Molecular characterization and functional analysis of Peptidoglycan recognition protein-L2 in Hexagrammos otakii

Molecular characterization and functional analysis of Peptidoglycan recognition protein-L2 in Hexagrammos otakii | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Molecular characterization and functional analysis of Peptidoglycan recognition protein-L2 in Hexagrammos otakii Yifan Bai, Yingying Liu This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4223167/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Peptidoglycan recognition proteins (PGRPs) belong to the pattern recognition receptors (PRRs), which are essential for sensing and defending against pathogenic microorganisms during innate immunity pathways. Although an increasing body of research indicates that the PGRP protein in fish has various biological functions such as antimicrobial activity, amidase activity, and the ability to regulate multiple signaling pathways, the molecular mechanisms by which PGRP contributes to the innate immune processes in fish remain relatively limited. In the present study, we have recombinantly expressed a long-type PGRP from fat greenling ( Hexagrammos otakii ) (HoPGRP-L2) and analyzed its molecular mechanism in the pathogen identification process. The open reading frame (ORF) of HoPGRP-L2 is 1449 bp in length that encodes for a peptide with 482 amino acids. As a PRR, HoPGRP-L2 has a typical PGRP domain that enables HoPGRP-L2 to recognize and conjugate to bacterial peptidoglycan (PGN) on the cell wall. We demonstrated that HoPGRP-L2 could bind to pathogenic microorganisms and promote the agglutination of them. Furthermore, HoPGRP-L2 was confirmed to possess zinc ion-dependent amidase activity and exhibited an effect on the growth inhibition of chosen bacteria. HoPGRP-L2 also prolongs the survival time in carp injected with Aeromonas hydrophila . Taken together, our results indicate that PGRP acts as a PRR involved in recognizing and eliminating pathogens during the innate immune response in Hexagrammos otakii . Hexagrammos otakii Peptidoglycan recognition protein (PGRP) Immune response Amidase activity Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 1. Introduction Although specific immunity has evolved, innate immunity continues to play a greater role in the immunization process for fish (Saurabh & Sahoo, 2008 ; Yang et al., 2019 ). As highly conserved molecular structures common on the surface of pathogenic microorganisms, pathogen-associated molecular patterns (PAMPs) are critical targets to be recognized by the innate immune system of fish. In this process, it is the conserved PRR that exerts specific recognition of PAMPs. PRRs, including lectin, Gram-negative bacterial-binding proteins (GNBPs), scavenger receptors (SRs), and PGRPs, are highly conserved germline-encoded genes that recognize PAMPs specifically through different structures on which they can induce a rapid immune response (Lu et al., 2020 ; Wei et al., 2018 ). As members of the PRRs, PGRPs can specifically recognize PGN, which functions as a direct target for innate immune receptors, commonly with a peptidoglycan-binding domain consisting of approximately 165 amino acids (Dziarski, 2004 ; C. Liu, Xu, Gupta, & Dziarski, 2001 ; Sharma et al., 2011 ; Wolf & Underhill, 2018 ). Concerning the size of the relative molecular mass, PGRPs can be broken into the categories of L-type (above 90 kDa, with transmembrane and intracellular domains) and S-type (usually below 25 kDa, generally small extracellular secretory proteins with signal peptides) (Royet, Gupta, & Dziarski, 2011 ). Their sequence shares a similarity of 30% with bacteriophage T7 lysozyme and are highly evolutionarily conserved (Guan & Mariuzza, 2007 ), homologous to N-acetylcytidylic acid-alanine amidase. Notably, PGRP has a Zn 2+ binding site consisting of four amino acid residues, which enables it to eradicate invading pathogens greatly enhanced by the action of Zn 2+ (Hou et al., 2023 ; Yang et al., 2019 ). However, studies in insects have shown that not all PGRPs have amidase activity. PGRPs with amidase activity that have IMD pathway regulation secretion, while those PGRPs that do not exhibit amidase activity act mainly through the Toll pathway (Kurata, 2010 ; Maillet, Bischoff, Vignal, Hoffmann, & Royet, 2008 ; Q. Wang et al., 2021 ; Zaidman-Remy et al., 2006 ). The situation is the same in mammals, PGLYRP1-4 have only antimicrobial activity, except for PGLYPR2 with nicotinamide and antimicrobial activity (Z. M. Wang et al., 2003 ). In general, PGRPs are involved in the immune process of different organisms in several forms and play an important role such as recognizing pathogenic bacteria and degrading their peptidoglycans, promoting phagocytosis, and participating in the regulation of Toll and IMD signaling pathways (Kim, Byun, & Oh, 2003 ; Lemaitre & Hoffmann, 2007 ; Leulier et al., 2003 ; Werner et al., 2000 ). Although about many PGRPs have been identified in teleost fish such as zebrafish ( Danio rerio ) (Chang & Nie, 2008 ), greater amberjack ( Pseudosciaena crocea ) (Mao, Wang, Zhang, Ding, & Su, 2010 ), rainbow trout ( Oncorhynchus mykiss ) (Jang, Kim, & Cho, 2017 ) and American redfish ( Sciaenops ocellatus ) (M. F. Li, Zhang, Wang, & Sun, 2012 ), the molecular mechanisms through which the family exerts its immune effects are still needed to be studied in more detail. Fish PGRP2, homologous to mammalian PGLYRP2, has had numerous functions successively confirmed across various species in recent years (Sun et al., 2014 ). PGRP2 from Ctenopharyngodon idella was characterized as having the ability to specifically bind PGN and possessing an amidase activity (J. H. Li, Chang, Xue, & Nie, 2013 ). PGRP2 from Oncorhynchus mykiss was demonstrated to modulate the body's inflammatory response by reducing NF-κB activity during bacterial infection (Choi et al., 2018 ). In Lateolabrax maculatus , Ssb-PGRP-L2 expressed bactericidal effects on Vibrio harveyi , Staphylococcus aureus , and Edwardsiella tarda (X. Li et al., 2020 ). However, the exact function and molecular mechanism of fish PGRP2 in the course of innate immunity remain ambiguous and require extensive research. In the present research, we have recombinantly expressed and purified a long-type PGRP from fat greenling, a major economic fish in the Yellow Sea and Bohai Sea of China. To investigate the role of HoPGRP-L2 in the process of Hexagrammos otakii innate immunity and its molecular mechanism, we performed a PGN binding assay, pathogen binding assay, and agglutination assay of HoPGRP-L2. In addition, we also investigated the inhibitory effect of HoPGRP-L2 on the growth of the pathogenic bacterium Aeromonas hydrophila in vitro, and these data may be of interest to further understanding the role of fish PGRP-L2 in the innate immune process. 2. Materials and methods 2.1. Fish selection and tissue sampling The fish was purchased from a fish farm in Weihai, Shandong province of China, with body weights ranging from 140 g to 180 g, lengths from 22 cm to 28 cm, and general ages from 5 to 8 months. The fish were kept in seawater at 21 ℃ before tissue extraction for two weeks, and the healthy individuals were sampled, excluding those that were injured or diseased. 2.2. Total RNA extraction and cDNA synthesis Total RNA extraction was performed under the instructions of the RNA extraction kit (Sangong Company, China). Using the extracted 5 µg RNA as template, Smart F and Oligo anchor R as primers (Table 1 ), the first strand of cDNA was synthesized by the method of SMART cDNA (BD Biosciences Clontech) and then stored at -20°C. Table 1 Primers for HoPGRP-L2 cloning and expression Name Sequence(5'-3') Smart F TACGGCTGCGAGAAGACGACAGAAGGG Oligo anchor R GACCACGCGTATCGATGTCGACTV HoPGRP-L2 F TACTCAGAATTCTACTGAAATAAACCTGAC HoPGRP-L2 R TACTCACTCGAG ACCCTTGTGAAGTCCCTT 5′ Primer TACGGCTGCGAGAAGACGACAGAA 3′ anchor R GACCACGCGTATCGATGTCGAC 2.3. Cloning and bioinformatics analysis of HoPGRP-L2. As per the corresponding Expressed Sequence Tag (EST) sequences obtained by random sequencing of the fish cDNA library in our laboratory, a pair of specific primers were designed. And then the full-length cDNA sequence of HoPGRPL2 gene was obtained by the method of rapid amplification of the cDNA ends (RACE), using the specific primer HoPGRP-L2 F and 3′ anchor R at the 3' end, HoPGRP-L2 R and 5′ Primer at the 5' end (Table 1 ). For sequence similarity analysis of HoPGRP-L2, NCBI's BLASTP ( http://www.ncbi.nlm.nih.gov/ ) was applied. Gene translation was performed with Expasy ( http://www.au.expasy.org/ ). The SMART online program ( https://smart.embl-heidelberg.de/ ) was employed to reveal protein functional domains. Furthermore, the neighbor-joining phylogenetic tree was constructed by MEGA 7.0 software with a bootstrap value of 5000. 2.4. Recombinant expression and purification of HoPGRP-L2 The cDNA fragments encoding the mature peptide, N-terminal domain, and C-terminal domain of HoPGRP-L2 were amplified by specific primers. Then we cloned these fragments into the pET30a (+) plasmid. The recombinant plasmids were sequenced by Sangon Company (Shanghai, China) and transferred into E. coli Rosetta (DE3) cells. The induction was carried out at 37 ℃ under shaking incubation for 4 hours by adding the appropriate amount of Isopropyl beta-D-thiogalacyranoside (IPTG) to the bacterial solution at 1:300. Then the protein concentration was determined according to the method of the Bradford Portein Assay Kit (Sangon, China). 2.5. Preparation of polyclonal antibody and western blotting analysis Antiserum was obtained by injecting purified proteins into rats according to the previous method (Shi, Zhao, & Wang, 2008 ). In the first week, purified recombinant protein was mixed 1:1 with complete Freund's adjuvant until it was fully emulsified, and 200 µg of protein per kilogram of body weight was injected subcutaneously at multiple points on the back of the rats. In the fourth and fifth weeks, the complete Freund's adjuvant was replaced with incomplete Freund's adjuvant, and HoPGRP-L2 was injected as before. Finally, 200 µg of protein mixed with 500 µl of incomplete Freund's adjuvant was injected intramuscularly. After all injections, serum was collected by orbital blood sampling method, and serum antibody specificity was quantified by an enzyme-linked immunosorbent assay (ELISA) method. 2.6. Polysaccharide binding ability assay of HoPGRP-L2 We conducted binding tests of three different polysaccharide-based PAMs, LPS (Lipopolysaccharide), PGN (Lys type, from Bacillus subtilis sigma), and LTA (Lipophosphatidic acid), using the ELISA method as described previously (Wei et al., 2018 ). Briefly, polysaccharide was diluted to 80 µg per milliliter, 50 µl of which was added to each well of a 96-well plate and incubated at 37°C overnight. The next day, the 96-well plate was fixed at 60°C for 30 min, and 200 µl of 5% skim milk powder diluted in phosphate buffered saline (PBS) was added to each well for 2-hour blocking. After washing 4 times with PBST solution(1 L PBS with 1 mL 20% Tween 80), 100 µl of recombinant HoPGRP-L2 containing 1% skim milk powder in PBS buffer was added to each well and incubated at 25°C for 3 h. The negative control used BSA instead of HoPGRP-L2. After washing 4 times, 100 µl of HoPGRP-L2 antibody (1:300 diluted in 1% skim milk powder) was added and incubated at room temperature for two hours. After three washes, peroxidase-conjugated goat anti-rabbit IgG (1:3000 diluted 1% skim milk powder) was added and incubated for another 2 hours. We also established an independent experiment to investigate the effect of zinc ions on the ability of HoPGRP-L2 to bind polysaccharides. Protein concentration was adjusted to 175 µg/mL, 1 µl of 5 mM ZnCl 2 solution was added to the experimental group before incubation, and the rest of the steps remained unchanged. Finally, the chromogenic reactions were performed with EL-TMB Chromogenic Reagent Kits (Sangon Company, China), and the absorbance values of the samples at 450 nm were measured using an enzyme marker. 