Streptococcus gallolyticus supernatant promotes macrophage M2 polarization and regulates the IL-17 pathway in the oncogenesis of colorectal cancer

Streptococcus gallolyticus supernatant promotes macrophage M2 polarization and regulates the IL-17 pathway in the oncogenesis of colorectal cancer | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Streptococcus gallolyticus supernatant promotes macrophage M2 polarization and regulates the IL-17 pathway in the oncogenesis of colorectal cancer Jiaqi Wang, Yan Zhang, Jing Xu, Xin Nie, Chen Huang, Hailan Zhao, and 7 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6861254/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 12 Aug, 2025 Read the published version in Gut Pathogens → Version 1 posted 10 You are reading this latest preprint version Abstract Colorectal cancer (CRC) is a highly prevalent malignant tumor worldwide, and emerging evidence suggests that the gut microbiota plays a crucial role in its development. Streptococcus gallolyticus ( Sg ) is a gut commensal bacterium that can also act as an opportunistic pathogen in association with CRC. In this study, it was found that the detection rate of Sg was higher in CRC tissues and the high burden of Sg was correlated with tumor location. Moreover, the researchers demonstrated that Sg supernatant could promote the proliferation of CRC cells, increase tumor burden in AOM/DSS-induced mice, exacerbate inflammatory response, and promote M2 polarization of macrophages. The aforementioned effects may be related to the IL-17 pathway, as revealed by RNA-seq analysis. Overall, these findings suggest a potential role of Sg in the pathogenesis of CRC, and targeting its supernatant may represent a promising approach for the prevention and treatment of CRC. CRC Streptococcus gallolyticus supernatant macrophages Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Colorectal cancer(CRC) is the third most commonly diagnosed cancer and the second leading cause of cancer-related deaths worldwide [ 1 ] . The risk of suffering from CRC is 2–3 times higher in people with inflammatory bowel disease(IBD) than in those without IBD [ 2 ] . Recent studies have shown that the gut microbiota plays a critical role in the progression from colitis to CRC [ 3 , 4 ] . Among the various bacterial species present in the gut, some species like Streptococcus gallolyticus are found to be associated with CRC [ 3 , 5 , 6 ] . Streptococcus gallolyticus ( Sg ), also known as Streptococcus bovis biotype I, is a Gram-positive bacterium that inhabits the human gastrointestinal tract as a commensal organism [ 6 ] . The association of Sg with CRC was initially identified in 1951 [ 5 ] . Initially, it was observed that individuals infected with Sg had a considerably higher risk of being with CRC in subsequent years, despite the absence of any intestinal symptoms during that time. A comprehensive 12-year study revealed that 75% of patients with S. bovis -infected endocarditis were subsequently found to have malignant lesions in the colon [ 7 ] , while a 40-year literature survey showed that 60% of patients with S. bovis infection had colorectal adenomas or carcinomas [ 8 ] , and a separate study conducted over 24 years demonstrated a higher prevalence of colonic tumors(70%) in patients with S. bovis bacteremia compared to controls(32%) [ 9 ] . On the other hand, studies have revealed a significant increase in the detection rate of Sg in the excreted tissues of patients diagnosed with CRC. Specifically, the incidence of S. bovis fecal carriage was noted to be approximately five-fold and three-fold higher in CRC patients compared to those with IBD and healthy controls, respectively [ 10 ] . Moreover, the presence of Sg was observed to be approximately ten-fold higher in tumor colon tissues compared to normal colon tissues [ 11 ] . Interestingly, approximately 74% of tumor tissues and 47% of adjacent normal tissues from CRC patients tested positive for Sg [ 12 ] . Furthermore, a separate investigation determined that Sg was detected in the intestines of 62.5% of 99 healthy volunteers [ 13 ] .Taken together, these aforementioned studies strongly suggest an intricate connection between Sg and CRC, positioning Sg as a potential causative bacterium in the oncogenesis of CRC. Additionally, the seropositivity rates for Sg -specific IgG antibodies were determined to be 68% in CRC patients, 78% in patients with adenomas, and 16.66% in the healthy controls [ 14 ] . This observation indicates a higher prevalence of Sg in early adenomas compared to advanced carcinomas, suggesting a pivotal role for Sg in the early stages of colorectal carcinogenesis. Although the exact mechanism of Sg influences CRC remains unclear, it is speculated that the supernatant of Sg culture( Sg sup) contain sparticular molecular substances that actively promote the development of CRC. Bacteria have the capacity to secrete a wide range of substances, including growth factors, proteases, cytokines, various other proteins, and diverse metabolites, which facilitate intricate interactions between the host's immune system and cancer cells. Certain metabolites, like lactate, serve as nourishment for cancer cells and promote cancer progression, while others, such as butyrate, inhibit pro-inflammatory genes and hinder tumor growth. [ 3 , 15 ] Within the supernatant of Sg resides a multitude of components, such as proteins, lipids, and metabolites, which have substantial potential to affect the advancement of CRC. There is an ongoing controversy in current research regarding the potential of Sg sup to promote the proliferation of CRC cells. Some studies suggest that direct contact between Sg and cells is necessary for its effectiveness [ 12 ] , while others posit that Sg sup contains specific substances capable of facilitating CRC development [ 16 , 17 ] . The aim of this study is to investigat the effects of Sg sup on CRC and to figure out its composition and mechanism of action. Methods 1. Clinical data and specimen collection The study involved 46 patients diagnosed with CRC who underwent surgical treatment at the Guangzhou First People's Hospital between 2012 and 2015. Specimen collection was conducted with strict adherence to aseptic principles. Both tumor tissue and adjacent tissues (> 5 cm from the tumor margin) were collected from each patient and immediately frozen in liquid nitrogen for rapid preservation. Subsequently, the specimens were transferred to a -80°C refrigerator for storage. Patient information, such as age, gender, blood type, tumor size, location, stage, smoking history, alcohol consumption history, 5-year survival, metastasis, and pathological indicators, were collected through the medical record system and telephone call follow-up. Informed consent was obtained from each patient. The study was approved by the ethics committee of Guangzhou First People's Hospital. The research team is committed to following the committee's guidelines to maintain ethical integrity and scientific validity throughout the study. 2.Quantitative Real-time PCR(qPCR) of Sg abundance Genomic DNA (gDNA) was extracted from tissue samples using the Total DNA/RNA/Protein Kit ( Omega, USA). A 20 µL reaction solution was prepared, consisting of 10 µL SYBR Premix Ex Taq II (2X), 1 µL PCR Forward Primer (10 µM), 1 µL PCR Reverse Primer (10 µM), 2 µL gDNA solution, and 6 µL ddH 2 O. The qPCR program was set as follows: A. Pre-denaturation: 95°C, 30 s; B. PCR reaction: 40 cycles of 95°C for 5 s and 60°C for 30–60 s. The specific primer sequences for Sg were obtained from the literature [ 18 ] and were as follows: Forward: 5'-AACGCGAAGAACCTTACCAG-3', Reverse: 5'-GAGTGCCCAACTGAATGAT G-3'. ACTB was used as an internal reference gene. All samples were analyzed in triplicate to account for biological variability. The abundance of Sg was evaluated by calculating the 2^( -ΔCT) values. 3.Quantitative Reverse Transcription PCR(RT-qPCR) Mouse colon tissue was collected for RT-qPCR analysis. Total RNA was extracted using the Total DNA/RNA/Protein Kit ( Omega, USA). Reverse transcription converted RNA to cDNA using the PrimeScript RT reagent Kit( Takara, Japan) and qPCR steps: Step 1 - Pre-denaturation at 95°C for 30 seconds. Steps 2 and 3 - Denaturation at 95°C for 15 seconds and annealing at 60°C for 1 minute, cycled 40 times. Step 4 - Rapid denaturation at 95°C for 1 second. Step 5 - Melting step of 6 seconds. A 20 µL reaction mixture contained SYBR Premix Ex Taq II (2X), PCR Forward Primer (10uM), PCR Reverse Primer (10uM), cDNA solution, and dH2O. ACTB served as an internal reference. Relative gene expression was calculated using the 2-ΔΔ CT method. Primer sequences are provided below. Gene name Source Primer name Sequence(5’-3’) PTGS2 mouse Forward Primer GCGACATACTCAAGCAGGAGCA PTGS2 mouse Reverse Primer AGTGGTAACCGCTCAGGTGTTG IL-1β mouse Forward Primer TGGACCTTCCAGGATGAGGACA IL-1β mouse Reverse Primer GTTCATCTCGGAGCCTGTAGTG IL-8 mouse Forward Primer GGTGATATTCGAGACCATTTACTG IL-8 mouse Reverse Primer GCCAACAGTAGCCTTCACCCAT IL-6 mouse Forward Primer TACCACTTCACAAGTCGGAGGC IL-6 mouse Reverse Primer CTGCAAGTGCATCATCGTTGTTC IL-17A mouse Forward Primer CAGACTACCTCAACCGTTCCAC IL-17A mouse Reverse Primer CTTTCCCTCCGCATTGACAC IL-17F mouse Forward Primer AACCAGGGCATTTCTGTCCCAC IL-17F mouse Reverse Primer GGCATTGATGCAGCCTGAGTGT IL-22 mouse Forward Primer GCTTGAGGTGTCCAACTTCCAG IL-22 mouse Reverse Primer ACTCCTCGGAACAGTTTCTCCC ACTB mouse Forward Primer CATTGCTGACAGGATGCAGAAGG ACTB mouse Reverse Primer TGCTGGAAGGTGGACAGTGAGG 4.Cell culture HCT116 and HT29 cells were purchased from ATCC and cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS). The cells were maintained in a humidified incubator at 37°C with 5% CO₂ to ensure optimal growth conditions. The culture medium was refreshed every 48 hours to maintain nutrient levels and remove metabolic waste. When cell confluence reached 70–80%, they were sub-cultured using 0.25% trypsin-EDTA to ensure sustained proliferation and viability for downstream experiments. 5.Sgsup preparation The Sg strain (DSM16831) was obtained from the BeNa Culture Collection (BNCC). After receiving the bacterial strain, it was revived and cultured aerobically in Brain Heart Infusion broth (BHI) medium(Huankai Microbial Sci & Tech Co., Ltd., China) at 37°C. When the bacteria reached the logarithmic growth phase, the suspension was centrifuged at 3000 rpm for 5 minutes to obtain the bacterial culture supernatant. The supernatant was then filtered through a 0.22 µm membrane to ensure sterility, verifying the absence of viable bacteria [ 19 ] . The filtered supernatant was confirmed to be free of viable bacteria by inoculation culture. The supernatant was prepared fresh before each experiment. 6.Cell proliferation assay Cell proliferation was assessed using the Cell Counting Kit-8 (CCK-8) assay ( Biosharp, China), following the manufacturer’s instructions. 1000 cells in 100 µL of cell suspension were added to each well of a 96-well plate. After the cells adhere to the bottom, add 10 uL of Sg sup, BHI medium, or PBS to the wells, respectively. After 8 hours of incubation, 10 µL of CCK8 solution was added to each well and incubated for 1 hour, protected from light. The absorbance value OD450 at 450nm was measured using an enzyme-labeled instrument( Thermo Fisher Scientific, USA). Each intervention was performed with at least 3 replicate wells. The blank control group refers to the absorbance value of wells containing only the medium without any cells. 7.Non-targeted metabolomics Sg sup and BHI blank media were subjected to off-target metabolomics analysis and sequencing was performed by Novogene Co., Ltd. (Beijing, China). A 1 mL sample was lyophilized, mixed with 100 µL of 80% methanol, vortexed, incubated on ice for 5 minutes, and centrifuged at 15,000 × g at 4°C for 15 minutes. The supernatant was diluted to 53% methanol, centrifuged again, and collected for LC-MS analysis. LC-MS was performed using a Hypersil GOLD C18 column at 40°C with a flow rate of 0.2 mL/min. In positive mode, the mobile phases were (A) 0.1% formic acid in water and (B) methanol; in negative mode, (A) 5 mM ammonium acetate (pH 9.0) and (B) methanol. The gradient elution was 2–100% B over 10 minutes, then returned to 2% B over 2 minutes, and held at 100% B. The mass spectrometer operated with a scan range of m/z 100–1500 and the ESI source parameters were set to 3.5 kV spray voltage, 35 psi sheath gas flow, 10 L/min auxiliary gas flow, 320°C capillary temperature, 60 S-lens RF level, and 350°C auxiliary gas heater temperature. Raw data were processed using Compound Discoverer 3.1 (CD3.1) and peaks were extracted using a retention time deviation of 0.2 minutes, mass deviation of 5 ppm, signal intensity deviation of 30%, S/N ratio of 3, and a minimum intensity threshold [ 20 ] . Metabolite identifications were based on matching molecular ions and fragments with mzCloud, mzVault, and MassList databases, excluding those with a coefficient of variation (CV) greater than 30% in quality control samples. Data processing was performed on CentOS 6.6 using R and Python, with differential metabolites identified using thresholds of VIP > 1.0, fold change (FC) > 1.2 or < 0.833, and p-value < 0.05 [ 21 ] . 8. Animal Modeling Eight-week-old female Balb/c mice (approximately 25g) were obtained from the Guangdong Medical Laboratory Animal Center and were kept under specific pathogen-free (SPF) conditions. After a one-week acclimatization period, the azoxymethane/dextran sulfate sodium (AOM/DSS) model for CRC was established. Mice received an intraperitoneal injection of AOM(Sigma-Aldrich, USA) at a dose of 12.5 mg/kg on the first day, followed by the administration of 2% DSS(MP Biomedicals, USA) in their drinking water for 5 days, succeeded by 14 days of regular water intake; this cycle was repeated three times. The experiment was concluded on day 80. During the process, 200 µL intervention was administered by oral gavage every other day, with water being replaced thrice weekly to maintain freshness. All experimental protocols were approved by the relevant ethical committee and adhered to established guidelines to minimize distress, ensuring humane treatment and rigorous monitoring throughout the study [ 22 ] . 9.Mouse Colonoscopy The colonoscopy procedure was performed on mice using a mouse endoscope (KARL STORZ, 26430520-1, Germany) equipped with an IMAGE1 S D3-LINK connection module and a 64301 AA probe (diameter: 1.9 mm, length: 10 cm) with 495 NT fiber optics and a protective probe sleeve (61029 C) of 8.5 cm working length. The camera system was connected to a Display screen for real-time imaging and photographic documentation. Mice were fasted for 24 hours prior to the procedure and anesthetized with 1% sodium pentobarbital administered intraperitoneally and placed in the supine position on a heating pad to maintain body temperature. The anus was lubricated with glycerol, and the endoscope was carefully inserted, with its tip coated to minimize mucosal trauma. The endoscope's position was adjusted to ensure clear visualization of the colonic mucosa, and images of the intestinal lumen were recorded. After completing the examination, the endoscope was gently removed, and the perianal area was cleaned. Mice were monitored closely for any signs of pain or complications. All procedures were conducted by an experienced operator to ensure accuracy and consistency in the results. 10.Flow Cytometry The colon is dissected longitudinally and rinsed thoroughly with cold PBS. Tumor tissue was carefully collected from the colon and digested using a digestive enzyme solution for 30 minutes at 37°C on a shaker. The enzyme solution consisted of 0.5 mg/mL collagenase IV (Roche, Switzerland) and 0.5 mg/mL DNase I (Roche, Switzerland), both dissolved in calcium- and magnesium-free PBS. The digested cell suspension was filtered through a 70 µm cell strainer and resuspended in 1% bovine serum albumin. Single-cell suspensions were prepared by centrifugation at 400 × g for 10 min at 4°C and then resuspended in 1% bovine serum albumin. Antibody staining was performed by adding 1 µL of fluorescent antibodies, including APC anti-mouse CD45 (BioLegend, 103111, USA), APC/Cy7 anti-mouse CD11b (BioLegend, 101226, USA), PE anti-mouse F4/80 (BioLegend, 123109, USA), FITC anti-mouse CD86 ( BioLegend, 105005, USA) and BV421 anti-mouse CD206 (BioLegend, 141717, USA). The mixtures were incubated at 4°C under light protection for 30 min, and the reaction was terminated by the addition of 1% BSA, followed by centrifugation and resuspension in PBS. Stained cells were then analyzed by flow cytometer BD FACS Canto II( BD Biotechnology, USA) and data were processed using FlowJo software. 11. Hematoxylin and Eosin(HE) Staining and Immunohistochemistry(IHC) Staining The colon was isolated and cleaned, then embedded in paraffin in a "Swiss roll" fashion and cut into 4 µm thick sections. HE Staining and IHC staining were performed as described previously [ 23 , 24 ] .Microscopic examination was performed, and ImageJ was used for image analysis. Blind histological scoring was conducted to evaluate the success of the modeling [ 25 ] . Inflammation was assessed using the MCHI scoring criteria, which consisted of the following components:(1) Cupping defects: Scored as 0 points for no defects, 1 point for 50% defects.(2) Crypts: Scored as 0 points for a normal number, 1 point for a decrease of < 10%, and 2 points for a decrease of ≥ 10%. (3) Hyperplasia: Scored as 0 points for no hyperplasia, 1 point for mild increase in crypt length, 2 points for 2–3 times increase in crypt length, and 3 points for > 3 times increase in crypt length.(4) Submucosal inflammatory infiltration: Scored as 0 points for no inflammatory infiltration, 1 point for individual inflammatory cell infiltration, 2 points for more inflammatory cell infiltration, and 3 points for large inflammatory cell infiltration. The total score was calculated as follows: Cupping defects score * 1 + Crypts score * 2 + Hyperplasia score * 2 + Submucosal inflammatory infiltration score * 3 [ 25 ] . 12. RNA sequencing The transcriptome analysis of mouse tumor tissue was performed using RNA sequencing (RNA-seq) technology by PANOMIX Biomedical Tech Co., LTD (Suzhou, China). RNA was first extracted and tested for concentration and purity, mRNA was purified and fragmented to 200–300 bp, followed by the synthesis of cDNA duplexes, construction and amplification of sequencing libraries, and selection of libraries of about 450 bp. After the library was quality checked, Paired-end sequencing was performed using the Illumina HiSeq platform. Sequencing raw data were preliminarily filtered to obtain Clean Data. A reference genome index was constructed using Bowtie2, and Clean Reads were compared to the reference genome using Tophat2. Read Count on each gene was counted by HTSeq and expression was normalized by FPKM. Differentially expressed genes (DEGs) were analyzed using DESeq with the criterion of |log2FoldChange| > 1 and P-value < 0.05. Subsequently, functional enrichment analyses of Gene Ontology (GO) and Kyoto Encyclopedia of the Genome (KEGG) pathways were carried out to identify the biological processes, molecular functions, and signaling pathways associated with DEGs. Data visualization of heatmaps, volcano plots, and bubble plots was performed using the ggplot2 package for the R language [ 26 ] . 