin and AMP-Activated Protein Kinase in Cell Growth Control. Cold Spring Harb Perspect Biol 7:a019141. https://doi.org/10.1101/CSHPERSPECT.A019141 Amin S, Lux A, O’Callaghan F (2019) The journey of metformin from glycaemic control to mTOR inhibition and the suppression of tumour growth. Br J Clin Pharmacol 85:37–46 Du R-W, Bu W-G (2020) Metformin improves depressive-like symptoms in mice via inhibition of peripheral and central NF-κB-NLRP3 inflammation activation. 238:2549–2556. https://doi.org/10.1007/s00221-020-05911-x Rabieipoor S, Zare M, Ettcheto M, Camins A, Javan M (2023) Metformin restores cognitive dysfunction and histopathological deficits in an animal model of sporadic Alzheimer’s disease. Heliyon 9:e17873. https://doi.org/10.1016/J.HELIYON.2023.E17873 Kodali M, Attaluri S, Madhu LN, Shuai B, Upadhya R, Gonzalez JJ, Rao X, Shetty AK (2021) Metformin treatment in late middle age improves cognitive function with alleviation of microglial activation and enhancement of autophagy in the hippocampus. Aging Cell 20:e13277. https://doi.org/10.1111/ACEL.13277 Seneviratne A, Cave L, Hyde G, Moestrup SK, Carling D, Mason JC, Haskard DO, Boyle JJ (2020) Metformin directly suppresses atherosclerosis in normoglycaemic mice via haematopoietic adenosine monophosphate-activated protein kinase. Cardiovasc Res 117:1295. https://doi.org/10.1093/CVR/CVAA171 Farr SA, Roesler E, Niehoff ML, Roby DA, McKee A, Morley JE (2019) Metformin improves learning and memory in the samp8 mouse model of Alzheimer’s disease. Journal of Alzheimer’s Disease 68:1699–1710. https://doi.org/10.3233/JAD-181240 Prut L, Belzung C (2003) The open field as a paradigm to measure the effects of drugs on anxiety-like behaviors: A review. Eur J Pharmacol 463:3–33. https://doi.org/10.1016/S0014-2999(03)01272-X Greco SJ, Bryan KJ, Sarkar S, Zhu X, Smith MA, Wesson Ashford J, Johnston JM, Tezapsidis N, Casadesus G (2010) Leptin Reduces Pathology and Improves Memory in a Transgenic Mouse Model of Alzheimer’s Disease. J Alzheimers Dis 19:1155–1167. https://doi.org/10.3233/JAD-2010-1308 Assini FL, Duzzioni M, Takahashi RN (2009) Object location memory in mice: pharmacological validation and further evidence of hippocampal CA1 participation. Behavioural brain research 204:206–211. https://doi.org/10.1016/J.BBR.2009.06.005 Steru L, Chermat R, Thierry B, Simon P (1985) The tail suspension test: a new method for screening antidepressants in mice. Psychopharmacology (Berl) 85:367–370. https://doi.org/10.1007/BF00428203 Arcego DM, Krolow R, Lampert C, Toniazzo AP, Berlitz C, Lazzaretti C, Schmitz F, Rodrigues AF, Wyse ATS, Dalmaz C (2016) Early life adversities or high fat diet intake reduce cognitive function and alter BDNF signaling in adult rats: Interplay of these factors changes these effects. International Journal of Developmental Neuroscience 50:16–25. https://doi.org/10.1016/J.IJDEVNEU.2016.03.001, Santos L, Behrens L, Barbosa C, Tiefensee-Ribeiro C, Rosa-Silva H, Somensi N, Brum PO, Silveira AK, Rodrigues MS, de Oliveira J, Gelain DP, Almeida RF, Moreira JCF (2024) Histone 3 Trimethylation Patterns are Associated with Resilience or Stress Susceptibility in a Rat Model of Major Depression Disorder. Mol Neurobiol 61:5718–5737. https://doi.org/10.1007/S12035-024-03912-3/METRICS Mozaffarian D, Benjamin EJ, Go AS, Arnett DK, Blaha MJ, Cushman M, De Ferranti S, Després JP, Fullerton HJ, Howard VJ, Huffman MD, Judd SE, Kissela BM, Lackland DT, Lichtman JH, Lisabeth LD, Liu S, Mackey RH, Matchar DB, McGuire DK, Mohler ER, Moy CS, Muntner P, Mussolino ME, Nasir K, Neumar RW, Nichol G, Palaniappan L, Pandey DK, Reeves MJ, Rodriguez CJ, Sorlie PD, Stein J, Towfighi A, Turan TN, Virani SS, Willey JZ, Woo D, Yeh RW, Turner MB (2015) Heart disease and stroke statistics--2015 update: a report from the American Heart Association. Circulation 131:e29–e39. https://doi.org/10.1161/CIR.0000000000000152 Akioyamen LE, Genest J, Shan SD, Reel RL, Albaum JM, Chu A, Tu J V. (2017) Estimating the prevalence of heterozygous familial hypercholesterolaemia: a systematic review and meta-analysis. BMJ Open 7:. https://doi.org/10.1136/BMJOPEN-2017-016461 Benito-Vicente A, Uribe KB, Jebari S, Galicia-Garcia U, Ostolaza H, Martin C (2018) Familial Hypercholesterolemia: The Most Frequent Cholesterol Metabolism Disorder Caused Disease. Int J Mol Sci 19:. https://doi.org/10.3390/IJMS19113426 Thirumangalakudi L, Prakasam A, Zhang R, Bimonte-Nelson H, Sambamurti K, Kindy MS, Bhat NR (2008) High cholesterol-induced neuroinflammation and amyloid precursor protein processing correlate with loss of working memory in mice. J Neurochem 106:475–485. https://doi.org/10.1111/J.1471-4159.2008.05415.X de Oliveira J, Hort MA, Moreira ELG, Glaser V, Ribeiro-do-Valle RM, Prediger RD, Farina M, Latini A, de Bem AF (2011) Positive correlation between elevated plasma cholesterol levels and cognitive impairments in LDL receptor knockout mice: Relevance of cortico-cerebral mitochondrial dysfunction and oxidative stress. Neuroscience 197:99–106. https://doi.org/10.1016/j.neuroscience.2011.09.009 Campbell JM, Stephenson MD, de Courten B, Chapman I, Bellman SM, Aromataris E (2017) Metformin and Alzheimer’s disease, dementia and cognitive impairment: a systematic review protocol. JBI Database System Rev Implement Rep 15:2055–2059 Zhou G, Myers R, Li Y, Chen Y, Shen X, Fenyk-Melody J, Wu M, Ventre J, Doebber T, Fujii N, Musi N, Hirshman MF, Goodyear LJ, Moller DE (2001) Role of AMP-activated protein kinase in mechanism of metformin action. Journal of Clinical Investigation 108:1167–1174. https://doi.org/10.1172/JCI13505 Glueck CJ, Fontaine RN, Wang P, Subbiah MTR, Weber K, Illig E, Streicher P, Sieve-Smith L, Tracy TM, Lang JE, McCullough P (2001) Metformin reduces weight, centripetal obesity, insulin, leptin, and low-density lipoprotein cholesterol in nondiabetic, morbidly obese subjects with body mass index greater than 30. Metabolism 50:856–861. https://doi.org/10.1053/meta.2001.24192 Xu T, Brandmaier S, Messias AC, Herder C, Draisma HHM, Demirkan A, Yu Z, Ried JS, Haller T, Heier M, Campillos M, Fobo G, Stark R, Holzapfel C, Adam J, Chi S, Rotter M, Panni T, Quante AS, He Y, Prehn C, Roemisch-Margl W, Kastenmuller G, Willemsen G, Pool R, Kasa K, Van Dijk KW, Hankemeier T, Meisinger C, Thorand B, Ruepp A, De Angelis MH, Li Y, Wichmann HE, Stratmann B, Strauch K, Metspalu A, Gieger C, Suhre K, Adamski J, Illig T, Rathmann W, Roden M, Peters A, Van Duijn CM, Boomsma DI, Meitinger T, Wang-Sattler R (2015) Effects of metformin on metabolite profiles and LDL cholesterol in patients with type 2 diabetes. Diabetes Care 38:1858–1867. https://doi.org/10.2337/dc15-0658 Petrie JR, Chaturvedi N, Ford I, Hramiak I, Hughes AD, Jenkins AJ, E. Klein B, Klein R, Ooi TC, Rossing P, Sattar N, Stehouwer CDA, Colhoun HM, Kean S, Thomson E, Gillespie L, Gibb J, Greenlaw N, Hramiak I, Keech A, Chaturvedi N, Hughes A, March K, Coady E, Tillin T, Bots M, Klein R, Klein B, Dreyer J, Jan T, Meuer S, Murach D, Sheffy K, Lusky R, Peleg S, Colhoun H, Shore A, Carty D, Donnan P, Witham M, Adler A, Lonn E, Rauchhaus P, Hramiak I, Lindsay R, Brouwers M, Van-Melckebeke J, Gillespie L, Hamill T, Cuthbertson L, Murray A, Jolly L, Miller E, Hair J, Bell A, Carmichael S, Douglas E, Surtees P, Dinnett E, Allan J, Kean S, Watson C, McLaughlin M, Brindley G, Smillie E, Motherwell D, MacDonald S, Ellis P, Stuart D, Travers M, Brearley S, Greig L, Haw J (2017) Metformin in adults with type 1 diabetes: Design and methods of REducing with MetfOrmin Vascular Adverse Lesions (REMOVAL): An international multicentre trial. Diabetes Obes Metab 19:509–516. https://doi.org/10.1111/DOM.12840 Wang CP, Lorenzo C, Habib SL, Jo B, Espinoza SE (2017) Differential effects of metformin on age related comorbidities in older men with type 2 diabetes. J Diabetes Complications 31:679–686. https://doi.org/10.1016/J.JDIACOMP.2017.01.013 Seifarth C, Schehler B, Schneider HJ (2013) Effectiveness of metformin on weight loss in non-diabetic individuals with obesity. Exp Clin Endocrinol Diabetes 121:27–31. https://doi.org/10.1055/S-0032-1327734 Wulffelé MG, Kooy A, De Zeeuw D, Stehouwer CDA, Gansevoort RT (2004) The effect of metformin on blood pressure, plasma cholesterol and triglycerides in type 2 diabetes mellitus: A systematic review. J Intern Med 256:1–14. https://doi.org/10.1111/J.1365-2796.2004.01328.X Asai A, Shuto Y, Nagao M, Kawahara M, Miyazawa T, Sugihara H, Oikawa S (2019) Metformin Attenuates Early-Stage Atherosclerosis in Mildly Hyperglycemic Oikawa-Nagao Mice. J Atheroscler Thromb 26:1075–1083. https://doi.org/10.5551/JAT.48223 Sung JY, Kim SG, Park SY, Kim JR, Choi HC (2024) Telomere stabilization by metformin mitigates the progression of atherosclerosis via the AMPK-dependent p-PGC-1α pathway. Experimental & Molecular Medicine 2024 56:9 56:1967–1979. https://doi.org/10.1038/s12276-024-01297-w Yan N, Wang L, Li Y, Wang T, Yang L, Yan R, Wang H, Jia S (2021) Metformin intervention ameliorates AS in ApoE-/- mice through restoring gut dysbiosis and anti-inflammation. PLoS One 16:e0254321. https://doi.org/10.1371/JOURNAL.PONE.0254321 Chen X, Wang S, Xu W, Zhao M, Zhang Y, Xiao H (2023) Metformin Directly Binds to MMP-9 to Improve Plaque Stability. J Cardiovasc Dev Dis 10:54. https://doi.org/10.3390/JCDD10020054/S1 Wu H, Feng K, Zhang C, Zhang H, Zhang J, Hua Y, Dong Z, Zhu Y, Yang S, Ma C (2021) Metformin attenuates atherosclerosis and plaque vulnerability by upregulating KLF2-mediated autophagy in apoE−/- mice. Biochem Biophys Res Commun 557:334–341. https://doi.org/10.1016/J.BBRC.2021.04.029 Luo F, Guo Y, Ruan GY, Long JK, Zheng XL, Xia Q, Zhao SP, Peng DQ, Fang ZF, Li XP (2017) Combined use of metformin and atorvastatin attenuates atherosclerosis in rabbits fed a high-cholesterol diet. Sci Rep 7:. https://doi.org/10.1038/S41598-017-02080-W Allard JS, Perez EJ, Fukui K, Carpenter P, Ingram DK, Cabo R de (2015) Prolonged metformin treatment leads to reduced transcription of Nrf2 and neurotrophic factors without cognitive impairment in older C57BL/6J mice. Behavioural brain research 301:1. https://doi.org/10.1016/J.BBR.2015.12.012 Chen F, Dong RR, Zhong KL, Ghosh A, Tang SS, Long Y, Hu M, Miao MX, Liao JM, Sun HB, Kong LY, Hong H (2016) Antidiabetic drugs restore abnormal transport of amyloid-β across the blood–brain barrier and memory impairment in db/db mice. Neuropharmacology 101:123–136. https://doi.org/10.1016/J.NEUROPHARM.2015.07.023 Pintana H, Apaijai N, Pratchayasakul W, Chattipakorn N, Chattipakorn SC (2012) Effects of metformin on learning and memory behaviors and brain mitochondrial functions in high fat diet induced insulin resistant rats. Life Sci 91:409–414. https://doi.org/10.1016/J.LFS.2012.08.017 Rodrigues MS, de Paula GC, Duarte MB, de Rezende VL, Possato JC, Farias HR, Medeiros EB, Feuser PE, Streck EL, de Ávila RAM, Bast RKSS, Budni J, de Bem AF, Silveira PCL, de Oliveira J (2021) Nanotechnology as a therapeutic strategy to prevent neuropsychomotor alterations associated with hypercholesterolemia. Colloids Surf B Biointerfaces 201:. https://doi.org/10.1016/j.colsurfb.2021.111608 Guo M, Mi J, Jiang QM, Xu JM, Tang YY, Tian G, Wang B (2014) Metformin may produce antidepressant effects through improvement of cognitive function among depressed patients with diabetes mellitus. Clin Exp Pharmacol Physiol 41:650–656. https://doi.org/10.1111/1440-1681.12265 Zemdegs J, Martin H, Pintana H, Bullich S, Manta S, Marqués MA, Moro C, Laye S, Ducrocq F, Chattipakorn N, Chattipakorn SC, Rampon C, Pénicaud L, Fioramonti X, Guiard BP (2019) Metformin Promotes Anxiolytic and Antidepressant-Like Responses in Insulin-Resistant Mice by Decreasing Circulating Branched-Chain Amino Acids. The Journal of Neuroscience 39:5935. https://doi.org/10.1523/JNEUROSCI.2904-18.2019 de Bem AF, Krolow R, Farias HR, de Rezende VL, Gelain DP, Moreira JCF, Duarte JM das N, de Oliveira J (2021) Animal Models of Metabolic Disorders in the Study of Neurodegenerative Diseases: An Overview. Front Neurosci 14:604150. https://doi.org/10.3389/FNINS.2020.604150/XML Harries LW, Bradley-Smith RM, Llewellyn DJ, Pilling LC, Fellows A, Henley W, Hernandez D, Guralnik JM, Bandinelli S, Singleton A, Ferrucci L, Melzer D (2012) Leukocyte CCR2 Expression Is Associated with Mini-Mental State Examination Score in Older Adults. https://home.liebertpub.com/rej 15:395–404. https://doi.org/10.1089/REJ.2011.1302 Solfrizzi V, D’Introno A, Colacicco AM, Capurso C, Todarello O, Pellicani V, Capurso SA, Pietrarossa G, Santamato V, Capurso A, Panza F (2006) Circulating biomarkers of cognitive decline and dementia. Clinica Chimica Acta 364:91–112. https://doi.org/10.1016/J.CCA.2005.06.015 Westin K, Buchhave P, Nielsen H, Minthon L, Janciauskiene S, Hansson O (2012) CCL2 Is Associated with a Faster Rate of Cognitive Decline during Early Stages of Alzheimer’s Disease. PLoS One 7:e30525. https://doi.org/10.1371/JOURNAL.PONE.0030525 Garcez ML, Mina F, Bellettini-Santos T, Carneiro FG, Luz AP, Schiavo GL, Andrighetti MS, Scheid MG, Bolfe RP, Budni J (2017) Minocycline reduces inflammatory parameters in the brain structures and serum and reverses memory impairment caused by the administration of amyloid β (1-42) in mice. Prog Neuropsychopharmacol Biol Psychiatry 77:23–31. https://doi.org/10.1016/J.PNPBP.2017.03.010 Lima Garcez M, Mina F, Bellettini-Santos T, Pereira da Luz A, Luis Schiavo G, Matias Carollo Macieski J, Behenck Medeiros E, Oliveira Marques A, Quadros Magnus N, Budni J (2019) The Involvement of NLRP3 on the Effects of Minocycline in an AD-Like Pathology Induced by β-Amyloid Oligomers Administered to Mice. https://doi.org/10.1007/s12035-018-1211-9 Sparks DL, Kuo YM, Roher A, Martin T, Lukas RJ (2000) Alterations of Alzheimer’s disease in the cholesterol-fed rabbit, including vascular inflammation. Preliminary observations. Ann N Y Acad Sci 903:335–344. https://doi.org/10.1111/J.1749-6632.2000.TB06384.X, Streit WJ, Sparks DL (1997) Activation of microglia in the brains of humans with heart disease and hypercholesterolemic rabbits. J Mol Med (Berl) 75:130–138. https://doi.org/10.1007/S001090050097 Kaye S, Gold A, Lin D, Chen M, Zhu J, Gao J (2025) Hypercholesterolemia drives microglial dysfunction and weakens response to amyloid plaques. Exp Neurol 390:. https://doi.org/10.1016/j.expneurol.2025.115272 Lian H, Yang L, Cole A, Sun L, Chiang ACA, Fowler SW, Shim DJ, Rodriguez-Rivera J, Taglialatela G, Jankowsky JL, Lu HC, Zheng H (2015) NFκB-activated astroglial release of complement C3 compromises neuronal morphology and function associated with Alzheimer’s disease. Neuron 85:101–115. https://doi.org/10.1016/J.NEURON.2014.11.018 Morales I, Guzmán-Martínez L, Cerda-Troncoso C, Farías GA, Maccioni RB (2014) Neuroinflammation in the pathogenesis of Alzheimer’s disease. A rational framework for the search of novel therapeutic approaches. Front Cell Neurosci 8:. https://doi.org/10.3389/FNCEL.2014.00112 Chen YL, Wang LM, Chen Y, Gao JY, Marshall C, Cai ZY, Hu G, Xiao M (2016) Changes in astrocyte functional markers and β-amyloid metabolism-related proteins in the early stages of hypercholesterolemia. Neuroscience 316:178–191. https://doi.org/10.1016/J.NEUROSCIENCE.2015.12.039 Phillips EC, Croft CL, Kurbatskaya K, O’Neill MJ, Hutton ML, Hanger DP, Garwood CJ, Noble W (2014) Astrocytes and neuroinflammation in Alzheimer’s disease. Biochem Soc Trans 42:1321–1325. https://doi.org/10.1042/BST20140155 Hol EM, Pekny M (2015) Glial fibrillary acidic protein (GFAP) and the astrocyte intermediate filament system in diseases of the central nervous system. Curr Opin Cell Biol 32:121–130. https://doi.org/10.1016/J.CEB.2015.02.004 