Dencichine ameliorates hepatic fibrosis by modulating the PI3K-AKT

Dencichine ameliorates hepatic fibrosis by modulating the PI3K-AKT | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Dencichine ameliorates hepatic fibrosis by modulating the PI3K-AKT Longkuan Li, Huan Luo, Zeyun Liu, Yingqiang Chen, Fuxue Meng This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7450683/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background: Hepatic fibrosis is a major consequence of various chronic liver injuries and can progress to cirrhosis and hepatocellular carcinoma. As a medicinal and edible traditional Chinese herb, Panax notoginseng contains an active ingredient, Dencichine, which shows promising potential in the treatment of hepatic fibrosis. This study aimed to investigate the mechanism of Dencichine in ameliorating hepatic fibrosis using both in vivo and in vitro models. Methods: C57BL/6J mice were randomly grouped and injected with 10% CCl₄ for 15 weeks to induce hepatic fibrosis. Dencichine treatment was administered from the 7th week onward. LX-2 hepatic stellate cells were induced with 20 ng/mL PDGF-BB for 1–48 hours to establish a fibrotic model, and treatment groups received low-, medium-, and high-dose Dencichine. Liver function was assessed by measuring serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), hyaluronic acid (HA), and laminin (LN). Liver morphology and fibrosis were evaluated using hematoxylin-eosin (H&E) staining, Masson staining, and Sirius red staining. Gene and protein expression levels were analyzed using quantitative reverse transcription polymerase chain reaction (RT-PCR) and Western blotting, respectively. Cell migration was assessed via scratch and Transwell assays, while cell proliferation and cell cycle were examined using EdU assay and flow cytometry. Results: Dencichine significantly reduced serum levels of AST, ALT, HA, and LN in CCl₄-treated mice, alleviated liver injury, and decreased collagen deposition. Furthermore, Dencichine suppressed the expression of cyclin D1 and cyclin E1. It also inhibited the phosphorylation of PI3K and AKT in hepatic fibrotic cells. Conclusion: The findings suggest that Dencichine may effectively attenuate the progression of hepatic fibrosis by inhibiting the PI3K-AKT signaling pathway, thereby exerting anti-fibrotic effects. Dencichine Hepatic fibrosis PI3K-AKT signaling pathway Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Hepatic fibrosis is a pathological condition arising from various chronic liver diseases, characterized by excessive deposition of extracellular matrix (ECM) in the liver, which disrupts its normal structure and function [ 1 ] . It represents the fundamental cause of complications in all end-stage liver diseases and poses a serious threat to human health. According to statistics, liver diseases affect nearly 800 million people worldwide annually, resulting in over 2 million deaths each year [ 2 ] . Although significant progress has been made in elucidating the pathological mechanisms of hepatic fibrosis and numerous candidate drugs have been identified for treatment, no anti-fibrotic therapy has yet been approved specifically for hepatic fibrosis. Current treatment strategies primarily focus on managing the underlying causes of fibrotic damage, such as antiviral therapy or alcohol abstinence [ 3 ] . Existing anti-fibrotic agents face multiple limitations. Conventional Western medicines often target single genes or proteins, making it difficult to comprehensively intervene in the complex process of fibrosis. Moreover, they are prone to adverse effects, which restrict their clinical application. Therefore, the development of safe and effective therapeutic approaches and drugs for hepatic fibrosis remains an urgent and critical challenge in the medical field. Traditional Chinese Medicine (TCM) possesses unique advantages and potential in the treatment of hepatic fibrosis. Studies have shown that many Chinese herbal medicines and their extracts exhibit beneficial anti-fibrotic effects. For instance, components such as tanshinone and salvianolic acid from Salvia miltiorrhiza can inhibit the activation and proliferation of hepatic stellate cells (HSCs) and reduce collagen synthesis, thereby alleviating the extent of liver fibrosis [ 4 – 6 ] . Huperzine A has been shown to mitigate the progression of hepatic fibrosis by modulating oxidative stress and inflammatory responses [ 7 ] . These findings provide both a theoretical foundation and practical experience for the use of TCM in treating hepatic fibrosis. Panax notoginseng, a valuable traditional Chinese herb, is known for its effects in resolving stasis, stopping bleeding, reducing swelling, and alleviating pain [ 8 ] . In recent years, a growing body of research has demonstrated its remarkable efficacy against hepatic fibrosis [ 9 ] . Studies indicate that Panax notoginseng can reduce serum markers of liver fibrosis in rat models, suppress inflammatory responses, and inhibit the activation and proliferation of HSCs, thereby ameliorating the severity of liver fibrosis [ 10 ] . However, its underlying mechanisms have not yet been fully elucidated. Therefore, this study employs both in vivo and in vitro approaches to investigate the mechanisms by which Dencichine-a key bioactive component of Panax notoginseng-modulates hepatic fibrosis. The findings aim to provide a theoretical basis for the application of Dencichine in the treatment of hepatic fibrosis and offer potential targets and insights for the development of novel anti-fibrotic drugs. Materials and Methods Main Reagents Dencichine Ft1 (Solarbio, Beijing, China); Carbon tetrachloride (Nanjing Reagent, Nanjing, China), prepared as a 20% (v/v) CCl4 solution in olive oil for modeling; Alanine aminotransferase (ALT), Aspartate aminotransferase (AST), Hyaluronic acid (HA), and Laminin (LN) assay kits (all from Solarbio, Beijing, China); Hematoxylin and eosin (HE) staining kit, Masson staining kit, and Sirius Red staining kit (MCE Life Sciences, USA); Rabbit anti-mouse α-smooth muscle actin (α-SMA) polyclonal antibody, rabbit anti-mouse transforming growth factor-β1 (TGF-β1) polyclonal antibody, rabbit anti-mouse Smad2/3 polyclonal antibody, rabbit anti-mouse p-Smad2/3 polyclonal antibody, as well as antibodies against PI3K, AKT, collagen 1, and TIMP1 (all from MCE Life Sciences, USA); Horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG secondary antibody (Solarbio, Beijing, China); RIPA lysis buffer, BCA protein quantification kit, SDS-PAGE gel preparation kit, and ECL chemiluminescence kit (Beyotime, Shanghai, China); Trizol reagent (Solarbio, Beijing, China), reverse transcription kit, and SYBR Green quantitative PCR kit (Thermo Scientific, USA). Methods Establishment of Mouse and Cell Models of Liver Fibrosis Forty male C57BL/6J mice, aged 6–7 weeks and weighing 16–20 g, were purchased from Nanjing Junke Biotechnology Co., Ltd. (Nanjing, China). Upon arrival, the mice were acclimatized for one week in an animal room maintained at a temperature of (22 ± 2) °C and relative humidity of (50 ± 10)% before the experiment. They were then randomly divided into four groups (n = 10 per group): the normal control group, the model group, the low-dose dencichine group, and the high-dose dencichine group. From week 1 to week 15, the mice received intraperitoneal injections twice a week of either olive oil or a 10% carbon tetrachloride (CCl₄) solution (dissolved in olive oil) at a dosage of 5 µL/g [ 3 ] . Starting from the end of week 7, mice in the treatment groups were administered dencichine via oral gavage daily for 8 consecutive weeks at a volume of 0.2 mL per 10 g body weight. The low-dose group received dencichine at 2.925 g/(kg·day), while the high-dose group received a significantly higher dose of 11.7 g/(kg·day) [ 10 ] . After the 8-week gavage period, the mice were euthanized. Anesthesia was induced by intraperitoneal injection of 0.3% sodium pentobarbital (0.05 g/kg), followed by the collection of blood and liver samples. The study protocol was approved by the Animal Ethics Committee of the Third Affiliated Hospital of Guizhou Medical University (Approval No.: 2022A020). For the in vitro studies, hepatic stellate cells (LX-2) were stimulated with 20 ng/mL PDGF-BB for durations ranging from 1 to 48 hours, based on the characteristics of the specific detection indicators [ 11 ] . The drug treatment groups were administered dencichine at concentrations of 0.01 mM, 0.1 mM, and 1 mM, respectively. Collection of Biological Samples At the end of the experiment, specifically after the 8-week administration period, the mice were fasted for 12 hours and anesthetized via intraperitoneal injection of sodium pentobarbital at the concentration mentioned above. Blood samples were collected using the eyeball blood extraction method. The blood was placed in centrifuge tubes, allowed to stand at room temperature for 2 hours, and then centrifuged at 4°C and 3000 rpm for 10 minutes to separate the serum. The serum was aliquoted and stored at -80°C for subsequent analysis. The mice were promptly