Chinese Medicine PaBing-II Protects Human iPSC Derived Dopaminergic Neurons from Oxygen Stress

Chinese Medicine PaBing-II Protects Human iPSC Derived Dopaminergic Neurons from Oxygen Stress | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Chinese Medicine PaBing-II Protects Human iPSC Derived Dopaminergic Neurons from Oxygen Stress Shouhai Wu, Tongxiang Lin, Yang Xu This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-179866/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background PaBing-II Formula (PB-II) is a traditional Chinese medicine developed to treat Parkinson's disease (PD). However, due to the complexity of PB-II and the difficulty of culturing human dopaminergic neurons (DAn) in vitro , the mechanism of PB-II to treat PD remains unclear. Methods We established the human induced pluripotent stem cells (iPSCs) and derived DAn from hiPSCs to study the protective effects of PB-II on DAn after oxidative stress, which plays an important role in PD pathogenesis. Results We found that serum derived from rats that had ingested PB-II significantly protect hiPSC-derived DAn from reactive oxygen species (ROS). In addition, PB-II dependent serum can activate nuclear erythroid-derived factor 2 (Nrf2) responses, which are required for the neutralization of ROS. In addition, PB-II can activate the Nrf2/ARE signal pathway of midbrain dopaminergic neurons of PD rats induced with 6-hydroxydopamine (6-OHDA) injury, rescue DAn cells, and improve the symptoms of PD rats. Conclusions PB-II significantly protects the DA neurons from oxidative stress by activating the Nrf2 pathway. Translational Medicine Parkinson's disease oxidative stress hiPSCs DAn Nrf2/ARE Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Background Parkinson's disease is a common progressive neurodegenerative disease characterized by tremor and bradykinesia [1]. As patients age, their symptoms continue to deteriorate [2]. The hallmark of PD is the degeneration of dopaminergic (DA) neurons in the substantia nigra (SN) and the presence of Lewy bodies (LBs) [2, 3]. While the mechanims underlying PD pathology remains unclear, extensive evidences from postmortem brain tissues suggest that oxidative stress and deficiency of complex I activity are related to PD pathogenesis [4, 5]. Currently there is no cure for PD. The primary treatment of PD is to supplement dopamine or promote endogenous dopamine release. Levodopa, commonly used in the treatment of PD, can significantly improve the motor symptoms of PD, but it cannot prevent the disease progression that eventually leads to the death of DA neurons. The long-term use of L-dopa can also cause movement disorders and insomnia Serious complications such as anxiety [6]. PaBing-II Formula (PB-II), a Traditional Chinese Medicine remedy, has been developed and used to treat Parkinson's disease (PD) in the Second Affiliated Hospital of Guangzhou University of Chinese Medicine for over 20 years. PB-II is composed of Wumei 20 g, Coptis 3 g, Paeony 20 g, Angelica 10 g, Aconite 10 g, Rehmannia 10 g, Polygonum multiflorum 20 g, Ligusticum chuanxiong 10 g, Pueraria 20 g, Ginseng 10 g, Acorus 5 g, Gastrodia 10 g, Tortoise plate 10 g, and Roasted licorice 3 g. Wumei nourishes kidney, liver, blood, softens tendons, and balances Yin and Yang to treat the symptoms of involuntary tremor. PaBing-II Formula has significant therapeutic effects on PD patients, especially during the early stage [7, 8]. PB-II can relieve PD patients’ motor and non-motor symptoms, improve the therapeutic effects of dopaminergic drugs while reducing drug's side effects, and improve patients' quality of life [9, 10]. Previous studies report that gavaging PD rats induced by 6-hydroxydopamine (6-OHDA) with PB-II improve the rotational behavior [11], and protected the dopaminergic neurons from apoptosis [12, 13]. The 6-OHDA can damage the dopaminergic neurons in substantia nigra of midbrain, and lead to the symptoms of PD in mice. The unilaterally lesioned 6-OHDA-lesioned rat model of PD has proved to be invaluable in advancing our understanding of the mechanisms underlying parkinsonian symptoms, and is widely used in PD research [14]. However, the impact of PB-II on human DAn and mechanisms underlying its therapeutic benefit remain to be established. Based on the pluripotency of iPSCs to differentiate into all cell types in the body, the iPSC technology has provided an essential model to study human diseases in dishes [15]. Here, we generated iPSC from human fibroblast and differentiated them into dopaminergic neurons. Using this model, we investigated the mechanisms underlying the therapeutic benefits of PB-II on PD patients. Methods PB- II medicated serum preparation For PB-II original recipe, refer to previous reports. We prepared slices of Chinese crude drugs from the pharmacy of Guangdong Province Hospital of Chinese medicine, which were decocted twice with 10 and 8 times of water, filtered, and concentrated with water bath at 80℃ to 1.6 kg/L (measured by rude drug weight/volume). Rats took gavage of PB-II twice a day at 32 G•kg -1 (according to the crude drug meter) according to the body surface area converted from clinical dosage. After gavage for 2 weeks, the rats with 10% chloral hydrate anesthesia were bled of arterial blood and separated for medicated serum in accordance with the method reported in the previous studies [16]. The medicated serum and control serum were inactivated at 56 ℃ for 30 min, then stored at -80 ℃ before use. LC-MS LC-MS was conducted through the combined application of Dionex Ultimate 3000 UHPLC (Thermo Fisher Scientific, Waltham, MA, USA) and Q Exactive Orbitrap mass spectrometer. After screening, the analysis was carried out using the Waters TM UPLCTM HSS T3 C18 (2.1×100 mm, 1.7μm). Chromatographic conditions: Gradient elution was performed with acetonitrile (A) -0.1% formic acid water (B). The elution procedure was: 0 min, 10% A; 5 min, 20% A; 20 min, 60% A; 25 min, 90% A; 28 min 90% A; 29-33min 10% A. The flow rate was 0.2 mL/min. Mass spectrometry conditions: The samples were ionized by ESI ion source and then analyzed by Q ExactiveOrbitrap high-resolution mass spectrometer. The main parameters of the ESI ion source are: spray voltage 3500V (Anion voltage -3500V), capillary temperature 350 ℃; Sheath gas: 40, Auxiliary gas, 15. All other parameters are default. The liquid eluent with a retention time of 0.5-29 min was selected by the automatic switching valve for mass spectrometry analysis. Generation of human DA neurons from iPS cells We selected an iPS cell line from a healthy human skin cell line preserved in our laboratory. According to the previous reports [17], we differentiated the DA neuron from the iPSC with the necessary media and related cytokines. iPSCs were plated at 4×10 4 cells/cm 2 on Matrigel (BD)-coated tissue culture dishes for differentiation. N2B27-CDM + bFGF (20ng/ml) was used to culture for 3 days. The differentiation was performed in the KSR medium. On day 3, the cell should be almost confluent (over 80%). The culture was gradually changed to the N2 medium, supplemented at day 0-5 with SB431542 (5 μM)+LDN-193189 (100 nM)+Iwp2 (1 μM) to get retinal progenitor, and then split in 1:3 ratio for the next six passages using Accutase. Neural induction media supplemented with 3 μM CHIR99021 and 2 μM on X-ray inactivated MEF feeders or Matrigel-coated plates was used to culture the cells. On day 6-10, induction factors were withdrawn, meanwhile adding PD173074 (0.2 μM)+DAPT (10 μM) for retinal ganglion cell inductions. On day 10-15, the medium was changed to N2, B27 and 300 mμg/mL cAMP (Sigma-Aldrich) adding 100 ng/mL SHH (C24Ⅱ) and 100 ng/mL FGF8b. We then added 10 ng/mL BDNF, 10 ng/mL GDNF, 10 ng/mL IGF-1, 1 ng/mL TGF-β, and 0.5 mM db-cAMP and continued culturing cells for 30 days. We collected the cell and detected the cells with dopaminergic neuronal markers, such as TH and TUJ1. We used primary antibodies, which were as follows: Tyrosine Hydroxylase Antibody (CST-2791), β3-Tubulin (TU-20) Antibody (CST-4466), DAPI (Sigma-D9542). The primers of DA neuron-specific genes are shown in the following table. The immunofluorescence method Cells were fixed using 4% v/v paraformaldehyde (Alfa Aesar), washed three times with PBS containing 0.2% v/v Tween (PBST) (Fisher Scientific), and permeablized using 0.15% v/v TritionX-100 (Sigma-Aldrich) in PBS for 1 hr at 25 ℃. After gentle removal of PBST, cells were incubated with the primary antibody in PBST overnight at 4 ℃. After that, cells were washed three times with PBST and stained with the secondary antibody for 1 hr at 37 ℃. The cells were washed three times in PBST, stained with DAPI, and viewed with a Laser scanning confocal microscope (Carl Zeiss-710). Dopaminergic neuron-specific TH antibody, TUJ1 staining, To observe the ratio of dopaminergic neurons, we statistically analyzed the proportion of TH+/TUJ1+ double positive in all the cells. The establishment of DA neurons oxidation model Cultured DA neurons were treated with 100 μM H 2 O 2 for 12 h in accordance with the method previously reported [18]. After the treatment, we carried out examinations of apoptosis and the ROS levels in the cells. By flow cytometry analysis, we found that ROS and apoptosis increased significantly. And the IF data showed that the ratio of TH/TUJ1 double-positive cells in H 2 O 2 treated cells decreased significantly, which is considered to be a DA neuron model of oxidative damage. Experimental grouping The neural cell culture and DA neuronal cells were randomly divided into 4 groups, including the control group (Ctrl), oxidative damage model (ODM), blank serum group (BS), and medicated serum group (MS). Control cells were cultured in normal conditions, and the other cultures were treated separately. We added 10% mock serum in the BS group and 10% medicated serum in the MS group but continued normal condition without supplementing the model sample for 24 hours. On the following day, the 3 treatment groups, including the BS group, MS group, and the ODM group, were treated at 100 μM H 2 O 2 for another 12 hours. Finally, all cell samples were examined for cell apoptosis, DA neuronal activity, ROS, and Nrf2 signal pathway gene expressions. Flow cytometry analysis We used flow cytometry to analyze the TH positive ratio, apoptosis, and ROS levels. For TH detection, we used intracellular staining. The cells were digested, fixed with 4% paraformaldehyde, and blocked with BSA. The TH-antibody (ab75875, 1/100 dilution) was then for 30 min at 22ºC. The secondary antibody used was DyLight- 488 goat anti-rabbit IgG (H+L) (ab96899) at 1/500 dilution for 30 min at 22ºC. Acquisition of >5,000 events was performed. For apoptosis detection, we used the KEYGEN apoptosis kit (#KGA108-1) according to the manufacturer’s instructions. We also