Intro
The intervertebral disc consists of nucleus pulposus, annulus fibrosis, and endplate substructures, contributing to the spinal flexibility and large multi-directional loads transformation [ 1 ]. As a progressive and irreversible disease that affects the structural integrity and mechanical function [ 2 ], intervertebral disc degeneration (IDD) is the initial step of degenerative spinal change, which is accompanied by the gradual occurrence of osteophyte, disc narrowing, and spinal stenosis, and IDD is also the cause of several symptoms such as neck and low back pain [ 3 ]. It has been reported that the occlusion of the cartilaginous endplate route results in a lack of nutrition in disc cells, which then causes cell loss and imbalanced tissue homeostasis, and finally leads to the mechanical failure of intervertebral disc [ 4 ]. The development of IDD is a complex interaction of physiological, biological, and mechanical factors that are regulated by genetic background, inflammatory responses, and health of individuals [ 5 ]. Nowadays, the therapy for IDD includes conservative administration such as bed rest, non-steroidal anti-inflammatory medicines and physical treatment, and surgical methods including laminectomy, corpectomy, and fusion. However, these methods could only treat the symptoms, but could not decelerate or reverse the progression of IDD [ 6 ]. Therefore, novel targets are urgently demanded the treatment of IDD.
MicroRNAs (miRNAs) are small non-coding RNAs containing about 22 nucleotides and modulate genes correlated with biological functions and signaling pathways [ 7 ]. Recently, some miRNAs have been clarified in human diseases, and there are several documents revealing that miRNAs are implicated in the progression of IDD, such as miR-15a [ 8 ] and miR-184 [ 9 ]. As a member of the miRNAs, miR-494-5p has been identified in several human diseases including endometriosis-associated infertility [ 10 ] and portal hypertension [ 11 ]. Moreover, miR-494 has been validated to promote apoptosis and extracellular matrix degradation in degenerative human nucleus pulposus cells [ 12 ], and the inhibition of miR-494 has been revealed to protect nucleus pulposus cells from tumor necrosis factor-α-induced apoptosis [ 13 ]. Thus, we speculated that miR-494-5p may participate in the progression of IDD. Moreover, tissue inhibitor of metalloproteinase 3 (TIMP3) is one of the TIMPs and is comprised of four proteins, which are inhibitors of metalloproteinases and could degenerate the extracellular matrix and improve shedding of cell surface molecules [ 14 ]. As previously reported, TIMP3 is implicated in the processes of human malignant melanoma [ 15 ], breast cancer [ 16 ], and also in IDD [ 17 ], while the relation between miR-494-5p and TIMP3 has not been unveiled in human diseases yet.
We aimed to identify the impacts of miR-494-5p and TIMP3 on IDD progression, and we inferred that the knockdown of miR-494-5p could attenuate the development of IDD by regulating the biological behaviors of nucleus pulposus cells via targeting TIMP3.
Results
The results of HE staining ( Figure 1(a )) indicated that there were abundant oval nucleus pulposus and cartilage cells distributed in the extracellular matrix in normal nucleus pulposus tissues with integrated membrane, even cytoplasm, and red collagen tissue, and regularly arranged. While in the IDD nucleus pulposus tissues, there were a small amount of large nucleus pulposus and cartilage cells with irregular morphology, incomplete membrane, vacuoles in cytoplasm, and red collagen tissue, and irregularly arranged. Figure 1. An increased expression of miR-494-5p and a decreased expression of TIMP3 appear in IDD clinical samples. (a), representative images of HE staining in nucleus pulposus tissues of the IDD group and the control group; (b), miR-494-5p expression in nucleus pulposus tissues of the IDD group and the control group; (c), TIMP3 mRNA expression in nucleus pulposus tissues of the IDD group and the control group; (d), protein expression of TIMP3 in nucleus pulposus tissues of the IDD group and the control group; n = 20. Data are expressed as mean ± standard deviation, and the unpaired t-test was performed for comparisons between two groups
An increased expression of miR-494-5p and a decreased expression of TIMP3 appear in IDD clinical samples. (a), representative images of HE staining in nucleus pulposus tissues of the IDD group and the control group; (b), miR-494-5p expression in nucleus pulposus tissues of the IDD group and the control group; (c), TIMP3 mRNA expression in nucleus pulposus tissues of the IDD group and the control group; (d), protein expression of TIMP3 in nucleus pulposus tissues of the IDD group and the control group; n = 20. Data are expressed as mean ± standard deviation, and the unpaired t-test was performed for comparisons between two groups
Outcomes of RT-qPCR and Western blot analysis ( Figure 1b ) revealed that miR-494-5p expression was elevated, while TIMP3 expression was reduced in nucleus pulposus tissues of IDD patients.