De Oliveira WH, De Santana Nunes AK, De França MER, Dos Santos LA, Lós DB, Rocha SWS, De Sousa Barbosa KP, Rodrigues GB, Peixoto CA (2016) Effects of metformin on inflammation and short-term memory in streptozotocin-induced diabetic mice. Brain Res 1644:149–160. https://doi.org/10.1016/J.BRAINRES.2016.05.013 Oliveira WH, Braga CF, Lós DB, Araújo SMR, França MER, Duarte-Silva E, Rodrigues GB, Rocha SWS, Peixoto CA (2021) Metformin prevents p-tau and amyloid plaque deposition and memory impairment in diabetic mice. Exp Brain Res 239:2821–2839. https://doi.org/10.1007/S00221-021-06176-8/FIGURES/13 Mendonça IP, Paiva IHR de, Duarte-Silva EP, Melo MG de, Silva RS da, Oliveira WH de, Costa BL da SA da, Peixoto CA (2022) Metformin and fluoxetine improve depressive-like behavior in a murine model of Parkinsońs disease through the modulation of neuroinflammation, neurogenesis and neuroplasticity. Int Immunopharmacol 102:108415. https://doi.org/10.1016/J.INTIMP.2021.108415 Sabzali M, Eidi A, Khaksari M, Khastar H (2022) Anti-inflammatory, Antioxidant, and Antiapoptotic Action of Metformin Attenuates Ethanol Neurotoxicity in the Animal Model of Fetal Alcohol Spectrum Disorders. Neurotox Res 40:605–613. https://doi.org/10.1007/S12640-022-00499-2/FIGURES/5 Bachiller S, Jiménez-Ferrer I, Paulus A, Yang Y, Swanberg M, Deierborg T, Boza-Serrano A (2018) Microglia in Neurological Diseases: A Road Map to Brain-Disease Dependent-Inflammatory Response. Front Cell Neurosci 12:. https://doi.org/10.3389/FNCEL.2018.00488 Paolicelli RC, Bisht K, Tremblay MÈ (2014) Fractalkine regulation of microglial physiology and consequences on the brain and behavior. Front Cell Neurosci 8:. https://doi.org/10.3389/FNCEL.2014.00129 Paolicelli RC, Sierra A, Stevens B, Tremblay ME, Aguzzi A, Ajami B, Amit I, Audinat E, Bechmann I, Bennett M, Bennett F, Bessis A, Biber K, Bilbo S, Blurton-Jones M, Boddeke E, Brites D, Brône B, Brown GC, Butovsky O, Carson MJ, Castellano B, Colonna M, Cowley SA, Cunningham C, Davalos D, De Jager PL, de Strooper B, Denes A, Eggen BJL, Eyo U, Galea E, Garel S, Ginhoux F, Glass CK, Gokce O, Gomez-Nicola D, González B, Gordon S, Graeber MB, Greenhalgh AD, Gressens P, Greter M, Gutmann DH, Haass C, Heneka MT, Heppner FL, Hong S, Hume DA, Jung S, Kettenmann H, Kipnis J, Koyama R, Lemke G, Lynch M, Majewska A, Malcangio M, Malm T, Mancuso R, Masuda T, Matteoli M, McColl BW, Miron VE, Molofsky AV, Monje M, Mracsko E, Nadjar A, Neher JJ, Neniskyte U, Neumann H, Noda M, Peng B, Peri F, Perry VH, Popovich PG, Pridans C, Priller J, Prinz M, Ragozzino D, Ransohoff RM, Salter MW, Schaefer A, Schafer DP, Schwartz M, Simons M, Smith CJ, Streit WJ, Tay TL, Tsai LH, Verkhratsky A, von Bernhardi R, Wake H, Wittamer V, Wolf SA, Wu LJ, Wyss-Coray T (2022) Microglia states and nomenclature: A field at its crossroads. Neuron 110:3458–3483 Guzman-Martinez L, Maccioni RB, Andrade V, Navarrete LP, Pastor MG, Ramos-Escobar N (2019) Neuroinflammation as a common feature of neurodegenerative disorders. Front Pharmacol 10:1008. https://doi.org/10.3389/FPHAR.2019.01008/BIBTEX Ma X, Xiao W, Li H, Pang P, Xue F, Wan L, Pei L, Yan H (2021) Metformin restores hippocampal neurogenesis and learning and memory via regulating gut microbiota in the obese mouse model. Brain Behav Immun 95:68–83. https://doi.org/10.1016/J.BBI.2021.02.011 Wang Y, Wang Z, Yang H, Chen S, Zheng D, Liu X, Jiang Q, Chen Y (2022) Metformin Ameliorates Chronic Colitis-Related Intestinal Fibrosis via Inhibiting TGF-β1/Smad3 Signaling. Front Pharmacol 13:. https://doi.org/10.3389/fphar.2022.887497 Xiao Q, Xiao J, Liu J, Liu J, Shu G, Yin G (2022) Metformin suppresses the growth of colorectal cancer by targeting INHBA to inhibit TGF-β/PI3K/AKT signaling transduction. Cell Death Dis 13:202. https://doi.org/10.1038/S41419-022-04649-4 Chen X, Levy JM, Hou A, Winters C, Azzam R, Sousa AA, Leapman RD, Nicoll RA, Reese TS (2015) PSD-95 family MAGUKs are essential for anchoring AMPA and NMDA receptor complexes at the postsynaptic density. Proc Natl Acad Sci U S A 112:E6983–E6992. https://doi.org/10.1073/PNAS.1517045112/-/DCSUPPLEMENTAL Qin Z, Zhou C, Xiao X, Guo C (2021) Metformin attenuates sepsis-induced neuronal injury and cognitive impairment. BMC Neurosci 22:1–10. https://doi.org/10.1186/S12868-021-00683-8/FIGURES/6 Wang YL, Zhao JH, Guo FL, Gao XH, Xie X, Liu SQ, Yang X, Yang XF, Zhang LY, Ye YX, Fan LB, Wang JG (2020) Metformin Ameliorates Synaptic Defects in a Mouse Model of AD by Inhibiting Cdk5 Activity. Front Cell Neurosci 14:. https://doi.org/10.3389/FNCEL.2020.00170, Cho SY, Kim EW, Park SJ, Phillips BU, Jeong J, Kim H, Heath CJ, Kim D, Jang Y, López-Cruz L, Saksida LM, Bussey TJ, Lee DY, Kim E (2024) Reconsidering repurposing: long-term metformin treatment impairs cognition in Alzheimer’s model mice. Transl Psychiatry 14:. https://doi.org/10.1038/S41398-024-02755-9, Wu Q, Jia XY, Zhang SH, Wu YZ, Xu LS, Han JG, Yu W, Zhou QH (2025) Metformin activates the PI3K/AKT/BDNF axis to attenuate postoperative cognitive dysfunction. Neuropharmacology 265:. https://doi.org/10.1016/j.neuropharm.2024.110262 Fang W, Zhang J, Hong L, Huang W, Dai X, Ye Q, Chen X (2020) Metformin ameliorates stress-induced depression-like behaviors via enhancing the expression of BDNF by activating AMPK/CREB-mediated histone acetylation. J Affect Disord 260:302–313. https://doi.org/10.1016/j.jad.2019.09.013 Moiseeva O, Deschênes-Simard X, St-Germain E, Igelmann S, Huot G, Cadar AE, Bourdeau V, Pollak MN, Ferbeyre G (2013) Metformin inhibits the senescence-associated secretory phenotype by interfering with IKK/NF-κB activation. Aging Cell 12:489–498. https://doi.org/10.1111/ACEL.12075 Halloran J, Hussong SA, Burbank R, Podlutskaya N, Fischer KE, Sloane LB, Austad SN, Strong R, Richardson A, Hart MJ, Galvan V (2012) Chronic inhibition of mTOR by rapamycin modulates cognitive and non-cognitive components of behavior throughout lifespan in mice. Neuroscience 223:102. https://doi.org/10.1016/J.NEUROSCIENCE.2012.06.054 Spilman P, Podlutskaya N, Hart MJ, Debnath J, Gorostiza O, Bredesen D, Richardson A, Strong R, Galvan V (2010) Inhibition of mTOR by rapamycin abolishes cognitive deficits and reduces amyloid-β levels in a mouse model of alzheimer’s disease. PLoS One 5:. https://doi.org/10.1371/journal.pone.0009979 Van Skike CE, Hussong SA, Hernandez SF, Banh AQ, DeRosa N, Galvan V (2021) MTOR attenuation with rapamycin reverses neurovascular uncoupling and memory deficits in mice modeling alzheimer’s Disease. Journal of Neuroscience 41:4305–4320. https://doi.org/10.1523/JNEUROSCI.2144-20.2021, Kalender A, Selvaraj A, Kim SY, Gulati P, Brûlé S, Viollet B, Kemp BE, Bardeesy N, Dennis P, Schlager JJ, Marette A, Kozma SC, Thomas G (2010) Metformin, independent of AMPK, inhibits mTORC1 in a rag GTPase-dependent manner. Cell Metab 11:390–401. https://doi.org/10.1016/j.cmet.2010.03.014 Barzilai N, Crandall JP, Kritchevsky SB, Espeland MA (2016) Metformin as a Tool to Target Aging. Cell Metab 23:1060–1065. https://doi.org/10.1016/J.CMET.2016.05.011 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 24 Jan, 2026 Read the published version in Neurochemical Research → Version 1 posted Editorial decision: Revision requested 27 Oct, 2025 Reviews received at journal 04 Oct, 2025 Reviews received at journal 02 Oct, 2025 Reviewers agreed at journal 04 Sep, 2025 Reviewers agreed at journal 04 Sep, 2025 Reviewers invited by journal 28 Aug, 2025 Editor assigned by journal 27 Aug, 2025 Submission checks completed at journal 23 Aug, 2025 First submitted to journal 22 Aug, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7436605","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":509731831,"identity":"b63a0050-709d-4b93-a00e-5319da02f4bd","order_by":0,"name":"Natália Baltazar do Nascimento","email":"","orcid":"","institution":"Federal University of Rio Grande do Sul","correspondingAuthor":false,"prefix":"","firstName":"Natália","middleName":"Baltazar do","lastName":"Nascimento","suffix":""},{"id":509731832,"identity":"bf7930af-92a8-4839-83c1-ca5fd0711295","order_by":1,"name":"Hémelin Resende Farias","email":"","orcid":"","institution":"Federal University of Rio Grande do Sul","correspondingAuthor":false,"prefix":"","firstName":"Hémelin","middleName":"Resende","lastName":"Farias","suffix":""},{"id":509731833,"identity":"56f3d2f0-34f4-4d42-a096-d9347b09a9d2","order_by":2,"name":"Tainá Schons","email":"","orcid":"","institution":"Federal University of Rio Grande do Sul","correspondingAuthor":false,"prefix":"","firstName":"Tainá","middleName":"","lastName":"Schons","suffix":""},{"id":509731834,"identity":"48b556f0-e18c-4e66-b226-a9253b82d93c","order_by":3,"name":"Alex Paulo Zeferino Padilha","email":"","orcid":"","institution":"Federal University of Rio Grande do Sul","correspondingAuthor":false,"prefix":"","firstName":"Alex","middleName":"Paulo Zeferino","lastName":"Padilha","suffix":""},{"id":509731835,"identity":"c2dcbff3-0ec1-4fd9-8b84-2513ebce8a58","order_by":4,"name":"Mariana Viana Costa","email":"","orcid":"","institution":"Federal University of Rio Grande do Sul","correspondingAuthor":false,"prefix":"","firstName":"Mariana","middleName":"Viana","lastName":"Costa","suffix":""},{"id":509731836,"identity":"2f6ab55a-d478-44d3-b8d0-e3a4cf3c4746","order_by":5,"name":"Ariadni Mesquita Peres","email":"","orcid":"","institution":"Federal University of Rio Grande do Sul","correspondingAuthor":false,"prefix":"","firstName":"Ariadni","middleName":"Mesquita","lastName":"Peres","suffix":""},{"id":509731837,"identity":"2b4a2b35-0dca-4239-a2b9-0d832abd1010","order_by":6,"name":"Lucas dos Santos da Silva","email":"","orcid":"","institution":"Universidade Federal do Rio Grande do Sul","correspondingAuthor":false,"prefix":"","firstName":"Lucas","middleName":"dos Santos da","lastName":"Silva","suffix":""},{"id":509731838,"identity":"70f2333e-6955-49a1-a3b7-f0f9d5f10199","order_by":7,"name":"Jessica Marques Obelar Ramos","email":"","orcid":"","institution":"Federal University of Rio Grande do Sul","correspondingAuthor":false,"prefix":"","firstName":"Jessica","middleName":"Marques Obelar","lastName":"Ramos","suffix":""},{"id":509731839,"identity":"eadf6fef-16d5-4286-9100-f7be106bef35","order_by":8,"name":"Matheus Scarpatto Rodrigues","email":"","orcid":"","institution":"Federal University of Rio Grande do Sul","correspondingAuthor":false,"prefix":"","firstName":"Matheus","middleName":"Scarpatto","lastName":"Rodrigues","suffix":""},{"id":509731840,"identity":"6456ddff-f40e-4267-bec5-fe240026ba95","order_by":9,"name":"Fernanda Telles Fróes","email":"","orcid":"","institution":"Federal University of Rio Grande do Sul","correspondingAuthor":false,"prefix":"","firstName":"Fernanda","middleName":"Telles","lastName":"Fróes","suffix":""},{"id":509731841,"identity":"2744b2f6-f250-438b-b082-1b4f08151281","order_by":10,"name":"Fátima Theresinha Costa Rodrigues Guma","email":"","orcid":"","institution":"Federal University of Rio Grande do Sul","correspondingAuthor":false,"prefix":"","firstName":"Fátima","middleName":"Theresinha Costa Rodrigues","lastName":"Guma","suffix":""},{"id":509731842,"identity":"4d6bf543-fa57-4540-be87-f6ee5137de26","order_by":11,"name":"José Cláudio Fonseca Moreira","email":"","orcid":"","institution":"Federal University of Rio Grande do Sul","correspondingAuthor":false,"prefix":"","firstName":"José","middleName":"Cláudio Fonseca","lastName":"Moreira","suffix":""},{"id":509731843,"identity":"e2341e71-5a86-4156-95e7-5b20e04e7d2c","order_by":12,"name":"Rachel Krolow Santos Silva Bast","email":"","orcid":"","institution":"Universidade Federal do Rio Grande do Sul","correspondingAuthor":false,"prefix":"","firstName":"Rachel","middleName":"Krolow Santos Silva","lastName":"Bast","suffix":""},{"id":509731844,"identity":"91d003ae-fff0-4348-9a60-43a745675008","order_by":13,"name":"Andreza Fabro de Bem","email":"","orcid":"","institution":"University of Brasília","correspondingAuthor":false,"prefix":"","firstName":"Andreza","middleName":"Fabro","lastName":"de Bem","suffix":""},{"id":509731845,"identity":"2ee5b25e-093a-4e31-9969-8a67899c30ce","order_by":14,"name":"Jade de Oliveira","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABHElEQVRIie2PMUvDQBTHz8nl0tvkhZT2K5x0sELRr/JCIFMHxwwiBSFO4qrYb+AiBDI/KbTLBdeIg8keoWNAUO+qSIc0dRS833DvveP/494xZrH8RYjtEDLGdYv6BC7MLZ60KmxdGfbciWnlFuVn4CwayNXYonQW50RlPOoeXFC5rCLwk8c7f1lI1hd71Ki4ao7kxyHvKgzcqQI/zV8T0Ivt39xioyLzsSRUMw4M0XNio2T3RkH5vEF5qYzywUEUwZvzrhe7zpK6Vcm5ViLiABh6zgQGUlymra+4KkStBFopwsPpHHqQO+kQJWz8S2cxeyhreXQMYhzk1ekZF1dZ8lRHo77wmpU1+HcCVhW2xQ279FUF/SZtsVgs/4hPAr5nnXAJXJQAAAAASUVORK5CYII=","orcid":"","institution":"Federal University of Rio Grande do Sul","correspondingAuthor":true,"prefix":"","firstName":"Jade","middleName":"","lastName":"de Oliveira","suffix":""}],"badges":[],"createdAt":"2025-08-22 17:38:16","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7436605/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7436605/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s11064-025-04658-7","type":"published","date":"2026-01-24T15:58:44+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":90575735,"identity":"aaf4694b-1dc9-46b5-a226-18e518f9ac67","added_by":"auto","created_at":"2025-09-04 09:15:49","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":164110,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eExperimental protocol.\u003c/em\u003e\u003cem\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/em\u003e3-5-month-old male C57BL/6 LDLr\u003csup\u003e-/-\u003c/sup\u003e mice received vehicle or 200 mg/Kg of Metformin via gavage for 30 days. All animals were weighed weekly and had capillary blood glucose assessed on days 0 and 30 of the experimental protocol. Over the last four days of treatment, mice were tested for locomotor activity (OF), short-term memory (NOR), spatial reference memory (OR), and a depressive-like phenotype (TST). After euthanasia, brain tissue was dissected for immunohistochemistry assays, RT-qPCR, and Western blotting. Total cholesterol was determined from plasma\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7436605/v1/30f55ba8344041fdfb338575.png"},{"id":90575734,"identity":"c95ee582-8ceb-4b72-b72c-674a7214492a","added_by":"auto","created_at":"2025-09-04 09:15:49","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":232927,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eMetformin effects on metabolic parameters of LDLr\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e mice.\u003c/em\u003e\u003cstrong\u003e \u003c/strong\u003ePlasmatic levels of (a) total cholesterol (n = 5-8), (b) glucose of the vehicle (left) and metformin (right) groups (n = 6-9), and (c) total body weight (n = 19-23). Data are expressed as mean ± SEM. * P \u0026lt; 0.05 vs metformin D0 (Paired t-test)\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7436605/v1/8ce4e9f68e458a9581e90b71.png"},{"id":90575742,"identity":"2323d21e-ad84-4afe-ace7-631c2552898b","added_by":"auto","created_at":"2025-09-04 09:15:49","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":398772,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eMetformin treatment improves hypercholesterolemia-induced cognitive impairment.