checked Annexin V-FITC/PI staining through flow cytometry with software (BD). ROS were detected with the Reactive Oxygen Species kit (#KGT010-1) according to the manufacturer’s instructions. The brief principle for the detection of ROS was based on the fluorescent probe DCFH-DA. Intracellular ROS can oxidize non-color DCFH into fluorescent DCF. Thus, flow cytometry could be used to detect the fluorescence intensity for ROS levels. Nrf2/ARE signal detection Western blotting was carried out for the detection of Nrf2 protein in each group of cells. ImageJ software was used to analyze the protein gray value. The RT-PCR detection was for Nrf2 downstream gene mRNAs, such as HO-1, NQO1, MRP2, and GPX2. The primer sequences are shown in the following table. Quantification and statistical analysis Data are represented as mean ± SEM unless otherwise indicated, and Student’s t-test was used for comparing two groups. F-test was used for comparing variances. For comparing multiple groups, one-way ANOVA or two-way ANOVA were used. n was indicated in figure legends. GraphPad Prism 5 software was used for statistical analysis. Differences between two groups were considered significant when the P -value was less than 0.05 (* p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001; n.s., not significant. Error bars indicate means ±s.d.). Results Quality control test of medicated serum We used liquid chromatography and mass spectrometry (LC-MS) method to analyze the active ingredients in the medicated serum, and analyze the main six compounds in the whole recipe (citric acid (Figure 1-1), hypaconitine (Figure 1-2), stilbene glucoside (Figure 1-3), glycyrrhizin (Figure 1-4), paeoniflorin (Figure 1-5), Ginsenoside Rg1 (Figure 1-6)). Perform identification and simultaneous detection to provide a reference for the quality control of PB-II. The detailed map is shown in Figure 1. Generation of hiPSC and their differentiation into DAn We derived an iPSC line from healthy human skin fibroblasts as previously described. Briefly, we used a Nucleotransfection Kit (P2 primary cell 4D-Nucleotector X Kit, Lonza) to transfect the Y4 episomal vectors (pCXLE-hOCT3/4-shp53, pCXLE-hSK and pCXLE-hUL, Okita et al Nat Methods. 2011 ) to the fibroblasts with the procedure of DT-130. Cells were cultured in ESC medium containing DMEM/F12 (Gibco, 11330), KnockOut™ Serum Replacement (Gibco), MEM non-essential amino acids (Gibco), L-glutamine (Gibco), 55 mM β-mercaptoethanol (Gibco) and 20ng bFGF (Gibco), on feeders which were taken from CF1 mouse embryos and subjected to radioactive irradiation with the dose of 30 Gy advance. Colones with hESC morphology appeared between day 25 and 45. They were picked and expanded under hESC culture condition. The pluripotency of the hiPSC line was confirmed by the colony morphology, the expression of the pluripotency markers OCT4 and TRA-1-81, and the formation of teratomas in NSG mice (Figure 2A-C). These data confirmed the pluripotency of the hiPSCs. Using the protocol described previously (Li W et al., 2011, PANS), we differentiated hiPSCs into dopaminergic neurons. We confirmed the presence of dopamine neurons in the differentiating culture using DAn-specific markers. DAn-specific genes such as Tyrosine hydroxylase , TUBB3 (TUJ1), FOXA2, and Engrailed 1 (EN1) were significantly increased in iPSC-derived DAn culture (Figure 2D). In addition, the cell morphology confirmed the morphological characteristics of DA neurons (Figure 2E). Immunofluorescence (IF) analysis demonstrated that about 60% of iPSC-derived cells expressed the neuron-specific markers TUJ1, and about 40% of iPSC-derived neurons were TH + /TUJ1 + , confirming the presence of hiPSC-derived DAn (Figure 2F). . PB- II protects DA neurons from oxidative damage induced by H 2 O 2 Immunofluorescence data showed more TUJ1 + TH + neurons in the PB-II medicated serum (MS) sample than those in the oxidative damage model sample (ODM) which was prepared by H 2 O 2 damage and blank serum (BS) samples (Figure 3A). While TUJ1 + TH + neurons were obviously decreased in the ODM group after the treatment with H 2 O 2 , MS could significantly increase TUJ1 + TH + neurons, indicating that MS could protect TUJ1 + TH + neurons from oxidative stress (Figure 3A). In support of this conclusion, flow cytometric analysis indicated that the percentage of TH + cells in the MS group was significantly higher than that in the ODM or BS group (Figure 3B, 3C). We further analyzed the percentage of apoptosis in each experimental group, indicating that MS protected the neuronal apoptosis after H 2 O 2 treatment (Figure 3D, 3E). PB- II activates the Nrf2/ARE signaling pathway and reduces cellular ROS In order to explore the mechanism of PB-II to protect DAn from oxidative stress neurons, we examined the ROS levels of hiPSC-derived neuronal culture after various treatments. While the ROS levels were similar between the ODM and BS treatment groups, MS significantly decreased cellular ROS in hiPSC-derived neuronal culture, supporting a role of PB-II in reducing oxidative stress (Figure 4A, 4B). Together, these findings support the notion that PB-II can protect DAn from oxidative stress by reducing cellular ROS levels. As reported before, the ROS triggers the redox system by activating Nrf2, which induces its downstream genes such as HO-1, NQO1, MRP2, and GPX2. After the treatment with H 2 O 2 (100μM, 12h), Nrf2 protein levels and its downstream gene expression was statistically similar to those of the Ctrl group (Figure 4C-F). However, MS treatment significantly increases the expression of Nrf2 protein and its downstream genes such as NQO1 (Figure 4C-F). Therefore, PB-II can activate the Nrf2/ARE signaling pathway to protect DAn from oxidative stress. PB- II improves the symptoms of PD rats by activating the Nrf2/ARE signaling pathway To further validate the findings that PB-II can activate the Nrf2/ARE signaling pathway to protect DAn from oxidative stress, we tested the effects of PB-II on PD rat models by injecting 6-OHDA into the substantia nigra striatum of rats to induce the death of midbrain DAn (Model group). The Sham operation group was injected with the same volume of normal saline (Sham group). The PB-II group was given 32g / kg of PB-II by gavage. During the treatment course of 4 weeks, the behavioral symptoms of PD rats were measured weekly. The spinal behavior in PD rats was induced by the subcutaneous injection of APO in the back of the neck, and the number of rotations was recorded within 30 minutes. During the initial stage of treatment (0 weeks), the rats in the Ctrl group and the Sham group had no symptoms of in-situ circles. However, the model group and PB-II group showed serious rotationary behavior with more than 210 rotations in 30 minutes, and there was no significant difference between the two groups. During the third week of the treatment, the number of rotations of rats was significantly reduced in the PB-II group (Figure 5E). After 4 weeks of treatment, we euthanized the rats and obtained the tissues of the nigrostriatal region. The number of TH + neurons in the substantia nigra striatum of rats in the PB-II group was significantly higher than those in the Sham group and Model group (Figure 5A). In addition, the levels of Nrf2 protein in midbrain dopamine neurons of rats in the PB-II group were significantly higher than those in the Sham group and Model group (Figure 5B and Figure 5C). The expression of HO-1, NQO1, MRP2, and GPX2 in the midbrain dopaminergic neurons of the PB-II group was also significantly increased, indicating the activation of the Nrf2/ARE signaling pathway by PB-II (Figure 5D). These data confirm that PB-II activates the Nrf2 / ARE signal pathway in the midbrain of PD rats by activating Nrf2 to reduce oxidative stress in DAn, and thus protecting DAn from oxidative stress induced apoptosis. Discussion It is commonly believed that oxidative stress can eventually lead to the death of dopaminergic neurons [19-21], and the activation of the endogenous antioxidant system may protect the cells from oxidative damage, which is a research hotspot at present [21]. Multiple studies in various organs have confirmed that the Nrf2- antioxidant response element (ARE) pathway can play a role of endogenous antioxidant to antagonize the oxidative stress injury [22]. In the central nervous system cells, such as dopaminergic neurons, astrocytes, and microglia, Nrf2 maintains the redox balances through the up-regulation of antioxidant gene expression [23]. Previous researches have verified that Nrf2 mostly translocates to the nucleus in the dopaminergic neurons in the substantia nigra of PD patients, while it is present in the cytoplasm in the matched normal control group of the same age [16, 24, 25]. Besides, studies have also demonstrated that overexpression of Nrf2 can reduce the damage of 6-OHDA in dopaminergic neurons [19, 26]. Under physiological condition, Nrf2 protein expression levels were low in cells, mainly in the cytoplasm, where it can interact with Kelch-like ECH associated protein-1 (Keap1) [27, 28]. When the occurrence of oxidative stress, Nrf2 phosphorylation, and Keap1 protein translocation into the uncoupling combine with ARE in the nucleus, regulation on downstream target genes, such as Heme Oxygenase-1 (HO-1) and NAD(P)H quinone dehydrogenase 1 (NQO1), is induced, to enhance the process of detoxification and antioxidant ability of cells [29-31]. In vitro experiments have also shown that the up-regulation of HO-1 and NQO1 can protect cells against oxidative damage of glutamic acid, hydrogen peroxide, and amyloid beta-protein [32-34]. Our experiments showed that the PB-II medicated serum could effectively reduce ROS levels in the oxidation model of dopaminergic neurons, protecting dopaminergic neurons from apoptotic death. These results suggested the Nrf2/ARE pathway-mediated antioxidant mechanism might play the role of the PB-II in treating this neurodegenerative disease. When neurotoxic substances, such as H 2 O 2 , are transported by the dopamine transporter system into neuron cells, and induce oxidative stress and increase DA neuron apoptosis. Compared with the Model group, the Medicated serum group had highly up-regulated nuclear protein Nrf2 and its downstream HO-1, NQO1, MRP2, and GPX2 expression. The results suggest that PB-II plays a protective role in the oxidative stress in neurons through increased nuclear accumulation and phosphorylation of Nrf2, as well as the expression of Nrf2 downstream target genes. PB-II contains 14 kinds of Traditional Chinese Medicine compounds. Although the complex compound composition of these natural Chinese herbal medicine is not very clear, its function has been significantly observed and confirmed by a lot of clinicians in the clinical practice for many years [9, 