dissected, and their livers were rapidly excised. The livers were rinsed with pre-cooled physiological saline and blotted dry with filter paper. A portion of the left lobe liver tissue was immersion-fixed in 10% neutral buffered formalin for subsequent histopathological examinations, including Hematoxylin and Eosin (H&E) staining, Masson's trichrome staining, and Sirius Red staining, to assess the degree of liver inflammation and fibrosis. The remaining liver tissue was wrapped in aluminum foil, rapidly frozen in liquid nitrogen, and subsequently transferred to a -80°C freezer for preservation. This tissue was reserved for subsequent analyses, such as Western blotting to detect relevant protein expression levels and quantitative real-time polymerase chain reaction (qRT-PCR) to measure the expression levels of related genes. Measurement of Serum Liver Function and Liver Fibrosis Indices The activities of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in serum were measured using a fully automated biochemical analyzer (BIOBASE, Shandong, China). Enzyme-linked immunosorbent assay (ELISA) was employed to determine the serum levels of hyaluronic acid (HA), laminin (LN), transforming growth factor-beta 1 (TGF-β1), interleukin-6 (IL-6), tumor necrosis factor-alpha (TNF-α), interferon-gamma (IFN-γ), malondialdehyde (MDA), and platelet-derived growth factor BB (PDGF-BB). Histopathological Examination of Liver Tissue The fixed liver tissues were embedded in paraffin, sectioned, and subsequently subjected to Hematoxylin and Eosin (H&E) staining. The morphological architecture of the liver tissue was observed under a light microscope to assess the degree of hepatocyte degeneration, necrosis, and inflammatory cell infiltration. Masson's trichrome staining was performed to visualize the deposition of collagen fibers. The collagen fiber area ratio was quantitatively analyzed using ImageJ image analysis software to evaluate the extent of liver fibrosis. Sirius Red staining was observed under polarized light microscopy, wherein type I collagen appears red and type III collagen appears green. This staining method allows for intuitive visualization of the distribution and content changes of different collagen types, providing further assessment of the degree and pattern of liver fibrosis. Western Blot Analysis of Protein Expression Approximately 20 mg of liver tissue was thoroughly homogenized and lysed to extract total protein. Alternatively, hepatic stellate cells were collected by centrifugation and lysed for total protein extraction. The proteins were separated by SDS-PAGE and subsequently transferred onto a PVDF membrane (Millipore Ltd.) using an electrophoresis apparatus from Anneng Biotechnology. After blocking, the membrane was incubated overnight at 4°C with the following primary antibodies: α-SMA (1:1000), Collagen I, Smad2/3, p-Smad2/3, PDGFR-β, MMP2, MMP9, TIMP1, and GAPDH (1:5000). Then, the membrane was incubated at room temperature for 1 hour with a horseradish peroxidase (HRP)-conjugated goat anti-rabbit or anti-mouse IgG secondary antibody (1:5000). GAPDH monoclonal antibody was used as an internal reference control for normalization. RT-PCR for Gene Expression Analysis Total RNA was extracted from hepatic stellate cells or liver tissue samples using the TRIzol-chloroform method. According to the instructions of the Bestar qPCR RT Kit, the reverse transcription reaction system was prepared. Following reverse transcription, a 20 µl real-time PCR amplification reaction system was configured as per the manufacturer's protocol. Fluorescence-based real-time quantitative PCR was performed using the Agilent Stratagene Mx3000P real-time PCR system. The experimental data were analyzed using the 2^(-ΔΔCt) method. The sequence-specific PCR primers used are listed below. ID Sequence F (5’- 3’) Sequence R (3’- 5’) GAPDH CCTCGTCTCATAGACAAGATGGT GGGTAGAGTCATACTGGAACATG cyclinE1 AGTACCCACAGCAGGTCTTC CTGCATCAACTCCAACGAGG cyclinD1 AAGTGTGACCCGGACTGC AGCTTCTTCCTCCACTTCCC Timp1 CTCTGGCATCCTCTTGTTGC GCCCTTATAACCAGGTCCGA Mmp9 TCGGATGGTTATCGCTGGTG AAGACGCACATCTCTCCTGC Mmp2 GAACACCATCGAGACCATGC CATGCTCCCATCGACCAAAG α-SMA GGGCCAAAAGGACAGCTATG TGATGCCGTGTTCTATCGGA PDGF-βR TCGAGCCAAGACACCTCAAA AGTGCCTTCTTGTCATGGGT collagenⅠ GAGAGAGCATGACCGATGGA GTAGGCTACGCTGTTCTTGC Cell Proliferation Assay Cells were seeded in a 96-well plate (1.5 × 10⁵ cells/well in 100 µL medium) with three replicate wells per condition. The cells were treated with 0.01 mM, 0.1 mM, and 1 mM dencichine for 24, 48, and 72 hours, respectively. Cell viability was assessed using a CCK-8 kit according to the manufacturer’s instructions, and the absorbance was measured at a wavelength of 450 nm. For the EdU assay, cells in the logarithmic growth phase were incubated with EdU working solution at a final concentration of 30 µM for 12 hours. After incubation, the cells were collected, fixed with 4% paraformaldehyde at room temperature for 15 minutes, and washed twice with PBS. Permeabilization was performed using 0.5% Triton X-100 for 15 minutes, followed by incubation with Click reaction mixture for 30 minutes at room temperature in the dark. The cells were then washed twice with PBS and subjected to flow cytometry analysis. To prepare samples for flow cytometry, cells were collected by centrifugation and resuspended as a single-cell suspension. They were incubated with fluorescence-conjugated antibodies for 30 minutes at room temperature in the dark, washed twice with PBS to remove unbound antibodies, resuspended in flow cytometry buffer, filtered, and analyzed using a flow cytometer. Cell Migration Assay For the wound healing (scratch) assay, cells were seeded in 6-well plates at a density of 5 × 10⁵ cells per well and cultured at 37°C until 100% confluent monolayer formation. A uniform scratch was created using a sterile 200 µL pipette tip held vertically. After gently washing with PBS to remove detached cells, images of the same scratch location were captured at 0, 12, and 24 hours under a microscope. The wound area was quantitatively analyzed using ImageJ software. In the Transwell migration assay, cells were collected and resuspended in serum-free medium. A total of 5 × 10⁴ cells were seeded into the upper chamber and incubated for 24–48 hours at 37°C. Cells that migrated to the lower membrane surface were fixed with 4% paraformaldehyde for 30 minutes and stained with 0.1% crystal violet for 20 minutes. The number of migrated cells was counted in five randomly selected fields under a microscope. Data Analysis Data analysis was performed using GraphPad Prism 8.0 statistical software. Experimental data are expressed as mean ± standard deviation (x ± s). Comparisons between groups were analyzed by one-way analysis of variance (One-way ANOVA), with a significance threshold set at P < 0.05. Results Dencichine Attenuates CCl₄-Induced Liver Fibrosis in Mice This study utilized a C57BL/6J mouse model to investigate whether dencichine can mitigate the progression of liver fibrosis. Biochemical results showed that compared with the normal control group, the model group exhibited significantly elevated serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), hyaluronic acid (HA), and laminin (LN) (P < 0.01), indicating severe hepatocellular damage induced by CCl₄. In dencichine-treated groups, the CCl₄-induced increases in ALT, AST, HA, and LN levels were markedly alleviated. Additionally, the oxidative stress indicator GSH/GSSG ratio was significantly higher than that in the model group (Fig. 1 A). Histopathological examination via H&E, Masson’s trichrome, and Sirius red staining revealed severe liver injury, inflammatory infiltration, and expanded fibrotic areas in the CCl₄ model group (Fig. 1 B). Western blot and RT-PCR results demonstrated significant upregulation of hepatic stellate cell activation marker α-SMA and fibrosis marker collagen type I (Collagen I), along with increased expression of platelet-derived growth factor receptor-β (PDGFR-β), matrix metalloproteinases (MMP2 and MMP9), and tissue inhibitor of metalloproteinase-1 (TIMP1) in the model group. However, these indicators were markedly reduced in dencichine-treated groups (Fig. 1 C, D). ELISA results further confirmed that CCl₄ treatment significantly increased the levels of Col1a1, α-SMA, TNF-α, TGF-β1, IL-6, and PDGF-BB, while dencichine treatment notably modulated the expression of these proteins (Fig. 2 ). These findings suggest that dencichine treatment provides substantial benefits in alleviating CCl₄-induced liver fibrosis in mice, delaying the progression of liver fibrosis and reducing inflammatory infiltration. Dencichine Influences the Function of PDGF-BB-Activated Hepatic Stellate Cells To further investigate the role of dencichine in liver cells, hepatic stellate cells were activated using platelet-derived growth factor-BB (PDGF-BB) and subsequently treated with low, medium, and high concentrations of dencichine. As shown in Figs. 3 A and 3 F, dencichine inhibited the proliferation of hepatic stellate cells in a concentration-dependent manner, restricted cell migration, and