13. Statistical Methods Data were analyzed using SPSS 25.0 software (IBM Corp., USA). Descriptive statistics presented means ± standard deviation ( χ ± s). Two-group comparisons with normal distribution used the independent samples t-test, while non-normally distributed data employed the Wilcoxon signed-rank test. Multiple group comparisons utilized one-way ANOVA. Categorical variables were analyzed with the chi-square test, considering P < 0.05 as statistically significant. GraphPad Prism8( GraphPad Software, USA) and Adobe Illustrator 2020( Adobe Inc., USA)were used for Data analysis and visualization. Results 1. A high abundance of Sg was found in CRC tissues by using qPCR, which correlates with tumor location. Patient demographics and clinical characteristics are shown in Table 1 . Sg was detected in 93.5% (43 out of 46) of CRC tissues( both tumor and paraneoplastic normal tissues), with only 3 patients (6.5%) showing no Sg colonization. Notably, the abundance of Sg in tumor tissues was significantly higher than that in the adjacent peritumor normal tissues (P < 0.01)(Fig. 1 a). Table 1 Characteristics of study population. Variables Statistics(%) Variables Statistics(%) Age AJCCstage ≥ 60 30(65.2) 1 6(13.0) <60 16(34.8) 2 22(47.8) Sex 3 4(8.7) Male 27(58.7) 4 14(30.4) Female 19(41.3) Smoking Blood type Yes 9(19.6) A 11(23.9) no 37(80.4) B 16(34.8) Alcohol use O 17(37.0) Yes 5(10.9) AB 2(4.3) No 41(89.1) Tumor location CEA Rectum 21(45.7) Postive 41(93.2) Sigmoid colon 13(28.3) Negtive 3(6.8) Left hemicolon 3(6.5) P53 Right hemicolon 9(19.6) Positive 25(58.1) Tumor size Negative 18(41.9) ≥ 4cm 29(63.0) Ki67 <4cm 17(37.0) ≥ 65% 25(54.3) TNMstage < 65% 21(45.7) T 5-year survival 1 0(0) Live 19(52.8) 2 7(15.2) Dead 17(47.2) 3 12(26.1) Recurrence 4 27(58.7) Yes 13(36.1) N No 23(63.9) 0 31(67.4) Sg in tumor 1 9(19.6) Positive 22(47.8) 2 6(13.0) Negative 24(52.2) M Sg in peritumor 0 32(69.6) Positive 14(30.4) 1 14(30.4) Negative 32(69.6) Based on ΔCT values, the samples were divided into two groups: Sg -positive (high abundance) and Sg -negative (low abundance or test-negative).In tumor tissues, 22 cases(47.8%) were Sg -positive, while 24 cases were negative. In the peritumor normal tissues, 14 cases (30.4%)were Sg -positive, and 32 cases were negative. According to Chi-square tests, there was a significant correlation between Sg abundance in the tumor and adjacent normal tissues (P < 0.001), as well as a correlation with the tumor location (P < 0.01). However, no significant association was observed between Sg abundance and other factors such as age, gender, blood type, tumor size, stage, smoking, alcohol consumption, CEA, P53, Ki67 positivity rate, five-year survival, or recurrence (P > 0.05).(Table 2 ). Table 2 Correlation analysis of Sg abundance and clinical information in tumor and peritumor tissues in CRC patients Variables Sg -neg in tumor(n = 24) Sg -pos in tumor(n = 22) P value Sg -neg in peritumor(n = 32) Sg -pos in peritumor(n = 14) P value Age 0.404 0.447 ≥ 60 17 13 22 8 <60 7 9 10 6 Sex 0.958 0.611 Male 14 13 18 9 Female 10 9 14 5 Blood type 0.385 0.391 A 7 4 9 2 B 7 9 9 7 O 8 9 12 5 AB 2 0 2 0 Tumor location 0.007 0.203 Rectum 11 10 13 8 Sigmoid colon 11 2 12 1 Left hemicolon 1 2 2 1 Right hemicolon 1 8 5 4 Tumor size 0.193 0.436 ≥ 4cm 13 16 19 10 <4cm 11 6 13 4 TNM stage T 0.422 0.867 1 0 0 0 0 2 4 3 5 2 3 8 4 9 3 4 12 15 18 9 N 0.696 0.733 0 15 16 21 10 1 5 4 6 3 2 4 2 5 1 M 0.845 0.607 0 17 15 23 9 1 7 7 9 5 AJCCstage 0.251 0.577 1 3 3 4 2 2 10 12 15 7 3 4 0 4 0 4 7 7 9 5 Smoking 0.605 0.308 Yes 4 5 5 4 no 20 17 27 10 Alcohol use 0.564 0.591 Yes 2 3 4 1 No 22 19 28 13 CEA 0.496 0.882 Postive 22 19 29 12 Negtive 1 2 2 1 P53 0.697 0.987 Positive 14 11 18 7 Negative 9 9 13 5 Ki67 0.080 0.301 ≥ 65% 16 9 19 6 < 65% 8 13 13 8 5-year survival 0.463 0.847 Live 10 9 14 5 Dead 11 6 13 4 Recurrence 0.587 0.636 Yes 8 5 10 3 No 12 11 16 7 Sg in tumor - 0.000 Positive - - 8 14 Negative - - 24 0 Sg in peritumor 0.000 - Positive 0 14 - - Negative 24 8 - - Note: P < 0.05 is considered statistically significant. 2. Sg sup promotes CRC cell proliferation and its component analysis To explore the potential pathogenic effects of Sg on CRC, the supernatant of Sg culture ( Sg sup) was extracted for further study. Sg sup was added to HCT116 and HT29 cells to evaluate its impact on cell proliferation. Results indicated that neither the PBS group nor the BHI( Media for the cultivation of Sg ) group exercised a noteworthy influence on cell proliferation in both HCT116 and HT29 cells(Fig. 1 b). However, when compared to the PBS control group, Sg sup administration resulted in a considerable significant increase in proliferation for both HCT116 and HT29 cells(Fig. 1 b). Furthermore, non-target metabolomics analysis of the supernatant revealed significant alterations in metabolite levels. Specifically, Sgsup contained 851 metabolites that were markedly different from the blank medium, with 67 metabolites exhibiting up-regulation and 13 showing down-regulation(Fig. 1 c). Notably, inosine-5'-monophosphate (IMP), methionine, uridine, and creatine levels were observed to be significantly higher in Sg sup(Fig. 1 d-g). 3. Sg sup promotes colon tumor progression, exacerbates inflammation, and promotes macrophage M2 polarisation in AOM/DSS mice Colonic tumor growth in mice was observed using mouse endoscopy. Healthy mice exhibited a smooth circular area with pale pink intestinal mucosa, normal vascular structure, and smooth translucent mucosal surface. In contrast, AOM/DSS-induced CRC mice displayed intestinal masses of varying sizes, reduced intestinal wall translucency, and loss of normal vascular structures(Fig. 2 a). Dissecting the mouse colon at the end of the study revealed masses (confirmed as tumors by HE staining) in all groups except the normal group, with a significant increase in size and number of colon tumors in the Sg sup group(Fig. 2 b). Statistical analysis showed a significant increase in tumor count(Fig. 2 e) and tumor load(Fig. 2 f) after Sg sup intervention compared to the model group. The weight of mice in the normal group increased steadily, while the model group showed a significant decrease, and the Sg sup group exhibited a significant weight loss in the first week of DSS administration(Fig. 2 c). The length of the colon was significantly shortened after the Sg sup intervention(Fig. 2 g and Fig. 2 h). HE staining revealed that the normal mouse colon was composed of mucosal, submucosal, muscular, and plasma layers. In the normal group, glands were neatly arranged, with intact crypts and cup-shaped cells at the base. AOM/DSS-treated mice exhibited varying degrees of dysplasia. Mild dysplasia showed disorganized glands with heterogeneous cells and deeply stained nuclei. Low-grade heterogeneous hyperplasia (early adenomas) displayed deeply stained cells with pseudocomplexed nuclei without deeper gland involvement. High-grade heterogeneous hyperplasia (carcinoma in situ) showed sieved or fused crypts and complete loss of nuclear polarity. Invasive carcinomas displayed cancer cells crossing the basal lamina and infiltrating beneath the lamina propria(Fig. 2 a). Regarding inflammatory conditions, the DAI scores on the day with the most significant weight loss revealed notably higher scores in the Sg sup group(Fig. 3 b).In the normal group of mice, the colonic epithelial structure remained intact without ulceration and no submucosal inflammatory cell infiltration. However, the model group exhibited increased chronic inflammatory cells, as well as lymphoid follicular hyperplasia. The Sg sup group showed irregularities in subepithelial crypts and visible ulcerated surfaces(Fig. 3 a). Subsequent histological inflammation scoring demonstrated increased inflammation in the Sg sup group compared to the model group(Fig. 3 c). Furthermore, RT-qPCR analysis of mouse colon tumor tissues revealed up-regulation of inflammatory factors, namely PTGS2(Fig. 3 d), IL-6(Fig. 3 e), IL-1β(Fig. 3 f), and IL-8(Fig. 3 g) after Sg sup intervention as compared to the model group. Immunohistochemical staining revealed an increased expression of the macrophage signature molecule F4/80 in tumors after Sg sup intervention, as compared to the model group. Notably, there was a substantial increase in the expression of the M2 polarization marker CD206, whereas the expression of the M1 polarization marker CD86 was relatively lower(Fig. 4 a). Additional analysis through flow cytometry further corroborated these findings, demonstrating that Sgsup intervention led to an increased proportion of macrophages in mouse tumors, favoring polarization towards M2 and subsequently reducing the M1/M2 ratio as compared to the model group(Fig. 4 b- Fig. 4 g). 4.The mechanism of effect of Sg sup to promote CRC is revealed to be related to the IL17 pathway. In order to investigate the specific manner in which Sg sup promotes CRC development, RNA-seq sequencing analyses were carried out on tumor tissues obtained from mice. The findings revealed noteworthy variationsin gene expression, with 68 genes being up-regulated and 47 genes being down-regulated when compared to the model group(Fig. 5 a and Fig. 5 b). Additionally, KEGG pathway enrichment analysis pinpointed the IL-17 signaling pathway as the most considerably enriched (Fig. 5 c). To further validate the RNA-seq data, the expression levels of IL-17 pathway-related factors were assessed. These assessments showed no statistical differences in the expression levels of IL-17A among the three groups of mice (Fig. 5 d). However, following intervention with Sg sup, notable elevations were observed in the expression of IL-17F(Fig. 5 e) and IL-22(Fig. 5 f)as compared to the model group. Discussion Numerous studies have solidified a strong association between Sg infection and CRC [ 27 – 29 ] . Sg , a commensal in the healthy gut's ileal region, significantly influences host metabolism and immunity [ 30 , 31 ] . However, altered intestinal microecology due to bacterial overgrowth may modulate disease progression [ 32 ] . Sg detection in colon tissue and feces escalates during gut inflammation. Prior cross-regional investigations reported varying Sg positivity rates in tumor tissues( 3.2–74%) [ 8 , 11 , 12 , 28 , 29 , 33 – 35 ] , possibly due to diverse sampling populations and detection methods. This study utilized Sg -specific qPCR to assess Sg content in tumor and adjacent tissues of 46 CRC patients, identifying Sg colonization in 93.5% of cases. Tumor tissues exhibited notably higher Sg abundance than adjacent normal tissues, consistent with earlier findings. Additionally, this study unveiled a correlation between Sg abundance and tumor location, though unrelated to age, gender, blood type, tumor size, stage, smoking, alcohol, survival, CEA, P53, Ki67, or recurrence. Earlier studies have found that Sg promotes the proliferation of CRC cells. Sg promotes cell proliferation in the human CRC cell lines HCT116, HT29, and LoVo, whereas for the human CRC cell lines SW480 and SW1116, human normal colon epithelial cell lines FHC and CCD 841 CoN, human renal epithelial cells HEK293 and human lung cancer cell line A549 had no significant effect on cell proliferation [ 12 ] . Some studies believed that Sg sup could not promote CRC cell proliferation, which means that direct contact of bacteria with the cells is required for its effect [ 12 ] . However, other studies have suggested that Sg sup can promote the proliferation and migration of CRC cells [ 16 , 17 ] .This study revealed that Sg supcould promote the proliferation of CRC cells HCT116 and HT29, underscoring Sg 's capacity to secrete specific bioactive substances that facilitate CRC progression. To explore its specific pathogenic components, Sg supwas subjected to off-target metabolomics analysis, and it was found that IMP, methionine, uridine, and creatine levels appeared to be significantly increased compared to the blank medium. Increased levels of IMP could enhance the availability of purine nucleotides, supporting the rapid DNA and RNA synthesis required by proliferating tumor cells [ 36 ] . Increased uridine can support the synthesis of RNA, which is crucial for protein synthesis and cell growth. This could support tumor cell proliferation, particularly in cancers where RNA synthesis is upregulated [ 37 ] . Elevated methionine levels can increase S-adenosylmethionine (SAM), the primary methyl donor in the body. Increased SAM can lead to hypermethylation of DNA and histones, which can silence tumor suppressor genes or activate oncogenes, potentially promoting cancer progression [ 38 ] . Creatine is a nitrogenous organic acid that occurs naturally in mammals, and it plays a key role in thermogenesis, immune function, and cancer cell survival [ 39 ] . Previous studies considered creatine and its analog cyclic creatine to be oncogenic metabolites. However, emerging research suggests that creatine has a promoting effect on tumor progression [ 40 ] .Creatine could promote invasion and metastasis in pancreatic, colorectal, and breast cancers [ 41 ] . Creatine acts as a non-dependent energy buffer during high ATP demand, phosphorylating ADP to ATP through phosphocreatine, thus mitigating transient increases in energy expenditure [ 42 – 44 ] . CRC cells secrete creatine kinase brain type, which synergizing with hepatocyte-derived creatine, generates phosphocreatine in the extracellular space. This phosphocreatine is then taken up by CRC cells, supporting their metastatic survival in the liver [ 42 ] .Also, knockdown of Slc6a8, a creatine transporter, in macrophages, impedes creatine uptake and depletes creatine abundance, resulting in a significant reduction in M2-like effector function in vivo [ 45 ] . Creatine supplementation modulates macrophage polarization by inhibiting the IFNγ-JAK-STAT1-iNOS axis and promoting the IL-4-STAT6-ARG1 axis, thereby inhibiting M1-like polarization and promoting M2-like polarization [ 39 ] . Additionally, creatine endocytosis is heightened in M2-like macrophages compared to M1-like macrophages, suggesting creatine's involvement in a feed-forward loop that shifts macrophage homeostasis towards an M2-like state [ 39 ] . Building on these findings, this study conducted in vivo experiments. Utilizing mouse endoscopy, observations depicted the smooth and translucent pink intestinal lumen in the normal group and flatter intestinal lesions, possibly indicating early-stage tumor alteration in the model group. Notably, administration of Sg sup led to significantly enlarged and irregularly raised intestinal tumors in mice, indicative of advanced-stage alterations. The increase in colorectal tumor number, tumor load, and inflammation in the mice after Sgsup intervention suggests a role for Sgsup in tumorigenesis and inflammatory escalation in AOM/DSS mice.The gastrointestinal tract possesses the largest number of macrophages. On the one hand, it recruits regulatory T cells(Tregs) by secreting chemokines, thus promoting tumor immunosuppression [ 46 – 48 ] . On the other hand, TAM also plays a role in the interaction with the microbiota through different metabolic pathways. Notably, a close interplay between macrophages, gut bacteria, and tumor promotion has been observed. Intestinal microbiota can incite chemokine production via LPS, promoting monocyte-like macrophage accumulation and generating an inflammatory milieu conducive to colitis-associated tumorigenesis [ 49 ] . Crucially, macrophage depletion completely nullifies the pro-tumorigenic effects of dysbiotic gut bacterial ecology, underscoring the symbiotic interdependence between bacteria and macrophages for tumor development [ 50 ] . Furthermore, macrophages drive alterations in the CRC-associated microbiota. For instance, Fusobacterium nucleatum instigates the recruitment of M2 macrophages and MDSCs, culminating in an immunosuppressive tumor microenvironment that facilitates tumor progression [ 51 ] . Early stages of CRC initiation typically manifest within the inflamed epithelial stroma, dominated by pro-inflammatory M1 macrophages, which generate reactive oxygen species, leading to oncogene activation in adjacent epithelial cells [ 52 ] . Subsequently, tumorigenesis attracts additional bone marrow-derived monocytes, secreting growth factors and chemokines like CCL2, CCL5, VEGF, and TGF-β, which encourages TAM transformation into the cancer-promoting M2 phenotype, fueling advanced CRC growth and progression. Sg hasbeen demonstrated to have prolonged survival within macrophages compared to other bacteria, triggering specific cytokine expression and minimizing macrophage lysis [ 53 ] . Furthermore, Sg selectively recruits tumor-infiltrating myeloid cells, encompassing bone marrow-derived suppressor cells, TAMs, and dendritic cells [ 18 ] . This study unveiled increased M2-type macrophage infiltration in mouse tumor tissues after Sg sup intervention. This suggests that Sg sup may facilitate immunosuppression by recruiting TAMs, thereby bolstering tumor development. A potential pathway enriched by RNA-seqis the IL-17 signaling pathway. The IL-17 pathway is activated by the IL-17 family of cytokines, produced by various immune cells such as helper T cells 17(Th17), γδ T cells, natural killer( NK) cells, and innate lymphocytes [ 54 ] . IL-17 exerts its biological role by binding to the IL-17 receptor (IL-17R) expressed in multiple cell types, including epithelial cells, endothelial cells, fibroblasts, and immune cells. This activation triggers downstream signaling pathways, including NF-kB and MAPK, promoting the recruitment of immune cells to the site of infection or inflammation [ 55 ] . IL-17 can induce the expression of various cytokines like IL-6, IL-1β, IL-8, and PTGS2. These factors stimulate further IL-17 production, contributing to the activation of the IL-17 pathway in CRC, and creating a positive feedback loop that exacerbates inflammation and tumor growth [ 56 ] . Studies have shown the presence of IL-17 and Th17 cells in a wide range of tumors, promoting tumor growth and metastasis through diverse mechanisms [ 56 – 58 ] . The IL-17 pathway has been demonstrated to promote tumor angiogenesis, inhibit anti-tumor immunity, and enhance tumor cell survival and proliferation [ 59 ] . IL-17F, a major modulator of the intestinal commensal microbiota, is constitutively expressed in the gut and induces the production of antimicrobial peptides [ 60 ] .Fusobacterium nucleatum, known for its association with chronic inflammation and cancer, aggravates intestinal inflammation in mice through activation of the IL-17F / NF-κB pathway [ 61 ] . In this study, after Sg sup intervention, both IL-17F and IL-22 showed significant upregulation in expression, while IL-17A displayed a trend towards downregulation, though not statistically significant. IL-17A is known to inhibit colitis development by maintaining intestinal mucosal integrity, whereas IL-17F is pro-inflammatory [ 61 ] . This evidence has been confirmed in humans, where elevated IL-17F mRNA is observed in colon biopsies of ulcerative colitis patients, contributing to a localized inflammatory environment along with factors like IL-6 [ 61 ] . Microbiota-induced IL-17A has been linked to the pathogenesis of various cancers including colon, breast, pancreatic, and ovarian cancers, and multiple myeloma [ 62 ] . However, the precise role of IL-17A in different cancers remains incompletely understood. Th17 cells, in melanoma and ovarian cancer, activate anti-tumor cytotoxic T-cell responses [ 63 ] , but they exhibit tumorigenic properties in various mouse models of CRC [ 64 , 65 ] , hepatocellular carcinoma [ 66 , 67 ] , and pancreatic cancer [ 68 ] . Overall, these analyses suggest that Sg sups might induce heightened inflammation and promote CRC development through the IL-17 pathway.Recently, studies have shed light on the interaction between the IL-17 pathway and macrophage polarization, particularly the polarization of macrophages towards the M2 phenotype. Research indicates that IL-17could promote macrophage M2 polarization [ 69 ] .Past studies have shown that IL-17A can directly activate macrophages [ 70 ] . In colitis, IL-17 induces the emergence of M2-like subpopulations of macrophages, which protect against the development of severe colitis [ 71 ] . IL-17A is likely to be a stimulus inducing the pathogenic polarization of macrophages into the M2 phenotype by first acting on the endometriotic lesion [ 72 ] . In addition, IL-17 can promote M2 macrophage differentiation indirectly by stimulating the COX-2/PGE2 pathway in cancer cells, thus playing an indirect role in regulating the tumor immune microenvironment [ 73 ] . In summary, this study investigated Sg colonization using tumor and adjacent normal tissues from CRC patients. It revealed a significant correlation between the abundance of Sg in tumor tissues and tumor location. The Sg sup was shown to promote CRC development, recruit tumor macrophages, and promote M2 polarization, and the mechanism was found to be possibly related to the IL-17 pathway by transcriptome analysis.However, it's important to note that the patient samples in this study were limited to a small sample size from a single center, necessitating a broader sample collection for comprehensive analysis. Additionally, further fundamental experiments are warranted to fully elucidate the molecular mechanisms underlying Sg sup-mediated promotion of CRC development. In conclusion, this study underscores the potential of Sg sup as a promotive factor in CRC progression, presenting it as a prospective target for CRC prevention and treatment. Declarations Data Availability Statement The original contributions presented in this study are included in the article, further inquiries can be directed to the corresponding author/s. Ethics declarations The studies involving human participants were reviewed and approved by Guangzhou First People’s Hospital, Guangzhou, China. The patients/participants provided their written informed consent to participate in this study. The animal study was reviewed and approved by Guangdong Medical Laboratory Animal Center (GDMLAC; Certificate number SYXK 2022-0002). All subsequent studies were performed in accordance with the guidelines approved by the Animal Ethics Committee of GDMLAC. Contributions J-QW an YZ designed the study and drafted the manuscript. JX, XN CH and H-LZ, H-MX involved in statistical analysis and interpretation of the data; M-ZZ and XG participated the animal experiments and recorded general status; YZ performed the sample collection and DNA extraction; YZ and H-MX collected the patient clinical and follow-up information; W-JQ and H-MX conducted mouse colonoscopy; Y-QN and Y-LZ planned and directed the project, and contributed to interpretation of the data, and revision of the article. Funding This work was supported by the National Natural Science Foundation of China (82270577, 82203371, 82370552); Natural Science Foundation of Guangdong Province (2023A1515030214), and Yuqiang Nie Key Laboratory of Digestive Diseases in 2022-2023 (KY17010003). Conflict of interest The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. References Sung H, Ferlay J, Siegel R L, Laversanne M, Soerjomataram I, Jemal A, Bray F. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries[J]. CA: a cancer journal for clinicians, 2021, 71(3): 209–249. Stidham R W ; H Peter D R. Colorectal Cancer in Inflammatory Bowel Disease[J]. Clinics in Colon and Rectal Surgery, 2018, 31(03): 168–178. Rebersek M. Gut microbiome and its role in colorectal cancer[J]. BMC cancer, 2021, 21(1): 1–13. Ahn J, Sinha R, Pei Z, Dominianni C, Wu J, Shi J, Goedert J J, Hayes R B, Yang L. Human gut microbiome and risk for colorectal cancer[J]. Journal of the National Cancer Institute, 2013, 105(24): 1907–1911. McCoy W, Mason 3rd J. Enterococcal endocarditis associated with carcinoma of the sigmoid; report of a case[J]. Journal of the Medical Association of the State of Alabama, 1951, 21(6): 162–166. Pardo C P, Gonzalez R C, Pinto M E S, Galiana A. Chapter 3 - Streptococcus gallolyticus and its implication in colorectal cancer[M]. FLOCH M H. //Colorectal Neoplasia and the Colorectal Microbiome. Academic Press,2020: 35–55. Grinberg M, Mansur A, Ferreira D, Bellotti G, Pileggi F. Endocarditis caused by Streptococcus bovis and colorectal neoplasms[J]. Arquivos brasileiros de cardiologia, 1990, 54(4): 265–269. Boleij A, Van Gelder M M, Swinkels D W, Tjalsma H. Clinical Importance of Streptococcus gallolyticus infection among colorectal cancer patients: systematic review and meta-analysis[J]. Clinical Infectious Diseases, 2011, 53(9): 870–878. Corredoira-Sánchez J, García-Garrote F, Rabuñal R, López-Roses L, García-País M J, Castro E, González-Soler R, Coira A, Pita J, López-Álvarez M J, Alonso M P, Varela J. Association Between Bacteremia Due to Streptococcus gallolyticus subsp. gallolyticus (Streptococcus bovis I) and Colorectal Neoplasia: A Case-Control Study[J]. Clinical Infectious Diseases, 2012, 55(4): 491–496. Klein R S, Recco R A, Catalano M T, Edberg S C, Casey J I, Steigbigel N H. Association of Streptococcus bovis with carcinoma of the colon[J]. New England Journal of Medicine, 1977, 297(15): 800–802. Abdulamir A S, Hafidh R R, Bakar F A. Molecular detection, quantification, and isolation of Streptococcus gallolyticus bacteria colonizing colorectal tumors: inflammation-driven potential of carcinogenesis via IL-1, COX-2, and IL-8[J]. Molecular cancer, 2010, 9(1): 1–18. Kumar R, Herold J L, Schady D, Davis J, Kopetz S, Martinez-Moczygemba M, Murray B E, Han F, Li Y, Callaway E, Others. Streptococcus gallolyticus subsp. gallolyticus promotes colorectal tumor development[J]. PLoS pathogens, 2017, 13(7): e1006440. Dumke J, Vollmer T, Akkermann O, Knabbe C, Dreier J. Case-control study: Determination of potential risk factors for the colonization of healthy volunteers with Streptococcus gallolyticus subsp. gallolyticus[J]. PLoS One, 2017, 12(5): e0176515. Abdulamir A S, Hafidh R R, Mahdi L K, Al-Jeboori T, Abubaker F. Investigation into the controversial association of Streptococcus gallolyticus with colorectal cancer and adenoma[J]. BMC cancer, 2009, 9(1): 1–12. Wong S H, Yu J. Gut microbiota in colorectal cancer: mechanisms of action and clinical applications[J]. Nature Reviews Gastroenterology & Hepatology, 2019, 16(11): 690–704. Taylor J C, Gao X, Xu J, Holder M, Petrosino J, Kumar R, Liu W, Höök M, Mackenzie C, Hillhouse A, Others. A type VII secretion system of Streptococcus gallolyticus subsp. gallolyticus contributes to gut colonization and the development of colon tumors[J]. PLoS pathogens, 2021, 17(1): e1009182. Taddese R, Garza D R, Ruiter L N, De Jonge M I, Belzer C, Aalvink S, Nagtegaal I D, Dutilh B E, Boleij A. Growth rate alterations of human colorectal cancer cells by 157 gut bacteria[J]. Gut Microbes, 2020, 12(1): 1799733. Zhang Y, Weng Y, Gan H, Zhao X, Zhi F. Streptococcus gallolyticus conspires myeloid cells to promote tumorigenesis of inflammatory bowel disease[J]. Biochemical and biophysical research communications, 2018, 506(4): 907–911. Hahn M W. Broad diversity of viable bacteria in ‘sterile’ (0.2 μm) filtered water[J]. Research in Microbiology, 2004, 155(8): 688–691. Dai W, Xie D, Lu M, Li P, Lv H, Yang C, Peng Q, Zhu Y, Guo L, Zhang Y, Tan J, Lin Z. Characterization of white tea metabolome: Comparison against green and black tea by a nontargeted metabolomics approach[J]. Food Research International (Ottawa, Ont.), 2017, 96: 40–45. Sreekumar A, Poisson L M, Rajendiran T M, Khan A P, Cao Q, Yu J, Laxman B, Mehra R, Lonigro R J, Li Y, Nyati M K, Ahsan A, Kalyana-Sundaram S, Han B, Cao X, Byun J, Omenn G S, Ghosh D, Pennathur S, Alexander D C, Berger A, Shuster J R, Wei J T, Varambally S, Beecher C, Chinnaiyan A M. Metabolomic profiles delineate potential role for sarcosine in prostate cancer progression[J]. Nature, 2009, 457(7231): 910–914. Liang J, Yang C, Li P, Zhang M, Xie X, Xie X, Chen Y, Wang Q, Zhou L, Luo X. Astragaloside IV inhibits AOM/DSS-induced colitis-associated tumorigenesis via activation of PPARγ signaling in mice[J]. Phytomedicine: International Journal of Phytotherapy and Phytopharmacology, 2023, 121: 155116. Feldman A T, Wolfe D. Tissue processing and hematoxylin and eosin staining[J]. Methods in Molecular Biology (Clifton, N.J.), 2014, 1180: 31–43. Magaki S, Hojat S A, Wei B, So A, Yong W H. An Introduction to the Performance of Immunohistochemistry[J]. Methods in molecular biology (Clifton, N.J.), 2019, 1897: 289–298. Koelink G R Pim J Wildenberg, Manon E Stitt, Larry W Feagan, Brian G Koldijk, Martinvan ’t Wout, Angelique B Atreya, RajaVieth, MichaelBrandse, Johannan F Duijst, Suzannete Velde, Anje A D’Haens, Geert R A M Levesque, Barrett G van den Brink. Development of Reliable, Valid and Responsive Scoring Systems for Endoscopy and Histology in Animal Models for Inflammatory Bowel Disease[J]. Journal of Crohn’s & colitis, 2018, 12(7). Trapnell C, Hendrickson D G, Sauvageau M, Goff L, Rinn J L, Pachter L. Differential analysis of gene regulation at transcript resolution with RNA-seq[J]. Nature Biotechnology, 2013, 31(1): 46–53. Boleij A, Van Gelder M M H J, Swinkels D W, Tjalsma H. Clinical Importance of Streptococcus gallolyticus Infection Among Colorectal Cancer Patients: Systematic Review and Meta-analysis[J]. Clinical Infectious Diseases, 2011, 53(9): 870–878. Juan C S, Fernando G G, Ramón R, Leopoldo L R, Jose G, Elena C, Roberto G S, Amparo C, Julia P, Jose L. Association between bacteremia due to Streptococcus gallolyticus subsp. gallolyticus (Streptococcus bovis I) and colorectal neoplasia: a case-control study.[J]. Clinical Infectious Diseases, 2012(4): 491–496. Ewa P K, Mariana M, Laetitia A, Shaynoor D. Significance of Streptococcus gallolyticus subsp. gallolyticus Association With Colorectal Cancer[J]. Frontiers in Microbiology, 2018, 9: 614. Booijink C C, El-Aidy S, Rajilić-Stojanović M, Heilig H G, Troost F J, Smidt H, Kleerebezem M, De Vos W M, Zoetendal E G. High temporal and inter-individual variation detected in the human ileal microbiota[J]. Environmental microbiology, 2010, 12(12): 3213–3227. Pardo C P, Gonzalez R C, Pinto M, Galiana A. Streptococcus gallolyticus and its implication in colorectal cancer[J]. Colorectal Neoplasia and the Colorectal Microbiome, 2020. Drewes J L, Domingue J C, Housseau F. Microbiota, mucosal immunity, and Colon cancer - ScienceDirect[J]. Colorectal Neoplasia and the Colorectal Microbiome, 2020: 157–209. Abdulamir A S, Hafidh R R, Bakar F A. The association of Streptococcus bovis/gallolyticus with colorectal tumors: The nature and the underlying mechanisms of its etiological role[J]. Journal of Experimental & Clinical Cancer Research, 2011, 30(1): 11. Jessika D, Tanja V, Oke A, Cornelius K, Jens D, Jose M C. Case-control study: Determination of potential risk factors for the colonization of healthy volunteers with Streptococcus gallolyticus subsp. gallolyticus[J]. PLoS ONE, 2017, 12(5): e0176515. Maria A F, Antonio G, Victoria S H, Enrique O, Eva H I, Pilar L G, Adela C, Isabel C M, Manuel B V, Josefa G D. Streptococcus gallolyticus infection in colorectal cancer and association with biological and clinical factors[J]. Plos One, 2017, 12(3): e0174305. Kofuji S, Hirayama A, Eberhardt A O, Kawaguchi R, Sugiura Y, Sampetrean O, Ikeda Y, Warren M, Sakamoto N, Kitahara S, Yoshino H, Yamashita D, Sumita K, Wolfe K, Lange L, Ikeda S, Shimada H, Minami N, Malhotra A, Morioka S, Ban Y, Asano M, Flanary V L, Ramkissoon A, Chow L M L, Kiyokawa J, Mashimo T, Lucey G, Mareninov S, Ozawa T, Onishi N, Okumura K, Terakawa J, Daikoku T, Wise-Draper T, Majd N, Kofuji K, Sasaki M, Mori M, Kanemura Y, Smith E P, Anastasiou D, Wakimoto H, Holland E C, Yong W H, Horbinski C, Nakano I, DeBerardinis R J, Bachoo R M, Mischel P S, Yasui W, Suematsu M, Saya H, Soga T, Grummt I, Bierhoff H, Sasaki A T. IMP dehydrogenase-2 drives aberrant nucleolar activity and promotes tumorigenesis in glioblastoma[J]. Nature cell biology, 2019, 21(8): 1003–1014. Nwosu Z C, Ward M H, Sajjakulnukit P, Poudel P, Ragulan C, Kasperek S, Radyk M, Sutton D, Menjivar R E, Andren A, Apiz-Saab J J, Tolstyka Z, Brown K, Lee H-J, Dzierozynski L N, He X, Ps H, Ugras J, Nyamundanda G, Zhang L, Halbrook C J, Carpenter E S, Shi J, Shriver L P, Patti G J, Muir A, Pasca Di Magliano M, Sadanandam A, Lyssiotis C A. Uridine-derived ribose fuels glucose-restricted pancreatic cancer[J]. Nature, 2023, 618(7963): 151–158. Sanderson S M, Gao X, Dai Z, Locasale J W. Methionine metabolism in health and cancer: a nexus of diet and precision medicine[J]. Nature Reviews. Cancer, 2019, 19(11): 625–637. Kazak L, Cohen P. Creatine metabolism: energy homeostasis, immunity and cancer biology[J]. Nature Reviews Endocrinology, 2020, 16(8): 421–436. Zhang L, Bu P. The two sides of creatine in cancer[J]. Trends in Cell Biology, 2022, 32(5): 380–390. Zhang L, Zhu Z, Yan H, Wang W, Wu Z, Zhang F, Zhang Q, Shi G, Du J, Cai H, Zhang X, Hsu D, Gao P, Piao H-L, Chen G, Bu P. Creatine promotes cancer metastasis through activation of Smad2/3[J]. Cell Metabolism, 2021, 33(6): 1111-1123.e4. MacPherson R E K, Gamu D, Frendo-Cumbo S, Castellani L, Kwon F, Tupling A R, Wright D C. Sarcolipin knockout mice fed a high-fat diet exhibit altered indices of adipose tissue inflammation and remodeling[J]. Obesity (Silver Spring, Md.), 2016, 24(7): 1499–1505. Kurmi K, Hitosugi S, Yu J, Boakye-Agyeman F, Wiese E K, Larson T R, Dai Q, Machida Y J, Lou Z, Wang L, Boughey J C, Kaufmann S H, Goetz M P, Karnitz L M, Hitosugi T. Tyrosine Phosphorylation of Mitochondrial Creatine Kinase 1 Enhances a Druggable Tumor Energy Shuttle Pathway[J]. Cell Metabolism, 2018, 28(6): 833-847.e8. Fenouille N, Bassil C F, Ben-Sahra I, Benajiba L, Alexe G, Ramos A, Pikman Y, Conway A S, Burgess M R, Li Q, Luciano F, Auberger P, Galinsky I, DeAngelo D J, Stone R M, Zhang Y, Perkins A S, Shannon K, Hemann M T, Puissant A, Stegmaier K. The creatine kinase pathway is a metabolic vulnerability in EVI1-positive acute myeloid leukemia[J]. Nature Medicine, 2017, 23(3): 301–313. Ji L, Zhao X, Zhang B, Kang L, Song W, Zhao B, Xie W, Chen L, Hu X. Slc6a8-Mediated Creatine Uptake and Accumulation Reprogram Macrophage Polarization via Regulating Cytokine Responses[J]. Immunity, 2019, 51(2): 272-284.e7. Jaehong K, Jong-Sup B. Tumor-Associated Macrophages and Neutrophils in Tumor Microenvironment[J]. Mediators of Inflammation, 2016, 2016: 1–11. Fridman W H, Pagès F, Sautès-Fridman C, Galon J. The immune contexture in human tumours: impact on clinical outcome[J]. Nature Reviews Cancer, 2012, 12(4): 298–306. Yang L, Zhang Y. Tumor-associated macrophages: from basic research to clinical application[J]. Journal of Hematology & Oncology, 2017, 10(1): 1–12. Qin H XialiGu, YuLiu, TianyuWang, ChenZhong, WeilongWang, BangmaoCao. Gut mycobiome: A promising target for colorectal cancer[J]. Biochimica et biophysica acta. Reviews on cancer, 2021, 1875(1): 188489. Yang Y, Li L, Xu C, Wang Y, Qiu F. Cross-talk between the gut microbiota and monocyte-like macrophages mediates an inflammatory response to promote colitis-associated tumourigenesis[J]. Gut, 2020, 70(8). Chen T, Li Q, Wu J, Wu Y, Peng W, Li H, Wang J, Tang X, Peng Y, Fu X. Fusobacterium nucleatum promotes M2 polarization of macrophages in the microenvironment of colorectal tumours via a TLR4-dependent mechanism.[J]. Cancer immunology, immunotherapy : CII, 2018, 67(10): 1635–1646. Wang H, Tian T, Zhang J. Tumor-Associated Macrophages (TAMs) in Colorectal Cancer (CRC): From Mechanism to Therapy and Prognosis[J]. International Journal of Molecular Sciences, 2021, 22(16): 8470. Cui L, Li K, Zhou Y Y, Zhang T, Li T. Correlations of Tumor-associated Macrophage Subtypes with Liver Metastases of Colorectal Cancer[J]. Asian Pacific Journal of Cancer Prevention Apjcp, 2013, 14(2): 1003–1007. Padova F D, Ryffel B, Quesniaux V. IL-17, IL-22 and Their Producing Cells: Role in Inflammation and Autoimmunity[M]. IL-17, IL-22 and Their Producing Cells: Role in Inflammation and Autoimmunity,2013. Nawrocka A, Owczarek W, Pilu A. Th17 cells and Th17-cytokines in the pathogenesis of inflammatory diseases[J]. International Review of Allergology and Clinical Immunology, 2011, 17(1): 27–31. McGeachy M J, Cua D J, Gaffen S L. The IL-17 family of cytokines in health and disease[J]. Immunity, 2019, 50(4): 892–906. Pan Y, Yang W, Tang B, Wang X, Zhang Q, Li W, Li L. The protective and pathogenic role of Th17 cell plasticity and function in the tumor microenvironment[J]. Frontiers in Immunology, 2023, 14: 1192303. Numasaki M. Interleukin-17 promotes angiogenesis and tumor growth[J]. Blood, 2003, 101(7): 2620–2627. Brevi A, Cogrossi L L, Grazia G, Masciovecchio D, Impellizzieri D, Lacanfora L, Grioni M, Bellone M. Much More Than IL-17A: Cytokines of the IL-17 Family Between Microbiota and Cancer[J]. Frontiers in Immunology, 2020, 11: 565470. Ishigame H, Kakuta S, Nagai T, Kadoki M, Nambu A, Komiyama Y, Fujikado N, Tanahashi Y, Akitsu A, Kotaki H, Sudo K, Nakae S, Sasakawa C, Iwakura Y. Differential Roles of Interleukin-17A and -17F in Host Defense against Mucoepithelial Bacterial Infection and Allergic Responses[J]. Immunity, 2009, 30(1): 108–119. Chen Y, Chen Y, Cao P, Su W, Dong W. Fusobacterium nucleatum facilitates ulcerative colitis through activating IL‐17F signaling to NF‐κB via the upregulation of CARD3 expression[J]. The Journal of Pathology, 2020, 250(2). Vitiello G A, Miller G. Targeting the interleukin-17 immune axis for cancer immunotherapy[J]. The Journal of Experimental Medicine, 2020, 217(1): e20190456. Martin-Orozco N, Muranski P, Chung Y, Yang X O, Yamazaki T, Lu S, Hwu P, Restifo N P, Overwijk W W, Chen D. T helper 17 cells promote cytotoxic T cell activation in tumor immunity.[J]. Immunity, 2009, 31(5): 787–798. Wang L, Yi T, Kortylewski M, Pardoll D M, Zeng D, Yu H. IL-17 can promote tumor growth through an IL-6-Stat3 signaling pathway[J]. The Journal of Experimental Medicine, 2009, 206(7): 1457–1464. Xu M, Pokrovskii M, Ding Y, Yi R, Au C, Harrison O J, Galan C, Belkaid Y, Bonneau R, Littman D R. c-MAF-dependent regulatory T cells mediate immunological tolerance to a gut pathobiont[J]. Nature, 2018, 554(7692): 373–377. Gomes A L, Teijeiro A, Burén S, Tummala K S, Yilmaz M, Waisman A, Theurillat J-P, Perna C, Djouder N. Metabolic Inflammation-Associated IL-17A Causes Non-alcoholic Steatohepatitis and Hepatocellular Carcinoma[J]. Cancer Cell, 2016, 30(1): 161–175. Kuang D-M, Zhao Q, Wu Y, Peng C, Wang J, Xu Z, Yin X-Y, Zheng L. Kuang DM, Zhao Q, Wu Y, Peng C, Wang J, Xu Z, Yin XY, Zheng LPeritumoral neutrophils link inflammatory response to disease progression by fostering angiogenesis in hepatocellular carcinoma. J Hepatol 54(5): 948-955[J]. Journal of hepatology, 2010, 54: 948–55. Mcallister F, Bailey J, Alsina J, Nirschl C, Sharma R, Fan H, Rattigan Y, Roeser J, Lankapalli R, Zhang H. Oncogenic Kras activates a hematopoietic-to-epithelial IL-17 signaling axis in preinvasive pancreatic neoplasia.[J]. Cancer cell, 2014, 25(5): 621–637. Shen J, Sun X, Pan B, Cao S, Cao J, Che D, Liu F, Zhang S, Yu Y. IL-17 induces macrophages to M2-like phenotype via NF-κB[J]. Cancer Management and Research, 2018, 10: 4217–4228. Barin J G, Baldeviano G C, Talor M V, Wu L, Ong S, Quader F, Chen P, Zheng D, Caturegli P, Rose N R, Ciháková D. Macrophages participate in IL-17-mediated inflammation[J]. European Journal of Immunology, 2012, 42(3): 726–736. Nishikawa K, Seo N, Torii M, Ma N, Muraoka D, Tawara I, Masuya M, Tanaka K, Takei Y, Shiku H, Katayama N, Kato T. Interleukin-17 Induces an Atypical M2-Like Macrophage Subpopulation That Regulates Intestinal Inflammation[J]. PLOS ONE, 2014, 9(9): e108494. Miller J E, Ahn S H, Marks R M, Monsanto S P, Fazleabas A T, Koti M, Tayade C. IL-17A Modulates Peritoneal Macrophage Recruitment and M2 Polarization in Endometriosis[J]. Frontiers in Immunology, 2020, 11[2023-09-19]. Li Q, Liu L, Zhang Q, Liu S, Ge D, You Z. Interleukin-17 Indirectly Promotes M2 Macrophage Differentiation through Stimulation of COX-2/PGE2 Pathway in the Cancer Cells[J]. Cancer Research and Treatment : Official Journal of Korean Cancer Association, 2014, 46(3): 297–306. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 12 Aug, 2025 Read the published version in Gut Pathogens → Version 1 posted Editorial decision: Revision requested 17 Jun, 2025 Reviews received at journal 17 Jun, 2025 Reviews received at journal 15 Jun, 2025 Reviewers agreed at journal 12 Jun, 2025 Reviewers agreed at journal 12 Jun, 2025 Reviewers agreed at journal 12 Jun, 2025 Reviewers invited by journal 12 Jun, 2025 Editor assigned by journal 11 Jun, 2025 Submission checks completed at journal 11 Jun, 2025 First submitted to journal 10 Jun, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6861254","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":471537168,"identity":"c438b867-66f5-4ba2-9b15-72b8b9591842","order_by":0,"name":"Jiaqi Wang","email":"","orcid":"","institution":"South China University of Technology","correspondingAuthor":false,"prefix":"","firstName":"Jiaqi","middleName":"","lastName":"Wang","suffix":""},{"id":471537169,"identity":"c0891ee5-b82f-424b-b8a3-20a493b6024b","order_by":1,"name":"Yan Zhang","email":"","orcid":"","institution":"South China University of Technology","correspondingAuthor":false,"prefix":"","firstName":"Yan","middleName":"","lastName":"Zhang","suffix":""},{"id":471537170,"identity":"1fcfed13-4f29-4c64-88ae-4425052606ee","order_by":2,"name":"Jing Xu","email":"","orcid":"","institution":"South China University of Technology","correspondingAuthor":false,"prefix":"","firstName":"Jing","middleName":"","lastName":"Xu","suffix":""},{"id":471537171,"identity":"68732905-16f0-4421-b8ee-139e53036b90","order_by":3,"name":"Xin Nie","email":"","orcid":"","institution":"South China University of Technology","correspondingAuthor":false,"prefix":"","firstName":"Xin","middleName":"","lastName":"Nie","suffix":""},{"id":471537172,"identity":"067c5797-d37d-4e3d-9702-5475d114f38e","order_by":4,"name":"Chen Huang","email":"","orcid":"","institution":"South China University of Technology","correspondingAuthor":false,"prefix":"","firstName":"Chen","middleName":"","lastName":"Huang","suffix":""},{"id":471537173,"identity":"8f46897e-5432-411d-b6a2-e91edf21128f","order_by":5,"name":"Hailan Zhao","email":"","orcid":"","institution":"Jinan University (Shenzhen People's Hospital)","correspondingAuthor":false,"prefix":"","firstName":"Hailan","middleName":"","lastName":"Zhao","suffix":""},{"id":471537174,"identity":"7422de30-cf6d-4b3b-9ae8-6204d473353b","order_by":6,"name":"Minzheng Zhu","email":"","orcid":"","institution":"South China University of Technology","correspondingAuthor":false,"prefix":"","firstName":"Minzheng","middleName":"","lastName":"Zhu","suffix":""},{"id":471537175,"identity":"69332fa3-3e34-496d-9508-80d5d81bad13","order_by":7,"name":"Xue Guo","email":"","orcid":"","institution":"South China University of Technology","correspondingAuthor":false,"prefix":"","firstName":"Xue","middleName":"","lastName":"Guo","suffix":""},{"id":471537176,"identity":"1ed17c17-4d49-49e6-948c-35230c08e84d","order_by":8,"name":"Yong Zhang","email":"","orcid":"","institution":"South China University of Technology","correspondingAuthor":false,"prefix":"","firstName":"Yong","middleName":"","lastName":"Zhang","suffix":""},{"id":471537177,"identity":"61545e39-9f56-4913-905b-5740113ea9ac","order_by":9,"name":"Wenjing Qiu","email":"","orcid":"","institution":"South China University of Technology","correspondingAuthor":false,"prefix":"","firstName":"Wenjing","middleName":"","lastName":"Qiu","suffix":""},{"id":471537178,"identity":"9d0019c6-d27c-4e99-b090-f49b1fcc8ccc","order_by":10,"name":"Haoming Xu","email":"","orcid":"","institution":"South China University of Technology","correspondingAuthor":false,"prefix":"","firstName":"Haoming","middleName":"","lastName":"Xu","suffix":""},{"id":471537179,"identity":"ea19a620-0a13-40b7-b61a-bcf60382078f","order_by":11,"name":"Yuqiang Nie","email":"","orcid":"","institution":"South China University of Technology","correspondingAuthor":false,"prefix":"","firstName":"Yuqiang","middleName":"","lastName":"Nie","suffix":""},{"id":471537180,"identity":"3e83c69f-4bab-4a99-9ce4-9152154aba39","order_by":12,"name":"Youlian Zhou","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABBUlEQVRIiWNgGAWjYNCCAgkgwQPEFVABHoJaDGBazgAxG3FaoCYzthGhhV8ix/Axj4GFvDn/2YOPeefVyRvcb2B88LaNQd4chxbJGTnGxjwGEoY7G84lG/NuO2y44RgDs+HcNgagCA4n3cgxkwZqYdxwsMdMmnfbgQSDYwxs0rxtDAkGB7BrsYdqsd9wmAeoZU4dSAv7b3xaDCQgWhI3HANpaWAG28KMT4vEmWfFhnMMJJI3nOExNpxz7LDhzGOJzZJzzkkYbsChhb89eeODNxV1thvOnzF88KamTp7v8OGDH96U2cjjsoVBIMMAXYixAWQ9DvUga44/wC05CkbBKBgFowAEAKT5UsvPHycOAAAAAElFTkSuQmCC","orcid":"","institution":"South China University of Technology","correspondingAuthor":true,"prefix":"","firstName":"Youlian","middleName":"","lastName":"Zhou","suffix":""}],"badges":[],"createdAt":"2025-06-10 09:08:45","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6861254/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6861254/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s13099-025-00731-2","type":"published","date":"2025-08-12T15:57:45+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":84683556,"identity":"ae0c7519-bc86-4eac-8592-ae64e73116d6","added_by":"auto","created_at":"2025-06-16 08:39:41","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":321392,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eSg\u003c/em\u003e abundance is increased in tumor tissues \u0026amp; \u003cem\u003eSg\u003c/em\u003esup promotes proliferation of colon cancer cells analysis and its component analysis.\u003c/p\u003e\n\u003cp\u003e(a) The abundance of \u003cem\u003eSg\u003c/em\u003e in tumor tissue was significantly higher than that of the adjacent paracancerous normal tissue.(b) \u003cem\u003eSg\u003c/em\u003esup promote the proliferation of HCT116 and HT29. (c) Volcano map of differential metabolites between BHI medium and \u003cem\u003eSg\u003c/em\u003esup. (d)\u003c/p\u003e\n\u003cp\u003e*\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.05; **\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.01; ***\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.001; ****P\u0026lt; 0.0001; ns, not significant.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-6861254/v1/119b2f62c4e89621d5cc8dff.png"},{"id":84684637,"identity":"753f7a10-cb6f-45bc-ae47-ecf0125f9a1b","added_by":"auto","created_at":"2025-06-16 08:47:41","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":505511,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eSg\u003c/em\u003esup promotes tumor growth and analysis of macronomic parameters in AOM/DSS mice.\u003c/p\u003e\n\u003cp\u003e(a) Mouse colonoscopy. (b)Tumor condition of mouse colon. (c) Body weight of mice in the first week of DSS administration. (d) AOM/DSS-induced mice develop different degrees of tumor development. (e) Mouse colon tumor count. (f) Mouse colon tumor load. (g) Mouse colon length. (f) mice colon. *\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.05; **\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.01; ***\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.001; ****P\u0026lt; 0.0001; ns, not significant.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-6861254/v1/0ba30b3b76a0baf4c935c1af.png"},{"id":84683557,"identity":"634a792c-98f0-4ae1-b3de-45ba3fef9157","added_by":"auto","created_at":"2025-06-16 08:39:41","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":518153,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eSg\u003c/em\u003esup exacerbates inflammation levels in AOM/DSS mice\u003c/p\u003e\n\u003cp\u003e(a) HE pathologic evaluation. (b) DAI score on the day of most significant weight loss in mice. (c) HE pathology inflammation score. (d-g) The expression level of PTGS2(d), IL-6(e), IL-1β(f), IL-8(g) in mouse colon tumor tissue by qPCR. *\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.05; **\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.01; ***\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.001; ****P\u0026lt; 0.0001; ns, not significant.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-6861254/v1/e3019e79c67ea1a98ce1760c.png"},{"id":84684638,"identity":"854ab803-a18d-452d-bd7c-0730a07aeac4","added_by":"auto","created_at":"2025-06-16 08:47:41","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":572058,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eSg\u003c/em\u003esup intervention increases TAM infiltration and toward to M2 polarization in mouse colon tumor tissues\u003c/p\u003e\n\u003cp\u003e(a) Immunohistochemistry of mouse colon（x100）. (b) Flow cytometry analysis of mouse colon tumor tissues. (c-e) Statistical analysis reuslts of macrophage(c), M1-like macrophage(d), M2-like macrophage(e) in TAM. (f) M1/M2 ratio analysis. *\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.05; **\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.01; ***\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.001; ****P\u0026lt; 0.0001; ns, not significant.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-6861254/v1/05a8b4b47e9c227e5eb9d407.png"},{"id":84683560,"identity":"afffd268-5178-4fe3-926c-18c287a2ba08","added_by":"auto","created_at":"2025-06-16 08:39:41","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":342407,"visible":true,"origin":"","legend":"\u003cp\u003eThe mechanism of effect of \u003cem\u003eSg\u003c/em\u003esup to promote CRC is revealed to be related to the IL17 pathway.\u003c/p\u003e\n\u003cp\u003e(a) Differential expression gene volcano map. (b) Differential expression gene clustering heat map. (c) KEGG pathway enrichment analysis of differential expression genes. (d)The expression level of IL-17A in mouse colon tumor tissue. (e) The expression level of IL-17F in mouse colon tumor tissue. (f) The expression level of IL-22 in mouse colon tumor tissues. *\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.05; **\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.01; ***\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.001; ****P\u0026lt; 0.0001; ns, not significant.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-6861254/v1/756aad7e118562f9665fbb5a.png"},{"id":89310669,"identity":"9ee8b094-7ac9-43d7-8457-ba5c6b8e5fdc","added_by":"auto","created_at":"2025-08-18 16:09:29","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3952551,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6861254/v1/ca055f39-907a-44d0-b823-fe913aaec534.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Streptococcus gallolyticus supernatant promotes macrophage M2 polarization and regulates the IL-17 pathway in the oncogenesis of colorectal cancer","fulltext":[{"header":"Introduction","content":"\u003cp\u003eColorectal cancer(CRC) is the third most commonly diagnosed cancer and the second leading cause of cancer-related deaths worldwide\u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]\u003c/sup\u003e. The risk of suffering from CRC is 2\u0026ndash;3 times higher in people with inflammatory bowel disease(IBD) than in those without IBD\u003csup\u003e[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]\u003c/sup\u003e. Recent studies have shown that the gut microbiota plays a critical role in the progression from colitis to CRC\u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e. Among the various bacterial species present in the gut, some species like \u003cem\u003eStreptococcus gallolyticus\u003c/em\u003eare found to be associated with CRC\u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003e \u003cem\u003eStreptococcus gallolyticus\u003c/em\u003e(\u003cem\u003eSg\u003c/em\u003e), also known as \u003cem\u003eStreptococcus bovis\u003c/em\u003e biotype I, is a Gram-positive bacterium that inhabits the human gastrointestinal tract as a commensal organism\u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e. The association of \u003cem\u003eSg\u003c/em\u003e with CRC was initially identified in 1951\u003csup\u003e[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e. Initially, it was observed that individuals infected with \u003cem\u003eSg\u003c/em\u003e had a considerably higher risk of being with CRC in subsequent years, despite the absence of any intestinal symptoms during that time. A comprehensive 12-year study revealed that 75% of patients with \u003cem\u003eS. bovis\u003c/em\u003e-infected endocarditis were subsequently found to have malignant lesions in the colon\u003csup\u003e[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e, while a 40-year literature survey showed that 60% of patients with \u003cem\u003eS. bovis\u003c/em\u003e infection had colorectal adenomas or carcinomas\u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]\u003c/sup\u003e, and a separate study conducted over 24 years demonstrated a higher prevalence of colonic tumors(70%) in patients with \u003cem\u003eS. bovis\u003c/em\u003e bacteremia compared to controls(32%)\u003csup\u003e[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e. On the other hand, studies have revealed a significant increase in the detection rate of Sg in the excreted tissues of patients diagnosed with CRC. Specifically, the incidence of \u003cem\u003eS. bovis\u003c/em\u003e fecal carriage was noted to be approximately five-fold and three-fold higher in CRC patients compared to those with IBD and healthy controls, respectively\u003csup\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e. Moreover, the presence of \u003cem\u003eSg\u003c/em\u003e was observed to be approximately ten-fold higher in tumor colon tissues compared to normal colon tissues\u003csup\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]\u003c/sup\u003e. Interestingly, approximately 74% of tumor tissues and 47% of adjacent normal tissues from CRC patients tested positive for \u003cem\u003eSg\u003c/em\u003e\u003csup\u003e[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e. Furthermore, a separate investigation determined that \u003cem\u003eSg\u003c/em\u003e was detected in the intestines of 62.5% of 99 healthy volunteers\u003csup\u003e[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e.Taken together, these aforementioned studies strongly suggest an intricate connection between \u003cem\u003eSg\u003c/em\u003e and CRC, positioning \u003cem\u003eSg\u003c/em\u003e as a potential causative bacterium in the oncogenesis of CRC. Additionally, the seropositivity rates for \u003cem\u003eSg\u003c/em\u003e-specific IgG antibodies were determined to be 68% in CRC patients, 78% in patients with adenomas, and 16.66% in the healthy controls\u003csup\u003e[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e. This observation indicates a higher prevalence of \u003cem\u003eSg\u003c/em\u003e in early adenomas compared to advanced carcinomas, suggesting a pivotal role for \u003cem\u003eSg\u003c/em\u003e in the early stages of colorectal carcinogenesis.\u003c/p\u003e \u003cp\u003eAlthough the exact mechanism of \u003cem\u003eSg\u003c/em\u003e influences CRC remains unclear, it is speculated that the supernatant of \u003cem\u003eSg\u003c/em\u003e culture(\u003cem\u003eSg\u003c/em\u003esup) contain sparticular molecular substances that actively promote the development of CRC. Bacteria have the capacity to secrete a wide range of substances, including growth factors, proteases, cytokines, various other proteins, and diverse metabolites, which facilitate intricate interactions between the host's immune system and cancer cells. Certain metabolites, like lactate, serve as nourishment for cancer cells and promote cancer progression, while others, such as butyrate, inhibit pro-inflammatory genes and hinder tumor growth.\u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e Within the supernatant of \u003cem\u003eSg\u003c/em\u003e resides a multitude of components, such as proteins, lipids, and metabolites, which have substantial potential to affect the advancement of CRC. There is an ongoing controversy in current research regarding the potential of \u003cem\u003eSg\u003c/em\u003esup to promote the proliferation of CRC cells. Some studies suggest that direct contact between \u003cem\u003eSg\u003c/em\u003e and cells is necessary for its effectiveness\u003csup\u003e[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e, while others posit that \u003cem\u003eSg\u003c/em\u003esup contains specific substances capable of facilitating CRC development\u003csup\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e. The aim of this study is to investigat the effects of \u003cem\u003eSg\u003c/em\u003esup on CRC and to figure out its composition and mechanism of action.\u003c/p\u003e "},{"header":"Methods","content":"\u003ch2\u003e1. Clinical data and specimen collection\u003c/h2\u003e\u003cp\u003eThe study involved 46 patients diagnosed with CRC who underwent surgical treatment at the Guangzhou First People's Hospital between 2012 and 2015. Specimen collection was conducted with strict adherence to aseptic principles. Both tumor tissue and adjacent tissues (\u0026gt;\u0026thinsp;5 cm from the tumor margin) were collected from each patient and immediately frozen in liquid nitrogen for rapid preservation. Subsequently, the specimens were transferred to a -80\u0026deg;C refrigerator for storage. Patient information, such as age, gender, blood type, tumor size, location, stage, smoking history, alcohol consumption history, 5-year survival, metastasis, and pathological indicators, were collected through the medical record system and telephone call follow-up. Informed consent was obtained from each patient. The study was approved by the ethics committee of Guangzhou First People's Hospital. The research team is committed to following the committee's guidelines to maintain ethical integrity and scientific validity throughout the study.\u003c/p\u003e \u003cp\u003e \u003cb\u003e2.Quantitative Real-time PCR(qPCR) of\u003c/b\u003e \u003cb\u003eSg\u003c/b\u003e \u003cb\u003eabundance\u003c/b\u003e\u003c/p\u003e \u003cp\u003eGenomic DNA (gDNA) was extracted from tissue samples using the Total DNA/RNA/Protein Kit ( Omega, USA). A 20 \u0026micro;L reaction solution was prepared, consisting of 10 \u0026micro;L SYBR Premix Ex Taq II (2X), 1 \u0026micro;L PCR Forward Primer (10 \u0026micro;M), 1 \u0026micro;L PCR Reverse Primer (10 \u0026micro;M), 2 \u0026micro;L gDNA solution, and 6 \u0026micro;L ddH\u003csub\u003e2\u003c/sub\u003eO. The qPCR program was set as follows: A. Pre-denaturation: 95\u0026deg;C, 30 s; B. PCR reaction: 40 cycles of 95\u0026deg;C for 5 s and 60\u0026deg;C for 30\u0026ndash;60 s. The specific primer sequences for \u003cem\u003eSg\u003c/em\u003e were obtained from the literature\u003csup\u003e[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e and were as follows: Forward: 5'-AACGCGAAGAACCTTACCAG-3', Reverse: 5'-GAGTGCCCAACTGAATGAT G-3'. ACTB was used as an internal reference gene. All samples were analyzed in triplicate to account for biological variability. The abundance of \u003cem\u003eSg\u003c/em\u003e was evaluated by calculating the 2^( -ΔCT) values.\u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e3.Quantitative Reverse Transcription PCR(RT-qPCR)\u003c/h2\u003e \u003cp\u003eMouse colon tissue was collected for RT-qPCR analysis. Total RNA was extracted using the Total DNA/RNA/Protein Kit ( Omega, USA). Reverse transcription converted RNA to cDNA using the PrimeScript RT reagent Kit( Takara, Japan) and qPCR steps: Step 1 - Pre-denaturation at 95\u0026deg;C for 30 seconds. Steps 2 and 3 - Denaturation at 95\u0026deg;C for 15 seconds and annealing at 60\u0026deg;C for 1 minute, cycled 40 times. Step 4 - Rapid denaturation at 95\u0026deg;C for 1 second. Step 5 - Melting step of 6 seconds. A 20 \u0026micro;L reaction mixture contained SYBR Premix Ex Taq II (2X), PCR Forward Primer (10uM), PCR Reverse Primer (10uM), cDNA solution, and dH2O. ACTB served as an internal reference. Relative gene expression was calculated using the 2-ΔΔ CT method. Primer sequences are provided below.