Results of RT-qPCR and Western blot analysis ( Figure 2a ) suggested that miR-494-5p expression was increased, and TIMP3 expression was decreased in mice’s nucleus pulposus tissues of the IDD model. IDD modeled mice injected with miR-494-5p downregulated lentivirus exhibited downregulated miR-494-5p expression while upregulated TIMP3 expression; those injected with TIMP3 overexpressed lentivirus elevated TIMP3 expression in mouse nucleus pulposus tissues. These data indicated that the injection of miR-494-5p low expression lentivirus or TIMP3 overexpression lentivirus in mice was successfully intervened. Figure 2. Inhibited miR-494-5p or elevated TIMP3 alleviates pathology and decelerates cell apoptosis in nucleus pulposus tissues of IDD mice. (a), miR-494-5p expression in mice’s nucleus pulposus tissues of each group; (b), TIMP3 mRNA expression in mice’ nucleus pulposus tissues of each group; (c), protein expression of TIMP3 in mice’ nucleus pulposus tissues of each group; (d), representative images of HE staining in nucleus pulposus tissues of mice in each group; (e), representative images of TUNEL staining in nucleus pulposus tissues of mice in each group; (f), statistical results of TUNEL staining in nucleus pulposus tissues of mice in each group; n = 8, a P < 0.05 vs the normal group, b P < 0.05 vs the NC group, c P < 0.05 vs the anti-miR-494-5p group. Data are expressed as mean ± standard deviation and one-way ANOVA was used for comparisons among multiple groups
Inhibited miR-494-5p or elevated TIMP3 alleviates pathology and decelerates cell apoptosis in nucleus pulposus tissues of IDD mice. (a), miR-494-5p expression in mice’s nucleus pulposus tissues of each group; (b), TIMP3 mRNA expression in mice’ nucleus pulposus tissues of each group; (c), protein expression of TIMP3 in mice’ nucleus pulposus tissues of each group; (d), representative images of HE staining in nucleus pulposus tissues of mice in each group; (e), representative images of TUNEL staining in nucleus pulposus tissues of mice in each group; (f), statistical results of TUNEL staining in nucleus pulposus tissues of mice in each group; n = 8, a P < 0.05 vs the normal group, b P < 0.05 vs the NC group, c P < 0.05 vs the anti-miR-494-5p group. Data are expressed as mean ± standard deviation and one-way ANOVA was used for comparisons among multiple groups
The HE staining showed that ( Figure 2(d )) there were more notochord cells or chondrocyte-like cells, and the cells evenly arranged in the normal mice; in the IDD modeled mice, the nucleus pulposus cells were sharply decreased and disorderedly arranged. The situation of modeled mice that had been injected with negative control lentivirus and miR-494-5p downregulated lentivirus + TIMP3 downregulated lentivirus was similar to IDD modeled mice; there were more nucleus pulposus cells which were in much-ordered arrangement in the modeled mice that had been injected with miR-494-5p downregulated lentivirus, TIMP3 overexpressed lentivirus than the IDD modeled mice.
The outcomes of TUNEL staining ( Figure 2e ) mirrored that IDD modeled mice had more TUNEL positive cells in nucleus pulposus tissues than normal ones; inhibition of miR-494-5p or overexpression of TIMP3 decreased the TUNEL positive cells in nucleus pulposus tissues of IDD mice; effect of suppressed miR-494-5p on TUNEL positive cells was reversed by inhibition of TIMP3.