promoted apoptosis (Figs. 3 B– 3 E). These findings suggest that dencichine alleviates the progression of fibrosis by suppressing hepatic stellate cell activation through the regulation of cell proliferation and the promotion of apoptosis. Dencichine Attenuates Liver Fibrosis via the PI3K/AKT Pathway in a Cellular Model Given the critical role of the PI3K/AKT pathway in the survival and activation of hepatic stellate cells, we hypothesized that it might be a potential target of dencichine. We further investigated the mechanism by which dencichine inhibits liver fibrosis in a cellular model. Western blot analysis in PDGF-BB-induced LX-2 hepatic stellate cells showed that dencichine treatment suppressed the phosphorylation of PI3K and AKT in a dose-dependent manner, without altering the total protein levels of PI3K and AKT (Fig. 4 A). Furthermore, treatment with the PI3K inhibitor LY294002 largely reversed the inhibitory effects of dencichine on the expression of α-SMA and Col1a1 (Fig. 4 B), as well as the protein expression of CyclinD1, CyclinE1, MMP2, and MMP9. RT-PCR results of related functional genes were consistent with these findings. These data suggest that dencichine likely exerts its anti-fibrotic effects primarily through inhibition of the PI3K/AKT signaling pathway. Discussion As a sequela of chronic liver injury, the core mechanism of liver fibrosis lies in the sustained activation and proliferation of hepatic stellate cells (HSCs), leading to excessive deposition of extracellular matrix (ECM) [ 12 ] . Despite recent advances in understanding its molecular mechanisms, effective anti-fibrotic treatment options remain limited. This study explored the therapeutic potential of dencichine, one of the main active components of Panax notoginseng, in liver fibrosis models and further elucidated its molecular mechanisms. Our key finding is that dencichine significantly alleviates liver fibrosis progression both in vivo and in vitro, primarily by inhibiting the PI3K/AKT signaling pathway, thereby suppressing the proliferation and migration of HSCs. First, our in vivo experimental data demonstrate the anti-fibrotic efficacy of dencichine. In a CCl₄-induced mouse liver fibrosis model, dencichine treatment markedly improved liver function (reduced ALT, AST, HA, and LN levels) and effectively decreased collagen deposition (as indicated by reduced Sirius Red staining area). More importantly, at the molecular level, dencichine dose-dependently downregulated the expression of key fibrosis markers, α-SMA and Collagen I. α-SMA is a specific marker of activated HSCs, while Collagen I is the predominant collagen type in fibrotic scars [ 13 – 14 ] . These results collectively suggest that dencichine targets the central executors of liver fibrosis—activated HSCs—and reverses their pathological functions. To further investigate the mechanism of dencichine’s action on HSCs, we conducted in vitro studies using the human HSC line LX-2. The PI3K/AKT pathway serves as a central hub regulating cell survival, proliferation, metabolism, and migration, playing a critical pro-survival role in the activation and maintenance of HSCs [ 15 – 17 ] . Our data show that dencichine treatment significantly reduced the phosphorylation levels of PI3K and AKT in LX-2 cells without affecting total protein levels, indicating specific inhibition of pathway activation rather than protein expression. To further establish the causal relationship between PI3K/AKT inhibition and the anti-fibrotic phenotype, we used the inhibitor LY294002 [ 18 ] . The results confirmed that the anti-fibrotic effects of dencichine are functionally dependent on PI3K/AKT pathway inhibition. While previous studies on Panax notoginseng in liver fibrosis have focused on mechanisms involving MAPK [10], JAK2/STAT3 [ 19 ] , and TGF-β pathways [ 20 , 21 ] , similarities and differences exist. The common ground is that active components of Panax notoginseng exhibit anti-fibrotic effects. The distinction lies in the fact that this study is the first to report the role of dencichine in liver fibrosis and its specific mechanism via PI3K/AKT signaling. This study demonstrates that dencichine exerts hepatoprotective effects by modulating the PI3K/AKT pathway, providing a modern pharmacological basis for its traditional liver-protective use. Notably, unlike broad-spectrum kinase inhibitors, dencichine showed no significant cytotoxicity at experimental doses, suggesting a favorable safety profile. Additionally, the known anti-inflammatory properties of dencichine may synergize with its anti-fibrotic effects. Future studies could explore whether dencichine also modulates the hepatic immune microenvironment to indirectly influence HSC activity. It is important to acknowledge certain limitations of this study. First, we primarily relied on the CCl₄-induced toxicity model, which, although classic, differs pathophysiologically from fibrosis caused by viral or metabolic liver diseases (e.g., NAFLD/NASH). Validating dencichine’s efficacy in other models (e.g., choline-deficient diet, STAM, or bile duct ligation models) would help demonstrate its broad applicability. Second, while we focused on the upstream PI3K/AKT pathway, how downstream effectors (such as mTOR, GSK-3β, and NF-κB) are precisely regulated remains to be elucidated. Finally, pharmacokinetic (PK) studies, in vivo distribution, and long-term toxicological investigations of dencichine are essential next steps for its development as a preclinical candidate. In conclusion, this study establishes dencichine as a potent natural compound against liver fibrosis, revealing that its mechanism involves inhibition of the PI3K/AKT signaling pathway in HSCs. These findings provide a theoretical foundation for developing dencichine-based novel therapeutic strategies for liver fibrosis. Declarations Acknowledgments This study was supported by the Science and Technology Project of Guizhou Provincial Health Commission (Grant No. gzwkj2023-022 and No. gzwkj2023-082) and the Youth Guidance Project of Guizhou Provincial Department of Science and Technology (Grant No. Qiankehe Foundation-[2024] Youth 250). Conflict of Interest All authors declare no conflicts of interest. References Xi YY, Chen C, Zheng JJ, Jiang B, Dong XY, Lou SY, Luo JG, Zhang XH, Zhou ZY, Luo QJ, Wang W, Zhou XD (2024) Ampelopsis grossedentata tea alleviating liver fibrosis in BDL-induced mice via gut microbiota and metabolite modulation. NPJ Sci Food 8(1):93–101 Marcellin P, Kutala BK (2018) Liver diseases: A major, neglected global public health problem requiring urgent actions and large-scale screening. Liver Int 38(Suppl 1):2–6 Tao Y, Niu Q, Yao Y, Wang K, Dong H, Zhao X, Zeng Z, Li H (2025) Qizhu Rougan Granules suppress liver fibrosis by inhibiting the expression of the P2Y14 receptor on hepatic stellate cells. Front Pharmacol 15:1528100 Li Q, Huang D, Liao W, Su X, Li J, Zhang J, Fang M, Liu Y (2024) Tanshinone IIA regulates CCl4 induced liver fibrosis in C57BL/6J mice via the PI3K/Akt and Nrf2/HO-1 signaling pathways. J Biochem Mol Toxicol 38(2):e23648 Fu Y, Zhou X, Wang L, Fan W, Gao S, Zhang D, Ling Z, Zhang Y, Ma L, Bai F, Chen J, Sun B, Liu P (2024) Salvianolic acid B attenuates liver fibrosis by targeting Ecm1 and inhibiting hepatocyte ferroptosis. Redox Biol 69:103029 Wang R, Song F, Li S, Wu B, Gu Y, Yuan Y (2019) Salvianolic acid A attenuates CCl4-induced liver fibrosis by regulating the PI3K/AKT/mTOR, Bcl-2/Bax and caspase-3/cleaved caspase-3 signaling pathways. Drug Des Devel Ther 13:1889–1900 Luo S, Yang B, Xu H, Pan X, Chen X, Jue X, Liu S, Wan R, Tan Q, Yao Y, Chen X, Jiang J, Deng B, Li J (2024) Lithospermic acid improves liver fibrosis through Piezo1-mediated oxidative stress and inflammation. Phytomedicine 134:155974 Xu Y, Zhu M, Feng Y, Xu H (2023) Panax notoginseng-microbiota interactions: From plant cultivation to medicinal application. Phytomedicine 119:154978 Peng XD, Dai LL, Huang CQ, He CM, Yang B, Chen LJ (2009) Relationship between anti-fibrotic effect of Panax notoginseng saponins and serum cytokines in rat hepatic fibrosis. Biochem Biophys Res Commun 388(1):31–34 Gong X, Shan L, Cao S, Li K, Wu Y, Zhang Q (2022) Dencichine R1, An Active Compound from Panax notoginseng, Inhibits Hepatic Stellate Cell Activation and Liver Fibrosis via MAPK Signaling Pathway. Am J Chin Med 50(2):511–523 Yao H, He Q, Xiang L, Liu S, Yang Z, Li X, Liu W, Huang C, Wang B, Xie Q, Gao Y, Zheng C, Li X (2024) Guizhi Fuling Wan attenuates tetrachloromethane-induced hepatic fibrosis in rats via PTEN/AKT/mTOR signaling pathway. J Ethnopharmacol 334:118593 Palomer X, Wang JR, Escalona C, Wu S, Wahli W, Vázquez-Carrera M (2025) Targeting AMPK as a potential treatment for hepatic fibrosis in MASLD. Trends Pharmacol Sci 46(6):551–566 Zhang J, Liu Y, Chen H, Yuan Q, Wang J, Niu M, Hou L, Gu J, Zhang J (2022) MyD88 in hepatic stellate cells enhances liver fibrosis via promoting macrophage M1 polarization. Cell Death Dis 13(4):411 Wang L, Liu K, Deng L, Zhou G, Qian W, Xu K (2024) Exploration of Perturbed Liver Fibrosis-Related Factors and Collagen Type I