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Taba\" border=\"1\"\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSource\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePrimer name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSequence(5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePTGS2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003emouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGCGACATACTCAAGCAGGAGCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePTGS2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003emouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAGTGGTAACCGCTCAGGTGTTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-1β\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003emouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTGGACCTTCCAGGATGAGGACA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-1β\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003emouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGTTCATCTCGGAGCCTGTAGTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003emouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGGTGATATTCGAGACCATTTACTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003emouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGCCAACAGTAGCCTTCACCCAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003emouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTACCACTTCACAAGTCGGAGGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003emouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCTGCAAGTGCATCATCGTTGTTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-17A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003emouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCAGACTACCTCAACCGTTCCAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-17A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003emouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCTTTCCCTCCGCATTGACAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-17F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003emouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAACCAGGGCATTTCTGTCCCAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-17F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003emouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGGCATTGATGCAGCCTGAGTGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003emouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGCTTGAGGTGTCCAACTTCCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003emouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eACTCCTCGGAACAGTTTCTCCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eACTB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003emouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCATTGCTGACAGGATGCAGAAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eACTB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003emouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTGCTGGAAGGTGGACAGTGAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003e4.Cell culture\u003c/h3\u003e\n\u003cp\u003eHCT116 and HT29 cells were purchased from ATCC and cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS). The cells were maintained in a humidified incubator at 37\u0026deg;C with 5% CO₂ to ensure optimal growth conditions. The culture medium was refreshed every 48 hours to maintain nutrient levels and remove metabolic waste. When cell confluence reached 70\u0026ndash;80%, they were sub-cultured using 0.25% trypsin-EDTA to ensure sustained proliferation and viability for downstream experiments.\u003c/p\u003e\n\u003ch3\u003e5.Sgsup preparation\u003c/h3\u003e\n\u003cp\u003eThe Sg strain (DSM16831) was obtained from the BeNa Culture Collection (BNCC). After receiving the bacterial strain, it was revived and cultured aerobically in Brain Heart Infusion broth (BHI) medium(Huankai Microbial Sci \u0026amp; Tech Co., Ltd., China) at 37\u0026deg;C. When the bacteria reached the logarithmic growth phase, the suspension was centrifuged at 3000 rpm for 5 minutes to obtain the bacterial culture supernatant. The supernatant was then filtered through a 0.22 \u0026micro;m membrane to ensure sterility, verifying the absence of viable bacteria\u003csup\u003e[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/sup\u003e. The filtered supernatant was confirmed to be free of viable bacteria by inoculation culture. The supernatant was prepared fresh before each experiment.\u003c/p\u003e\n\u003ch3\u003e6.Cell proliferation assay\u003c/h3\u003e\n\u003cp\u003eCell proliferation was assessed using the Cell Counting Kit-8 (CCK-8) assay ( Biosharp, China), following the manufacturer\u0026rsquo;s instructions. 1000 cells in 100 \u0026micro;L of cell suspension were added to each well of a 96-well plate. After the cells adhere to the bottom, add 10 uL of \u003cem\u003eSg\u003c/em\u003esup, BHI medium, or PBS to the wells, respectively. After 8 hours of incubation, 10 \u0026micro;L of CCK8 solution was added to each well and incubated for 1 hour, protected from light. The absorbance value OD450 at 450nm was measured using an enzyme-labeled instrument( Thermo Fisher Scientific, USA). Each intervention was performed with at least 3 replicate wells. The blank control group refers to the absorbance value of wells containing only the medium without any cells.\u003c/p\u003e\n\u003ch3\u003e7.Non-targeted metabolomics\u003c/h3\u003e\n\u003cp\u003e \u003cem\u003eSg\u003c/em\u003esup and BHI blank media were subjected to off-target metabolomics analysis and sequencing was performed by Novogene Co., Ltd. (Beijing, China). A 1 mL sample was lyophilized, mixed with 100 \u0026micro;L of 80% methanol, vortexed, incubated on ice for 5 minutes, and centrifuged at 15,000 \u0026times; g at 4\u0026deg;C for 15 minutes. The supernatant was diluted to 53% methanol, centrifuged again, and collected for LC-MS analysis. LC-MS was performed using a Hypersil GOLD C18 column at 40\u0026deg;C with a flow rate of 0.2 mL/min. In positive mode, the mobile phases were (A) 0.1% formic acid in water and (B) methanol; in negative mode, (A) 5 mM ammonium acetate (pH 9.0) and (B) methanol. The gradient elution was 2\u0026ndash;100% B over 10 minutes, then returned to 2% B over 2 minutes, and held at 100% B. The mass spectrometer operated with a scan range of m/z 100\u0026ndash;1500 and the ESI source parameters were set to 3.5 kV spray voltage, 35 psi sheath gas flow, 10 L/min auxiliary gas flow, 320\u0026deg;C capillary temperature, 60 S-lens RF level, and 350\u0026deg;C auxiliary gas heater temperature. Raw data were processed using Compound Discoverer 3.1 (CD3.1) and peaks were extracted using a retention time deviation of 0.2 minutes, mass deviation of 5 ppm, signal intensity deviation of 30%, S/N ratio of 3, and a minimum intensity threshold\u003csup\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e. Metabolite identifications were based on matching molecular ions and fragments with mzCloud, mzVault, and MassList databases, excluding those with a coefficient of variation (CV) greater than 30% in quality control samples. Data processing was performed on CentOS 6.6 using R and Python, with differential metabolites identified using thresholds of VIP\u0026thinsp;\u0026gt;\u0026thinsp;1.0, fold change (FC)\u0026thinsp;\u0026gt;\u0026thinsp;1.2 or \u0026lt;\u0026thinsp;0.833, and p-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003csup\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e8. Animal Modeling\u003c/h2\u003e \u003cp\u003eEight-week-old female Balb/c mice (approximately 25g) were obtained from the Guangdong Medical Laboratory Animal Center and were kept under specific pathogen-free (SPF) conditions. After a one-week acclimatization period, the azoxymethane/dextran sulfate sodium (AOM/DSS) model for CRC was established. Mice received an intraperitoneal injection of AOM(Sigma-Aldrich, USA) at a dose of 12.5 mg/kg on the first day, followed by the administration of 2% DSS(MP Biomedicals, USA) in their drinking water for 5 days, succeeded by 14 days of regular water intake; this cycle was repeated three times. The experiment was concluded on day 80. During the process, 200 \u0026micro;L intervention was administered by oral gavage every other day, with water being replaced thrice weekly to maintain freshness. All experimental protocols were approved by the relevant ethical committee and adhered to established guidelines to minimize distress, ensuring humane treatment and rigorous monitoring throughout the study\u003csup\u003e[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003e9.Mouse Colonoscopy\u003c/h3\u003e\n\u003cp\u003eThe colonoscopy procedure was performed on mice using a mouse endoscope (KARL STORZ, 26430520-1, Germany) equipped with an IMAGE1 S D3-LINK connection module and a 64301 AA probe (diameter: 1.9 mm, length: 10 cm) with 495 NT fiber optics and a protective probe sleeve (61029 C) of 8.5 cm working length. The camera system was connected to a Display screen for real-time imaging and photographic documentation. Mice were fasted for 24 hours prior to the procedure and anesthetized with 1% sodium pentobarbital administered intraperitoneally and placed in the supine position on a heating pad to maintain body temperature. The anus was lubricated with glycerol, and the endoscope was carefully inserted, with its tip coated to minimize mucosal trauma. The endoscope's position was adjusted to ensure clear visualization of the colonic mucosa, and images of the intestinal lumen were recorded. After completing the examination, the endoscope was gently removed, and the perianal area was cleaned. Mice were monitored closely for any signs of pain or complications. All procedures were conducted by an experienced operator to ensure accuracy and consistency in the results.\u003c/p\u003e\n\u003ch3\u003e10.Flow Cytometry\u003c/h3\u003e\n\u003cp\u003eThe colon is dissected longitudinally and rinsed thoroughly with cold PBS. Tumor tissue was carefully collected from the colon and digested using a digestive enzyme solution for 30 minutes at 37\u0026deg;C on a shaker. The enzyme solution consisted of 0.5 mg/mL collagenase IV (Roche, Switzerland) and 0.5 mg/mL DNase I (Roche, Switzerland), both dissolved in calcium- and magnesium-free PBS. The digested cell suspension was filtered through a 70 \u0026micro;m cell strainer and resuspended in 1% bovine serum albumin. Single-cell suspensions were prepared by centrifugation at 400 \u0026times; g for 10 min at 4\u0026deg;C and then resuspended in 1% bovine serum albumin. Antibody staining was performed by adding 1 \u0026micro;L of fluorescent antibodies, including APC anti-mouse CD45 (BioLegend, 103111, USA), APC/Cy7 anti-mouse CD11b (BioLegend, 101226, USA), PE anti-mouse F4/80 (BioLegend, 123109, USA), FITC anti-mouse CD86 ( BioLegend, 105005, USA) and BV421 anti-mouse CD206 (BioLegend, 141717, USA). The mixtures were incubated at 4\u0026deg;C under light protection for 30 min, and the reaction was terminated by the addition of 1% BSA, followed by centrifugation and resuspension in PBS. Stained cells were then analyzed by flow cytometer BD FACS Canto II( BD Biotechnology, USA) and data were processed using FlowJo software.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e11. Hematoxylin and Eosin(HE) Staining and Immunohistochemistry(IHC) Staining\u003c/h2\u003e \u003cp\u003eThe colon was isolated and cleaned, then embedded in paraffin in a \"Swiss roll\" fashion and cut into 4 \u0026micro;m thick sections. HE Staining and IHC staining were performed as described previously \u003csup\u003e[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]\u003c/sup\u003e.Microscopic examination was performed, and ImageJ was used for image analysis. Blind histological scoring was conducted to evaluate the success of the modeling\u003csup\u003e[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]\u003c/sup\u003e. Inflammation was assessed using the MCHI scoring criteria, which consisted of the following components:(1) Cupping defects: Scored as 0 points for no defects, 1 point for \u0026lt;\u0026thinsp;10% defects, 2 points for 10\u0026ndash;50% defects, and 3 points for \u0026gt;\u0026thinsp;50% defects.(2) Crypts: Scored as 0 points for a normal number, 1 point for a decrease of \u0026lt;\u0026thinsp;10%, and 2 points for a decrease of \u0026ge;\u0026thinsp;10%. (3) Hyperplasia: Scored as 0 points for no hyperplasia, 1 point for mild increase in crypt length, 2 points for 2\u0026ndash;3 times increase in crypt length, and 3 points for \u0026gt;\u0026thinsp;3 times increase in crypt length.(4) Submucosal inflammatory infiltration: Scored as 0 points for no inflammatory infiltration, 1 point for individual inflammatory cell infiltration, 2 points for more inflammatory cell infiltration, and 3 points for large inflammatory cell infiltration. The total score was calculated as follows: Cupping defects score * 1\u0026thinsp;+\u0026thinsp;Crypts score * 2\u0026thinsp;+\u0026thinsp;Hyperplasia score * 2\u0026thinsp;+\u0026thinsp;Submucosal inflammatory infiltration score * 3\u003csup\u003e[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e12. RNA sequencing\u003c/h2\u003e \u003cp\u003eThe transcriptome analysis of mouse tumor tissue was performed using RNA sequencing (RNA-seq) technology by PANOMIX Biomedical Tech Co., LTD (Suzhou, China). RNA was first extracted and tested for concentration and purity, mRNA was purified and fragmented to 200\u0026ndash;300 bp, followed by the synthesis of cDNA duplexes, construction and amplification of sequencing libraries, and selection of libraries of about 450 bp. After the library was quality checked, Paired-end sequencing was performed using the Illumina HiSeq platform. Sequencing raw data were preliminarily filtered to obtain Clean Data. A reference genome index was constructed using Bowtie2, and Clean Reads were compared to the reference genome using Tophat2. Read Count on each gene was counted by HTSeq and expression was normalized by FPKM. Differentially expressed genes (DEGs) were analyzed using DESeq with the criterion of |log2FoldChange| \u0026gt; 1 and P-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05. Subsequently, functional enrichment analyses of Gene Ontology (GO) and Kyoto Encyclopedia of the Genome (KEGG) pathways were carried out to identify the biological processes, molecular functions, and signaling pathways associated with DEGs. Data visualization of heatmaps, volcano plots, and bubble plots was performed using the ggplot2 package for the R language\u003csup\u003e[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e13. Statistical Methods\u003c/h2\u003e \u003cp\u003eData were analyzed using SPSS 25.0 software (IBM Corp., USA). Descriptive statistics presented means\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation ( \u003cem\u003eχ\u003c/em\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;s). Two-group comparisons with normal distribution used the independent samples t-test, while non-normally distributed data employed the Wilcoxon signed-rank test. Multiple group comparisons utilized one-way ANOVA. Categorical variables were analyzed with the chi-square test, considering P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 as statistically significant. GraphPad Prism8( GraphPad Software, USA) and Adobe Illustrator 2020( Adobe Inc., USA)were used for Data analysis and visualization.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003e1. A high abundance of\u003c/b\u003e \u003cb\u003eSg\u003c/b\u003e \u003cb\u003ewas found in CRC tissues by using qPCR, which correlates with tumor location.\u003c/b\u003e\u003c/p\u003e \u003cp\u003ePatient demographics and clinical characteristics are shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. \u003cem\u003eSg\u003c/em\u003e was detected in 93.5% (43 out of 46) of CRC tissues( both tumor and paraneoplastic normal tissues), with only 3 patients (6.5%) showing no \u003cem\u003eSg\u003c/em\u003e colonization. Notably, the abundance of \u003cem\u003eSg\u003c/em\u003e in tumor tissues was significantly higher than that in the adjacent peritumor normal tissues (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01)(Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eCharacteristics of study population.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVariables\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eStatistics(%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eVariables\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eStatistics(%)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eAge\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003eAJCCstage\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e30(65.2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e6(13.0)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u0026lt;60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e16(34.8)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e22(47.8)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eSex\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e4(8.7)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e27(58.7)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e14(30.4)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e19(41.3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003eSmoking\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eBlood type\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eYes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e9(19.6)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e11(23.9)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eno\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e37(80.4)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e16(34.8)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003eAlcohol use\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e17(37.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eYes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e5(10.9)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2(4.3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e41(89.1)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eTumor location\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003eCEA\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRectum\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e21(45.7)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePostive\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e41(93.2)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSigmoid colon\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e13(28.3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNegtive\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3(6.8)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLeft hemicolon\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3(6.5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003eP53\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRight hemicolon\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e9(19.6)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePositive\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e25(58.1)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eTumor size\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNegative\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e18(41.9)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;4cm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e29(63.