2.7. Bacterial binding capacity assay of HoPGRP-L2 Following the previous method, we tested the binding ability of HoPGRP-L2 to eight bacteria including four Gram-positive bacteria ( Bacillus subtilis , Micrococcus lysodeikticus, Bacillus megaterium , Staphylococcus aureus ) and four Gram-negative bacteria (Vibrio harvey, Vibrio eelii , Vibrio Parahaemolyticus, Aeromonas hydrophila ) as follow steps (Y. Y. Liu et al., 2021 ). In brief, overnight cultures were transferred to new liquid medium 1:100 and incubated on the shaker for about 3.5 h. After centrifugation at 6000 rpm for 5 min, re-suspend 2 times with tris buffered saline (TBS) and dilute to 8*10 8 cells/mL. After that, 500 µl of bacteria were mixed with purified protein (1 mg/mL, 100 µl) and shaken gently for 1h at 37°C. Microorganisms were washed 4 times with TBS and then subjected to elution with 7% SDS for 1 min by strong agitation. Subsequently, the bacterial precipitate was washed twice with TBS. Finally, the washings were subjected to 12.5% SDS-PAGE electrophoresis with the wash buffer, elution, and the bacterial cells. The result was detected by western blot with specific antiserum against HoPGRP-L2. 2.8. Microbial agglutination assay of HoPGRP-L2 Eight kinds of bacteria used in the bacteria binding assay were also selected for this test as described previously (Choi et al., 2018 ). Microorganisms in the logarithmic phase were resuspended with TBS to 3*10 6 CFU/mL. In the system of 50 µl in a 96-well plate, 25 µl of recombinant HoPGRP-L2 protein and 25 µl of diluted bacterial solution were added as the positive control, while the negative control was made with TBS instead of HoPGRP-L2 incubated with the bacterial solution. In addition, an additional 0.5 µl of 5 mM ZnCl 2 was added to the same system, together with a set of blank controls in which 0.5 µl of 5 mM EDTA was added. All the assays were performed in triplicate. 2.9. Amidase activity assay of HoPGRP-L2 The ability of HoPGRP-L2 to hydrolyze peptidoglycan was analyzed by the previously report with modifications (Hu, Cao, Guo, & Li, 2020 ). We dissolved the experimental peptidoglycan by sonication and adjusted its concentration to 0.5 mg/mL. After that 25 µL PGN (lys type, from Bacillus subtilis sigma) and 25 µL HoPGRP-L2 (1.0 mg/mL) were added to a 96-well plate with 0.5 µL Tris buffer (20 mM Tris-HCl, 150 mM NaCl, pH 8.0), and for the negative control, 25 µL of PGN and 25 µL Tris buffer were added. Subsequently, 25 µL of PGN, 25 µL HoPGRP-L2 and 0.5 µL Tris-ZnCl 2 buffer (20 mM Tris-HCl, 150 mM NaCl, 10 mM ZnCl 2 , pH 8.0) were added to another 96-well plate, while an addition of 25 µL of PGN and 25 µL of Tris buffer with 0.5 µL Tris -ZnCl 2 buffer were added in the control group. Each group was designed with 3 replicates. 2.10. Bacterial inhibition assay of HoPGRP-L2 Our antibacterial experiments followed the method described by Xia Li et al. with adaptations (X. Li et al., 2020 ). The experimental bacteria were shaken to be revived overnight. The next day, the bacteria were cultured in a logarithmic phase at a ratio of 1:100 and the bacterial solution was diluted by 100 times upon 200 µL of a bacterial solution, 6000 rpm centrifugation for 5min, and two resuspensions with TBS. The test group was incubated with 10 µl of bacterial solution and 25 µl of protein, while the control group was incubated with the bacteria with appropriate TBS instead of protein, adding appropriate TBS to reach 50 ml. The zinc ion-enhanced group was added with 10 µl of the bacterial solution, 25 µl of protein, and another 0.5 µl of 5 mM ZnCl 2 solution, whereas its control group was supplemented by 0.5 µl of ZnCl 2 solution without protein, and finally replenished 50 µl with appropriate TBS for all EP tubes. The mixtures were incubated at room temperature for 5 hours and then at 37°C overnight upon addition of 1 mL of LB liquid medium. The following day, the samples were spotted on 96-well plates, and the absorbance value of each well at 620 nm was measured with an enzyme marker no less than three times. 2.11 In vivo antibacterial assay of HoPGRP-L2 Carp (5–6 cm in length) were kept in aerated freshwater for 2 weeks, then divided into three separate groups and the individuals in good health were selected for the experiment. Briefly, 35 fish were injected with 50 µl of HoPGRP-L2 and 50 µl of Aeromonas hydrophila in PBS dilution. After that, the OD was adjusted to 0.3. Another 35 fish were injected with pET30a (+) empty carrier protein for HoPGRP-L2 instead of HoPGRP-L2 and adjust the OD to the same value. The blank control was injected with 100 µl of PBS buffer. The number of deaths was observed every hour after injection. 3. Results 3.1. Sequence analysis of HoPGPR-L2 As shown in Fig. 1, the full-length cDNA sequence of HoPGRP-L2 was 1449 bp. By Expasy analysis, the molecular weight of the protein encoded by this gene was about 53.51 kDa with a theoretical isoelectric point of 6.70. The ami-2 domain was predicted by SMART to be present at amino acids 326 to 467, and proteins containing this domain included zinc amidases that display N-acetylmuramoyl-L-alanine amidase activity. We also predicted the signal peptide to be present at the N-terminal amino acids 1 to 21 on SignalP. By BLASTing the HoPGRP-L2 sequence with other sequences in the NCBI database, we discovered a high similarity to the amino acid sequence of PGRP-L2 with several species (Fig. 2). 3.2. Recombinant expression and preparation of HoPGRP-L2 antibody To further investigate the function of HoPGRP-L2, we inserted its mature peptide, N-terminal domain and C-terminal domain into the pET30a vector. Only HoPGRP-L2 was successfully expressed in E. coli Rosetta (DE3), and the molecular weight of the recombinant protein with a 5.7 kDa of His-tag was about 57 kDa by SDS-PAGE electrophoresis, as expected. The concentration of recombinant protein was determined to be 1.4 mg/mL by the Bradford method of standard curve plotting. The purified protein was used to produce polyclonal antibodies using rabbits as commonly described. The results of the western blot assay showed that the antiserum could recognize both recombinant protein and native protein in the fat greenling. 3.3. Polysaccharide binding assay of HoPGRP-L2 It was discovered that HoPGRP-L2 could bind not only the Gram-positive PAMPs PGN and LTA but also showed such dose-dependent binding for LPS, which is the main component of the cell wall of Gram-negative bacteria. Moreover, from the results, the affinity of this protein for LPS was lower than that of PGN and LTA. In addition, we found that HoPGRP-L2 hydrolyzes PGN in the presence of Zn 2+ , thus reducing the binding for PGN, while this effect is absent for LTA and LPS. 3.4. Bacterial binding assay of HoPGRP-L2 In bacterial binding experiments, eight microorganisms including Gram-negative and Gram-positive bacteria were cultured. After several washes as well as strong elution with 7% SDS, the results of western blot showed that HoPGRP-L2 could bind all experimental bacteria, and there was a discrepancy in the binding ability for Gram-positive and Gram-negative bacteria. 3.5. Bacterial agglutination promotion assay of HoPGRP-L2 HoPGRP-L2 can agglutinate all experimental bacteria, and the agglutination time for Gram-positive bacteria is shorter than that for Gram-negative bacteria. In the experimental group with EDTA, we noted that HoPGRP-L2 still had significant pro-agglutination activity, indicating that the pro-agglutination function of this protein is independent of zinc ions, but may be regulated by Zn 2+ . Figure 5 Bacterial agglutination assay of HoPGRP-L2. 3.6. Amidase activity assay of HoPGRP-L2 In the peptidoglycan hydrolysis experiments, only the samples to which both PGRP and zinc ions were added showed a significant decrease in absorbance values. HoPGRP-L2 did not have a significant ability to hydrolyze peptidoglycan in the absence of added zinc ions, suggesting that its amidase activity is dependent on zinc ions. 3.7. Bacterial inhibition assay of HoPGRP-L2 Although zinc ions may have an inhibitory effect on bacterial growth, the bacteria in the test tubes to which only zinc ions were added did not show a significant growth decline because the amount of zinc ions in the solution was very low.. It was observed that recombinant HoPGRP-L2 could considerably inhibit the growth of Bacillus subtilis , Bacillus megaterium , Micrococcus luteus , and Aeromonas hydrophila in the presence of Zn 2+ , but this effect cannot be achieved in the absence of Zn 2+ . 3.8. In vivo antibacterial assay of HoPGRP-L2 Among carp infected with A. hydrophila , the number of deaths in the group injected with HoPGRP-L2 at the identical time was significantly lower than that of the negative control. The control and experimental groups exhibited over half of their cumulative deaths at the 6th and 10th hours post-injection, respectively, indicating the involvement of HoPGRP-L2 in the immune response of carp to pathogenic bacteria. Figure 8 The in vivo inhibition experiments of HoPGRP-L2, all have been subtracted blank control Date were expressed as mean ± SE, with * indicating p < 0.05. 4. Discussion In the present study, a PGRP gene named HoPGRP-L2 was identified from fat greenling. In the course of innate immunity, HoPGRP-L2 could serve as an excellent model for understanding the mechanisms of host-pathogen interactions. Sequence analysis reveals that HoPGRP-L2 possesses a signal peptide and lacks a transmembrane structural domain, suggesting its potential role as a secretory protein. But not all PGRPs are secretory proteins, such as grass carp PGRP5 which is localized in the cytoplasm of CIK cells (J. H. Li et al., 2013 ). As the bacterial cell wall component, peptidoglycan is a prime example of a conserved PAMP for which the innate immune system has evolved sensing mechanisms (Wolf & Underhill, 2018 ). Previous reports have shown that the transcript levels of Eco-PGRP-L1 and Eco-PGRP-L2 are significantly increased after stimulation by PGN in head-kidney leukocytes of orange-spotted grouper (Hou et al., 2023 ). Similarly, it has been shown that the expression of PGRP2 and its variants is up-regulated in grass carp after the injection of PGN (Jin, Li, Li, & Nie, 2022 ). Moreover, the majority of PGRPs can interact directly with PGN. For example, RSgPGRP-S1 in Solen grandis can bind both Lys-type PGN and Dap-type PGN, but it is unable to bind LPS and β-glucan (J. H. Li et al., 2013 ; Wei et al., 2018 ). HoPGRP-L2 exhibited a dose-dependent binding capacity for PGN and it demonstrated a stronger binding capacity for PGN than for LTA and LPS. In addition, the binding ability of HoPGRP-L2 to both Gram-positive and Gram-negative bacteria was confirmed using western-blot method, and it was inferred that the binding ability of HoPGRP-L2 to pathogenic bacteria is based on recognition of PAMPs such as PGN. These results suggest that HoPGRP-L2 may play an essential part in recognizing PGN and regulating the PGN-induced immune response. Ami-2 domain is