\u003c/em\u003e (a) Crossings and rearings number evaluated in the OF (n = 19-22), (b) group-representative track plots of crossings in the OF, (c) immobility time evaluated by TST (n = 19-22), (d) location index evaluated by the OR (n = 18-21), (e) and discrimination index evaluated by NOR (n = 16-20). Data are expressed as mean ± SEM. * P \u0026lt; 0.05 vs vehicle (Unpaired t-test), # P \u0026lt; 0.05 vs chance levels (50% of a new or displaced object investigation time in test trial; one sample t-test)\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7436605/v1/0920cce716c5bab43af7cd79.png"},{"id":90575743,"identity":"01d7193b-58b4-47b6-874f-464c1f005546","added_by":"auto","created_at":"2025-09-04 09:15:49","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":816018,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eMetformin treatment decreases GFAP immunoreactivity in the hippocampus of LDLr\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e mice.\u003c/em\u003e (a) GFAP immunoreactivity in total hippocampus and representative images (n = 7-8), and (b) IBA1 immunoreactivity in total hippocampus and representative images (n = 7-8). Data are expressed as mean ± SEM. * P \u0026lt; 0.05 vs vehicle (Unpaired t-test).\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7436605/v1/380fd8c57946a40fd7a0562d.png"},{"id":90576814,"identity":"db819126-a03a-404d-ba2f-a886e8c547cd","added_by":"auto","created_at":"2025-09-04 09:23:49","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":363932,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eMetformin treatment modulates gene expression in the hippocampus.\u003c/em\u003e\u003cstrong\u003e \u003c/strong\u003e(a,f) Representation of each gene fold change expression on the hippocampus of LDLr-/- mice treated with Metformin. Effect of vehicle (n = 3-5) or metformin (n = 3-5) administration on (b) TGF-β, (c) TNF-α, (d) TLR-4, (e) CD68, (g) TrkB, (h) PSD-95, (i) SYP, and (j) BDNF expression levels. Data are expressed as mean ± SEM. * P \u0026lt; 0.05 vs vehicle (Unpaired t-test).\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7436605/v1/01501e1fec33ba14a6375bdc.png"},{"id":90576813,"identity":"3c334cbc-fdc8-4f56-95f3-4d9912b8e0fe","added_by":"auto","created_at":"2025-09-04 09:23:49","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":255566,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eThe positive effects of metformin treatment on LDLr\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e mice are independent of AMPK activation.\u003c/em\u003e (a)Western blotting representative images. Protein content of (b) AMPK (n = 6) and (c) mTOR (n = 4-6), and (d) phospho:total ratio of AMPK and mTOR. Data are expressed as mean ± SEM. * P \u0026lt; 0.05 vs vehicle (Unpaired t-test)\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7436605/v1/ee912b2306b6e00dba08cd2b.png"},{"id":90575736,"identity":"c0bca1bf-f30a-45b5-aa8a-0cfc5d7528c0","added_by":"auto","created_at":"2025-09-04 09:15:49","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":159549,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eKey findings. \u003c/em\u003eLDLr\u003csup\u003e-/-\u003c/sup\u003e mice present neuroinflammation and behavioral alterations such as a depressive-like phenotype and memory impairment. Treatment with metformin reduced hippocampal astrogliosis, ameliorated cognitive function, increased gene expression of PSD-95 and decreased gene expression of TGF-β in the hippocampus.\u003c/p\u003e","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-7436605/v1/a0a16aa03859e37b14807e3a.png"},{"id":101151987,"identity":"f87c4a91-47f9-431e-a7c9-485205af8106","added_by":"auto","created_at":"2026-01-26 16:09:04","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3314006,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7436605/v1/7bc81fff-af72-40b9-ba0b-5eb9a3a69992.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"\u003cp\u003eEffects of Metformin on Metabolic Profile, Cognitive Function, and Neuroinflammation in LDLr\u003csup\u003e⁻/⁻ \u003c/sup\u003eMice\u003c/p\u003e","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eIn the past few decades, hypercholesterolemia, a well-known risk factor for cardiovascular disease, has also been considered a causative factor for dementia and mood disorders [\u003cspan additionalcitationids=\"CR2 CR3 CR4 CR5\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. In particular, familial hypercholesterolemia (FH) patients aged between 18 and 40 years display alterations in their neuropsychological performance [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e], while middle-aged FH individuals have an increased incidence of mild cognitive impairment (MCI) [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. FH is caused by a mutation in the gene encoding the low-density lipoprotein (LDL) receptor, which results in high levels of LDL cholesterol and premature cardiovascular disease [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eOur research group, using LDL receptor knockout (LDLr\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e) mice, corroborated the clinical data from FH patients [\u003cspan additionalcitationids=\"CR12\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. We observed that these hypercholesterolemic animals present memory impairments and depressive phenotype already at three months, which was associated with hippocampal and prefrontal cortex blood-brain barrier (BBB) leakage and neuroinflammation characterized by astrogliosis and microgliosis [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. In addition, it was observed that mTOR signaling is involved in the brain dysfunction induced by FH. As a proof-of-concept, treating LDLr\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice with rapamycin, a classical mTOR inhibitor, improved neurovascular function and cognition in these mice [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eAnother way to attenuate mTOR signaling is through AMPK activation [\u003cspan additionalcitationids=\"CR18\" citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. In this context, metformin is a potential molecule that can act via AMPK signaling [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Metformin is a widely used anti-diabetic medication with neuroprotective effects, primarily through the modulation of neuroinflammation [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Rabieipoor and collaborators (2023) reported that a two-week treatment with metformin restored cognitive dysfunction in an experimental model of sporadic Alzheimer\u0026rsquo;s disease (AD), which was associated with improved astrocyte density and prevented neuronal loss [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. In aged mice, metformin treatment attenuated cognitive decline, decreased hippocampal microglial activation and astrocyte hypertrophy, and reduced levels of proinflammatory factors, accompanied by AMPK activation and mTORC inhibition [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Moreover, in LDLr\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice, metformin treatment prevented the formation of aortic atherosclerotic plaques [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eTherefore, our primary hypothesis was that metformin could be an effective strategy for attenuating the behavioral disorders associated with FH. To test this experimentally, we treated LDLr\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice for 30 days with metformin.\u003c/p\u003e"},{"header":"MATERIALS AND METHODS","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eAnimals\u003c/h2\u003e\u003cp\u003eMale 3-5-month-old C57BL/6 LDLr\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice weighing 20\u0026ndash;30 g from the Department of Biochemistry at Federal University of Rio Grande do Sul (UFRGS) were used in this study (n\u0026thinsp;=\u0026thinsp;42). Mouse progenitors were obtained from Jackson Laboratories. The mice were allocated into groups of 5 per housing box (42 \u0026times; 34 \u0026times; 17 cm), in controlled temperature (22\u0026thinsp;\u0026plusmn;\u0026thinsp;1\u0026deg;C) and light (light-dark cycle of 12 hours, lights on from 7 AM to 7 PM), as well as \u003cem\u003ead libitum\u003c/em\u003e access to water and standard chow. The UFRGS Ethics Committee approved the present study (Protocol #41034).\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eExperimental protocol and pharmacological treatment\u003c/h3\u003e\n\u003cp\u003eMetformin (200 mg/Kg) [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e] was administered by gavage daily to the mice for 30 days. The vehicle used was a sodium chloride solution (0.9% in distilled water). The control group received the vehicle solution at the same frequency and period as the metformin group. Both treatment solutions were stored at 2\u0026ndash;8 \u0026ordm;C. The animals were divided into two experimental groups (n\u0026thinsp;=\u0026thinsp;19\u0026ndash;24 per group) according to treatment: LDLr\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice treated with vehicle and LDLr\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice treated with metformin. From the first day of treatment, animals were weighed weekly until the end of the experimental protocol. Capillary blood glucose was measured on day 0 and day 30. Over the last four days of treatment, the mice underwent the following behavioral tests: open field (OF), novel object recognition (NOR), object reallocation (OR), and tail suspension test (TST), to evaluate locomotor activity, hippocampal-linked memory, and a depressive-like phenotype, respectively. Following the behavioral tests, some of the animals were fasted for 12 hours and then anesthetized via intraperitoneal injection with a mixture of xylazine (10 mg/Kg) and ketamine (80 mg/Kg). Blood was collected by cardiac puncture to investigate total cholesterol, and the hippocampus was dissected for Western blotting and RT-qPCR analysis. The remaining mice were anesthetized and perfused with 4% paraformaldehyde, and then their brains were collected for immunofluorescence assays. It is essential to mention that we conducted two different treatment cohorts. The experimental design is illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e below.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\n\u003ch3\u003eBehavioral tests\u003c/h3\u003e\n\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\u003ch2\u003eOF\u003c/h2\u003e\u003cp\u003eThe OF test was conducted on the 27th day of treatment. The open-field test investigated locomotor and exploratory activity [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. The apparatus consists of a grey acrylic box (30 \u0026times; 40 \u0026times; 40 cm) with the floor delimited into 9 quadrants. Each mouse was placed in the center square of the arena and allowed to explore for a 5-minute training period. To evaluate locomotor and exploratory activity, crossings and rearings of the animals were counted during a test session of 5 minutes.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eNOR\u003c/h3\u003e\n\u003cp\u003eOn the 28th day of treatment, animals were subjected to the NOR test to evaluate their short-term memory. In this test, the mouse was exposed to 2 identical objects, and after a short interval, it was again exposed to 1 of the same object and a novel one [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. The test was conducted in the same apparatus used in the OF, in 2 sessions of 5 minutes each. During the training and acquisition sessions, the animals were exposed to two identical objects placed in parallel, and their exploration time was recorded. After 60 minutes, in the test and retention session, the animals explored 1 of the familiar objects and a novel object placed in the same position as the previous one. The exploration time for each object is registered for the determination of the Discrimination Index using the following formula:\u003cdiv id=\"Equa\" class=\"Equation\"\u003e\u003cdiv format=\"TEX\" class=\"mathdisplay\" id=\"FileID_Equa\" name=\"EquationSource\"\u003e\n$$\\:Discriminatin\\:Index\\:\\left(\\%\\right)\\:=\\:\\frac{Time\\:exploring\\:novel\\:object\\:\\left(s\\right)}{\\left(Time\\:exploring\\:novel\\:object\\:\\right(s)\\:+\\:Time\\:exploring\\:familiar\\:object\\:(s\\left)\\right)}\\:\\times\\:\\:100$$\u003c/div\u003e\u003c/div\u003e\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eOR\u003c/h2\u003e\u003cp\u003eOn the 29th day of the experimental protocol, we performed the OR test to evaluate the animals\u0026rsquo; spatial reference memory [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Like the NOR test, this test is based on the natural rodent's tendency to explore a new or relocated object for longer than a familiar object. In this test, which was also executed in the OF apparatus, we completed a 5-minute training session where two identical objects placed parallel to each other were exposed to the mice to explore freely, and the exploration time for each object was documented. After 180 minutes, in the test session, 1 of the objects was repositioned transversally, and the animal\u0026rsquo;s exploration time for each object was recorded for 5 minutes. The Location Index is determined by the following equation, based on the object\u0026rsquo;s total exploration time:\u003cdiv id=\"Equb\" class=\"Equation\"\u003e\u003cdiv format=\"TEX\" class=\"mathdisplay\" id=\"FileID_Equb\" name=\"EquationSource\"\u003e\n$$\\:Location\\:Index\\:\\left(\\%\\right)\\:=\\:\\frac{Time\\:exploring\\:reallocated\\:object\\:\\left(s\\right)}{\\left(Time\\:exploring\\:relocated\\:object\\:\\right(s)\\:+\\:Time\\:exploring\\:familiar\\:object\\:(s\\left)\\right)}\\:\\times\\:\\:100$$\u003c/div\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eTST\u003c/h3\u003e\n\u003cp\u003eOn the last day of treatment, the animals were subjected to the TST to evaluate a depressive-like phenotype [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. For this test, the mice were suspended 50 centimeters from the ground by their tail\u0026rsquo;s distal extremity for 6 minutes, and the total immobility time was recorded.\u003c/p\u003e\n\u003ch3\u003eBiochemical analysis\u003c/h3\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eMetabolic parameters\u003c/h2\u003e\u003cp\u003eAfter the behavioral tests, one cohort of animals was anesthetized with xylazine and ketamine for blood collection via cardiac puncture, which was sequentially centrifuged to obtain heparinized plasma. The total cholesterol levels in plasma were determined using a commercial enzymatic kit according to the manufacturer's instructions (Gold Analisa Diagnostica Ltda). On the first and last days of the experimental protocol, a capillary glucose test was conducted with blood from the tail vein. A drop of blood was collected with a test strip and tested by a glucose meter according to the manufacturer's instructions (Accumed Produtos M\u0026eacute;dico Hospitalares Ltda). The results are expressed as mg/dL.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eImmunofluorescence\u003c/h2\u003e\u003cp\u003eAnother cohort of animals was anesthetized and perfused via the left ventricle with 0.9% saline solution, followed by 4% paraformaldehyde. After perfusion, whole brains were removed, immersed in 4% paraformaldehyde for 24 hours, and preserved in phosphate-buffered saline (PBS) with 30% sucrose solution. Coronal sequential slices with 30 \u0026micro;m width of the prefrontal cortex and hippocampus were obtained using a vibrating blade microtome (Leica Biosystems VT1000S) and stored in PBS 0.1 M with 0.5% sodium azide. All immunofluorescence assays were performed according to the instructions previously described by Rodrigues \u003cem\u003eet al.