As analyzed by the biological prediction website ( Figure 3(a )), miR-494-5p could target TIMP3. To confirm that TIMP3 was the target gene of miR-494-5p, the target relation between miR-494-5p and TIMP3 was analyzed by dual-luciferase reporter gene assay, and the outcomes reflected that miR-494-5p mimic apparently repressed the luciferase activity of WT TIMP3, while exerted no apparent effect on the luciferase activity of MUT TIMP3 ( Figure 3(b )), indicating that TIMP3 was the target gene of miR-494-5p. Figure 3. The 3ʹUTR of TIMP3 mRNA is a direct target of miR-494-5p. (a), binding sites of miR-494-5p and TIMP3 that predicted by http://www.targetscan.org/vert_72/ ; (b), results of dual-luciferase reporter gene assay; (c), miR-494-5p expression in transfected mice’ nucleus pulposus cells of each group; (d), TIMP3 mRNA expression in transfected mice’ nucleus pulposus cells of each group; (e), protein expression of TIMP3 in transfected mice’ nucleus pulposus cells of each group; N = 3, a P < 0.05 vs the normal group, b P < 0.05 vs the NC group, c P < 0.05 vs the miR-494-5p inhibitor group. Data are expressed as mean ± standard deviation, and one-way ANOVA was used for comparisons among multiple groups. The experiment was independently repeated for 3 times, and the unpaired t-test was performed for comparisons between two groups
The 3ʹUTR of TIMP3 mRNA is a direct target of miR-494-5p. (a), binding sites of miR-494-5p and TIMP3 that predicted by http://www.targetscan.org/vert_72/ ; (b), results of dual-luciferase reporter gene assay; (c), miR-494-5p expression in transfected mice’ nucleus pulposus cells of each group; (d), TIMP3 mRNA expression in transfected mice’ nucleus pulposus cells of each group; (e), protein expression of TIMP3 in transfected mice’ nucleus pulposus cells of each group; N = 3, a P < 0.05 vs the normal group, b P < 0.05 vs the NC group, c P < 0.05 vs the miR-494-5p inhibitor group. Data are expressed as mean ± standard deviation, and one-way ANOVA was used for comparisons among multiple groups. The experiment was independently repeated for 3 times, and the unpaired t-test was performed for comparisons between two groups
Outcomes of RT-qPCR and Western blot analysis ( Figure 3c ) suggested that miR-494-5p expression was increased, and TIMP3 expression was decreased in mice’ nucleus pulposus cells of mice with IDD. miR-494-5p inhibitor downregulated miR-494-5p expression while upregulated TIMP3 expression in nucleus pulposus cells of mice with IDD; OE-TIMP3 overexpressed TIMP3 expression in nucleus pulposus cells of mice with IDD; the promotive role of miR-494-5p inhibitor on TIMP3 expression was reversed by si-TIMP3.
The expression of Aggrecan and Col-2 in mice’s nucleus pulposus cells was determined ( Figure 4a ), and we have found that Aggrecan and Col-2 expression was decreased in nucleus pulposus cells of mice with IDD; miR-494-5p inhibitor or OE-TIMP3 upregulated Aggrecan and Col-2 expression in nucleus pulposus cells of mice with IDD; effect of miR-494-5p inhibitor on Aggrecan and Col-2 expression was eliminated by si-TIMP3. Figure 4. Inhibited miR-494-5p or elevated TIMP3 attenuates senescence of nucleus pulposus cells from IDD mice. (a), expression of Aggrecan mRNA in transfected mice’ nucleus pulposus cells of each group; (b), expression of Col-2 mRNA in transfected mice’ nucleus pulposus cells of each group; (c), expression of Caveolin-1 mRNA in transfected mice’ nucleus pulposus cells of each group; (d), expression of SA-β-gal mRNA in transfected mice’ nucleus pulposus cells of each group; (e), representative images and statistical results of SA-β-gal staining in transfected mice’ nucleus pulposus cells of each group; N = 3, a P < 0.05 vs the normal group, b P < 0.05 vs the NC group, c P < 0.05 vs the miR-494-5p inhibitor group. Data are expressed as mean ± standard deviation and one-way ANOVA was used for comparisons among multiple groups
Inhibited miR-494-5p or elevated TIMP3 attenuates senescence of nucleus pulposus cells from IDD mice. (a), expression of Aggrecan mRNA in transfected mice’ nucleus pulposus cells of each group; (b), expression of Col-2 mRNA in transfected mice’ nucleus pulposus cells of each group; (c), expression of Caveolin-1 mRNA in transfected mice’ nucleus pulposus cells of each group; (d), expression of SA-β-gal mRNA in transfected mice’ nucleus pulposus cells of each group; (e), representative images and statistical results of SA-β-gal staining in transfected mice’ nucleus pulposus cells of each group; N = 3, a P < 0.05 vs the normal group, b P < 0.05 vs the NC group, c P < 0.05 vs the miR-494-5p inhibitor group. Data are expressed as mean ± standard deviation and one-way ANOVA was used for comparisons among multiple groups
The expression of Caveolin-1 and SA-β-gal was measured as well ( Figure 4c ), and the outcomes revealed that Caveolin-1 and SA-β-gal expression was increased in IDD nucleus pulposus cells; miR-494-5p inhibitor or OE-TIMP3 downregulated Caveolin-1 and SA-β-gal expression in nucleus pulposus cells of mice with IDD; the role of miR-494-5p inhibitor in Caveolin-1 and SA-β-gal expression was reversed by si-TIMP3.