present at amino acids 326–427 of HoPGRP-L2, and this structure is predicted to be a zinc-dependent N-acetylmuramoyl-L-alanine amidase. Amidase activity, which functions as scavengers in the innate immune process, is of great importance to HoPGRP-L2 in the immune response for the recognition of pathogenic PAMPs and the execution of PGN (Mellroth, Karlsson, & Steiner, 2003 ; Zaidman-Remy et al., 2006 ). The amidase activity depends on a Zn 2+ binding site which consists of two histidines, one tyrosine and one cysteine (Hu et al., 2020 ). In the present study, HoPGRP-L2 was shown to possess a Zn 2+ -binding domain that can hydrolyze PGN in the presence of Zn 2+ . This suggests that HoPGRP-L2 may function importantly in the immune response associated with PGN and that its function is dependent on Zn 2+ . Some PGRPs showed agglutinating activity towards both Gram-negative and Gram-positive bacteria, and the effect is regulated by Zn 2+ (Jang et al., 2017 ; Wei et al., 2018 ). Although HoPGRP-L2 was shown be able to promote the agglutination of a variety of pathogenic bacteria, this effect was not significantly diminished by the addition of EDTA. The antibacterial activity of PGRP has been demonstrated both in vivo by blocking bacterial infection and in vitro by directly interacting with pathogenic bacteria. It has been demonstrated in previous studies that the expression of PGRP6 is significantly increased after Aeromonas hydrophila treatment of carp (Yang et al., 2019 ). Similarly, SoPGLYRP-2 caused a significant reduction in the number of bacteria recovered intracellularly from lymphocytes infected with Streptococcus iniae. In in vitro assays, several PGRPs such as rSoPGLYRP-2 and rSoPGLYRP-AD in Sciaenops ocellatus and rSgPGRP-S1 in Solen grandis were shown to have amidase activity and bactericidal activity, and all of them required zinc as a cofactor (M. F. Li et al., 2012 ). This research showed that HoPGRP-L2 significantly restrained the growth of Bacillus subtilis , Bacillus megaterium , Micrococcus luteus and Aeromonas hydrophila in the presence of Zn 2+ , but no or insignificant inhibitory effect was observed without Zn 2+ . In addition, HoPGRP-L2 prolongs the survival time in carp infected by A. hydrophila . This effect of HoPGRP-L2 suggests that this protein can recognize and remove pathogenic bacteria in the course of the immune response, and this function is dependent on Zn 2+ , probably because the amidase activity of HoPGRP-L2 is activated only in the presence of Zn 2+ , which can hydrolyze the bacterial cell wall and subsequently kill pathogenic bacteria. In conclusion, this investigation demonstrated that HoPGRP-L2, which depends on a conserved substrate binding site, plays an important role in pathogen recognition during ontogenesis of the immune response. HoPGRP-L2 can bind a variety of PAMPs and pathogenic bacteria, promote agglutination of pathogenic bacteria, and hydrolyze PGN in the presence of zinc ions. In addition, this study demonstrated that HoPGRP-L2 can directly inhibit the growth of a variety of pathogenic bacteria such as Bacillus subtilis and Bacillus megaterium , and prolong the survival time of carp infected with A. hydrophila . These mechanisms are zinc ion-dependent, in the sense that HoPGRP-L2 activities such as bacteriostatic and amidase are not prominently expressed in the absence of zinc ions, whereas the effect is particularly evident when zinc ions are added to the system. These results support the role of HoPGRP-L2 in host immune defense against bacterial infections. Declarations Author Contributions Yifan Bai: Methodology, Investigation, Software, Data curation, Writing– original draft. Yingying Liu: Investigation, Software, Data curation, Conceptualization, Supervision, Writing – review & editing. Funding This work was supported by the Natural Science Foundation of Shandong Province, China (ZR2016CP10). Data Availability Data will be made available on request. Code availability Not applicable. Ethics statement All experimental procedures of this study were in line with the animal ethics committee of Shandong University and the Department of Central Lab, Weihai Municipal Hospital (No.2023002). Competing Interest The authors declare no competing interests. References Chang, M. X., & Nie, P. (2008). RNAi suppression of zebrafish peptidoglycan recognition protein 6 (zfPGRP6) mediated differentially expressed genes involved in Toll-like receptor signaling pathway and caused increased susceptibility to Flavobacterium columnare . Veterinary Immunology and Immunopathology, 124 (3–4), 295–301. doi: 10.1016/j.vetimm.2008.04.003 Choi, K. M., Joo, M. S., Cho, D. H., Bae, J. S., Jeong, J. M., Woo, W. S.,.. . Park, C. I. (2018). Molecular characterization, expression and functional analysis of peptidoglycan recognition protein-SC2 from rock bream, Oplegnathus fasciatus . Fish & Shellfish Immunology, 77 , 286–293. doi: 10.1016/j.fsi.2018.04.006 Dziarski, R. (2004). Peptidoglycan recognition proteins (PGRPs). Molecular Immunology, 40 (12), 877–886. doi: 10.1016/j.molimm.2003.10.011 Guan, R. J., & Mariuzza, R. A. (2007). Peptidoglycan recognition proteins of the innate immune system. Trends in Microbiology, 15 (3), 127–134. doi: 10.1016/j.tim.2007.01.006 Hou, J., Hao, W., Li, M. C., Gan, Z., Chen, S. N., Lu, Y. S., & Xia, L. Q. (2023). Identification and characterization of two long-type peptidoglycan recognition proteins, PGRP-L1 and PGRP-L2, in the orange-spotted grouper, Epinephelus coioides . Fish & Shellfish Immunology, 134 , 108580–108588. doi: 10.1016/j.fsi.2023.108580 Hu, Z. G., Cao, X. B., Guo, M., & Li, C. H. (2020). Identification and characterization of a novel short-type peptidoglycan recognition protein in Apostichopus japonicus . Fish & Shellfish Immunology, 99 , 257–266. doi: 10.1016/j.fsi.2020.02.013 Jang, J. H., Kim, H., & Cho, J. H. (2017). Molecular cloning and functional characterization of peptidoglycan recognition protein OmPGRP-L2 from the rainbow trout, Oncorhynchus mykiss . Veterinary Immunology and Immunopathology, 192 , 28–32. doi: 10.1016/j.vetimm.2017.09.004 Jin, Y., Li, L., Li, J. H., & Nie, P. (2022). Identification of PGRP2 and its three splice variants in grass carp Ctenopharyngodon idella . Fish & Shellfish Immunology, 127 , 933–938. doi: 10.1016/j.fsi.2022.07.042 Kim, M. S., Byun, M. J., & Oh, B. H. (2003). Crystal structure of peptidoglycan recognition protein LB from Drosophila melanogaster . Nature Immunology, 4 (8), 787–793. doi: 10.1038/ni952 Kurata, S. (2010). Extracellular and intracellular pathogen recognition by Drosophila PGRP-LE and PGRP-LC. International Immunology, 22 (3), 143–148. doi: 10.1093/intimm/dxp128 Lemaitre, B., & Hoffmann, J. (2007). The host defense of Drosophila melanogaster . Annual Review of Immunology, 25 , 697–743. doi: 10.1146/annurev.immunol.25.022106.141615 Leulier, F., Parquet, C., Pili-Floury, S., Ryu, J. H., Caroff, M., Lee, W. J.,.. . Lemaitre, B. (2003). The Drosophila immune system detects bacteria through specific peptidoglycan recognition. Nature Immunology, 4 (5), 478–484. doi: 10.1038/ni922 Li, J. H., Chang, M. X., Xue, N. N., & Nie, R. (2013). Functional characterization of a short peptidoglycan recognition protein, PGRP5 in grass carp Ctenopharyngodon idella . Fish & Shellfish Immunology, 35 (2), 221–230. doi: 10.1016/j.fsi.2013.04.025 Li, M. F., Zhang, M., Wang, C. L., & Sun, L. (2012). A peptidoglycan recognition protein from Sciaenops ocellatus is a zinc amidase and a bactericide with a substrate range limited to Gram-positive bacteria. Fish & Shellfish Immunology, 32 (2), 322–330. doi: 10.1016/j.fsi.2011.11.024 Li, X., Yuan, S. Y., Sun, Z. S., Lei, L. N., Wan, S., Wang, J. Y.,.. . Gao, Q. (2020). Gene identification and functional analysis of peptidoglycan recognition protein from the spotted sea bass ( Lateolabrax maculatus ). Fish & Shellfish Immunology, 106 , 1014–1024. doi: 10.1016/j.fsi.2020.08.041 Liu, C., Xu, Z. J., Gupta, D., & Dziarski, R. (2001). Peptidoglycan recognition proteins - A novel family of four human innate immunity pattern recognition molecules. Journal of Biological Chemistry, 276 (37), 34686–34694. doi: 10.1074/jbc.M105566200 Liu, Y. Y., Zha, H. D., Han, X. D., Yu, S. S., Chai, Y. M., Zhong, J. M., & Zhu, Q. (2021). Molecular characterization and functional analysis of the bactericidal permeability-increasing protein/LPS-binding protein (BPI/LBP) from roughskin sculpin ( Trachidermus fasciatus ). Developmental and Comparative Immunology, 123 , 104133–104142. doi: 10.1016/j.dci.2021.104133 Lu, Y. Z., Su, F. H., Li, Q. L., Zhang, J., Li, Y. J., Tang, T.,.. . Yu, X. Q. (2020). Pattern recognition receptors in Drosophila immune responses. Developmental and Comparative Immunology, 102 , 103468–103477. doi: 10.1016/j.dci.2019.103468 Maillet, F., Bischoff, V., Vignal, C., Hoffmann, J., & Royet, J. (2008). The Drosophila peptidoglycan recognition protein PGRP-LF blocks PGRP-LC and IMD/JNK pathway activation. Cell Host & Microbe, 3 (5), 293–303. doi: 10.1016/j.chom.2008.04.002 Mao, Y., Wang, J., Zhang, Z. W., Ding, S. X., & Su, Y. Q. (2010). Cloning, mRNA expression, and recombinant expression of peptidoglycan recognition protein II gene from large yellow croaker ( Pseudosciaena crocea ). Molecular Biology Reports, 37 (8), 3897–3908. doi: 10.1007/s11033-010-0046-x Mellroth, P., Karlsson, J., & Steiner, H. (2003). A scavenger function for a Drosophila peptidoglycan recognition protein. Journal of Biological Chemistry, 278 (9), 7059–7064. doi: 10.1074/jbc.M208900200 Royet, J., Gupta, D., & Dziarski, R. (2011). Peptidoglycan recognition proteins: modulators of the microbiome and inflammation. Nature Reviews Immunology, 11 (12), 837–851. doi: 10.1038/nri3089 Saurabh, S., & Sahoo, P. K. (2008). Lysozyme: an important defence molecule of fish innate immune system. Aquaculture Research, 39 (3), 223–239. doi: 10.1111/j.1365-2109.2007.01883.x Sharma, P., Dube, D., Sinha, M., Kaur, P., Sharma, S., & Singh, T. P. (2011). Structural basis of recognition of pathogen-associated molecular patterns by pgrp-s. Acta Crystallographica a-Foundation and Advances, 67 , C546-C546. doi: 10.1107/s0108767311086193 Shi, X. Z., Zhao, X. F., & Wang, J. X. (2008). Molecular cloning and expression analysis of chymotrypsin-like serine protease from the Chinese shrimp, Fenneropenaeus chinensis . Fish & Shellfish Immunology, 25 (5), 589–597. doi: 10.1016/j.fsi.2008.07.011 Sun, L. Y., Liu, S. K., Wang, R. J., Li, C., Zhang, J. R., & Liu, Z. J. (2014). Pathogen recognition receptors in channel catfish: IV. Identification, phylogeny and expression analysis of peptidoglycan recognition proteins. Developmental and Comparative Immunology, 46 (2), 291–299. doi: 10.1016/j.dci.2014.04.018 Wang, Q., Wang, J. Y., Ren, M. J., Ma, S. S., Liu, X. Y., Chen, K. P., & Xia, H. C. (2021). Peptidoglycan recognition protein-S1 acts as a receptor to activate AMP expression through the IMD pathway in the silkworm Bombyx mori . Developmental and Comparative Immunology, 115 , 103903–103912. doi: 10.1016/j.dci.2020.103903 Wang, Z. M., Li, X. N., Cocklin, R. R., Wang, M. H., Wang, M., Fukase, K.,.. . Dziarski, R. (2003). Human peptidoglycan recognition protein-L is an N -acetylmuramoyl-L-alanine amidase. Journal of Biological Chemistry, 278 (49), 49044–49052. doi: 10.1074/jbc.M307758200 Wei, X. M., Yang, D. L., Li, H. Y., Zhao, T. Y., Jiang, H. L., Liu, X. Q., & Yang, J. L. (2018). Peptidoglycan recognition protein of Solen grandis (SgPGRP-S1) mediates immune recognition and bacteria clearance. Fish & Shellfish Immunology, 73 , 30–36. doi: 10.1016/j.fsi.2017.12.001 Werner, T., Liu, G., Kang, D., Ekengren, S., Steiner, H., & Hultmark, D. (2000). A family of peptidoglycan recognition proteins in the fruit fly Drosophila melanogaster . Proceedings of the National Academy of Sciences of the United States of America, 97 (25), 13772–13777. doi: 10.1073/pnas.97.25.13772 Wolf, A. J., & Underhill, D. M. (2018). Peptidoglycan recognition by the innate immune system. Nature Reviews Immunology, 18 (4), 243–254. doi: 10.1038/nri.2017.136 Yang, D., Han, Y., Liu, Y., Cao, R., Wang, Q., Dong, Z.,.. . Zhao, J. (2019). A peptidoglycan recognition protein involved in immune recognition and immune defenses in Ruditapes philippinarum . Fish & Shellfish Immunology, 88 , 441–448. doi: 10.1016/j.fsi.2019.03.017 Zaidman-Remy, A., Herve, M., Poidevin, M., Pili-Floury, S., Kim, M. S., Blanot, D.,.. . Lemaitre, B. (2006). The Drosophila amidase PGRP-LB modulates the immune response to bacterial infection. Immunity, 24 (4), 463–473. doi: 10.1016/j.immuni.2006.02.012 Additional Declarations No competing interests reported. Supplementary Files Supplementarymaterials.