\u003c/em\u003e (2023) [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Initially, the slices were washed twice with PBS 0.1 M and then blocked with 1% bovine serum albumin diluted in PBS 0.1 M and 0.3% Triton X for 45 minutes. The slices were incubated overnight with primary antibodies for glial fibrillary acidic protein (GFAP, 1:1000 dilution, Sigma-Aldrich G3893) or ionized calcium-binding adapter molecule 1 (IBA-1, 1:500 dilution, FUJIFILM Wako 019-19741), markers for astrocytes and microglia, respectively. After 5 washes with PBS 0.1 M, the slices were incubated with secondary fluorescent antibodies (Alexa Fluor\u0026trade; 488, 1:1000 dilution, Invitrogen A-11001; Alexa Fluor\u0026trade; 647, 1:1000 dilution, Invitrogen A-21246) diluted in PBS 0.1 M and 0.3% Triton X for 2 hours. Lastly, the slices were washed 3 times with PBS 0.1 M, mounted on glass slides with CC/mount, and covered with coverslips. For each slide, 2 whole hippocampus and 2 prefrontal cortices from different coronal slices where imaged under 20x and 40x magnification using the Olympus\u0026reg;FV1000 confocal microscope from the UFRGS Centro de Microscopia e Microan\u0026aacute;lise. ImageJ software was used to crop the interest regions and measure mean fluorescence intensity (MFI).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003eWestern blotting\u003c/h2\u003e\u003cp\u003eThe protein content was quantified through immunodetection in the hippocampal tissue [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. The samples were homogenized in ice-cold lysis buffer pH 7.9: 2.5 M KCl, 10 mM Hepes, 0.6 mM EDTA, 0.1% NP 40, and 1% protease inhibitor cocktail (PIC). Equal protein concentrations (40 \u0026micro;g/lane of total protein, determined using a commercial kit BCA Protein Assay [Thermo Scientific Cat. no. A53225, U.S.A.]) were loaded onto NuPAGE\u0026reg; 4%\u0026shy;12% Bis\u0026shy;Tris Gels. After electrophoresis, proteins were transferred (XCell SureLock\u0026reg; Mini\u0026shy;Cell, Invitrogen Cat. no. EI0001) to nitrocellulose membranes (1 hour at 50 volts in transfer buffer [48 mM Trizma, 39 mM glycine, 20% methanol, and 0.25% sodium dodecyl sulfate]). The membranes were incubated for 2 hours in a blocking solution (Tris-buffered saline [TBS] plus 5% bovine serum albumin). After incubation, the membranes were incubated overnight at 4\u0026deg;C in a blocking solution containing one of the following antibodies: anti\u0026shy;mTOR (1:1000, Cell Signaling, Cat. no. #2983), anti-pmTOR (1:1000, Cell Signaling, Cat. no. #2971), anti-AMPK (1:1000, Abcam, Cat. no. #AB80039), anti-pAMPK (1:1000, Abcam, Cat. no. #AB133448 or anti-β\u0026shy;actin (1:1000, Sigma\u0026shy;Aldrich, Cat. no. #A4700). The blot was then washed three times for 5 minutes with T\u0026shy;TBS and incubated for 2 hours in a solution containing peroxidase\u0026shy;conjugated anti\u0026shy;rabbit IgG (1:1000, Millipore, Cat. no. AP132P) and peroxidase\u0026shy;conjugated anti\u0026shy;mouse IgG (1:1000, Millipore, Cat. no. AP124P). The blot was again washed four times for 5 minutes with T\u0026shy;TBS and then left in TBS. The blot was developed using a chemiluminescent ECL kit (Amersham, Oakville, Ontario; Cat. no. RPN 3004). The chemiluminescence was detected using a digital imaging system (Image Quant LAS 4000; GE Healthcare LifeSciences) and analyzed using the Image Studio Lite Software 5.2 (RRID: SCR_013715). The quantification of protein content involves calculating a ratio of intensity. The intensity of the protein of interest was measured and compared to that of anti\u0026shy;β-actin on the same membrane. All results are expressed as % of the control.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003eRT-qPCR\u003c/h2\u003e\u003cp\u003eHippocampal RNA extraction was done using TRIzol\u0026reg; Reagent (Thermo Fisher Scientific, USA) and 2-Mercaptoethanol (Sigma-Aldrich, M3148), following the manufacturer\u0026rsquo;s instructions and a protocol previously described by Santos \u003cem\u003eet al.\u003c/em\u003e (2024) [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. RNA purity (absorbance ratio at 260 nm and 280 nm [A260/A280]) and concentration were assessed by the I-Quant equipment (Loccus, BR). For cDNA synthesis, 2 \u0026micro;g of RNA per sample was used with the High-Capacity cDNA Reverse Transcription\u0026reg; kit (Thermo Fisher Scientific, USA). Gene-specific primers were designed using the NCBI\u0026rsquo;s Primer-BLAST tool (National Library of Medicine, USA), ensuring no secondary structures were formed. Primer efficiency was evaluated to confirm the absence of nonspecific amplifications. Gene expression analysis was performed for proteins involved in neuroplasticity, neuroinflammation, and the β-actin housekeeping gene, using the sequences in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. RT-qPCR reactions were conducted in triplicate with the PowerUp\u0026trade; SYBR\u0026reg; Green Master Mix kit (Thermo Fisher Scientific, USA), following the manufacturer\u0026rsquo;s instructions. Results were analyzed using the \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:{2}^{-\\varDelta\\:\\varDelta\\:CT}\\)\u003c/span\u003e\u003c/span\u003e method.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003e\u003cem\u003ePrimers used for RT-qPCR.\u003c/em\u003e Forward (F) and reverse (R) primer sequences used for RT-qPCR analysis of genes related to inflammation and synaptic plasticity\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGene\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward sequence (5\u0026rsquo; to 3\u0026rsquo;)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eReverse sequence (5\u0026rsquo; to 3)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTNF-α\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eATGTCTCAGCCTCTTCTCATTC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGCTTGTCACTCGAATTTTGAGA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTLR4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCTGGGGCTCATTCACTCACTA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCTCAGACTCGGCACTTAGCA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTGF-β\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eATGGTGGACCGCAACAACGC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGGCACTGCTTCCCGAATGTCTG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCD68\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCTTCCCACAGGCAGCACAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAATGATGAGAGGCAGCAAGAGG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eBDNF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTGACGACGACATCACTGGCT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eACAAGTCCGCGTCCTTATGGTT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSYP\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCCACCTCCTTCTCCAATCAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCAGCAAAGACAGGGTCTCCT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTrkB\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAACGGAGACTACACCCTGATGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGCAATCACCACCACGGCATA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePSD-95\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCGATTACCACTTTGTCTCCTCCC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eACGGATGAAGATGGCGATAGG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eβ-actin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTCAAGATCATTGCTCCTCCTGAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eACATCTGCTGGAAGGTGGACA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003eStatistical analysis\u003c/h2\u003e\u003cp\u003eAll data were tested for normality using the Shapiro-Wilk test. Differences in glucose levels between groups were evaluated by paired t-test. Unpaired t-tests were used for the remaining comparisons when data distribution was normal, and the Mann-Whitney test was used for non-normal data distribution. For the NOR and OR behavioral tests, the groups were compared to a hypothetical value of 50% using one-sample t-tests to analyze the chance levels. All data are presented as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error of the mean (SEM). Statistical significance was set at p\u0026thinsp;\u0026lt;\u0026thinsp;0.05. Statistical analyses were performed using Statistica\u0026copy; 10 (StatSoft Inc., Tulsa, OK, USA) or GraphPad Prism\u0026copy; 8 (GraphPad Inc., San Diego, CA, USA).\u003c/p\u003e\u003c/div\u003e"},{"header":"RESULTS","content":"\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003eEffects of Metformin treatment on metabolic alterations related to FH\u003c/h2\u003e\u003cp\u003eFirst, we evaluated the metabolic parameters of animals that received metformin treatment. Figure\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e shows the total cholesterol levels, glucose levels pre- and post-treatment, and total body weight of the LDLr\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice. The metformin treatment did not reduce cholesterol levels (t(10)\u0026thinsp;=\u0026thinsp;0.1694, P\u0026thinsp;=\u0026thinsp;0.8689) of the FH animal model (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea). Importantly, animals that received metformin administration showed reduced blood glucose levels on day 30 compared to day 0 (t(8)\u0026thinsp;=\u0026thinsp;3.021, P\u0026thinsp;=\u0026thinsp;0.0165) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb). Finally, metformin treatment didn\u0026rsquo;t alter the body mass (t(40)\u0026thinsp;=\u0026thinsp;0.9432, P\u0026thinsp;=\u0026thinsp;0.3512) of LDLr\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003eMETFORMIN TREATMENT ATTENUATED BEHAVIORAL ALTERATIONS IN LDLR\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e MICE\u003c/h2\u003e\u003cp\u003eAnalysis of the behavioral test data is shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. The OF test was used to evaluate locomotor and exploratory activities by analyzing the number of crossings and rearings during the animals\u0026rsquo; permanence in the apparatus. Metformin treatment caused no alteration in the crossing (t(39)\u0026thinsp;=\u0026thinsp;0.6161, P\u0026thinsp;=\u0026thinsp;0.5414) and rearing (t(39)\u0026thinsp;=\u0026thinsp;0.6397, P\u0026thinsp;=\u0026thinsp;0.5261) numbers in LDLr\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea, b).\u003c/p\u003e\u003cp\u003eTo evaluate a depressive-like phenotype, the tail suspension test was performed. The unpaired t-test highlighted a trend (t(39)\u0026thinsp;=\u0026thinsp;1.941, P\u0026thinsp;=\u0026thinsp;0.0596) toward reduction of immobility time in metformin-treated animals compared to the vehicle-treated group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec). Analysis of the effect size of treatment on immobility time by Cohen\u0026rsquo;s d showed a medium effect (d\u0026thinsp;=\u0026thinsp;0.6).\u003c/p\u003e\u003cp\u003eIn addition, the OR (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ed) and NOR (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ee) tests were performed to evaluate hippocampal-dependent memories. One sample t-test revealed that LDLr\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e + vehicle groups showed memory and learning deficits (OR: t(17)\u0026thinsp;=\u0026thinsp;1.989, P\u0026thinsp;=\u0026thinsp;0.0630 vs 50%; NOR: t(15)\u0026thinsp;=\u0026thinsp;1.627, P\u0026thinsp;=\u0026thinsp;0.1246 vs 50%). Moreover, the unpaired t-test displayed that the metformin group had a higher location index than the vehicle-administered group (t(37)\u0026thinsp;=\u0026thinsp;2.790, P\u0026thinsp;=\u0026thinsp;0.0083) and a trend toward an increased location index versus chance levels (t(20)\u0026thinsp;=\u0026thinsp;1.927, P\u0026thinsp;=\u0026thinsp;0.0683 vs 50%). Mice treated with metformin also showed an elevated discrimination index compared to chance levels by one-sample t-test (t(19)\u0026thinsp;=\u0026thinsp;2.391, P\u0026thinsp;=\u0026thinsp;0.0273 vs 50%). These findings suggest that Metformin administration can mitigate hippocampal-associated memory deficit in the FH mice model and ameliorate their depressive phenotype.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003eMETFORMIN DECREASES HIPPOCAMPAL ASTROGLIOSIS IN LDLR\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e MICE\u003c/h2\u003e\u003cp\u003eAstroglial density and reactivity were evaluated by GFAP immunoreactivity in the hippocampus. Figure\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea shows representative images of the hippocampus labeled with GFAP in 20x, 40x (+), and digital zoom (++). The unpaired t-test pointed to a significant decrease (t(13)\u0026thinsp;=\u0026thinsp;2.726, P\u0026thinsp;=\u0026thinsp;0.0173) in GFAP immunoreactivity in the group treated with metformin (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo investigate the effects of metformin treatment on microglial density in the hippocampus, we performed immunofluorescence assays with IBA1. Figure\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb presents a representative panel with images of the hippocampus with IBA1 signal in 20x, 40x (+), and digital zoom (++) magnification. The unpaired t-test analysis did not detect significant statistical differences (t(13)\u0026thinsp;=\u0026thinsp;0.6761, P\u0026thinsp;=\u0026thinsp;0.5109) between groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb).\u003c/p\u003e\u003cp\u003e\u003cb\u003eMETFORMIN MODULATES GENE EXPRESSION RELATED TO NEUROINFLAMMATION AND SYNAPTIC PLASTICITY IN LDLR\u003c/b\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e \u003cb\u003eMICE\u003c/b\u003e\u003c/p\u003e\u003cp\u003eWe also analyzed the gene expression of proteins associated with neuroinflammation and synaptic plasticity in the hippocampus of the animals. Our findings suggest that metformin treatment may downregulate the expression of genes involved in inflammatory pathways, while upregulating the expression of proteins related to neuroplasticity. In particular, the hippocampus of LDLr\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e treated with metformin presented a decrease in the gene expression of TGF-β (t(7)\u0026thinsp;=\u0026thinsp;2.991, P\u0026thinsp;=\u0026thinsp;0.0202) and an increase in the gene expression of PSD-95 (t(5)\u0026thinsp;=\u0026thinsp;2.904, P\u0026thinsp;=\u0026thinsp;0.0336) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea, b, f, h). In addition, we observed lower TLR-4 (t(7)\u0026thinsp;=\u0026thinsp;1.533, P\u0026thinsp;=\u0026thinsp;0.1692, Cohen\u0026rsquo;s d\u0026thinsp;=\u0026thinsp;1.16) and higher BDNF (t(7)\u0026thinsp;=\u0026thinsp;1.886, P\u0026thinsp;=\u0026thinsp;0.1013, Cohen\u0026rsquo;s d\u0026thinsp;=\u0026thinsp;0.422) expression in the hippocampus of mice treated with metformin (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ed, j), although no significant statistical difference was detected. No significant changes were observed in the expression levels of TNF-α (t(7)\u0026thinsp;=\u0026thinsp;0.5474, P\u0026thinsp;=\u0026thinsp;0.6011), CD68 (t(8)\u0026thinsp;=\u0026thinsp;0.2370, P\u0026thinsp;=\u0026thinsp;0.8186), TrkB (t(7)\u0026thinsp;=\u0026thinsp;0.3857, P\u0026thinsp;=\u0026thinsp;0.7112), or SYP (U\u0026thinsp;=\u0026thinsp;3, P\u0026thinsp;=\u0026thinsp;0.25) following metformin treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ec, e, g, i).