The results of SA-β-gal staining ( Figure 4e ) indicated an increased rate of SA-β-gal positive cells in nucleus pulposus cells of mice with IDD; suppression of miR-494-5p or overexpression of TIMP3 decreased the rate of SA-β-gal positive cells; impact of miR-494-5p downregulation on rate of SA-β-gal positive cells was abrogated by inhibition of TIMP3.
The results of CCK-8 assay ( Figure 5(a )) reflected that the cell viability of mouse nucleus pulposus cells in each group increased with time. The nucleus pulposus cell viability was suppressed in nucleus pulposus cells of mice with IDD; miR-494-5p inhibitor or OE-TIMP3 enhanced the cell viability in nucleus pulposus cells of mice with IDD, while si-TIMP3 abrogated the role of miR-494-5p inhibitor in nucleus pulposus cell viability. Figure 5. Inhibited miR-494-5p or elevated TIMP3 promotes proliferation and abates apoptosis of nucleus pulposus cells from IDD mice. (a), the viability of transfected mice’ nucleus pulposus cells in each group was detected using CCK-8 assay; (b), cell cycle distribution of transfected mice’ nucleus pulposus cells in each group was assessed by flow cytometry; (c), numbers of mice’ nucleus pulposus cells that arrested in the G0/G1, S, and G2/M phases in each group; (d), apoptosis of transfected mice’ nucleus pulposus cells in each group was measured by flow cytometry; (e), comparisons of apoptosis rate of mice’ nucleus pulposus cells among the groups; N = 3, a P < 0.05 vs the normal group, b P < 0.05 vs the NC group, c P < 0.05 vs the miR-494-5p inhibitor group. Data are expressed as mean ± standard deviation and one-way ANOVA was used for comparisons among multiple groups
Inhibited miR-494-5p or elevated TIMP3 promotes proliferation and abates apoptosis of nucleus pulposus cells from IDD mice. (a), the viability of transfected mice’ nucleus pulposus cells in each group was detected using CCK-8 assay; (b), cell cycle distribution of transfected mice’ nucleus pulposus cells in each group was assessed by flow cytometry; (c), numbers of mice’ nucleus pulposus cells that arrested in the G0/G1, S, and G2/M phases in each group; (d), apoptosis of transfected mice’ nucleus pulposus cells in each group was measured by flow cytometry; (e), comparisons of apoptosis rate of mice’ nucleus pulposus cells among the groups; N = 3, a P < 0.05 vs the normal group, b P < 0.05 vs the NC group, c P < 0.05 vs the miR-494-5p inhibitor group. Data are expressed as mean ± standard deviation and one-way ANOVA was used for comparisons among multiple groups
PI single staining was used to detect the cell cycle distribution of mice’s nucleus pulposus cells, and the outcomes showed that ( Figure 5b ) cells in the G0/G1 phases were advanced, while in S phase and G2/M phases were reduced in the nucleus pulposus cells of mice with IDD; miR-494-5p inhibitor or OE-TIMP3 decreased cells in the G0/G1 phases and increased cells in the S phase and G2/M phases in nucleus pulposus cells of mice with IDD; the impacts of miR-494-5p inhibitor on cell cycle distribution were abrogated by si-TIMP3.
The results of Annexin V-FITC/PI double staining revealed that ( Figure 5d ) the apoptosis rate of mice’s nucleus pulposus cells was considerably heightened in nucleus pulposus cells of mice with IDD; the apoptosis rate in nucleus pulposus cells was suppressed by miR-494-5p inhibitor or OE-TIMP3, while the effect of miR-494-5p inhibitor was reversed by si-TIMP3.
Materials
Written informed consents were acquired from all patients before this study. The protocol of this study was confirmed by the Ethics Committee of The Second Affiliated Hospital Zhejiang University School of Medicine. The protocol of animal experiments was approved by the Institutional Animal Care and Use Committee of The Second Affiliated Hospital Zhejiang University School of Medicine.