in Animal Model of Non-Alcoholic Fatty Liver Disease. Appl Biochem Biotechnol 196(6):3260–3273 Shamsan E, Almezgagi M, Gamah M, Khan N, Qasem A, Chuanchuan L, Haining F (2024) The role of PI3k/AKT signaling pathway in attenuating liver fibrosis: a comprehensive review. Front Med (Lausanne) 11:1389329 Zhang Z, Shang J, Yang Q, Dai Z, Liang Y, Lai C, Feng T, Zhong D, Zou H, Sun L, Su Y, Yan S, Chen J, Yao Y, Shi Y, Huang X (2023) Exosomes derived from human adipose mesenchymal stem cells ameliorate hepatic fibrosis by inhibiting PI3K/Akt/mTOR pathway and remodeling choline metabolism. J Nanobiotechnol 21(1):29 Chen Z, Lin Z, Yu J, Zhong H, Zhuo X, Jia C, Wan Y (2022) Mitofusin-2 Restrains Hepatic Stellate Cells' Proliferation via PI3K/Akt Signaling Pathway and Inhibits Liver Fibrosis in Rats. J Healthc Eng 2022:6731335 Wang Y, Kuramitsu Y, Baron B, Kitagawa T, Tokuda K, Akada J, Maehara SI, Maehara Y, Nakamura K (2017) PI3K inhibitor LY294002, as opposed to wortmannin, enhances AKT phosphorylation in gemcitabine-resistant pancreatic cancer cells. Int J Oncol 50(2):606–612 Hui J, Gao J, Wang Y, Zhang J, Han Y, Wei L, Liu Xiaochuang, Wu J (2016) Panax notoginseng saponins ameliorates experimental hepatic fibrosis and hepatic stellate cell proliferation by inhibiting the Jak2/ Stat3 pathways. J Tradit Chin Med 36(2):217–224 Li D, Ma D, Liu Y, Liu L, Chen Y, Liu H, Zhang L, Lu J, Chen K, You J, Li W (2022) Extracts of Periplaneta americana alleviate hepatic fibrosis by affecting hepatic TGF-β and NF-κB expression in rats with pig serum-induced liver fibrosis. Folia Histochem Cytobiol 60(2):125–135 Zhan H, Huang F, Ma W, Zhao Z, Zhang H, Zhang C (2016) Protective Effect of Ginsenoside Rg1 on Bleomycin-Induced Pulmonary Fibrosis in Rats: Involvement of Caveolin-1 and TGF-β1 Signal Pathway. Biol Pharm Bull 39(8):1284–1292 Additional Declarations The authors declare no competing interests. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7450683","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":505092020,"identity":"423e64b2-8475-4a23-abad-046c4fb843f2","order_by":0,"name":"Longkuan Li","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Longkuan","middleName":"","lastName":"Li","suffix":""},{"id":505092021,"identity":"5c08995b-5779-4e5b-b222-bf280ffaa419","order_by":1,"name":"Huan Luo","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Huan","middleName":"","lastName":"Luo","suffix":""},{"id":505092022,"identity":"570b6061-a1fd-4062-bf84-71f3e9b430ce","order_by":2,"name":"Zeyun Liu","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Zeyun","middleName":"","lastName":"Liu","suffix":""},{"id":505092023,"identity":"87b884aa-b2fe-4cb1-a783-a48e3a859531","order_by":3,"name":"Yingqiang Chen","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Yingqiang","middleName":"","lastName":"Chen","suffix":""},{"id":505092024,"identity":"d4711c5b-ddc5-4de8-b86a-e4358a67b102","order_by":4,"name":"Fuxue Meng","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA2klEQVRIie3RsQrCMBDG8YRAdLjiJpUKPoHQIDgVfJWKoEsHR8eDipu4RnwJR8crQqb6BAoKgnPFVURnERs3h/zm+w8fx5jj/CNBleL6eABfpETFxCaRseRaUlNo0890bpmIqqSogkln600tivYMumcGB/AwL8hD1qrV6XvSNXLUGfsXaKTzNTU2TC1XcUlyTCnQoQCFuzWpnMXhviwxHAOIBfQoOVF/ZpUIEwBtgWPCKLNL5EAtcQhcmzDD3LfYYkCdrhj1Xq883+6TqFULSpJ3/m/njuM4zmdP33xNHrNBTg4AAAAASUVORK5CYII=","orcid":"","institution":"The Third Affiliated Hospital of Guizhou Medical University","correspondingAuthor":true,"prefix":"","firstName":"Fuxue","middleName":"","lastName":"Meng","suffix":""}],"badges":[],"createdAt":"2025-08-25 07:16:24","currentVersionCode":1,"declarations":{"humanSubjects":false,"vertebrateSubjects":true,"conflictsOfInterestStatement":false,"humanSubjectEthicalGuidelines":false,"humanSubjectConsent":false,"humanSubjectClinicalTrial":false,"humanSubjectCaseReport":false,"vertebrateSubjectEthicalGuidelines":true},"doi":"10.21203/rs.3.rs-7450683/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7450683/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":90098880,"identity":"b9db2b26-5965-42c3-879b-0de0783bccae","added_by":"auto","created_at":"2025-08-28 12:57:43","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1067673,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDencichine alleviates CCl₄-induced liver fibrosis in mice \u003c/strong\u003eFollowing the establishment of a liver fibrosis mouse model induced by CCl₄, mice were treated with low and high concentrations of dencichine, respectively. \u003cstrong\u003e(A)\u003c/strong\u003e Serum levels of liver fibrosis indicators ALT, AST, HA, LN, and the GSH/GSSG ratio were measured using an automated biochemical analyzer. \u003cstrong\u003e(B)\u003c/strong\u003e Histopathological evaluation of mouse liver tissue using H\u0026amp;E, Masson’s trichrome, and Sirius red staining. \u003cstrong\u003e(C)\u003c/strong\u003e Protein expression levels in liver tissue were detected by Western blot. \u003cstrong\u003e(D)\u003c/strong\u003e mRNA expression levels of related genes were determined by RT-PCR. (* indicates a statistically significant difference compared to the CCl₄ model group; *P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001)\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7450683/v1/78b4ce0eb8d93b8145b196b0.png"},{"id":90098878,"identity":"1946d903-7ada-4c1f-a8bc-d8253753c430","added_by":"auto","created_at":"2025-08-28 12:57:43","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":86829,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eELISA detection of liver fibrosis-related protein concentrations in liver tissue \u003c/strong\u003eCompared with the CCl₄ model group, the normal control group and dencichine-treated groups showed significantly reduced levels of TGF-β, IFN-γ, TNF-α, IL-6, MDA, and PDGF-BB (*P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001).\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7450683/v1/bf5e4ca8043cb38b41a6d714.png"},{"id":90098882,"identity":"dcf11b76-e1ef-4010-9835-f01efedba84b","added_by":"auto","created_at":"2025-08-28 12:57:44","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":851883,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDencichine affects the function of PDGF-BB-activated hepatic stellate cells (A)\u003c/strong\u003e Cell proliferation was assessed using the CCK-8 assay in PDGF-BB-activated hepatic stellate cells treated with dencichine. \u003cstrong\u003e(B)\u003c/strong\u003e Cell migration was evaluated by the wound healing assay. \u003cstrong\u003e(C)\u003c/strong\u003e Representative images from Transwell and EdU assays. \u003cstrong\u003e(D)\u003c/strong\u003e Quantitative analysis of cell migration from the Transwell assay. \u003cstrong\u003e(E, F)\u003c/strong\u003e Cell proliferation was measured by EdU assay and flow cytometry, respectively. (*P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001)\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-7450683/v1/4c378591814b78a8972ded78.png"},{"id":90099183,"identity":"43ac3831-abf8-4b67-94b4-92822f70692b","added_by":"auto","created_at":"2025-08-28 13:05:44","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":319698,"visible":true,"origin":"","legend":"\u003cp\u003eDencichine alleviates liver fibrosis through the PI3K/AKT pathway in a cellular model (A) Western blot analysis of PI3K, AKT, Smad2/3, PDGFR-β protein expression and phosphorylation levels, as well as related functional proteins, in PDGF-BB-activated hepatic stellate cells treated with dencichine. (B) Protein expression and phosphorylation levels of PI3K and AKT, along with related proteins, in hepatic stellate cells after inhibitor treatment. (C) mRNA expression levels of α-SMA, Col1a1, CyclinD1, CyclinE1, MMP2, and MMP9 detected by RT-PCR. (*P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001)\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-7450683/v1/9c0d177b6ea21cd4f4063d1d.png"},{"id":90101299,"identity":"f6725c62-df3a-47af-b1e1-0b06b15a8b3e","added_by":"auto","created_at":"2025-08-28 13:21:45","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2944768,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7450683/v1/d6df8ad7-bef4-421c-a0e0-32c7ab8d4bc4.pdf"}],"financialInterests":"The authors declare no competing interests.","formattedTitle":"\u003cp\u003eDencichine ameliorates hepatic fibrosis by modulating the PI3K-AKT\u003c/p\u003e","fulltext":[{"header":"Introduction","content":"\u003cp\u003eHepatic fibrosis is a pathological condition arising from various chronic liver diseases, characterized by excessive deposition of extracellular matrix (ECM) in the liver, which disrupts its normal structure and function\u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]\u003c/sup\u003e. It represents the fundamental cause of complications in all end-stage liver diseases and poses a serious threat to human health. According to statistics, liver diseases affect nearly 800\u0026nbsp;million people worldwide annually, resulting in over 2\u0026nbsp;million deaths each year\u003csup\u003e[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]\u003c/sup\u003e. Although significant progress has been made in elucidating the pathological mechanisms of hepatic fibrosis and numerous candidate drugs have been identified for treatment, no anti-fibrotic therapy has yet been approved specifically for hepatic fibrosis. Current treatment strategies primarily focus on managing the underlying causes of fibrotic damage, such as antiviral therapy or alcohol abstinence\u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]\u003c/sup\u003e. Existing anti-fibrotic agents face multiple limitations. Conventional Western medicines often target single genes or proteins, making it difficult to comprehensively intervene in the complex process of fibrosis. Moreover, they are prone to adverse effects, which restrict their clinical application. Therefore, the development of safe and effective therapeutic approaches and drugs for hepatic fibrosis remains an urgent and critical challenge in the medical field.