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4223167","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":289851509,"identity":"2a02a3b3-e156-4d8d-b6ab-806fff9d23d1","order_by":0,"name":"Yifan Bai","email":"","orcid":"","institution":"Shandong University (Weihai)","correspondingAuthor":false,"prefix":"","firstName":"Yifan","middleName":"","lastName":"Bai","suffix":""},{"id":289851510,"identity":"bfd40595-c1e0-4491-9058-7b57063fbe83","order_by":1,"name":"Yingying Liu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA70lEQVRIiWNgGAWjYBACPmYgkcDAwMPP39j4gIGNAcLFB9igWuQkZxxuNiBOC5Q2NmhIb5MgTgs7j5nEwx21iRsYDrZV/ig7zMDPnmPA8HMHPocBtSSeOZ64nbmx7TbPucMMkj1vDBh7zxDS0nYscWfDwbbbjG2HGQxu5BgwM7YRoWXDgcS2wp9ALfZEaqkxNgBqYeAF2SJBUAtbsUVi2wFgIB9sluY5l84jceZZwcFePFr4+Q9vvPmzrQ4Yle0PP/4os5bjb0/e+OAnHi1AwCLBwHAYzuMBEQfwamBgYP7AwFBHQM0oGAWjYBSMaAAAQS9PizwwFH0AAAAASUVORK5CYII=","orcid":"","institution":"Shandong University (Weihai)","correspondingAuthor":true,"prefix":"","firstName":"Yingying","middleName":"","lastName":"Liu","suffix":""}],"badges":[],"createdAt":"2024-04-05 13:01:12","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4223167/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4223167/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":54729049,"identity":"f409d36e-255d-4b6d-b399-c164be95e7b2","added_by":"auto","created_at":"2024-04-15 21:07:13","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":400991,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"HoPGRPL2figs1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4223167/v1/0dc80a6e3fbc7e9da826620f.jpg"},{"id":54729047,"identity":"267ccd25-055e-4ccd-bbb6-a82e51f4e796","added_by":"auto","created_at":"2024-04-15 21:07:13","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":342530,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"HoPGRPL2figs2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4223167/v1/7338091e95a87c089c261528.jpg"},{"id":54729044,"identity":"0edfe7ca-2f14-4c9b-b45d-0e7da30f8b72","added_by":"auto","created_at":"2024-04-15 21:07:13","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":359039,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"HoPGRPL2figs3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4223167/v1/7eefe6ff86fb93bb6633b63f.jpg"},{"id":54729046,"identity":"ba7299eb-3d3b-4752-8d4b-cfc4f86158ce","added_by":"auto","created_at":"2024-04-15 21:07:13","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":251854,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"HoPGRPL2figs4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4223167/v1/0f5749893b0db7e08b9a63c5.jpg"},{"id":54729052,"identity":"95c3c11a-0f0d-4e80-b051-2e7d1ffaedf1","added_by":"auto","created_at":"2024-04-15 21:07:13","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":294271,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"HoPGRPL2figs5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4223167/v1/973ef8dec9dda2e69bd17ae7.jpg"},{"id":54729294,"identity":"5293f425-c4c4-4187-815a-0ef04a12afc1","added_by":"auto","created_at":"2024-04-15 21:15:13","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":270935,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"HoPGRPL2figs6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4223167/v1/388515eb5cd195d1e26b4973.jpg"},{"id":54729051,"identity":"4bff5543-e7b5-44de-b3ba-ca44de6f066b","added_by":"auto","created_at":"2024-04-15 21:07:13","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":297172,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"HoPGRPL2figs7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4223167/v1/6d67498f8d81a4cf451c31cf.jpg"},{"id":54729048,"identity":"fa8ca10d-80fd-4239-b058-d801d565895a","added_by":"auto","created_at":"2024-04-15 21:07:13","extension":"jpg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":256227,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"HoPGRPL2figs8.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4223167/v1/4fe878cf30a809ce5aa6e5e3.jpg"},{"id":55469269,"identity":"05404dc6-dc77-40db-bc4c-1eb5045c9429","added_by":"auto","created_at":"2024-04-28 19:51:44","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1054878,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4223167/v1/2001ec7b-9717-4854-9931-a5ccf857a8c3.pdf"},{"id":54729295,"identity":"58a2807c-fec1-43fc-8274-af19c560f1ce","added_by":"auto","created_at":"2024-04-15 21:15:13","extension":"docx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":282017,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementarymaterials.docx","url":"https://assets-eu.researchsquare.com/files/rs-4223167/v1/ef13ac23ff153226f8e07e79.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Molecular characterization and functional analysis of Peptidoglycan recognition protein-L2 in Hexagrammos otakii","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eAlthough specific immunity has evolved, innate immunity continues to play a greater role in the immunization process for fish (Saurabh \u0026amp; Sahoo, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Yang et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). As highly conserved molecular structures common on the surface of pathogenic microorganisms, pathogen-associated molecular patterns (PAMPs) are critical targets to be recognized by the innate immune system of fish. In this process, it is the conserved PRR that exerts specific recognition of PAMPs. PRRs, including lectin, Gram-negative bacterial-binding proteins (GNBPs), scavenger receptors (SRs), and PGRPs, are highly conserved germline-encoded genes that recognize PAMPs specifically through different structures on which they can induce a rapid immune response (Lu et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Wei et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2018\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAs members of the PRRs, PGRPs can specifically recognize PGN, which functions as a direct target for innate immune receptors, commonly with a peptidoglycan-binding domain consisting of approximately 165 amino acids (Dziarski, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; C. Liu, Xu, Gupta, \u0026amp; Dziarski, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Sharma et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Wolf \u0026amp; Underhill, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Concerning the size of the relative molecular mass, PGRPs can be broken into the categories of L-type (above 90 kDa, with transmembrane and intracellular domains) and S-type (usually below 25 kDa, generally small extracellular secretory proteins with signal peptides) (Royet, Gupta, \u0026amp; Dziarski, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Their sequence shares a similarity of 30% with bacteriophage T7 lysozyme and are highly evolutionarily conserved (Guan \u0026amp; Mariuzza, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2007\u003c/span\u003e), homologous to N-acetylcytidylic acid-alanine amidase. Notably, PGRP has a Zn\u003csup\u003e2+\u003c/sup\u003e binding site consisting of four amino acid residues, which enables it to eradicate invading pathogens greatly enhanced by the action of Zn\u003csup\u003e2+\u003c/sup\u003e (Hou et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Yang et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). However, studies in insects have shown that not all PGRPs have amidase activity. PGRPs with amidase activity that have IMD pathway regulation secretion, while those PGRPs that do not exhibit amidase activity act mainly through the Toll pathway (Kurata, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Maillet, Bischoff, Vignal, Hoffmann, \u0026amp; Royet, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Q. Wang et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Zaidman-Remy et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). The situation is the same in mammals, PGLYRP1-4 have only antimicrobial activity, except for PGLYPR2 with nicotinamide and antimicrobial activity (Z. M. Wang et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2003\u003c/span\u003e). In general, PGRPs are involved in the immune process of different organisms in several forms and play an important role such as recognizing pathogenic bacteria and degrading their peptidoglycans, promoting phagocytosis, and participating in the regulation of Toll and IMD signaling pathways (Kim, Byun, \u0026amp; Oh, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Lemaitre \u0026amp; Hoffmann, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Leulier et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Werner et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2000\u003c/span\u003e). Although about many PGRPs have been identified in teleost fish such as zebrafish (\u003cem\u003eDanio rerio\u003c/em\u003e) (Chang \u0026amp; Nie, \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2008\u003c/span\u003e), greater amberjack (\u003cem\u003ePseudosciaena crocea\u003c/em\u003e) (Mao, Wang, Zhang, Ding, \u0026amp; Su, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2010\u003c/span\u003e), rainbow trout (\u003cem\u003eOncorhynchus mykiss\u003c/em\u003e) (Jang, Kim, \u0026amp; Cho, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) and American redfish (\u003cem\u003eSciaenops ocellatus\u003c/em\u003e) (M. F. Li, Zhang, Wang, \u0026amp; Sun, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2012\u003c/span\u003e), the molecular mechanisms through which the family exerts its immune effects are still needed to be studied in more detail. Fish PGRP2, homologous to mammalian PGLYRP2, has had numerous functions successively confirmed across various species in recent years (Sun et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). PGRP2 from \u003cem\u003eCtenopharyngodon idella\u003c/em\u003e was characterized as having the ability to specifically bind PGN and possessing an amidase activity (J. H. Li, Chang, Xue, \u0026amp; Nie, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). PGRP2 from \u003cem\u003eOncorhynchus mykiss\u003c/em\u003e was demonstrated to modulate the body's inflammatory response by reducing NF-κB activity during bacterial infection (Choi et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). In \u003cem\u003eLateolabrax maculatus\u003c/em\u003e, Ssb-PGRP-L2 expressed bactericidal effects on \u003cem\u003eVibrio harveyi\u003c/em\u003e, \u003cem\u003eStaphylococcus aureus\u003c/em\u003e, and \u003cem\u003eEdwardsiella tarda\u003c/em\u003e (X. Li et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). However, the exact function and molecular mechanism of fish PGRP2 in the course of innate immunity remain ambiguous and require extensive research.