An amount of 40 intervertebral disc nucleus pulposus samples were collected between January 2017 and September 2018 at the The Second Affiliated Hospital Zhejiang University School of Medicine., 20 cases of which from patients with a mean age of 40.20 ± 8.54 years that had accepted surgery for intervertebral disc herniation were taken as the IDD group, and the rest 20 cases that from patients had accepted surgery for vertebral fracture or patients died of accident (mean age of 36.10 ± 7.98 years) were taken as the control group. The separated specimens were immediately frozen at -80°C.
The total RNAs in tissues and cells were extracted by Trizol kits (Invitrogen Inc., Carlsbad, CA, USA). The primers ( Table 1 ) weresynthesized by GenePharma Co., Ltd. (Shanghai, China). RNA was reversely transcripted into cDNA, and the reaction solution was conducted with RT-qPCR. The reaction solution contained 2.0 µL diluted cDNA, 0.2 µM/L of each paired primer, 200 µM/L deoxynucleotide triphosphates, 1 U Taq DNA polymerase (Qiagen Co., Ltd., Beijing, China) and 1 × PCR buffer. SYBRGreen (Roche Ltd, Basel, Switzerland) was used for detection and the PCR was conducted by the MiniOpticon real-time PCR detection system (Bio-Rad Laboratories, Hercules, CA, USA). U6 and glyceraldehyde phosphate dehydrogenase (GAPDH) were taken as the internal references of miR-494-5p and TIMP3, respectively. The data were analyzed by 2 −ΔΔCt method [ 18 ]. Table 1. Primer sequence Gene Primer sequence (5ʹ-3ʹ) MiR-494-5p Forward: ATTGAAACATACACGGGAAAC Reverse: GCATGCAGATCCCTACCG TIMP3 Forward: CACGGAAGCCTCTGAAAGTC Reverse: TCCCACCTCTCCACAAAGTT Aggrecan Forward: GGCAACCTCCTGGGTGTAAG Reverse: GGTTCGTGG GCTCACAA Col-2 Forward: GAACAGCATCGCCTACCTGG Reverse: TGTTTCGTGCAGCCATCCT caveolin-1 Forward: CTACAAGCCCAACAACAAGGC Reverse: AGGAAGCTCTTGATGCACGGT SA-β-gal Forward: AGCTATGACTATGACGCCCC Reverse: CTTCCGTCACCGTCTTGAAC U6 Forward: CTCGCTTCGGCAGCACA Reverse: AACGCTTCACGAATTTGCGT GAPDH Forward: GGATTTGGTCGTATTGGG Reverse: GGAAGATGGTGATGGGATT F, forward; R, reverse; miR-494-5p, microRNA-494-5p; TIMP3, tissue inhibitor of metalloproteinase 3; GAPDH, glyceraldehyde phosphate dehydrogenase.
Primer sequence
F, forward; R, reverse; miR-494-5p, microRNA-494-5p; TIMP3, tissue inhibitor of metalloproteinase 3; GAPDH, glyceraldehyde phosphate dehydrogenase.
The total proteins in nucleus pulposus tissues and cells were extracted with the concentrations measured using bicinchoninic acid method. The protein load was 30 µg/lane in 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and the proteins were transferred to nitrocellulose membranes, which were blocked with 5% skim milk powder in 0.1% tris-buffered saline/Tween20 for 2 h and incubated with primary antibody against TIMP3 (1: 1000, Abcam Inc., Cambridge, MA, USA). After added with horseradish peroxidase (HRP)-conjectured secondary antibody (1: 1000, BOSTER Biological Technology Co., Ltd., Wuhan, Hubei, China) for 1-h incubation at 37°C, the membranes were immersed in enhanced chemiluminescent reaction liquid (Thermo Fisher Scientific Inc., Waltham, MA, USA) for 1 min. With the liquid removed, the membranes were covered by food wrap, exposed, developed, and fixed at dark environment; then, the protein bands were analyzed using ImageJ2x software with GAPDH was taken as the loading control.
Specific pathogen-free (SPF) mice (12 weeks) obtained from Experimental animal center of Zhejiang University (Zhejiang, China) were fed at 24 ± 2°C with free access to food and water, and 12 h day/night cycle for 7-d adaptive feeding.