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003eKi67\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u0026lt;4cm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e17(37.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;65%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e25(54.3)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eTNMstage\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;65%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e21(45.7)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eT\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e5-year survival\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0(0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLive\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e19(52.8)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7(15.2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDead\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e17(47.2)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e12(26.1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003eRecurrence\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e27(58.7)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eYes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e13(36.1)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eN\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e23(63.9)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e31(67.4)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003eSg\u003c/b\u003e \u003cb\u003ein tumor\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e9(19.6)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePositive\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e22(47.8)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e6(13.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNegative\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e24(52.2)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eM\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003eSg\u003c/b\u003e \u003cb\u003ein peritumor\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e32(69.6)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePositive\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e14(30.4)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e14(30.4)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNegative\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e32(69.6)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eBased on ΔCT values, the samples were divided into two groups: \u003cem\u003eSg\u003c/em\u003e-positive (high abundance) and \u003cem\u003eSg\u003c/em\u003e-negative (low abundance or test-negative).In tumor tissues, 22 cases(47.8%) were \u003cem\u003eSg\u003c/em\u003e-positive, while 24 cases were negative. In the peritumor normal tissues, 14 cases (30.4%)were \u003cem\u003eSg\u003c/em\u003e-positive, and 32 cases were negative. According to Chi-square tests, there was a significant correlation between \u003cem\u003eSg\u003c/em\u003e abundance in the tumor and adjacent normal tissues (P\u0026thinsp;\u0026lt;\u0026thinsp;0.001), as well as a correlation with the tumor location (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). However, no significant association was observed between \u003cem\u003eSg\u003c/em\u003e abundance and other factors such as age, gender, blood type, tumor size, stage, smoking, alcohol consumption, CEA, P53, Ki67 positivity rate, five-year survival, or recurrence (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05).(Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eCorrelation analysis of \u003cem\u003eSg\u003c/em\u003e abundance and clinical information in tumor and peritumor tissues in CRC patients\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVariables\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eSg\u003c/em\u003e-neg in tumor(n\u0026thinsp;=\u0026thinsp;24)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eSg\u003c/em\u003e-pos in tumor(n\u0026thinsp;=\u0026thinsp;22)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e value\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eSg\u003c/em\u003e-neg in peritumor(n\u0026thinsp;=\u0026thinsp;32)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eSg\u003c/em\u003e-pos in peritumor(n\u0026thinsp;=\u0026thinsp;14)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e value\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eAge\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.404\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.447\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u0026lt;60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eSex\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.958\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.611\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eBlood type\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.385\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.391\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eTumor location\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.007\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.203\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRectum\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSigmoid colon\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLeft hemicolon\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRight hemicolon\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eTumor size\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.193\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.436\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;4cm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u0026lt;4cm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eTNM stage\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eT\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.422\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.867\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eN\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.696\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.733\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eM\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.845\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.607\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eAJCCstage\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.251\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.577\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eSmoking\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.605\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.308\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eno\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eAlcohol use\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.564\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.591\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCEA\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.496\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.882\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePostive\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNegtive\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eP53\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.697\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.987\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePositive\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNegative\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eKi67\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.080\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.301\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;65%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;65%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e5-year survival\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.463\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.847\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLive\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDead\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eRecurrence\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.587\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.636\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eSg\u003c/b\u003e \u003cb\u003ein tumor\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePositive\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNegative\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eSg\u003c/b\u003e \u003cb\u003ein peritumor\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePositive\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNegative\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"7\"\u003eNote: \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 is considered statistically significant.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003e2.\u003c/b\u003e \u003cb\u003eSg\u003c/b\u003e \u003cb\u003esup promotes CRC cell proliferation and its component analysis\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo explore the potential pathogenic effects of Sg on CRC, the supernatant of \u003cem\u003eSg\u003c/em\u003e culture ( \u003cem\u003eSg\u003c/em\u003esup) was extracted for further study. \u003cem\u003eSg\u003c/em\u003esup was added to HCT116 and HT29 cells to evaluate its impact on cell proliferation. Results indicated that neither the PBS group nor the BHI( Media for the cultivation of \u003cem\u003eSg\u003c/em\u003e) group exercised a noteworthy influence on cell proliferation in both HCT116 and HT29 cells(Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb). However, when compared to the PBS control group, \u003cem\u003eSg\u003c/em\u003esup administration resulted in a considerable significant increase in proliferation for both HCT116 and HT29 cells(Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb).\u003c/p\u003e \u003cp\u003eFurthermore, non-target metabolomics analysis of the supernatant revealed significant alterations in metabolite levels. Specifically, Sgsup contained 851 metabolites that were markedly different from the blank medium, with 67 metabolites exhibiting up-regulation and 13 showing down-regulation(Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec). Notably, inosine-5'-monophosphate (IMP), methionine, uridine, and creatine levels were observed to be significantly higher in \u003cem\u003eSg\u003c/em\u003esup(Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ed-g).\u003c/p\u003e \u003cp\u003e \u003cb\u003e3.\u003c/b\u003e \u003cb\u003eSg\u003c/b\u003e \u003cb\u003esup promotes colon tumor progression, exacerbates inflammation, and promotes macrophage M2 polarisation in AOM/DSS mice\u003c/b\u003e \u003c/p\u003e \u003cp\u003eColonic tumor growth in mice was observed using mouse endoscopy. Healthy mice exhibited a smooth circular area with pale pink intestinal mucosa, normal vascular structure, and smooth translucent mucosal surface. In contrast, AOM/DSS-induced CRC mice displayed intestinal masses of varying sizes, reduced intestinal wall translucency, and loss of normal vascular structures(Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea). Dissecting the mouse colon at the end of the study revealed masses (confirmed as tumors by HE staining) in all groups except the normal group, with a significant increase in size and number of colon tumors in the \u003cem\u003eSg\u003c/em\u003esup group(Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb). Statistical analysis showed a significant increase in tumor count(Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ee) and tumor load(Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ef) after \u003cem\u003eSg\u003c/em\u003esup intervention compared to the model group. The weight of mice in the normal group increased steadily, while the model group showed a significant decrease, and the \u003cem\u003eSg\u003c/em\u003esup group exhibited a significant weight loss in the first week of DSS administration(Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec). The length of the colon was significantly shortened after the \u003cem\u003eSg\u003c/em\u003esup intervention(Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eg and Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eh).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eHE staining revealed that the normal mouse colon was composed of mucosal, submucosal, muscular, and plasma layers. In the normal group, glands were neatly arranged, with intact crypts and cup-shaped cells at the base. AOM/DSS-treated mice exhibited varying degrees of dysplasia. Mild dysplasia showed disorganized glands with heterogeneous cells and deeply stained nuclei. Low-grade heterogeneous hyperplasia (early adenomas) displayed deeply stained cells with pseudocomplexed nuclei without deeper gland involvement. High-grade heterogeneous hyperplasia (carcinoma in situ) showed sieved or fused crypts and complete loss of nuclear polarity. Invasive carcinomas displayed cancer cells crossing the basal lamina and infiltrating beneath the lamina propria(Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea). Regarding inflammatory conditions, the DAI scores on the day with the most significant weight loss revealed notably higher scores in the \u003cem\u003eSg\u003c/em\u003esup group(Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb).In the normal group of mice, the colonic epithelial structure remained intact without ulceration and no submucosal inflammatory cell infiltration. However, the model group exhibited increased chronic inflammatory cells, as well as lymphoid follicular hyperplasia. The \u003cem\u003eSg\u003c/em\u003esup group showed irregularities in subepithelial crypts and visible ulcerated surfaces(Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea). Subsequent histological inflammation scoring demonstrated increased inflammation in the \u003cem\u003eSg\u003c/em\u003esup group compared to the model group(Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec). Furthermore, RT-qPCR analysis of mouse colon tumor tissues revealed up-regulation of inflammatory factors, namely PTGS2(Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ed), IL-6(Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ee), IL-1β(Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ef), and IL-8(Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eg) after \u003cem\u003eSg\u003c/em\u003esup intervention as compared to the model group.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eImmunohistochemical staining revealed an increased expression of the macrophage signature molecule F4/80 in tumors after \u003cem\u003eSg\u003c/em\u003esup intervention, as compared to the model group. Notably, there was a substantial increase in the expression of the M2 polarization marker CD206, whereas the expression of the M1 polarization marker CD86 was relatively lower(Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea). Additional analysis through flow cytometry further corroborated these findings, demonstrating that Sgsup intervention led to an increased proportion of macrophages in mouse tumors, favoring polarization towards M2 and subsequently reducing the M1/M2 ratio as compared to the model group(Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb- Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eg).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003e4.The mechanism of effect of\u003c/b\u003e \u003cb\u003eSg\u003c/b\u003e\u003cb\u003esup to promote CRC is revealed to be related to the IL17 pathway.\u003c/b\u003e\u003c/p\u003e \u003cp\u003eIn order to investigate the specific manner in which \u003cem\u003eSg\u003c/em\u003esup promotes CRC development, RNA-seq sequencing analyses were carried out on tumor tissues obtained from mice. The findings revealed noteworthy variationsin gene expression, with 68 genes being up-regulated and 47 genes being down-regulated when compared to the model group(Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea and Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb). Additionally, KEGG pathway enrichment analysis pinpointed the IL-17 signaling pathway as the most considerably enriched (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ec). To further validate the RNA-seq data, the expression levels of IL-17 pathway-related factors were assessed. These assessments showed no statistical differences in the expression levels of IL-17A among the three groups of mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ed). However, following intervention with \u003cem\u003eSg\u003c/em\u003esup, notable elevations were observed in the expression of IL-17F(Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ee) and IL-22(Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ef)as compared to the model group.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eNumerous studies have solidified a strong association between \u003cem\u003eSg\u003c/em\u003e infection and CRC\u003csup\u003e[\u003cspan additionalcitationids=\"CR28\" citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]\u003c/sup\u003e. \u003cem\u003eSg\u003c/em\u003e, a commensal in the healthy gut's ileal region, significantly influences host metabolism and immunity\u003csup\u003e[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]\u003c/sup\u003e. However, altered intestinal microecology due to bacterial overgrowth may modulate disease progression\u003csup\u003e[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]\u003c/sup\u003e. \u003cem\u003eSg\u003c/em\u003e detection in colon tissue and feces escalates during gut inflammation. Prior cross-regional investigations reported varying \u003cem\u003eSg\u003c/em\u003e positivity rates in tumor tissues( 3.2\u0026ndash;74%)\u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan additionalcitationids=\"CR34\" citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]\u003c/sup\u003e, possibly due to diverse sampling populations and detection methods. This study utilized \u003cem\u003eSg\u003c/em\u003e-specific qPCR to assess \u003cem\u003eSg\u003c/em\u003e content in tumor and adjacent tissues of 46 CRC patients, identifying \u003cem\u003eSg\u003c/em\u003e colonization in 93.5% of cases. Tumor tissues exhibited notably higher \u003cem\u003eSg\u003c/em\u003e abundance than adjacent normal tissues, consistent with earlier findings. Additionally, this study unveiled a correlation between \u003cem\u003eSg\u003c/em\u003e abundance and tumor location, though unrelated to age, gender, blood type, tumor size, stage, smoking, alcohol, survival, CEA, P53, Ki67, or recurrence.