\u003c/p\u003e\u003cp\u003eTraditional Chinese Medicine (TCM) possesses unique advantages and potential in the treatment of hepatic fibrosis. Studies have shown that many Chinese herbal medicines and their extracts exhibit beneficial anti-fibrotic effects. For instance, components such as tanshinone and salvianolic acid from Salvia miltiorrhiza can inhibit the activation and proliferation of hepatic stellate cells (HSCs) and reduce collagen synthesis, thereby alleviating the extent of liver fibrosis \u003csup\u003e[\u003cspan additionalcitationids=\"CR5\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e. Huperzine A has been shown to mitigate the progression of hepatic fibrosis by modulating oxidative stress and inflammatory responses\u003csup\u003e[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e. These findings provide both a theoretical foundation and practical experience for the use of TCM in treating hepatic fibrosis. Panax notoginseng, a valuable traditional Chinese herb, is known for its effects in resolving stasis, stopping bleeding, reducing swelling, and alleviating pain\u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]\u003c/sup\u003e. In recent years, a growing body of research has demonstrated its remarkable efficacy against hepatic fibrosis\u003csup\u003e[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e. Studies indicate that Panax notoginseng can reduce serum markers of liver fibrosis in rat models, suppress inflammatory responses, and inhibit the activation and proliferation of HSCs, thereby ameliorating the severity of liver fibrosis\u003csup\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eHowever, its underlying mechanisms have not yet been fully elucidated. Therefore, this study employs both in vivo and in vitro approaches to investigate the mechanisms by which Dencichine-a key bioactive component of Panax notoginseng-modulates hepatic fibrosis. The findings aim to provide a theoretical basis for the application of Dencichine in the treatment of hepatic fibrosis and offer potential targets and insights for the development of novel anti-fibrotic drugs.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec2\" class=\"Section2\"\u003e\u003ch2\u003eMain Reagents\u003c/h2\u003e\u003cp\u003eDencichine Ft1 (Solarbio, Beijing, China); Carbon tetrachloride (Nanjing Reagent, Nanjing, China), prepared as a 20% (v/v) CCl4 solution in olive oil for modeling; Alanine aminotransferase (ALT), Aspartate aminotransferase (AST), Hyaluronic acid (HA), and Laminin (LN) assay kits (all from Solarbio, Beijing, China); Hematoxylin and eosin (HE) staining kit, Masson staining kit, and Sirius Red staining kit (MCE Life Sciences, USA); Rabbit anti-mouse α-smooth muscle actin (α-SMA) polyclonal antibody, rabbit anti-mouse transforming growth factor-β1 (TGF-β1) polyclonal antibody, rabbit anti-mouse Smad2/3 polyclonal antibody, rabbit anti-mouse p-Smad2/3 polyclonal antibody, as well as antibodies against PI3K, AKT, collagen 1, and TIMP1 (all from MCE Life Sciences, USA); Horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG secondary antibody (Solarbio, Beijing, China); RIPA lysis buffer, BCA protein quantification kit, SDS-PAGE gel preparation kit, and ECL chemiluminescence kit (Beyotime, Shanghai, China); Trizol reagent (Solarbio, Beijing, China), reverse transcription kit, and SYBR Green quantitative PCR kit (Thermo Scientific, USA).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eMethods\u003c/h2\u003e\u003cdiv id=\"Sec4\" class=\"Section3\"\u003e\u003ch2\u003eEstablishment of Mouse and Cell Models of Liver Fibrosis\u003c/h2\u003e\u003cp\u003eForty male C57BL/6J mice, aged 6\u0026ndash;7 weeks and weighing 16\u0026ndash;20 g, were purchased from Nanjing Junke Biotechnology Co., Ltd. (Nanjing, China). Upon arrival, the mice were acclimatized for one week in an animal room maintained at a temperature of (22\u0026thinsp;\u0026plusmn;\u0026thinsp;2) \u0026deg;C and relative humidity of (50\u0026thinsp;\u0026plusmn;\u0026thinsp;10)% before the experiment. They were then randomly divided into four groups (n\u0026thinsp;=\u0026thinsp;10 per group): the normal control group, the model group, the low-dose dencichine group, and the high-dose dencichine group. From week 1 to week 15, the mice received intraperitoneal injections twice a week of either olive oil or a 10% carbon tetrachloride (CCl₄) solution (dissolved in olive oil) at a dosage of 5 \u0026micro;L/g \u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]\u003c/sup\u003e. Starting from the end of week 7, mice in the treatment groups were administered dencichine via oral gavage daily for 8 consecutive weeks at a volume of 0.2 mL per 10 g body weight. The low-dose group received dencichine at 2.925 g/(kg\u0026middot;day), while the high-dose group received a significantly higher dose of 11.7 g/(kg\u0026middot;day) \u003csup\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e. After the 8-week gavage period, the mice were euthanized. Anesthesia was induced by intraperitoneal injection of 0.3% sodium pentobarbital (0.05 g/kg), followed by the collection of blood and liver samples. The study protocol was approved by the Animal Ethics Committee of the Third Affiliated Hospital of Guizhou Medical University (Approval No.: 2022A020). For the in vitro studies, hepatic stellate cells (LX-2) were stimulated with 20 ng/mL PDGF-BB for durations ranging from 1 to 48 hours, based on the characteristics of the specific detection indicators \u003csup\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]\u003c/sup\u003e. The drug treatment groups were administered dencichine at concentrations of 0.01 mM, 0.1 mM, and 1 mM, respectively.\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\n\u003ch3\u003eCollection of Biological Samples\u003c/h3\u003e\n\u003cp\u003eAt the end of the experiment, specifically after the 8-week administration period, the mice were fasted for 12 hours and anesthetized via intraperitoneal injection of sodium pentobarbital at the concentration mentioned above. Blood samples were collected using the eyeball blood extraction method. The blood was placed in centrifuge tubes, allowed to stand at room temperature for 2 hours, and then centrifuged at 4\u0026deg;C and 3000 rpm for 10 minutes to separate the serum. The serum was aliquoted and stored at -80\u0026deg;C for subsequent analysis.\u003c/p\u003e\u003cp\u003eThe mice were promptly dissected, and their livers were rapidly excised. The livers were rinsed with pre-cooled physiological saline and blotted dry with filter paper. A portion of the left lobe liver tissue was immersion-fixed in 10% neutral buffered formalin for subsequent histopathological examinations, including Hematoxylin and Eosin (H\u0026amp;E) staining, Masson's trichrome staining, and Sirius Red staining, to assess the degree of liver inflammation and fibrosis. The remaining liver tissue was wrapped in aluminum foil, rapidly frozen in liquid nitrogen, and subsequently transferred to a -80\u0026deg;C freezer for preservation. This tissue was reserved for subsequent analyses, such as Western blotting to detect relevant protein expression levels and quantitative real-time polymerase chain reaction (qRT-PCR) to measure the expression levels of related genes.\u003c/p\u003e\n\u003ch3\u003eMeasurement of Serum Liver Function and Liver Fibrosis Indices\u003c/h3\u003e\n\u003cp\u003eThe activities of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in serum were measured using a fully automated biochemical analyzer (BIOBASE, Shandong, China). Enzyme-linked immunosorbent assay (ELISA) was employed to determine the serum levels of hyaluronic acid (HA), laminin (LN), transforming growth factor-beta 1 (TGF-β1), interleukin-6 (IL-6), tumor necrosis factor-alpha (TNF-α), interferon-gamma (IFN-γ), malondialdehyde (MDA), and platelet-derived growth factor BB (PDGF-BB).