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003ch2\u003eMETFORMIN EFFECTS ARE AMPK/mTOR INDEPENDENT\u003c/h2\u003e\u003cp\u003eConsidering that most of the effects of metformin treatment are associated with its modulation of the AMPK/mTOR signaling pathway, total and phosphorylated AMPK and mTOR content were assessed using Western blotting. The content of both proteins, total and phosphorylated fractions, was not significantly different (AMPK: t(10)\u0026thinsp;=\u0026thinsp;0.3415, P\u0026thinsp;=\u0026thinsp;0.7398; p-AMPK: t(10)\u0026thinsp;=\u0026thinsp;0.1813, P\u0026thinsp;=\u0026thinsp;0.8597; mTOR: t(7)\u0026thinsp;=\u0026thinsp;0.1434, P\u0026thinsp;=\u0026thinsp;0.89; p-mTOR: t(10)\u0026thinsp;=\u0026thinsp;0.4766, P\u0026thinsp;=\u0026thinsp;0.6439) when comparing the groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea, \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eb and \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ec). However, a tendency towards a lower phospho:total mTOR ratio (mTOR: t(8)\u0026thinsp;=\u0026thinsp;1.487, P\u0026thinsp;=\u0026thinsp;0.1753; AMPK: t(10)\u0026thinsp;=\u0026thinsp;0.6548, P\u0026thinsp;=\u0026thinsp;0.5274) was evidenced by the unpaired t-test (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ed) in the LDLr\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice treated with metformin. Additionally, when analyzing the effect size of phospho:total mTOR ratio, Cohen\u0026rsquo;s d pointed to a large effect (d\u0026thinsp;=\u0026thinsp;0.94).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eIn this study, we investigated the effects of metformin on metabolic, behavioral, molecular, and cellular alterations in LDLr\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice, a well-established model of FH. Our findings reveal that, although metformin did not reduce cholesterol levels or body mass, it significantly reduced blood glucose levels after 30 days of treatment. Behaviorally, metformin improved hippocampal-dependent cognitive performance in object reallocation and novel object recognition tasks and showed a trend toward alleviating depressive-like behavior. At the cellular level, metformin significantly reduced astroglial reactivity in the hippocampus, without altering microglial density. On the molecular level, metformin downregulated the expression of TGF-β and upregulated PSD-95, while also showing trends toward reduced TLR-4 and increased BDNF expression. These effects may occur independently of canonical AMPK/mTOR signaling, although a trend toward a lower phospho/total mTOR ratio was observed (d\u0026thinsp;=\u0026thinsp;0.94). Collectively, these findings suggest that metformin exerts neuroprotective effects in FH, potentially by modulating neuroinflammation and synaptic plasticity through alternative molecular pathways.\u003c/p\u003e\u003cp\u003eHypercholesterolemia is a well-established risk factor for the development of cardiovascular diseases, which remain the leading cause of mortality worldwide [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Over the past decades, hypercholesterolemia has been associated with the development of neurodegenerative diseases, such as AD [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. More recently, high plasmatic LDL-cholesterol levels during midlife have been recognized as a significant risk factor for dementia [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. The most common form of genetic hypercholesterolemia, FH, is typically caused by mutations that impair LDLr function and reduce LDL clearance from the circulation [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Notably, a clinical study demonstrated that FH individuals can present executive function impairment as early as 18 to 40 years old [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Complementing these findings, experimental studies using LDLr\u003csup\u003e⁻/⁻\u003c/sup\u003e mice\u0026mdash;a widely used model of FH\u0026mdash;have demonstrated hippocampal neuroinflammation [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e], astrogliosis and blood-brain barrier disruption [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], depressive-like behavior [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e], and memory deficits as early as 3 months of age [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. These observations underscore the urgent need for effective therapeutic strategies to prevent or mitigate the neurological consequences of FH. In this context, we investigated the effects of metformin administration on metabolic, behavioral, and glial alterations in LDLr\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice.\u003c/p\u003e\u003cp\u003eMetformin is a first-line oral antidiabetic drug widely used to improve insulin sensitivity and regulate glucose metabolism, particularly in individuals with type 2 diabetes [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Beyond its effects on blood glucose levels, metformin has also been associated with cardiovascular benefits, including lipid-lowering properties [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Human studies have shown that metformin reduces the risk of cardiovascular disease in diabetic patients by lowering circulating LDL cholesterol levels and reducing atherosclerotic plaque thickness [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. Both acute and chronic metformin treatment tend to reduce total and LDL cholesterol levels, while having minimal effects on plasma triglycerides and HDL cholesterol [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. These effects are supported by preclinical data. In hyperglycemic mice exposed to an atherogenic diet, metformin reduced atherosclerotic lesion formation by nearly 60% [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. Likewise, in ApoE\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice fed a high-fat diet, metformin treatment reduced atherosclerotic burden and was associated with lower body weight [\u003cspan additionalcitationids=\"CR47 CR48\" citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. However, findings in non-diabetic hypercholesterolemic models have been more variable. Some studies report that metformin does not significantly affect circulating lipid levels in these models [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. Consistent with these reports, our study found that metformin did not reduce total cholesterol or body weight in FH mice. Nevertheless, it significantly lowered blood glucose levels after 30 days of treatment, suggesting a selective metabolic benefit that could still support vascular and cognitive health.\u003c/p\u003e\u003cp\u003eAs previously demonstrated, LDLr\u003csup\u003e⁻/⁻\u003c/sup\u003e mice between 3 and 5 months of age already exhibit significant memory impairments [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. In the present study, metformin treatment improved learning and spatial memory deficits in these hypercholesterolemic mice. Animals receiving metformin spent more time exploring novel or reallocated objects in recognition-based memory tasks compared to vehicle-treated controls. However, while a group difference was observed in the OR, metformin did not fully reverse memory impairment: the location index did not significantly differ from the hypothetical 50% chance level. These findings are in line with previous studies demonstrating that metformin can improve cognitive performance in various models of neurological dysfunction, including AD, obesity, and diabetes [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan additionalcitationids=\"CR52\" citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. For example, genetically diabetic mice treated with 200 mg/Kg of metformin for six weeks showed enhanced learning and memory performance in the Morris water maze [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. Likewise, rats fed a high-fat diet recovered learning behavior in the same task following a 12-week treatment with 30 mg/Kg of metformin [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eAnother behavioral alteration frequently reported in animal models of hypercholesterolemia is a depressive-like phenotype [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. Increased immobility in the forced swim test and TST\u0026mdash;hallmarks of depressive-like behavior\u0026mdash;has been consistently observed in mice subjected to diet-induced hypercholesterolemia [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. Similarly, Engel \u003cem\u003eet al.\u003c/em\u003e (2016) demonstrated that LDLr\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice exhibit depressive-like behavior across multiple paradigms, including the TST, sucrose preference, and sucrose splash tests [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. In the present study, metformin treatment tended to reduce immobility time in LDLr\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice, suggesting a potential improvement in depressive-like behavior. This finding aligns with clinical evidence; for instance, Guo \u003cem\u003eet al.\u003c/em\u003e (2014) reported that metformin treatment in diabetic patients with comorbid depression led to a reduction in depressive symptoms [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]. Moreover, experimental data from C57BL/6J male mice fed a high-fat diet showed that chronic administration of metformin (300 mg/Kg) produced antidepressant-like effects, further supporting the psychotropic potential of the drug in metabolically compromised conditions [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. Collectively, these findings reinforce the hypothesis that metformin may grant mood-stabilizing or antidepressant-like benefits in the context of metabolic disturbances, such as those associated with FH.\u003c/p\u003e\u003cp\u003eNeuroinflammation is increasingly recognized as a central mechanism linking hypercholesterolemia to the pathogenesis of neurodegenerative diseases, including AD [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]. Clinical studies have shown that elevated levels of pro-inflammatory cytokines correlate with cognitive impairment in AD patients and elderly individuals [\u003cspan additionalcitationids=\"CR59\" citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e], while anti-inflammatory interventions in animal models of AD improve memory outcomes [\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e, \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e]. In hypercholesterolemic conditions, both systemic and cerebral inflammation have been documented [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e, \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e], with glial reactivity\u0026mdash;particularly of astrocytes and microglia\u0026mdash;playing a key role in the propagation of neuroinflammatory responses [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e]. Astrocytes, which normally regulate metabolism, support neurons, and facilitate synaptogenesis, can be activated via NF-κB-mediated inflammatory pathways [\u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e, \u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e]. In this inflammatory milieu, activated astrocytes contribute to the production of reactive nitrogen species and other inflammatory mediators[\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e, \u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e] and exhibit increased expression of GFAP, which is a key cytoskeletal protein that serves as a marker of astrocytic reactivity [\u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e]. Similarly, metformin has been shown to attenuate astrocyte reactivity in models of diabetes [\u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e71\u003c/span\u003e, \u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e], Parkinson\u0026rsquo;s disease [\u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e73\u003c/span\u003e], and fetal alcohol syndrome [\u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e74\u003c/span\u003e], highlighting its potential as a therapeutic modulator of neuroinflammation.\u003c/p\u003e\u003cp\u003eMicroglia play a central role in the innate immune response of the central nervous system, acting as key regulators of neuroinflammation and homeostasis [\u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e75\u003c/span\u003e]. In addition to its immune surveillance function, microglia contribute to neurogenesis, synaptic pruning, and the secretion of pro-inflammatory cytokines in response to pathological stimuli [\u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e76\u003c/span\u003e, \u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e77\u003c/span\u003e]. Their activation profile is highly context-dependent and varies according to the nature, intensity, and chronicity of the triggering insult [\u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e78\u003c/span\u003e]. In a previous study from our group, we demonstrated that LDLr\u003csup\u003e⁻/⁻\u003c/sup\u003e mice exhibit increased hippocampal IBA1 immunoreactivity at 3, 6, and 14 months of age, indicative of heightened microglial activation compared to wild-type controls [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. In the present study, however, metformin treatment did not reduce hippocampal microglial density in LDLr\u003csup\u003e⁻/⁻\u003c/sup\u003e mice. This finding contrasts with previous reports showing that metformin attenuates microgliosis in models of high-fat diet-induced neuroinflammation. For example, Ma \u003cem\u003eet al.\u003c/em\u003e (2021) reported a significant reduction in IBA1-positive microglia in the hippocampus of 8-month-old C57BL/6J male mice following 3 months of treatment with 250 mg/Kg/day of metformin [\u003cspan citationid=\"CR79\" class=\"CitationRef\"\u003e79\u003c/span\u003e]. Importantly, discrepancies in the observed effects may stem from differences in treatment duration, animal age, or disease context. Supporting this, Kodali \u003cem\u003eet al.\u003c/em\u003e (2021) found that metformin administration for 10 weeks in aged mice did not reduce overall IBA1 expression in the hippocampus but did diminish the tendency of microglia to form pro-inflammatory clusters [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. These findings suggest that metformin\u0026rsquo;s effects on microglial activation may depend on the stage of disease progression and specific microglial phenotypes rather than simply reducing cell density.\u003c/p\u003e\u003cp\u003eAlthough we did not observe changes in microglial density following metformin treatment in LDLr\u003csup\u003e⁻/⁻\u003c/sup\u003e mice, we further explored potential molecular shifts in neuroinflammatory signaling and neuroplasticity by analyzing hippocampal gene expression profiles. This approach provides insights into metformin\u0026rsquo;s modulatory effects beyond its effects on microglial morphology or density. Notably, our results demonstrated a significant downregulation of TGF-β gene expression in the hippocampus of metformin-treated LDLr\u003csup\u003e⁻/⁻\u003c/sup\u003e mice, which suggests a potential attenuation of pro-inflammatory signaling. Although TGF-β plays context-dependent roles in the central nervous system, exerting both neuroprotective and neuroinflammatory effects, its reduced expression may reflect a shift toward a less reactive glial environment. These findings align with previous reports showing that metformin suppresses TGF-β1 signaling in various models. For instance, in a chronic colitis mouse model, metformin reduced TGF-β1 expression and Smad3 phosphorylation, mitigating inflammation and fibrosis [\u003cspan citationid=\"CR80\" class=\"CitationRef\"\u003e80\u003c/span\u003e]. Moreover, Xiao \u003cem\u003eet al.