10, 35, 36]. Furthermore, several researchers have reported its protective effects on midbrain dopaminergic neurons against 6-OHDA toxicity in substantia nigra in rat models [11-13]. PB-II reduces the apoptosis of DA neurons in the PD rats model, promotes cell regeneration, and finally plays a role in improving rats’ PD symptoms. This study may provide further evidence in iPSC-derived DA neurons and elaborate reversal of H 2 O 2 -induced oxidative stress. Furthermore, our experiments provide a useful model for in vitro PD studies on complicated Chinese medicine formulas. Conclusions PB-II activated Nrf2 signaling pathway in oxidative damaged DA neurons, increasing the expression of antioxidant genes downstream of Nrf2, thereby improving the antioxidant capacity of neurons and reducing the ROS and apoptosis. PB-II might protect DA neurons from functional damage by this mechanism, and thus play a role in the treatment of PD. Abbreviations PD: Parkinson's Disease; PB-II: PaBing-II; DAn: Dopaminergic neurons; iPSCs: induced Pluripotent Stem Cells; ROS: Reactive Oxygen Species; Nrf2: Nuclear erythroid-derived Factor 2; 6-OHDA: 6-Hydroxydopamine; SN: Substantia Nigra; LBs: Lewy bodies; LC-MS: Liquid Chromatograph-Mass Spectrometer; Ctrl: the Control group; ODM: Oxidative Damage Model; BS: Blank Serum group; MS: Medicated Serum group; IF: Immunofluorescence; RT-PCR: Reverse Transcription-Polymerase Chain Reaction; TH: Tyrosine Hydroxylase; TUJ1: β3-Tubulin; HO-1: Heme Oxygenase 1; NQO1: NAD(P)H quinone dehydrogenase 1. Declarations Acknowledgements We would like to thank Xiaodong Luo, Beibei Zhao, Qingfeng Xie, Qiuxiang Yi and Wen Xu, Guangdong Provincial Hospital of traditional Chinese medicine, for providing PB-II prescription and assistance in experimental research. Authors’ contributions XY conceived and designed the work; SHW performed the experiments; TXL analyzed the data and wrote the original draft; XY reviewed and revised the manuscript. All authors read and approved the final manuscript. Funding This work was supported by the Medical Scientific Research Foundation of Guangdong Province of China (Grant No. A2016437), the Guangdong basic and applied basic research fund project (Grant No. 2020A1515110450) and the Project of Administration of Traditional Chinese Medicine of Guangdong Province of China (Grant No. 20211183). Availability of data and materials The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request. Ethics approval and consent to participate The study was approved by the Guangdong Provincial Hospital of TCM Review Board for Ethics. People’s cell samples used in our experiments were approved by the board, with all patients providing written informed consent. The animal experiments were approved by the Animal Review Board at Guangdong Provincial Hospital of Chinese Medicine. Consent for publication Not applicable. Competing Interests The authors declare that they have no competing interests. Author details 1 Center for Regenerative and Translational Medicine, Guangdong Provincial Academy of Chinese Medical Sciences, the Second Affiliated Hospital of Guangzhou University of Chinese Medicine, Guangzhou 510632, Guangdong, China; 2 School of Basic Medical Sciences, Southern Medical University, Guangzhou, Guangdong, 510515, China. References Hayes MT: Parkinson's Disease and Parkinsonism . Am J Med 2019, 132 (7):802-807. Kalia LV, Lang AE: Parkinson's disease . Lancet 2015, 386 (9996):896-912. Musgrove RE, Helwig M, Bae EJ, Aboutalebi H, Lee SJ, Ulusoy A, Di Monte DA: Oxidative stress in vagal neurons promotes parkinsonian pathology and intercellular α-synuclein transfer . J Clin Invest 2019, 129 (9):3738-3753. Henchcliffe C, Beal MF: Mitochondrial biology and oxidative stress in Parkinson disease pathogenesis . Nat Clin Pract Neurol 2008, 4 (11):600-609. Zhao J, Yu S, Zheng Y, Yang H, Zhang J: Oxidative Modification and Its Implications for the Neurodegeneration of Parkinson's Disease . Mol Neurobiol 2017, 54 (2):1404-1418. Voon V, Napier TC, Frank MJ, Sgambato-Faure V, Grace AA, Rodriguez-Oroz M, Obeso J, Bezard E, Fernagut PO: Impulse control disorders and levodopa-induced dyskinesias in Parkinson's disease: an update . Lancet Neurol 2017, 16 (3):238-250. Fan YP, Zeng L, Sun ZY, Su QZ, Lian XF: Clinical research of tremor type parkinson's disease with PD NO.2 . Tianjin Journal of Traditional Chinese Medicine 2010, 27 (03):190-191 %@ 1672-1519 %L 1612-1349/R %W CNKI. Luo X, Wen X, Lian X, Wang C: Effect of Formula Ⅱ for Parkinson's Disease on the TCM Syndrome of Early Parkinson's Disease Patients with Liver-Kidney Deficiency Syndrome . Journal of Traditional Chinese Medicine 2013, 54 (01):32-34. Xiao-Dong W, Ding R, Chun-Ling W, De-Yan K, Kai-Hua W: Effects of Chinese herbal medicine Pabing Ⅱ Formula on quality of life of patients with Parkinson's disease at early-stage . China Journal of Traditional Chinese Medicine and Pharmacy 2013, 28 (10):2917-2921. Chun-Ye Z, Xin-Fu L, Xiu-Ju Z, Yun L, Xiao-Dong L: Therapeutic effect evaluation of modified Wumei Pills on Parkinson's disease . China Journal of Traditional Chinese Medicine and Pharmacy 2013, 28 (3):1673-1727. Xiao-Dong W, Xiao-Dong L, Chun-Ling W: Experimental Study on Protective Effects of Pabing Ⅱ Formula in Parkinson's Disease Rats . Chinese Journal of Experimental Traditional Medical Formulae 2012(9):224-228. Yuzhi S, Xiaodong L, Beibei Z, Shouhai W, Xiaofeng C: Effect of Pa-Bing Formula No.2 on Morphological Changes of Substantia Nigra Cells in Parkinson's Disease Rats . Modernization of Traditional Chinese Medicine and Materia Medica-World Science and Technology 2014, 16 (10):2131-2136. Xiao-Dong W, Chun-Ling W, Xiao-Dong L: Involvement in Neuroprotective Effect of Pabing II Formula on the Dopaminergic Neurons of Parkinson's disease Rats . Lishizhen Medicine and Materia Medica Research 2013, 24 (3):568-571. Thiele SL, Warre R, Nash JE: Development of a unilaterally-lesioned 6-OHDA mouse model of Parkinson's disease . J Vis Exp 2012(60). Tabata Y, Okano H: Modeling Familial Parkinson's Disease Using Patient-specific Induced Pluripotent Stem Cells . Brain Nerve 2019, 71 (8):875-883. Ammal Kaidery N, Ahuja M, Thomas B: Crosstalk between Nrf2 signaling and mitochondrial function in Parkinson's disease . Mol Cell Neurosci 2019, 101 :103413. Alvarez-Carbonell D, Ye F, Ramanath N, Garcia-Mesa Y, Knapp PE, Hauser KF, Karn J: Cross-talk between microglia and neurons regulates HIV latency . PLoS Pathog 2019, 15 (12):e1008249. Guan H, Yang H, Yang M, Yanagisawa D, Bellier JP, Mori M, Takahata S, Nonaka T, Zhao S, Tooyama I: Mitochondrial ferritin protects SH-SY5Y cells against H(2)O(2)-induced oxidative stress and modulates α-synuclein expression . Exp Neurol 2017, 291 :51-61. Kwon SH, Lee SR, Park YJ, Ra M, Lee Y, Pang C, Kim KH: Suppression of 6-Hydroxydopamine-Induced Oxidative Stress by Hyperoside Via Activation of Nrf2/HO-1 Signaling in Dopaminergic Neurons . Int J Mol Sci 2019, 20 (23). Lim HS, Kim JS, Moon BC, Ryu SM, Lee J, Park G: Batryticatus Bombyx Protects Dopaminergic Neurons Against MPTP-Induced Neurotoxicity by Inhibiting Oxidative Damage . Antioxidants (Basel) 2019, 8 (12). Ramirez-Moreno MJ, Duarte-Jurado AP, Gopar-Cuevas Y, Gonzalez-Alcocer A, Loera-Arias MJ, Saucedo-Cardenas O, Montes de Oca-Luna R, Rodriguez-Rocha H, Garcia-Garcia A: Autophagy Stimulation Decreases Dopaminergic Neuronal Death Mediated by Oxidative Stress . Mol Neurobiol 2019, 56 (12):8136-8156. Raghunath A, Sundarraj K, Nagarajan R, Arfuso F, Bian J, Kumar AP, Sethi G, Perumal E: Antioxidant response elements: Discovery, classes, regulation and potential applications . Redox Biol 2018, 17 :297-314. Sivandzade F, Bhalerao A, Cucullo L: Cerebrovascular and Neurological Disorders: Protective Role of NRF2 . International journal of molecular sciences 2019, 20 (14). Guo C, Zhu J, Wang J, Duan J, Ma S, Yin Y, Quan W, Zhang W, Guan Y, Ding Y et al : Neuroprotective effects of protocatechuic aldehyde through PLK2/p-GSK3β/Nrf2 signaling pathway in both in vivo and in vitro models of Parkinson's disease . Aging (Albany NY) 2019, 11 (21):9424-9441. Petrillo S, Schirinzi T, Di Lazzaro G, D'Amico J, Colona VL, Bertini E, Pierantozzi M, Mari L, Mercuri NB, Piemonte F et al : Systemic activation of Nrf2 pathway in Parkinson's disease . Mov Disord 2020, 35 (1):180-184. Sun Y, He L, Wang T, Hua W, Qin H, Wang J, Wang L, Gu W, Li T, Li N et al : Activation of p62-Keap1-Nrf2 Pathway Protects 6-Hydroxydopamine-Induced Ferroptosis in Dopaminergic Cells . Mol Neurobiol 2020, 57 (11):4628-4641. Baird L, Yamamoto M: The Molecular Mechanisms Regulating the KEAP1-NRF2 Pathway . Mol Cell Biol 2020, 40 (13). Wang J, Lu Q, Cai J, Wang Y, Lai X, Qiu Y, Huang Y, Ke Q, Zhang Y, Guan Y et al : Nestin regulates cellular redox homeostasis in lung cancer through the Keap1-Nrf2 feedback loop . Nat Commun 2019, 10 (1):5043. Luo J, Yan D, Li S, Liu S, Zeng F, Cheung CW, Liu H, Irwin MG, Huang H, Xia Z: Allopurinol reduces oxidative stress and activates Nrf2/p62 to attenuate diabetic cardiomyopathy in rats . J Cell Mol Med 2020, 24 (2):1760-1773. Wu GD, Li ZH, Li X, Zheng T, Zhang DK: microRNA-592 blockade inhibits oxidative stress injury in Alzheimer's disease astrocytes via the KIAA0319-mediated Keap1/Nrf2/ARE signaling pathway . Exp Neurol 2020, 324 :113128. Wu H, Jia L: Scutellarin attenuates hypoxia/reoxygenation injury in hepatocytes by inhibiting apoptosis and oxidative stress through regulating Keap1/Nrf2/ARE signaling . Biosci Rep 2019, 39 (11). Cui R, Tian L, Lu D, Li H, Cui J: Exendin-4 Protects Human Retinal Pigment Epithelial Cells from H2O2-Induced Oxidative Damage via Activation of NRF2 Signaling . Ophthalmic Res 2020, 63 (4):404-412. Du Y, You L, Ni B, Sai N, Wang W, Sun M, Xu R, Yao Y, Zhang Z, Qu C et al : Phillyrin Mitigates Apoptosis and Oxidative Stress in Hydrogen Peroxide-Treated RPE Cells through Activation of the Nrf2 Signaling Pathway . Oxid Med Cell Longev 2020, 2020 :2684672. Zheng S, Deng Z, Chen F, Zheng L, Pan Y, Xing Q, Tsao R, Li H: Synergistic antioxidant effects of petunidin and lycopene in H9c2 cells submitted to hydrogen peroxide: Role of Akt/Nrf2 pathway . J Food Sci 2020, 85 (6):1752-1763. F Y-P, Z L, S Y-Z: Clinical research of tremor type parkinson's disease with PD NO.2 . Tianjin Journal of Traditional Chinese Medicine 2010, 27 (3):190-192. Xiaodong L, Xiaodong W, Xinfu L, Chunling W: Effect of Formula Ⅱ for Parkinson's Disease on the TCM Syndrome of Early Parkinson's Disease Patients with Liver-Kidney Deficiency Syndrome . Journal of Traditional Chinese Medicine 2013, 54 (3):32-35. Tables Table 1 : The primers of DA neuron-specific genes Gene Forward (5' to 3') Reverse (5' to 3') Homo-GAPDH CGGAGTCAACGGATTTGGTC GACAAGCTTCCCGTTCTCAG Homo-TUJ1 GCCTCTTCTCACAAGTACGTGCCTCG GGGCGAAGCCGGGCATGAACAAGTGCA Homo-TH GCCCTACCAAGACCAGACGTA