The mice were randomly classified into: the normal group (n = 8), the model group (n = 8), the NC group (n = 8), the anti-miR-494-5p group (n = 8), the Lenti-TIMP3 group (n = 8) and the anti-miR-494-5p + si-TIMP3 group (n = 8).
IDD models were established as previously described [ 19 ]. Briefly, mice were anesthetized by ketamine (100 mg/kg) and an incision was conducted from Co6 to Co8. Next, Co6-Co7 coccygeal discs were punctured by a syringe needle, which was vertically inserted into disc and rotated in the axial direction by 180°for 10 s. The puncture was made parallel to the endplates through the annulus fibrosis into the nucleus pulposus using a 31-G needle, which was inserted 1.5 mm into the disc to depressurize the nucleus. The other segments were left undisturbed as a contrast segment. Negative control (NC) lentivirus (2 µL of lentivirus-containing solution (approximately 10 6 plaque-forming units)), miR-494-5p downregulated lentivirus (2 µL of lentivirus-containing solution (approximately 10 6 plaque-forming units)), TIMP3 overexpressed lentivirus (2 µL of lentivirus-containing solution (approximately 10 6 plaque-forming units)), and miR-494-5p downregulated lentivirus (2 µL of lentivirus-containing solution (approximately 10 6 plaque-forming units)) + TIMP3 downregulated lentivirus (2 µL of lentivirus-containing solution (approximately 10 6 plaque-forming units)) were injected into nucleus pulposus of the mice according to the grouping. The miR-494-5p downregulated lentivirus, TIMP3 overexpressed lentivirus, TIMP3 downregulated lentivirus were all constructed by OBIO (Shanghai, China). The mice were euthanized using lethal anesthetic overdose on the 28 th d after the operation with their intervertebral disc nucleus pulposus tissues separated. One part of the tissues were fixed for the histological observation, and the rest were preserved in liquid nitrogen for RT-qPCR and Western blot analysis.
Sections were dewaxed with xylene, rehydrated with gradient ethanol and rinsed for 2 min. Sections were then stained with hematoxylin for 2 min, conducted with color separation by 1% hydrochloric acid ethanol for 10 s, and rinsed by distilled water for 1 min, and then were stained with eosin for 1 min. After the eosin staining, sections were washed by distilled water for 10 s and dehydrated by 95% and 100% ethanol. Finally, sections were permeabilized with xylene and sealed using neutral balsam.
TUNEL kits were purchased from Roche company. The paraffin sections were dewaxed by xylene at 60°C twice (each for 5 min), and dehydrated by gradient ethanol, then rinsed by phosphate-buffered saline (PBS) for 3 times (each for 5 min). The proteinase K solution was prepared (98 μL PBS and 2 μL proteinase K (Roche)), and each sample was appended with 100 proteinase K solution at 37°C for 30 min, then blocked for 10 min. After permeabilized by 1 μL 0.1% Triton X 100 and 0.1% sodium citrate solution on ice, the sections were supplemented with TUNEL reaction solution (Roche, PBS was used to replace the reaction solution in the NC group), transfected by peroxidase, and developed by diaminobenzidine (ZSGB-Bio, Beijing, China), and then counterstained by hematoxylin. Next, the sections were dehydrated, permeabilized, sealed, and observed by a light microscope.
Mice from the normal group and the model group were euthanized by cervical dislocation. The fascia and muscle were dissected, the IVD was exposed, and then the cartilage endplate was removed with the jelly-like tissues collected. The obtained tissues were cut into 0.5 mm 3 blocks and detached by 0.25% trypsin at 37°C for 10 min. The detachment was ended by adding 3–5 mL Dulbecco’s modified Eagle medium (DMEM)/F12 complete medium. The tissues were centrifuged at 1200 r/min for 5 min with supernatant discarded, detached by 0.25% collagenase Ⅱ at 37°C for 3 h, and centrifuged at 1200 r/min for 5 min with supernatant discarded, and then the cell concentration was adjusted to 5 × 10 5 cells/mL by DMEM/F12 complete medium. The cells were incubated at 37°C and with 5% CO 2 . The medium was changed every 3 d, the morphology and growth of the normal and degenerated nucleus pulposus cells were observed under an inverted microscope, and the ultrastructure of these cells were observed by an electron microscope. After the monolayer formed in primary cells, the cells were detached by 0.25% trypsin and passaged, and cells in the logarithmic growth phase were selected for the subsequent experiments.
