Cloning, characterization and comparative innate immune functions of duRIPK2 in Cherry Valley duck against APEC and NDRV

Cloning, characterization and comparative innate immune functions of duRIPK2 in Cherry Valley duck against APEC and NDRV | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Cloning, characterization and comparative innate immune functions of duRIPK2 in Cherry Valley duck against APEC and NDRV Xiaocui Jiang, Rong Li, Shuo Li, Wenhao Li, Zhi Cao, Qing Pan, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8719745/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Receptor-interacting protein kinase 2 (RIPK2) is an indispensable adaptor and effector protein in the NOD-like receptor (NLRs) signaling pathway. Its C-terminal CARD binds NLRs via CARD-CARD interaction, while its N-terminal kinase domain (KD) mediates ubiquitination and phosphorylation for downstream signaling. In this study, we cloned and analyzed the gene sequence and structural characteristics of Cherry Valley duck RIPK2 ( du RIPK2), systematically investigated its expression distribution in different tissues of Cherry Valley ducks, and explored its immune regulatory role in the infection of avian pathogenic Escherichia coli (APEC) and novel duck reovirus (NDRV). Through bioinformatics analysis, the full-length open reading frame (ORF) of du RIPK2 was identified for the first time, and conserved sites related to its kinase role were predicted. The tissue expression profile analysis indicated that du RIPK2 was highly expressed in the liver, muscle, and trachea, but was expressed at a lower level in intestinal tissues. The infection model analysis confirmed that APEC infection could markedly elevate du RIPK2 expression level, induce the enhanced expression of inflammatory factors, and inhibit the bacterial load. Whereas, in NDRV infection, the expression of du RIPK2 was significantly inhibited, accompanied by the increased expression of inflammatory factors, and the viral load remained at a relatively high level at 3dpi. The results demonstrate that du RIPK2 is a momentous hub of both anti-bacterial and anti-viral immunity systems in ducks, advancing the mechanistic understanding of the NOD-RIPK2 signaling pathways in poultry, providing direction for breeding strategies and entry points for adjuvant development, and reducing antibacterial and antiviral drug dependency in the duck farming industry. RIPK2 Cherry Valley duck cloning APEC NDRV innate immunity Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Introduction Innate immunity operates as the frontline barrier against pathogenic microbial invasion. It rapidly recognizes pathogenic microorganisms’ pathogen- and damage- associated molecular patterns via pattern recognition receptors (PRRs), and activates relevant pathways to trigger the release of various interferons, interleukins, or chemokines, thereby eliminating infected or damaged cells [ 1 ] . The nucleotide-binding oligomerization domain-like receptors (NLRs) include nucleotide-binding oligomerization domain-containing protein (NOD) 1 and NOD2, etc. [ 2 ] , and they can recognize peptidoglycan upon bacterial infection, and recruit receptor-interacting protein kinase 2 (RIPK2) [ 3 ] ,which can transmit cell signals, activate nuclear factor (NF)-κB and involve mitogen-activated protein kinase (MAPK) pathway, thereby adjusting the host's innate immunity system [ 4 , 5 ] . RIPKs act as pivotal regulators in inflammatory and cell death signaling pathway. So far, there have been discovered 7 types of RIPKs, among which RIPK2 is included, and they share a highly similar N-terminal kinase domain (KD) with the major differences lying in the distinct C-terminal structures [ 6 ] . KD is the determinant for RIPKs to exert their kinase activity, and RIPKs are activated by autophosphorylation at sites within the KD and then relay signals downstream. A variety of kinase inhibitors currently achieve the goal of alleviating inflammatory responses and reducing tissue damage by competitively or allosterically targeting the KD [ 7 – 9 ] . RIPK2, as known as RIP2, RICK, CARD3, CCK, or CARDIAK, is a 61-kDa serine/threonine kinase, and it has higher abundant in human spleen, peripheral-blood leukocytes, placenta, testis, and heart [ 10 ] . RIPK2 contains a bridging domain in its middle region, a caspase activation and recruitment domain (CARD) at its C-terminus, and a KD at its N-terminus that regulates RIPK2 phosphorylation and ubiquitylation [ 11 ] . Upon detecting bacterial peptidoglycan, NOD1/2 engage RIPK2 through a CARD-CARD homotypic interaction to transmit a signal [ 12 , 13 ] . This signal leads to RIPK2’s phosphorylation and ubiquitylation to trigger the activation of NF-κB and MAPK pathway: Activated NF-κB moves into the nucleus, and adjusts transcription of multiple cytokines and antimicrobial peptide genes; activated MAPK pathway terminal kinases, covering c-Jun N-terminal kinase, extracellular signal-regulated kinase 2 and p38 mitogen-activated protein kinase, phosphorylate multiple downstream substrates, and regulate cellular behavior [ 14 , 15 ] . Growing evidence has revealed RIPK2 as a critical defender against various bacterial infections. In the absence of RIPK2, host cells exhibit a markedly reduced capacity to eliminate bacteria: In a murine model of Staphylococcus aureus infection, RIPK2 −/− mice show delayed peritoneal-macrophage emigration, diminished intracellular bacterial clearance, and lower secretion of pro-inflammatory mediators [ 16 ] . Similarly, Listeria monocytogenes infection leads to decreased tumor necrosis factor and interleukin (IL)-6 production by RIPK2-deficient macrophages [ 17 ] , and in models of Escherichia coli and Chlamydophila pneumoniae infection, RIPK2 −/− mice both display significantly compromised bacterial clearance [ 18 , 19 ] . Studies have illuminated that stimulation with avian pathogenic Escherichia coli (APEC) upregulates RIPK2 expression, enhances apoptosis, and suppresses cell viability. Knockdown of RIPK2 significantly alleviates the APEC infection-mediated suppression of cell viability and attenuates apoptosis [ 20 ] . RIPK2's antibacterial mechanism in human and mouse models has come under intensive scrutiny, but research on the antibacterial function of RIPK2 in birds is scarce. APEC, as an extraintestinal pathogen, can cause colibacillosis in poultry, manifesting as pericarditis, perihepatitis, septicaemia, airsacculitis, and meningitis. These pathologies impair bird welfare, reduce egg output, prolong broiler time-to-market, and raise production costs, inflicting substantial economic losses on the poultry industry [ 21 , 22 ] . Extensive homology and parallel evolutionary trajectories exist between avian and human pathogenic Escherichi coli isolates, underscoring the zoonotic potential of APEC [ 23 ] . Intensified investigation of APEC biology and the host immune response is imperative for both animal and public health. Most APEC isolates are multidrug-resistant, rendering antibiotic-based prophylaxis and therapy increasingly ineffective [ 24 , 25 ] , and the extensive serotypic diversity of APEC has also hampered the development of a universal vaccine [ 26 ] . Studies have confirmed that, in APEC-infected chickens, RIPK2 is markedly up-regulated in bone marrow, thymus, bursa of Fabricius, leukocytes, and spleen [ 27 – 30 ] , and whole transcriptome analysis clarified that the NLRs signaling pathway and its core gene RIPK2 are common transcriptional immune responses to APEC stimulation [ 27 – 29 ] . Exploiting this immune signature through genetic improvement consequently holds great promise for enhancing poultry resistance to APEC infection. More and more studies have manifested that RIPK2 not only mediates the inflammatory response triggered by bacterial infection but also participates in the immune defense against viral infection. Studies have manifested that it can mediate the response to influenza virus A infection [ 6 ] . Novel duck reovirus (NDRV), classified within the family Reoviridae , is a non-enveloped virus possessing an icosahedral capsid. NDRV possesses a segmented double-stranded RNA genome that encodes viral functional proteins. Its genome contains 43–46 kilobase pairs, encapsidated within virions 60–85 nm in diameter [ 31 ] . NDRV infection produces depression, complete anorexia, watery diarrhoea, and hepatic mottling and haemorrhage together with splenic haemorrhagic necrosis, and induced clinical signs are most severe and mortality highest in ducklings aged 1–10 days, and it inflicts substantial economic losses on the poultry industry [ 32 ] . Studies have demonstrated that NOD2 senses viral RNA and activates RIPK2 to launch mitophagy, dampen inflammasome activity, and curb IL-18, IFN-γ, and chemokines, thereby alleviating tissue damage from inflammation [ 33 ] . As a result, the regulation of the RIPK2 gene for controlling avian-susceptible viral infections represents a feasible and scientifically meaningful strategy. Innate immunity relies on the NLRs-RIPK2 signaling axis to trigger inflammatory response. In this research, we aim to clarify the regulatory role of duRIPK2 in defense against APEC and NDRV Infections, providing a precision target for intervention in avian bacterial or viral infections and a certain reference for regulating RIPK2 activity as a new prevention and control strategy to curb excessive inflammation and reduce economic losses in the aquaculture industry. Materials and methods Animals, bacterial and viral strains The APEC strains used in this study have been employed in our previous research [34] . It was grown in LB-Miller broth for 18h at 37℃.1×10 8 colony-forming units (CFU)/mL APEC phosphate-buffered saline (PBS) suspension was prepared [35] . NDRV strains were isolated from the spleen of clinically diseased ducks. After the virus titer was determined, the viral suspension was diluted with PBS to 10 4.5 TCID 50 /mL [36] . To establish APEC- and NDRV- infection models with Cherry Valley ducks, we purchased one-day-old ducks from Weifang, Shandong, and acclimatized them for one week. After seronegativity to both APEC and NDRV was verified by enzyme-linked immunosorbent assays, three groups (n = 30 each) were set: APEC-challenged ducks were subcutaneously inoculated with 0.2 mL of 1×10 8 CFU/mL APEC suspension in the neck; NDRV-challenged ducks were intramuscularly injected with 0.2mL 10 4.5 TCID 50 /mL NDRV suspension; the control group was intramuscularly injected with 0.2mL PBS. Liver, spleen, and brain of ducks in three groups were collected at 1-, 2-, and 3-days post-infection (dpi). One portion of each tissue was fixed in 4 % formalin at 25°C for pathological sections and the remainder was stored at -70 °C for gene-expression analyses, and microbial load quantification. To profile the tissue distribution of du RIPK2, three healthy Cherry Valley ducks were used and the following 20 tissues were collected: heart, liver, spleen, lung, kidney, brain, cerebellum, thymus, bursa of Fabricius, esophagus, trachea, duodenum, jejunum, ileum, cecum, rectum, gizzard, proventriculus, skin, and muscle. All remaining ducks were euthanized with an overdose of sodium pentobarbital. RNA Extraction and cloning of du RIPK2 Total RNA extraction was performed using the BioFlux Total RNA Extraction Kit (BioFlux, Hangzhou, China). After RNA concentration and quality were confirmed, reverse transcription was performed using ReverTra Ace® qPCR RT Master Mix with gDNA Remover (TOYOBO, Osaka, Japan). Full-length du RIPK2 was amplified with polymerase chain reaction (PCR) primers (Table 1) designed according to the predicted Anas platyrhynchos RIPK2 sequence recorded in the National Center for Biotechnology Information (NCBI, https://www.ncbi.nlm.nih.gov/) database. PCR setting was as follows: 94 ℃ 5 min; 35 × (94 ℃ 30 s, 57 ℃ 30 s, 72 ℃ 4 min); 72 ℃ 10 min. Following electrophoresis on 1 % agarose gels, the target PCR products were excised and cleaned up with the Gel Extraction Kit from CWBIO (Beijing, China), and sent to Sangon Biotech (Shanghai, China) for sequencing, and the sequence analysis was performed using Editseq, DNAStar Lasergene [37] . Sequence and phylogenetic analysis To construct a phylogenetic tree for du RIPK2, the obtained sequence was imported into the BLAST tool of the NCBI website, and RIPK2 amino acid (AA) sequences from various species were retrieved (Table 2). AA sequence alignments were performed using ClustalX2 and BoxShade software. The phylogenetic tree of duRIPK2 was constructed using MEGA 11.0 software by the Neighbor-joining method over 1000 replicates. The functional domains of du RIPK2 were predicted according to its AA sequence by the SMART tool (http://smart.embl-heidelberg.de/). Antibacterial and antiviral activity of du RIPK2 To investigate the relationship between pathogenic microorganisms and du RIPK2 during bacterial and viral infection, three ducks per experiment group were randomly selected at each timepoint. Liver, spleen and brain were collected, weighed, and homogenized with PBS. The grinding products were centrifuged at 1000 × g for 5 min to collect the supernatant. The plate count method was used to quantify the colonies. The liver, spleen, and brain grinding products of three randomly selected ducks from each experiment group at each timepoint were collected by the same method. The extraction and reverse transcription of NDRV RNA were performed as described. To investigate the NDRV load in each tissue during infection, the reverse-transcribed product and the NDRV quantification standard were amplified using the TOROGreen ® qPCR Master Mix (TOROIVD, Shanghai, China) and the Archimed X4 Real-Time qPCR System (Rocgene, Beijing, China) with the qPCR setting: 95 ℃ 5 min; 40 × (95 ℃ 10 s, 60 ℃ 34 s). The NDRV load in each tissue at each timepoint was calculated from the standard curve. Each sample was assayed in three technical replicates and represented as mean ± SD. Inflammatory cytokines regulation activity of du RIPK2 To investigate the relationship between inflammatory cytokines and du RIPK2 during bacterial and viral infection, the supernatant of liver, spleen, and brain from three randomly selected ducks in each experiment group was collected using the previously described method, and treated using the RNA extraction and reverse transcription methods mentioned above. Quantitative Real Time PCR (qRT-PCR) was performed using the TOROGreen ® qPCR Master Mix (TOROIVD, Shanghai, China) on the Archimed X4 Real-Time qPCR System (Rocgene, Beijing, China) with the setting: 95 ℃ 5 min; 40 × (95 ℃ 10 s, 60 ℃ 34 s). The primer sequences of du RIPK2 and inflammatory cytokines IL-1β, IL-2, IL-6, IL-10, IFN-α, IFN-β, and β-actin (endogenous reference) were listed in Table 1. All data were calculated using the 2 −ΔΔCt method [38] . Each sample was assayed in three technical replicates and represented as mean ± SD. Methods of Calculation and Statistics All data were analyzed by SPSS 19.0 software, and differences were assessed by Two-way ANOVA, followed by Tukey's multiple comparisons test ( P < 0.05, significant, P < 0.01, highly significant). Graph Pad Prism 5.0 software (Graph Pad Software Inc., San Diego, CA, USA) was used to process related graphs. Results Molecular characterization of du RIPK2 The full-length ORF of