CGTGAGGCATAGCTCCTGAG Homo-FOXA2 GGGAGCGGTGAAGATGGA TCATGTTGCTCACGGAGGAGTA Homo-PITX3 GTGCGGGTGTGGTTCAAGAA AGCTGCCTTTGCATAGCTCG Homo-HO-1 AAGACTGCGTTCCTGCTCAAC AAAGCCCTACAGCAACTGTCG Homo-NQO1 GAAGAGCACTGATCGTACTGGC GGATACTGAAAGTTCGCAGGG Homo-MRP2 AGTGAATGACATCTTCACGTTTG CTTGCAAAGGAGATCAGCAA Homo-GPX2 CTGGTGGTCCTTGGCTTC TGTTCAGGATCTCCTCATTCTG Rat-GAPDH CCTCGTCTCATAGACAAGAT GGGTAGAGTCATACTGGAA Rat-HO-1 TGCACATCCGTGCAGAGAAT CTGGGTTCTGCTTGTTTCGC Rat-NQO1 AGGATGGGAGGTACTCGAATC TGCTAGAGATGACTCGGAAGG Rat-MRP2 GCCCCTCAAGCACTCTGAC GCTTTGTGTCCCAGATGGACT Rat-GPX2 GAGCTGCAATGTCGCTTTCC TGGGTAAGACTAAAGGTGGGC Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-179866","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research","associatedPublications":[],"authors":[{"id":9998508,"identity":"c7eb6102-a243-400c-91cc-69f13242d70c","order_by":0,"name":"Shouhai Wu","email":"","orcid":"","institution":"The Second Affiliated Hospital of Guangzhou University of Chinese Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Shouhai","middleName":"","lastName":"Wu","suffix":""},{"id":9998509,"identity":"92002343-bce0-45c5-81b1-62c08c40296b","order_by":1,"name":"Tongxiang Lin","email":"","orcid":"","institution":"The Second Affiliated Hospital of Guangzhou University of Chinese Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Tongxiang","middleName":"","lastName":"Lin","suffix":""},{"id":9998510,"identity":"c2fbf01f-df79-4c13-8d31-025219bc3a44","order_by":2,"name":"Yang Xu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAuUlEQVRIiWNgGAWjYPACGxBhwMDARryWNNK1HCZBi8Hxs4df87adT+zvP7yB4UPZYSK0nMlLs5zZdjtxxo20AsYZ54jRciDHzOAjUMsGCR4DZt42YrScf2NmkNh2LnED/xkD5r9EabmRY/zgY9uBxA0MOQbMjMRokbzxxgzohWRjkF8O9pxLJ6yF73yO8WeeMjtZYIhtfPCjzJqwFoUDDGwSMM4BwuqBQL6BgfkDUSpHwSgYBaNg5AIAcu5AT2LMwAoAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0001-5574-921X","institution":"The Second Affiliated Hospital of Guangzhuo University of Chinese Medicine","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Yang","middleName":"","lastName":"Xu","suffix":""}],"badges":[],"createdAt":"2021-01-28 21:00:34","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-179866/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-179866/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":5750640,"identity":"39d6bd0a-3c3b-408c-bec8-89d6b3dda8d2","added_by":"auto","created_at":"2021-02-08 20:04:11","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":153117,"visible":true,"origin":"","legend":"LC-MS spectrum for PB-II. The mass spectrum of PB-II was obtained using the LC-MS in drug-containing serum. 1: Citric acid; 2: Hypaconitine; 3: Stibene glucoside; 4: Liquiritin; 5: Paeoniflorin; 6: Ginsenoside Rg1.","description":"","filename":"Fig1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-179866/v1/03f6d6cb210cb4d48fbb6066.jpg"},{"id":5750540,"identity":"6f8087d6-491d-414f-96f4-19179b7851b6","added_by":"auto","created_at":"2021-02-08 20:01:11","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1047704,"visible":true,"origin":"","legend":"Generation of iPSC and differentiate into the dopaminergic neuron. A-B. Representative colonies of passage-20 iPSC stained positive for the pluripotency-associated markers OCT4 and TRA-1-81 (the scale is 20μm). C. Teratomas derived from iPSC have all pluripotency of 3 germ layers. The sections with hematoxylin and eosin staining showed all three germ layers of ectoderm, mesoderm, and endoderm differentiation (the scale is 100μm). D. RT-PCR shows that the iPSC-DA neurons expression about 100 times neurons relative genes such TH, TUJ1, FOXA2 and En1 to the iPSC lines. E. Differentiated cells have the morphology of DA neuron. F. Immunofluorescence staining of neuronal cultures derived from iPSC for neuron-specific TUJ1 (red), the DA marker TH (green), and nuclear DAPI (blue) (the scale is 20μm).","description":"","filename":"Fig2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-179866/v1/6c351d26018613c242041aa8.jpg"},{"id":5750543,"identity":"8d0ea575-3cdd-4ae0-9f45-4bd8db638067","added_by":"auto","created_at":"2021-02-08 20:01:12","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1407224,"visible":true,"origin":"","legend":"PB-II protects the neuronal cell with activated neuronal expressions. A. Immunofluorescence data showed more TUJ1 and TH neuronal stainings in MS sample than those in the ODM and BS samples (the scale is 20μm). B, D. Flow cytometry analysis of the proportion of TH positive cells in each experimental group, compared with the ODM group and the BS group, the MS group had a higher percentage of TH positive cells, with statistically significant differences (n=3, *P≤0.05). C, E. Flow cytometry detected the proportion of apoptosis in each experimental group. Compared with the ODM group and the BS group, the apoptosis in the MS group decreased significantly (n=3, *P≤0.05).","description":"","filename":"Fig3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-179866/v1/7c9e6ea20f07117e05c234dd.jpg"},{"id":5750641,"identity":"353b83d2-e567-4b09-8228-ef1395d411b4","added_by":"auto","created_at":"2021-02-08 20:04:12","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1117765,"visible":true,"origin":"","legend":"Nrf2 pathway genes are activated in medicated cells and reduce ROS. A, B. The higher ROS level activated under H2O2 stress was inhibited by medicated serum. The bar image showed the data and significance (n=3, *P≤0.05). C. The Nrf2 signaling pathway downstream genes, HO-1, NQO1, MRP2, and GPX2, were found in higher levels in MS samples than those in ODM or BS samples, suggesting they are activated and confirmed the Nrf2 pathway is involved in the protection process. D-F. Because Nrf2 genes are regulated in protein modification ways, we checked their expression by Western blotting, and the data showed that both Nrf2 and NQO1 proteins were present in higher levels in medicated samples. We further analyzed the protein gray value with ImageJ software. The results show that the Nrf2 and NQO1 protein in MS samples are significantly more increased than other samples (n=3, *P≤0.05).","description":"","filename":"Fig4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-179866/v1/b42f1a0b2067b5375fe667df.jpg"},{"id":5750542,"identity":"f388480e-8d8c-4def-9ee5-e28b3a2a4916","added_by":"auto","created_at":"2021-02-08 20:01:11","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":919019,"visible":true,"origin":"","legend":"PB-II protects PD rat DA neurons by activating the Nrf2/ARE signaling pathway. A. Immunohistochemical results showed that the TH-positive neurons in the substantia nigra striatum of the PB-II group were significantly increased compared with the Sham and Model groups (the scale is 120μm). B, C. Western blotting detection results showed that the expression of Nrf2 protein in cells of the nigrostriatal region of the midbrain in the PB-II group of rats increased significantly (n=3, *P≤0.05). D. RT-PCR results showed that the expression of Nrf2 downstream genes in the substantia nigra tissues of rats in the PB-II group was significantly increased, suggesting the activation of the Nrf2 signaling pathway of PB-II on DAn cells under 6-OHDA toxicity (n=3, **P≤0.01). E. Calculate the number of rotations of the rats in each experimental group within 30 minutes. From the third week, the number of rotations of the PD-rats in the PB-II group decreased compared with the Model group (n=5, * P≤0.05) and reached a very significant difference in the fourth week (n=5, ** P≤0.01).","description":"","filename":"Fig5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-179866/v1/c3ee7ee0bdd5454f28dd1563.jpg"},{"id":13657102,"identity":"ed697a55-6d31-4129-a120-352007b44dd8","added_by":"auto","created_at":"2021-09-17 10:08:55","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1926087,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-179866/v1/eb3b4028-85ab-400f-ba06-eed35261ef80.pdf"}],"financialInterests":"","formattedTitle":"\u003cp\u003eChinese Medicine PaBing-II Protects Human iPSC Derived Dopaminergic Neurons from Oxygen Stress\u003c/p\u003e","fulltext":[{"header":"Background","content":"\u003cp\u003eParkinson's disease is a common progressive neurodegenerative disease characterized by tremor and bradykinesia [1]. As patients age, their symptoms continue to deteriorate [2]. The hallmark of PD is the degeneration of dopaminergic (DA) neurons in the substantia nigra (SN) and the presence of Lewy bodies (LBs) [2, 3]. While the mechanims underlying PD pathology remains unclear, extensive evidences from postmortem brain tissues suggest that oxidative stress and deficiency of complex I activity are related to PD pathogenesis [4, 5]. Currently there is no cure for PD. The primary treatment of PD is to supplement dopamine or promote endogenous dopamine release. Levodopa, commonly used in the treatment of PD, can significantly improve the motor symptoms of PD, but it cannot prevent the disease progression that eventually leads to the death of DA neurons. The long-term use of L-dopa can also cause movement disorders and insomnia Serious complications such as anxiety [6].\u003c/p\u003e\n\u003cp\u003ePaBing-II Formula (PB-II), a Traditional Chinese Medicine remedy, has been developed and used to treat Parkinson's disease (PD) in the Second Affiliated Hospital of Guangzhou University of Chinese Medicine for over 20 years. PB-II is composed of Wumei 20 g, Coptis 3 g, Paeony 20 g, Angelica 10 g, Aconite 10 g, Rehmannia 10 g, Polygonum multiflorum 20 g, Ligusticum chuanxiong 10 g, Pueraria 20 g, Ginseng 10 g, Acorus 5 g, Gastrodia 10 g, Tortoise plate 10 g, and Roasted licorice 3 g. Wumei nourishes kidney, liver, blood, softens tendons, and balances Yin and Yang to treat the symptoms of involuntary tremor. PaBing-II Formula has significant therapeutic effects on PD patients, especially during the early stage [7, 8]. PB-II can relieve PD patients\u0026rsquo; motor and non-motor symptoms, improve the therapeutic effects of dopaminergic drugs while reducing drug's side effects, and improve patients' quality of life [9, 10]. Previous studies report that gavaging PD rats induced by 6-hydroxydopamine (6-OHDA) with PB-II improve the rotational behavior [11], and protected the dopaminergic neurons from apoptosis [12, 13]. The 6-OHDA can damage the dopaminergic neurons in substantia nigra of midbrain, and lead to the symptoms of PD in mice. The unilaterally lesioned 6-OHDA-lesioned rat model of PD has proved to be invaluable in advancing our understanding of the mechanisms underlying parkinsonian symptoms, and is widely used in PD research [14]. However, the impact of PB-II on human DAn and mechanisms underlying its therapeutic benefit remain to be established.