\u003c/p\u003e\n\u003ch3\u003eHistopathological Examination of Liver Tissue\u003c/h3\u003e\n\u003cp\u003eThe fixed liver tissues were embedded in paraffin, sectioned, and subsequently subjected to Hematoxylin and Eosin (H\u0026amp;E) staining. The morphological architecture of the liver tissue was observed under a light microscope to assess the degree of hepatocyte degeneration, necrosis, and inflammatory cell infiltration. Masson's trichrome staining was performed to visualize the deposition of collagen fibers. The collagen fiber area ratio was quantitatively analyzed using ImageJ image analysis software to evaluate the extent of liver fibrosis. Sirius Red staining was observed under polarized light microscopy, wherein type I collagen appears red and type III collagen appears green. This staining method allows for intuitive visualization of the distribution and content changes of different collagen types, providing further assessment of the degree and pattern of liver fibrosis.\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eWestern Blot Analysis of Protein Expression\u003c/h2\u003e\u003cp\u003eApproximately 20 mg of liver tissue was thoroughly homogenized and lysed to extract total protein. Alternatively, hepatic stellate cells were collected by centrifugation and lysed for total protein extraction. The proteins were separated by SDS-PAGE and subsequently transferred onto a PVDF membrane (Millipore Ltd.) using an electrophoresis apparatus from Anneng Biotechnology. After blocking, the membrane was incubated overnight at 4\u0026deg;C with the following primary antibodies: α-SMA (1:1000), Collagen I, Smad2/3, p-Smad2/3, PDGFR-β, MMP2, MMP9, TIMP1, and GAPDH (1:5000). Then, the membrane was incubated at room temperature for 1 hour with a horseradish peroxidase (HRP)-conjugated goat anti-rabbit or anti-mouse IgG secondary antibody (1:5000). GAPDH monoclonal antibody was used as an internal reference control for normalization.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eRT-PCR for Gene Expression Analysis\u003c/h3\u003e\n\u003cp\u003eTotal RNA was extracted from hepatic stellate cells or liver tissue samples using the TRIzol-chloroform method. According to the instructions of the Bestar qPCR RT Kit, the reverse transcription reaction system was prepared. Following reverse transcription, a 20 \u0026micro;l real-time PCR amplification reaction system was configured as per the manufacturer's protocol. Fluorescence-based real-time quantitative PCR was performed using the Agilent Stratagene Mx3000P real-time PCR system. The experimental data were analyzed using the 2^(-ΔΔCt) method. The sequence-specific PCR primers used are listed below.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Taba\" border=\"1\"\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eID\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSequence F (5\u0026rsquo;- 3\u0026rsquo;)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSequence R (3\u0026rsquo;- 5\u0026rsquo;)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGAPDH\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCCTCGTCTCATAGACAAGATGGT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGGGTAGAGTCATACTGGAACATG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ecyclinE1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAGTACCCACAGCAGGTCTTC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCTGCATCAACTCCAACGAGG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ecyclinD1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAAGTGTGACCCGGACTGC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAGCTTCTTCCTCCACTTCCC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTimp1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCTCTGGCATCCTCTTGTTGC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGCCCTTATAACCAGGTCCGA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMmp9\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTCGGATGGTTATCGCTGGTG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAAGACGCACATCTCTCCTGC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMmp2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGAACACCATCGAGACCATGC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCATGCTCCCATCGACCAAAG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eα-SMA\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGGGCCAAAAGGACAGCTATG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTGATGCCGTGTTCTATCGGA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePDGF-βR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTCGAGCCAAGACACCTCAAA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAGTGCCTTCTTGTCATGGGT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ecollagenⅠ\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGAGAGAGCATGACCGATGGA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGTAGGCTACGCTGTTCTTGC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\n\u003ch3\u003eCell Proliferation Assay\u003c/h3\u003e\n\u003cp\u003eCells were seeded in a 96-well plate (1.5 \u0026times; 10⁵ cells/well in 100 \u0026micro;L medium) with three replicate wells per condition. The cells were treated with 0.01 mM, 0.1 mM, and 1 mM dencichine for 24, 48, and 72 hours, respectively. Cell viability was assessed using a CCK-8 kit according to the manufacturer\u0026rsquo;s instructions, and the absorbance was measured at a wavelength of 450 nm. For the EdU assay, cells in the logarithmic growth phase were incubated with EdU working solution at a final concentration of 30 \u0026micro;M for 12 hours. After incubation, the cells were collected, fixed with 4% paraformaldehyde at room temperature for 15 minutes, and washed twice with PBS. Permeabilization was performed using 0.5% Triton X-100 for 15 minutes, followed by incubation with Click reaction mixture for 30 minutes at room temperature in the dark. The cells were then washed twice with PBS and subjected to flow cytometry analysis. To prepare samples for flow cytometry, cells were collected by centrifugation and resuspended as a single-cell suspension. They were incubated with fluorescence-conjugated antibodies for 30 minutes at room temperature in the dark, washed twice with PBS to remove unbound antibodies, resuspended in flow cytometry buffer, filtered, and analyzed using a flow cytometer.\u003c/p\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eCell Migration Assay\u003c/h2\u003e\u003cp\u003eFor the wound healing (scratch) assay, cells were seeded in 6-well plates at a density of 5 \u0026times; 10⁵ cells per well and cultured at 37\u0026deg;C until 100% confluent monolayer formation. A uniform scratch was created using a sterile 200 \u0026micro;L pipette tip held vertically. After gently washing with PBS to remove detached cells, images of the same scratch location were captured at 0, 12, and 24 hours under a microscope. The wound area was quantitatively analyzed using ImageJ software. In the Transwell migration assay, cells were collected and resuspended in serum-free medium. A total of 5 \u0026times; 10⁴ cells were seeded into the upper chamber and incubated for 24\u0026ndash;48 hours at 37\u0026deg;C. Cells that migrated to the lower membrane surface were fixed with 4% paraformaldehyde for 30 minutes and stained with 0.1% crystal violet for 20 minutes. The number of migrated cells was counted in five randomly selected fields under a microscope.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eData Analysis\u003c/h2\u003e\u003cp\u003eData analysis was performed using GraphPad Prism 8.0 statistical software. Experimental data are expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (x\u0026thinsp;\u0026plusmn;\u0026thinsp;s). Comparisons between groups were analyzed by one-way analysis of variance (One-way ANOVA), with a significance threshold set at P\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e\u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003eDencichine Attenuates CCl₄-Induced Liver Fibrosis in Mice\u003c/h2\u003e\u003cp\u003eThis study utilized a C57BL/6J mouse model to investigate whether dencichine can mitigate the progression of liver fibrosis. Biochemical results showed that compared with the normal control group, the model group exhibited significantly elevated serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), hyaluronic acid (HA), and laminin (LN) (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01), indicating severe hepatocellular damage induced by CCl₄. In dencichine-treated groups, the CCl₄-induced increases in ALT, AST, HA, and LN levels were markedly alleviated. Additionally, the oxidative stress indicator GSH/GSSG ratio was significantly higher than that in the model group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Histopathological examination via H\u0026amp;E, Masson\u0026rsquo;s trichrome, and Sirius red staining revealed severe liver injury, inflammatory infiltration, and expanded fibrotic areas in the CCl₄ model group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Western blot and RT-PCR results demonstrated significant upregulation of hepatic stellate cell activation marker α-SMA and fibrosis marker collagen type I (Collagen I), along with increased expression of platelet-derived growth factor receptor-β (PDGFR-β), matrix metalloproteinases (MMP2 and MMP9), and tissue inhibitor of metalloproteinase-1 (TIMP1) in the model group. However, these indicators were markedly reduced in dencichine-treated groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC, D).