du RIPK2’s is 1,659bp, encoding a protein of 553 amino acids (the sequence has been submitted to GenBank, and the GenBank accession number is SUB15937840), containing lysine 209 (K209), serine 176 (S176), and tyrosine 474 (Y474) (The K has been marked in green font, and the S and Y have been marked in red font. Figure 1). SMART prediction revealed that du RIPK2 possesses serine/threonine protein kinases, catalytic (S-TKc) domain (26-296aa, indicated by the blue line), and the CARD (457-541aa, indicated by the red line) (Figure 1 and Figure 2). Phylogenetic analysis of du RIPK2 In Figure 3, we constructed a phylogenetic tree using RIPK2 AA sequences from Cherry Valley duck and other species. The phylogenetic tree contains mammals, avian, and fish branches, and d u RIPK2 was mapped in the birds’ one. Du RIPK2 is most closely related to that of Anas platyrhynchos and Anas acuta RIPK2, and shows a distant relationship with fish RIPK2. In Figure 4, the multiple sequence alignment indicated an overall 90 % identity with avian RIPK2 orthologs and 100 % identity with the RIPK2 sequence of Anas acuta by comparing the AA sequence of RIPK2s in Cherry Valley ducks and others. Tissue distribution of du RIPK2 We profiled du RIPK2 mRNA expression level across all 20 tissues as described. Du RIPK2 was widely expressed in 20 tissues, and this wide expression indicates a systemic role in host immune responses. The highest du RIPK2 mRNA expression level was detected in the liver, followed by muscle and trachea, whereas expression in intestinal tissues was comparatively low (Figure 5). Gross lesions and histopathological analysis of the infected ducks Throughout the experiment, no abnormal clinical signs were observed on the ducks injected with PBS. In contrast, APEC- and NDRV-challenged ducks exhibited listlessness, ruffled feathers, and sluggish movement (Figure 6A and 6E). For the APEC-infected group, the liver was markedly enlarged, dark red, and accompanied by diffuse hemorrhage; the spleen showed significant enlargement with a tense capsule; the brain was obviously edematous and presented prominent hemorrhage (Figure 6B-D). In the NDRV-challenged ducks, the liver was notably enlarged, with extensive petechial hemorrhages on the surface; the spleen was significantly enlarged, dark red, with a mottled appearance and distinct necrotic foci; the brain tissue was markedly swollen and severely edematous (Figure 6F-H). Histopathologically, the liver of APEC-infected ducks presented disorganized hepatic architecture, loss of hepatic cord arrangement, hepatic sinusoidal congestion, and mild steatosis (Figure 7D); in NDRV-infected ducks, the liver showed severe disruption of hepatic architecture, with hepatocytes exhibiting extensive vacuolar degeneration and necrosis (Figure 7G). In the spleen, APEC infection induced lymphocyte necrosis with abundant cellular debris (Figure 7E), while NDRV infection caused disrupted splenic architecture, lymphocyte necrosis, and formation of distinct necrotic foci (Figure 7H). In the brain, APEC-infected ducks showed severe cerebral edema with concurrent congestion (Figure 7F), whereas NDRV-infected ducks presented mild cerebral edema and loosened tissue texture (Figure 7I). In summary, both APEC and NDRV can induce histopathological lesions in multiple tissues of ducks. Bacterial load and viral DNA load in the infected ducks We detected APEC loads in the examined tissues at each timepoint (Figure 8A). At 1 dpi, bacteria load increased significantly in all three tissues, reaching 3.0 × 10 8 CFU/g in the liver, 1.0 × 10 8 CFU /g in the spleen, and 4.0 × 10 7 CFU/g in the brain. At 2 dpi, APEC content declined in the liver and brain, whereas the spleen continued to accumulate bacteria, peaking at 3.0 × 10 8 CFU/g. By 3 dpi, bacterial burdens decreased in all three tissues examined. We also tested NDRV loads in the examined organs at 1, 2, and 3 dpi (Figure 8B). At 1 dpi, no high load was detected in these tissues examined. At 2 dpi, the viral loads in both liver and spleen respectively, peaked at 7.94×10 3 copies/μL and 1.04×10 5 copies/μL. At 3 dpi, viral loads in liver, spleen, and brain all showed a downward trend. Compared with other organs, the NDRV load in the brain has always been low. No gene segment of APEC or NDRV was detected in any tissues of the control group. Transcriptional levels of du RIPK2 after APEC and NDRV challenge To investigate whether du RIPK2 participates in antibacterial and antiviral immune response, its mRNA content was measured in the liver, spleen, and brain after APEC and NDRV challenge. Following infection with the APEC, du RIPK2 expression was upregulation at all tested timepoints in all tested tissues (Figure 9A). Among these, duRIPK2 expression in the spleen peaked at 1 dpi with an 11.23-fold increase (Figure 9A). At 2 dpi, du RIPK2 also showed significant upregulation, with a 4.34-fold and 4.71-fold increase in liver and spleen, respectively (Figure 9A). At 3 dpi, the relevant upregulation is not very obvious, and the upregulation in the brain is relatively mild. (Figure 9A). Notably, in the NDRV infection group, du RIPK2 expression was significantly downregulated throughout the entire experimental period in all examined tissues (Figure 9B). These findings indicate du RIPK2 as an essential factor of the innate immunity against both bacterial and viral pathogens. Transcriptional level s of inflammatory cytokines in the infected ducks To characterize the kinetic profiles of inflammatory cytokines during bacterial and viral infection, we quantified the transcript levels of IL-1β, IL-2, IL-6, IL-10, IFN-α, and IFN-β in the liver, spleen and brain of APEC- and NDRV- challenged Cherry Valley ducks. The transcriptional profiles of IL-1β in the liver and spleen of the APEC- and NDRV-infected groups were significantly upregulated (Figure 10A and 10a). The mRNA expression of IL-2 has a similar trend in both APEC- and NDRV- infected tissues, with the highest upregulation observed in the liver. For example, it reached a peak of 184.3 times at 3 dpi in the APEC-infected liver, and reached a peak of 230.35 times at 2 dpi in the NDRV-infected liver (Figure 10B and 10b, P < 0.0001). Significant upregulation of IL-6 expression was found in APEC-infected spleen, with IL-6 mRNA expression levels significantly upregulated by 2566.96 times at 1 dpi ( P < 0.0001), upregulated by 447.79-fold at 2 dpi ( P < 0.0001), but returned to normal levels at 3 dpi (Figure 10C). Inversely, in the NDRV-challenged Cherry Valley ducks, the expression of IL-6 mRNA was not upregulated as much as mentioned above. It was upregulated the most in the liver at 2 dpi, reaching 30.48 times (Figure 10c, P < 0.0001). The transcriptional level of IL-10 was significantly upregulated in both APEC- and NDRV- infected liver and spleen. There was the similar trend in livers: reaching the peak at 2 dpi. At 3 dpi, the IL-10 expression level in APEC-infected spleen almost returned to the normal level but remained significantly up-regulated in NDRV-infected spleen. In the brain tissues, the expression level of IL-10 at 1 dpi and 2 dpi also barely changed, but it significantly upregulated at 3 dpi in the NDRV-infected brain. In contrast, the expression level of IL-10 in the brain of the APEC-infection group did not show significant changes at 1 to 3 dpi (Figure 10D and 10d). Secondly, we found that the transcription level of IFN-α and IFN-β also showed significant upregulation both in the APEC and NDRV infection groups (Figure 10E-F and Figure 10e-f). In summary, compared to the liver and spleen, the levels of changes in most of the aforementioned cytokines in the brain are relatively low (Figure 10). Analogously, transcription profiles of these cytokines in the NDRV-challenged group were relatively lower than those in the APEC-challenged group (Figure 10) Discussion This study aims to detect and explore the gene sequence and composition structure of du RIPK2, label the conserved sites related to activation, and draw a phylogenetic tree. Simultaneously, 1-week-old Cherry Valley ducks were selected to detect and summarize the distribution of du RIPK2 in different tissues. After inoculation, the clinical symptoms and pathological changes caused by AEPC and NDRV, the bacterial/viral loads, and the expression levels of du RIPK2 and inflammatory cytokines, in the liver, spleen, and brain, were analyzed and compared. Although the gene sequence of RIPK2 has been determined in human and mouse [ 39 , 40 ] , no relevant information on ducks RIPK2 has been reported. In this research, we first obtained the full length of du RIPK2’s gene sequence and determined the number of its encoded proteins (Fig. 1 ). Previous reports have indicated that RIPK2 has ubiquitination-related sites K209, phosphorylation sites S176 and Y474 [ 41 – 43 ] , which are associated with structural changes and activation events of RIPK2. K209 serves as a “handle” that engages the BIR2 domain of X-linked inhibitor of apoptosis protein, helping its C-terminal RING domain exert its E3 ubiquitin ligase activity so that ubiquitin is conjugated to the ubiquitination sites on RIPK2 [ 41 ] . And these above three functional sites also exist in the AA sequence of du RIPK2 that we detected (Fig. 1 ). In addition, we constructed a phylogenetic tree and found that du RIPK2 clusters with avian RIPK2s (Fig. 3 ). Sequence similarity analysis indicated that duRIPK2 shares 100% identity with Anas acuta RIPK2, over 90% identity with RIPK2s from birds, but only about 50%-70% with mammals and fish, and the lowest identity with Carassius auratus (Fig. 4 ). This indicates that Cherry Valley ducks can serve as an animal model for studying RIPK2 in birds. Moreover, we used the SMART tool to predict its protein structure, and the result clarifies that du RIPK2 has a characteristic C-terminal CARD of RIPKs, which is used to receive the related molecular pattern recognition signals from NOD1/2, and the N-terminal S-TKc to activate downstream related proteins and pathways (Fig. 2 ). Previous studies have illuminated that RIPK2 mRNA content is most in the bone marrow, followed by the spleen, blood, thymus and other tissues in chickens [ 44 ] , and it is abundantly expressed in human tissues, including the spleen, placenta, testis, and heart [ 45 ] . Nevertheless, the tissue distribution of duck RIPK2 has not been reported. In this research, we first detected that du RIPK2 shows a pattern of widespread expression in multiple tissues, high expression in "liver-muscle-trachea" and low expression in intestine (Fig. 5 ), indicating that du RIPK2 participates in systemic immunity. In this study, Cherry Valley ducks in the infected groups showed listlessness, ruffled feathers, and sluggish movement (Fig. 6 A and 6 E), which are consistent with the typical clinical manifestations of APEC and NDRV infection in poultry as reported previously [ 46 , 47 ] . Moreover, the examined tissues of APEC- and NDRV- challenged ducks all presented varying degrees of enlargement and hemorrhage (Fig. 6 ), which may be attributed to factors such as enhanced platelet adhesion and increased vascular permeability induced by various inflammatory mediators [ 48 , 49 ] . In terms of histopathological changes, both APEC and NDRV caused severe lesions in the tested organs, which can severely impair the growth and maturation of the host (Fig. 7 ). In our study, the APEC could rapidly replicate in the liver, spleen, and brain at 1dpi, and the bacterial load reached a peak in the spleen at 2 dpi (Fig. 8 A), further proving that APEC infection can cause damage to multiple organs of Cherry Valley ducks. In terms of RIPK2, previous research has manifested that bacterial invasion can significantly increase RIPK2 expression level [ 50 – 52 ] . In this study, we also observed a similar pattern of du RIPK2 changes in APEC-infected groups: it markedly increased in all tissues, especially in the spleen, where it was upregulated by 11 times at 1 dpi, and maintained the upward trend at 2dpi (Fig. 9 A). In the results of the determination of the expression levels of inflammatory factors, we detected that the transcriptional profiles of multiple ILs and IFNs were significantly upregulated in the liver and spleen, while the changes in the brain tissue were not such obvious in this study (Fig. 10 A-F). Similarly, multiple previous reports also indicated that bacterial infection can upregulate the expression of inflammatory factors via RIPK2 activation, inducing a cytokine storm and thereby triggering an inflammatory response. For instance, Zheng et al. discovered that after Streptococcus pneumoniae infects the host, NOD2 senses bacterial peptidoglycan and, via the NOD2-RIPK2 signal, activates NF-κB and triggers a cytokine storm, thereby upregulating the transcription of inflammatory cytokines [ 53 ] . In an epithelial cell model of Fusobacterium nucleatum infection, Wei et al. found that bacterial infection markedly up-regulated the expression of NOD1, RIPK2, and IL-1β. Knockdown of NOD1 significantly reduced RIPK2 levels, while inhibition of RIPK2 markedly decreased IL-1β expression, demonstrating that the NOD1–RIPK2 axis regulates IL-1β production [ 54 ] . Coincidentally, RIPK2 can directly or indirectly regulate the expression levels of IFN-α and IFN-β [ 20 ] . As a result, the simultaneous increase in APEC load, the expression levels of du RIPK2 and inflammatory cytokines at 1 dpi and 2 dpi in this experiment was in line with expectations. At 3 dpi, however, we observed that the APEC load showed a downward trend, and the up-regulation amplitude of du RIPK2 in both liver and spleen and inflammatory cytokines in spleen was significantly reduced, suggesting a key anti-bacterial role of du RIPK2 until 2 dpi, which has been pointed out by multiple studies: BIST et al. testified that knocking down the RIPK2 gene in acinetobacter baumannii infection can inhibit the release of inflammatory cytokines [ 55 ] , And overexpression of the RIPK2 gene can activate MAPK pathway and enhance apoptosis level in bacterial infected or damaged cells [ 56 ] . Consequently, all of the above together prove that du RIPK2 is vital in innate immunity defense against APEC infection. After NDRV invaded the body, it replicated extensively in the spleen and liver at 2 dpi (Fig. 8 B), which confirms the previous research indicating that the spleen and liver are the target tissues of NDRV [ 47 ] . The NDRV load in the brain remained relatively low (Fig. 8 B), suggesting that it might be because the existence of the blood-brain barrier has prevented a large amount of NDRV from invading [ 57 ] . Compared with the APEC infection group, the transcriptional level of du RIPK2 in NDRV-challenged ducks was significantly inhibited, the up-regulation amplitude of inflammatory factor expression levels was also much smaller, and at 3 dpi, the NDRV viral load in the liver and spleen still remained relatively high (Fig. 9 B). It has been reported that viral infection can stimulate the transcription process of RIPK2 but reduces the expression level of it [ 58 ] , In this way, the expression level of du RIPK2 was significantly upregulated during APEC infection and significantly downregulated during NDRV infection, and this resulted in substantial differences in the expression levels of inflammatory