\u003c/p\u003e\n\u003cp\u003eBased on the pluripotency of iPSCs to differentiate into all cell types in the body, the iPSC technology has provided an essential model to study human diseases in dishes [15]. Here, we generated iPSC from human fibroblast and differentiated them into dopaminergic neurons. Using this model, we investigated the mechanisms underlying the therapeutic benefits of PB-II on PD patients.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e\u003cstrong\u003ePB-\u003c/strong\u003e\u003cstrong\u003eII\u003c/strong\u003e\u003cstrong\u003e medicated serum preparation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor PB-II original recipe, refer to previous reports. We prepared slices of Chinese crude drugs from the pharmacy of Guangdong Province Hospital of Chinese medicine, which were decocted twice with 10 and 8 times of water, filtered, and concentrated with water bath at 80℃ to 1.6 kg/L (measured by rude drug weight/volume). Rats took gavage of PB-II twice a day at 32 G\u0026bull;kg\u003csup\u003e-1\u003c/sup\u003e (according to the crude drug meter) according to the body surface area converted from clinical dosage. After gavage for 2 weeks, the rats with 10% chloral hydrate anesthesia were bled of arterial blood and separated for medicated serum in accordance with the method reported in the previous studies [16]. The medicated serum and control serum were inactivated at 56 ℃ for 30 min, then stored at -80 ℃ before use.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLC-MS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLC-MS was conducted through the combined application of Dionex Ultimate 3000 UHPLC (Thermo Fisher Scientific, Waltham, MA, USA) and Q Exactive Orbitrap mass spectrometer. After screening, the analysis was carried out using the Waters\u003csup\u003eTM\u003c/sup\u003e UPLCTM HSS T3 C18 (2.1\u0026times;100 mm, 1.7\u0026mu;m). Chromatographic conditions: Gradient elution was performed with acetonitrile (A) -0.1% formic acid water (B). The elution procedure was: 0 min, 10% A; 5 min, 20% A; 20 min, 60% A; 25 min, 90% A; 28 min 90% A; 29-33min 10% A. The flow rate was 0.2 mL/min. Mass spectrometry conditions: The samples were ionized by ESI ion source and then analyzed by Q ExactiveOrbitrap high-resolution mass spectrometer. The main parameters of the ESI ion source are: spray voltage 3500V (Anion voltage -3500V), capillary temperature 350 ℃; Sheath gas: 40, Auxiliary gas, 15. All other parameters are default. The liquid eluent with a retention time of 0.5-29 min was selected by the automatic switching valve for mass spectrometry analysis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGeneration of human DA neurons from iPS cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe selected an iPS cell line from a healthy human skin cell line preserved in our laboratory. According to the previous reports [17], we differentiated the DA neuron from the iPSC with the necessary media and related cytokines. iPSCs were plated at 4\u0026times;10\u003csup\u003e4\u003c/sup\u003e\u0026nbsp;cells/cm\u003csup\u003e2\u003c/sup\u003e on Matrigel (BD)-coated tissue culture dishes for differentiation. N2B27-CDM + bFGF (20ng/ml) was used to culture for 3 days. The differentiation was performed in the KSR medium. On day 3, the cell should be almost confluent (over 80%). The culture was gradually changed to the N2 medium, supplemented at day 0-5 with SB431542 (5 \u0026mu;M)+LDN-193189 (100 nM)+Iwp2 (1 \u0026mu;M) to get retinal progenitor, and then split in 1:3 ratio for the next six passages using Accutase. Neural induction media supplemented with 3 \u0026mu;M CHIR99021 and 2 \u0026mu;M on X-ray inactivated MEF feeders or Matrigel-coated plates was used to culture the cells. On day 6-10, induction factors were withdrawn, meanwhile adding PD173074 (0.2 \u0026mu;M)+DAPT (10 \u0026mu;M) for retinal ganglion cell inductions. On day 10-15, the medium was changed to N2, B27 and 300 m\u0026mu;g/mL cAMP (Sigma-Aldrich) adding 100 ng/mL SHH (C24Ⅱ) and 100 ng/mL FGF8b. We then added 10 ng/mL BDNF, 10 ng/mL GDNF, 10 ng/mL IGF-1, 1 ng/mL TGF-\u0026beta;, and 0.5 mM db-cAMP and continued culturing cells for 30 days. We collected the cell and detected the cells with dopaminergic neuronal markers, such as TH and TUJ1. We used primary antibodies, which were as follows: Tyrosine Hydroxylase Antibody (CST-2791), \u0026beta;3-Tubulin (TU-20) Antibody (CST-4466), DAPI (Sigma-D9542). The primers of DA neuron-specific genes are shown in the following table.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eThe immunofluorescence method\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCells were fixed using 4% v/v paraformaldehyde (Alfa Aesar), washed three times with PBS containing 0.2% v/v Tween (PBST) (Fisher Scientific), and permeablized using 0.15% v/v TritionX-100 (Sigma-Aldrich) in PBS for 1 hr at 25 ℃. After gentle removal of PBST, cells were incubated with the primary antibody in PBST overnight at 4 ℃. After that, cells were washed three times with PBST and stained with the secondary antibody for 1 hr at 37 ℃. The cells were washed three times in PBST, stained with DAPI, and viewed with a Laser scanning confocal microscope (Carl Zeiss-710). Dopaminergic neuron-specific TH antibody, TUJ1 staining, To observe the ratio of dopaminergic neurons, we statistically analyzed the proportion of TH+/TUJ1+ double positive in all the cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eThe establishment of DA neurons oxidation model\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCultured DA neurons were treated with 100 \u0026mu;M H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e for 12 h in accordance with the method previously reported [18]. After the treatment, we carried out examinations of apoptosis and the ROS levels in the cells. By flow cytometry analysis, we found that ROS and apoptosis increased significantly. And the IF data showed that the ratio of TH/TUJ1 double-positive cells in H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e treated cells decreased significantly, which is considered to be a DA neuron model of oxidative damage.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eExperimental grouping\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe neural cell culture and DA neuronal cells were randomly divided into 4 groups, including the control group (Ctrl), oxidative damage model (ODM), blank serum group (BS), and medicated serum group (MS). Control cells were cultured in normal conditions, and the other cultures were treated separately. We added 10% mock serum in the BS group and 10% medicated serum in the MS group but continued normal condition without supplementing the model sample for 24 hours. On the following day, the 3 treatment groups, including the BS group, MS group, and the ODM group, were treated at 100 \u0026mu;M H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e for another 12 hours. Finally, all cell samples were examined for cell apoptosis, DA neuronal activity, ROS, and Nrf2 signal pathway gene expressions.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFlow cytometry analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe used flow cytometry to analyze the TH positive ratio, apoptosis, and ROS levels. For TH detection, we used intracellular staining. The cells were digested, fixed with 4% paraformaldehyde, and blocked with BSA. The TH-antibody (ab75875, 1/100 dilution) was then for 30 min at 22\u0026ordm;C. The secondary antibody used was DyLight- 488 goat anti-rabbit IgG (H+L) (ab96899) at 1/500 dilution for 30 min at 22\u0026ordm;C. Acquisition of \u0026gt;5,000 events was performed. For apoptosis detection, we used the KEYGEN apoptosis kit (#KGA108-1) according to the manufacturer\u0026rsquo;s instructions. We also checked Annexin V-FITC/PI staining through flow cytometry with software (BD). ROS were detected with the Reactive Oxygen Species kit (#KGT010-1) according to the manufacturer\u0026rsquo;s instructions. The brief principle for the detection of ROS was based on the fluorescent probe DCFH-DA. Intracellular ROS can oxidize non-color DCFH into fluorescent DCF. Thus, flow cytometry could be used to detect the fluorescence intensity for ROS levels.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eNrf2/ARE signal detection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWestern blotting was carried out for the detection of Nrf2 protein in each group of cells. ImageJ software was used to analyze the protein gray value. The RT-PCR detection was for Nrf2 downstream gene mRNAs, such as HO-1, NQO1, MRP2, and GPX2. The primer sequences are shown in the following table.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eQuantification and statistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData are represented as mean \u0026plusmn; SEM unless otherwise indicated, and Student\u0026rsquo;s t-test was used for comparing two groups. F-test was used for comparing variances. For comparing multiple groups, one-way ANOVA or two-way ANOVA were used. n was indicated in figure legends. GraphPad Prism 5 software was used for statistical analysis. Differences between two groups were considered significant when the \u003cem\u003eP\u003c/em\u003e-value was less than 0.05 (* \u003cem\u003ep\u003c/em\u003e \u0026le; 0.05, ** \u003cem\u003ep\u003c/em\u003e \u0026le; 0.01, *** \u003cem\u003ep\u003c/em\u003e \u0026le; 0.001; n.s., not significant. Error bars indicate means \u0026plusmn;s.d.).\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eQuality control test of medicated serum\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe used liquid chromatography and mass spectrometry (LC-MS) method to analyze the active ingredients in the medicated serum, and analyze the main six compounds in the whole recipe (citric acid (Figure 1-1), hypaconitine (Figure 1-2), stilbene glucoside (Figure 1-3), glycyrrhizin (Figure 1-4), paeoniflorin (Figure 1-5), Ginsenoside Rg1 (Figure 1-6)). Perform identification and simultaneous detection to provide a reference for the quality control of PB-II. The detailed map is shown in Figure 1.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGeneration of hiPSC and their differentiation into DAn\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe derived an iPSC line from healthy human skin fibroblasts as previously described. Briefly, we used a Nucleotransfection Kit (P2 primary cell 4D-Nucleotector X Kit, Lonza) to transfect the Y4 episomal vectors (pCXLE-hOCT3/4-shp53, pCXLE-hSK and pCXLE-hUL, \u003ca href=\"https://www.addgene.org/browse/article/4195/\"\u003eOkita et al Nat Methods. 