\u003c/em\u003e (2022) showed that metformin downregulated INHBA, a key ligand of TGF-β signaling, in colorectal cancer cells, thereby inhibiting PI3K/Akt activation and cell proliferation [\u003cspan citationid=\"CR81\" class=\"CitationRef\"\u003e81\u003c/span\u003e]. Together, these data support the hypothesis that metformin may reduce TGF-β\u0026ndash;mediated glial activation in neuroinflammatory contexts, contributing to its neuroprotective effects in LDLr⁻/⁻ mice.\u003c/p\u003e\u003cp\u003eIn parallel, metformin treatment increased the gene expression of PSD-95, a key synaptic scaffolding protein associated with synaptic stability and plasticity, indicating a potential enhancement of hippocampal synaptic function. Given the established role of PSD-95 in anchoring NMDA and AMPA receptors and supporting synaptic strength [\u003cspan citationid=\"CR82\" class=\"CitationRef\"\u003e82\u003c/span\u003e], its upregulation likely contributes to the observed improvements in hippocampal-dependent memory. This finding aligns with prior evidence showing that, in a rat sepsis model, metformin restored PSD‑95 levels along with other synaptic markers disrupted by systemic inflammation [\u003cspan citationid=\"CR83\" class=\"CitationRef\"\u003e83\u003c/span\u003e]. Similarly, in APP/PS1 transgenic mice, metformin improved synaptic integrity and increased PSD-95 expression [\u003cspan citationid=\"CR84\" class=\"CitationRef\"\u003e84\u003c/span\u003e]. However, in contrast, Cho \u003cem\u003eet al.\u003c/em\u003e (2024) reported that long-term metformin administration (1\u0026ndash;2 years) in 3xTg-AD mice resulted in decreased PSD-95 expression, suggesting model- and time-dependent effects [\u003cspan citationid=\"CR85\" class=\"CitationRef\"\u003e85\u003c/span\u003e]. Together, these findings reinforce the notion that metformin supports hippocampal synaptic plasticity, which may underlie the cognitive improvements observed in our LDLr⁻/⁻ mouse model.\u003c/p\u003e\u003cp\u003eWhile changes in TLR4 and BDNF expression did not reach statistical significance, the moderate-to-large effect sizes observed (Cohen\u0026rsquo;s d\u0026thinsp;=\u0026thinsp;1.16 for TLR4 and d\u0026thinsp;=\u0026thinsp;0.42 for BDNF) indicate potential biological trends toward reduced innate immune activation and enhanced neurotrophic support. Although non-significant, the observed trend toward increased BDNF expression aligns with prior reports demonstrating metformin-induced upregulation of BDNF in models of depression and cognitive impairment [\u003cspan citationid=\"CR86\" class=\"CitationRef\"\u003e86\u003c/span\u003e, \u003cspan citationid=\"CR87\" class=\"CitationRef\"\u003e87\u003c/span\u003e]. These molecular shifts complement our behavioral findings, which showed improved memory performance and reduced depressive-like behavior in metformin-treated animals. Altogether, the data support the hypothesis that metformin may exert neuroprotective effects in FH by modulating inflammatory signaling and enhancing synaptic resilience.\u003c/p\u003e\u003cp\u003eInterestingly, we observed a trend toward a reduced phospho/total mTOR ratio in the hippocampus of metformin-treated LDLr\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice, with a large effect size, suggesting a potential downregulation of mTOR activity. This observation is consistent with previous findings indicating that metformin can suppress mTOR signaling, most commonly via activation of AMPK, a key energy sensor that negatively regulates the mTOR pathway [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR88\" class=\"CitationRef\"\u003e88\u003c/span\u003e]. Given that phosphorylated mTOR\u0026mdash;particularly within the mTORC1 complex\u0026mdash;represents its active state, the observed reduction in phosphorylation likely reflects decreased mTORC1 activity. In the central nervous system, inhibition of mTORC1 has been associated with multiple neuroprotective mechanisms, including enhanced autophagy, reduced neuroinflammation, and improved synaptic plasticity. Indeed, in animal models, pharmacological inhibition of mTOR with rapamycin has been shown to rescue behavioral deficits, including depressive-like behavior and cognitive deficits [\u003cspan citationid=\"CR89\" class=\"CitationRef\"\u003e89\u003c/span\u003e, \u003cspan citationid=\"CR90\" class=\"CitationRef\"\u003e90\u003c/span\u003e]. Of particular relevance, rapamycin-mediated mTOR inhibition has been shown to restore neurovascular coupling and memory performance in AD mouse models by reversing both nitric oxide synthase-dependent and independent cerebrovascular deficits [\u003cspan citationid=\"CR91\" class=\"CitationRef\"\u003e91\u003c/span\u003e]. Although we did not detect significant changes in AMPK phosphorylation in the hippocampus, this does not exclude its participation. Transient or localized AMPK activation may have occurred at earlier time points not captured in our analysis. Moreover, metformin has also been shown to inhibit mTOR via AMPK-independent mechanisms, including through REDD1 induction or Rag GTPase modulation [\u003cspan citationid=\"CR92\" class=\"CitationRef\"\u003e92\u003c/span\u003e]. Therefore, the trend toward mTOR inhibition observed here may reflect a cumulative outcome of multiple upstream regulatory inputs, potentially amplified by the metabolic disturbances inherent to LDLr\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice. Collectively, our findings suggest that metformin may contribute to neuroprotective effects in hypercholesterolemic conditions (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e), at least in part, by modulating the AMPK/mTOR axis. This pathway is of particular interest in the context of aging and neurodegeneration, as its dysregulation has been implicated in both processes. In line with this, large-scale clinical trials such as \u0026ldquo;Targeting Aging with Metformin\u0026rdquo; and \u0026ldquo;Investigation of Metformin in Pre-Diabetes on Atherosclerotic Cardiovascular OuTcomes\u0026rdquo; are currently investigating the broader systemic and neurological benefits of metformin in non-diabetic populations [\u003cspan citationid=\"CR93\" class=\"CitationRef\"\u003e93\u003c/span\u003e]. Our results contribute to this growing body of evidence by highlighting potential central mechanisms through which metformin may exert protective actions on brain health.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e"},{"header":"CONCLUSION","content":"\u003cp\u003eIn conclusion, our findings suggest that metformin improves cognitive and mood-related behaviors in LDLr⁻/⁻ mice, likely through modulation of neuroinflammatory and synaptic pathways. While canonical metabolic pathways like AMPK and mTOR may play a role, our data point to additional mechanisms, including suppression of TGF-β and upregulation of PSD-95. These results add to the growing body of evidence supporting metformin\u0026rsquo;s pleiotropic benefits on brain health and support further investigation into its potential use in FH and other hypercholesterolemic conditions.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u0026nbsp;\u003c/strong\u003eHenrique Beck Biehl (Centro de Microscopia e Microan\u0026aacute;lise\u0026nbsp;\u0026mdash;\u0026nbsp;CMM, Federal University of Rio Grande do Sul, Brazil) for the contribution to the immunofluorescence imaging. Figures created with BioRender.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u0026nbsp;\u003c/strong\u003eThis work was supported by the Universidade Federal do Rio Grande do Sul (UFGRS), Conselho Nacional de Desenvolvimento Cient\u0026iacute;fico e Tecnol\u0026oacute;gico (CNPq) [CNPq/MCTI/FNDCT N\u0026ordm; 18/2021 - Faixa A - Grupos Emergentes No do Processo: 407006/2021 - 4], Coordena\u0026ccedil;\u0026atilde;o de Aperfei\u0026ccedil;oamento de Pessoal de N\u0026iacute;vel Superior (Capes), Funda\u0026ccedil;\u0026atilde;o de Amparo \u0026agrave; pesquisa do Estado do RS [21/2551-0000 740-0 Edital FAPERGS | 10/2020 Aux\u0026iacute;lio Recem Doutor-ARD], Brazilian National Institute of Science and Technology on Excitoxicity and neuroprotection (INEN 2014-465671/2014-4), Instituto Nacional Sa\u0026uacute;de Cerebral (INSC, No 406020/2022\u0026ndash;1/ CNPq, Brazil (INSC 406020/2022-1), and L\u0026rsquo;Or\u0026eacute;al-UNESCO-ABC program Brazil para Mulheres na Ci\u0026ecirc;ncia.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interest\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u0026nbsp;\u003c/strong\u003eMethodology, analyses, manuscript writing and review, NBN; Methodology and analyses, HRF; Analyses, TS; Methodology, APZP; Methodology, MVC; Methodology, AMP; Methodology, LSS; Methodology, JMOR; Methodology, MSR; Manuscript writing and review, FT; Work supervision and manuscript review, FTCRG; Work supervision and manuscript review, JCFM; Work supervision and manuscript review, RKSSB; Interpretation of results and manuscript review, AFB; Elaboration of the main hypothesis and experimental protocol, work supervision, manuscript review, JO. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability\u0026nbsp;\u003c/strong\u003eThe data that support this study are available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval\u0026nbsp;\u003c/strong\u003eAll applicable international, national, and/or institutional guidelines for the care and use of animals were followed. All procedures performed in studies involving animals were in accordance with the ethical standards of the institution or practice at which the studies were conducted.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eKivipelto M, Helkala EL, Laakso MP, H\u0026auml;nninen T, Hallikainen M, Alhainen K, Soininen H, Tuomilehto J, Nissien A (2001) Midlife vascular risk factors and Alzheimer\u0026rsquo;s disease in later life: longitudinal, population based study. BMJ 322:1447\u0026ndash;1451. https://doi.org/10.1136/BMJ.322.7300.1447\u003c/li\u003e\n\u003cli\u003eSolomon A, Kivipelto M, Wolozin B, Zhou J, Whitmer RA (2009) Midlife Serum Cholesterol and Increased Risk of Alzheimer\u0026rsquo;s and Vascular Dementia Three Decades Later. Dement Geriatr Cogn Disord 28:75. https://doi.org/10.1159/000231980\u003c/li\u003e\n\u003cli\u003eTyrovolas S, Lionis C, Zeimbekis A, Bountziouka V, Micheli M, Katsarou A, Papairakleous N, Metallinos G, Makri K, Polychronopoulos E, Panagiotakos DB (2009) Increased body mass and depressive symptomatology are associated with hypercholesterolemia, among elderly individuals; Results from the MEDIS study. Lipids Health Dis 8:1\u0026ndash;7. https://doi.org/10.1186/1476-511X-8-10/TABLES/2\u003c/li\u003e\n\u003cli\u003eStrekalova T, Evans M, Costa-Nunes J, Bachurin S, Yeritsyan N, Couch Y, Steinbusch HMW, K\u0026ouml;hler SE, Lesch KP, Anthony DC (2015) Tlr4 upregulation in the brain accompanies depression- and anxiety-like behaviors induced by a high-cholesterol diet. Brain Behav Immun 48:42\u0026ndash;47. https://doi.org/10.1016/J.BBI.2015.02.015\u003c/li\u003e\n\u003cli\u003eAnstey KJ, Ashby-Mitchell K, Peters R (2017) Updating the Evidence on the Association between Serum Cholesterol and Risk of\u0026amp;nbsp;Late-Life Dementia: Review and\u0026amp;nbsp;Meta-Analysis. Journal of Alzheimer\u0026rsquo;s Disease 56:215\u0026ndash;228. https://doi.org/10.3233/JAD-160826\u003c/li\u003e\n\u003cli\u003eLivingston G, Huntley J, Liu KY, Costafreda SG, Selb\u0026aelig;k G, Alladi S, Ames D, Banerjee S, Burns A, Brayne C, Fox NC, Ferri CP, Gitlin LN, Howard R, Kales HC, Kivim\u0026auml;ki M, Larson EB, Nakasujja N, Rockwood K, Samus Q, Shirai K, Singh-Manoux A, Schneider LS, Walsh S, Yao Y, Sommerlad A, Mukadam N (2024) Dementia prevention, intervention, and care: 2024 report of the Lancet standing Commission. The Lancet 404:572\u0026ndash;628. https://doi.org/10.1016/S0140-6736(24)01296-0\u003c/li\u003e\n\u003cli\u003eAriza M, Cuenca N, Mauri M, Jurado MA, Garolera M (2016) Neuropsychological performance of young familial hypercholesterolemia patients. Eur J Intern Med 34:e29\u0026ndash;e31. https://doi.org/10.1016/j.ejim.2016.05.009\u003c/li\u003e\n\u003cli\u003eZamb\u0026oacute;n D, Quintana M, Mata P, Alonso R, Benavent J, Cruz-S\u0026aacute;nchez F, Gich J, Pocov\u0026iacute; M, Civeira F, Capurro S, Bachman D, Sambamurti K, Nicholas J, Pappolla MA (2010) Higher incidence of mild cognitive impairment in familial hypercholesterolemia. American Journal of Medicine 123:267\u0026ndash;274. https://doi.org/10.1016/j.amjmed.2009.08.015\u003c/li\u003e\n\u003cli\u003eKane JP, Malloy MJ, Ports TA, Phillips NR, Diehl JC, Havel RJ (1990) Regression of Coronary Atherosclerosis During Treatment of Familial Hypercholesterolemia With Combined Drug Regimens. JAMA 264:3007\u0026ndash;3012. https://doi.org/10.1001/JAMA.1990.03450230043027\u003c/li\u003e\n\u003cli\u003eMytilinaiou M, Kyrou I, Khan M, Grammatopoulos DK, Randeva HS (2018) Familial hypercholesterolemia: New horizons for diagnosis and effective management. Front Pharmacol 9:378217. https://doi.org/10.3389/FPHAR.2018.00707/XML\u003c/li\u003e\n\u003cli\u003eEngel DF, de Oliveira J, Lopes JB, Santos DB, Moreira ELG, Farina M, Rodrigues ALS, de Souza Brocardo P, de Bem AF (2016) Is there an association between hypercholesterolemia and depression? Behavioral evidence from the LDLr(-/-) mouse experimental model. Behavioural brain research 311:31\u0026ndash;38. https://doi.org/10.1016/J.BBR.2016.05.029\u003c/li\u003e\n\u003cli\u003eDe Oliveira J, Engel DF, De Paula GC, Dos Santos DB, Lopes JB, Farina M, Moreira ELG, De Bem AF (2020) High Cholesterol Diet Exacerbates Blood-Brain Barrier Disruption in LDLr-/- Mice: Impact on Cognitive Function. Journal of Alzheimer\u0026rsquo;s Disease 78:97\u0026ndash;115. https://doi.org/10.3233/JAD-200541\u003c/li\u003e\n\u003cli\u003ede Oliveira J, Moreira ELG, de Bem AF (2024) Beyond cardiovascular risk: Implications of Familial hypercholesterolemia on cognition and brain function. Ageing Res Rev 93:. https://doi.org/10.1016/J.ARR.2023.102149\u003c/li\u003e\n\u003cli\u003eDe Oliveira J, Moreira ELG, Dos Santos DB, Piermartiri TC, Dutra RC, Pinton S, Tasca CI, Farina M, Prediger RDS, De Bem AF (2014) Increased susceptibility to amyloid-\u0026beta;-induced neurotoxicity in mice lacking the low-density lipoprotein receptor. Journal of Alzheimer\u0026rsquo;s Disease 41:43\u0026ndash;60. https://doi.org/10.3233/JAD-132228\u003c/li\u003e\n\u003cli\u003eRodrigues MS, do Nascimento NB, Farias HR, Schons T, Machado AG, Behenck E, Mesquita A, Krolow Bast R, Budni J, Engblom D, de Bem AF, de Oliveira J (2024) Microglia contribute to cognitive decline in hypercholesterolemic LDLr\u0026minus;/\u0026minus; mice. J Neurochem 168:1565\u0026ndash;1586. https://doi.org/10.1111/jnc.15952\u003c/li\u003e\n\u003cli\u003eJahrling JB, Lin AL, DeRosa N, Hussong SA, Van Skike CE, Girotti M, Javors M, Zhao Q, Maslin LA, Asmis R, Galvan V (2018) mTOR drives cerebral blood flow and memory deficits in LDLR\u0026minus;/\u0026minus; mice modeling atherosclerosis and vascular cognitive impairment. Journal of Cerebral Blood Flow and Metabolism 38:58\u0026ndash;74. https://doi.org/10.1177/0271678X17705973\u003c/li\u003e\n\u003cli\u003eGwinn DM, Shackelford DB, Egan DF, Mihaylova MM, Mery A, Vasquez DS, Turk BE, Shaw RJ (2008) AMPK phosphorylation of raptor mediates a metabolic checkpoint. Mol Cell 30:214\u0026ndash;226. https://doi.org/10.1016/J.MOLCEL.2008.03.003\u003c/li\u003e\n\u003cli\u003eNing J, Clemmons DR (2010) AMP-Activated Protein Kinase Inhibits IGF-I Signaling and Protein Synthesis in Vascular Smooth Muscle Cells via Stimulation of Insulin Receptor Substrate 1 S794 and Tuberous Sclerosis 2 S1345 Phosphorylation. Molecular Endocrinology 24:1218. https://doi.org/10.1210/ME.2009-0474\u003c/li\u003e\n\u003cli\u003eHindupur SK, Gonz\u0026aacute;lez A, Hall MN (2015) The Opposing Actions of Target of Rapamycin and AMP-Activated Protein Kinase in Cell Growth Control. Cold Spring Harb Perspect Biol 7:a019141. https://doi.org/10.1101/CSHPERSPECT.A019141\u003c/li\u003e\n\u003cli\u003eAmin S, Lux A, O\u0026rsquo;Callaghan F (2019) The journey of metformin from glycaemic control to mTOR inhibition and the suppression of tumour growth. Br J Clin Pharmacol 85:37\u0026ndash;46\u003c/li\u003e\n\u003cli\u003eDu R-W, Bu W-G (2020) Metformin improves depressive-like symptoms in mice via inhibition of peripheral and central NF-\u0026kappa;B-NLRP3 inflammation activation. 