factors (Fig. 10 a-f), indicating that du RIPK2 constitutes a vital determinant of regulating inflammatory factors and triggering innate immune responses. This further indicates that du RIPK2 plays a significant role against bacterial and viral infections. The experimental results show that du RIPK2 exhibits a strong correlation with inflammatory cytokines in both bacterial and viral infections. Currently, immunotherapy for inflammatory diseases includes regulating the degree of inflammatory response [ 59 ] . Therefore, RIPK2 can serve as a potential entry point for immunotherapy. In this study, we confirmed the comparative analysis of the anti-bacterial and anti-viral functions of du RIPK2 in Cherry Valley ducks. Besides, we summarized the ORF of du RIPK2, predicted the protein structure, detected the transcriptional profiles in different tissues, and testified its role during APEC and NDRV infection in healthy Cherry Valley ducks. The research results indicate that du RIPK2 can significantly inhibit the replication of APEC and also serve as a potential target for the development of NDRV drugs. Declarations Ethics approval and consent to participate All ducks used in this experiment were handled according to the guidelines of the Ethics Committee on Animal Experiments of Qingdao Agricultural University and the appropriate biosecurity guidelines, the number of the approval protocol being “QAU-2025-007.” The study was conducted in accordance with the local legislation and institutional requirements. Consent for publication Not applicable. Availability of data and materials All data generated or analyzed during this study are included in this published article [and its supplementary information files]. Competing interests The authors declare that they have no competing interests. Funding The author(s) declare that financial support was received for the research and/or publication of this article. This work was supported by the Natural Science Foundation of Shandong Province, China (ZR2021QC093 and ZR2021QC007); Qingdao Agricultural University High-level Talents Research Fund (1122011 and 1120016). Authors’ contributions XJ offered methodology and wrote the original draft. RL reviewed and edited the article. SL offered methodology, reviewed and edited the article. WL reviewed and edited the article. ZC conducted formal Analysis, reviewed and edited the article. QP reviewed and edited the article. GL conceptualized the study, investigated the experiments, developed the methodology, provided resources, supervised the project, and reviewed and edited the article. All authors read and approved the final manuscript. Acknowledgements Not applicable. References Bauernfeind F G, Horvath G, Stutz A, et al. Cutting edge: NF-kappaB activating pattern recognition and cytokine receptors license NLRP3 inflammasome activation by regulating NLRP3 expression[J]. Journal of immunology (Baltimore, Md. : 1950), 2009,183(2):787-791. Lee M S, Kim Y. Signaling pathways downstream of pattern-recognition receptors and their cross talk[J]. Annual review of biochemistry, 2007,76:447-480. Inohara N, Nu Ez G. NODs: intracellular proteins involved in inflammation and apoptosis[J]. Nature reviews. Immunology, 2003,3(5):371-382. Inohara N, Koseki T, Lin J, et al. An induced proximity model for NF-kappa B activation in the Nod1/RICK and RIP signaling pathways[J]. The Journal of biological chemistry, 2000,275(36):27823-27831. Damgaard R B, Nachbur U, Yabal M, et al. The ubiquitin ligase XIAP recruits LUBAC for NOD2 signaling in inflammation and innate immunity[J]. Molecular cell, 2012,46(6):746-758. Meylan E, Tschopp J. The RIP kinases: crucial integrators of cellular stress[J]. Trends in biochemical sciences, 2005,30(3):151-159. Ayala-Aguilera C C, Valero T, Lorente-Macías Á, et al. Small Molecule Kinase Inhibitor Drugs (1995-2021): Medical Indication, Pharmacology, and Synthesis[J]. Journal of medicinal chemistry, 2022,65(2):1047-1131. Cohen P, Cross D, J Nne P A. Kinase drug discovery 20 years after imatinib[J]. Nature reviews. Drug discovery, 2022:10-1038. Ma D, Hu S, Wang C, et al. Discovery of Potent and Balanced Dual RIPK2 and 3 Inhibitors as a New Strategy for the Treatment of Inflammatory Bowel Diseases[J]. Journal of medicinal chemistry, 2025,68(7):7539-7559. McCarthy J V, Ni J, Dixit V M. RIP2 is a novel NF-kappaB-activating and cell death-inducing kinase[J]. The Journal of biological chemistry, 1998,273(27):16968-16975. Windheim M, Lang C, Peggie M, et al. Molecular mechanisms involved in the regulation of cytokine production by muramyl dipeptide[J]. The Biochemical journal, 2007,404(2):179-190. Gong Q, Long Z, Zhong F L, et al. Structural basis of RIP2 activation and signaling[J]. Nature communications, 2018,9(1):4993. Maharana J, Maharana D, Bej A, et al. Structural Elucidation of Inter-CARD Interfaces involved in NOD2 Tandem CARD Association and RIP2 Recognition[J]. The journal of physical chemistry. B, 2021,125(49):13349-13365. Thome M, Hofmann K, Burns K, et al. Identification of CARDIAK, a RIP-like kinase that associates with caspase-1[J]. Current biology : CB, 1998,8(15):885-888. Navas T A, Baldwin D T, Stewart T A. RIP2 is a Raf1-activated mitogen-activated protein kinase kinase[J]. The Journal of biological chemistry, 1999,274(47):33684-33690. McCully M L, Fairhead T, Colmont C S, et al. Receptor-interacting protein-2 deficiency delays macrophage migration and increases intracellular infection during peritoneal dialysis-associated peritonitis[J]. American journal of nephrology, 2008,28(6):879-889. Kobayashi K, Inohara N, Hernandez L D, et al. RICK/Rip2/CARDIAK mediates signalling for receptors of the innate and adaptive immune systems[J]. Nature, 2002,416(6877):194-199. Balamayooran T, Batra S, Balamayooran G, et al. Receptor-interacting protein 2 controls pulmonary host defense to Escherichia coli infection via the regulation of interleukin-17A[J]. Infection and immunity, 2011,79(11):4588-4599. Shimada K, Chen S, Dempsey P W, et al. The NOD/RIP2 pathway is essential for host defenses against Chlamydophila pneumoniae lung infection[J]. PLoS pathogens, 2009,5(4):e1000379. Sun H, Cao Y, Yang Y, et al. Analysis of miRNA Expression Profiling of RIP2 Knockdown in Chicken HD11 Cells When Infected with Avian Pathogenic E. coli (APEC)[J]. International journal of molecular sciences, 2022,23(13):7319. Guabiraba R, Schouler C. Avian colibacillosis: still many black holes[J]. FEMS microbiology letters, 2015,362(15):fnv118. Lutful Kabir S M. Avian colibacillosis and salmonellosis: a closer look at epidemiology, pathogenesis, diagnosis, control and public health concerns[J]. International journal of environmental research and public health, 2010,7(1):89-114. Logue C M, Wannemuehler Y, Nicholson B A, et al. Comparative Analysis of Phylogenetic Assignment of Human and Avian ExPEC and Fecal Commensal Escherichia coli Using the (Previous and Revised) Clermont Phylogenetic Typing Methods and its Impact on Avian Pathogenic Escherichia coli (APEC) Classification[J]. Frontiers in microbiology, 2017,8:283. Dou X, Gong J, Han X, et al. Characterization of avian pathogenic Escherichia coli isolated in eastern China[J]. Gene, 2016,576(1 Pt 2):244-248. Gyles C L. Antimicrobial resistance in selected bacteria from poultry[J]. Animal health research reviews, 2008,9(2):149-158. Ghunaim H, Abu-Madi M A, Kariyawasam S. Advances in vaccination against avian pathogenic Escherichia coli respiratory disease: potentials and limitations[J]. Veterinary microbiology, 2014,172(1-2):13-22. Sandford E E, Orr M, Balfanz E, et al. Spleen transcriptome response to infection with avian pathogenic Escherichia coli in broiler chickens[J]. BMC genomics, 2011,12:469. Sandford E E, Orr M, Shelby M, et al. Leukocyte transcriptome from chickens infected with avian pathogenic Escherichia coli identifies pathways associated with resistance[J]. Results in immunology, 2012,2:44-53. Sun H, Liu P, Nolan L K, et al. Avian pathogenic Escherichia coli (APEC) infection alters bone marrow transcriptome in chickens[J]. BMC genomics, 2015,16(1):690. Sun H, Liu P, Nolan L K, et al. Novel Pathways Revealed in Bursa of Fabricius Transcriptome in Response to Extraintestinal Pathogenic Escherichia coli (ExPEC) Infection[J]. PloS one, 2015,10(11):e142570. Chen S, Chen S, Lin F, et al. The isolation and identification of novel duck reovirus[J]. Bing du xue bao = Chinese journal of virology, 2012,28(3):224-230. Wang H, Gao B, Liu X, et al. Pathogenicity of a variant duck orthoreovirus strain in Cherry Valley Ducklings[J]. Veterinary microbiology, 2020,242:108546. Lupfer C, Thomas P G, Anand P K, et al. Receptor interacting protein kinase 2-mediated mitophagy regulates inflammasome activation during virus infection[J]. Nature immunology, 2013,14(5):480-488. Li R, Li N, Zhang J, et al. Expression of Immune-Related Genes of Ducks Infected with Avian Pathogenic Escherichia coli (APEC)[J]. Frontiers in microbiology, 2016,7:637. Dho M, Lafont J P. Adhesive properties and iron uptake ability in Escherichia coli lethal and nonlethal for chicks[J]. Avian diseases, 1984,28(4):1016-1025. Li N, Hong T, Wang Y, et al. The pathogenicity of novel duck reovirus in Cherry Valley ducks[J]. Veterinary microbiology, 2016,192:181-185. Burland T G. DNASTAR's Lasergene sequence analysis software[J]. Methods in molecular biology (Clifton, N.J.), 2000,132:71-91. Livak K J, Schmittgen T D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method[J]. Methods (San Diego, Calif.), 2001,25(4):402-408. Cole C G, McCann O T, Collins J E, et al. Finishing the finished human chromosome 22 sequence[J]. Genome biology, 2008,9(5):R78. Yue F, Cheng Y, Breschi A, et al. A comparative encyclopedia of DNA elements in the mouse genome[J]. Nature, 2014,515(7527):355-364. Lethier M, Huard K, Hons M, et al. Structure shows that the BIR2 domain of E3 ligase XIAP binds across the RIPK2 kinase dimer interface[J]. Life science alliance, 2023,6(11):e202201784. Wei K, Zhou C, Shu Z, et al. MYSM1 attenuates osteoarthritis by recruiting PP2A to deubiquitinate and dephosphorylate RIPK2[J]. Bone research, 2025,13(1):3. Ellwanger K, Briese S, Arnold C, et al. XIAP controls RIPK2 signaling by preventing its deposition in speck-like structures[J]. Life science alliance, 2019,2(4):e201900346. Hong-Yan S, Huan L, Ye-Xin Y, et al. Transcriptome alterations in chicken HD11 cells with steady knockdown and overexpression of RIPK2 gene[J]. Poultry science, 2023,102(1):102263. Tian E, Zhou C, Quan S, et al. RIPK2 inhibitors for disease therapy: Current status and perspectives[J]. European journal of medicinal chemistry, 2023,259:115683. Tan M, Tan J, Fang S, et al. Pathogenicity and identification of host adaptation genes of the avian pathogenic Escherichia coli O145 in duck[J]. Frontiers in cellular and infection microbiology, 2024,14:1453907. Yu K, Ti J, Lu X, et al. Novel duck reovirus exhibits pathogenicity to specific pathogen-free chickens by the subcutaneous route[J]. Scientific reports, 2021,11(1):11769. Lentsch A B, Ward P A. Regulation of inflammatory vascular damage[J]. The Journal of pathology, 2000,190(3):343-348. Gando S, Wada T. Thromboplasminflammation in COVID-19 Coagulopathy: Three Viewpoints for Diagnostic and Therapeutic Strategies[J]. Frontiers in immunology, 2021,12:649122. Geddes K, Rubino S, Streutker C, et al. Nod1 and Nod2 regulation of inflammation in the Salmonella colitis model[J]. Infection and immunity, 2010,78(12):5107-5115. Shehat M G, Cardona O A, Aranjuez G F, et al. RIP2 promotes FcγR-mediated reactive oxygen species production[J]. The Journal of biological chemistry, 2019,294(26):10365-10378. Frutuoso M S, Hori J I, Pereira M S F, et al. The pattern recognition receptors Nod1 and Nod2 account for neutrophil recruitment to the lungs of mice infected with Legionella pneumophila[J]. Microbes and infection, 2010,12(11):819-827. Zheng Y, Shang F, An L, et al. NOD2-RIP2 contributes to the inflammatory responses of mice in vivo to Streptococcus pneumoniae[J]. Neuroscience letters, 2018,671:43-49. Wei Z, Bao L, Li B, et al. Fusobacterium nucleatum promotes anastomotic leakage by activating epithelial cells through the NOD1/RIPK2/ERK signalling pathway to drive IL-1β-induced neutrophil chemotaxis and collagen degradation[J]. Clinical and translational medicine, 2025,15(3):e70262. Bist P, Dikshit N, Koh T H, et al. The Nod1, Nod2, and Rip2 axis contributes to host immune defense against intracellular Acinetobacter baumannii infection[J]. Infection and immunity, 2014,82(3):1112-1122. Goh F Y, Cook K L T P, Upton N, et al. Receptor-interacting protein 2 gene silencing attenuates allergic airway inflammation[J]. Journal of immunology (Baltimore, Md. : 1950), 2013,191(5):2691-2699. Pandit R, Chen L, G Tz J. The blood-brain barrier: Physiology and strategies for drug delivery[J]. Advanced drug delivery reviews, 2020,165-166:1-14. Liu H, Xue Q, Zhu Z, et al. Foot-and-Mouth Disease Virus Inhibits RIP2 Protein Expression to Promote Viral Replication[J]. Virologica Sinica, 2021,36(4):608-622. McInnes I B, Gravallese E M. Immune-mediated inflammatory disease therapeutics: past, present and future[J]. Nature reviews. Immunology, 2021,21(10):680-686. Tables Table 1 Primers employed in test Primer name Sequence (5’-3’) Purpose du RIPK2-F CAAGCTCCTGGCCGAGAC Gene cloning du RIPK2-R CCAAATGCAGCCTAGATG q- du RIPK2-F CCATTGCTGCACCATGACTT qRT-PCR q- du RIPK2-R GCGTGATTGCGACATGGATA q- du β-actin-F GGTATCGGCAGCAGTCTTA qRT-PCR q- du β-actin-R TTCACAGAGGCGAGTAACTT q- du IL1β-F TCATCTTCTACCGCCTGGAC qRT-PCR q- du IL1β-R GTAGGTGGCGATGTTGACCT q- du IL2-F GCCAAGAGCTGACCAACTTC qRT-PCR q- du IL2-R ATCGCCCACACTAAGAGCAT q- du IL6-F TTCGACGAGGAGAAATGCTT qRT-PCR q- du IL6-R CCTTATCGTCGTTGCCAGAT q- du IL10-F GCCTCCACTTGTCTGACCTC qRT-PCR q- du IL10-R CCTCCATGTAGAACCGCATC q- du IFNα-F TCCTCCAACACCTCTTCGAC qRT-PCR q- du IFNα-R GGGCTGTAGGTGTGGTTCTG q- du IFNβ-F AGATGGCTCCCAGCTCTACA qRT-PCR q- du IFNβ-R AGTGGTTGAGCTGGTTGAGG F, forward primer; R, reverse primer; q, qRT-PCR. Table 2 RIPK2s employed in phylogenetic tree Species GenBank accession numbers Ovibos moschatus XER92221.1 Bos taurus NP 001029782.1 Sus scrofa QCO69316.1 Homo sapiens AAC27722.1 Gulo gulo luscus UQT06239.1 Ictidomys tridecemlineatus P XP 005328693.1 Callospermophilus lateralis P XP 076691774.1 Rattus norvegicus NP 001178794.1 Mus musculus AAL96436.1 Gallus gallus X1 NP 001026114.1 Gallus gallus X2 NP 001383534.1 Anser cygnoides P XP 066846679.1 Anas platyrhynchos P XP 027308245.1 Anas acuta P XP 068528328.1 Larimichthys crocea WRW50915.1 Gasterosteus aculeatus P XP 040026812.2 Maylandia zebra P XP 004570558.1 Ictalurus punctatus WBW48352.1 Brachyhypopomus gauderio P XP 076828097.1 Danio rerio NP 919392.3 Ctenopharyngodon idella AYN79345.1 Carassius auratus AJG06856.1 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8719745","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":591619869,"identity":"f23e7613-d112-4461-ba34-8ac94de037ed","order_by":0,"name":"Xiaocui Jiang","email":"","orcid":"","institution":"Qingdao Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Xiaocui","middleName":"","lastName":"Jiang","suffix":""},{"id":591619870,"identity":"e15b2a2b-10fa-4e83-a302-4f77e489e8d3","order_by":1,"name":"Rong