\u003c/p\u003e \u003cp\u003eEarlier studies have found that \u003cem\u003eSg\u003c/em\u003e promotes the proliferation of CRC cells. \u003cem\u003eSg\u003c/em\u003e promotes cell proliferation in the human CRC cell lines HCT116, HT29, and LoVo, whereas for the human CRC cell lines SW480 and SW1116, human normal colon epithelial cell lines FHC and CCD 841 CoN, human renal epithelial cells HEK293 and human lung cancer cell line A549 had no significant effect on cell proliferation\u003csup\u003e[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e. Some studies believed that \u003cem\u003eSg\u003c/em\u003esup could not promote CRC cell proliferation, which means that direct contact of bacteria with the cells is required for its effect\u003csup\u003e[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e. However, other studies have suggested that \u003cem\u003eSg\u003c/em\u003esup can promote the proliferation and migration of CRC cells\u003csup\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e.This study revealed that \u003cem\u003eSg\u003c/em\u003esupcould promote the proliferation of CRC cells HCT116 and HT29, underscoring \u003cem\u003eSg\u003c/em\u003e's capacity to secrete specific bioactive substances that facilitate CRC progression. To explore its specific pathogenic components, \u003cem\u003eSg\u003c/em\u003esupwas subjected to off-target metabolomics analysis, and it was found that IMP, methionine, uridine, and creatine levels appeared to be significantly increased compared to the blank medium. Increased levels of IMP could enhance the availability of purine nucleotides, supporting the rapid DNA and RNA synthesis required by proliferating tumor cells\u003csup\u003e[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]\u003c/sup\u003e. Increased uridine can support the synthesis of RNA, which is crucial for protein synthesis and cell growth. This could support tumor cell proliferation, particularly in cancers where RNA synthesis is upregulated\u003csup\u003e[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]\u003c/sup\u003e. Elevated methionine levels can increase S-adenosylmethionine (SAM), the primary methyl donor in the body. Increased SAM can lead to hypermethylation of DNA and histones, which can silence tumor suppressor genes or activate oncogenes, potentially promoting cancer progression\u003csup\u003e[\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]\u003c/sup\u003e. Creatine is a nitrogenous organic acid that occurs naturally in mammals, and it plays a key role in thermogenesis, immune function, and cancer cell survival\u003csup\u003e[\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]\u003c/sup\u003e. Previous studies considered creatine and its analog cyclic creatine to be oncogenic metabolites. However, emerging research suggests that creatine has a promoting effect on tumor progression\u003csup\u003e[\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]\u003c/sup\u003e.Creatine could promote invasion and metastasis in pancreatic, colorectal, and breast cancers\u003csup\u003e[\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]\u003c/sup\u003e. Creatine acts as a non-dependent energy buffer during high ATP demand, phosphorylating ADP to ATP through phosphocreatine, thus mitigating transient increases in energy expenditure\u003csup\u003e[\u003cspan additionalcitationids=\"CR43\" citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]\u003c/sup\u003e. CRC cells secrete creatine kinase brain type, which synergizing with hepatocyte-derived creatine, generates phosphocreatine in the extracellular space. This phosphocreatine is then taken up by CRC cells, supporting their metastatic survival in the liver\u003csup\u003e[\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]\u003c/sup\u003e.Also, knockdown of Slc6a8, a creatine transporter, in macrophages, impedes creatine uptake and depletes creatine abundance, resulting in a significant reduction in M2-like effector function in vivo\u003csup\u003e[\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]\u003c/sup\u003e. Creatine supplementation modulates macrophage polarization by inhibiting the IFNγ-JAK-STAT1-iNOS axis and promoting the IL-4-STAT6-ARG1 axis, thereby inhibiting M1-like polarization and promoting M2-like polarization\u003csup\u003e[\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]\u003c/sup\u003e. Additionally, creatine endocytosis is heightened in M2-like macrophages compared to M1-like macrophages, suggesting creatine's involvement in a feed-forward loop that shifts macrophage homeostasis towards an M2-like state\u003csup\u003e[\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eBuilding on these findings, this study conducted in vivo experiments. Utilizing mouse endoscopy, observations depicted the smooth and translucent pink intestinal lumen in the normal group and flatter intestinal lesions, possibly indicating early-stage tumor alteration in the model group. Notably, administration of \u003cem\u003eSg\u003c/em\u003esup led to significantly enlarged and irregularly raised intestinal tumors in mice, indicative of advanced-stage alterations. The increase in colorectal tumor number, tumor load, and inflammation in the mice after Sgsup intervention suggests a role for Sgsup in tumorigenesis and inflammatory escalation in AOM/DSS mice.The gastrointestinal tract possesses the largest number of macrophages. On the one hand, it recruits regulatory T cells(Tregs) by secreting chemokines, thus promoting tumor immunosuppression\u003csup\u003e[\u003cspan additionalcitationids=\"CR47\" citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]\u003c/sup\u003e. On the other hand, TAM also plays a role in the interaction with the microbiota through different metabolic pathways. Notably, a close interplay between macrophages, gut bacteria, and tumor promotion has been observed. Intestinal microbiota can incite chemokine production via LPS, promoting monocyte-like macrophage accumulation and generating an inflammatory milieu conducive to colitis-associated tumorigenesis\u003csup\u003e[\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]\u003c/sup\u003e. Crucially, macrophage depletion completely nullifies the pro-tumorigenic effects of dysbiotic gut bacterial ecology, underscoring the symbiotic interdependence between bacteria and macrophages for tumor development\u003csup\u003e[\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]\u003c/sup\u003e. Furthermore, macrophages drive alterations in the CRC-associated microbiota. For instance, Fusobacterium nucleatum instigates the recruitment of M2 macrophages and MDSCs, culminating in an immunosuppressive tumor microenvironment that facilitates tumor progression\u003csup\u003e[\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]\u003c/sup\u003e. Early stages of CRC initiation typically manifest within the inflamed epithelial stroma, dominated by pro-inflammatory M1 macrophages, which generate reactive oxygen species, leading to oncogene activation in adjacent epithelial cells\u003csup\u003e[\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]\u003c/sup\u003e. Subsequently, tumorigenesis attracts additional bone marrow-derived monocytes, secreting growth factors and chemokines like CCL2, CCL5, VEGF, and TGF-β, which encourages TAM transformation into the cancer-promoting M2 phenotype, fueling advanced CRC growth and progression. \u003cem\u003eSg\u003c/em\u003e hasbeen demonstrated to have prolonged survival within macrophages compared to other bacteria, triggering specific cytokine expression and minimizing macrophage lysis\u003csup\u003e[\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]\u003c/sup\u003e. Furthermore, \u003cem\u003eSg\u003c/em\u003e selectively recruits tumor-infiltrating myeloid cells, encompassing bone marrow-derived suppressor cells, TAMs, and dendritic cells\u003csup\u003e[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e. This study unveiled increased M2-type macrophage infiltration in mouse tumor tissues after\u003cem\u003eSg\u003c/em\u003esup intervention. This suggests that \u003cem\u003eSg\u003c/em\u003esup may facilitate immunosuppression by recruiting TAMs, thereby bolstering tumor development.\u003c/p\u003e \u003cp\u003eA potential pathway enriched by RNA-seqis the IL-17 signaling pathway. The IL-17 pathway is activated by the IL-17 family of cytokines, produced by various immune cells such as helper T cells 17(Th17), γδ T cells, natural killer( NK) cells, and innate lymphocytes\u003csup\u003e[\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]\u003c/sup\u003e. IL-17 exerts its biological role by binding to the IL-17 receptor (IL-17R) expressed in multiple cell types, including epithelial cells, endothelial cells, fibroblasts, and immune cells. This activation triggers downstream signaling pathways, including NF-kB and MAPK, promoting the recruitment of immune cells to the site of infection or inflammation\u003csup\u003e[\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]\u003c/sup\u003e. IL-17 can induce the expression of various cytokines like IL-6, IL-1β, IL-8, and PTGS2. These factors stimulate further IL-17 production, contributing to the activation of the IL-17 pathway in CRC, and creating a positive feedback loop that exacerbates inflammation and tumor growth\u003csup\u003e[\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]\u003c/sup\u003e. Studies have shown the presence of IL-17 and Th17 cells in a wide range of tumors, promoting tumor growth and metastasis through diverse mechanisms\u003csup\u003e[\u003cspan additionalcitationids=\"CR57\" citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e]\u003c/sup\u003e. The IL-17 pathway has been demonstrated to promote tumor angiogenesis, inhibit anti-tumor immunity, and enhance tumor cell survival and proliferation\u003csup\u003e[\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e]\u003c/sup\u003e. IL-17F, a major modulator of the intestinal commensal microbiota, is constitutively expressed in the gut and induces the production of antimicrobial peptides\u003csup\u003e[\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e]\u003c/sup\u003e.Fusobacterium nucleatum, known for its association with chronic inflammation and cancer, aggravates intestinal inflammation in mice through activation of the IL-17F / NF-κB pathway\u003csup\u003e[\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e]\u003c/sup\u003e. In this study, after \u003cem\u003eSg\u003c/em\u003esup intervention, both IL-17F and IL-22 showed significant upregulation in expression, while IL-17A displayed a trend towards downregulation, though not statistically significant. IL-17A is known to inhibit colitis development by maintaining intestinal mucosal integrity, whereas IL-17F is pro-inflammatory\u003csup\u003e[\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e]\u003c/sup\u003e. This evidence has been confirmed in humans, where elevated IL-17F mRNA is observed in colon biopsies of ulcerative colitis patients, contributing to a localized inflammatory environment along with factors like IL-6\u003csup\u003e[\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e]\u003c/sup\u003e. Microbiota-induced IL-17A has been linked to the pathogenesis of various cancers including colon, breast, pancreatic, and ovarian cancers, and multiple myeloma\u003csup\u003e[\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e]\u003c/sup\u003e. However, the precise role of IL-17A in different cancers remains incompletely understood. Th17 cells, in melanoma and ovarian cancer, activate anti-tumor cytotoxic T-cell responses\u003csup\u003e[\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e]\u003c/sup\u003e, but they exhibit tumorigenic properties in various mouse models of CRC\u003csup\u003e[\u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e, \u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e]\u003c/sup\u003e, hepatocellular carcinoma\u003csup\u003e[\u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e, \u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e]\u003c/sup\u003e, and pancreatic cancer\u003csup\u003e[\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e]\u003c/sup\u003e. Overall, these analyses suggest that \u003cem\u003eSg\u003c/em\u003esups might induce heightened inflammation and promote CRC development through the IL-17 pathway.Recently, studies have shed light on the interaction between the IL-17 pathway and macrophage polarization, particularly the polarization of macrophages towards the M2 phenotype. Research indicates that IL-17could promote macrophage M2 polarization\u003csup\u003e[\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e]\u003c/sup\u003e.Past studies have shown that IL-17A can directly activate macrophages\u003csup\u003e[\u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e]\u003c/sup\u003e. In colitis, IL-17 induces the emergence of M2-like subpopulations of macrophages, which protect against the development of severe colitis\u003csup\u003e[\u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e71\u003c/span\u003e]\u003c/sup\u003e. IL-17A is likely to be a stimulus inducing the pathogenic polarization of macrophages into the M2 phenotype by first acting on the endometriotic lesion\u003csup\u003e[\u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e]\u003c/sup\u003e. In addition, IL-17 can promote M2 macrophage differentiation indirectly by stimulating the COX-2/PGE2 pathway in cancer cells, thus playing an indirect role in regulating the tumor immune microenvironment\u003csup\u003e[\u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e73\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eIn summary, this study investigated\u003cem\u003eSg\u003c/em\u003e colonization using tumor and adjacent normal tissues from CRC patients. It revealed a significant correlation between the abundance of \u003cem\u003eSg\u003c/em\u003e in tumor tissues and tumor location. The \u003cem\u003eSg\u003c/em\u003esup was shown to promote CRC development, recruit tumor macrophages, and promote M2 polarization, and the mechanism was found to be possibly related to the IL-17 pathway by transcriptome analysis.However, it's important to note that the patient samples in this study were limited to a small sample size from a single center, necessitating a broader sample collection for comprehensive analysis. Additionally, further fundamental experiments are warranted to fully elucidate the molecular mechanisms underlying \u003cem\u003eSg\u003c/em\u003esup-mediated promotion of CRC development. In conclusion, this study underscores the potential of \u003cem\u003eSg\u003c/em\u003esup as a promotive factor in CRC progression, presenting it as a prospective target for CRC prevention and treatment.\u003c/p\u003e "},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData Availability Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe original contributions presented in this study are included in the article, further inquiries can be directed to the corresponding author/s.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003edeclarations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe studies involving human participants were reviewed and approved by Guangzhou First People\u0026rsquo;s Hospital, Guangzhou, China. The patients/participants provided their written informed consent to participate in this study. The animal study was reviewed and approved by Guangdong Medical Laboratory Animal Center (GDMLAC; Certificate number SYXK 2022-0002). All subsequent studies were performed in accordance with the guidelines approved by the Animal Ethics Committee of GDMLAC.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eContributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eJ-QW an YZ designed the study and drafted the manuscript. JX, XN CH and H-LZ, H-MX involved in statistical analysis and interpretation of the data; M-ZZ and XG participated the animal experiments and recorded general status; YZ performed the sample collection and DNA extraction; YZ and H-MX collected the patient clinical and follow-up information; W-JQ and H-MX conducted mouse colonoscopy; Y-QN and Y-LZ planned and directed the project, and contributed to interpretation of the data, and revision of the article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by\u0026nbsp;the National Natural Science Foundation of China (82270577, 82203371, 82370552); Natural Science Foundation of Guangdong Province (2023A1515030214), and Yuqiang Nie Key Laboratory of Digestive Diseases in 2022-2023 (KY17010003).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eSung H, Ferlay J, Siegel R L, Laversanne M, Soerjomataram I, Jemal A, Bray F. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries[J]. CA: a cancer journal for clinicians, 2021, 71(3): 209\u0026ndash;249.\u003c/li\u003e\n\u003cli\u003eStidham R W ; H Peter D R. Colorectal Cancer in Inflammatory Bowel Disease[J]. Clinics in Colon and Rectal Surgery, 2018, 31(03): 168\u0026ndash;178.\u003c/li\u003e\n\u003cli\u003eRebersek M. Gut microbiome and its role in colorectal cancer[J]. BMC cancer, 2021, 21(1): 1\u0026ndash;13.\u003c/li\u003e\n\u003cli\u003eAhn J, Sinha R, Pei Z, Dominianni C, Wu J, Shi J, Goedert J J, Hayes R B, Yang L. Human gut microbiome and risk for colorectal cancer[J]. Journal of the National Cancer Institute, 2013, 105(24): 1907\u0026ndash;1911.\u003c/li\u003e\n\u003cli\u003eMcCoy W, Mason 3rd J. Enterococcal endocarditis associated with carcinoma of the sigmoid; report of a case[J]. Journal of the Medical Association of the State of Alabama, 1951, 21(6): 162\u0026ndash;166.\u003c/li\u003e\n\u003cli\u003ePardo C P, Gonzalez R C, Pinto M E S, Galiana A. Chapter 3 - Streptococcus gallolyticus and its implication in colorectal cancer[M]. FLOCH M H. //Colorectal Neoplasia and the Colorectal Microbiome. Academic Press,2020: 35\u0026ndash;55.\u003c/li\u003e\n\u003cli\u003eGrinberg M, Mansur A, Ferreira D, Bellotti G, Pileggi F. Endocarditis caused by Streptococcus bovis and colorectal neoplasms[J]. Arquivos brasileiros de cardiologia, 1990, 54(4): 265\u0026ndash;269.\u003c/li\u003e\n\u003cli\u003eBoleij A, Van Gelder M M, Swinkels D W, Tjalsma H. Clinical Importance of Streptococcus gallolyticus infection among colorectal cancer patients: systematic review and meta-analysis[J]. Clinical Infectious Diseases, 2011, 53(9): 870\u0026ndash;878.\u003c/li\u003e\n\u003cli\u003eCorredoira-S\u0026aacute;nchez J, Garc\u0026iacute;a-Garrote F, Rabu\u0026ntilde;al R, L\u0026oacute;pez-Roses L, Garc\u0026iacute;a-Pa\u0026iacute;s M J, Castro E, Gonz\u0026aacute;lez-Soler R, Coira A, Pita J, L\u0026oacute;pez-\u0026Aacute;lvarez M J, Alonso M P, Varela J. Association Between Bacteremia Due to Streptococcus gallolyticus subsp. gallolyticus (Streptococcus bovis I) and Colorectal Neoplasia: A Case-Control Study[J]. Clinical Infectious Diseases, 2012, 55(4): 491\u0026ndash;496.\u003c/li\u003e\n\u003cli\u003eKlein R S, Recco R A, Catalano M T, Edberg S C, Casey J I, Steigbigel N H. Association of Streptococcus bovis with carcinoma of the colon[J]. New England Journal of Medicine, 1977, 297(15): 800\u0026ndash;802.\u003c/li\u003e\n\u003cli\u003eAbdulamir A S, Hafidh R R, Bakar F A. Molecular detection, quantification, and isolation of Streptococcus gallolyticus bacteria colonizing colorectal tumors: inflammation-driven potential of carcinogenesis via IL-1, COX-2, and IL-8[J]. Molecular cancer, 2010, 9(1): 1\u0026ndash;18.\u003c/li\u003e\n\u003cli\u003eKumar R, Herold J L, Schady D, Davis J, Kopetz S, Martinez-Moczygemba M, Murray B E, Han F, Li Y, Callaway E, Others. Streptococcus gallolyticus subsp. gallolyticus promotes colorectal tumor development[J]. PLoS pathogens, 2017, 13(7): e1006440.\u003c/li\u003e\n\u003cli\u003eDumke J, Vollmer T, Akkermann O, Knabbe C, Dreier J. Case-control study: Determination of potential risk factors for the colonization of healthy volunteers with Streptococcus gallolyticus subsp. gallolyticus[J]. PLoS One, 2017, 12(5): e0176515.\u003c/li\u003e\n\u003cli\u003eAbdulamir A S, Hafidh R R, Mahdi L K, Al-Jeboori T, Abubaker F. Investigation into the controversial association of Streptococcus gallolyticus with colorectal cancer and adenoma[J]. BMC cancer, 2009, 9(1): 1\u0026ndash;12.\u003c/li\u003e\n\u003cli\u003eWong S H, Yu J. Gut microbiota in colorectal cancer: mechanisms of action and clinical applications[J]. Nature Reviews Gastroenterology \u0026amp; Hepatology, 2019, 16(11): 690\u0026ndash;704.\u003c/li\u003e\n\u003cli\u003eTaylor J C, Gao X, Xu J, Holder M, Petrosino J, Kumar R, Liu W, H\u0026ouml;\u0026ouml;k M, Mackenzie C, Hillhouse A, Others. A type VII secretion system of Streptococcus gallolyticus subsp. gallolyticus contributes to gut colonization and the development of colon tumors[J]. PLoS pathogens, 2021, 17(1): e1009182.