2011\u003c/a\u003e) to the fibroblasts with the procedure of DT-130. Cells were cultured in ESC medium containing DMEM/F12 (Gibco, 11330), KnockOut\u0026trade; Serum Replacement (Gibco), MEM non-essential amino acids (Gibco), L-glutamine (Gibco), 55\u0026nbsp;mM \u0026beta;-mercaptoethanol (Gibco) and 20ng bFGF (Gibco), on feeders which were taken from CF1 mouse embryos and subjected to radioactive irradiation with the dose of 30 Gy advance. Colones with hESC morphology appeared between day 25 and 45. They were picked and expanded under hESC culture condition. The pluripotency of the hiPSC line was confirmed by the colony morphology, the expression of the pluripotency markers OCT4 and TRA-1-81, and the formation of teratomas in NSG mice (Figure 2A-C). These data confirmed the pluripotency of the hiPSCs.\u003c/p\u003e\n\u003cp\u003eUsing the protocol described previously (Li W et al., 2011, PANS), we differentiated hiPSCs into dopaminergic neurons. We confirmed the presence of dopamine neurons in the differentiating culture using DAn-specific markers. DAn-specific genes such as Tyrosine\u0026nbsp;hydroxylase\u0026nbsp;, TUBB3 (TUJ1), FOXA2, and Engrailed 1 (EN1) were significantly increased in iPSC-derived DAn culture (Figure 2D). In addition, the cell morphology confirmed the morphological characteristics of DA neurons (Figure 2E). Immunofluorescence (IF) analysis demonstrated that about 60% of iPSC-derived cells expressed the neuron-specific markers TUJ1, and about 40% of iPSC-derived neurons were TH\u003csup\u003e+\u003c/sup\u003e/TUJ1\u003csup\u003e+\u003c/sup\u003e, confirming the presence of hiPSC-derived DAn (Figure 2F). .\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePB-\u003c/strong\u003e\u003cstrong\u003eII\u003c/strong\u003e\u003cstrong\u003e protects DA neurons from oxidative damage induced by H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eImmunofluorescence data showed more TUJ1\u003csup\u003e+\u003c/sup\u003eTH\u003csup\u003e+\u003c/sup\u003e neurons in the PB-II medicated serum (MS) sample than those in the oxidative damage model sample (ODM) which was prepared by H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e damage and blank serum (BS) samples (Figure 3A). While TUJ1\u003csup\u003e+\u003c/sup\u003eTH\u003csup\u003e+\u003c/sup\u003e neurons were obviously decreased in the ODM group after the treatment with H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e, MS could significantly increase TUJ1\u003csup\u003e+\u003c/sup\u003eTH\u003csup\u003e+\u003c/sup\u003e neurons, indicating that MS could protect TUJ1\u003csup\u003e+\u003c/sup\u003eTH\u003csup\u003e+\u003c/sup\u003e neurons from oxidative stress (Figure 3A). In support of this conclusion, flow cytometric analysis indicated that the percentage of TH\u003csup\u003e+\u003c/sup\u003e cells in the MS group was significantly higher than that in the ODM or BS group (Figure 3B, 3C). We further analyzed the percentage of apoptosis in each experimental group, indicating that MS protected the neuronal apoptosis after H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e treatment (Figure 3D, 3E).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePB-\u003c/strong\u003e\u003cstrong\u003eII\u003c/strong\u003e\u003cstrong\u003e activates the Nrf2/ARE signaling pathway and reduces cellular ROS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn order to explore the mechanism of PB-II\u0026nbsp;to protect DAn from oxidative stress\u0026nbsp;neurons,\u0026nbsp;we examined the\u0026nbsp;ROS levels of hiPSC-derived neuronal culture after various treatments. While the ROS levels were similar between the ODM and BS treatment groups, MS significantly decreased cellular ROS in hiPSC-derived neuronal culture, supporting a role of PB-II in reducing\u0026nbsp;oxidative stress (Figure 4A, 4B). Together, these findings support the notion that PB-II can protect DAn from oxidative stress by reducing cellular ROS levels.\u003c/p\u003e\n\u003cp\u003eAs reported before, the ROS triggers the redox system by activating Nrf2, which induces its downstream genes such as HO-1, NQO1, MRP2, and GPX2. After the treatment with H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e (100\u0026mu;M, 12h), Nrf2 protein levels and its downstream gene expression was statistically similar to those of the Ctrl group (Figure 4C-F). However, MS treatment significantly increases the expression of Nrf2 protein and its downstream genes such as NQO1 (Figure 4C-F). Therefore, PB-II can activate the Nrf2/ARE signaling pathway to protect DAn from oxidative stress.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePB-\u003c/strong\u003e\u003cstrong\u003eII\u003c/strong\u003e\u003cstrong\u003e improves the symptoms of PD rats by activating the Nrf2/ARE signaling pathway\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo further validate the findings that PB-II can activate the Nrf2/ARE signaling pathway to protect DAn from oxidative stress, we tested the effects of PB-II on PD rat models by injecting 6-OHDA into the substantia nigra striatum of rats to induce the death of midbrain DAn (Model group). The Sham operation group was injected with the same volume of normal saline (Sham group). The PB-II group was given 32g / kg of PB-II by gavage. During the treatment course of 4 weeks, the behavioral symptoms of PD rats were measured weekly. The spinal behavior in PD rats was induced by the subcutaneous injection of APO in the back of the neck, and the number of rotations was recorded within 30 minutes. During the initial stage of treatment (0 weeks), the rats in the Ctrl group and the Sham group had no symptoms of in-situ circles. However, the model group and PB-II group showed serious rotationary behavior with more than 210 rotations in 30 minutes, and there was no significant difference between the two groups. During the third week of the treatment, the number of rotations of rats was significantly reduced in the PB-II group (Figure 5E). After 4 weeks of treatment, we euthanized the rats and obtained the tissues of the nigrostriatal region. The number of TH\u003csup\u003e+\u003c/sup\u003e neurons in the substantia nigra striatum of rats in the PB-II group was significantly higher than those in the Sham group and Model group (Figure 5A). In addition, the levels of Nrf2 protein in midbrain dopamine neurons of rats in the PB-II group were significantly higher than those in the Sham group and Model group (Figure 5B and Figure 5C). The expression of HO-1, NQO1, MRP2, and GPX2 in the midbrain dopaminergic neurons of the PB-II group was also significantly increased, indicating the activation of the Nrf2/ARE signaling pathway by PB-II (Figure 5D). These data confirm that PB-II activates the Nrf2 / ARE signal pathway in the midbrain of PD rats by activating Nrf2 to reduce oxidative stress in DAn, and thus protecting DAn from oxidative stress induced apoptosis.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIt is commonly believed that oxidative stress can eventually lead to the death of dopaminergic neurons [19-21], and the activation of the endogenous antioxidant system may protect the cells from oxidative damage, which is a research hotspot at present [21]. Multiple studies in various organs have confirmed that the Nrf2- antioxidant response element (ARE) pathway can play a role of endogenous antioxidant to antagonize the oxidative stress injury [22]. In the central nervous system cells, such as dopaminergic neurons, astrocytes, and microglia, Nrf2 maintains the redox balances through the up-regulation of antioxidant gene expression [23]. Previous researches have verified that Nrf2 mostly translocates to the nucleus in the dopaminergic neurons in the substantia nigra of PD patients, while it is present in the cytoplasm in the matched normal control group of the same age [16, 24, 25]. Besides, studies have also demonstrated that overexpression of Nrf2 can reduce the damage of 6-OHDA in dopaminergic neurons [19, 26]. Under physiological condition, Nrf2 protein expression levels were low in cells, mainly in the cytoplasm, where it can interact with Kelch-like ECH associated protein-1 (Keap1) [27, 28]. When the occurrence of oxidative stress, Nrf2 phosphorylation, and Keap1 protein translocation into the uncoupling combine with ARE in the nucleus, regulation on downstream target genes, such as Heme Oxygenase-1 (HO-1) and NAD(P)H quinone dehydrogenase 1 (NQO1), is induced, to enhance the process of detoxification and antioxidant ability of cells [29-31]. \u003cem\u003eIn vitro\u003c/em\u003e experiments have also shown that the up-regulation of HO-1 and NQO1 can protect cells against oxidative damage of glutamic acid, hydrogen peroxide, and amyloid beta-protein [32-34].\u003c/p\u003e\n\u003cp\u003eOur experiments showed that the PB-II medicated serum could effectively reduce ROS levels in the oxidation model of dopaminergic neurons, protecting dopaminergic neurons from apoptotic death. These results suggested the Nrf2/ARE pathway-mediated antioxidant mechanism might play the role of the PB-II in treating this neurodegenerative disease. When neurotoxic substances, such as H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e, are transported by the dopamine transporter system into neuron cells, and induce oxidative stress and increase DA neuron apoptosis. Compared with the Model group, the Medicated serum group had highly up-regulated nuclear protein Nrf2 and its downstream HO-1, NQO1, MRP2, and GPX2 expression. The results suggest that PB-II plays a protective role in the oxidative stress in neurons through increased nuclear accumulation and phosphorylation of Nrf2, as well as the expression of Nrf2 downstream target genes. PB-II contains 14 kinds of Traditional Chinese Medicine compounds. Although the complex compound composition of these natural Chinese herbal medicine is not very clear, its function has been significantly observed and confirmed by a lot of clinicians in the clinical practice for many years [9, 10, 35, 36]. Furthermore, several researchers have reported its protective effects on midbrain dopaminergic neurons against 6-OHDA toxicity in substantia nigra in rat models [11-13]. PB-II reduces the apoptosis of DA neurons in the PD rats model, promotes cell regeneration, and finally plays a role in improving rats\u0026rsquo; PD symptoms. This study may provide further evidence in iPSC-derived DA neurons and elaborate reversal of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e-induced oxidative stress. Furthermore, our experiments provide a useful model for in vitro PD studies on complicated Chinese medicine formulas.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003ePB-II activated Nrf2 signaling pathway in oxidative damaged DA neurons, increasing the expression of antioxidant genes downstream of Nrf2, thereby improving the antioxidant capacity of neurons and reducing the ROS and apoptosis. PB-II might protect DA neurons from functional damage by this mechanism, and thus play a role in the treatment of PD.