238:2549\u0026ndash;2556. https://doi.org/10.1007/s00221-020-05911-x\u003c/li\u003e\n\u003cli\u003eRabieipoor S, Zare M, Ettcheto M, Camins A, Javan M (2023) Metformin restores cognitive dysfunction and histopathological deficits in an animal model of sporadic Alzheimer\u0026rsquo;s disease. Heliyon 9:e17873. https://doi.org/10.1016/J.HELIYON.2023.E17873\u003c/li\u003e\n\u003cli\u003eKodali M, Attaluri S, Madhu LN, Shuai B, Upadhya R, Gonzalez JJ, Rao X, Shetty AK (2021) Metformin treatment in late middle age improves cognitive function with alleviation of microglial activation and enhancement of autophagy in the hippocampus. Aging Cell 20:e13277. https://doi.org/10.1111/ACEL.13277\u003c/li\u003e\n\u003cli\u003eSeneviratne A, Cave L, Hyde G, Moestrup SK, Carling D, Mason JC, Haskard DO, Boyle JJ (2020) Metformin directly suppresses atherosclerosis in normoglycaemic mice via haematopoietic adenosine monophosphate-activated protein kinase. Cardiovasc Res 117:1295. https://doi.org/10.1093/CVR/CVAA171\u003c/li\u003e\n\u003cli\u003eFarr SA, Roesler E, Niehoff ML, Roby DA, McKee A, Morley JE (2019) Metformin improves learning and memory in the samp8 mouse model of Alzheimer\u0026rsquo;s disease. Journal of Alzheimer\u0026rsquo;s Disease 68:1699\u0026ndash;1710. https://doi.org/10.3233/JAD-181240\u003c/li\u003e\n\u003cli\u003ePrut L, Belzung C (2003) The open field as a paradigm to measure the effects of drugs on anxiety-like behaviors: A review. Eur J Pharmacol 463:3\u0026ndash;33. https://doi.org/10.1016/S0014-2999(03)01272-X\u003c/li\u003e\n\u003cli\u003eGreco SJ, Bryan KJ, Sarkar S, Zhu X, Smith MA, Wesson Ashford J, Johnston JM, Tezapsidis N, Casadesus G (2010) Leptin Reduces Pathology and Improves Memory in a Transgenic Mouse Model of Alzheimer\u0026rsquo;s Disease. J Alzheimers Dis 19:1155\u0026ndash;1167. https://doi.org/10.3233/JAD-2010-1308\u003c/li\u003e\n\u003cli\u003eAssini FL, Duzzioni M, Takahashi RN (2009) Object location memory in mice: pharmacological validation and further evidence of hippocampal CA1 participation. Behavioural brain research 204:206\u0026ndash;211. https://doi.org/10.1016/J.BBR.2009.06.005\u003c/li\u003e\n\u003cli\u003eSteru L, Chermat R, Thierry B, Simon P (1985) The tail suspension test: a new method for screening antidepressants in mice. Psychopharmacology (Berl) 85:367\u0026ndash;370. https://doi.org/10.1007/BF00428203\u003c/li\u003e\n\u003cli\u003eArcego DM, Krolow R, Lampert C, Toniazzo AP, Berlitz C, Lazzaretti C, Schmitz F, Rodrigues AF, Wyse ATS, Dalmaz C (2016) Early life adversities or high fat diet intake reduce cognitive function and alter BDNF signaling in adult rats: Interplay of these factors changes these effects. International Journal of Developmental Neuroscience 50:16\u0026ndash;25. https://doi.org/10.1016/J.IJDEVNEU.2016.03.001,\u003c/li\u003e\n\u003cli\u003eSantos L, Behrens L, Barbosa C, Tiefensee-Ribeiro C, Rosa-Silva H, Somensi N, Brum PO, Silveira AK, Rodrigues MS, de Oliveira J, Gelain DP, Almeida RF, Moreira JCF (2024) Histone 3 Trimethylation Patterns are Associated with Resilience or Stress Susceptibility in a Rat Model of Major Depression Disorder. Mol Neurobiol 61:5718\u0026ndash;5737. https://doi.org/10.1007/S12035-024-03912-3/METRICS\u003c/li\u003e\n\u003cli\u003eMozaffarian D, Benjamin EJ, Go AS, Arnett DK, Blaha MJ, Cushman M, De Ferranti S, Despr\u0026eacute;s JP, Fullerton HJ, Howard VJ, Huffman MD, Judd SE, Kissela BM, Lackland DT, Lichtman JH, Lisabeth LD, Liu S, Mackey RH, Matchar DB, McGuire DK, Mohler ER, Moy CS, Muntner P, Mussolino ME, Nasir K, Neumar RW, Nichol G, Palaniappan L, Pandey DK, Reeves MJ, Rodriguez CJ, Sorlie PD, Stein J, Towfighi A, Turan TN, Virani SS, Willey JZ, Woo D, Yeh RW, Turner MB (2015) Heart disease and stroke statistics--2015 update: a report from the American Heart Association. Circulation 131:e29\u0026ndash;e39. https://doi.org/10.1161/CIR.0000000000000152\u003c/li\u003e\n\u003cli\u003eAkioyamen LE, Genest J, Shan SD, Reel RL, Albaum JM, Chu A, Tu J V. (2017) Estimating the prevalence of heterozygous familial hypercholesterolaemia: a systematic review and meta-analysis. BMJ Open 7:. https://doi.org/10.1136/BMJOPEN-2017-016461\u003c/li\u003e\n\u003cli\u003eBenito-Vicente A, Uribe KB, Jebari S, Galicia-Garcia U, Ostolaza H, Martin C (2018) Familial Hypercholesterolemia: The Most Frequent Cholesterol Metabolism Disorder Caused Disease. Int J Mol Sci 19:. https://doi.org/10.3390/IJMS19113426\u003c/li\u003e\n\u003cli\u003eThirumangalakudi L, Prakasam A, Zhang R, Bimonte-Nelson H, Sambamurti K, Kindy MS, Bhat NR (2008) High cholesterol-induced neuroinflammation and amyloid precursor protein processing correlate with loss of working memory in mice. J Neurochem 106:475\u0026ndash;485. https://doi.org/10.1111/J.1471-4159.2008.05415.X\u003c/li\u003e\n\u003cli\u003ede Oliveira J, Hort MA, Moreira ELG, Glaser V, Ribeiro-do-Valle RM, Prediger RD, Farina M, Latini A, de Bem AF (2011) Positive correlation between elevated plasma cholesterol levels and cognitive impairments in LDL receptor knockout mice: Relevance of cortico-cerebral mitochondrial dysfunction and oxidative stress. Neuroscience 197:99\u0026ndash;106. https://doi.org/10.1016/j.neuroscience.2011.09.009\u003c/li\u003e\n\u003cli\u003eCampbell JM, Stephenson MD, de Courten B, Chapman I, Bellman SM, Aromataris E (2017) Metformin and Alzheimer\u0026rsquo;s disease, dementia and cognitive impairment: a systematic review protocol. JBI Database System Rev Implement Rep 15:2055\u0026ndash;2059\u003c/li\u003e\n\u003cli\u003eZhou G, Myers R, Li Y, Chen Y, Shen X, Fenyk-Melody J, Wu M, Ventre J, Doebber T, Fujii N, Musi N, Hirshman MF, Goodyear LJ, Moller DE (2001) Role of AMP-activated protein kinase in mechanism of metformin action. Journal of Clinical Investigation 108:1167\u0026ndash;1174. https://doi.org/10.1172/JCI13505\u003c/li\u003e\n\u003cli\u003eGlueck CJ, Fontaine RN, Wang P, Subbiah MTR, Weber K, Illig E, Streicher P, Sieve-Smith L, Tracy TM, Lang JE, McCullough P (2001) Metformin reduces weight, centripetal obesity, insulin, leptin, and low-density lipoprotein cholesterol in nondiabetic, morbidly obese subjects with body mass index greater than 30. Metabolism 50:856\u0026ndash;861. https://doi.org/10.1053/meta.2001.24192\u003c/li\u003e\n\u003cli\u003eXu T, Brandmaier S, Messias AC, Herder C, Draisma HHM, Demirkan A, Yu Z, Ried JS, Haller T, Heier M, Campillos M, Fobo G, Stark R, Holzapfel C, Adam J, Chi S, Rotter M, Panni T, Quante AS, He Y, Prehn C, Roemisch-Margl W, Kastenmuller G, Willemsen G, Pool R, Kasa K, Van Dijk KW, Hankemeier T, Meisinger C, Thorand B, Ruepp A, De Angelis MH, Li Y, Wichmann HE, Stratmann B, Strauch K, Metspalu A, Gieger C, Suhre K, Adamski J, Illig T, Rathmann W, Roden M, Peters A, Van Duijn CM, Boomsma DI, Meitinger T, Wang-Sattler R (2015) Effects of metformin on metabolite profiles and LDL cholesterol in patients with type 2 diabetes. Diabetes Care 38:1858\u0026ndash;1867. https://doi.org/10.2337/dc15-0658\u003c/li\u003e\n\u003cli\u003ePetrie JR, Chaturvedi N, Ford I, Hramiak I, Hughes AD, Jenkins AJ, E. Klein B, Klein R, Ooi TC, Rossing P, Sattar N, Stehouwer CDA, Colhoun HM, Kean S, Thomson E, Gillespie L, Gibb J, Greenlaw N, Hramiak I, Keech A, Chaturvedi N, Hughes A, March K, Coady E, Tillin T, Bots M, Klein R, Klein B, Dreyer J, Jan T, Meuer S, Murach D, Sheffy K, Lusky R, Peleg S, Colhoun H, Shore A, Carty D, Donnan P, Witham M, Adler A, Lonn E, Rauchhaus P, Hramiak I, Lindsay R, Brouwers M, Van-Melckebeke J, Gillespie L, Hamill T, Cuthbertson L, Murray A, Jolly L, Miller E, Hair J, Bell A, Carmichael S, Douglas E, Surtees P, Dinnett E, Allan J, Kean S, Watson C, McLaughlin M, Brindley G, Smillie E, Motherwell D, MacDonald S, Ellis P, Stuart D, Travers M, Brearley S, Greig L, Haw J (2017) Metformin in adults with type 1 diabetes: Design and methods of REducing with MetfOrmin Vascular Adverse Lesions (REMOVAL): An international multicentre trial. Diabetes Obes Metab 19:509\u0026ndash;516. https://doi.org/10.1111/DOM.12840\u003c/li\u003e\n\u003cli\u003eWang CP, Lorenzo C, Habib SL, Jo B, Espinoza SE (2017) Differential effects of metformin on age related comorbidities in older men with type 2 diabetes. J Diabetes Complications 31:679\u0026ndash;686. https://doi.org/10.1016/J.JDIACOMP.2017.01.013\u003c/li\u003e\n\u003cli\u003eSeifarth C, Schehler B, Schneider HJ (2013) Effectiveness of metformin on weight loss in non-diabetic individuals with obesity. Exp Clin Endocrinol Diabetes 121:27\u0026ndash;31. https://doi.org/10.1055/S-0032-1327734\u003c/li\u003e\n\u003cli\u003eWulffel\u0026eacute; MG, Kooy A, De Zeeuw D, Stehouwer CDA, Gansevoort RT (2004) The effect of metformin on blood pressure, plasma cholesterol and triglycerides in type 2 diabetes mellitus: A systematic review. J Intern Med 256:1\u0026ndash;14. https://doi.org/10.1111/J.1365-2796.2004.01328.X\u003c/li\u003e\n\u003cli\u003eAsai A, Shuto Y, Nagao M, Kawahara M, Miyazawa T, Sugihara H, Oikawa S (2019) Metformin Attenuates Early-Stage Atherosclerosis in Mildly Hyperglycemic Oikawa-Nagao Mice. J Atheroscler Thromb 26:1075\u0026ndash;1083. https://doi.org/10.5551/JAT.48223\u003c/li\u003e\n\u003cli\u003eSung JY, Kim SG, Park SY, Kim JR, Choi HC (2024) Telomere stabilization by metformin mitigates the progression of atherosclerosis via the AMPK-dependent p-PGC-1\u0026alpha; pathway. Experimental \u0026amp; Molecular Medicine 2024 56:9 56:1967\u0026ndash;1979. https://doi.org/10.1038/s12276-024-01297-w\u003c/li\u003e\n\u003cli\u003eYan N, Wang L, Li Y, Wang T, Yang L, Yan R, Wang H, Jia S (2021) Metformin intervention ameliorates AS in ApoE-/- mice through restoring gut dysbiosis and anti-inflammation. PLoS One 16:e0254321. https://doi.org/10.1371/JOURNAL.PONE.0254321\u003c/li\u003e\n\u003cli\u003eChen X, Wang S, Xu W, Zhao M, Zhang Y, Xiao H (2023) Metformin Directly Binds to MMP-9 to Improve Plaque Stability. J Cardiovasc Dev Dis 10:54. https://doi.org/10.3390/JCDD10020054/S1\u003c/li\u003e\n\u003cli\u003eWu H, Feng K, Zhang C, Zhang H, Zhang J, Hua Y, Dong Z, Zhu Y, Yang S, Ma C (2021) Metformin attenuates atherosclerosis and plaque vulnerability by upregulating KLF2-mediated autophagy in apoE\u0026minus;/- mice. Biochem Biophys Res Commun 557:334\u0026ndash;341. https://doi.org/10.1016/J.BBRC.2021.04.029\u003c/li\u003e\n\u003cli\u003eLuo F, Guo Y, Ruan GY, Long JK, Zheng XL, Xia Q, Zhao SP, Peng DQ, Fang ZF, Li XP (2017) Combined use of metformin and atorvastatin attenuates atherosclerosis in rabbits fed a high-cholesterol diet. Sci Rep 7:. https://doi.org/10.1038/S41598-017-02080-W\u003c/li\u003e\n\u003cli\u003eAllard JS, Perez EJ, Fukui K, Carpenter P, Ingram DK, Cabo R de (2015) Prolonged metformin treatment leads to reduced transcription of Nrf2 and neurotrophic factors without cognitive impairment in older C57BL/6J mice. Behavioural brain research 301:1. https://doi.org/10.1016/J.BBR.2015.12.012\u003c/li\u003e\n\u003cli\u003eChen F, Dong RR, Zhong KL, Ghosh A, Tang SS, Long Y, Hu M, Miao MX, Liao JM, Sun HB, Kong LY, Hong H (2016) Antidiabetic drugs restore abnormal transport of amyloid-\u0026beta; across the blood\u0026ndash;brain barrier and memory impairment in db/db mice. Neuropharmacology 101:123\u0026ndash;136. https://doi.org/10.1016/J.NEUROPHARM.2015.07.023\u003c/li\u003e\n\u003cli\u003ePintana H, Apaijai N, Pratchayasakul W, Chattipakorn N, Chattipakorn SC (2012) Effects of metformin on learning and memory behaviors and brain mitochondrial functions in high fat diet induced insulin resistant rats. Life Sci 91:409\u0026ndash;414. https://doi.org/10.1016/J.LFS.2012.08.017\u003c/li\u003e\n\u003cli\u003eRodrigues MS, de Paula GC, Duarte MB, de Rezende VL, Possato JC, Farias HR, Medeiros EB, Feuser PE, Streck EL, de \u0026Aacute;vila RAM, Bast RKSS, Budni J, de Bem AF, Silveira PCL, de Oliveira J (2021) Nanotechnology as a therapeutic strategy to prevent neuropsychomotor alterations associated with hypercholesterolemia. Colloids Surf B Biointerfaces 201:. https://doi.org/10.1016/j.colsurfb.2021.111608\u003c/li\u003e\n\u003cli\u003eGuo M, Mi J, Jiang QM, Xu JM, Tang YY, Tian G, Wang B (2014) Metformin may produce antidepressant effects through improvement of cognitive function among depressed patients with diabetes mellitus. Clin Exp Pharmacol Physiol 41:650\u0026ndash;656. https://doi.org/10.1111/1440-1681.12265\u003c/li\u003e\n\u003cli\u003eZemdegs J, Martin H, Pintana H, Bullich S, Manta S, Marqu\u0026eacute;s MA, Moro C, Laye S, Ducrocq F, Chattipakorn N, Chattipakorn SC, Rampon C, P\u0026eacute;nicaud L, Fioramonti X, Guiard BP (2019) Metformin Promotes Anxiolytic and Antidepressant-Like Responses in Insulin-Resistant Mice by Decreasing Circulating Branched-Chain Amino Acids. The Journal of Neuroscience 39:5935. https://doi.org/10.1523/JNEUROSCI.2904-18.2019\u003c/li\u003e\n\u003cli\u003ede Bem AF, Krolow R, Farias HR, de Rezende VL, Gelain DP, Moreira JCF, Duarte JM das N, de Oliveira J (2021) Animal Models of Metabolic Disorders in the Study of Neurodegenerative Diseases: An Overview. Front Neurosci 14:604150. https://doi.org/10.3389/FNINS.2020.604150/XML\u003c/li\u003e\n\u003cli\u003eHarries LW, Bradley-Smith RM, Llewellyn DJ, Pilling LC, Fellows A, Henley W, Hernandez D, Guralnik JM, Bandinelli S, Singleton A, Ferrucci L, Melzer D (2012) Leukocyte CCR2 Expression Is Associated with Mini-Mental State Examination Score in Older Adults. https://home.liebertpub.com/rej 15:395\u0026ndash;404. https://doi.org/10.1089/REJ.2011.1302\u003c/li\u003e\n\u003cli\u003eSolfrizzi V, D\u0026rsquo;Introno A, Colacicco AM, Capurso C, Todarello O, Pellicani V, Capurso SA, Pietrarossa G, Santamato V, Capurso A, Panza F (2006) Circulating biomarkers of cognitive decline and dementia. Clinica Chimica Acta 364:91\u0026ndash;112. https://doi.org/10.1016/J.CCA.2005.06.015\u003c/li\u003e\n\u003cli\u003eWestin K, Buchhave P, Nielsen H, Minthon L, Janciauskiene S, Hansson O (2012) CCL2 Is Associated with a Faster Rate of Cognitive Decline during Early Stages of Alzheimer\u0026rsquo;s Disease. PLoS One 7:e30525. https://doi.org/10.1371/JOURNAL.PONE.0030525\u003c/li\u003e\n\u003cli\u003eGarcez ML, Mina F, Bellettini-Santos T, Carneiro FG, Luz AP, Schiavo GL, Andrighetti MS, Scheid MG, Bolfe RP, Budni J (2017) Minocycline reduces inflammatory parameters in the brain structures and serum and reverses memory impairment caused by the administration of amyloid \u0026beta; (1-42) in mice. Prog Neuropsychopharmacol Biol Psychiatry 77:23\u0026ndash;31. https://doi.org/10.1016/J.PNPBP.2017.03.010\u003c/li\u003e\n\u003cli\u003eLima Garcez M, Mina F, Bellettini-Santos T, Pereira da Luz A, Luis Schiavo G, Matias Carollo Macieski J, Behenck Medeiros E, Oliveira Marques A, Quadros Magnus