\u003c/p\u003e \u003cp\u003eIn the present research, we have recombinantly expressed and purified a long-type PGRP from fat greenling, a major economic fish in the Yellow Sea and Bohai Sea of China. To investigate the role of HoPGRP-L2 in the process of \u003cem\u003eHexagrammos otakii\u003c/em\u003e innate immunity and its molecular mechanism, we performed a PGN binding assay, pathogen binding assay, and agglutination assay of HoPGRP-L2. In addition, we also investigated the inhibitory effect of HoPGRP-L2 on the growth of the pathogenic bacterium \u003cem\u003eAeromonas hydrophila\u003c/em\u003e in vitro, and these data may be of interest to further understanding the role of fish PGRP-L2 in the innate immune process.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Fish selection and tissue sampling\u003c/h2\u003e \u003cp\u003eThe fish was purchased from a fish farm in Weihai, Shandong province of China, with body weights ranging from 140 g to 180 g, lengths from 22 cm to 28 cm, and general ages from 5 to 8 months. The fish were kept in seawater at 21 ℃ before tissue extraction for two weeks, and the healthy individuals were sampled, excluding those that were injured or diseased.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. Total RNA extraction and cDNA synthesis\u003c/h2\u003e \u003cp\u003eTotal RNA extraction was performed under the instructions of the RNA extraction kit (Sangong Company, China). Using the extracted 5 \u0026micro;g RNA as template, Smart F and Oligo anchor R as primers (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), the first strand of cDNA was synthesized by the method of SMART cDNA (BD Biosciences Clontech) and then stored at -20\u0026deg;C.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers for HoPGRP-L2 cloning and expression\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eName\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence(5'-3')\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSmart F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTACGGCTGCGAGAAGACGACAGAAGGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOligo anchor R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGACCACGCGTATCGATGTCGACTV\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHoPGRP-L2 F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTACTCAGAATTCTACTGAAATAAACCTGAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHoPGRP-L2 R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTACTCACTCGAG ACCCTTGTGAAGTCCCTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e5\u0026prime; Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTACGGCTGCGAGAAGACGACAGAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3\u0026prime; anchor R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGACCACGCGTATCGATGTCGAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3. Cloning and bioinformatics analysis of HoPGRP-L2.\u003c/h2\u003e \u003cp\u003eAs per the corresponding Expressed Sequence Tag (EST) sequences obtained by random sequencing of the fish cDNA library in our laboratory, a pair of specific primers were designed. And then the full-length cDNA sequence of HoPGRPL2 gene was obtained by the method of rapid amplification of the cDNA ends (RACE), using the specific primer HoPGRP-L2 F and 3\u0026prime; anchor R at the 3' end, HoPGRP-L2 R and 5\u0026prime; Primer at the 5' end (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eFor sequence similarity analysis of HoPGRP-L2, NCBI's BLASTP (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.ncbi.nlm.nih.gov/\u003c/span\u003e\u003cspan address=\"http://www.ncbi.nlm.nih.gov/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) was applied. Gene translation was performed with Expasy (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.au.expasy.org/\u003c/span\u003e\u003cspan address=\"http://www.au.expasy.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The SMART online program (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://smart.embl-heidelberg.de/\u003c/span\u003e\u003cspan address=\"https://smart.embl-heidelberg.de/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) was employed to reveal protein functional domains. Furthermore, the neighbor-joining phylogenetic tree was constructed by MEGA 7.0 software with a bootstrap value of 5000.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Recombinant expression and purification of HoPGRP-L2\u003c/h2\u003e \u003cp\u003eThe cDNA fragments encoding the mature peptide, N-terminal domain, and C-terminal domain of HoPGRP-L2 were amplified by specific primers. Then we cloned these fragments into the pET30a (+) plasmid. The recombinant plasmids were sequenced by Sangon Company (Shanghai, China) and transferred into \u003cem\u003eE. coli\u003c/em\u003e Rosetta (DE3) cells. The induction was carried out at 37 ℃ under shaking incubation for 4 hours by adding the appropriate amount of Isopropyl beta-D-thiogalacyranoside (IPTG) to the bacterial solution at 1:300. Then the protein concentration was determined according to the method of the Bradford Portein Assay Kit (Sangon, China).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5. Preparation of polyclonal antibody and western blotting analysis\u003c/h2\u003e \u003cp\u003eAntiserum was obtained by injecting purified proteins into rats according to the previous method (Shi, Zhao, \u0026amp; Wang, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). In the first week, purified recombinant protein was mixed 1:1 with complete Freund's adjuvant until it was fully emulsified, and 200 \u0026micro;g of protein per kilogram of body weight was injected subcutaneously at multiple points on the back of the rats. In the fourth and fifth weeks, the complete Freund's adjuvant was replaced with incomplete Freund's adjuvant, and HoPGRP-L2 was injected as before. Finally, 200 \u0026micro;g of protein mixed with 500 \u0026micro;l of incomplete Freund's adjuvant was injected intramuscularly. After all injections, serum was collected by orbital blood sampling method, and serum antibody specificity was quantified by an enzyme-linked immunosorbent assay (ELISA) method.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6. Polysaccharide binding ability assay of HoPGRP-L2\u003c/h2\u003e \u003cp\u003eWe conducted binding tests of three different polysaccharide-based PAMs, LPS (Lipopolysaccharide), PGN (Lys type, from \u003cem\u003eBacillus subtilis\u003c/em\u003e sigma), and LTA (Lipophosphatidic acid), using the ELISA method as described previously (Wei et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Briefly, polysaccharide was diluted to 80 \u0026micro;g per milliliter, 50 \u0026micro;l of which was added to each well of a 96-well plate and incubated at 37\u0026deg;C overnight. The next day, the 96-well plate was fixed at 60\u0026deg;C for 30 min, and 200 \u0026micro;l of 5% skim milk powder diluted in phosphate buffered saline (PBS) was added to each well for 2-hour blocking. After washing 4 times with PBST solution(1 L PBS with 1 mL 20% Tween 80), 100 \u0026micro;l of recombinant HoPGRP-L2 containing 1% skim milk powder in PBS buffer was added to each well and incubated at 25\u0026deg;C for 3 h. The negative control used BSA instead of HoPGRP-L2. After washing 4 times, 100 \u0026micro;l of HoPGRP-L2 antibody (1:300 diluted in 1% skim milk powder) was added and incubated at room temperature for two hours. After three washes, peroxidase-conjugated goat anti-rabbit IgG (1:3000 diluted 1% skim milk powder) was added and incubated for another 2 hours. We also established an independent experiment to investigate the effect of zinc ions on the ability of HoPGRP-L2 to bind polysaccharides. Protein concentration was adjusted to 175 \u0026micro;g/mL, 1 \u0026micro;l of 5 mM ZnCl\u003csub\u003e2\u003c/sub\u003e solution was added to the experimental group before incubation, and the rest of the steps remained unchanged. Finally, the chromogenic reactions were performed with EL-TMB Chromogenic Reagent Kits (Sangon Company, China), and the absorbance values of the samples at 450 nm were measured using an enzyme marker.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7. Bacterial binding capacity assay of HoPGRP-L2\u003c/h2\u003e \u003cp\u003eFollowing the previous method, we tested the binding ability of HoPGRP-L2 to eight bacteria including four Gram-positive bacteria (\u003cem\u003eBacillus subtilis\u003c/em\u003e, \u003cem\u003eMicrococcus lysodeikticus, Bacillus megaterium\u003c/em\u003e, \u003cem\u003eStaphylococcus aureus\u003c/em\u003e) and four Gram-negative bacteria \u003cem\u003e(Vibrio harvey, Vibrio eelii\u003c/em\u003e, \u003cem\u003eVibrio Parahaemolyticus, Aeromonas hydrophila\u003c/em\u003e) as follow steps (Y. Y. Liu et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In brief, overnight cultures were transferred to new liquid medium 1:100 and incubated on the shaker for about 3.5 h. After centrifugation at 6000 rpm for 5 min, re-suspend 2 times with tris buffered saline (TBS) and dilute to 8*10\u003csup\u003e8\u003c/sup\u003e cells/mL. After that, 500 \u0026micro;l of bacteria were mixed with purified protein (1 mg/mL, 100 \u0026micro;l) and shaken gently for 1h at 37\u0026deg;C. Microorganisms were washed 4 times with TBS and then subjected to elution with 7% SDS for 1 min by strong agitation. Subsequently, the bacterial precipitate was washed twice with TBS. Finally, the washings were subjected to 12.5% SDS-PAGE electrophoresis with the wash buffer, elution, and the bacterial cells. The result was detected by western blot with specific antiserum against HoPGRP-L2.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8. Microbial agglutination assay of HoPGRP-L2\u003c/h2\u003e \u003cp\u003eEight kinds of bacteria used in the bacteria binding assay were also selected for this test as described previously (Choi et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Microorganisms in the logarithmic phase were resuspended with TBS to 3*10\u003csup\u003e6\u003c/sup\u003e CFU/mL. In the system of 50 \u0026micro;l in a 96-well plate, 25 \u0026micro;l of recombinant HoPGRP-L2 protein and 25 \u0026micro;l of diluted bacterial solution were added as the positive control, while the negative control was made with TBS instead of HoPGRP-L2 incubated with the bacterial solution. In addition, an additional 0.5 \u0026micro;l of 5 mM ZnCl\u003csub\u003e2\u003c/sub\u003e was added to the same system, together with a set of blank controls in which 0.5 \u0026micro;l of 5 mM EDTA was added. All the assays were performed in triplicate.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9. Amidase activity assay of HoPGRP-L2\u003c/h2\u003e \u003cp\u003eThe ability of HoPGRP-L2 to hydrolyze peptidoglycan was analyzed by the previously report with modifications (Hu, Cao, Guo, \u0026amp; Li, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). We dissolved the experimental peptidoglycan by sonication and adjusted its concentration to 0.5 mg/mL. After that 25 \u0026micro;L PGN (lys type, from \u003cem\u003eBacillus subtilis\u003c/em\u003e sigma) and 25 \u0026micro;L HoPGRP-L2 (1.0 mg/mL) were added to a 96-well plate with 0.5 \u0026micro;L Tris buffer (20 mM Tris-HCl, 150 mM NaCl, pH 8.0), and for the negative control, 25 \u0026micro;L of PGN and 25 \u0026micro;L Tris buffer were added. Subsequently, 25 \u0026micro;L of PGN, 25 \u0026micro;L HoPGRP-L2 and 0.5 \u0026micro;L Tris-ZnCl\u003csub\u003e2\u003c/sub\u003e buffer (20 mM Tris-HCl, 150 mM NaCl, 10 mM ZnCl\u003csub\u003e2\u003c/sub\u003e, pH 8.0) were added to another 96-well plate, while an addition of 25 \u0026micro;L of PGN and 25 \u0026micro;L of Tris buffer with 0.5 \u0026micro;L Tris -ZnCl\u003csub\u003e2\u003c/sub\u003e buffer were added in the control group. Each group was designed with 3 replicates.