Li","email":"","orcid":"","institution":"Qingdao Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Rong","middleName":"","lastName":"Li","suffix":""},{"id":591619871,"identity":"cfce8e1c-0b63-40b8-9d76-c8bd8d517145","order_by":2,"name":"Shuo Li","email":"","orcid":"","institution":"Yantai Penglai District Xiaomenjia Animal Husbandry and Veterinary Station, the government office of Xiaomenjia Town","correspondingAuthor":false,"prefix":"","firstName":"Shuo","middleName":"","lastName":"Li","suffix":""},{"id":591619872,"identity":"ba7a4d12-8ec6-4104-b5a7-99db25dde441","order_by":3,"name":"Wenhao Li","email":"","orcid":"","institution":"Yantai Penglai District Xiaomenjia Animal Husbandry and Veterinary Station, the government office of Xiaomenjia Town","correspondingAuthor":false,"prefix":"","firstName":"Wenhao","middleName":"","lastName":"Li","suffix":""},{"id":591619873,"identity":"523e821d-846d-4e40-8e9a-aaaf00589ced","order_by":4,"name":"Zhi Cao","email":"","orcid":"","institution":"Qingdao Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Zhi","middleName":"","lastName":"Cao","suffix":""},{"id":591619874,"identity":"2c989833-3d7e-4783-bba1-0b961c2229d1","order_by":5,"name":"Qing Pan","email":"","orcid":"","institution":"Qingdao Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Qing","middleName":"","lastName":"Pan","suffix":""},{"id":591619875,"identity":"49c07351-741e-4fff-ac93-afbac83ca913","order_by":6,"name":"Gen Li","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAvElEQVRIiWNgGAWjYBACPmYQWQHhSBClhQ2s5QxJWkAEYxtJWtjZLz4unGctb3CA+eBtHga7PCIcxlNsPHNbuuGGA2zJ1jwMycXEaEmT5t12mHHDAR4zaR6GA4kNRGhJ/80757D9hgP834jVwn6MmbfhcCLQFjaibWGW5jmWnjzzMJux5RyDZMJa+PmPP/zMU2Nt23e8+eGNNxV2hLUwMPAYAAlmMGJgMCCsHgjYHzBA1Y+CUTAKRsEowA4A0asx5DwQ17MAAAAASUVORK5CYII=","orcid":"","institution":"Qingdao Agricultural University","correspondingAuthor":true,"prefix":"","firstName":"Gen","middleName":"","lastName":"Li","suffix":""}],"badges":[],"createdAt":"2026-01-28 11:08:25","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8719745/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8719745/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":102755133,"identity":"b0bb15ee-430c-4e6d-b4ad-d9325856a75c","added_by":"auto","created_at":"2026-02-16 09:41:56","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1917860,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eRIPK2s’ AA sequence alignment.\u003c/strong\u003e Black highlighted parts represent the completely identical AA among RIPK2s of different species; gray highlighted parts represent that AA of RIPK2s from different species have more than 50% similarity. AA within the blue line range constitutes the S-TKc domain; AA within the red line range constitutesthe CARD domain. Du= Cherry Valley duck; Ga = \u003cem\u003eGallus gallus\u003c/em\u003e; Ho = \u003cem\u003eHomo sapiens\u003c/em\u003e, Mu, = \u003cem\u003eMus musculus.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8719745/v1/4a02f4c3e1b9486a8c233b5f.png"},{"id":102755138,"identity":"2ad31fc5-e1a2-4370-acec-8147c6156b9a","added_by":"auto","created_at":"2026-02-16 09:41:57","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":112039,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eProtein structure of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003edu\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eRIPK2.\u003c/strong\u003e \u003cem\u003eDu\u003c/em\u003eRIPK2 owns the S-TKc domain (26-296aa) and the CARD domain (457-541aa).\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8719745/v1/21e6ebed07508017665ba1c1.png"},{"id":102755113,"identity":"6da35bc1-17fd-46e2-bcb7-c45474369bae","added_by":"auto","created_at":"2026-02-16 09:41:44","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":318455,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe phylogenetic tree of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003edu\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eRIPK2 and RIPK2s from other species.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8719745/v1/ac7190486cfe0726b84b56de.png"},{"id":102755137,"identity":"ac8b113d-4344-45ce-bb52-b485fb68cc6d","added_by":"auto","created_at":"2026-02-16 09:41:57","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":754413,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSequence similarity analysis of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003edu\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eRIPK2 and RIPK2s from other species.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-8719745/v1/ff66300d0bf3951e9618cfed.png"},{"id":102755125,"identity":"2c1eef4d-5aaf-4870-a1c5-70ea7c48730c","added_by":"auto","created_at":"2026-02-16 09:41:50","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":242574,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTissue distributions of\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e du\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eRIPK2.\u003c/strong\u003e Transcript levels of \u003cem\u003edu\u003c/em\u003eRIPK2 were normalized to β-actin and expressed relative to ileum (2\u003csup\u003e−△△Ct\u003c/sup\u003e method), values are means ± SD of three biological replicates.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-8719745/v1/934f07e1e3c59bfdbebf2a95.png"},{"id":102755080,"identity":"367a8256-4608-4966-8ebd-805db018d4f2","added_by":"auto","created_at":"2026-02-16 09:41:33","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":371242,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eClinical signs and Gross lesions of the APEC- and NDRV-infected ducks. (A) \u003c/strong\u003eClinical signs of APEC-infected ducks;\u003cstrong\u003e(B-D) \u003c/strong\u003eGross lesions in examined tissues of APEC-infected ducks; (\u003cstrong\u003eE) \u003c/strong\u003eClinical signs of NDRV-infected ducks; \u003cstrong\u003e(F-H)\u003c/strong\u003eGross lesions in examined tissues of NDRV-infected ducks.\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-8719745/v1/af3b44b07081447e464e660d.png"},{"id":102755115,"identity":"bee8a24f-53f5-422b-bd15-f5954d8487e9","added_by":"auto","created_at":"2026-02-16 09:41:45","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":1126490,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHistopathological changes of examined tissues in the APEC- and NDRV-infected ducks.\u003c/strong\u003e \u003cstrong\u003e(A–C)\u003c/strong\u003e Histopathological changes of examined tissues from the control group; \u003cstrong\u003e(D–F)\u003c/strong\u003e Histopathological changes of examined tissues during APEC infection \u003cstrong\u003e(G-I)\u003c/strong\u003e Histopathological changes of examined tissues during NDVR infection; Magnification 400×.\u003c/p\u003e","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-8719745/v1/e3f2cc10fa9421528ac82afb.png"},{"id":102755079,"identity":"1f279111-075b-4d2b-b1dd-7141de94ae55","added_by":"auto","created_at":"2026-02-16 09:41:32","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":143888,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eChanges in bacterial or viral content. (A) \u003c/strong\u003eBacteria content of APEC-infected ducks’ samples. \u003cstrong\u003e(B)\u003c/strong\u003e NDRV loads of NDRV-infected ducks’ samples. Bar represents the mean ± standard deviation (n=3) and each sample was analyzed in triplicate; dpi, days post-infection.\u003c/p\u003e","description":"","filename":"floatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-8719745/v1/1c8512111c75bd1180ad6b86.png"},{"id":102755112,"identity":"68839561-3b38-4183-ae81-24a2bd16ea44","added_by":"auto","created_at":"2026-02-16 09:41:44","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":148438,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAnalysis of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003edu\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eRIPK2 transcriptional profiles in APEC and NDRV infection.\u003c/strong\u003e \u003cstrong\u003e(A) \u003c/strong\u003eExpression levels of \u003cem\u003edu\u003c/em\u003eRIPK2 during APEC infection, \u003cstrong\u003e(B)\u003c/strong\u003e Expression levels of \u003cem\u003edu\u003c/em\u003eRIPK2 during NDRV infection. Bar represents the mean ± standard deviation (n=3) and each sample was analyzed in triplicate; Reference is control ducks at the same timepoint, Date is processed using the 2\u003csup\u003e−△△Ct\u003c/sup\u003e method.; differences were evaluated by Two-way ANOVA, followed by Tukey's multiple comparisons test. ***, 0.0001 ≤ \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001, ****, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.0001; dpi, days post-infection.\u003c/p\u003e","description":"","filename":"floatimage9.png","url":"https://assets-eu.researchsquare.com/files/rs-8719745/v1/ed17298f3d12a44101d23ff9.png"},{"id":102755116,"identity":"b1a0e650-f5af-443b-a707-a807feac2c9e","added_by":"auto","created_at":"2026-02-16 09:41:46","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":182804,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAnalysis of inflammatory cytokines transcriptional profiles in APEC and NDRV infection. (A-F) \u003c/strong\u003eThe expression levels of inflammatory cytokines in the APEC-infection, \u003cstrong\u003e(A)\u003c/strong\u003e IL-1β \u003cstrong\u003e(B)\u003c/strong\u003e IL-2, \u003cstrong\u003e(C)\u003c/strong\u003e IL-6, \u003cstrong\u003e(D)\u003c/strong\u003e IL-10, \u003cstrong\u003e(E)\u003c/strong\u003e IFN-α, \u003cstrong\u003e(F)\u003c/strong\u003e IFN-β; \u003cstrong\u003e(a-f) \u003c/strong\u003eThe expression levels of inflammatory cytokines in the NDRV-infection, \u003cstrong\u003e(a)\u003c/strong\u003e IL-1β \u003cstrong\u003e(b)\u003c/strong\u003e IL-2, \u003cstrong\u003e(c)\u003c/strong\u003e IL-6, \u003cstrong\u003e(d)\u003c/strong\u003e IL-10, \u003cstrong\u003e(e)\u003c/strong\u003e IFN-α, \u003cstrong\u003e(f)\u003c/strong\u003e IFN-β. Bar represents the mean ± standard deviation (n=3) and each sample was analyzed in triplicate; Reference is control ducks at the same timepoint; Date is processed using the 2\u003csup\u003e−△△Ct\u003c/sup\u003e method.; differences were evaluated by Two-way ANOVA, followed by Tukey's multiple comparisons test. *, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, **, 0.001 ≤ \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, ***, 0.0001 ≤ \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001, ****, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.0001; dpi, days post-infection.\u003c/p\u003e","description":"","filename":"floatimage10.png","url":"https://assets-eu.researchsquare.com/files/rs-8719745/v1/5d56e53aa92f0bde0e745637.png"},{"id":104397193,"identity":"86d536dd-2ef5-4c3a-9f2e-8ff02a884f80","added_by":"auto","created_at":"2026-03-11 11:43:04","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":6493791,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8719745/v1/bdc58660-36ee-40a2-9c3a-d8b97d6957e8.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Cloning, characterization and comparative innate immune functions of duRIPK2 in Cherry Valley duck against APEC and NDRV","fulltext":[{"header":"Introduction","content":"\u003cp\u003eInnate immunity operates as the frontline barrier against pathogenic microbial invasion. It rapidly recognizes pathogenic microorganisms\u0026rsquo; pathogen- and damage- associated molecular patterns via pattern recognition receptors (PRRs), and activates relevant pathways to trigger the release of various interferons, interleukins, or chemokines, thereby eliminating infected or damaged cells\u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]\u003c/sup\u003e. The nucleotide-binding oligomerization domain-like receptors (NLRs) include nucleotide-binding oligomerization domain-containing protein (NOD) 1 and NOD2, etc.\u003csup\u003e[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]\u003c/sup\u003e, and they can recognize peptidoglycan upon bacterial infection, and recruit receptor-interacting protein kinase 2 (RIPK2)\u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]\u003c/sup\u003e ,which can transmit cell signals, activate nuclear factor (NF)-κB and involve mitogen-activated protein kinase (MAPK) pathway, thereby adjusting the host's innate immunity system\u003csup\u003e[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eRIPKs act as pivotal regulators in inflammatory and cell death signaling pathway. So far, there have been discovered 7 types of RIPKs, among which RIPK2 is included, and they share a highly similar N-terminal kinase domain (KD) with the major differences lying in the distinct C-terminal structures\u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e. KD is the determinant for RIPKs to exert their kinase activity, and RIPKs are activated by autophosphorylation at sites within the KD and then relay signals downstream. A variety of kinase inhibitors currently achieve the goal of alleviating inflammatory responses and reducing tissue damage by competitively or allosterically targeting the KD\u003csup\u003e[\u003cspan additionalcitationids=\"CR8\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e. RIPK2, as known as RIP2, RICK, CARD3, CCK, or CARDIAK, is a 61-kDa serine/threonine kinase, and it has higher abundant in human spleen, peripheral-blood leukocytes, placenta, testis, and heart\u003csup\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e. RIPK2 contains a bridging domain in its middle region, a caspase activation and recruitment domain (CARD) at its C-terminus, and a KD at its N-terminus that regulates RIPK2 phosphorylation and ubiquitylation\u003csup\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]\u003c/sup\u003e. Upon detecting bacterial peptidoglycan, NOD1/2 engage RIPK2 through a CARD-CARD homotypic interaction to transmit a signal\u003csup\u003e[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e. This signal leads to RIPK2\u0026rsquo;s phosphorylation and ubiquitylation to trigger the activation of NF-κB and MAPK pathway: Activated NF-κB moves into the nucleus, and adjusts transcription of multiple cytokines and antimicrobial peptide genes; activated MAPK pathway terminal kinases, covering c-Jun N-terminal kinase, extracellular signal-regulated kinase 2 and p38 mitogen-activated protein kinase, phosphorylate multiple downstream substrates, and regulate cellular behavior\u003csup\u003e[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eGrowing evidence has revealed RIPK2 as a critical defender against various bacterial infections. In the absence of RIPK2, host cells exhibit a markedly reduced capacity to eliminate bacteria: In a murine model of \u003cem\u003eStaphylococcus aureus\u003c/em\u003e infection, RIPK2\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice show delayed peritoneal-macrophage emigration, diminished intracellular bacterial clearance, and lower secretion of pro-inflammatory mediators\u003csup\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e. Similarly, \u003cem\u003eListeria monocytogenes\u003c/em\u003e infection leads to decreased tumor necrosis factor and interleukin (IL)-6 production by RIPK2-deficient macrophages\u003csup\u003e[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e, and in models of \u003cem\u003eEscherichia coli\u003c/em\u003e and \u003cem\u003eChlamydophila pneumoniae\u003c/em\u003e infection, RIPK2\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice both display significantly compromised bacterial clearance\u003csup\u003e[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/sup\u003e. Studies have illuminated that stimulation with avian pathogenic \u003cem\u003eEscherichia coli\u003c/em\u003e (APEC) upregulates RIPK2 expression, enhances apoptosis, and suppresses cell viability. Knockdown of RIPK2 significantly alleviates the APEC infection-mediated suppression of cell viability and attenuates apoptosis\u003csup\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e. RIPK2's antibacterial mechanism in human and mouse models has come under intensive scrutiny, but research on the antibacterial function of RIPK2 in birds is scarce.