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003ePD: Parkinson's Disease; PB-II: PaBing-II; DAn: Dopaminergic neurons; iPSCs: induced Pluripotent Stem Cells; ROS: Reactive Oxygen Species; Nrf2: Nuclear erythroid-derived Factor 2; 6-OHDA: 6-Hydroxydopamine; SN: Substantia Nigra; LBs: Lewy bodies; LC-MS: Liquid Chromatograph-Mass Spectrometer; Ctrl: the Control group; ODM: Oxidative Damage Model; BS: Blank Serum group; MS: Medicated Serum group; IF: Immunofluorescence; RT-PCR: Reverse Transcription-Polymerase Chain Reaction; TH: Tyrosine Hydroxylase; TUJ1: \u0026beta;3-Tubulin; HO-1: Heme Oxygenase 1; NQO1: NAD(P)H quinone dehydrogenase 1.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe would like to thank Xiaodong Luo, Beibei Zhao, Qingfeng Xie, Qiuxiang Yi and Wen Xu, Guangdong Provincial Hospital of traditional Chinese medicine, for providing PB-II prescription and assistance in experimental research.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eXY conceived and designed the work; SHW performed the experiments; TXL analyzed the data and wrote the original draft; XY reviewed and revised the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Medical Scientific Research Foundation of Guangdong Province of China (Grant No. A2016437), the Guangdong basic and applied basic research fund project (Grant No. 2020A1515110450) and the Project of Administration of Traditional Chinese Medicine of Guangdong Province of China (Grant No. 20211183).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study was approved by the Guangdong Provincial Hospital of TCM Review Board for Ethics. People\u0026rsquo;s cell samples used in our experiments were approved by the board, with all patients providing written informed consent. The animal experiments were approved by the Animal Review Board at Guangdong Provincial Hospital of Chinese Medicine.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor details\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e1 \u003c/sup\u003eCenter for Regenerative and Translational Medicine, Guangdong Provincial Academy of Chinese Medical Sciences, the Second Affiliated Hospital of Guangzhou University of Chinese Medicine, Guangzhou 510632, Guangdong, China; \u003csup\u003e2 \u003c/sup\u003eSchool of Basic Medical Sciences, Southern Medical University, Guangzhou, Guangdong, 510515, China.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eHayes MT: \u003cstrong\u003eParkinson's Disease and Parkinsonism\u003c/strong\u003e. \u003cem\u003eAm J Med \u003c/em\u003e2019, \u003cstrong\u003e132\u003c/strong\u003e(7):802-807.\u003c/li\u003e\n\u003cli\u003eKalia LV, Lang AE: \u003cstrong\u003eParkinson's disease\u003c/strong\u003e. \u003cem\u003eLancet \u003c/em\u003e2015, \u003cstrong\u003e386\u003c/strong\u003e(9996):896-912.\u003c/li\u003e\n\u003cli\u003eMusgrove RE, Helwig M, Bae EJ, Aboutalebi H, Lee SJ, Ulusoy A, Di Monte DA: \u003cstrong\u003eOxidative stress in vagal neurons promotes parkinsonian pathology and intercellular \u0026alpha;-synuclein transfer\u003c/strong\u003e. \u003cem\u003eJ Clin Invest \u003c/em\u003e2019, \u003cstrong\u003e129\u003c/strong\u003e(9):3738-3753.\u003c/li\u003e\n\u003cli\u003eHenchcliffe C, Beal MF: \u003cstrong\u003eMitochondrial biology and oxidative stress in Parkinson disease pathogenesis\u003c/strong\u003e. \u003cem\u003eNat Clin Pract Neurol \u003c/em\u003e2008, \u003cstrong\u003e4\u003c/strong\u003e(11):600-609.\u003c/li\u003e\n\u003cli\u003eZhao J, Yu S, Zheng Y, Yang H, Zhang J: \u003cstrong\u003eOxidative Modification and Its Implications for the Neurodegeneration of Parkinson's Disease\u003c/strong\u003e. \u003cem\u003eMol Neurobiol \u003c/em\u003e2017, \u003cstrong\u003e54\u003c/strong\u003e(2):1404-1418.\u003c/li\u003e\n\u003cli\u003eVoon V, Napier TC, Frank MJ, Sgambato-Faure V, Grace AA, Rodriguez-Oroz M, Obeso J, Bezard E, Fernagut PO: \u003cstrong\u003eImpulse control disorders and levodopa-induced dyskinesias in Parkinson's disease: an update\u003c/strong\u003e. \u003cem\u003eLancet Neurol \u003c/em\u003e2017, \u003cstrong\u003e16\u003c/strong\u003e(3):238-250.\u003c/li\u003e\n\u003cli\u003eFan YP, Zeng L, Sun ZY, Su QZ, Lian XF: \u003cstrong\u003eClinical research of tremor type parkinson's disease with PD NO.2\u003c/strong\u003e. \u003cem\u003eTianjin Journal of Traditional Chinese Medicine \u003c/em\u003e2010, \u003cstrong\u003e27\u003c/strong\u003e(03):190-191 %@ 1672-1519 %L 1612-1349/R %W CNKI.\u003c/li\u003e\n\u003cli\u003eLuo X, Wen X, Lian X, Wang C:\u003cstrong\u003e Effect of Formula \u003c/strong\u003e\u003cstrong\u003eⅡ\u003c/strong\u003e\u003cstrong\u003e for Parkinson's Disease on the TCM Syndrome of Early Parkinson's Disease Patients with Liver-Kidney Deficiency Syndrome\u003c/strong\u003e. \u003cem\u003eJournal of Traditional Chinese Medicine \u003c/em\u003e2013, \u003cstrong\u003e54\u003c/strong\u003e(01):32-34.\u003c/li\u003e\n\u003cli\u003eXiao-Dong W, Ding R, Chun-Ling W, De-Yan K, Kai-Hua W: \u003cstrong\u003eEffects of Chinese herbal medicine Pabing \u003c/strong\u003e\u003cstrong\u003eⅡ\u003c/strong\u003e\u003cstrong\u003e Formula on quality of life of patients with Parkinson's disease at early-stage\u003c/strong\u003e. \u003cem\u003eChina Journal of Traditional Chinese Medicine and Pharmacy \u003c/em\u003e2013, \u003cstrong\u003e28\u003c/strong\u003e(10):2917-2921.\u003c/li\u003e\n\u003cli\u003eChun-Ye Z, Xin-Fu L, Xiu-Ju Z, Yun L, Xiao-Dong L: \u003cstrong\u003eTherapeutic effect evaluation of modified Wumei Pills on Parkinson's disease\u003c/strong\u003e. \u003cem\u003eChina Journal of Traditional Chinese Medicine and Pharmacy \u003c/em\u003e2013, \u003cstrong\u003e28\u003c/strong\u003e(3):1673-1727.\u003c/li\u003e\n\u003cli\u003eXiao-Dong W, Xiao-Dong L, Chun-Ling W: \u003cstrong\u003eExperimental Study on Protective Effects of Pabing \u003c/strong\u003e\u003cstrong\u003eⅡ\u003c/strong\u003e\u003cstrong\u003e Formula in Parkinson's Disease Rats\u003c/strong\u003e. \u003cem\u003eChinese Journal of Experimental Traditional Medical Formulae \u003c/em\u003e2012(9):224-228.\u003c/li\u003e\n\u003cli\u003eYuzhi S, Xiaodong L, Beibei Z, Shouhai W, Xiaofeng C: \u003cstrong\u003eEffect of Pa-Bing Formula No.2 on Morphological Changes of Substantia Nigra Cells in Parkinson's Disease Rats\u003c/strong\u003e. \u003cem\u003eModernization of Traditional Chinese Medicine and Materia Medica-World Science and Technology \u003c/em\u003e2014, \u003cstrong\u003e16\u003c/strong\u003e(10):2131-2136.\u003c/li\u003e\n\u003cli\u003eXiao-Dong W, Chun-Ling W, Xiao-Dong L: \u003cstrong\u003eInvolvement in Neuroprotective Effect of Pabing II Formula on the Dopaminergic Neurons of Parkinson's disease Rats\u003c/strong\u003e. \u003cem\u003eLishizhen Medicine and Materia Medica Research \u003c/em\u003e2013, \u003cstrong\u003e24\u003c/strong\u003e(3):568-571.\u003c/li\u003e\n\u003cli\u003eThiele SL, Warre R, Nash JE: \u003cstrong\u003eDevelopment of a unilaterally-lesioned 6-OHDA mouse model of Parkinson's disease\u003c/strong\u003e. \u003cem\u003eJ Vis Exp \u003c/em\u003e2012(60).\u003c/li\u003e\n\u003cli\u003eTabata Y, Okano H: \u003cstrong\u003eModeling Familial Parkinson's Disease Using Patient-specific Induced Pluripotent Stem Cells\u003c/strong\u003e. \u003cem\u003eBrain Nerve \u003c/em\u003e2019, \u003cstrong\u003e71\u003c/strong\u003e(8):875-883.\u003c/li\u003e\n\u003cli\u003eAmmal Kaidery N, Ahuja M, Thomas B: \u003cstrong\u003eCrosstalk between Nrf2 signaling and mitochondrial function in Parkinson's disease\u003c/strong\u003e. \u003cem\u003eMol Cell Neurosci \u003c/em\u003e2019, \u003cstrong\u003e101\u003c/strong\u003e:103413.\u003c/li\u003e\n\u003cli\u003eAlvarez-Carbonell D, Ye F, Ramanath N, Garcia-Mesa Y, Knapp PE, Hauser KF, Karn J: \u003cstrong\u003eCross-talk between microglia and neurons regulates HIV latency\u003c/strong\u003e. \u003cem\u003ePLoS Pathog \u003c/em\u003e2019, \u003cstrong\u003e15\u003c/strong\u003e(12):e1008249.\u003c/li\u003e\n\u003cli\u003eGuan H, Yang H, Yang M, Yanagisawa D, Bellier JP, Mori M, Takahata S, Nonaka T, Zhao S, Tooyama I: \u003cstrong\u003eMitochondrial ferritin protects SH-SY5Y cells against H(2)O(2)-induced oxidative stress and modulates \u0026alpha;-synuclein expression\u003c/strong\u003e. \u003cem\u003eExp Neurol \u003c/em\u003e2017, \u003cstrong\u003e291\u003c/strong\u003e:51-61.\u003c/li\u003e\n\u003cli\u003eKwon SH, Lee SR, Park YJ, Ra M, Lee Y, Pang C, Kim KH: \u003cstrong\u003eSuppression of 6-Hydroxydopamine-Induced Oxidative Stress by Hyperoside Via Activation of Nrf2/HO-1 Signaling in Dopaminergic Neurons\u003c/strong\u003e. \u003cem\u003eInt J Mol Sci \u003c/em\u003e2019, \u003cstrong\u003e20\u003c/strong\u003e(23).\u003c/li\u003e\n\u003cli\u003eLim HS, Kim JS, Moon BC, Ryu SM, Lee J, Park G: \u003cstrong\u003eBatryticatus Bombyx Protects Dopaminergic Neurons Against MPTP-Induced Neurotoxicity by Inhibiting Oxidative Damage\u003c/strong\u003e. \u003cem\u003eAntioxidants (Basel) \u003c/em\u003e2019, \u003cstrong\u003e8\u003c/strong\u003e(12).\u003c/li\u003e\n\u003cli\u003eRamirez-Moreno MJ, Duarte-Jurado AP, Gopar-Cuevas Y, Gonzalez-Alcocer A, Loera-Arias MJ, Saucedo-Cardenas O, Montes de Oca-Luna R, Rodriguez-Rocha H, Garcia-Garcia A: \u003cstrong\u003eAutophagy Stimulation Decreases Dopaminergic Neuronal Death Mediated by Oxidative Stress\u003c/strong\u003e. \u003cem\u003eMol Neurobiol \u003c/em\u003e2019, \u003cstrong\u003e56\u003c/strong\u003e(12):8136-8156.\u003c/li\u003e\n\u003cli\u003eRaghunath A, Sundarraj K, Nagarajan R, Arfuso F, Bian J, Kumar AP, Sethi G, Perumal E: \u003cstrong\u003eAntioxidant response elements: Discovery, classes, regulation and potential applications\u003c/strong\u003e. \u003cem\u003eRedox Biol \u003c/em\u003e2018, \u003cstrong\u003e17\u003c/strong\u003e:297-314.\u003c/li\u003e\n\u003cli\u003eSivandzade F, Bhalerao A, Cucullo L: \u003cstrong\u003eCerebrovascular and Neurological Disorders: Protective Role of NRF2\u003c/strong\u003e. \u003cem\u003eInternational journal of molecular sciences \u003c/em\u003e2019, \u003cstrong\u003e20\u003c/strong\u003e(14).\u003c/li\u003e\n\u003cli\u003eGuo C, Zhu J, Wang J, Duan J, Ma S, Yin Y, Quan W, Zhang W, Guan Y, Ding Y\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eNeuroprotective effects of protocatechuic aldehyde through PLK2/p-GSK3\u0026beta;/Nrf2 signaling pathway in both in vivo and in vitro models of Parkinson's disease\u003c/strong\u003e. \u003cem\u003eAging (Albany NY) \u003c/em\u003e2019, \u003cstrong\u003e11\u003c/strong\u003e(21):9424-9441.\u003c/li\u003e\n\u003cli\u003ePetrillo S, Schirinzi T, Di Lazzaro G, D'Amico J, Colona VL, Bertini E, Pierantozzi M, Mari L, Mercuri NB, Piemonte F\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eSystemic activation of Nrf2 pathway in Parkinson's disease\u003c/strong\u003e. \u003cem\u003eMov Disord \u003c/em\u003e2020, \u003cstrong\u003e35\u003c/strong\u003e(1):180-184.