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.10. Bacterial inhibition assay of HoPGRP-L2\u003c/h2\u003e \u003cp\u003eOur antibacterial experiments followed the method described by Xia Li et al. with adaptations (X. Li et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The experimental bacteria were shaken to be revived overnight. The next day, the bacteria were cultured in a logarithmic phase at a ratio of 1:100 and the bacterial solution was diluted by 100 times upon 200 \u0026micro;L of a bacterial solution, 6000 rpm centrifugation for 5min, and two resuspensions with TBS. The test group was incubated with 10 \u0026micro;l of bacterial solution and 25 \u0026micro;l of protein, while the control group was incubated with the bacteria with appropriate TBS instead of protein, adding appropriate TBS to reach 50 ml. The zinc ion-enhanced group was added with 10 \u0026micro;l of the bacterial solution, 25 \u0026micro;l of protein, and another 0.5 \u0026micro;l of 5 mM ZnCl\u003csub\u003e2\u003c/sub\u003e solution, whereas its control group was supplemented by 0.5 \u0026micro;l of ZnCl\u003csub\u003e2\u003c/sub\u003e solution without protein, and finally replenished 50 \u0026micro;l with appropriate TBS for all EP tubes. The mixtures were incubated at room temperature for 5 hours and then at 37\u0026deg;C overnight upon addition of 1 mL of LB liquid medium. The following day, the samples were spotted on 96-well plates, and the absorbance value of each well at 620 nm was measured with an enzyme marker no less than three times.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.11 In vivo antibacterial assay of HoPGRP-L2\u003c/h2\u003e \u003cp\u003eCarp (5\u0026ndash;6 cm in length) were kept in aerated freshwater for 2 weeks, then divided into three separate groups and the individuals in good health were selected for the experiment. Briefly, 35 fish were injected with 50 \u0026micro;l of HoPGRP-L2 and 50 \u0026micro;l of \u003cem\u003eAeromonas hydrophila\u003c/em\u003e in PBS dilution. After that, the OD was adjusted to 0.3. Another 35 fish were injected with pET30a (+) empty carrier protein for HoPGRP-L2 instead of HoPGRP-L2 and adjust the OD to the same value. The blank control was injected with 100 \u0026micro;l of PBS buffer. The number of deaths was observed every hour after injection.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv\u003e\n\u003ch2\u003e3.1. Sequence analysis of HoPGPR-L2\u003c/h2\u003e\n\u003cp\u003eAs shown in Fig.\u0026nbsp;1, the full-length cDNA sequence of HoPGRP-L2 was 1449 bp. By Expasy analysis, the molecular weight of the protein encoded by this gene was about 53.51 kDa with a theoretical isoelectric point of 6.70. The ami-2 domain was predicted by SMART to be present at amino acids 326 to 467, and proteins containing this domain included zinc amidases that display N-acetylmuramoyl-L-alanine amidase activity. We also predicted the signal peptide to be present at the N-terminal amino acids 1 to 21 on SignalP. By BLASTing the HoPGRP-L2 sequence with other sequences in the NCBI database, we discovered a high similarity to the amino acid sequence of PGRP-L2 with several species (Fig.\u0026nbsp;2).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv\u003e\n\u003ch2\u003e3.2. Recombinant expression and preparation of HoPGRP-L2 antibody\u003c/h2\u003e\n\u003cp\u003eTo further investigate the function of HoPGRP-L2, we inserted its mature peptide, N-terminal domain and C-terminal domain into the pET30a vector. Only HoPGRP-L2 was successfully expressed in \u003cem\u003eE. coli\u003c/em\u003e Rosetta (DE3), and the molecular weight of the recombinant protein with a 5.7 kDa of His-tag was about 57 kDa by SDS-PAGE electrophoresis, as expected. The concentration of recombinant protein was determined to be 1.4 mg/mL by the Bradford method of standard curve plotting. The purified protein was used to produce polyclonal antibodies using rabbits as commonly described. The results of the western blot assay showed that the antiserum could recognize both recombinant protein and native protein in the fat greenling.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv\u003e\n\u003ch2\u003e3.3. Polysaccharide binding assay of HoPGRP-L2\u003c/h2\u003e\n\u003cp\u003eIt was discovered that HoPGRP-L2 could bind not only the Gram-positive PAMPs PGN and LTA but also showed such dose-dependent binding for LPS, which is the main component of the cell wall of Gram-negative bacteria. Moreover, from the results, the affinity of this protein for LPS was lower than that of PGN and LTA. In addition, we found that HoPGRP-L2 hydrolyzes PGN in the presence of Zn\u003csup\u003e2+\u003c/sup\u003e, thus reducing the binding for PGN, while this effect is absent for LTA and LPS.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv\u003e\n\u003ch2\u003e3.4. Bacterial binding assay of HoPGRP-L2\u003c/h2\u003e\n\u003cp\u003eIn bacterial binding experiments, eight microorganisms including Gram-negative and Gram-positive bacteria were cultured. After several washes as well as strong elution with 7% SDS, the results of western blot showed that HoPGRP-L2 could bind all experimental bacteria, and there was a discrepancy in the binding ability for Gram-positive and Gram-negative bacteria.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv\u003e\n\u003ch2\u003e3.5. Bacterial agglutination promotion assay of HoPGRP-L2\u003c/h2\u003e\n\u003cp\u003eHoPGRP-L2 can agglutinate all experimental bacteria, and the agglutination time for Gram-positive bacteria is shorter than that for Gram-negative bacteria. In the experimental group with EDTA, we noted that HoPGRP-L2 still had significant pro-agglutination activity, indicating that the pro-agglutination function of this protein is independent of zinc ions, but may be regulated by Zn\u003csup\u003e2+\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eFigure\u0026nbsp;5 Bacterial agglutination assay of HoPGRP-L2.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv\u003e\n\u003ch2\u003e3.6. Amidase activity assay of HoPGRP-L2\u003c/h2\u003e\n\u003cp\u003eIn the peptidoglycan hydrolysis experiments, only the samples to which both PGRP and zinc ions were added showed a significant decrease in absorbance values. HoPGRP-L2 did not have a significant ability to hydrolyze peptidoglycan in the absence of added zinc ions, suggesting that its amidase activity is dependent on zinc ions.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv\u003e\n\u003ch2\u003e3.7. Bacterial inhibition assay of HoPGRP-L2\u003c/h2\u003e\n\u003cp\u003eAlthough zinc ions may have an inhibitory effect on bacterial growth, the bacteria in the test tubes to which only zinc ions were added did not show a significant growth decline because the amount of zinc ions in the solution was very low.. It was observed that recombinant HoPGRP-L2 could considerably inhibit the growth of \u003cem\u003eBacillus subtilis\u003c/em\u003e, \u003cem\u003eBacillus megaterium\u003c/em\u003e, \u003cem\u003eMicrococcus luteus\u003c/em\u003e, and \u003cem\u003eAeromonas hydrophila\u003c/em\u003e in the presence of Zn\u003csup\u003e2+\u003c/sup\u003e, but this effect cannot be achieved in the absence of Zn\u003csup\u003e2+\u003c/sup\u003e.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv\u003e\n\u003ch2\u003e3.8. In vivo antibacterial assay of HoPGRP-L2\u003c/h2\u003e\n\u003cp\u003eAmong carp infected with \u003cem\u003eA. hydrophila\u003c/em\u003e, the number of deaths in the group injected with HoPGRP-L2 at the identical time was significantly lower than that of the negative control. The control and experimental groups exhibited over half of their cumulative deaths at the 6th and 10th hours post-injection, respectively, indicating the involvement of HoPGRP-L2 in the immune response of carp to pathogenic bacteria.\u003c/p\u003e\n\u003cp\u003eFigure\u0026nbsp;8 The in vivo inhibition experiments of HoPGRP-L2, all have been subtracted blank control Date were expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SE, with * indicating p\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eIn the present study, a PGRP gene named HoPGRP-L2 was identified from fat greenling. In the course of innate immunity, HoPGRP-L2 could serve as an excellent model for understanding the mechanisms of host-pathogen interactions. Sequence analysis reveals that HoPGRP-L2 possesses a signal peptide and lacks a transmembrane structural domain, suggesting its potential role as a secretory protein. But not all PGRPs are secretory proteins, such as grass carp PGRP5 which is localized in the cytoplasm of CIK cells (J. H. Li et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2013\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAs the bacterial cell wall component, peptidoglycan is a prime example of a conserved PAMP for which the innate immune system has evolved sensing mechanisms (Wolf \u0026amp; Underhill, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Previous reports have shown that the transcript levels of Eco-PGRP-L1 and Eco-PGRP-L2 are significantly increased after stimulation by PGN in head-kidney leukocytes of orange-spotted grouper (Hou et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Similarly, it has been shown that the expression of PGRP2 and its variants is up-regulated in grass carp after the injection of PGN (Jin, Li, Li, \u0026amp; Nie, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Moreover, the majority of PGRPs can interact directly with PGN. For example, RSgPGRP-S1 in \u003cem\u003eSolen grandis\u003c/em\u003e can bind both Lys-type PGN and Dap-type PGN, but it is unable to bind LPS and β-glucan (J. H. Li et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Wei et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). HoPGRP-L2 exhibited a dose-dependent binding capacity for PGN and it demonstrated a stronger binding capacity for PGN than for LTA and LPS. In addition, the binding ability of HoPGRP-L2 to both Gram-positive and Gram-negative bacteria was confirmed using western-blot method, and it was inferred that the binding ability of HoPGRP-L2 to pathogenic bacteria is based on recognition of PAMPs such as PGN. These results suggest that HoPGRP-L2 may play an essential part in recognizing PGN and regulating the PGN-induced immune response.