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eELISA results further confirmed that CCl₄ treatment significantly increased the levels of Col1a1, α-SMA, TNF-α, TGF-β1, IL-6, and PDGF-BB, while dencichine treatment notably modulated the expression of these proteins (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). These findings suggest that dencichine treatment provides substantial benefits in alleviating CCl₄-induced liver fibrosis in mice, delaying the progression of liver fibrosis and reducing inflammatory infiltration.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003eDencichine Influences the Function of PDGF-BB-Activated Hepatic Stellate Cells\u003c/h2\u003e\u003cp\u003eTo further investigate the role of dencichine in liver cells, hepatic stellate cells were activated using platelet-derived growth factor-BB (PDGF-BB) and subsequently treated with low, medium, and high concentrations of dencichine. As shown in Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF, dencichine inhibited the proliferation of hepatic stellate cells in a concentration-dependent manner, restricted cell migration, and promoted apoptosis (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB\u0026ndash;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). These findings suggest that dencichine alleviates the progression of fibrosis by suppressing hepatic stellate cell activation through the regulation of cell proliferation and the promotion of apoptosis.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003eDencichine Attenuates Liver Fibrosis via the PI3K/AKT Pathway in a Cellular Model\u003c/h2\u003e\u003cp\u003eGiven the critical role of the PI3K/AKT pathway in the survival and activation of hepatic stellate cells, we hypothesized that it might be a potential target of dencichine. We further investigated the mechanism by which dencichine inhibits liver fibrosis in a cellular model. Western blot analysis in PDGF-BB-induced LX-2 hepatic stellate cells showed that dencichine treatment suppressed the phosphorylation of PI3K and AKT in a dose-dependent manner, without altering the total protein levels of PI3K and AKT (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Furthermore, treatment with the PI3K inhibitor LY294002 largely reversed the inhibitory effects of dencichine on the expression of α-SMA and Col1a1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB), as well as the protein expression of CyclinD1, CyclinE1, MMP2, and MMP9. RT-PCR results of related functional genes were consistent with these findings. These data suggest that dencichine likely exerts its anti-fibrotic effects primarily through inhibition of the PI3K/AKT signaling pathway.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eAs a sequela of chronic liver injury, the core mechanism of liver fibrosis lies in the sustained activation and proliferation of hepatic stellate cells (HSCs), leading to excessive deposition of extracellular matrix (ECM)\u003csup\u003e[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e. Despite recent advances in understanding its molecular mechanisms, effective anti-fibrotic treatment options remain limited. This study explored the therapeutic potential of dencichine, one of the main active components of Panax notoginseng, in liver fibrosis models and further elucidated its molecular mechanisms. Our key finding is that dencichine significantly alleviates liver fibrosis progression both in vivo and in vitro, primarily by inhibiting the PI3K/AKT signaling pathway, thereby suppressing the proliferation and migration of HSCs.\u003c/p\u003e\u003cp\u003eFirst, our in vivo experimental data demonstrate the anti-fibrotic efficacy of dencichine. In a CCl₄-induced mouse liver fibrosis model, dencichine treatment markedly improved liver function (reduced ALT, AST, HA, and LN levels) and effectively decreased collagen deposition (as indicated by reduced Sirius Red staining area). More importantly, at the molecular level, dencichine dose-dependently downregulated the expression of key fibrosis markers, α-SMA and Collagen I. α-SMA is a specific marker of activated HSCs, while Collagen I is the predominant collagen type in fibrotic scars \u003csup\u003e[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e. These results collectively suggest that dencichine targets the central executors of liver fibrosis\u0026mdash;activated HSCs\u0026mdash;and reverses their pathological functions.\u003c/p\u003e\u003cp\u003eTo further investigate the mechanism of dencichine\u0026rsquo;s action on HSCs, we conducted in vitro studies using the human HSC line LX-2. The PI3K/AKT pathway serves as a central hub regulating cell survival, proliferation, metabolism, and migration, playing a critical pro-survival role in the activation and maintenance of HSCs \u003csup\u003e[\u003cspan additionalcitationids=\"CR16\" citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e. Our data show that dencichine treatment significantly reduced the phosphorylation levels of PI3K and AKT in LX-2 cells without affecting total protein levels, indicating specific inhibition of pathway activation rather than protein expression. To further establish the causal relationship between PI3K/AKT inhibition and the anti-fibrotic phenotype, we used the inhibitor LY294002 \u003csup\u003e[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e. The results confirmed that the anti-fibrotic effects of dencichine are functionally dependent on PI3K/AKT pathway inhibition.\u003c/p\u003e\u003cp\u003eWhile previous studies on Panax notoginseng in liver fibrosis have focused on mechanisms involving MAPK [10], JAK2/STAT3 \u003csup\u003e[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/sup\u003e, and TGF-β pathways \u003csup\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/sup\u003e, similarities and differences exist. The common ground is that active components of Panax notoginseng exhibit anti-fibrotic effects. The distinction lies in the fact that this study is the first to report the role of dencichine in liver fibrosis and its specific mechanism via PI3K/AKT signaling.\u003c/p\u003e\u003cp\u003eThis study demonstrates that dencichine exerts hepatoprotective effects by modulating the PI3K/AKT pathway, providing a modern pharmacological basis for its traditional liver-protective use. Notably, unlike broad-spectrum kinase inhibitors, dencichine showed no significant cytotoxicity at experimental doses, suggesting a favorable safety profile. Additionally, the known anti-inflammatory properties of dencichine may synergize with its anti-fibrotic effects. Future studies could explore whether dencichine also modulates the hepatic immune microenvironment to indirectly influence HSC activity.\u003c/p\u003e\u003cp\u003eIt is important to acknowledge certain limitations of this study. First, we primarily relied on the CCl₄-induced toxicity model, which, although classic, differs pathophysiologically from fibrosis caused by viral or metabolic liver diseases (e.g., NAFLD/NASH). Validating dencichine\u0026rsquo;s efficacy in other models (e.g., choline-deficient diet, STAM, or bile duct ligation models) would help demonstrate its broad applicability. Second, while we focused on the upstream PI3K/AKT pathway, how downstream effectors (such as mTOR, GSK-3β, and NF-κB) are precisely regulated remains to be elucidated. Finally, pharmacokinetic (PK) studies, in vivo distribution, and long-term toxicological investigations of dencichine are essential next steps for its development as a preclinical candidate.\u003c/p\u003e\u003cp\u003eIn conclusion, this study establishes dencichine as a potent natural compound against liver fibrosis, revealing that its mechanism involves inhibition of the PI3K/AKT signaling pathway in HSCs. These findings provide a theoretical foundation for developing dencichine-based novel therapeutic strategies for liver fibrosis.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eAcknowledgments\u003c/h2\u003e\u003cp\u003eThis study was supported by the Science and Technology Project of Guizhou Provincial Health Commission (Grant No. gzwkj2023-022 and No. gzwkj2023-082) and the Youth Guidance Project of Guizhou Provincial Department of Science and Technology (Grant No. Qiankehe Foundation-[2024] Youth 250).