The IDD mice’ nucleus pulposus cells were separated into seven groups: the model group (nucleus pulposus cells were normally cultured without any treatment), the NC group (nucleus pulposus cells were transfected with NC sequence), the miR-494-5p inhibitor group (nucleus pulposus cells were transfected with miR-494-5p inhibitor), the overexpressed (OE)-TIMP3 group (nucleus pulposus cells were transfected with overexpressed TIMP3 plasmids), and the miR-494-5p inhibitor + small interfering RNA (si)-TIMP3 group (nucleus pulposus cells were transfected with miR-494-5p inhibitor and silenced TIMP3 vector). The miR-494-5p inhibitor, OE-TIMP3 plasmid and si-TIMP3 vector were obtained from RiboBio Co., Ltd. (Guangdong, China). The transfection was performed using Lipofectamine 2000 reagent (Invitrogen) according to the manufacturers’ information. Other than that, the normal group (nucleus pulposus cells from normal mice without any treatment) was also set.
Nucleus pulposus cells were seeded onto 96-well plates at 4 × 10 3 cells/well (3 duplicates were set in each group) and incubated. The cell viability was assessed at 0 h, 24 h, 48 h, and 72 h according to the instructions of CCK-8 kits (Beyotime): each well was appended with 10 μL CCK-8 reagent and incubated for 2 h. The absorbance at 490 nm was analyzed by a microplate reader.
The nucleus pulposus cells in the logarithmic growth phase trypsinized and seeded onto 6-well plates at 2 × 10 5 cells/well. The medium was removed and cells were rinsed with PBS. Fixed with 1 mL β-gal staining fixative for 15 min, the cells were washed with PBS three times (3 min/time). The staining working solution (6 mL) was prepared according to the kit instruction (Beyotime Institute of Biotechnology, Shanghai, China) and each well was added with 1 mL prepared staining working solution. The plates were sealed with plastic wrap and put into a 37°C oven overnight, and then the cells were observed under a microscope.
Cell cycle distribution assessment: transfected cells were rinsed with PBS, fixed in 70% ethanol and precooled at 4°C for at least 1 h, and then were centrifuged at 1500 rev/min for 5 min to remove the fixative solution. The sediment was washed with PBS, and propidium iodide (PI) solution was added according to the instructions of DNA ploidy test kit (BD Biosciences, CA, USA). The BD FACSVerse™ flow cytometry (Becton, Dickinson and Company, NJ, USA) was used to detect cell cycle after 15 min without light exposure. The DNA content was assessed at 488 nm.
Cell apoptosis measurement: transfected cells were suspended in binding buffer with the concentration adjusted to 1 × 10 6 cells/mL, and were then added with 10 μL fluorescein isothiocyanate (FITC)-marked connexin. Annexin and 10 μL of 20 mg/L PI (BD Biosciences) were mixed and incubated for 10 min in the dark. It was washed with binding buffer and analyzed using the Coulter Elite (Beckman Coulter, Miami, FL) flow cytometer.
The binding sites of miR-494-5p on TIMP3 promoters were predicted by a biological prediction website ( http://www.targetscan.org/vert_72/ ), and dual-luciferase reporter gene assay was employed to confirm whether TIMP3 was the target gene of miR-494-5p. The wild type (WT) and mutation type (MUT) luciferase reporter gene vectors of TIMP3 3ʹ-untranslated region (3ʹUTR) containing binding sites of miR-494-5p were established (respectively, defined as TIMP3-WT and TIMP3-MUT). The sequenced TIMP3-WT and TIMP3-MUT vectors were co-transfected into nucleus pulposus cells with miR-494-5p mimic or mimic NC and incubated for 48 h. Based on the directions of Dual-Luciferase reporter gene detection kits (Promega Corporation, Madison, WI, USA): each sample was resuspended by 80–90 μL passive lysis buffer that had been diluted by distilled sterile water for 15 min. The cell lysis solution (50 μL) was mixed with luciferase assay buffer that had been supplemented with the substrate, and placed on a microplate reader, and the luciferase activity was measured by a fluorescence luminescence instrument, and the standardized data were calculated by the ratio of luciferase activities of renilla and firefly luciferases.