\u003c/p\u003e \u003cp\u003eAPEC, as an extraintestinal pathogen, can cause colibacillosis in poultry, manifesting as pericarditis, perihepatitis, septicaemia, airsacculitis, and meningitis. These pathologies impair bird welfare, reduce egg output, prolong broiler time-to-market, and raise production costs, inflicting substantial economic losses on the poultry industry\u003csup\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/sup\u003e. Extensive homology and parallel evolutionary trajectories exist between avian and human pathogenic \u003cem\u003eEscherichi coli\u003c/em\u003e isolates, underscoring the zoonotic potential of APEC\u003csup\u003e[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]\u003c/sup\u003e. Intensified investigation of APEC biology and the host immune response is imperative for both animal and public health. Most APEC isolates are multidrug-resistant, rendering antibiotic-based prophylaxis and therapy increasingly ineffective\u003csup\u003e[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]\u003c/sup\u003e, and the extensive serotypic diversity of APEC has also hampered the development of a universal vaccine\u003csup\u003e[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/sup\u003e. Studies have confirmed that, in APEC-infected chickens, RIPK2 is markedly up-regulated in bone marrow, thymus, bursa of Fabricius, leukocytes, and spleen\u003csup\u003e[\u003cspan additionalcitationids=\"CR28 CR29\" citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]\u003c/sup\u003e, and whole transcriptome analysis clarified that the NLRs signaling pathway and its core gene RIPK2 are common transcriptional immune responses to APEC stimulation\u003csup\u003e[\u003cspan additionalcitationids=\"CR28\" citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]\u003c/sup\u003e. Exploiting this immune signature through genetic improvement consequently holds great promise for enhancing poultry resistance to APEC infection.\u003c/p\u003e \u003cp\u003eMore and more studies have manifested that RIPK2 not only mediates the inflammatory response triggered by bacterial infection but also participates in the immune defense against viral infection. Studies have manifested that it can mediate the response to influenza virus A infection\u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e. Novel duck reovirus (NDRV), classified within the family \u003cem\u003eReoviridae\u003c/em\u003e, is a non-enveloped virus possessing an icosahedral capsid. NDRV possesses a segmented double-stranded RNA genome that encodes viral functional proteins. Its genome contains 43\u0026ndash;46 kilobase pairs, encapsidated within virions 60\u0026ndash;85 nm in diameter\u003csup\u003e[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]\u003c/sup\u003e. NDRV infection produces depression, complete anorexia, watery diarrhoea, and hepatic mottling and haemorrhage together with splenic haemorrhagic necrosis, and induced clinical signs are most severe and mortality highest in ducklings aged 1\u0026ndash;10 days, and it inflicts substantial economic losses on the poultry industry\u003csup\u003e[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]\u003c/sup\u003e. Studies have demonstrated that NOD2 senses viral RNA and activates RIPK2 to launch mitophagy, dampen inflammasome activity, and curb IL-18, IFN-γ, and chemokines, thereby alleviating tissue damage from inflammation\u003csup\u003e[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]\u003c/sup\u003e. As a result, the regulation of the RIPK2 gene for controlling avian-susceptible viral infections represents a feasible and scientifically meaningful strategy.\u003c/p\u003e \u003cp\u003eInnate immunity relies on the NLRs-RIPK2 signaling axis to trigger inflammatory response. In this research, we aim to clarify the regulatory role of duRIPK2 in defense against APEC and NDRV Infections, providing a precision target for intervention in avian bacterial or viral infections and a certain reference for regulating RIPK2 activity as a new prevention and control strategy to curb excessive inflammation and reduce economic losses in the aquaculture industry.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003e\u003cstrong\u003eAnimals, bacterial and viral strains\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe APEC strains used in this study have been employed in our previous research\u003csup\u003e[34]\u003c/sup\u003e. It was grown in LB-Miller broth for 18h at 37℃.1\u0026times;10\u003csup\u003e8\u0026nbsp;\u003c/sup\u003ecolony-forming units (CFU)/mL APEC phosphate-buffered saline (PBS) suspension was prepared\u0026nbsp;\u003csup\u003e[35]\u003c/sup\u003e. NDRV strains were isolated from the spleen of clinically diseased ducks. After the virus titer was determined, the viral suspension was diluted with PBS to 10\u003csup\u003e4.5\u003c/sup\u003e TCID\u003csub\u003e50\u003c/sub\u003e/mL\u003csup\u003e[36]\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eTo establish APEC- and NDRV- infection models with Cherry Valley ducks, we purchased one-day-old ducks from Weifang, Shandong, and acclimatized them for one week. After seronegativity to both APEC and NDRV was verified by enzyme-linked immunosorbent assays, three groups (n = 30 each) were set: APEC-challenged ducks were\u0026nbsp;subcutaneously inoculated with 0.2 mL of 1\u0026times;10\u003csup\u003e8\u0026nbsp;\u003c/sup\u003eCFU/mL APEC suspension in the neck; NDRV-challenged ducks were intramuscularly injected with 0.2mL 10\u003csup\u003e4.5\u003c/sup\u003e TCID\u003csub\u003e50\u003c/sub\u003e/mL NDRV suspension; the control group was intramuscularly injected with 0.2mL PBS. Liver, spleen, and brain of ducks in three groups were collected at 1-, 2-, and 3-days post-infection (dpi). One portion of each tissue was fixed in 4 % formalin at 25\u0026deg;C for pathological sections and the remainder was stored at -70 \u0026deg;C for gene-expression analyses, and microbial load quantification.\u003c/p\u003e\n\u003cp\u003eTo profile the tissue distribution of \u003cem\u003edu\u003c/em\u003eRIPK2, three healthy Cherry Valley ducks were used and the following 20 tissues were collected: heart, liver, spleen, lung, kidney, brain, cerebellum, thymus, bursa of Fabricius, esophagus, trachea, duodenum, jejunum, ileum, cecum, rectum, gizzard, proventriculus, skin, and muscle.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAll remaining ducks were euthanized with an overdose of sodium pentobarbital.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRNA Extraction and cloning of \u003cem\u003edu\u003c/em\u003eRIPK2\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA extraction was performed using the BioFlux Total RNA Extraction Kit (BioFlux, Hangzhou, China). After RNA concentration and quality were confirmed, reverse transcription was performed using ReverTra Ace\u0026reg; qPCR RT Master Mix with gDNA Remover (TOYOBO, Osaka, Japan).\u003c/p\u003e\n\u003cp\u003eFull-length \u003cem\u003edu\u003c/em\u003eRIPK2 was amplified with polymerase chain reaction (PCR) primers (Table 1) designed according to the predicted\u0026nbsp;\u003cem\u003eAnas platyrhynchos\u003c/em\u003e RIPK2 sequence recorded in the National Center for Biotechnology Information (NCBI, https://www.ncbi.nlm.nih.gov/) database. PCR setting was as follows: 94\u0026nbsp;℃\u0026nbsp;5 min; 35 \u0026times; (94\u0026nbsp;℃\u0026nbsp;30 s, 57\u0026nbsp;℃\u0026nbsp;30 s, 72\u0026nbsp;℃\u0026nbsp;4 min); 72\u0026nbsp;℃\u0026nbsp;10 min. Following electrophoresis on 1 % agarose gels, the target PCR products were excised and cleaned up with the Gel Extraction Kit from CWBIO (Beijing, China), and sent to Sangon Biotech (Shanghai, China) for sequencing, and the sequence analysis was performed using Editseq, DNAStar Lasergene\u003csup\u003e[37]\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSequence and phylogenetic analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo construct a phylogenetic tree for \u003cem\u003edu\u003c/em\u003eRIPK2, the obtained sequence was imported into the BLAST tool of the NCBI website, and RIPK2 amino acid (AA) sequences from various species were retrieved (Table 2). AA sequence alignments were performed using ClustalX2 and BoxShade software. The phylogenetic tree of duRIPK2 was constructed using MEGA 11.0 software by the Neighbor-joining method over 1000 replicates. The functional domains of \u003cem\u003edu\u003c/em\u003eRIPK2 were predicted according to its AA sequence by the SMART tool (http://smart.embl-heidelberg.de/).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAntibacterial and antiviral activity of \u003cem\u003edu\u003c/em\u003eRIPK2\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo investigate the relationship between pathogenic microorganisms and \u003cem\u003edu\u003c/em\u003eRIPK2 during bacterial and viral infection, three ducks per experiment group were randomly selected at each timepoint. Liver, spleen and brain were collected, weighed, and homogenized with PBS. The grinding products were centrifuged at 1000 \u0026times; g for 5 min to collect the supernatant. The plate count method was used to quantify the colonies. The liver, spleen, and brain grinding products of three randomly selected ducks from each experiment group at each timepoint were collected by the same method. The extraction and reverse transcription of NDRV RNA were performed as described. To investigate the NDRV load in each tissue during infection, the reverse-transcribed product and the NDRV quantification standard were amplified using the TOROGreen\u003csup\u003e\u0026reg;\u003c/sup\u003e qPCR Master Mix (TOROIVD, Shanghai, China) and the Archimed X4 Real-Time qPCR System (Rocgene, Beijing, China) with the qPCR setting: 95 ℃\u0026nbsp;5 min; 40 \u0026times; (95\u0026nbsp;℃\u0026nbsp;10 s, 60\u0026nbsp;℃\u0026nbsp;34 s). The NDRV load in each tissue at each timepoint was calculated from the standard curve. Each sample was assayed in three technical replicates and represented as mean\u0026nbsp;\u0026plusmn;\u0026nbsp;SD.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInflammatory cytokines regulation activity of \u003cem\u003edu\u003c/em\u003eRIPK2\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo investigate the relationship between inflammatory cytokines and \u003cem\u003edu\u003c/em\u003eRIPK2 during bacterial and viral infection, the supernatant of liver, spleen, and brain from three randomly selected ducks in each experiment group was collected using the previously described method, and treated using the RNA extraction and reverse transcription methods mentioned above.\u0026nbsp;Quantitative Real Time PCR (qRT-PCR) was performed using the TOROGreen\u003csup\u003e\u0026reg;\u003c/sup\u003e qPCR Master Mix (TOROIVD, Shanghai, China) on the Archimed X4 Real-Time qPCR System (Rocgene, Beijing, China) with the setting: 95 ℃\u0026nbsp;5 min; 40 \u0026times; (95\u0026nbsp;℃\u0026nbsp;10 s, 60\u0026nbsp;℃\u0026nbsp;34 s). The primer sequences of \u003cem\u003edu\u003c/em\u003eRIPK2 and inflammatory cytokines IL-1\u0026beta;, IL-2, IL-6, IL-10, IFN-\u0026alpha;, IFN-\u0026beta;, and \u0026beta;-actin (endogenous reference) were listed in Table 1. All data were calculated using the 2\u003csup\u003e\u0026minus;\u0026Delta;\u0026Delta;Ct\u003c/sup\u003e method\u003csup\u003e[38]\u003c/sup\u003e. Each sample was assayed in three technical replicates and represented as mean\u0026nbsp;\u0026plusmn;\u0026nbsp;SD.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods of Calculation and Statistics\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data were analyzed by SPSS 19.0 software, and differences were assessed by\u0026nbsp;Two-way ANOVA, followed by Tukey\u0026apos;s multiple comparisons test (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, significant, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, highly significant). Graph Pad Prism 5.0 software (Graph Pad Software Inc., San Diego, CA, USA) was used to process related graphs.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eMolecular characterization of \u003cem\u003edu\u003c/em\u003eRIPK2\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe full-length ORF of \u003cem\u003edu\u003c/em\u003eRIPK2\u0026rsquo;s is 1,659bp, encoding a protein of 553 amino acids (the sequence has been submitted to GenBank, and the GenBank accession number is SUB15937840), containing lysine 209 (K209), serine 176 (S176), and tyrosine 474 (Y474) (The K has been marked in green font, and the S and Y have been marked in red font. Figure 1). SMART prediction revealed that \u003cem\u003edu\u003c/em\u003eRIPK2 possesses serine/threonine protein kinases, catalytic (S-TKc) domain (26-296aa, indicated by the blue line), and the CARD (457-541aa, indicated by the red line) (Figure 1 and Figure 2).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePhylogenetic analysis of \u003cem\u003edu\u003c/em\u003eRIPK2\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn Figure 3, we constructed a phylogenetic tree using RIPK2 AA sequences from Cherry Valley duck and other species. The phylogenetic tree contains mammals, avian, and fish branches, and\u0026nbsp;\u003cem\u003ed\u003c/em\u003e\u003cem\u003eu\u003c/em\u003eRIPK2\u0026nbsp;was mapped in the\u0026nbsp;birds\u0026rsquo;\u0026nbsp;one.\u0026nbsp;\u003cem\u003eDu\u003c/em\u003eRIPK2 is most closely related to that of \u003cem\u003eAnas platyrhynchos\u003c/em\u003e and \u003cem\u003eAnas acuta\u0026nbsp;\u003c/em\u003eRIPK2, and shows a distant relationship with fish RIPK2. In Figure\u0026nbsp;4, the\u0026nbsp;multiple sequence alignment\u0026nbsp;indicated an overall 90 % identity with avian RIPK2 orthologs and 100 % identity with the RIPK2 sequence of \u003cem\u003eAnas acuta\u0026nbsp;\u003c/em\u003eby comparing\u0026nbsp;the\u0026nbsp;AA sequence of RIPK2s in Cherry Valley ducks and others.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTissue distribution of \u003cem\u003edu\u003c/em\u003eRIPK2\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe profiled \u003cem\u003edu\u003c/em\u003eRIPK2 mRNA expression level across all 20 tissues as described. \u003cem\u003eDu\u003c/em\u003eRIPK2 was widely expressed in 20 tissues, and this wide expression indicates a systemic role in host immune responses. The highest \u003cem\u003edu\u003c/em\u003eRIPK2 mRNA expression level was detected in the liver, followed by muscle and trachea, whereas expression in intestinal tissues was comparatively low (Figure 5).