\u003c/p\u003e\u003cp\u003e\u003cb\u003eConflict of Interest\u003c/b\u003e\u003c/p\u003e\u003cp\u003eAll authors declare no conflicts of interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eXi YY, Chen C, Zheng JJ, Jiang B, Dong XY, Lou SY, Luo JG, Zhang XH, Zhou ZY, Luo QJ, Wang W, Zhou XD (2024) Ampelopsis grossedentata tea alleviating liver fibrosis in BDL-induced mice via gut microbiota and metabolite modulation. NPJ Sci Food 8(1):93\u0026ndash;101\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMarcellin P, Kutala BK (2018) Liver diseases: A major, neglected global public health problem requiring urgent actions and large-scale screening. Liver Int 38(Suppl 1):2\u0026ndash;6\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTao Y, Niu Q, Yao Y, Wang K, Dong H, Zhao X, Zeng Z, Li H (2025) Qizhu Rougan Granules suppress liver fibrosis by inhibiting the expression of the P2Y14 receptor on hepatic stellate cells. Front Pharmacol 15:1528100\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi Q, Huang D, Liao W, Su X, Li J, Zhang J, Fang M, Liu Y (2024) Tanshinone IIA regulates CCl4 induced liver fibrosis in C57BL/6J mice via the PI3K/Akt and Nrf2/HO-1 signaling pathways. J Biochem Mol Toxicol 38(2):e23648\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFu Y, Zhou X, Wang L, Fan W, Gao S, Zhang D, Ling Z, Zhang Y, Ma L, Bai F, Chen J, Sun B, Liu P (2024) Salvianolic acid B attenuates liver fibrosis by targeting Ecm1 and inhibiting hepatocyte ferroptosis. Redox Biol 69:103029\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang R, Song F, Li S, Wu B, Gu Y, Yuan Y (2019) Salvianolic acid A attenuates CCl4-induced liver fibrosis by regulating the PI3K/AKT/mTOR, Bcl-2/Bax and caspase-3/cleaved caspase-3 signaling pathways. Drug Des Devel Ther 13:1889\u0026ndash;1900\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLuo S, Yang B, Xu H, Pan X, Chen X, Jue X, Liu S, Wan R, Tan Q, Yao Y, Chen X, Jiang J, Deng B, Li J (2024) Lithospermic acid improves liver fibrosis through Piezo1-mediated oxidative stress and inflammation. Phytomedicine 134:155974\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXu Y, Zhu M, Feng Y, Xu H (2023) Panax notoginseng-microbiota interactions: From plant cultivation to medicinal application. Phytomedicine 119:154978\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePeng XD, Dai LL, Huang CQ, He CM, Yang B, Chen LJ (2009) Relationship between anti-fibrotic effect of Panax notoginseng saponins and serum cytokines in rat hepatic fibrosis. Biochem Biophys Res Commun 388(1):31\u0026ndash;34\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGong X, Shan L, Cao S, Li K, Wu Y, Zhang Q (2022) Dencichine R1, An Active Compound from Panax notoginseng, Inhibits Hepatic Stellate Cell Activation and Liver Fibrosis via MAPK Signaling Pathway. Am J Chin Med 50(2):511\u0026ndash;523\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYao H, He Q, Xiang L, Liu S, Yang Z, Li X, Liu W, Huang C, Wang B, Xie Q, Gao Y, Zheng C, Li X (2024) Guizhi Fuling Wan attenuates tetrachloromethane-induced hepatic fibrosis in rats via PTEN/AKT/mTOR signaling pathway. J Ethnopharmacol 334:118593\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePalomer X, Wang JR, Escalona C, Wu S, Wahli W, V\u0026aacute;zquez-Carrera M (2025) Targeting AMPK as a potential treatment for hepatic fibrosis in MASLD. Trends Pharmacol Sci 46(6):551\u0026ndash;566\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang J, Liu Y, Chen H, Yuan Q, Wang J, Niu M, Hou L, Gu J, Zhang J (2022) MyD88 in hepatic stellate cells enhances liver fibrosis via promoting macrophage M1 polarization. Cell Death Dis 13(4):411\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang L, Liu K, Deng L, Zhou G, Qian W, Xu K (2024) Exploration of Perturbed Liver Fibrosis-Related Factors and Collagen Type I in Animal Model of Non-Alcoholic Fatty Liver Disease. Appl Biochem Biotechnol 196(6):3260\u0026ndash;3273\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShamsan E, Almezgagi M, Gamah M, Khan N, Qasem A, Chuanchuan L, Haining F (2024) The role of PI3k/AKT signaling pathway in attenuating liver fibrosis: a comprehensive review. Front Med (Lausanne) 11:1389329\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang Z, Shang J, Yang Q, Dai Z, Liang Y, Lai C, Feng T, Zhong D, Zou H, Sun L, Su Y, Yan S, Chen J, Yao Y, Shi Y, Huang X (2023) Exosomes derived from human adipose mesenchymal stem cells ameliorate hepatic fibrosis by inhibiting PI3K/Akt/mTOR pathway and remodeling choline metabolism. J Nanobiotechnol 21(1):29\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen Z, Lin Z, Yu J, Zhong H, Zhuo X, Jia C, Wan Y (2022) Mitofusin-2 Restrains Hepatic Stellate Cells' Proliferation via PI3K/Akt Signaling Pathway and Inhibits Liver Fibrosis in Rats. J Healthc Eng 2022:6731335\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang Y, Kuramitsu Y, Baron B, Kitagawa T, Tokuda K, Akada J, Maehara SI, Maehara Y, Nakamura K (2017) PI3K inhibitor LY294002, as opposed to wortmannin, enhances AKT phosphorylation in gemcitabine-resistant pancreatic cancer cells. Int J Oncol 50(2):606\u0026ndash;612\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHui J, Gao J, Wang Y, Zhang J, Han Y, Wei L, Liu Xiaochuang, Wu J (2016) Panax notoginseng saponins ameliorates experimental hepatic fibrosis and hepatic stellate cell proliferation by inhibiting the Jak2/ Stat3 pathways. J Tradit Chin Med 36(2):217\u0026ndash;224\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi D, Ma D, Liu Y, Liu L, Chen Y, Liu H, Zhang L, Lu J, Chen K, You J, Li W (2022) Extracts of Periplaneta americana alleviate hepatic fibrosis by affecting hepatic TGF-β and NF-κB expression in rats with pig serum-induced liver fibrosis. Folia Histochem Cytobiol 60(2):125\u0026ndash;135\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhan H, Huang F, Ma W, Zhao Z, Zhang H, Zhang C (2016) Protective Effect of Ginsenoside Rg1 on Bleomycin-Induced Pulmonary Fibrosis in Rats: Involvement of Caveolin-1 and TGF-β1 Signal Pathway. Biol Pharm Bull 39(8):1284\u0026ndash;1292\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[{"identity":"cbf333ca-ff67-4a17-b097-15e53206b627","identifier":"10.13039/501100010891","name":"Department of Health of Guizhou Province","awardNumber":"gzwkj2023-022","order_by":0},{"identity":"36f5e297-0fb2-4b8e-902e-cd85f187e5e6","identifier":"10.13039/501100010891","name":"Department of Health of Guizhou Province","awardNumber":"gzwkj2023-082","order_by":1},{"identity":"517ac5fd-e849-4939-b8a9-4e6757b0a72c","identifier":"10.13039/501100010891","name":"Department of Health of Guizhou Province","awardNumber":"Qiankehe Foundation-[2024] Youth 250","order_by":2}],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"The Third Affiliated Hospital of Guizhou Medical University","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Dencichine, Hepatic fibrosis, PI3K-AKT signaling pathway","lastPublishedDoi":"10.21203/rs.3.rs-7450683/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7450683/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cem\u003eBackground:\u003c/em\u003e Hepatic fibrosis is a major consequence of various chronic liver injuries and can progress to cirrhosis and hepatocellular carcinoma. As a medicinal and edible traditional Chinese herb, \u003cem\u003ePanax notoginseng\u003c/em\u003e contains an active ingredient, Dencichine, which shows promising potential in the treatment of hepatic fibrosis. This study aimed to investigate the mechanism of Dencichine in ameliorating hepatic fibrosis using both in vivo and in vitro models.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eMethods:\u003c/em\u003e C57BL/6J mice were randomly grouped and injected with 10% CCl₄ for 15 weeks to induce hepatic fibrosis. Dencichine treatment was administered from the 7th week onward. LX-2 hepatic stellate cells were induced with 20 ng/mL PDGF-BB for 1–48 hours to establish a fibrotic model, and treatment groups received low-, medium-, and high-dose Dencichine. Liver function was assessed by measuring serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), hyaluronic acid (HA), and laminin (LN). Liver morphology and fibrosis were evaluated using hematoxylin-eosin (H\u0026amp;E) staining, Masson staining, and Sirius red staining. Gene and protein expression levels were analyzed using quantitative reverse transcription polymerase chain reaction (RT-PCR) and Western blotting, respectively. Cell migration was assessed via scratch and Transwell assays, while cell proliferation and cell cycle were examined using EdU assay and flow cytometry.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eResults:\u003c/em\u003e Dencichine significantly reduced serum levels of AST, ALT, HA, and LN in CCl₄-treated mice, alleviated liver injury, and decreased collagen deposition. Furthermore, Dencichine suppressed the expression of cyclin D1 and cyclin E1. It also inhibited the phosphorylation of PI3K and AKT in hepatic fibrotic cells.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eConclusion:\u003c/em\u003e The findings suggest that Dencichine may effectively attenuate the progression of hepatic fibrosis by inhibiting the PI3K-AKT signaling pathway, thereby exerting anti-fibrotic effects.\u003c/p\u003e","manuscriptTitle":"Dencichine ameliorates hepatic fibrosis by modulating the PI3K-AKT","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-08-28 12:57:39","doi":"10.21203/rs.3.rs-7450683/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"91cf01ac-3ed3-47b4-869c-3ae23f159e41","owner":[],"postedDate":"August 28th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-08-28T12:57:39+00:00","versionOfRecord":[],"versionCreatedAt":"2025-08-28 12:57:39","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7450683","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7450683","identity":"rs-7450683","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}