\u003c/li\u003e\n\u003cli\u003eTaddese R, Garza D R, Ruiter L N, De Jonge M I, Belzer C, Aalvink S, Nagtegaal I D, Dutilh B E, Boleij A. Growth rate alterations of human colorectal cancer cells by 157 gut bacteria[J]. Gut Microbes, 2020, 12(1): 1799733.\u003c/li\u003e\n\u003cli\u003eZhang Y, Weng Y, Gan H, Zhao X, Zhi F. Streptococcus gallolyticus conspires myeloid cells to promote tumorigenesis of inflammatory bowel disease[J]. Biochemical and biophysical research communications, 2018, 506(4): 907\u0026ndash;911.\u003c/li\u003e\n\u003cli\u003eHahn M W. Broad diversity of viable bacteria in \u0026lsquo;sterile\u0026rsquo; (0.2 \u0026mu;m) filtered water[J]. Research in Microbiology, 2004, 155(8): 688\u0026ndash;691.\u003c/li\u003e\n\u003cli\u003eDai W, Xie D, Lu M, Li P, Lv H, Yang C, Peng Q, Zhu Y, Guo L, Zhang Y, Tan J, Lin Z. Characterization of white tea metabolome: Comparison against green and black tea by a nontargeted metabolomics approach[J]. Food Research International (Ottawa, Ont.), 2017, 96: 40\u0026ndash;45.\u003c/li\u003e\n\u003cli\u003eSreekumar A, Poisson L M, Rajendiran T M, Khan A P, Cao Q, Yu J, Laxman B, Mehra R, Lonigro R J, Li Y, Nyati M K, Ahsan A, Kalyana-Sundaram S, Han B, Cao X, Byun J, Omenn G S, Ghosh D, Pennathur S, Alexander D C, Berger A, Shuster J R, Wei J T, Varambally S, Beecher C, Chinnaiyan A M. Metabolomic profiles delineate potential role for sarcosine in prostate cancer progression[J]. Nature, 2009, 457(7231): 910\u0026ndash;914.\u003c/li\u003e\n\u003cli\u003eLiang J, Yang C, Li P, Zhang M, Xie X, Xie X, Chen Y, Wang Q, Zhou L, Luo X. Astragaloside IV inhibits AOM/DSS-induced colitis-associated tumorigenesis via activation of PPAR\u0026gamma; signaling in mice[J]. Phytomedicine: International Journal of Phytotherapy and Phytopharmacology, 2023, 121: 155116.\u003c/li\u003e\n\u003cli\u003eFeldman A T, Wolfe D. Tissue processing and hematoxylin and eosin staining[J]. Methods in Molecular Biology (Clifton, N.J.), 2014, 1180: 31\u0026ndash;43.\u003c/li\u003e\n\u003cli\u003eMagaki S, Hojat S A, Wei B, So A, Yong W H. An Introduction to the Performance of Immunohistochemistry[J]. Methods in molecular biology (Clifton, N.J.), 2019, 1897: 289\u0026ndash;298.\u003c/li\u003e\n\u003cli\u003eKoelink G R Pim J Wildenberg, Manon E Stitt, Larry W Feagan, Brian G Koldijk, Martinvan \u0026rsquo;t Wout, Angelique B Atreya, RajaVieth, MichaelBrandse, Johannan F Duijst, Suzannete Velde, Anje A D\u0026rsquo;Haens, Geert R A M Levesque, Barrett G van den Brink. Development of Reliable, Valid and Responsive Scoring Systems for Endoscopy and Histology in Animal Models for Inflammatory Bowel Disease[J]. Journal of Crohn\u0026rsquo;s \u0026amp; colitis, 2018, 12(7).\u003c/li\u003e\n\u003cli\u003eTrapnell C, Hendrickson D G, Sauvageau M, Goff L, Rinn J L, Pachter L. Differential analysis of gene regulation at transcript resolution with RNA-seq[J]. Nature Biotechnology, 2013, 31(1): 46\u0026ndash;53.\u003c/li\u003e\n\u003cli\u003eBoleij A, Van Gelder M M H J, Swinkels D W, Tjalsma H. Clinical Importance of Streptococcus gallolyticus Infection Among Colorectal Cancer Patients: Systematic Review and Meta-analysis[J]. Clinical Infectious Diseases, 2011, 53(9): 870\u0026ndash;878.\u003c/li\u003e\n\u003cli\u003eJuan C S, Fernando G G, Ram\u0026oacute;n R, Leopoldo L R, Jose G, Elena C, Roberto G S, Amparo C, Julia P, Jose L. Association between bacteremia due to Streptococcus gallolyticus subsp. gallolyticus (Streptococcus bovis I) and colorectal neoplasia: a case-control study.[J]. Clinical Infectious Diseases, 2012(4): 491\u0026ndash;496.\u003c/li\u003e\n\u003cli\u003eEwa P K, Mariana M, Laetitia A, Shaynoor D. Significance of Streptococcus gallolyticus subsp. gallolyticus Association With Colorectal Cancer[J]. Frontiers in Microbiology, 2018, 9: 614.\u003c/li\u003e\n\u003cli\u003eBooijink C C, El-Aidy S, Rajilić-Stojanović M, Heilig H G, Troost F J, Smidt H, Kleerebezem M, De Vos W M, Zoetendal E G. High temporal and inter-individual variation detected in the human ileal microbiota[J]. Environmental microbiology, 2010, 12(12): 3213\u0026ndash;3227.\u003c/li\u003e\n\u003cli\u003ePardo C P, Gonzalez R C, Pinto M, Galiana A. Streptococcus gallolyticus and its implication in colorectal cancer[J]. Colorectal Neoplasia and the Colorectal Microbiome, 2020.\u003c/li\u003e\n\u003cli\u003eDrewes J L, Domingue J C, Housseau F. Microbiota, mucosal immunity, and Colon cancer - ScienceDirect[J]. Colorectal Neoplasia and the Colorectal Microbiome, 2020: 157\u0026ndash;209.\u003c/li\u003e\n\u003cli\u003eAbdulamir A S, Hafidh R R, Bakar F A. The association of Streptococcus bovis/gallolyticus with colorectal tumors: The nature and the underlying mechanisms of its etiological role[J]. Journal of Experimental \u0026amp; Clinical Cancer Research, 2011, 30(1): 11.\u003c/li\u003e\n\u003cli\u003eJessika D, Tanja V, Oke A, Cornelius K, Jens D, Jose M C. Case-control study: Determination of potential risk factors for the colonization of healthy volunteers with Streptococcus gallolyticus subsp. gallolyticus[J]. PLoS ONE, 2017, 12(5): e0176515.\u003c/li\u003e\n\u003cli\u003eMaria A F, Antonio G, Victoria S H, Enrique O, Eva H I, Pilar L G, Adela C, Isabel C M, Manuel B V, Josefa G D. Streptococcus gallolyticus infection in colorectal cancer and association with biological and clinical factors[J]. Plos One, 2017, 12(3): e0174305.\u003c/li\u003e\n\u003cli\u003eKofuji S, Hirayama A, Eberhardt A O, Kawaguchi R, Sugiura Y, Sampetrean O, Ikeda Y, Warren M, Sakamoto N, Kitahara S, Yoshino H, Yamashita D, Sumita K, Wolfe K, Lange L, Ikeda S, Shimada H, Minami N, Malhotra A, Morioka S, Ban Y, Asano M, Flanary V L, Ramkissoon A, Chow L M L, Kiyokawa J, Mashimo T, Lucey G, Mareninov S, Ozawa T, Onishi N, Okumura K, Terakawa J, Daikoku T, Wise-Draper T, Majd N, Kofuji K, Sasaki M, Mori M, Kanemura Y, Smith E P, Anastasiou D, Wakimoto H, Holland E C, Yong W H, Horbinski C, Nakano I, DeBerardinis R J, Bachoo R M, Mischel P S, Yasui W, Suematsu M, Saya H, Soga T, Grummt I, Bierhoff H, Sasaki A T. IMP dehydrogenase-2 drives aberrant nucleolar activity and promotes tumorigenesis in glioblastoma[J]. Nature cell biology, 2019, 21(8): 1003\u0026ndash;1014.\u003c/li\u003e\n\u003cli\u003eNwosu Z C, Ward M H, Sajjakulnukit P, Poudel P, Ragulan C, Kasperek S, Radyk M, Sutton D, Menjivar R E, Andren A, Apiz-Saab J J, Tolstyka Z, Brown K, Lee H-J, Dzierozynski L N, He X, Ps H, Ugras J, Nyamundanda G, Zhang L, Halbrook C J, Carpenter E S, Shi J, Shriver L P, Patti G J, Muir A, Pasca Di Magliano M, Sadanandam A, Lyssiotis C A. Uridine-derived ribose fuels glucose-restricted pancreatic cancer[J]. Nature, 2023, 618(7963): 151\u0026ndash;158.\u003c/li\u003e\n\u003cli\u003eSanderson S M, Gao X, Dai Z, Locasale J W. Methionine metabolism in health and cancer: a nexus of diet and precision medicine[J]. Nature Reviews. Cancer, 2019, 19(11): 625\u0026ndash;637.\u003c/li\u003e\n\u003cli\u003eKazak L, Cohen P. Creatine metabolism: energy homeostasis, immunity and cancer biology[J]. Nature Reviews Endocrinology, 2020, 16(8): 421\u0026ndash;436.\u003c/li\u003e\n\u003cli\u003eZhang L, Bu P. The two sides of creatine in cancer[J]. Trends in Cell Biology, 2022, 32(5): 380\u0026ndash;390.\u003c/li\u003e\n\u003cli\u003eZhang L, Zhu Z, Yan H, Wang W, Wu Z, Zhang F, Zhang Q, Shi G, Du J, Cai H, Zhang X, Hsu D, Gao P, Piao H-L, Chen G, Bu P. Creatine promotes cancer metastasis through activation of Smad2/3[J]. Cell Metabolism, 2021, 33(6): 1111-1123.e4.\u003c/li\u003e\n\u003cli\u003eMacPherson R E K, Gamu D, Frendo-Cumbo S, Castellani L, Kwon F, Tupling A R, Wright D C. Sarcolipin knockout mice fed a high-fat diet exhibit altered indices of adipose tissue inflammation and remodeling[J]. Obesity (Silver Spring, Md.), 2016, 24(7): 1499\u0026ndash;1505.\u003c/li\u003e\n\u003cli\u003eKurmi K, Hitosugi S, Yu J, Boakye-Agyeman F, Wiese E K, Larson T R, Dai Q, Machida Y J, Lou Z, Wang L, Boughey J C, Kaufmann S H, Goetz M P, Karnitz L M, Hitosugi T. Tyrosine Phosphorylation of Mitochondrial Creatine Kinase 1 Enhances a Druggable Tumor Energy Shuttle Pathway[J]. Cell Metabolism, 2018, 28(6): 833-847.e8.\u003c/li\u003e\n\u003cli\u003eFenouille N, Bassil C F, Ben-Sahra I, Benajiba L, Alexe G, Ramos A, Pikman Y, Conway A S, Burgess M R, Li Q, Luciano F, Auberger P, Galinsky I, DeAngelo D J, Stone R M, Zhang Y, Perkins A S, Shannon K, Hemann M T, Puissant A, Stegmaier K. The creatine kinase pathway is a metabolic vulnerability in EVI1-positive acute myeloid leukemia[J]. Nature Medicine, 2017, 23(3): 301\u0026ndash;313.\u003c/li\u003e\n\u003cli\u003eJi L, Zhao X, Zhang B, Kang L, Song W, Zhao B, Xie W, Chen L, Hu X. Slc6a8-Mediated Creatine Uptake and Accumulation Reprogram Macrophage Polarization via Regulating Cytokine Responses[J]. Immunity, 2019, 51(2): 272-284.e7.\u003c/li\u003e\n\u003cli\u003eJaehong K, Jong-Sup B. Tumor-Associated Macrophages and Neutrophils in Tumor Microenvironment[J]. Mediators of Inflammation, 2016, 2016: 1\u0026ndash;11.\u003c/li\u003e\n\u003cli\u003eFridman W H, Pag\u0026egrave;s F, Saut\u0026egrave;s-Fridman C, Galon J. The immune contexture in human tumours: impact on clinical outcome[J]. Nature Reviews Cancer, 2012, 12(4): 298\u0026ndash;306.\u003c/li\u003e\n\u003cli\u003eYang L, Zhang Y. Tumor-associated macrophages: from basic research to clinical application[J]. Journal of Hematology \u0026amp; Oncology, 2017, 10(1): 1\u0026ndash;12.\u003c/li\u003e\n\u003cli\u003eQin H XialiGu, YuLiu, TianyuWang, ChenZhong, WeilongWang, BangmaoCao. Gut mycobiome: A promising target for colorectal cancer[J]. Biochimica et biophysica acta. Reviews on cancer, 2021, 1875(1): 188489.\u003c/li\u003e\n\u003cli\u003eYang Y, Li L, Xu C, Wang Y, Qiu F. Cross-talk between the gut microbiota and monocyte-like macrophages mediates an inflammatory response to promote colitis-associated tumourigenesis[J]. Gut, 2020, 70(8).\u003c/li\u003e\n\u003cli\u003eChen T, Li Q, Wu J, Wu Y, Peng W, Li H, Wang J, Tang X, Peng Y, Fu X. Fusobacterium nucleatum promotes M2 polarization of macrophages in the microenvironment of colorectal tumours via a TLR4-dependent mechanism.[J]. Cancer immunology, immunotherapy : CII, 2018, 67(10): 1635\u0026ndash;1646.\u003c/li\u003e\n\u003cli\u003eWang H, Tian T, Zhang J. Tumor-Associated Macrophages (TAMs) in Colorectal Cancer (CRC): From Mechanism to Therapy and Prognosis[J]. International Journal of Molecular Sciences, 2021, 22(16): 8470.\u003c/li\u003e\n\u003cli\u003eCui L, Li K, Zhou Y Y, Zhang T, Li T. Correlations of Tumor-associated Macrophage Subtypes with Liver Metastases of Colorectal Cancer[J]. Asian Pacific Journal of Cancer Prevention Apjcp, 2013, 14(2): 1003\u0026ndash;1007.\u003c/li\u003e\n\u003cli\u003ePadova F D, Ryffel B, Quesniaux V. IL-17, IL-22 and Their Producing Cells: Role in Inflammation and Autoimmunity[M]. IL-17, IL-22 and Their Producing Cells: Role in Inflammation and Autoimmunity,2013.\u003c/li\u003e\n\u003cli\u003eNawrocka A, Owczarek W, Pilu A. Th17 cells and Th17-cytokines in the pathogenesis of inflammatory diseases[J]. International Review of Allergology and Clinical Immunology, 2011, 17(1): 27\u0026ndash;31.\u003c/li\u003e\n\u003cli\u003eMcGeachy M J, Cua D J, Gaffen S L. The IL-17 family of cytokines in health and disease[J]. Immunity, 2019, 50(4): 892\u0026ndash;906.\u003c/li\u003e\n\u003cli\u003ePan Y, Yang W, Tang B, Wang X, Zhang Q, Li W, Li L. The protective and pathogenic role of Th17 cell plasticity and function in the tumor microenvironment[J]. Frontiers in Immunology, 2023, 14: 1192303.\u003c/li\u003e\n\u003cli\u003eNumasaki M. Interleukin-17 promotes angiogenesis and tumor growth[J]. Blood, 2003, 101(7): 2620\u0026ndash;2627.\u003c/li\u003e\n\u003cli\u003eBrevi A, Cogrossi L L, Grazia G, Masciovecchio D, Impellizzieri D, Lacanfora L, Grioni M, Bellone M. Much More Than IL-17A: Cytokines of the IL-17 Family Between Microbiota and Cancer[J]. Frontiers in Immunology, 2020, 11: 565470.\u003c/li\u003e\n\u003cli\u003eIshigame H, Kakuta S, Nagai T, Kadoki M, Nambu A, Komiyama Y, Fujikado N, Tanahashi Y, Akitsu A, Kotaki H, Sudo K, Nakae S, Sasakawa C, Iwakura Y. Differential Roles of Interleukin-17A and -17F in Host Defense against Mucoepithelial Bacterial Infection and Allergic Responses[J]. Immunity, 2009, 30(1): 108\u0026ndash;119.\u003c/li\u003e\n\u003cli\u003eChen Y, Chen Y, Cao P, Su W, Dong W. Fusobacterium nucleatum facilitates ulcerative colitis through activating IL‐17F signaling to NF‐\u0026kappa;B via the upregulation of CARD3 expression[J]. The Journal of Pathology, 2020, 250(2).\u003c/li\u003e\n\u003cli\u003eVitiello G A, Miller G. Targeting the interleukin-17 immune axis for cancer immunotherapy[J]. The Journal of Experimental Medicine, 2020, 217(1): e20190456.\u003c/li\u003e\n\u003cli\u003eMartin-Orozco N, Muranski P, Chung Y, Yang X O, Yamazaki T, Lu S, Hwu P, Restifo N P, Overwijk W W, Chen D. T helper 17 cells promote cytotoxic T cell activation in tumor immunity.[J]. Immunity, 2009, 31(5): 787\u0026ndash;798.\u003c/li\u003e\n\u003cli\u003eWang L, Yi T, Kortylewski M, Pardoll D M, Zeng D, Yu H. IL-17 can promote tumor growth through an IL-6-Stat3 signaling pathway[J]. The Journal of Experimental Medicine, 2009, 206(7): 1457\u0026ndash;1464.\u003c/li\u003e\n\u003cli\u003eXu M, Pokrovskii M, Ding Y, Yi R, Au C, Harrison O J, Galan C, Belkaid Y, Bonneau R, Littman D R. c-MAF-dependent regulatory T cells mediate immunological tolerance to a gut pathobiont[J]. Nature, 2018, 554(7692): 373\u0026ndash;377.\u003c/li\u003e\n\u003cli\u003eGomes A L, Teijeiro A, Bur\u0026eacute;n S, Tummala K S, Yilmaz M, Waisman A, Theurillat J-P, Perna C, Djouder N. Metabolic Inflammation-Associated IL-17A Causes Non-alcoholic Steatohepatitis and Hepatocellular Carcinoma[J]. Cancer Cell, 2016, 30(1): 161\u0026ndash;175.\u003c/li\u003e\n\u003cli\u003eKuang D-M, Zhao Q, Wu Y, Peng C, Wang J, Xu Z, Yin X-Y, Zheng L. Kuang DM, Zhao Q, Wu Y, Peng C, Wang J, Xu Z, Yin XY, Zheng LPeritumoral neutrophils link inflammatory response to disease progression by fostering angiogenesis in hepatocellular carcinoma. J Hepatol 54(5): 948-955[J]. Journal of hepatology, 2010, 54: 948\u0026ndash;55.\u003c/li\u003e\n\u003cli\u003eMcallister F, Bailey J, Alsina J, Nirschl C, Sharma R, Fan H, Rattigan Y, Roeser J, Lankapalli R, Zhang H. Oncogenic Kras activates a hematopoietic-to-epithelial IL-17 signaling axis in preinvasive pancreatic neoplasia.[J]. Cancer cell, 2014, 25(5): 621\u0026ndash;637.\u003c/li\u003e\n\u003cli\u003eShen J, Sun X, Pan B, Cao S, Cao J, Che D, Liu F, Zhang S, Yu Y. IL-17 induces macrophages to M2-like phenotype via NF-\u0026kappa;B[J]. Cancer Management and Research, 2018, 10: 4217\u0026ndash;4228.\u003c/li\u003e\n\u003cli\u003eBarin J G, Baldeviano G C, Talor M V, Wu L, Ong S, Quader F, Chen P, Zheng D, Caturegli P, Rose N R, Cih\u0026aacute;kov\u0026aacute; D. Macrophages participate in IL-17-mediated inflammation[J]. European Journal of Immunology, 2012, 42(3): 726\u0026ndash;736.\u003c/li\u003e\n\u003cli\u003eNishikawa K, Seo N, Torii M, Ma N, Muraoka D, Tawara I, Masuya M, Tanaka K, Takei Y, Shiku H, Katayama N, Kato T. Interleukin-17 Induces an Atypical M2-Like Macrophage Subpopulation That Regulates Intestinal Inflammation[J]. PLOS ONE, 2014, 9(9): e108494.\u003c/li\u003e\n\u003cli\u003eMiller J E, Ahn S H, Marks R M, Monsanto S P, Fazleabas A T, Koti M, Tayade C. IL-17A Modulates Peritoneal Macrophage Recruitment and M2 Polarization in Endometriosis[J]. Frontiers in Immunology, 2020, 11[2023-09-19].\u003c/li\u003e\n\u003cli\u003eLi Q, Liu L, Zhang Q, Liu S, Ge D, You Z. Interleukin-17 Indirectly Promotes M2 Macrophage Differentiation through Stimulation of COX-2/PGE2 Pathway in the Cancer Cells[J]. Cancer Research and Treatment : Official Journal of Korean Cancer Association, 2014, 46(3): 297\u0026ndash;306.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"gut-pathogens","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"gutp","sideBox":"Learn more about [Gut Pathogens](http://gutpathogens.biomedcentral.com/)","snPcode":"13099","submissionUrl":"https://submission.nature.com/new-submission/13099/3","title":"Gut Pathogens","twitterHandle":"@GutPathogens","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"CRC, Streptococcus gallolyticus, supernatant, macrophages","lastPublishedDoi":"10.21203/rs.3.rs-6861254/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6861254/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eColorectal cancer (CRC) is a highly prevalent malignant tumor worldwide, and emerging evidence suggests that the gut microbiota plays a crucial role in its development. \u003cem\u003eStreptococcus gallolyticus\u003c/em\u003e(\u003cem\u003eSg\u003c/em\u003e) is a gut commensal bacterium that can also act as an opportunistic pathogen in association with CRC. In this study, it was found that the detection rate of \u003cem\u003eSg\u003c/em\u003e was higher in CRC tissues and the high burden of \u003cem\u003eSg\u003c/em\u003e was correlated with tumor location. Moreover, the researchers demonstrated that \u003cem\u003eSg\u003c/em\u003e supernatant could promote the proliferation of CRC cells, increase tumor burden in AOM/DSS-induced mice, exacerbate inflammatory response, and promote M2 polarization of macrophages. The aforementioned effects may be related to the IL-17 pathway, as revealed by RNA-seq analysis. Overall, these findings suggest a potential role of \u003cem\u003eSg\u003c/em\u003e in the pathogenesis of CRC, and targeting its supernatant may represent a promising approach for the prevention and treatment of CRC.\u003c/p\u003e","manuscriptTitle":"Streptococcus gallolyticus supernatant promotes macrophage M2 polarization and regulates the IL-17 pathway in the oncogenesis of colorectal cancer","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-06-16 08:39:36","doi":"10.21203/rs.3.rs-6861254/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-06-18T03:31:43+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-06-17T17:28:27+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-06-15T16:52:59+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"330608877782385152452725851572567803570","date":"2025-06-12T08:48:41+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"57841451756379157582791502583169127818","date":"2025-06-12T08:42:01+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"241629058544136380605086153073783417099","date":"2025-06-12T08:40:30+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-06-12T08:35:29+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-06-11T15:08:33+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-06-11T15:07:51+00:00","index":"","fulltext":""},{"type":"submitted","content":"Gut Pathogens","date":"2025-06-10T09:03:59+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"gut-pathogens","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"gutp","sideBox":"Learn more about [Gut Pathogens](http://gutpathogens.biomedcentral.com/)","snPcode":"13099","submissionUrl":"https://submission.nature.com/new-submission/13099/3","title":"Gut Pathogens","twitterHandle":"@GutPathogens","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"a9011a08-6528-4034-8e86-35766f3a434a","owner":[],"postedDate":"June 16th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-08-18T16:05:40+00:00","versionOfRecord":{"articleIdentity":"rs-6861254","link":"https://doi.org/10.1186/s13099-025-00731-2","journal":{"identity":"gut-pathogens","isVorOnly":false,"title":"Gut Pathogens"},"publishedOn":"2025-08-12 15:57:45","publishedOnDateReadable":"August 12th, 2025"},"versionCreatedAt":"2025-06-16 08:39:36","video":"","vorDoi":"10.1186/s13099-025-00731-2","vorDoiUrl":"https://doi.org/10.1186/s13099-025-00731-2","workflowStages":[]},"version":"v1","identity":"rs-6861254","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6861254","identity":"rs-6861254","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}