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGross lesions and histopathological analysis of the infected ducks\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThroughout the experiment, no abnormal clinical signs were observed on the ducks injected with PBS. In contrast, APEC- and NDRV-challenged ducks exhibited listlessness, ruffled feathers, and sluggish movement (Figure 6A and 6E). For the APEC-infected group, the liver was markedly enlarged, dark red, and accompanied by diffuse hemorrhage; the spleen showed significant enlargement with a tense capsule; the brain was obviously edematous and presented prominent hemorrhage (Figure 6B-D). In the NDRV-challenged ducks, the liver was notably enlarged, with extensive petechial hemorrhages on the surface; the spleen was significantly enlarged, dark red, with a mottled appearance and distinct necrotic foci; the brain tissue was markedly swollen and severely edematous (Figure 6F-H).\u003c/p\u003e\n\u003cp\u003eHistopathologically, the liver of APEC-infected ducks presented disorganized hepatic architecture, loss of hepatic cord arrangement, hepatic sinusoidal congestion, and mild steatosis (Figure 7D); in NDRV-infected ducks, the liver showed severe disruption of hepatic architecture, with hepatocytes exhibiting extensive vacuolar degeneration and necrosis (Figure 7G). In the spleen, APEC infection induced lymphocyte necrosis with abundant cellular debris (Figure 7E), while NDRV infection caused disrupted splenic architecture, lymphocyte necrosis, and formation of distinct necrotic foci (Figure 7H). In the brain, APEC-infected ducks showed severe cerebral edema with concurrent congestion (Figure 7F), whereas NDRV-infected ducks presented mild cerebral edema and loosened tissue texture (Figure 7I). In summary, both APEC and NDRV can induce histopathological lesions in multiple tissues of ducks.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBacterial load and viral DNA load in the infected ducks\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe detected APEC loads in the examined tissues at each timepoint (Figure 8A). At 1 dpi, bacteria load increased significantly in all three tissues, reaching 3.0 \u0026times; 10\u003csup\u003e8\u003c/sup\u003e CFU/g in the liver, 1.0 \u0026times; 10\u003csup\u003e8\u003c/sup\u003e CFU /g in the spleen, and 4.0 \u0026times; 10\u003csup\u003e7\u003c/sup\u003e CFU/g in the brain. At 2 dpi, APEC content declined in the liver and brain, whereas the spleen continued to accumulate bacteria, peaking at 3.0 \u0026times; 10\u003csup\u003e8\u003c/sup\u003e CFU/g. By 3 dpi, bacterial burdens decreased in all three tissues examined. We also tested NDRV loads in the examined organs at 1, 2, and 3 dpi (Figure 8B). At 1 dpi, no high load was detected in these tissues examined. At 2 dpi, the viral loads in both liver and spleen respectively, peaked at 7.94\u0026times;10\u003csup\u003e3\u003c/sup\u003ecopies/\u0026mu;L and 1.04\u0026times;10\u003csup\u003e5\u003c/sup\u003ecopies/\u0026mu;L. At 3 dpi, viral loads in liver, spleen, and brain all showed a downward trend. Compared with other organs, the NDRV load in the brain has always been low. No gene segment of APEC or NDRV was detected in any tissues of the control group.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTranscriptional levels of \u003cem\u003edu\u003c/em\u003eRIPK2 after APEC and NDRV challenge\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo investigate whether \u003cem\u003edu\u003c/em\u003eRIPK2 participates in antibacterial and antiviral immune response, its mRNA content was measured in the liver, spleen, and brain after APEC and NDRV challenge. Following infection with the APEC, \u003cem\u003edu\u003c/em\u003eRIPK2 expression was upregulation at all tested timepoints in all tested tissues (Figure 9A). Among these, duRIPK2 expression in the spleen peaked at 1 dpi with an 11.23-fold increase\u0026nbsp;(Figure 9A). At 2 dpi, \u003cem\u003edu\u003c/em\u003eRIPK2 also showed significant upregulation, with a 4.34-fold and 4.71-fold increase in liver and spleen, respectively (Figure 9A). At 3 dpi, the relevant upregulation is not very obvious, and the upregulation in the brain is relatively mild. (Figure 9A). Notably, in the NDRV infection group, \u003cem\u003edu\u003c/em\u003eRIPK2 expression was significantly downregulated throughout the entire experimental period in all examined tissues (Figure 9B). These findings indicate \u003cem\u003edu\u003c/em\u003eRIPK2 as an essential factor of the innate immunity against both bacterial and viral pathogens.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTranscriptional level\u003c/strong\u003e\u003cstrong\u003es of inflammatory cytokines in the infected ducks\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo characterize the kinetic profiles of inflammatory cytokines during bacterial and viral infection, we quantified the transcript levels of IL-1\u0026beta;, IL-2, IL-6, IL-10, IFN-\u0026alpha;, and IFN-\u0026beta; in the liver, spleen and brain of APEC- and NDRV- challenged Cherry Valley ducks. The transcriptional profiles of IL-1\u0026beta; in the liver and spleen of the APEC- and NDRV-infected groups were significantly upregulated (Figure 10A and 10a). The mRNA expression of IL-2 has a similar trend in both APEC- and NDRV- infected tissues, with the highest upregulation observed in the liver. For example, it reached a peak of 184.3 times at 3 dpi in the APEC-infected liver, and reached a peak of 230.35 times at 2 dpi in the NDRV-infected liver (Figure 10B and 10b, \u003cem\u003eP\u0026nbsp;\u003c/em\u003e\u0026lt; 0.0001). Significant upregulation of IL-6 expression was found in APEC-infected spleen, with IL-6 mRNA expression levels significantly upregulated by 2566.96 times at 1 dpi (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.0001), upregulated by 447.79-fold at 2 dpi (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.0001), but returned to normal levels at 3 dpi (Figure 10C). Inversely, in the NDRV-challenged Cherry Valley ducks, the expression of IL-6 mRNA was not upregulated as much as mentioned above. It was upregulated the most in the liver at 2 dpi, reaching 30.48 times (Figure 10c, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.0001). The transcriptional level of IL-10 was significantly upregulated in both APEC- and NDRV- infected liver and spleen. There was the similar trend in livers: reaching the peak at 2 dpi. At 3 dpi, the IL-10 expression level in APEC-infected spleen almost returned to the normal level but remained significantly up-regulated in NDRV-infected spleen. In the brain tissues, the expression level of IL-10 at 1 dpi and 2 dpi also barely changed, but it significantly upregulated at 3 dpi in the NDRV-infected brain. In contrast, the expression level of IL-10 in the brain of the APEC-infection group did not show significant changes at 1 to 3 dpi (Figure 10D and 10d). Secondly, we found that the transcription level of IFN-\u0026alpha; and IFN-\u0026beta; also showed significant upregulation both in the APEC and NDRV infection groups (Figure 10E-F and Figure 10e-f). In summary, compared to the liver and spleen, the levels of changes in most of the aforementioned cytokines in the brain are relatively low (Figure 10). Analogously, transcription profiles of these cytokines in the NDRV-challenged group were relatively lower than those in the APEC-challenged group (Figure 10)\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThis study aims to detect and explore the gene sequence and composition structure of \u003cem\u003edu\u003c/em\u003eRIPK2, label the conserved sites related to activation, and draw a phylogenetic tree. Simultaneously, 1-week-old Cherry Valley ducks were selected to detect and summarize the distribution of \u003cem\u003edu\u003c/em\u003eRIPK2 in different tissues. After inoculation, the clinical symptoms and pathological changes caused by AEPC and NDRV, the bacterial/viral loads, and the expression levels of \u003cem\u003edu\u003c/em\u003eRIPK2 and inflammatory cytokines, in the liver, spleen, and brain, were analyzed and compared.\u003c/p\u003e \u003cp\u003eAlthough the gene sequence of RIPK2 has been determined in human and mouse\u003csup\u003e[\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]\u003c/sup\u003e, no relevant information on ducks RIPK2 has been reported. In this research, we first obtained the full length of \u003cem\u003edu\u003c/em\u003eRIPK2\u0026rsquo;s gene sequence and determined the number of its encoded proteins (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Previous reports have indicated that RIPK2 has ubiquitination-related sites K209, phosphorylation sites S176 and Y474\u003csup\u003e[\u003cspan additionalcitationids=\"CR42\" citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]\u003c/sup\u003e, which are associated with structural changes and activation events of RIPK2. K209 serves as a \u0026ldquo;handle\u0026rdquo; that engages the BIR2 domain of X-linked inhibitor of apoptosis protein, helping its C-terminal RING domain exert its E3 ubiquitin ligase activity so that ubiquitin is conjugated to the ubiquitination sites on RIPK2\u003csup\u003e[\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]\u003c/sup\u003e. And these above three functional sites also exist in the AA sequence of \u003cem\u003edu\u003c/em\u003eRIPK2 that we detected (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). In addition, we constructed a phylogenetic tree and found that \u003cem\u003edu\u003c/em\u003eRIPK2 clusters with avian RIPK2s (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Sequence similarity analysis indicated that duRIPK2 shares 100% identity with Anas acuta RIPK2, over 90% identity with RIPK2s from birds, but only about 50%-70% with mammals and fish, and the lowest identity with \u003cem\u003eCarassius auratus\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). This indicates that Cherry Valley ducks can serve as an animal model for studying RIPK2 in birds. Moreover, we used the SMART tool to predict its protein structure, and the result clarifies that \u003cem\u003edu\u003c/em\u003eRIPK2 has a characteristic C-terminal CARD of RIPKs, which is used to receive the related molecular pattern recognition signals from NOD1/2, and the N-terminal S-TKc to activate downstream related proteins and pathways (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003ePrevious studies have illuminated that RIPK2 mRNA content is most in the bone marrow, followed by the spleen, blood, thymus and other tissues in chickens\u003csup\u003e[\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]\u003c/sup\u003e, and it is abundantly expressed in human tissues, including the spleen, placenta, testis, and heart\u003csup\u003e[\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]\u003c/sup\u003e. Nevertheless, the tissue distribution of duck RIPK2 has not been reported. In this research, we first detected that \u003cem\u003edu\u003c/em\u003eRIPK2 shows a pattern of widespread expression in multiple tissues, high expression in \"liver-muscle-trachea\" and low expression in intestine (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e), indicating that \u003cem\u003edu\u003c/em\u003eRIPK2 participates in systemic immunity.\u003c/p\u003e \u003cp\u003eIn this study, Cherry Valley ducks in the infected groups showed listlessness, ruffled feathers, and sluggish movement (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA and \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE), which are consistent with the typical clinical manifestations of APEC and NDRV infection in poultry as reported previously\u003csup\u003e[\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]\u003c/sup\u003e. Moreover, the examined tissues of APEC- and NDRV- challenged ducks all presented varying degrees of enlargement and hemorrhage (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e), which may be attributed to factors such as enhanced platelet adhesion and increased vascular permeability induced by various inflammatory mediators\u003csup\u003e[\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]\u003c/sup\u003e. In terms of histopathological changes, both APEC and NDRV caused severe lesions in the tested organs, which can severely impair the growth and maturation of the host (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn our study, the APEC could rapidly replicate in the liver, spleen, and brain at 1dpi, and the bacterial load reached a peak in the spleen at 2 dpi (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA), further proving that APEC infection can cause damage to multiple organs of Cherry Valley ducks. In terms of RIPK2, previous research has manifested that bacterial invasion can significantly increase RIPK2 expression level\u003csup\u003e[\u003cspan additionalcitationids=\"CR51\" citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]\u003c/sup\u003e. In this study, we also observed a similar pattern of \u003cem\u003edu\u003c/em\u003eRIPK2 changes in APEC-infected groups: it markedly increased in all tissues, especially in the spleen, where it was upregulated by 11 times at 1 dpi, and maintained the upward trend at 2dpi (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eA). In the results of the determination of the expression levels of inflammatory factors, we detected that the transcriptional profiles of multiple ILs and IFNs were significantly upregulated in the liver and spleen, while the changes in the brain tissue were not such obvious in this study (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eA-F). Similarly, multiple previous reports also indicated that bacterial infection can upregulate the expression of inflammatory factors via RIPK2 activation, inducing a cytokine storm and thereby triggering an inflammatory response. For instance, Zheng et al. discovered that after \u003cem\u003eStreptococcus pneumoniae\u003c/em\u003e infects the host, NOD2 senses bacterial peptidoglycan and, via the NOD2-RIPK2 signal, activates NF-κB and triggers a cytokine storm, thereby upregulating the transcription of inflammatory cytokines\u003csup\u003e[\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]\u003c/sup\u003e. In an epithelial cell model of \u003cem\u003eFusobacterium nucleatum\u003c/em\u003e infection, Wei et al. found that bacterial infection markedly up-regulated the expression of NOD1, RIPK2, and IL-1β. Knockdown of NOD1 significantly reduced RIPK2 levels, while inhibition of RIPK2 markedly decreased IL-1β expression, demonstrating that the NOD1\u0026ndash;RIPK2 axis regulates IL-1β production\u003csup\u003e[\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]\u003c/sup\u003e. Coincidentally, RIPK2 can directly or indirectly regulate the expression levels of IFN-α and IFN-β\u003csup\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e. As a result, the simultaneous increase in APEC load, the expression levels of \u003cem\u003edu\u003c/em\u003eRIPK2 and inflammatory cytokines at 1 dpi and 2 dpi in this experiment was in line with expectations. At 3 dpi, however, we observed that the APEC load showed a downward trend, and the up-regulation amplitude of \u003cem\u003edu\u003c/em\u003eRIPK2 in both liver and spleen and inflammatory cytokines in spleen was significantly reduced, suggesting a key anti-bacterial role of \u003cem\u003edu\u003c/em\u003eRIPK2 until 2 dpi, which has been pointed out by multiple studies: BIST et al. testified that knocking down the RIPK2 gene in \u003cem\u003eacinetobacter baumannii\u003c/em\u003e infection can inhibit the release of inflammatory cytokines\u003csup\u003e[\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]\u003c/sup\u003e, And overexpression of the RIPK2 gene can activate MAPK pathway and enhance apoptosis level in bacterial infected or damaged cells\u003csup\u003e[\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]\u003c/sup\u003e. Consequently, all of the above together prove that \u003cem\u003edu\u003c/em\u003eRIPK2 is vital in innate immunity defense against APEC infection.