\u003c/li\u003e\n\u003cli\u003eSun Y, He L, Wang T, Hua W, Qin H, Wang J, Wang L, Gu W, Li T, Li N\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eActivation of p62-Keap1-Nrf2 Pathway Protects 6-Hydroxydopamine-Induced Ferroptosis in Dopaminergic Cells\u003c/strong\u003e. \u003cem\u003eMol Neurobiol \u003c/em\u003e2020, \u003cstrong\u003e57\u003c/strong\u003e(11):4628-4641.\u003c/li\u003e\n\u003cli\u003eBaird L, Yamamoto M: \u003cstrong\u003eThe Molecular Mechanisms Regulating the KEAP1-NRF2 Pathway\u003c/strong\u003e. \u003cem\u003eMol Cell Biol \u003c/em\u003e2020, \u003cstrong\u003e40\u003c/strong\u003e(13).\u003c/li\u003e\n\u003cli\u003eWang J, Lu Q, Cai J, Wang Y, Lai X, Qiu Y, Huang Y, Ke Q, Zhang Y, Guan Y\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eNestin regulates cellular redox homeostasis in lung cancer through the Keap1-Nrf2 feedback loop\u003c/strong\u003e. \u003cem\u003eNat Commun \u003c/em\u003e2019, \u003cstrong\u003e10\u003c/strong\u003e(1):5043.\u003c/li\u003e\n\u003cli\u003eLuo J, Yan D, Li S, Liu S, Zeng F, Cheung CW, Liu H, Irwin MG, Huang H, Xia Z: \u003cstrong\u003eAllopurinol reduces oxidative stress and activates Nrf2/p62 to attenuate diabetic cardiomyopathy in rats\u003c/strong\u003e. \u003cem\u003eJ Cell Mol Med \u003c/em\u003e2020, \u003cstrong\u003e24\u003c/strong\u003e(2):1760-1773.\u003c/li\u003e\n\u003cli\u003eWu GD, Li ZH, Li X, Zheng T, Zhang DK: \u003cstrong\u003emicroRNA-592 blockade inhibits oxidative stress injury in Alzheimer's disease astrocytes via the KIAA0319-mediated Keap1/Nrf2/ARE signaling pathway\u003c/strong\u003e. \u003cem\u003eExp Neurol \u003c/em\u003e2020, \u003cstrong\u003e324\u003c/strong\u003e:113128.\u003c/li\u003e\n\u003cli\u003eWu H, Jia L: \u003cstrong\u003eScutellarin attenuates hypoxia/reoxygenation injury in hepatocytes by inhibiting apoptosis and oxidative stress through regulating Keap1/Nrf2/ARE signaling\u003c/strong\u003e. \u003cem\u003eBiosci Rep \u003c/em\u003e2019, \u003cstrong\u003e39\u003c/strong\u003e(11).\u003c/li\u003e\n\u003cli\u003eCui R, Tian L, Lu D, Li H, Cui J: \u003cstrong\u003eExendin-4 Protects Human Retinal Pigment Epithelial Cells from H2O2-Induced Oxidative Damage via Activation of NRF2 Signaling\u003c/strong\u003e. \u003cem\u003eOphthalmic Res \u003c/em\u003e2020, \u003cstrong\u003e63\u003c/strong\u003e(4):404-412.\u003c/li\u003e\n\u003cli\u003eDu Y, You L, Ni B, Sai N, Wang W, Sun M, Xu R, Yao Y, Zhang Z, Qu C\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003ePhillyrin Mitigates Apoptosis and Oxidative Stress in Hydrogen Peroxide-Treated RPE Cells through Activation of the Nrf2 Signaling Pathway\u003c/strong\u003e. \u003cem\u003eOxid Med Cell Longev \u003c/em\u003e2020, \u003cstrong\u003e2020\u003c/strong\u003e:2684672.\u003c/li\u003e\n\u003cli\u003eZheng S, Deng Z, Chen F, Zheng L, Pan Y, Xing Q, Tsao R, Li H: \u003cstrong\u003eSynergistic antioxidant effects of petunidin and lycopene in H9c2 cells submitted to hydrogen peroxide: Role of Akt/Nrf2 pathway\u003c/strong\u003e. \u003cem\u003eJ Food Sci \u003c/em\u003e2020, \u003cstrong\u003e85\u003c/strong\u003e(6):1752-1763.\u003c/li\u003e\n\u003cli\u003eF Y-P, Z L, S Y-Z: \u003cstrong\u003eClinical research of tremor type parkinson's disease with PD NO.2\u003c/strong\u003e. \u003cem\u003eTianjin Journal of Traditional Chinese Medicine \u003c/em\u003e2010, \u003cstrong\u003e27\u003c/strong\u003e(3):190-192.\u003c/li\u003e\n\u003cli\u003eXiaodong L, Xiaodong W, Xinfu L, Chunling W: \u003cstrong\u003eEffect of Formula \u003c/strong\u003e\u003cstrong\u003eⅡ\u003c/strong\u003e\u003cstrong\u003e for Parkinson's Disease on the TCM Syndrome of Early Parkinson's Disease Patients with Liver-Kidney Deficiency Syndrome\u003c/strong\u003e. \u003cem\u003eJournal of Traditional Chinese Medicine \u003c/em\u003e2013, \u003cstrong\u003e54\u003c/strong\u003e(3):32-35.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003e\u003cstrong\u003eTable 1 : The primers of DA neuron-specific genes\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\"\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd width=\"116\"\u003e\n\u003cp\u003eGene\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"230\"\u003e\n\u003cp\u003eForward (5' to 3')\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"247\"\u003e\n\u003cp\u003eReverse (5' to 3')\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"116\"\u003e\n\u003cp\u003eHomo-GAPDH\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"230\"\u003e\n\u003cp\u003eCGGAGTCAACGGATTTGGTC\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"247\"\u003e\n\u003cp\u003eGACAAGCTTCCCGTTCTCAG\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"116\"\u003e\n\u003cp\u003eHomo-TUJ1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"230\"\u003e\n\u003cp\u003eGCCTCTTCTCACAAGTACGTGCCTCG\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"247\"\u003e\n\u003cp\u003eGGGCGAAGCCGGGCATGAACAAGTGCA\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"116\"\u003e\n\u003cp\u003eHomo-TH\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"230\"\u003e\n\u003cp\u003eGCCCTACCAAGACCAGACGTA\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"247\"\u003e\n\u003cp\u003eCGTGAGGCATAGCTCCTGAG\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"116\"\u003e\n\u003cp\u003eHomo-FOXA2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"230\"\u003e\n\u003cp\u003eGGGAGCGGTGAAGATGGA\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"247\"\u003e\n\u003cp\u003eTCATGTTGCTCACGGAGGAGTA\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"116\"\u003e\n\u003cp\u003eHomo-PITX3\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"230\"\u003e\n\u003cp\u003eGTGCGGGTGTGGTTCAAGAA\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"247\"\u003e\n\u003cp\u003eAGCTGCCTTTGCATAGCTCG\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"116\"\u003e\n\u003cp\u003eHomo-HO-1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"230\"\u003e\n\u003cp\u003eAAGACTGCGTTCCTGCTCAAC\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"247\"\u003e\n\u003cp\u003eAAAGCCCTACAGCAACTGTCG\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"116\"\u003e\n\u003cp\u003eHomo-NQO1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"230\"\u003e\n\u003cp\u003eGAAGAGCACTGATCGTACTGGC\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"247\"\u003e\n\u003cp\u003eGGATACTGAAAGTTCGCAGGG\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"116\"\u003e\n\u003cp\u003eHomo-MRP2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"230\"\u003e\n\u003cp\u003eAGTGAATGACATCTTCACGTTTG\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"247\"\u003e\n\u003cp\u003eCTTGCAAAGGAGATCAGCAA\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"116\"\u003e\n\u003cp\u003eHomo-GPX2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"230\"\u003e\n\u003cp\u003eCTGGTGGTCCTTGGCTTC\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"247\"\u003e\n\u003cp\u003eTGTTCAGGATCTCCTCATTCTG\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"116\"\u003e\n\u003cp\u003eRat-GAPDH\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"230\"\u003e\n\u003cp\u003eCCTCGTCTCATAGACAAGAT\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"247\"\u003e\n\u003cp\u003eGGGTAGAGTCATACTGGAA\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"116\"\u003e\n\u003cp\u003eRat-HO-1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"230\"\u003e\n\u003cp\u003eTGCACATCCGTGCAGAGAAT\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"247\"\u003e\n\u003cp\u003eCTGGGTTCTGCTTGTTTCGC\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"116\"\u003e\n\u003cp\u003eRat-NQO1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"230\"\u003e\n\u003cp\u003eAGGATGGGAGGTACTCGAATC\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"247\"\u003e\n\u003cp\u003eTGCTAGAGATGACTCGGAAGG\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"116\"\u003e\n\u003cp\u003eRat-MRP2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"230\"\u003e\n\u003cp\u003eGCCCCTCAAGCACTCTGAC\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"247\"\u003e\n\u003cp\u003eGCTTTGTGTCCCAGATGGACT\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"116\"\u003e\n\u003cp\u003eRat-GPX2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"230\"\u003e\n\u003cp\u003eGAGCTGCAATGTCGCTTTCC\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"247\"\u003e\n\u003cp\u003eTGGGTAAGACTAAAGGTGGGC\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Parkinson's disease, oxidative stress, hiPSCs, DAn, Nrf2/ARE","lastPublishedDoi":"10.21203/rs.3.rs-179866/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-179866/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eBackground\u003c/p\u003e\u003cp\u003ePaBing-II Formula (PB-II) is a traditional Chinese medicine developed to treat Parkinson's disease (PD). However, due to the complexity of PB-II and the difficulty of culturing human dopaminergic neurons (DAn) \u003cem\u003ein vitro\u003c/em\u003e, the mechanism of PB-II to treat PD remains unclear. \u003c/p\u003e\u003cp\u003eMethods\u003c/p\u003e\u003cp\u003eWe established the human induced pluripotent stem cells (iPSCs) and derived DAn from hiPSCs to study the protective effects of PB-II on DAn after oxidative stress, which plays an important role in PD pathogenesis. \u003c/p\u003e\u003cp\u003eResults\u003c/p\u003e\u003cp\u003eWe found that serum derived from rats that had ingested PB-II significantly protect hiPSC-derived DAn from reactive oxygen species (ROS). In addition, PB-II dependent serum can activate nuclear erythroid-derived factor 2 (Nrf2) responses, which are required for the neutralization of ROS. In addition, PB-II can activate the Nrf2/ARE signal pathway of midbrain dopaminergic neurons of PD rats induced with 6-hydroxydopamine (6-OHDA) injury, rescue DAn cells, and improve the symptoms of PD rats. \u003c/p\u003e\u003cp\u003eConclusions\u003c/p\u003e\u003cp\u003ePB-II significantly protects the DA neurons from oxidative stress by activating the Nrf2 pathway.\u003c/p\u003e","manuscriptTitle":"Chinese Medicine PaBing-II Protects Human iPSC Derived Dopaminergic Neurons from Oxygen Stress","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2021-02-08 20:01:09","doi":"10.21203/rs.3.rs-179866/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"a9d92834-3420-496a-9149-6df887ffee17","owner":[],"postedDate":"February 8th, 2021","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":2285480,"name":"Translational Medicine"}],"tags":[],"updatedAt":"2021-02-08T20:01:11+00:00","versionOfRecord":[],"versionCreatedAt":"2021-02-08 20:01:09","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-179866","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-179866","identity":"rs-179866","version":["v1"]},"buildId":"cBFmMYwuxLRRLfASyISRj","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}