\u003c/p\u003e \u003cp\u003eAmi-2 domain is present at amino acids 326\u0026ndash;427 of HoPGRP-L2, and this structure is predicted to be a zinc-dependent N-acetylmuramoyl-L-alanine amidase. Amidase activity, which functions as scavengers in the innate immune process, is of great importance to HoPGRP-L2 in the immune response for the recognition of pathogenic PAMPs and the execution of PGN (Mellroth, Karlsson, \u0026amp; Steiner, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Zaidman-Remy et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). The amidase activity depends on a Zn\u003csup\u003e2+\u003c/sup\u003e binding site which consists of two histidines, one tyrosine and one cysteine (Hu et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). In the present study, HoPGRP-L2 was shown to possess a Zn\u003csup\u003e2+\u003c/sup\u003e-binding domain that can hydrolyze PGN in the presence of Zn\u003csup\u003e2+\u003c/sup\u003e. This suggests that HoPGRP-L2 may function importantly in the immune response associated with PGN and that its function is dependent on Zn\u003csup\u003e2+\u003c/sup\u003e. Some PGRPs showed agglutinating activity towards both Gram-negative and Gram-positive bacteria, and the effect is regulated by Zn\u003csup\u003e2+\u003c/sup\u003e (Jang et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Wei et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Although HoPGRP-L2 was shown be able to promote the agglutination of a variety of pathogenic bacteria, this effect was not significantly diminished by the addition of EDTA.\u003c/p\u003e \u003cp\u003eThe antibacterial activity of PGRP has been demonstrated both in vivo by blocking bacterial infection and in vitro by directly interacting with pathogenic bacteria. It has been demonstrated in previous studies that the expression of PGRP6 is significantly increased after \u003cem\u003eAeromonas hydrophila\u003c/em\u003e treatment of carp (Yang et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Similarly, SoPGLYRP-2 caused a significant reduction in the number of bacteria recovered intracellularly from lymphocytes infected with \u003cem\u003eStreptococcus iniae.\u003c/em\u003e In in vitro assays, several PGRPs such as rSoPGLYRP-2 and rSoPGLYRP-AD in \u003cem\u003eSciaenops ocellatus\u003c/em\u003e and rSgPGRP-S1 in \u003cem\u003eSolen grandis\u003c/em\u003e were shown to have amidase activity and bactericidal activity, and all of them required zinc as a cofactor (M. F. Li et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). This research showed that HoPGRP-L2 significantly restrained the growth of \u003cem\u003eBacillus subtilis\u003c/em\u003e, \u003cem\u003eBacillus megaterium\u003c/em\u003e, \u003cem\u003eMicrococcus luteus\u003c/em\u003e and \u003cem\u003eAeromonas hydrophila\u003c/em\u003e in the presence of Zn\u003csup\u003e2+\u003c/sup\u003e, but no or insignificant inhibitory effect was observed without Zn\u003csup\u003e2+\u003c/sup\u003e. In addition, HoPGRP-L2 prolongs the survival time in carp infected by \u003cem\u003eA. hydrophila\u003c/em\u003e. This effect of HoPGRP-L2 suggests that this protein can recognize and remove pathogenic bacteria in the course of the immune response, and this function is dependent on Zn\u003csup\u003e2+\u003c/sup\u003e, probably because the amidase activity of HoPGRP-L2 is activated only in the presence of Zn\u003csup\u003e2+\u003c/sup\u003e, which can hydrolyze the bacterial cell wall and subsequently kill pathogenic bacteria.\u003c/p\u003e \u003cp\u003eIn conclusion, this investigation demonstrated that HoPGRP-L2, which depends on a conserved substrate binding site, plays an important role in pathogen recognition during ontogenesis of the immune response. HoPGRP-L2 can bind a variety of PAMPs and pathogenic bacteria, promote agglutination of pathogenic bacteria, and hydrolyze PGN in the presence of zinc ions. In addition, this study demonstrated that HoPGRP-L2 can directly inhibit the growth of a variety of pathogenic bacteria such as \u003cem\u003eBacillus subtilis\u003c/em\u003e and \u003cem\u003eBacillus megaterium\u003c/em\u003e, and prolong the survival time of carp infected with \u003cem\u003eA. hydrophila\u003c/em\u003e. These mechanisms are zinc ion-dependent, in the sense that HoPGRP-L2 activities such as bacteriostatic and amidase are not prominently expressed in the absence of zinc ions, whereas the effect is particularly evident when zinc ions are added to the system. These results support the role of HoPGRP-L2 in host immune defense against bacterial infections.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e Yifan Bai: Methodology, Investigation, Software, Data curation, Writing\u0026ndash; original draft. Yingying Liu: Investigation, Software, Data curation, Conceptualization, Supervision, Writing \u0026ndash; review \u0026amp; editing.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e This work was supported by the Natural Science Foundation of Shandong Province, China (ZR2016CP10).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e Data will be made available on request.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCode availability\u003c/strong\u003e Not applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics statement\u003c/strong\u003e All experimental procedures of this study were in line with the animal ethics committee of Shandong University and the Department of Central Lab, Weihai Municipal Hospital (No.2023002).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interest\u003c/strong\u003e The authors declare no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eChang, M. X., \u0026amp; Nie, P. (2008). RNAi suppression of zebrafish peptidoglycan recognition protein 6 (zfPGRP6) mediated differentially expressed genes involved in Toll-like receptor signaling pathway and caused increased susceptibility to \u003cem\u003eFlavobacterium columnare\u003c/em\u003e. Veterinary Immunology and Immunopathology, \u003cem\u003e124\u003c/em\u003e(3\u0026ndash;4), 295\u0026ndash;301. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.vetimm.2008.04.003\u003c/span\u003e\u003cspan address=\"10.1016/j.vetimm.2008.04.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChoi, K. M., Joo, M. S., Cho, D. H., Bae, J. S., Jeong, J. M., Woo, W. S.,.. . Park, C. I. (2018). Molecular characterization, expression and functional analysis of peptidoglycan recognition protein-SC2 from rock bream, \u003cem\u003eOplegnathus fasciatus\u003c/em\u003e. Fish \u0026amp; Shellfish Immunology, \u003cem\u003e77\u003c/em\u003e, 286\u0026ndash;293. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.fsi.2018.04.006\u003c/span\u003e\u003cspan address=\"10.1016/j.fsi.2018.04.006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDziarski, R. (2004). Peptidoglycan recognition proteins (PGRPs). Molecular Immunology, \u003cem\u003e40\u003c/em\u003e(12), 877\u0026ndash;886. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.molimm.2003.10.011\u003c/span\u003e\u003cspan address=\"10.1016/j.molimm.2003.10.011\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuan, R. J., \u0026amp; Mariuzza, R. A. (2007). Peptidoglycan recognition proteins of the innate immune system. Trends in Microbiology, \u003cem\u003e15\u003c/em\u003e(3), 127\u0026ndash;134. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.tim.2007.01.006\u003c/span\u003e\u003cspan address=\"10.1016/j.tim.2007.01.006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHou, J., Hao, W., Li, M. C., Gan, Z., Chen, S. N., Lu, Y. S., \u0026amp; Xia, L. Q. (2023). Identification and characterization of two long-type peptidoglycan recognition proteins, PGRP-L1 and PGRP-L2, in the orange-spotted grouper, \u003cem\u003eEpinephelus coioides\u003c/em\u003e. Fish \u0026amp; Shellfish Immunology, \u003cem\u003e134\u003c/em\u003e, 108580\u0026ndash;108588. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.fsi.2023.108580\u003c/span\u003e\u003cspan address=\"10.1016/j.fsi.2023.108580\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu, Z. G., Cao, X. B., Guo, M., \u0026amp; Li, C. H. (2020). Identification and characterization of a novel short-type peptidoglycan recognition protein in \u003cem\u003eApostichopus japonicus\u003c/em\u003e. Fish \u0026amp; Shellfish Immunology, \u003cem\u003e99\u003c/em\u003e, 257\u0026ndash;266. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.fsi.2020.02.013\u003c/span\u003e\u003cspan address=\"10.1016/j.fsi.2020.02.013\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJang, J. H., Kim, H., \u0026amp; Cho, J. H. (2017). Molecular cloning and functional characterization of peptidoglycan recognition protein OmPGRP-L2 from the rainbow trout, \u003cem\u003eOncorhynchus mykiss\u003c/em\u003e. Veterinary Immunology and Immunopathology, \u003cem\u003e192\u003c/em\u003e, 28\u0026ndash;32. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.vetimm.2017.09.004\u003c/span\u003e\u003cspan address=\"10.1016/j.vetimm.2017.09.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJin, Y., Li, L., Li, J. H., \u0026amp; Nie, P. (2022). Identification of PGRP2 and its three splice variants in grass carp \u003cem\u003eCtenopharyngodon idella\u003c/em\u003e. Fish \u0026amp; Shellfish Immunology, \u003cem\u003e127\u003c/em\u003e, 933\u0026ndash;938. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.fsi.2022.07.042\u003c/span\u003e\u003cspan address=\"10.1016/j.fsi.2022.07.042\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim, M. S., Byun, M. J., \u0026amp; Oh, B. H. (2003). Crystal structure of peptidoglycan recognition protein LB from \u003cem\u003eDrosophila melanogaster\u003c/em\u003e. Nature Immunology, \u003cem\u003e4\u003c/em\u003e(8), 787\u0026ndash;793. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/ni952\u003c/span\u003e\u003cspan address=\"10.1038/ni952\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKurata, S. (2010). Extracellular and intracellular pathogen recognition by \u003cem\u003eDrosophila\u003c/em\u003e PGRP-LE and PGRP-LC. International Immunology, \u003cem\u003e22\u003c/em\u003e(3), 143\u0026ndash;148. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/intimm/dxp128\u003c/span\u003e\u003cspan address=\"10.1093/intimm/dxp128\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLemaitre, B., \u0026amp; Hoffmann, J. (2007). The host defense of \u003cem\u003eDrosophila melanogaster\u003c/em\u003e. Annual Review of Immunology, \u003cem\u003e25\u003c/em\u003e, 697\u0026ndash;743. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1146/annurev.immunol.25.022106.141615\u003c/span\u003e\u003cspan address=\"10.1146/annurev.immunol.25.022106.141615\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLeulier, F., Parquet, C., Pili-Floury, S., Ryu, J. H., Caroff, M., Lee, W. J.,.. . Lemaitre, B. (2003). The \u003cem\u003eDrosophila\u003c/em\u003e immune system detects bacteria through specific peptidoglycan recognition. Nature Immunology, \u003cem\u003e4\u003c/em\u003e(5), 478\u0026ndash;484. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/ni922\u003c/span\u003e\u003cspan address=\"10.1038/ni922\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi, J. H., Chang, M. X., Xue, N. N., \u0026amp; Nie, R. (2013). Functional characterization of a short peptidoglycan recognition protein, PGRP5 in grass carp \u003cem\u003eCtenopharyngodon idella\u003c/em\u003e. Fish \u0026amp; Shellfish Immunology, \u003cem\u003e35\u003c/em\u003e(2), 221\u0026ndash;230. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.fsi.2013.04.025\u003c/span\u003e\u003cspan address=\"10.1016/j.fsi.2013.04.025\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi, M. F., Zhang, M., Wang, C. L., \u0026amp; Sun, L. (2012). A peptidoglycan recognition protein from \u003cem\u003eSciaenops ocellatus\u003c/em\u003e is a zinc amidase and a bactericide with a substrate range limited to Gram-positive bacteria. Fish \u0026amp; Shellfish Immunology, \u003cem\u003e32\u003c/em\u003e(2), 322\u0026ndash;330. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.fsi.2011.11.024\u003c/span\u003e\u003cspan address=\"10.1016/j.fsi.2011.11.024\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi, X., Yuan, S. Y., Sun, Z. S., Lei, L. N., Wan, S., Wang, J. Y.,.. . Gao, Q. (2020). Gene identification and functional analysis of peptidoglycan recognition protein from the spotted sea bass (\u003cem\u003eLateolabrax maculatus\u003c/em\u003e). Fish \u0026amp; Shellfish Immunology, \u003cem\u003e106\u003c/em\u003e, 1014\u0026ndash;1024. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.fsi.2020.08.041\u003c/span\u003e\u003cspan address=\"10.1016/j.fsi.2020.08.041\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu, C., Xu, Z. J., Gupta, D., \u0026amp; Dziarski, R. (2001). Peptidoglycan recognition proteins - A novel family of four human innate immunity pattern recognition molecules. Journal of Biological Chemistry, \u003cem\u003e276\u003c/em\u003e(37), 34686\u0026ndash;34694. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1074/jbc.M105566200\u003c/span\u003e\u003cspan address=\"10.1074/jbc.M105566200\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu, Y. Y., Zha, H. D., Han, X. D., Yu, S. S., Chai, Y. M., Zhong, J. M., \u0026amp; Zhu, Q. (2021). Molecular characterization and functional analysis of the bactericidal permeability-increasing protein/LPS-binding protein (BPI/LBP) from roughskin sculpin (\u003cem\u003eTrachidermus fasciatus\u003c/em\u003e). Developmental and Comparative Immunology, \u003cem\u003e123\u003c/em\u003e, 104133\u0026ndash;104142. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.dci.2021.104133\u003c/span\u003e\u003cspan address=\"10.1016/j.dci.2021.104133\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLu, Y. Z., Su, F. H., Li, Q. L., Zhang, J., Li, Y. J., Tang, T.,.. . Yu, X. Q. (2020). Pattern recognition receptors in \u003cem\u003eDrosophila\u003c/em\u003e immune responses. Developmental and Comparative Immunology, \u003cem\u003e102\u003c/em\u003e, 103468\u0026ndash;103477. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.dci.2019.103468\u003c/span\u003e\u003cspan address=\"10.1016/j.dci.2019.103468\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMaillet, F., Bischoff, V., Vignal, C., Hoffmann, J., \u0026amp; Royet, J. (2008). The \u003cem\u003eDrosophila\u003c/em\u003e peptidoglycan recognition protein PGRP-LF blocks PGRP-LC and IMD/JNK pathway activation. Cell Host \u0026amp; Microbe, \u003cem\u003e3\u003c/em\u003e(5), 293\u0026ndash;303. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.chom.2008.04.002\u003c/span\u003e\u003cspan address=\"10.1016/j.chom.2008.04.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMao, Y., Wang, J., Zhang, Z. W., Ding, S. X., \u0026amp; Su, Y. Q. (2010). Cloning, mRNA expression, and recombinant expression of peptidoglycan recognition protein II gene from large yellow croaker (\u003cem\u003ePseudosciaena crocea\u003c/em\u003e). Molecular Biology Reports, \u003cem\u003e37\u003c/em\u003e(8), 3897\u0026ndash;3908. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s11033-010-0046-x\u003c/span\u003e\u003cspan address=\"10.1007/s11033-010-0046-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMellroth, P., Karlsson, J., \u0026amp; Steiner, H. (2003). A scavenger function for a \u003cem\u003eDrosophila\u003c/em\u003e peptidoglycan recognition protein. Journal of Biological Chemistry, \u003cem\u003e278\u003c/em\u003e(9), 7059\u0026ndash;7064. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1074/jbc.M208900200\u003c/span\u003e\u003cspan address=\"10.1074/jbc.M208900200\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoyet, J., Gupta, D., \u0026amp; Dziarski, R. (2011). Peptidoglycan recognition proteins: modulators of the microbiome and inflammation. Nature Reviews Immunology, \u003cem\u003e11\u003c/em\u003e(12), 837\u0026ndash;851. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nri3089\u003c/span\u003e\u003cspan address=\"10.1038/nri3089\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaurabh, S., \u0026amp; Sahoo, P. K. (2008). Lysozyme: an important defence molecule of fish innate immune system. Aquaculture Research, \u003cem\u003e39\u003c/em\u003e(3), 223\u0026ndash;239. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/j.1365-2109.2007.01883.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1365-2109.2007.01883.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSharma, P., Dube, D., Sinha, M., Kaur, P., Sharma, S., \u0026amp; Singh, T. P. (2011). Structural basis of recognition of pathogen-associated molecular patterns by pgrp-s. Acta Crystallographica a-Foundation and Advances, \u003cem\u003e67\u003c/em\u003e, C546-C546. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1107/s0108767311086193\u003c/span\u003e\u003cspan address=\"10.1107/s0108767311086193\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShi, X. Z., Zhao, X. F., \u0026amp; Wang, J. X. (2008). Molecular cloning and expression analysis of chymotrypsin-like serine protease from the Chinese shrimp, \u003cem\u003eFenneropenaeus chinensis\u003c/em\u003e. Fish \u0026amp; Shellfish Immunology, \u003cem\u003e25\u003c/em\u003e(5), 589\u0026ndash;597. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.fsi.2008.07.011\u003c/span\u003e\u003cspan address=\"10.1016/j.fsi.2008.07.011\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun, L. Y., Liu, S. K., Wang, R. J., Li, C., Zhang, J. R., \u0026amp; Liu, Z. J. (2014). Pathogen recognition receptors in channel catfish: IV. Identification, phylogeny and expression analysis of peptidoglycan recognition proteins. Developmental and Comparative Immunology, \u003cem\u003e46\u003c/em\u003e(2), 291\u0026ndash;299. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.dci.2014.04.018\u003c/span\u003e\u003cspan address=\"10.1016/j.dci.2014.04.018\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, Q., Wang, J. Y., Ren, M. J., Ma, S. S., Liu, X. Y., Chen, K. P., \u0026amp; Xia, H. C. (2021). Peptidoglycan recognition protein-S1 acts as a receptor to activate AMP expression through the IMD pathway in the silkworm \u003cem\u003eBombyx mori\u003c/em\u003e. Developmental and Comparative Immunology, \u003cem\u003e115\u003c/em\u003e, 103903\u0026ndash;103912. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.dci.2020.103903\u003c/span\u003e\u003cspan address=\"10.1016/j.dci.2020.103903\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, Z. M., Li, X. N., Cocklin, R. R., Wang, M. H., Wang, M., Fukase, K.,.. . Dziarski, R. (2003). Human peptidoglycan recognition protein-L is an \u003cem\u003eN\u003c/em\u003e-acetylmuramoyl-L-alanine amidase. Journal of Biological Chemistry, \u003cem\u003e278\u003c/em\u003e(49), 49044\u0026ndash;49052. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1074/jbc.M307758200\u003c/span\u003e\u003cspan address=\"10.1074/jbc.M307758200\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWei, X. M., Yang, D. L., Li, H. Y., Zhao, T. Y., Jiang, H. L., Liu, X. Q., \u0026amp; Yang, J. L. (2018). Peptidoglycan recognition protein of \u003cem\u003eSolen grandis\u003c/em\u003e (SgPGRP-S1) mediates immune recognition and bacteria clearance. Fish \u0026amp; Shellfish Immunology, \u003cem\u003e73\u003c/em\u003e, 30\u0026ndash;36. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.fsi.2017.12.001\u003c/span\u003e\u003cspan address=\"10.1016/j.fsi.2017.12.001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWerner, T., Liu, G., Kang, D., Ekengren, S., Steiner, H., \u0026amp; Hultmark, D. (2000). A family of peptidoglycan recognition proteins in the fruit fly \u003cem\u003eDrosophila melanogaster\u003c/em\u003e. Proceedings of the National Academy of Sciences of the United States of America, \u003cem\u003e97\u003c/em\u003e(25), 13772\u0026ndash;13777. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1073/pnas.97.25.13772\u003c/span\u003e\u003cspan address=\"10.1073/pnas.97.25.13772\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWolf, A. J., \u0026amp; Underhill, D. M. (2018). Peptidoglycan recognition by the innate immune system. Nature Reviews Immunology, \u003cem\u003e18\u003c/em\u003e(4), 243\u0026ndash;254. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nri.2017.136\u003c/span\u003e\u003cspan address=\"10.1038/nri.2017.136\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang, D., Han, Y., Liu, Y., Cao, R., Wang, Q., Dong, Z.,.. . Zhao, J. (2019). A peptidoglycan recognition protein involved in immune recognition and immune defenses in \u003cem\u003eRuditapes philippinarum\u003c/em\u003e. Fish \u0026amp; Shellfish Immunology, \u003cem\u003e88\u003c/em\u003e, 441\u0026ndash;448. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.fsi.2019.03.017\u003c/span\u003e\u003cspan address=\"10.1016/j.fsi.2019.03.017\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZaidman-Remy, A., Herve, M., Poidevin, M., Pili-Floury, S., Kim, M. S., Blanot, D.,.. . Lemaitre, B. (2006). The \u003cem\u003eDrosophila\u003c/em\u003e amidase PGRP-LB modulates the immune response to bacterial infection. Immunity, \u003cem\u003e24\u003c/em\u003e(4), 463\u0026ndash;473. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.immuni.2006.02.012\u003c/span\u003e\u003cspan address=\"10.1016/j.immuni.2006.02.012\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Hexagrammos otakii, Peptidoglycan recognition protein (PGRP), Immune response, Amidase activity","lastPublishedDoi":"10.21203/rs.3.rs-4223167/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4223167/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003ePeptidoglycan recognition proteins (PGRPs) belong to the pattern recognition receptors (PRRs), which are essential for sensing and defending against pathogenic microorganisms during innate immunity pathways. Although an increasing body of research indicates that the PGRP protein in fish has various biological functions such as antimicrobial activity, amidase activity, and the ability to regulate multiple signaling pathways, the molecular mechanisms by which PGRP contributes to the innate immune processes in fish remain relatively limited. In the present study, we have recombinantly expressed a long-type PGRP from fat greenling (\u003cem\u003eHexagrammos otakii\u003c/em\u003e) (HoPGRP-L2) and analyzed its molecular mechanism in the pathogen identification process. The open reading frame (ORF) of HoPGRP-L2 is 1449 bp in length that encodes for a peptide with 482 amino acids. As a PRR, HoPGRP-L2 has a typical PGRP domain that enables HoPGRP-L2 to recognize and conjugate to bacterial peptidoglycan (PGN) on the cell wall. We demonstrated that HoPGRP-L2 could bind to pathogenic microorganisms and promote the agglutination of them. Furthermore, HoPGRP-L2 was confirmed to possess zinc ion-dependent amidase activity and exhibited an effect on the growth inhibition of chosen bacteria. HoPGRP-L2 also prolongs the survival time in carp injected with \u003cem\u003eAeromonas hydrophila\u003c/em\u003e. Taken together, our results indicate that PGRP acts as a PRR involved in recognizing and eliminating pathogens during the innate immune response in \u003cem\u003eHexagrammos otakii\u003c/em\u003e.\u003c/p\u003e","manuscriptTitle":"Molecular characterization and functional analysis of Peptidoglycan recognition protein-L2 in Hexagrammos otakii","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-04-15 21:07:08","doi":"10.21203/rs.3.rs-4223167/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"f0c0dca8-68be-4877-9139-70bc3397f1a1","owner":[],"postedDate":"April 15th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-04-28T19:43:25+00:00","versionOfRecord":[],"versionCreatedAt":"2024-04-15 21:07:08","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4223167","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4223167","identity":"rs-4223167","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}