\u003c/p\u003e \u003cp\u003eAfter NDRV invaded the body, it replicated extensively in the spleen and liver at 2 dpi (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB), which confirms the previous research indicating that the spleen and liver are the target tissues of NDRV\u003csup\u003e[\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]\u003c/sup\u003e. The NDRV load in the brain remained relatively low (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB), suggesting that it might be because the existence of the blood-brain barrier has prevented a large amount of NDRV from invading\u003csup\u003e[\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]\u003c/sup\u003e. Compared with the APEC infection group, the transcriptional level of \u003cem\u003edu\u003c/em\u003eRIPK2 in NDRV-challenged ducks was significantly inhibited, the up-regulation amplitude of inflammatory factor expression levels was also much smaller, and at 3 dpi, the NDRV viral load in the liver and spleen still remained relatively high (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eB). It has been reported that viral infection can stimulate the transcription process of RIPK2 but reduces the expression level of it\u003csup\u003e[\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e]\u003c/sup\u003e, In this way, the expression level of \u003cem\u003edu\u003c/em\u003eRIPK2 was significantly upregulated during APEC infection and significantly downregulated during NDRV infection, and this resulted in substantial differences in the expression levels of inflammatory factors (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003ea-f), indicating that \u003cem\u003edu\u003c/em\u003eRIPK2 constitutes a vital determinant of regulating inflammatory factors and triggering innate immune responses. This further indicates that \u003cem\u003edu\u003c/em\u003eRIPK2 plays a significant role against bacterial and viral infections. The experimental results show that \u003cem\u003edu\u003c/em\u003eRIPK2 exhibits a strong correlation with inflammatory cytokines in both bacterial and viral infections. Currently, immunotherapy for inflammatory diseases includes regulating the degree of inflammatory response\u003csup\u003e[\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e]\u003c/sup\u003e. Therefore, RIPK2 can serve as a potential entry point for immunotherapy.\u003c/p\u003e \u003cp\u003eIn this study, we confirmed the comparative analysis of the anti-bacterial and anti-viral functions of \u003cem\u003edu\u003c/em\u003eRIPK2 in Cherry Valley ducks. Besides, we summarized the ORF of \u003cem\u003edu\u003c/em\u003eRIPK2, predicted the protein structure, detected the transcriptional profiles in different tissues, and testified its role during APEC and NDRV infection in healthy Cherry Valley ducks. The research results indicate that \u003cem\u003edu\u003c/em\u003eRIPK2 can significantly inhibit the replication of APEC and also serve as a potential target for the development of NDRV drugs.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll ducks used in this experiment were handled according to the guidelines of the Ethics Committee on Animal Experiments of Qingdao Agricultural University and the appropriate biosecurity guidelines, the number of the approval protocol being \u0026ldquo;QAU-2025-007.\u0026rdquo; The study was conducted in accordance with the local legislation and institutional requirements.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analyzed during this study are included in this published article [and its supplementary information files].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe author(s) declare that financial support was received for the research and/or publication of this article. This work was supported by the Natural Science Foundation of Shandong Province, China (ZR2021QC093 and ZR2021QC007); Qingdao Agricultural University High-level Talents Research Fund (1122011 and 1120016).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eXJ offered methodology and wrote the original draft. RL reviewed and edited the article. SL offered methodology, reviewed and edited the article. WL reviewed and edited the article. ZC conducted formal Analysis, reviewed and edited the article. QP reviewed and edited the article. GL conceptualized the study, investigated the experiments, developed the methodology, provided resources, supervised the project, and reviewed and edited the article. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBauernfeind F G, Horvath G, Stutz A, et al. Cutting edge: NF-kappaB activating pattern recognition and cytokine receptors license NLRP3 inflammasome activation by regulating NLRP3 expression[J]. Journal of immunology (Baltimore, Md. : 1950), 2009,183(2):787-791.\u003c/li\u003e\n\u003cli\u003eLee M S, Kim Y. Signaling pathways downstream of pattern-recognition receptors and their cross talk[J]. Annual review of biochemistry, 2007,76:447-480.\u003c/li\u003e\n\u003cli\u003eInohara N, Nu Ez G. NODs: intracellular proteins involved in inflammation and apoptosis[J]. Nature reviews. Immunology, 2003,3(5):371-382.\u003c/li\u003e\n\u003cli\u003eInohara N, Koseki T, Lin J, et al. An induced proximity model for NF-kappa B activation in the Nod1/RICK and RIP signaling pathways[J]. The Journal of biological chemistry, 2000,275(36):27823-27831.\u003c/li\u003e\n\u003cli\u003eDamgaard R B, Nachbur U, Yabal M, et al. The ubiquitin ligase XIAP recruits LUBAC for NOD2 signaling in inflammation and innate immunity[J]. Molecular cell, 2012,46(6):746-758.\u003c/li\u003e\n\u003cli\u003eMeylan E, Tschopp J. The RIP kinases: crucial integrators of cellular stress[J]. Trends in biochemical sciences, 2005,30(3):151-159.\u003c/li\u003e\n\u003cli\u003eAyala-Aguilera C C, Valero T, Lorente-Mac\u0026iacute;as \u0026Aacute;, et al. Small Molecule Kinase Inhibitor Drugs (1995-2021): Medical Indication, Pharmacology, and Synthesis[J]. Journal of medicinal chemistry, 2022,65(2):1047-1131.\u003c/li\u003e\n\u003cli\u003eCohen P, Cross D, J Nne P A. Kinase drug discovery 20 years after imatinib[J]. Nature reviews. Drug discovery, 2022:10-1038.\u003c/li\u003e\n\u003cli\u003eMa D, Hu S, Wang C, et al. Discovery of Potent and Balanced Dual RIPK2 and 3 Inhibitors as a New Strategy for the Treatment of Inflammatory Bowel Diseases[J]. Journal of medicinal chemistry, 2025,68(7):7539-7559.\u003c/li\u003e\n\u003cli\u003eMcCarthy J V, Ni J, Dixit V M. RIP2 is a novel NF-kappaB-activating and cell death-inducing kinase[J]. The Journal of biological chemistry, 1998,273(27):16968-16975.\u003c/li\u003e\n\u003cli\u003eWindheim M, Lang C, Peggie M, et al. Molecular mechanisms involved in the regulation of cytokine production by muramyl dipeptide[J]. The Biochemical journal, 2007,404(2):179-190.\u003c/li\u003e\n\u003cli\u003eGong Q, Long Z, Zhong F L, et al. Structural basis of RIP2 activation and signaling[J]. Nature communications, 2018,9(1):4993.\u003c/li\u003e\n\u003cli\u003eMaharana J, Maharana D, Bej A, et al. Structural Elucidation of Inter-CARD Interfaces involved in NOD2 Tandem CARD Association and RIP2 Recognition[J]. The journal of physical chemistry. B, 2021,125(49):13349-13365.\u003c/li\u003e\n\u003cli\u003eThome M, Hofmann K, Burns K, et al. Identification of CARDIAK, a RIP-like kinase that associates with caspase-1[J]. Current biology : CB, 1998,8(15):885-888.\u003c/li\u003e\n\u003cli\u003eNavas T A, Baldwin D T, Stewart T A. RIP2 is a Raf1-activated mitogen-activated protein kinase kinase[J]. The Journal of biological chemistry, 1999,274(47):33684-33690.\u003c/li\u003e\n\u003cli\u003eMcCully M L, Fairhead T, Colmont C S, et al. Receptor-interacting protein-2 deficiency delays macrophage migration and increases intracellular infection during peritoneal dialysis-associated peritonitis[J]. American journal of nephrology, 2008,28(6):879-889.\u003c/li\u003e\n\u003cli\u003eKobayashi K, Inohara N, Hernandez L D, et al. RICK/Rip2/CARDIAK mediates signalling for receptors of the innate and adaptive immune systems[J]. Nature, 2002,416(6877):194-199.\u003c/li\u003e\n\u003cli\u003eBalamayooran T, Batra S, Balamayooran G, et al. Receptor-interacting protein 2 controls pulmonary host defense to Escherichia coli infection via the regulation of interleukin-17A[J]. Infection and immunity, 2011,79(11):4588-4599.\u003c/li\u003e\n\u003cli\u003eShimada K, Chen S, Dempsey P W, et al. The NOD/RIP2 pathway is essential for host defenses against Chlamydophila pneumoniae lung infection[J]. PLoS pathogens, 2009,5(4):e1000379.\u003c/li\u003e\n\u003cli\u003eSun H, Cao Y, Yang Y, et al. Analysis of miRNA Expression Profiling of RIP2 Knockdown in Chicken HD11 Cells When Infected with Avian Pathogenic E. coli (APEC)[J]. International journal of molecular sciences, 2022,23(13):7319.\u003c/li\u003e\n\u003cli\u003eGuabiraba R, Schouler C. Avian colibacillosis: still many black holes[J]. FEMS microbiology letters, 2015,362(15):fnv118.\u003c/li\u003e\n\u003cli\u003eLutful Kabir S M. Avian colibacillosis and salmonellosis: a closer look at epidemiology, pathogenesis, diagnosis, control and public health concerns[J]. International journal of environmental research and public health, 2010,7(1):89-114.\u003c/li\u003e\n\u003cli\u003eLogue C M, Wannemuehler Y, Nicholson B A, et al. Comparative Analysis of Phylogenetic Assignment of Human and Avian ExPEC and Fecal Commensal Escherichia coli Using the (Previous and Revised) Clermont Phylogenetic Typing Methods and its Impact on Avian Pathogenic Escherichia coli (APEC) Classification[J]. Frontiers in microbiology, 2017,8:283.\u003c/li\u003e\n\u003cli\u003eDou X, Gong J, Han X, et al. Characterization of avian pathogenic Escherichia coli isolated in eastern China[J]. Gene, 2016,576(1 Pt 2):244-248.\u003c/li\u003e\n\u003cli\u003eGyles C L. Antimicrobial resistance in selected bacteria from poultry[J]. Animal health research reviews, 2008,9(2):149-158.\u003c/li\u003e\n\u003cli\u003eGhunaim H, Abu-Madi M A, Kariyawasam S. Advances in vaccination against avian pathogenic Escherichia coli respiratory disease: potentials and limitations[J]. Veterinary microbiology, 2014,172(1-2):13-22.\u003c/li\u003e\n\u003cli\u003eSandford E E, Orr M, Balfanz E, et al. Spleen transcriptome response to infection with avian pathogenic Escherichia coli in broiler chickens[J]. BMC genomics, 2011,12:469.\u003c/li\u003e\n\u003cli\u003eSandford E E, Orr M, Shelby M, et al. Leukocyte transcriptome from chickens infected with avian pathogenic Escherichia coli identifies pathways associated with resistance[J]. Results in immunology, 2012,2:44-53.\u003c/li\u003e\n\u003cli\u003eSun H, Liu P, Nolan L K, et al. Avian pathogenic Escherichia coli (APEC) infection alters bone marrow transcriptome in chickens[J]. BMC genomics, 2015,16(1):690.\u003c/li\u003e\n\u003cli\u003eSun H, Liu P, Nolan L K, et al. Novel Pathways Revealed in Bursa of Fabricius Transcriptome in Response to Extraintestinal Pathogenic Escherichia coli (ExPEC) Infection[J]. PloS one, 2015,10(11):e142570.\u003c/li\u003e\n\u003cli\u003eChen S, Chen S, Lin F, et al. The isolation and identification of novel duck reovirus[J]. Bing du xue bao = Chinese journal of virology, 2012,28(3):224-230.\u003c/li\u003e\n\u003cli\u003eWang H, Gao B, Liu X, et al. Pathogenicity of a variant duck orthoreovirus strain in Cherry Valley Ducklings[J]. Veterinary microbiology, 2020,242:108546.\u003c/li\u003e\n\u003cli\u003eLupfer C, Thomas P G, Anand P K, et al. Receptor interacting protein kinase 2-mediated mitophagy regulates inflammasome activation during virus infection[J]. Nature immunology, 2013,14(5):480-488.\u003c/li\u003e\n\u003cli\u003eLi R, Li N, Zhang J, et al. Expression of Immune-Related Genes of Ducks Infected with Avian Pathogenic Escherichia coli (APEC)[J]. Frontiers in microbiology, 2016,7:637.\u003c/li\u003e\n\u003cli\u003eDho M, Lafont J P. Adhesive properties and iron uptake ability in Escherichia coli lethal and nonlethal for chicks[J]. Avian diseases, 1984,28(4):1016-1025.\u003c/li\u003e\n\u003cli\u003eLi N, Hong T, Wang Y, et al. The pathogenicity of novel duck reovirus in Cherry Valley ducks[J]. Veterinary microbiology, 2016,192:181-185.\u003c/li\u003e\n\u003cli\u003eBurland T G. DNASTAR\u0026apos;s Lasergene sequence analysis software[J]. Methods in molecular biology (Clifton, N.J.), 2000,132:71-91.\u003c/li\u003e\n\u003cli\u003eLivak K J, Schmittgen T D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method[J]. Methods (San Diego, Calif.), 2001,25(4):402-408.\u003c/li\u003e\n\u003cli\u003eCole C G, McCann O T, Collins J E, et al. Finishing the finished human chromosome 22 sequence[J]. Genome biology, 2008,9(5):R78.\u003c/li\u003e\n\u003cli\u003eYue F, Cheng Y, Breschi A, et al. A comparative encyclopedia of DNA elements in the mouse genome[J]. Nature, 2014,515(7527):355-364.\u003c/li\u003e\n\u003cli\u003eLethier M, Huard K, Hons M, et al. Structure shows that the BIR2 domain of E3 ligase XIAP binds across the RIPK2 kinase dimer interface[J]. Life science alliance, 2023,6(11):e202201784.\u003c/li\u003e\n\u003cli\u003eWei K, Zhou C, Shu Z, et al. MYSM1 attenuates osteoarthritis by recruiting PP2A to deubiquitinate and dephosphorylate RIPK2[J]. Bone research, 2025,13(1):3.\u003c/li\u003e\n\u003cli\u003eEllwanger K, Briese S, Arnold C, et al. XIAP controls RIPK2 signaling by preventing its deposition in speck-like structures[J]. Life science alliance, 2019,2(4):e201900346.\u003c/li\u003e\n\u003cli\u003eHong-Yan S, Huan L, Ye-Xin Y, et al. Transcriptome alterations in chicken HD11 cells with steady knockdown and overexpression of RIPK2 gene[J]. Poultry science, 2023,102(1):102263.\u003c/li\u003e\n\u003cli\u003eTian E, Zhou C, Quan S, et al. RIPK2 inhibitors for disease therapy: Current status and perspectives[J]. European journal of medicinal chemistry, 2023,259:115683.\u003c/li\u003e\n\u003cli\u003eTan M, Tan J, Fang S, et al. Pathogenicity and identification of host adaptation genes of the avian pathogenic Escherichia coli O145 in duck[J]. Frontiers in cellular and infection microbiology, 2024,14:1453907.\u003c/li\u003e\n\u003cli\u003eYu K, Ti J, Lu X, et al. Novel duck reovirus exhibits pathogenicity to specific pathogen-free chickens by the subcutaneous route[J]. Scientific reports, 2021,11(1):11769.\u003c/li\u003e\n\u003cli\u003eLentsch A B, Ward P A. Regulation of inflammatory vascular damage[J]. The Journal of pathology, 2000,190(3):343-348.\u003c/li\u003e\n\u003cli\u003eGando S, Wada T. Thromboplasminflammation in COVID-19 Coagulopathy: Three Viewpoints for Diagnostic and Therapeutic Strategies[J]. Frontiers in immunology, 2021,12:649122.\u003c/li\u003e\n\u003cli\u003eGeddes K, Rubino S, Streutker C, et al. Nod1 and Nod2 regulation of inflammation in the Salmonella colitis model[J]. Infection and immunity, 2010,78(12):5107-5115.