All data analyses were conducted using SPSS 21.0 software (IBM Corp. Armonk, NY, USA). The measurement data were expressed as mean ± standard deviation. The unpaired t-test was performed for comparisons between two groups and one-way analysis of variance (ANOVA) was used for comparisons among multiple groups. P value <0.05 was indicative of a statistically significant difference.
Discussion
Although IDD is not a fatal disorder, it has been thought to be a main social burden with a great socioeconomic effect, and there are many people unable to go back to work for some weeks [ 4 ]. It has been demonstrated that the miRNAs constitute a group of endogenous post-transcriptional modulators of gene expression by RNA interference, and broadly expressed in organisms, including humans [ 20 ]. This research was designed to testify the effects of miR-494-5p in IDD through targeting TIMP3, and the results of our study have illuminated that the degradation of miR-494-5p was able to decelerate the progression of IDD by improving TIMP3 expression.
We have concluded several outcomes in this research, and one of them reflected that miR-494-5p was highly expressed, while TIMP3 was poorly expressed in nucleus pulposus tissues of IDD patients, and in both nucleus pulposus tissues and cells in IDD rats. Similar to this result, Xu et al . have pointed out that miR-494-5p expression was highly expressed in endometrial biopsy specimens that gained from mid-reproductive-aged infertile women with endometriosis, which was in contrast to the samples from endometriosis-free infertile women [ 10 ]. The same tendency of miR-494-5p has also been revealed by a previous study, in which the authors have provided evidence that miR-494-5p expression was enhanced in hepatic stellate cells after pressure overload, indicating that miR-494-5p was highly expressed in portal hypertension [ 11 ]. As for the abnormal expression of TIMP3, a previous study has unraveled that TIMP3 presents a low expression in melanoma lymph node biopsies of melanoma patients [ 15 ], and it has been implied that the expression of TIMP3 is repressed in breast cancer cells [ 16 ]. Moreover, we have confirmed that there existed a target relation between miR-494-5p and TIMP3 in nucleus pulposus cells of IDD mice, which has not been identified in other researches.
Another important finding in our study revealed that the suppressed miR-494-5p and elevated TIMP3 were able to decelerate the apoptosis of both nucleus pulposus tissues and cells in IDD. Similarly, Zheng et al . have illuminated that the degradation of miR-494-3p has the capacity to promote the apoptosis of rat bone marrow mesenchymal stem cells (BMSCs) that are induced by ischemia, and on the contrary, the overexpression of miR-494-3p could restrict the ischemia-triggered apoptosis of BMSCs [ 21 ]. Liu et al . have elucidated that the overexpression of TIMP3 could inhibit the myocardial apoptosis to protect against cardiac ischemia/reperfusion injury [ 22 ], and it has been validated from the opposite side that the loss of TIMP3 could lead to epithelial and mitochondrial apoptosis [ 23 ]. In addition, we have pointed out that the downregulated miR-494-5p and promoted TIMP3 could accelerate the proliferation of nucleus pulposus cells in IDD. Consistent with this result, Esser et al . have mentioned in their study that the repression of miR-494 increased the proliferation, migration, and sprout formation of endothelial cells in vitro as well as endothelial growth in vivo [ 24 ], and it has been illustrated that TIMP3 could regulate the proliferation of epithelial cells by inhibiting the activities of matrix metalloproteinases [ 25 ]. Besides, we have also found that the repression of miR-494-5p and elevation of TIMP3 could attenuate the senescence and cell cycle progression of nucleus pulposus cells in IDD. In line with the outcome, an extant document has provided evidence that the enhancement of miR-494 was able to induce senescence of human diploid IMR90 fibroblasts as a component of the genetic program [ 26 ]. Duan et al . have discovered that miR-494 elevated, and primary murine bronchial epithelial cells arrested in G1 phase after exposed to benzo[a]pyrene, while the downregulation of miR-494 could relive the G1 arrest of the cells [ 27 ]. Moreover, miR-494 has been elucidated to facilitate the apoptosis and extracellular matrix degradation in degenerative human nucleus pulposus cells [ 28 ], and it has been unraveled that miR-494 inhibition protected nucleus pulposus cells against tumor necrosis factor-α-induced apoptosis [ 13 ].
To sum up, we have demonstrated that the miR-494-5p knockdown could decelerate the progression of IDD via promoting the expression of TIMP3, which may be helpful to the further understanding and treatment development of IDD, thereby providing a broad insight into the underlying mechanism for IDD.
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.