N, Budni J (2019) The Involvement of NLRP3 on the Effects of Minocycline in an AD-Like Pathology Induced by \u0026beta;-Amyloid Oligomers Administered to Mice. https://doi.org/10.1007/s12035-018-1211-9\u003c/li\u003e\n\u003cli\u003eSparks DL, Kuo YM, Roher A, Martin T, Lukas RJ (2000) Alterations of Alzheimer\u0026rsquo;s disease in the cholesterol-fed rabbit, including vascular inflammation. Preliminary observations. Ann N Y Acad Sci 903:335\u0026ndash;344. https://doi.org/10.1111/J.1749-6632.2000.TB06384.X,\u003c/li\u003e\n\u003cli\u003eStreit WJ, Sparks DL (1997) Activation of microglia in the brains of humans with heart disease and hypercholesterolemic rabbits. J Mol Med (Berl) 75:130\u0026ndash;138. https://doi.org/10.1007/S001090050097\u003c/li\u003e\n\u003cli\u003eKaye S, Gold A, Lin D, Chen M, Zhu J, Gao J (2025) Hypercholesterolemia drives microglial dysfunction and weakens response to amyloid plaques. Exp Neurol 390:. https://doi.org/10.1016/j.expneurol.2025.115272\u003c/li\u003e\n\u003cli\u003eLian H, Yang L, Cole A, Sun L, Chiang ACA, Fowler SW, Shim DJ, Rodriguez-Rivera J, Taglialatela G, Jankowsky JL, Lu HC, Zheng H (2015) NF\u0026kappa;B-activated astroglial release of complement C3 compromises neuronal morphology and function associated with Alzheimer\u0026rsquo;s disease. Neuron 85:101\u0026ndash;115. https://doi.org/10.1016/J.NEURON.2014.11.018\u003c/li\u003e\n\u003cli\u003eMorales I, Guzm\u0026aacute;n-Mart\u0026iacute;nez L, Cerda-Troncoso C, Far\u0026iacute;as GA, Maccioni RB (2014) Neuroinflammation in the pathogenesis of Alzheimer\u0026rsquo;s disease. A rational framework for the search of novel therapeutic approaches. Front Cell Neurosci 8:. https://doi.org/10.3389/FNCEL.2014.00112\u003c/li\u003e\n\u003cli\u003eChen YL, Wang LM, Chen Y, Gao JY, Marshall C, Cai ZY, Hu G, Xiao M (2016) Changes in astrocyte functional markers and \u0026beta;-amyloid metabolism-related proteins in the early stages of hypercholesterolemia. Neuroscience 316:178\u0026ndash;191. https://doi.org/10.1016/J.NEUROSCIENCE.2015.12.039\u003c/li\u003e\n\u003cli\u003ePhillips EC, Croft CL, Kurbatskaya K, O\u0026rsquo;Neill MJ, Hutton ML, Hanger DP, Garwood CJ, Noble W (2014) Astrocytes and neuroinflammation in Alzheimer\u0026rsquo;s disease. Biochem Soc Trans 42:1321\u0026ndash;1325. https://doi.org/10.1042/BST20140155\u003c/li\u003e\n\u003cli\u003eHol EM, Pekny M (2015) Glial fibrillary acidic protein (GFAP) and the astrocyte intermediate filament system in diseases of the central nervous system. Curr Opin Cell Biol 32:121\u0026ndash;130. https://doi.org/10.1016/J.CEB.2015.02.004\u003c/li\u003e\n\u003cli\u003eDe Oliveira WH, De Santana Nunes AK, De Fran\u0026ccedil;a MER, Dos Santos LA, L\u0026oacute;s DB, Rocha SWS, De Sousa Barbosa KP, Rodrigues GB, Peixoto CA (2016) Effects of metformin on inflammation and short-term memory in streptozotocin-induced diabetic mice. Brain Res 1644:149\u0026ndash;160. https://doi.org/10.1016/J.BRAINRES.2016.05.013\u003c/li\u003e\n\u003cli\u003eOliveira WH, Braga CF, L\u0026oacute;s DB, Ara\u0026uacute;jo SMR, Fran\u0026ccedil;a MER, Duarte-Silva E, Rodrigues GB, Rocha SWS, Peixoto CA (2021) Metformin prevents p-tau and amyloid plaque deposition and memory impairment in diabetic mice. Exp Brain Res 239:2821\u0026ndash;2839. https://doi.org/10.1007/S00221-021-06176-8/FIGURES/13\u003c/li\u003e\n\u003cli\u003eMendon\u0026ccedil;a IP, Paiva IHR de, Duarte-Silva EP, Melo MG de, Silva RS da, Oliveira WH de, Costa BL da SA da, Peixoto CA (2022) Metformin and fluoxetine improve depressive-like behavior in a murine model of Parkinsońs disease through the modulation of neuroinflammation, neurogenesis and neuroplasticity. Int Immunopharmacol 102:108415. https://doi.org/10.1016/J.INTIMP.2021.108415\u003c/li\u003e\n\u003cli\u003eSabzali M, Eidi A, Khaksari M, Khastar H (2022) Anti-inflammatory, Antioxidant, and Antiapoptotic Action of Metformin Attenuates Ethanol Neurotoxicity in the Animal Model of Fetal Alcohol Spectrum Disorders. Neurotox Res 40:605\u0026ndash;613. https://doi.org/10.1007/S12640-022-00499-2/FIGURES/5\u003c/li\u003e\n\u003cli\u003eBachiller S, Jim\u0026eacute;nez-Ferrer I, Paulus A, Yang Y, Swanberg M, Deierborg T, Boza-Serrano A (2018) Microglia in Neurological Diseases: A Road Map to Brain-Disease Dependent-Inflammatory Response. Front Cell Neurosci 12:. https://doi.org/10.3389/FNCEL.2018.00488\u003c/li\u003e\n\u003cli\u003ePaolicelli RC, Bisht K, Tremblay M\u0026Egrave; (2014) Fractalkine regulation of microglial physiology and consequences on the brain and behavior. Front Cell Neurosci 8:. https://doi.org/10.3389/FNCEL.2014.00129\u003c/li\u003e\n\u003cli\u003ePaolicelli RC, Sierra A, Stevens B, Tremblay ME, Aguzzi A, Ajami B, Amit I, Audinat E, Bechmann I, Bennett M, Bennett F, Bessis A, Biber K, Bilbo S, Blurton-Jones M, Boddeke E, Brites D, Br\u0026ocirc;ne B, Brown GC, Butovsky O, Carson MJ, Castellano B, Colonna M, Cowley SA, Cunningham C, Davalos D, De Jager PL, de Strooper B, Denes A, Eggen BJL, Eyo U, Galea E, Garel S, Ginhoux F, Glass CK, Gokce O, Gomez-Nicola D, Gonz\u0026aacute;lez B, Gordon S, Graeber MB, Greenhalgh AD, Gressens P, Greter M, Gutmann DH, Haass C, Heneka MT, Heppner FL, Hong S, Hume DA, Jung S, Kettenmann H, Kipnis J, Koyama R, Lemke G, Lynch M, Majewska A, Malcangio M, Malm T, Mancuso R, Masuda T, Matteoli M, McColl BW, Miron VE, Molofsky AV, Monje M, Mracsko E, Nadjar A, Neher JJ, Neniskyte U, Neumann H, Noda M, Peng B, Peri F, Perry VH, Popovich PG, Pridans C, Priller J, Prinz M, Ragozzino D, Ransohoff RM, Salter MW, Schaefer A, Schafer DP, Schwartz M, Simons M, Smith CJ, Streit WJ, Tay TL, Tsai LH, Verkhratsky A, von Bernhardi R, Wake H, Wittamer V, Wolf SA, Wu LJ, Wyss-Coray T (2022) Microglia states and nomenclature: A field at its crossroads. Neuron 110:3458\u0026ndash;3483\u003c/li\u003e\n\u003cli\u003eGuzman-Martinez L, Maccioni RB, Andrade V, Navarrete LP, Pastor MG, Ramos-Escobar N (2019) Neuroinflammation as a common feature of neurodegenerative disorders. Front Pharmacol 10:1008. https://doi.org/10.3389/FPHAR.2019.01008/BIBTEX\u003c/li\u003e\n\u003cli\u003eMa X, Xiao W, Li H, Pang P, Xue F, Wan L, Pei L, Yan H (2021) Metformin restores hippocampal neurogenesis and learning and memory via regulating gut microbiota in the obese mouse model. Brain Behav Immun 95:68\u0026ndash;83. https://doi.org/10.1016/J.BBI.2021.02.011\u003c/li\u003e\n\u003cli\u003eWang Y, Wang Z, Yang H, Chen S, Zheng D, Liu X, Jiang Q, Chen Y (2022) Metformin Ameliorates Chronic Colitis-Related Intestinal Fibrosis via Inhibiting TGF-\u0026beta;1/Smad3 Signaling. Front Pharmacol 13:. https://doi.org/10.3389/fphar.2022.887497\u003c/li\u003e\n\u003cli\u003eXiao Q, Xiao J, Liu J, Liu J, Shu G, Yin G (2022) Metformin suppresses the growth of colorectal cancer by targeting INHBA to inhibit TGF-\u0026beta;/PI3K/AKT signaling transduction. Cell Death Dis 13:202. https://doi.org/10.1038/S41419-022-04649-4\u003c/li\u003e\n\u003cli\u003eChen X, Levy JM, Hou A, Winters C, Azzam R, Sousa AA, Leapman RD, Nicoll RA, Reese TS (2015) PSD-95 family MAGUKs are essential for anchoring AMPA and NMDA receptor complexes at the postsynaptic density. Proc Natl Acad Sci U S A 112:E6983\u0026ndash;E6992. https://doi.org/10.1073/PNAS.1517045112/-/DCSUPPLEMENTAL\u003c/li\u003e\n\u003cli\u003eQin Z, Zhou C, Xiao X, Guo C (2021) Metformin attenuates sepsis-induced neuronal injury and cognitive impairment. BMC Neurosci 22:1\u0026ndash;10. https://doi.org/10.1186/S12868-021-00683-8/FIGURES/6\u003c/li\u003e\n\u003cli\u003eWang YL, Zhao JH, Guo FL, Gao XH, Xie X, Liu SQ, Yang X, Yang XF, Zhang LY, Ye YX, Fan LB, Wang JG (2020) Metformin Ameliorates Synaptic Defects in a Mouse Model of AD by Inhibiting Cdk5 Activity. Front Cell Neurosci 14:. https://doi.org/10.3389/FNCEL.2020.00170,\u003c/li\u003e\n\u003cli\u003eCho SY, Kim EW, Park SJ, Phillips BU, Jeong J, Kim H, Heath CJ, Kim D, Jang Y, L\u0026oacute;pez-Cruz L, Saksida LM, Bussey TJ, Lee DY, Kim E (2024) Reconsidering repurposing: long-term metformin treatment impairs cognition in Alzheimer\u0026rsquo;s model mice. Transl Psychiatry 14:. https://doi.org/10.1038/S41398-024-02755-9,\u003c/li\u003e\n\u003cli\u003eWu Q, Jia XY, Zhang SH, Wu YZ, Xu LS, Han JG, Yu W, Zhou QH (2025) Metformin activates the PI3K/AKT/BDNF axis to attenuate postoperative cognitive dysfunction. Neuropharmacology 265:. https://doi.org/10.1016/j.neuropharm.2024.110262\u003c/li\u003e\n\u003cli\u003eFang W, Zhang J, Hong L, Huang W, Dai X, Ye Q, Chen X (2020) Metformin ameliorates stress-induced depression-like behaviors via enhancing the expression of BDNF by activating AMPK/CREB-mediated histone acetylation. J Affect Disord 260:302\u0026ndash;313. https://doi.org/10.1016/j.jad.2019.09.013\u003c/li\u003e\n\u003cli\u003eMoiseeva O, Desch\u0026ecirc;nes-Simard X, St-Germain E, Igelmann S, Huot G, Cadar AE, Bourdeau V, Pollak MN, Ferbeyre G (2013) Metformin inhibits the senescence-associated secretory phenotype by interfering with IKK/NF-\u0026kappa;B activation. Aging Cell 12:489\u0026ndash;498. https://doi.org/10.1111/ACEL.12075\u003c/li\u003e\n\u003cli\u003eHalloran J, Hussong SA, Burbank R, Podlutskaya N, Fischer KE, Sloane LB, Austad SN, Strong R, Richardson A, Hart MJ, Galvan V (2012) Chronic inhibition of mTOR by rapamycin modulates cognitive and non-cognitive components of behavior throughout lifespan in mice. Neuroscience 223:102. https://doi.org/10.1016/J.NEUROSCIENCE.2012.06.054\u003c/li\u003e\n\u003cli\u003eSpilman P, Podlutskaya N, Hart MJ, Debnath J, Gorostiza O, Bredesen D, Richardson A, Strong R, Galvan V (2010) Inhibition of mTOR by rapamycin abolishes cognitive deficits and reduces amyloid-\u0026beta; levels in a mouse model of alzheimer\u0026rsquo;s disease. PLoS One 5:. https://doi.org/10.1371/journal.pone.0009979\u003c/li\u003e\n\u003cli\u003eVan Skike CE, Hussong SA, Hernandez SF, Banh AQ, DeRosa N, Galvan V (2021) MTOR attenuation with rapamycin reverses neurovascular uncoupling and memory deficits in mice modeling alzheimer\u0026rsquo;s Disease. Journal of Neuroscience 41:4305\u0026ndash;4320. https://doi.org/10.1523/JNEUROSCI.2144-20.2021,\u003c/li\u003e\n\u003cli\u003eKalender A, Selvaraj A, Kim SY, Gulati P, Br\u0026ucirc;l\u0026eacute; S, Viollet B, Kemp BE, Bardeesy N, Dennis P, Schlager JJ, Marette A, Kozma SC, Thomas G (2010) Metformin, independent of AMPK, inhibits mTORC1 in a rag GTPase-dependent manner. Cell Metab 11:390\u0026ndash;401. https://doi.org/10.1016/j.cmet.2010.03.014\u003c/li\u003e\n\u003cli\u003eBarzilai N, Crandall JP, Kritchevsky SB, Espeland MA (2016) Metformin as a Tool to Target Aging. Cell Metab 23:1060\u0026ndash;1065. https://doi.org/10.1016/J.CMET.2016.05.011\u003c/li\u003e\n\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"neurochemical-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"nere","sideBox":"Learn more about [Neurochemical Research](https://www.springer.com/journal/11064)","snPcode":"11064","submissionUrl":"https://submission.nature.com/new-submission/11064/3","title":"Neurochemical Research","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Familial hypercholesterolemia, Metformin, LDLr−/− mice, Behavioral alterations, Astrocytes","lastPublishedDoi":"10.21203/rs.3.rs-7436605/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7436605/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eFamilial hypercholesterolemia (FH), caused by mutations in the low-density lipoprotein receptor (LDLr) gene, has been increasingly associated with brain alterations characteristic of neurodegenerative and mood disorders. Studies with LDLR knockout mice (LDLr\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e) showed that neuroinflammation is a key event in FH-related brain dysfunction. As mTOR inhibition can attenuate these alterations in this model, we hypothesized that metformin, a drug known to modulate mTOR signaling via AMPK activation, could mitigate FH-associated brain changes. To test this, adult LDLr\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice received daily oral doses of metformin (200 mg/Kg) or vehicle for 30 days. During the final week, behavioral assessments were conducted, including the open-field test (locomotor activity), novel object recognition and object reallocation tasks (memory), and the tail suspension test (depressive-like behavior). Body weight and metabolic parameters, including cholesterol and glucose plasma levels, were analyzed. The mice\u0026rsquo;s hippocampal astrocyte and microglial density, and gene expression related to neuroinflammation and synaptic plasticity were evaluated. Metformin did not alter total cholesterol levels but significantly improved cognitive performance and reduced depressive-like behavior. Notably, metformin treatment attenuated hippocampal astrogliosis without affecting microglial reactivity. Molecular analysis revealed a downregulation of genes related to neuroinflammation and an upregulation of genes associated with synaptic plasticity after metformin treatment. Accompanying these neuroprotective effects, a trend toward reduced levels of the phosphorylated-to-total mTOR ratio was observed. Overall, metformin improved memory function and astrocyte reactivity in LDLr\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice, effects that were independent of cholesterol reduction, suggesting its potential as a therapeutic strategy for FH-associated brain dysfunction.\u003c/p\u003e","manuscriptTitle":"Effects of Metformin on Metabolic Profile, Cognitive Function, and Neuroinflammation in LDLr⁻/⁻ Mice","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-04 09:15:44","doi":"10.21203/rs.3.rs-7436605/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-10-28T00:47:07+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-10-04T10:48:43+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-10-02T13:58:02+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"119037617338894215349871259457442489101","date":"2025-09-04T05:03:43+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"63567232950810970894232007248159994432","date":"2025-09-04T05:01:14+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-08-28T12:14:24+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-08-27T16:47:01+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-08-23T05:52:46+00:00","index":"","fulltext":""},{"type":"submitted","content":"Neurochemical Research","date":"2025-08-22T17:35:57+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"neurochemical-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"nere","sideBox":"Learn more about [Neurochemical Research](https://www.springer.com/journal/11064)","snPcode":"11064","submissionUrl":"https://submission.nature.com/new-submission/11064/3","title":"Neurochemical Research","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"7501379d-661d-407f-8ad1-72e968f42a37","owner":[],"postedDate":"September 4th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-01-26T16:06:03+00:00","versionOfRecord":{"articleIdentity":"rs-7436605","link":"https://doi.org/10.1007/s11064-025-04658-7","journal":{"identity":"neurochemical-research","isVorOnly":false,"title":"Neurochemical Research"},"publishedOn":"2026-01-24 15:58:44","publishedOnDateReadable":"January 24th, 2026"},"versionCreatedAt":"2025-09-04 09:15:44","video":"","vorDoi":"10.1007/s11064-025-04658-7","vorDoiUrl":"https://doi.org/10.1007/s11064-025-04658-7","workflowStages":[]},"version":"v1","identity":"rs-7436605","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7436605","identity":"rs-7436605","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.