\u003c/li\u003e\n\u003cli\u003eShehat M G, Cardona O A, Aranjuez G F, et al. RIP2 promotes Fc\u0026gamma;R-mediated reactive oxygen species production[J]. The Journal of biological chemistry, 2019,294(26):10365-10378.\u003c/li\u003e\n\u003cli\u003eFrutuoso M S, Hori J I, Pereira M S F, et al. The pattern recognition receptors Nod1 and Nod2 account for neutrophil recruitment to the lungs of mice infected with Legionella pneumophila[J]. Microbes and infection, 2010,12(11):819-827.\u003c/li\u003e\n\u003cli\u003eZheng Y, Shang F, An L, et al. NOD2-RIP2 contributes to the inflammatory responses of mice in vivo to Streptococcus pneumoniae[J]. Neuroscience letters, 2018,671:43-49.\u003c/li\u003e\n\u003cli\u003eWei Z, Bao L, Li B, et al. Fusobacterium nucleatum promotes anastomotic leakage by activating epithelial cells through the NOD1/RIPK2/ERK signalling pathway to drive IL-1\u0026beta;-induced neutrophil chemotaxis and collagen degradation[J]. Clinical and translational medicine, 2025,15(3):e70262.\u003c/li\u003e\n\u003cli\u003eBist P, Dikshit N, Koh T H, et al. The Nod1, Nod2, and Rip2 axis contributes to host immune defense against intracellular Acinetobacter baumannii infection[J]. Infection and immunity, 2014,82(3):1112-1122.\u003c/li\u003e\n\u003cli\u003eGoh F Y, Cook K L T P, Upton N, et al. Receptor-interacting protein 2 gene silencing attenuates allergic airway inflammation[J]. Journal of immunology (Baltimore, Md. : 1950), 2013,191(5):2691-2699.\u003c/li\u003e\n\u003cli\u003ePandit R, Chen L, G Tz J. The blood-brain barrier: Physiology and strategies for drug delivery[J]. Advanced drug delivery reviews, 2020,165-166:1-14.\u003c/li\u003e\n\u003cli\u003eLiu H, Xue Q, Zhu Z, et al. Foot-and-Mouth Disease Virus Inhibits RIP2 Protein Expression to Promote Viral Replication[J]. Virologica Sinica, 2021,36(4):608-622.\u003c/li\u003e\n\u003cli\u003eMcInnes I B, Gravallese E M. Immune-mediated inflammatory disease therapeutics: past, present and future[J]. Nature reviews. Immunology, 2021,21(10):680-686.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003eTable 1 Primers employed in test\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"99%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 30px;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePrimer name\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSequence\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e(5\u0026rsquo;-3\u0026rsquo;)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 25px;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePurpose\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 30px;\"\u003e\n \u003cp\u003e\u003cem\u003edu\u003c/em\u003eRIPK2-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44px;\"\u003e\n \u003cp\u003eCAAGCTCCTGGCCGAGAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 25px;\"\u003e\n \u003cp\u003eGene cloning\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 30px;\"\u003e\n \u003cp\u003e\u003cem\u003edu\u003c/em\u003eRIPK2-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44px;\"\u003e\n \u003cp\u003eCCAAATGCAGCCTAGATG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 30px;\"\u003e\n \u003cp\u003eq-\u003cem\u003edu\u003c/em\u003eRIPK2-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44px;\"\u003e\n \u003cp\u003eCCATTGCTGCACCATGACTT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 25px;\"\u003e\n \u003cp\u003eqRT-PCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 30px;\"\u003e\n \u003cp\u003eq-\u003cem\u003edu\u003c/em\u003eRIPK2-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44px;\"\u003e\n \u003cp\u003eGCGTGATTGCGACATGGATA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 30px;\"\u003e\n \u003cp\u003eq-\u003cem\u003edu\u003c/em\u003e\u0026beta;-actin-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44px;\"\u003e\n \u003cp\u003eGGTATCGGCAGCAGTCTTA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 25px;\"\u003e\n \u003cp\u003eqRT-PCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 30px;\"\u003e\n \u003cp\u003eq-\u003cem\u003edu\u003c/em\u003e\u0026beta;-actin-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44px;\"\u003e\n \u003cp\u003eTTCACAGAGGCGAGTAACTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 30px;\"\u003e\n \u003cp\u003eq-\u003cem\u003edu\u003c/em\u003eIL1\u0026beta;-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44px;\"\u003e\n \u003cp\u003eTCATCTTCTACCGCCTGGAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 25px;\"\u003e\n \u003cp\u003eqRT-PCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 30px;\"\u003e\n \u003cp\u003eq-\u003cem\u003edu\u003c/em\u003eIL1\u0026beta;-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44px;\"\u003e\n \u003cp\u003eGTAGGTGGCGATGTTGACCT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 30px;\"\u003e\n \u003cp\u003eq-\u003cem\u003edu\u003c/em\u003eIL2-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44px;\"\u003e\n \u003cp\u003eGCCAAGAGCTGACCAACTTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 25px;\"\u003e\n \u003cp\u003eqRT-PCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 30px;\"\u003e\n \u003cp\u003eq-\u003cem\u003edu\u003c/em\u003eIL2-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44px;\"\u003e\n \u003cp\u003eATCGCCCACACTAAGAGCAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 30px;\"\u003e\n \u003cp\u003eq-\u003cem\u003edu\u003c/em\u003eIL6-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44px;\"\u003e\n \u003cp\u003eTTCGACGAGGAGAAATGCTT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 25px;\"\u003e\n \u003cp\u003eqRT-PCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 30px;\"\u003e\n \u003cp\u003eq-\u003cem\u003edu\u003c/em\u003eIL6-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44px;\"\u003e\n \u003cp\u003eCCTTATCGTCGTTGCCAGAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 30px;\"\u003e\n \u003cp\u003eq-\u003cem\u003edu\u003c/em\u003eIL10-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44px;\"\u003e\n \u003cp\u003eGCCTCCACTTGTCTGACCTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 25px;\"\u003e\n \u003cp\u003eqRT-PCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 30px;\"\u003e\n \u003cp\u003eq-\u003cem\u003edu\u003c/em\u003eIL10-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44px;\"\u003e\n \u003cp\u003eCCTCCATGTAGAACCGCATC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 30px;\"\u003e\n \u003cp\u003eq-\u003cem\u003edu\u003c/em\u003eIFN\u0026alpha;-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44px;\"\u003e\n \u003cp\u003eTCCTCCAACACCTCTTCGAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 25px;\"\u003e\n \u003cp\u003eqRT-PCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 30px;\"\u003e\n \u003cp\u003eq-\u003cem\u003edu\u003c/em\u003eIFN\u0026alpha;-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44px;\"\u003e\n \u003cp\u003eGGGCTGTAGGTGTGGTTCTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 30px;\"\u003e\n \u003cp\u003eq-\u003cem\u003edu\u003c/em\u003eIFN\u0026beta;-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44px;\"\u003e\n \u003cp\u003eAGATGGCTCCCAGCTCTACA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 25px;\"\u003e\n \u003cp\u003eqRT-PCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 30px;\"\u003e\n \u003cp\u003eq-\u003cem\u003edu\u003c/em\u003eIFN\u0026beta;-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 44px;\"\u003e\n \u003cp\u003eAGTGGTTGAGCTGGTTGAGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eF, forward primer; R, reverse primer; q, qRT-PCR.\u003c/p\u003e\n\u003cp\u003eTable 2 RIPK2s employed in phylogenetic tree\u003c/p\u003e\n\u003cdiv align=\"center\"\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"99%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 46px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSpecies\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 53px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eGenBank accession numbers\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 46px;\"\u003e\n \u003cp\u003eOvibos moschatus\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 53px;\"\u003e\n \u003cp\u003eXER92221.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 46px;\"\u003e\n \u003cp\u003eBos taurus\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 53px;\"\u003e\n \u003cp\u003eNP 001029782.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 46px;\"\u003e\n \u003cp\u003eSus scrofa\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 53px;\"\u003e\n \u003cp\u003eQCO69316.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 46px;\"\u003e\n \u003cp\u003eHomo sapiens\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 53px;\"\u003e\n \u003cp\u003eAAC27722.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 46px;\"\u003e\n \u003cp\u003eGulo gulo luscus\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 53px;\"\u003e\n \u003cp\u003eUQT06239.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 46px;\"\u003e\n \u003cp\u003eIctidomys tridecemlineatus P\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 53px;\"\u003e\n \u003cp\u003eXP 005328693.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 46px;\"\u003e\n \u003cp\u003eCallospermophilus lateralis P\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 53px;\"\u003e\n \u003cp\u003eXP 076691774.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 46px;\"\u003e\n \u003cp\u003eRattus norvegicus\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 53px;\"\u003e\n \u003cp\u003eNP 001178794.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 46px;\"\u003e\n \u003cp\u003eMus musculus\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 53px;\"\u003e\n \u003cp\u003eAAL96436.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 46px;\"\u003e\n \u003cp\u003eGallus gallus X1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 53px;\"\u003e\n \u003cp\u003eNP 001026114.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 46px;\"\u003e\n \u003cp\u003eGallus gallus X2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 53px;\"\u003e\n \u003cp\u003eNP 001383534.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 46px;\"\u003e\n \u003cp\u003eAnser cygnoides P\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 53px;\"\u003e\n \u003cp\u003eXP 066846679.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 46px;\"\u003e\n \u003cp\u003eAnas platyrhynchos P\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 53px;\"\u003e\n \u003cp\u003eXP 027308245.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 46px;\"\u003e\n \u003cp\u003eAnas acuta P\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 53px;\"\u003e\n \u003cp\u003eXP 068528328.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 46px;\"\u003e\n \u003cp\u003eLarimichthys crocea\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 53px;\"\u003e\n \u003cp\u003eWRW50915.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 46px;\"\u003e\n \u003cp\u003eGasterosteus aculeatus P\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 53px;\"\u003e\n \u003cp\u003eXP 040026812.2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 46px;\"\u003e\n \u003cp\u003eMaylandia zebra P\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 53px;\"\u003e\n \u003cp\u003eXP 004570558.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 46px;\"\u003e\n \u003cp\u003eIctalurus punctatus\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 53px;\"\u003e\n \u003cp\u003eWBW48352.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 46px;\"\u003e\n \u003cp\u003eBrachyhypopomus gauderio P\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 53px;\"\u003e\n \u003cp\u003eXP 076828097.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 46px;\"\u003e\n \u003cp\u003eDanio rerio\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 53px;\"\u003e\n \u003cp\u003eNP 919392.3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 46px;\"\u003e\n \u003cp\u003eCtenopharyngodon idella\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 53px;\"\u003e\n \u003cp\u003eAYN79345.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 46px;\"\u003e\n \u003cp\u003eCarassius auratus\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 53px;\"\u003e\n \u003cp\u003eAJG06856.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"RIPK2, Cherry Valley duck, cloning, APEC, NDRV, innate immunity","lastPublishedDoi":"10.21203/rs.3.rs-8719745/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8719745/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eReceptor-interacting protein kinase 2 (RIPK2) is an indispensable adaptor and effector protein in the NOD-like receptor (NLRs) signaling pathway. Its C-terminal CARD binds NLRs via CARD-CARD interaction, while its N-terminal kinase domain (KD) mediates ubiquitination and phosphorylation for downstream signaling. In this study, we cloned and analyzed the gene sequence and structural characteristics of Cherry Valley duck RIPK2 (\u003cem\u003edu\u003c/em\u003eRIPK2), systematically investigated its expression distribution in different tissues of Cherry Valley ducks, and explored its immune regulatory role in the infection of avian pathogenic \u003cem\u003eEscherichia coli\u003c/em\u003e (APEC) and novel duck reovirus (NDRV). Through bioinformatics analysis, the full-length open reading frame (ORF) of \u003cem\u003edu\u003c/em\u003eRIPK2 was identified for the first time, and conserved sites related to its kinase role were predicted. The tissue expression profile analysis indicated that \u003cem\u003edu\u003c/em\u003eRIPK2 was highly expressed in the liver, muscle, and trachea, but was expressed at a lower level in intestinal tissues. The infection model analysis confirmed that APEC infection could markedly elevate \u003cem\u003edu\u003c/em\u003eRIPK2 expression level, induce the enhanced expression of inflammatory factors, and inhibit the bacterial load. Whereas, in NDRV infection, the expression of \u003cem\u003edu\u003c/em\u003eRIPK2 was significantly inhibited, accompanied by the increased expression of inflammatory factors, and the viral load remained at a relatively high level at 3dpi. The results demonstrate that \u003cem\u003edu\u003c/em\u003eRIPK2 is a momentous hub of both anti-bacterial and anti-viral immunity systems in ducks, advancing the mechanistic understanding of the NOD-RIPK2 signaling pathways in poultry, providing direction for breeding strategies and entry points for adjuvant development, and reducing antibacterial and antiviral drug dependency in the duck farming industry.\u003c/p\u003e","manuscriptTitle":"Cloning, characterization and comparative innate immune functions of duRIPK2 in Cherry Valley duck against APEC and NDRV","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-02-16 09:35:29","doi":"10.21203/rs.3.rs-8719745/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"692bb9fb-7e1d-4371-9cb0-fcb17a5ba34c","owner":[],"postedDate":"February 16th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-03-26T12:40:30+00:00","versionOfRecord":[],"versionCreatedAt":"2026-02-16 09:35:29","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8719745","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8719745","identity":"rs-8719745","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}